WorldWideScience

Sample records for ab binding alters

  1. Ab initio calculation of tight-binding parameters

    Energy Technology Data Exchange (ETDEWEB)

    McMahan, A.K.; Klepeis, J.E.

    1997-12-01

    We calculate ab initio values of tight-binding parameters for the f- electron metal Ce and various phases of Si, from local-density functional one-electron Hamiltonian and overlap matrix elements. Our approach allows us to unambiguously test the validity of the common minimal basis and two-center approximations as well as to determine the degree of transferability of both nonorthogonal and orthogonal hopping parameters in the cases considered.

  2. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with western corn rootworm midgut membrane binding sites.

    Directory of Open Access Journals (Sweden)

    Huarong Li

    Full Text Available BACKGROUND: Bacillus thuringiensis (Bt Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interactions are one line of evidence that Bt protein mechanisms of action differ and that the probability of receptor-mediated cross-resistance is low. METHODOLOGY/PRINCIPAL FINDINGS: Binding site interactions were investigated between Cry34Ab1/Cry35Ab1 and coleopteran active insecticidal proteins Cry3Aa, Cry6Aa, and Cry8Ba on western corn rootworm midgut brush border membrane vesicles (BBMV. Competitive binding of radio-labeled proteins to western corn rootworm BBMV was used as a measure of shared binding sites. Our work shows that (125I-Cry35Ab1 binds to rootworm BBMV, Cry34Ab1 enhances (125I-Cry35Ab1 specific binding, and that (125I-Cry35Ab1 with or without unlabeled Cry34Ab1 does not share binding sites with Cry3Aa, Cry6Aa, or Cry8Ba. Two primary lines of evidence presented here support the lack of shared binding sites between Cry34Ab1/Cry35Ab1 and the aforementioned proteins: 1 No competitive binding to rootworm BBMV was observed for competitor proteins when used in excess with (125I-Cry35Ab1 alone or combined with unlabeled Cry34Ab1, and 2 No competitive binding to rootworm BBMV was observed for unlabeled Cry34Ab1 and Cry35Ab1, or a combination of the two, when used in excess with (125I-Cry3Aa, or (125I-Cry8Ba. CONCLUSIONS/SIGNIFICANCE: Combining two or more insecticidal proteins active against the same target pest is one tactic to delay the onset of resistance to either protein. We conclude that Cry34Ab1/Cry35Ab1 are compatible with Cry3Aa, Cry6Aa, or Cry8Ba

  3. AB-Bind: Antibody binding mutational database for computational affinity predictions.

    Science.gov (United States)

    Sirin, Sarah; Apgar, James R; Bennett, Eric M; Keating, Amy E

    2016-02-01

    Antibodies (Abs) are a crucial component of the immune system and are often used as diagnostic and therapeutic agents. The need for high-affinity and high-specificity antibodies in research and medicine is driving the development of computational tools for accelerating antibody design and discovery. We report a diverse set of antibody binding data with accompanying structures that can be used to evaluate methods for modeling antibody interactions. Our Antibody-Bind (AB-Bind) database includes 1101 mutants with experimentally determined changes in binding free energies (ΔΔG) across 32 complexes. Using the AB-Bind data set, we evaluated the performance of protein scoring potentials in their ability to predict changes in binding free energies upon mutagenesis. Numerical correlations between computed and observed ΔΔG values were low (r = 0.16-0.45), but the potentials exhibited predictive power for classifying variants as improved vs weakened binders. Performance was evaluated using the area under the curve (AUC) for receiver operator characteristic (ROC) curves; the highest AUC values for 527 mutants with |ΔΔG| > 1.0 kcal/mol were 0.81, 0.87, and 0.88 using STATIUM, FoldX, and Discovery Studio scoring potentials, respectively. Some methods could also enrich for variants with improved binding affinity; FoldX and Discovery Studio were able to correctly rank 42% and 30%, respectively, of the 80 most improved binders (those with ΔΔG < -1.0 kcal/mol) in the top 5% of the database. This modest predictive performance has value but demonstrates the continuing need to develop and improve protein energy functions for affinity prediction. PMID:26473627

  4. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 Interactions with Western Corn Rootworm Midgut Membrane Binding Sites

    OpenAIRE

    Huarong Li; Monica Olson; Gaofeng Lin; Timothy Hey; Sek Yee Tan; Narva, Kenneth E.

    2013-01-01

    BACKGROUND: Bacillus thuringiensis (Bt) Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry) proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interact...

  5. Benchmarking ab initio binding energies of hydrogen-bonded molecular clusters based on FTIR spectroscopy

    DEFF Research Database (Denmark)

    Bork, Nicolai Christian; Du, Lin; Reiman, Heidi;

    2014-01-01

    Gibbs free binding energies in molecular complexes and clusters based on gas phase FTIR spectroscopy. The acetonitrile-HCl molecular complex is identified via its redshifted H-Cl stretching vibrational mode. We determine the Gibbs free binding energy, ΔG°295 K, to between 4.8 and 7.9 kJ mol(-1) and......Models of formation and growth of atmospheric aerosols are highly dependent on accurate cluster binding energies. These are most often calculated by ab initio electronic structure methods but remain associated with significant uncertainties. We present a computational benchmarking study of the...

  6. Binding of TNT to amplifying fluorescent polymers: an ab initio and molecular dynamics study.

    Science.gov (United States)

    Enlow, Mark A

    2012-03-01

    Molecular modeling techniques were employed to study the interaction of trinitrotoluene with an amplifying fluorescent polymer used in explosive sensor devices. The pentiptycene moiety present in these polymers appears to be the most energetically favorable binding site for trinitrotoluene. Surface features of the polymer suggest that the small cavity feature of the pentiptycene moiety may be more available for binding to analyte compounds due to steric crowding about the large cavity. Binding energies between model binding sites of the polymer and various analyte compounds were more rigorously estimated by semiempirical and ab initio techniques. Binding energies were found to be largest with trinitrotoluene and other nitroaromatic compounds. Electrostatic and π-stacking interactions between trinitrotoluene and the model host were investigated by studying a series of modified host compounds.

  7. Structural analysis of the DNA-binding domain of the Erwinia amylovora RcsB protein and its interaction with the RcsAB box.

    Science.gov (United States)

    Pristovsek, Primoz; Sengupta, Kaushik; Löhr, Frank; Schäfer, Birgit; von Trebra, Markus Wehland; Rüterjans, Heinz; Bernhard, Frank

    2003-05-16

    The transcriptional regulator RcsB interacts with other coactivators to control the expression of biosynthetic operons in enterobacteria. While in a heterodimer complex with the regulator RcsA the RcsAB box consensus is recognized, DNA binding sites for RcsB without RcsA have also been identified. The conformation of RcsB might therefore be modulated upon interaction with various coactivators, resulting in the recognition of different DNA targets. We report the solution structure of the C-terminal DNA-binding domain of the RcsB protein from Erwinia amylovora spanning amino acid residues 129-215 solved by heteronuclear magnetic resonance (NMR) spectroscopy. The C-terminal domain is composed of four alpha-helices where two central helices form a helix-turn-helix motif similar to the structures of the regulatory proteins GerE, NarL, and TraR. Amino acid residues involved in the RcsA independent DNA binding of RcsB were identified by titration studies with a RcsAB box consensus fragment. Data obtained from NMR spectroscopy together with surface plasmon resonance measurements demonstrate that the RcsAB box is specifically recognized by the RcsAB heterodimer as well as by RcsB alone. However, the binding constant of RcsB alone at target promoters from Escherichia coli, E. amylovora, and Pantoea stewartii was approximately 1 order of magnitude higher compared with that of the RcsAB heterodimer. We present evidence that the obvious role of RcsA is not to alter the DNA binding specificity of RcsB but to stabilize RcsB-DNA complexes. PMID:12740396

  8. Binding of human leukocytes to fibronectin is augmented by an anti-CD44 mAb (TL-1) and blocked by another anti-CD44 mAb (Hermes-3) but not by anti-VLA-4/VLA-5 mAbs.

    Science.gov (United States)

    Cao, L; Yoshino, T; Kawasaki, N; Yanai, H; Kawahara, K; Kondo, E; Omonishi, K; Takahashi, K; Akagi, T

    Fibronectin (FN) forms meshworks in extracellular spaces, and it plays an important role in cellular trafficking. Lymphoid cells are activated by binding to FN of the VLA-4 and VLA-5 receptors. CD44 also acts as a receptor of FN, but the mechanism and physiologic regulation of their binding are poorly understood. We have developed an anti-CD44 monoclonal antibody (mAb) (TL-1) in which lymphoid cells are activated and form homotypic cell aggregation. In this study, we found that the adhesion of CEM, HSB2, and LAD lymphoid cells to FN was augmented by TL-1 treatment and was apparently blocked by another anti-CD44 mAb (Hermes-3), but TL-1 Fab' fragments treatment did not induce FN-binding. A similar phenomenon is reported in the binding of the CD44 molecule to HA. This augmentation was not inhibited by the CS1 and RGD peptides of FN or by anti-VLA-4 and -VLA-5 mAbs; it was energy-dependent and associated with cytoplasmic actin filaments. Tl-1 treatment did not alter the cell surface expression of CD44 molecules. These findings above suggested that activated and/or altered cell surface distribution of CD44 molecules via a conformational change augmented the avidity of its binding to FN, which may be similar to lymphocyte-hyaluronate and lymphocyte-endothelial cell binding. As the Hermes-3 binding site is also involved in the interaction between lymphocytes and endothelial cells, activation of lymphocytes via CD44 molecules may facilitate the binding of lymphocytes to endothelial cells, extravasation, and migration to inflammatory sites rich in FN. PMID:9145328

  9. Characterization of DNA sequences that mediate nuclear protein binding to the regulatory region of the Pisum sativum (pea) chlorophyl a/b binding protein gene AB80: identification of a repeated heptamer motif.

    Science.gov (United States)

    Argüello, G; García-Hernández, E; Sánchez, M; Gariglio, P; Herrera-Estrella, L; Simpson, J

    1992-05-01

    Two protein factors binding to the regulatory region of the pea chlorophyl a/b binding protein gene AB80 have been identified. One of these factors is found only in green tissue but not in etiolated or root tissue. The second factor (denominated ABF-2) binds to a DNA sequence element that contains a direct heptamer repeat TCTCAAA. It was found that presence of both of the repeats is essential for binding. ABF-2 is present in both green and etiolated tissue and in roots and factors analogous to ABF-2 are present in several plant species. Computer analysis showed that the TCTCAAA motif is present in the regulatory region of several plant genes. PMID:1303797

  10. Binding site alteration is responsible for field-isolated resistance to Bacillus thuringiensis Cry2A insecticidal proteins in two Helicoverpa species.

    Directory of Open Access Journals (Sweden)

    Silvia Caccia

    Full Text Available BACKGROUND: Evolution of resistance by target pests is the main threat to the long-term efficacy of crops expressing Bacillus thuringiensis (Bt insecticidal proteins. Cry2 proteins play a pivotal role in current Bt spray formulations and transgenic crops and they complement Cry1A proteins because of their different mode of action. Their presence is critical in the control of those lepidopteran species, such as Helicoverpa spp., which are not highly susceptible to Cry1A proteins. In Australia, a transgenic variety of cotton expressing Cry1Ac and Cry2Ab (Bollgard II comprises at least 80% of the total cotton area. Prior to the widespread adoption of Bollgard II, the frequency of alleles conferring resistance to Cry2Ab in field populations of Helicoverpa armigera and Helicoverpa punctigera was significantly higher than anticipated. Colonies established from survivors of F(2 screens against Cry2Ab are highly resistant to this toxin, but susceptible to Cry1Ac. METHODOLOGY/PRINCIPAL FINDINGS: Bioassays performed with surface-treated artificial diet on neonates of H. armigera and H. punctigera showed that Cry2Ab resistant insects were cross-resistant to Cry2Ae while susceptible to Cry1Ab. Binding analyses with (125I-labeled Cry2Ab were performed with brush border membrane vesicles from midguts of Cry2Ab susceptible and resistant insects. The results of the binding analyses correlated with bioassay data and demonstrated that resistant insects exhibited greatly reduced binding of Cry2Ab toxin to midgut receptors, whereas no change in (125I-labeled-Cry1Ac binding was detected. As previously demonstrated for H. armigera, Cry2Ab binding sites in H. punctigera were shown to be shared by Cry2Ae, which explains why an alteration of the shared binding site would lead to cross-resistance between the two Cry2A toxins. CONCLUSION/SIGNIFICANCE: This is the first time that a mechanism of resistance to the Cry2 class of insecticidal proteins has been reported

  11. Electromechanical effects in carbon nanotubes: Ab initio and analytical tight-binding calculations

    Science.gov (United States)

    Verissimo-Alves, M.; Koiller, Belita; Chacham, H.; Capaz, R. B.

    2003-04-01

    We perform ab initio calculations of charged graphene and single-wall carbon nanotubes (CNTs). A wealth of electromechanical behaviors is obtained. (1) Both nanotubes and graphene expand upon electron injection. (2) Upon hole injection, metallic nanotubes and graphene display a nonmonotonic behavior. Upon increasing hole densities, the lattice constant initially contracts, reaches a minimum, and then starts to expand. The hole densities at minimum lattice constants are 0.3 |e|/atom for graphene and between 0.1 and 0.3|e|/atom for the metallic nanotubes studied. (3) Semiconducting CNT’s with small diameters (d≲20 Å) always expand upon hole injection. (4) Semiconducting CNT’s with large diameters (d≳20 Å) display a behavior intermediate between those of metallic and large-gap CNT’s. (5) The strain versus extra charge displays a linear plus power-law behavior, with characteristic exponents for graphene, metallic, and semiconducting CNT’s. All these features are physically understood within a simple tight-binding total-energy model.

  12. Altered binding of the Cry1Ac toxin to larval membranes but not to the toxin-binding protein in Plodia interpunctella selected for resistance to different Bacillus thuringiensis isolates.

    Science.gov (United States)

    Mohammed, S I; Johnson, D E; Aronson, A I

    1996-11-01

    Immunoblotting and cytochemical procedures were used to determine whether toxin binding was altered in strains of the Indianmeal moth, Plodia interpunctella, selected for resistance to various strains of Bacillus thuringiensis. Each of these B. thuringiensis subspecies produces a mixture of protoxins, primarily Cry1 types, and the greatest insect resistance is to the Cry1A protoxins. In several cases, however, there was also resistance to toxins not present in the B. thuringiensis strains used for selection. The Cry1Ab and Cry1Ac toxins bound equally well over a range of toxin concentrations and times of incubation to a single protein of ca. 80-kDa in immunoblots of larval membrane extracts from all of the colonies. This binding protein is essential for toxicity since a mutant Cry1Ac toxin known to be defective in binding and thus less toxic bound poorly to the 80-kDa protein. This binding protein differed in size from the major aminopeptidase N antigens implicated in toxin binding in other insects. Binding of fluorescently labeled Cry1Ac or Cry1Ab toxin to larval sections was found at the tips of the brush border membrane prepared from the susceptible but not from any of the resistant P. interpunctella. Accessibility of a major Cry1A-binding protein appears to be altered in resistant larvae and could account for their broad resistance to several B. thuringiensis toxins.

  13. Perspectives from ab-initio and tight-binding: Applications to transition metal compounds and superlattices

    Science.gov (United States)

    Venkataraman, Vijay Shankar

    The experimental and theoretical study of transition metal compounds have occupied condensed matter physicists for the best part of the last century. The rich variety of physical behaviour exhibited by these compounds owes its origin to the subtle balance of the energy scales at play for the d orbitals. In this thesis, we study three different systems comprised of transition metal atoms from the third, the fourth, and the fifth group of the periodic table using a combination of ab-initio density functional theory (DFT) computations and effective tight-binding models for the electronic properties. We first consider the electronic properties of artificially fabricated perovskite superlattices of the form [(SrIrO3)m / SrTiO3] with integer m denoting the number of layers of SrIrO3. After discussing the results of experiments undertaken by our collaborators, we present the results of our DFT calculations and build tight-binding models for the m = 1 and m = 2 superlattices. The active ingredient is found to be the 5d orbitals with significant spin-orbit coupling. We then study the energies of magnetic ground states within DFT and compare and contrast our results with those obtained for the bulk Ruddlesden-Popper iridates. Together with experimental measurements, our results suggest that these superlattices are an exciting venue to probe the magnetism and metal-insulator transitions that occur from the intricate balance of the spin-orbit coupling and electron interactions, as has been reported for their bulk counterparts. Next, we consider alpha-RuCl3, a honeycomb lattice compound. We first show using DFT calculations in conjunction with experiments performed by our collaborators, how spin-orbit coupling in the 4d orbitals of Ru is essential to understand the insulating state realized in this compound. Then, in the latter half of the chapter, we study the magnetic ground states of a two-dimensional analogue of alpha-RuCl3 in weak and strong-coupling regimes obtained from

  14. Shared midgut binding sites for Cry1A.105, Cry1Aa, Cry1Ab, Cry1Ac and Cry1Fa proteins from Bacillus thuringiensis in two important corn pests, Ostrinia nubilalis and Spodoptera frugiperda.

    Directory of Open Access Journals (Sweden)

    Carmen Sara Hernández-Rodríguez

    Full Text Available First generation of insect-protected transgenic corn (Bt-corn was based on the expression of Cry1Ab or Cry1Fa proteins. Currently, the trend is the combination of two or more genes expressing proteins that bind to different targets. In addition to broadening the spectrum of action, this strategy helps to delay the evolution of resistance in exposed insect populations. One of such examples is the combination of Cry1A.105 with Cry1Fa and Cry2Ab to control O. nubilalis and S. frugiperda. Cry1A.105 is a chimeric protein with domains I and II and the C-terminal half of the protein from Cry1Ac, and domain III almost identical to Cry1Fa. The aim of the present study was to determine whether the chimeric Cry1A.105 has shared binding sites either with Cry1A proteins, with Cry1Fa, or with both, in O. nubilalis and in S. frugiperda. Brush-border membrane vesicles (BBMV from last instar larval midguts were used in competition binding assays with (125I-labeled Cry1A.105, Cry1Ab, and Cry1Fa, and unlabeled Cry1A.105, Cry1Aa, Cry1Ab, Cry1Ac, Cry1Fa, Cry2Ab and Cry2Ae. The results showed that Cry1A.105, Cry1Ab, Cry1Ac and Cry1Fa competed with high affinity for the same binding sites in both insect species. However, Cry2Ab and Cry2Ae did not compete for the binding sites of Cry1 proteins. Therefore, according to our results, the development of cross-resistance among Cry1Ab/Ac, Cry1A.105, and Cry1Fa proteins is possible in these two insect species if the alteration of shared binding sites occurs. Conversely, cross-resistance between these proteins and Cry2A proteins is very unlikely in such case.

  15. Aluminum alters NMDA receptor 1A and 2A/B expression on neonatal hippocampal neurons in rats

    Directory of Open Access Journals (Sweden)

    Yuan Chia-Yi

    2011-11-01

    Full Text Available Abstract Background High aluminum (Al content in certain infant formula raises the concern of possible Al toxicity on brain development of neonates during their vulnerable period of growing. Results of in vivo study showed that Al content of brain tissues reached to 74 μM when oral intake up to 1110 μM, 10 times of that in the hi-Al infant formula. Methods Utilizing a cultured neuron cells in vitro model, we have assessed Al influence on neuronal specific gene expression alteration by immunoblot and immunohistochemistry and neural proliferation rate changes by MTT assay. Results Microscopic images showed that the neurite outgrowth of hippocampal neurons increased along with the Al dosages (37, 74 μM Al (AlCl3. MTT results also indicated that Al increased neural cell viability. On the other hand, the immunocytochemistry staining suggested that the protein expressions of NMDAR 1A and NMDAR 2A/B decreased with the Al dosages (p Conclusion Treated hippocampal neurons with 37 and 74 μM of Al for 14 days increased neural cell viability, but hampered NMDAR 1A and NMDAR 2A/B expressions. It was suggested that Al exposure might alter the development of hippocampal neurons in neonatal rats.

  16. Electronic transport properties of fullerene functionalized carbon nanotubes: Ab initio and tight-binding calculations

    DEFF Research Database (Denmark)

    Fürst, Joachim Alexander; Hashemi, J.; Markussen, Troels;

    2009-01-01

    Fullerene functionalized carbon nanotubes-NanoBuds-form a novel class of hybrid carbon materials, which possesses many advantageous properties as compared to the pristine components. Here, we report a theoretical study of the electronic transport properties of these compounds. We use both ab init...

  17. Surface-induced alteration of adsorbate electronic structure and intramolecular vibrational coupling: The vibrational spectrum of 2-propoxide on Mo(110) as determined by [ital ab] [ital initio] calculations and experiments

    Energy Technology Data Exchange (ETDEWEB)

    Uvdal, P. (MAX-Chemistry, Department of Chemistry, Box 124, Lund University, S-22100 Lund (Sweden)); MacKerell, A.D. Jr. (Department of Pharmaceutical Sciences, School of Pharmacy, University of Maryland at Baltimore, Baltimore, Maryland 21201 (United States)); Wiegand, B.C.; Friend, C.M. (Department of Chemistry, Harvard University, Cambridge, Massachusetts 02138 (United States))

    1995-03-15

    Interactions with the molybdenum surface have a strong influence on the vibrational spectrum of 2-propoxide on Mo(110). Using [ital ab] [ital initio] electronic-structure calculations the vibrational spectrum of the adsorbed 2-propoxide is determined. All major effects, experimentally observed by electron-energy-loss spectroscopy, are well reproduced by the calculation. Kinematic effects do not explain the observed changes. Calculations indicate that the changes in vibrational spectra are due to alterations of the intramolecular potential function and charge redistribution upon binding to the Mo.

  18. AB202. Altered micro RNA expression in patients with non-obstructive azoospermia

    OpenAIRE

    Zhang, Xiansheng; Liang, Chaozhao

    2014-01-01

    Background MicroRNAs (miRNAs), a class of small non-coding RNA molecules, are indicated to play essential roles in spermatogenesis. However, little is known about the expression patterns or function of miRNAs in human testes involved in infertility. Methods In this study, the miRNA expression profiles of testes of patients with non-obstructive azoospermia (NOA) and normal controls were performed by using microarray technologies. Results Altered microRNA expression in NOA patients was found, w...

  19. Geometry, Energy, and Some Electronic Properties of Carbon Polyprismanes: Ab Initio and Tight-Binding Study

    OpenAIRE

    Konstantin P. Katin; Shostachenko, Stanislav A.; Avkhadieva, Alina I.; Mikhail M. Maslov

    2015-01-01

    We report geometry, energy, and some electronic properties of [n,4]- and [n,5]prismanes (polyprismanes): a special type of carbon nanotubes constructed from dehydrogenated cycloalkane C4- and C5-rings, respectively. Binding energies, interatomic bonds, and the energy gaps between the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) have been calculated using density functional approach and nonorthogonal tight-binding model for the systems up to thir...

  20. Loss of liver FA binding protein significantly alters hepatocyte plasma membrane microdomains[S

    OpenAIRE

    McIntosh, Avery L.; Atshaves, Barbara P.; Storey, Stephen M.; Landrock, Kerstin K.; Landrock, Danilo; Martin, Gregory G.; Kier, Ann B.; Schroeder, Friedhelm

    2012-01-01

    Although lipid-rich microdomains of hepatocyte plasma membranes serve as the major scaffolding regions for cholesterol transport proteins important in cholesterol disposition, little is known regarding intracellular factors regulating cholesterol distribution therein. On the basis of its ability to bind cholesterol and alter hepatic cholesterol accumulation, the cytosolic liver type FA binding protein (L-FABP) was hypothesized to be a candidate protein regulating these microdomains. Compared ...

  1. Limitations of Ab Initio Predictions of Peptide Binding to MHC Class II Molecules

    DEFF Research Database (Denmark)

    Zhang, Hao; Lund, Ole; Nielsen, Morten;

    2010-01-01

    Successful predictions of peptide MHC binding typically require a large set of binding data for the specific MHC molecule that is examined. Structure based prediction methods promise to circumvent this requirement by evaluating the physical contacts a peptide can make with an MHC molecule based...... on the highly conserved 3D structure of peptide:MHC complexes. While several such methods have been described before, most are not publicly available and have not been independently tested for their performance. We here implemented and evaluated three prediction methods for MHC class II molecules: statistical...... methods prediction performance showed that these are significantly better than random, but still substantially lower than the best performing sequence based class II prediction methods available. While the approaches presented here were developed independently, we have chosen to present our results...

  2. Altered SPECT (123)I-iomazenil Binding in the Cingulate Cortex of Children with Anorexia Nervosa.

    Science.gov (United States)

    Nagamitsu, Shinichiro; Sakurai, Rieko; Matsuoka, Michiko; Chiba, Hiromi; Ozono, Shuichi; Tanigawa, Hitoshi; Yamashita, Yushiro; Kaida, Hayato; Ishibashi, Masatoshi; Kakuma, Tatsuki; Croarkin, Paul E; Matsuishi, Toyojiro

    2016-01-01

    Several lines of evidence suggest that anxiety plays a key role in the development and maintenance of anorexia nervosa (AN) in children. The purpose of this study was to examine cortical GABA(A)-benzodiazepine receptor binding before and after treatment in children beginning intensive AN treatment. Brain single-photon emission computed tomography (SPECT) measurements using (123)I-iomazenil, which binds to GABA(A)-benzodiazepine receptors, was performed in 26 participants with AN who were enrolled in a multimodal treatment program. Sixteen of the 26 participants underwent a repeat SPECT scan immediately before discharge at conclusion of the intensive treatment program. Eating behavior and mood disturbances were assessed using Eating Attitudes Test with 26 items (EAT-26) and the short form of the Profile of Mood States (POMS). Clinical outcome scores were evaluated after a 1-year period. We examined association between relative iomazenil-binding activity in cortical regions of interest and psychometric profiles and determined which psychometric profiles show interaction effects with brain regions. Further, we determined if binding activity could predict clinical outcome and treatment changes. Higher EAT-26 scores were significantly associated with lower iomazenil-binding activity in the anterior and posterior cingulate cortex. Higher POMS subscale scores were significantly associated with lower iomazenil-binding activity in the left frontal, parietal cortex, and posterior cingulate cortex (PCC). "Depression-Dejection" and "Confusion" POMS subscale scores, and total POMS score showed interaction effects with brain regions in iomazenil-binding activity. Decreased binding in the anterior cingulate cortex and left parietal cortex was associated with poor clinical outcomes. Relative binding increases throughout the PCC and occipital gyrus were observed after weight gain in children with AN. These findings suggest that cortical GABAergic receptor binding is altered in

  3. Altered SPECT 123I iomazenil Binding in the Cingulate Cortex of Children with Anorexia Nervosa

    Directory of Open Access Journals (Sweden)

    Shinichiro eNagamitsu

    2016-02-01

    Full Text Available Several lines of evidence suggest that anxiety plays a key role in the development and maintenance of anorexia nervosa (AN in children. The purpose of this study was to examine cortical GABA(A-benzodiazepine receptor binding before and after treatment in children beginning intensive AN treatment. Brain single photon emission computed tomography (SPECT measurements using 123I iomazenil, which binds to GABA(A-benzodiazepine receptors, was performed in 26 participants with AN who were enrolled in a multimodal treatment program. Sixteen of the 26 participants underwent a repeat SPECT scan immediately before discharge at conclusion of the intensive treatment program. Eating behavior and mood disturbances were assessed using Eating Attitudes Test with 26 items (EAT-26 and the short form of the Profile of Mood States (POMS. Clinical outcome scores were evaluated after a 1-year period. We examined association between relative iomazenil binding activity in cortical regions of interest (ROIs and psychometric profiles, and determined which psychometric profiles show interaction effects with brain regions. Further, we determined if binding activity could predict clinical outcome and treatment changes. Higher EAT-26 scores were significantly associated with lower iomazenil binding activity in the anterior posterior cingulate cortex (ACC. Higher POMS subscale scores were significantly associated with lower iomazenil binding activity in the left frontal, parietal cortex, and posterior cingulate cortex (PCC. Depression-Dejection, and Confusion POMS subscale scores, and total POMS score, showed interaction effects with brain regions in iomazenil binding activity. Decreased binding in the ACC and left parietal cortex was associated with poor clinical outcomes. Relative binding increases throughout the PCC and occipital gyrus were observed after weight gain in children with AN. These findings suggest that cortical GABAergic receptor binding is altered in children

  4. STN1 OB Fold Mutation Alters DNA Binding and Affects Selective Aspects of CST Function

    Science.gov (United States)

    Bhattacharjee, Anukana; Stewart, Jason; Chaiken, Mary; Price, Carolyn M.

    2016-01-01

    Mammalian CST (CTC1-STN1-TEN1) participates in multiple aspects of telomere replication and genome-wide recovery from replication stress. CST resembles Replication Protein A (RPA) in that it binds ssDNA and STN1 and TEN1 are structurally similar to RPA2 and RPA3. Conservation between CTC1 and RPA1 is less apparent. Currently the mechanism underlying CST action is largely unknown. Here we address CST mechanism by using a DNA-binding mutant, (STN1 OB-fold mutant, STN1-OBM) to examine the relationship between DNA binding and CST function. In vivo, STN1-OBM affects resolution of endogenous replication stress and telomere duplex replication but telomeric C-strand fill-in and new origin firing after exogenous replication stress are unaffected. These selective effects indicate mechanistic differences in CST action during resolution of different replication problems. In vitro binding studies show that STN1 directly engages both short and long ssDNA oligonucleotides, however STN1-OBM preferentially destabilizes binding to short substrates. The finding that STN1-OBM affects binding to only certain substrates starts to explain the in vivo separation of function observed in STN1-OBM expressing cells. CST is expected to engage DNA substrates of varied length and structure as it acts to resolve different replication problems. Since STN1-OBM will alter CST binding to only some of these substrates, the mutant should affect resolution of only a subset of replication problems, as was observed in the STN1-OBM cells. The in vitro studies also provide insight into CST binding mechanism. Like RPA, CST likely contacts DNA via multiple OB folds. However, the importance of STN1 for binding short substrates indicates differences in the architecture of CST and RPA DNA-protein complexes. Based on our results, we propose a dynamic DNA binding model that provides a general mechanism for CST action at diverse forms of replication stress. PMID:27690379

  5. Altered SPECT 123I-iomazenil Binding in the Cingulate Cortex of Children with Anorexia Nervosa

    Science.gov (United States)

    Nagamitsu, Shinichiro; Sakurai, Rieko; Matsuoka, Michiko; Chiba, Hiromi; Ozono, Shuichi; Tanigawa, Hitoshi; Yamashita, Yushiro; Kaida, Hayato; Ishibashi, Masatoshi; Kakuma, Tatsuki; Croarkin, Paul E.; Matsuishi, Toyojiro

    2016-01-01

    Several lines of evidence suggest that anxiety plays a key role in the development and maintenance of anorexia nervosa (AN) in children. The purpose of this study was to examine cortical GABA(A)-benzodiazepine receptor binding before and after treatment in children beginning intensive AN treatment. Brain single-photon emission computed tomography (SPECT) measurements using 123I-iomazenil, which binds to GABA(A)-benzodiazepine receptors, was performed in 26 participants with AN who were enrolled in a multimodal treatment program. Sixteen of the 26 participants underwent a repeat SPECT scan immediately before discharge at conclusion of the intensive treatment program. Eating behavior and mood disturbances were assessed using Eating Attitudes Test with 26 items (EAT-26) and the short form of the Profile of Mood States (POMS). Clinical outcome scores were evaluated after a 1-year period. We examined association between relative iomazenil-binding activity in cortical regions of interest and psychometric profiles and determined which psychometric profiles show interaction effects with brain regions. Further, we determined if binding activity could predict clinical outcome and treatment changes. Higher EAT-26 scores were significantly associated with lower iomazenil-binding activity in the anterior and posterior cingulate cortex. Higher POMS subscale scores were significantly associated with lower iomazenil-binding activity in the left frontal, parietal cortex, and posterior cingulate cortex (PCC). “Depression–Dejection” and “Confusion” POMS subscale scores, and total POMS score showed interaction effects with brain regions in iomazenil-binding activity. Decreased binding in the anterior cingulate cortex and left parietal cortex was associated with poor clinical outcomes. Relative binding increases throughout the PCC and occipital gyrus were observed after weight gain in children with AN. These findings suggest that cortical GABAergic receptor binding is altered

  6. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    International Nuclear Information System (INIS)

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo (125I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of control cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease

  7. Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)*

    OpenAIRE

    Unciuleac, Mihaela-Carmen; Shuman, Stewart

    2010-01-01

    Mycobacterial AdnAB is a heterodimeric DNA helicase-nuclease and 3′ to 5′ DNA translocase implicated in the repair of double strand breaks (DSBs). The AdnA and AdnB subunits are each composed of an N-terminal motor domain and a C-terminal nuclease domain. Inclusion of mycobacterial single strand DNA-binding protein (SSB) in reactions containing linear plasmid dsDNA allowed us to study the AdnAB helicase under conditions in which the unwound single strands are coated by SSB and thereby prevent...

  8. The constant region affects antigen binding of antibodies to DNA by altering secondary structure.

    Science.gov (United States)

    Xia, Yumin; Janda, Alena; Eryilmaz, Ertan; Casadevall, Arturo; Putterman, Chaim

    2013-11-01

    We previously demonstrated an important role of the constant region in the pathogenicity of anti-DNA antibodies. To determine the mechanisms by which the constant region affects autoantibody binding, a panel of isotype-switch variants (IgG1, IgG2a, IgG2b) was generated from the murine PL9-11 IgG3 autoantibody. The affinity of the PL9-11 antibody panel for histone was measured by surface plasmon resonance (SPR). Tryptophan fluorescence was used to determine wavelength shifts of the antibody panel upon binding to DNA and histone. Finally, circular dichroism spectroscopy was used to measure changes in secondary structure. SPR analysis revealed significant differences in histone binding affinity between members of the PL9-11 panel. The wavelength shifts of tryptophan fluorescence emission were found to be dependent on the antibody isotype, while circular dichroism analysis determined that changes in antibody secondary structure content differed between isotypes upon antigen binding. Thus, the antigen binding affinity is dependent on the particular constant region expressed. Moreover, the effects of antibody binding to antigen were also constant region dependent. Alteration of secondary structures influenced by constant regions may explain differences in fine specificity of anti-DNA antibodies between antibodies with similar variable regions, as well as cross-reactivity of anti-DNA antibodies with non-DNA antigens.

  9. Effect of impurity doping on tunneling conductance in AB-stacked bi-layer graphene: A tight-binding study

    Science.gov (United States)

    Rout, G. C.; Sahu, Sivabrata; Panda, S. K.

    2016-04-01

    We report here a microscopic tight-binding model calculation for AB-stacked bilayer graphene in presence of biasing potential between the two layers and the impurity effects to study the evolution of the total density of states with special emphasis on opening of band gap near Dirac point. We have calculated the electron Green's functions for both the A and B sub-lattices by Zubarev technique. The imaginary part of the Green's function gives the partial and total density of states of electrons. The density of states are computed numerically for 1000 × 1000 grid points of the electron momentum. The evolution of the opening of band gap near van-Hove singularities as well as near Dirac point is investigated by varying the different interlayer hoppings and the biasing potentials. The inter layer hopping splits the density of states at van-Hove singularities and produces a V-shaped gap near Dirac point. Further the biasing potential introduces a U shaped gap near Dirac point with a density minimum at the applied potential(i.e. at V/2).

  10. The sclerostin-neutralizing antibody AbD09097 recognizes an epitope adjacent to sclerostin's binding site for the Wnt co-receptor LRP6.

    Science.gov (United States)

    Boschert, V; Frisch, C; Back, J W; van Pee, K; Weidauer, S E; Muth, E-M; Schmieder, P; Beerbaum, M; Knappik, A; Timmerman, P; Mueller, T D

    2016-08-01

    The glycoprotein sclerostin has been identified as a negative regulator of bone growth. It exerts its function by interacting with the Wnt co-receptor LRP5/6, blocks the binding of Wnt factors and thereby inhibits Wnt signalling. Neutralizing anti-sclerostin antibodies are able to restore Wnt activity and enhance bone growth thereby presenting a new osteoanabolic therapy approach for diseases such as osteoporosis. We have generated various Fab antibodies against human and murine sclerostin using a phage display set-up. Biochemical analyses have identified one Fab developed against murine sclerostin, AbD09097 that efficiently neutralizes sclerostin's Wnt inhibitory activity. In vitro interaction analysis using sclerostin variants revealed that this neutralizing Fab binds to sclerostin's flexible second loop, which has been shown to harbour the LRP5/6 binding motif. Affinity maturation was then applied to AbD09097, providing a set of improved neutralizing Fab antibodies which particularly bind human sclerostin with enhanced affinity. Determining the crystal structure of AbD09097 provides first insights into how this antibody might recognize and neutralize sclerostin. Together with the structure-function relationship derived from affinity maturation these new data will foster the rational design of new and highly efficient anti-sclerostin antibodies for the therapy of bone loss diseases such as osteoporosis. PMID:27558933

  11. Alteration of methotrexate binding to human serum albumin induced by oxidative stress. Spectroscopic comparative study

    Science.gov (United States)

    Maciążek-Jurczyk, M.; Sułkowska, A.; Równicka-Zubik, J.

    2016-01-01

    Changes of oxidative modified albumin conformation by comparison of non-modified (HSA) and modified (oHSA) human serum albumin absorption spectra, Red Edge Excitation Shift (REES) effect and fluorescence synchronous spectra were investigated. Studies of absorption spectra indicated that changes in the value of absorbance associated with spectral changes in the region from 200 to 250 nm involve structural alterations related to variations in peptide backbone conformation. Analysis of the REES effect allowed for the observation of changes caused by oxidation in the region of the hydrophobic pocket containing the tryptophanyl residue. Synchronous fluorescence spectroscopy confirmed changes of the position of the tryptophanyl and tyrosil residues fluorescent band. Effect of oxidative stress on binding of methotrexate (MTX) was investigated by spectrofluorescence, UV-VIS and 1HNMR spectroscopy. MTX caused the fluorescence quenching of non-modified (HSA) and modified (oHSA) human serum albumin molecule. The values of binding constants, Hill's coefficients and a number of binding sites in the protein molecule in the high affinity binding site were calculated for the binary MTX-HSA and MTX-oHSA systems. For these systems, qualitative analysis in the low affinity binding sites was performed with the use of the 1HNMR technique.

  12. Antibody Binding Alters the Characteristics and Contents of Extracellular Vesicles Released by Histoplasma capsulatum.

    Science.gov (United States)

    Matos Baltazar, Ludmila; Nakayasu, Ernesto S; Sobreira, Tiago J P; Choi, Hyungwon; Casadevall, Arturo; Nimrichter, Leonardo; Nosanchuk, Joshua D

    2016-01-01

    Histoplasma capsulatum produces extracellular vesicles containing virulence-associated molecules capable of modulating host machinery, benefiting the pathogen. Treatment of H. capsulatum cells with monoclonal antibodies (MAbs) can change the outcome of infection in mice. We evaluated the sizes, enzymatic contents, and proteomic profiles of the vesicles released by fungal cells treated with either protective MAb 6B7 (IgG1) or nonprotective MAb 7B6 (IgG2b), both of which bind H. capsulatum heat shock protein 60 (Hsp60). Our results showed that treatment with either MAb was associated with changes in size and vesicle loading. MAb treatments reduced vesicle phosphatase and catalase activities compared to those of vesicles from untreated controls. We identified 1,125 proteins in vesicles, and 250 of these manifested differences in abundance relative to that of proteins in vesicles isolated from yeast cells exposed to Hsp60-binding MAbs, indicating that surface binding of fungal cells by MAbs modified protein loading in the vesicles. The abundance of upregulated proteins in vesicles upon MAb 7B6 treatment was 44.8% of the protein quantities in vesicles from fungal cells treated with MAb 6B7. Analysis of orthologous proteins previously identified in vesicles from other fungi showed that different ascomycete fungi have similar proteins in their extracellular milieu, many of which are associated with virulence. Our results demonstrate that antibody binding can modulate fungal cell responses, resulting in differential loading of vesicles, which could alter fungal cell susceptibility to host defenses. This finding provides additional evidence that antibody binding modulates microbial physiology and suggests a new function for specific immunoglobulins through alterations of fungal secretion. IMPORTANCE Diverse fungal species release extracellular vesicles, indicating that this is a common pathway for the delivery of molecules to the extracellular space. However, there has

  13. Human Herpesvirus-6A/B Binds to Spermatozoa Acrosome and Is the Most Prevalent Herpesvirus in Semen from Sperm Donors

    DEFF Research Database (Denmark)

    Kaspersen, Maja Døvling; Larsen, Peter; Kofod-Olsen, Emil;

    2012-01-01

    2.7%; HHV-6A/B in 13.5%; HHV-7 in 4.2%, whereas none of the samples had detectable VZV or HHV-8. Subsequently, we examined longitudinally data on ejaculates from 11 herpesvirus-positive donors. Serial analyses revealed that a donor who tested positive for herpesvirus at one time point did not...... necessarily remain positive over time. For the most frequently found herpesvirus, HHV-6A/B, we examined its association with sperm. For HHV-6A/B PCR-positive semen samples, HHV-6A/B could be detected on the sperm by flow cytometry. Conversely, PCR-negative semen samples were negative by flow cytometry. HHV-6B...... was shown to associate with sperm within minutes in a concentration dependent manner. Confocal microscopy demonstrated that HHV-6B associated with the sperm head, but only to sperm with an intact acrosome. Taken together, our data suggest that HHV-6A/B could be transported to the uterus via binding to...

  14. Deficiency of the miR-29a/b-1 cluster leads to ataxic features and cerebellar alterations in mice

    DEFF Research Database (Denmark)

    Papadopoulou, Aikaterini S; Serneels, Lutgarde; Achsel, Tilmann;

    2015-01-01

    miR-29 is expressed strongly in the brain and alterations in expression have been linked to several neurological disorders. To further explore the function of this miRNA in the brain, we generated miR-29a/b-1 knockout animals. Knockout mice develop a progressive disorder characterized by locomotor...... impairment and ataxia. The different members of the miR-29 family are strongly expressed in neurons of the olfactory bulb, the hippocampus and in the Purkinje cells of the cerebellum. Morphological analysis showed that Purkinje cells are smaller and display less dendritic arborisation compared...... to their wildtype littermates. In addition, a decreased number of parallel fibers form synapses on the Purkinje cells. We identified several mRNAs significantly up-regulated in the absence of the miR-29a/b-1 cluster. At the protein level, however, the voltage-gated potassium channel Kcnc3 (Kv3.3) was significantly...

  15. Altered Specificity of DNA-Binding Proteins with Transition Metal Dimerization Domains

    Science.gov (United States)

    Cuenoud, Bernard; Schepartz, Alanna

    1993-01-01

    The bZIP motif is characterized by a leucine zipper domain that mediates dimerization and a basic domain that contacts DNA. A series of transition metal dimerization domains were used to alter systematically the relative orientation of basic domain peptides. Both the affinity and the specificity of the peptide-DNA interaction depend on domain orientation. These results indicate that the precise configuration linking the domains is important; dimerization is not always sufficient for DNA binding. This approach to studying the effect of orientation on protein function complements mutagenesis and could be used in many systems.

  16. Disease-associated mutation in SRSF2 misregulates splicing by altering RNA-binding affinities.

    Science.gov (United States)

    Zhang, Jian; Lieu, Yen K; Ali, Abdullah M; Penson, Alex; Reggio, Kathryn S; Rabadan, Raul; Raza, Azra; Mukherjee, Siddhartha; Manley, James L

    2015-08-25

    Serine/arginine-rich splicing factor 2 (SRSF2) is an RNA-binding protein that plays important roles in splicing of mRNA precursors. SRSF2 mutations are frequently found in patients with myelodysplastic syndromes and certain leukemias, but how these mutations affect SRSF2 function has only begun to be examined. We used clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein-9 nuclease to introduce the P95H mutation to SRSF2 in K562 leukemia cells, generating an isogenic model so that splicing alterations can be attributed solely to mutant SRSF2. We found that SRSF2 (P95H) misregulates 548 splicing events (RNA gel shift assays showed that a mutant SRSF2 derivative bound more tightly than its wild-type counterpart to RNA sites containing UCCAG but bound less tightly to UGGAG sites. Thus in most cases the pattern of exon inclusion or exclusion correlated with stronger or weaker RNA binding, respectively. We further show that the P95H mutation does not affect other functions of SRSF2, i.e., protein-protein interactions with key splicing factors. Our results thus demonstrate that the P95H mutation positively or negatively alters the binding affinity of SRSF2 for cognate RNA sites in target transcripts, leading to misregulation of exon inclusion. Our findings shed light on the mechanism of the disease-associated SRSF2 mutation in splicing regulation and also reveal a group of misspliced mRNA isoforms for potential therapeutic targeting.

  17. Cocaine treatment alters oxytocin receptor binding but not mRNA production in postpartum rat dams☆

    Science.gov (United States)

    Jarrett, T.M.; McMurray, M.S.; Walker, C.H.; Johns, J.M.

    2011-01-01

    Gestational cocaine treatment in rat dams results in decreased oxytocin (OT) levels, up-regulated oxytocin receptor (OTR) binding density and decreased receptor affinity in the whole amygdala, all concomitant with a significant increase in maternal aggression on postpartum day six. Rat dams with no gestational drug treatment that received an infusion of an OT antagonist directly into the central nucleus of the amygdala (CeA) exhibited similarly high levels of maternal aggression towards intruders. Additionally, studies indicate that decreased OT release from the hypothalamic division of the paraventricular nucleus (PVN) is coincident with heightened maternal aggression in rats. Thus, it appears that cocaine-induced alterations in OT system dynamics (levels, receptors, production, and/or release) may mediate heightened maternal aggression following cocaine treatment, but the exact mechanisms through which cocaine impacts the OT system have not yet been determined. Based on previous studies, we hypothesized that two likely mechanisms of cocaine’s action would be, increased OTR binding specifically in the CeA, and decreased OT mRNA production in the PVN. Autoradiography and in situ hybridization assays were performed on targeted nuclei in brain regions of rat dams on postpartum day six, following gestational treatment twice daily with cocaine (15 mg/kg) or normal saline (1 ml/kg). We now report cocaine-induced reductions in OTR binding density in the ventromedial hypothalamus (VMH) and bed nucleus of the stria terminalis (BNST), but not the CeA. There was no significant change in OT mRNA production in the PVN following cocaine treatment. PMID:16677710

  18. Assessment of altered binding specificity of bacteriophage for ciprofloxacin-induced antibiotic-resistant Salmonella Typhimurium.

    Science.gov (United States)

    Kim, Jeongjin; Jo, Ara; Ding, Tian; Lee, Hyeon-Yong; Ahn, Juhee

    2016-08-01

    This study describes a new effort toward understanding the interaction mechanisms between antibiotic-resistant Salmonella Typhimurium and phages. The antibiotic susceptibility, β-lactamase activity, bacterial motility, gene expression, and lytic activity were evaluated in ciprofloxacin-induced antibiotic-sensitive Salmonella Typhimurium (ASST(CIP)) and ciprofloxacin-induced antibiotic-resistant S. Typhimurium (ARST(CIP)), which were compared to the wild-type strains (ASST(WT) and ARST(WT)). The MIC values of ampicillin, norfloxacin, chloramphenicol, and tetracycline were significantly increased to > 512, 16, 16, and 256 μg/ml, respectively, in the ARST(CIP). The lowest and highest extracellular lactamase activities were observed in ASST(WT) (6.85 μmol/min/ml) and ARST(CIP) (48.83 μmol/min/ml), respectively. The acrA, lpfE, and hilA genes were significantly upregulated by more than tenfold in both ASST(CIP) and ARST(CIP). The induction of multiple antibiotic resistance resulted from the increased efflux pump activity (AcrAB-TolC). The highest phage adsorption rates were more than 95 % for ASST(WT), ASST(CIP), and ARST(WT), while the lowest adsorption rate was 52 % for ARST(CIP) at 15 min of infection. The least lytic activity of phage was 20 % against the ARST(CIP), followed by ASST(CIP) (30 %). The adsorption rate of phage against ARST(CIP) was 52 % at 15 min of infection, which resulted in the decrease in lytic activity (12 %). Understanding the interaction of phage and bacteria is essential for the practical application of phage to control and detect antibiotic-resistant bacteria. The results provide useful information for understanding the binding specificity of phages for multiple antibiotic-resistant pathogens. PMID:27000396

  19. Comparative study of tight-binding and ab initio electronic structure calculations focused on magnetic anisotropy in ordered CoPt alloy

    Science.gov (United States)

    Zemen, J.; Mašek, J.; Kučera, J.; Mol, J. A.; Motloch, P.; Jungwirth, T.

    2014-04-01

    An empirical multiorbital (spd) tight binding (TB) model including magnetism and spin-orbit coupling is applied to calculations of magnetic anisotropy energy (MAE) in CoPt L10 structure. A realistic Slater-Koster parametrisation for single-element transition metals is adapted for the ordered binary alloy. Spin magnetic moment and density of states are calculated using a full-potential linearised augmented plane-wave (LAPW) ab initio method and our TB code with different variants of the interatomic parameters. Detailed mutual comparison of this data allows for determination of a subset of the compound TB parameters tuning of which improves the agreement of the TB and LAPW results. MAE calculated as a function of band filling using the refined parameters is in broad agreement with ab initio data for all valence states and in quantitative agreement with ab initio and experimental data for the natural band filling. Our work provides a practical basis for further studies of relativistic magnetotransport anisotropies by means of local Green's function formalism which is directly compatible with our TB approach.

  20. Loop replacements with gut-binding peptides in Cry1Ab domain II enhanced toxicity against the brown planthopper, Nilaparvata lugens (Stål)

    Science.gov (United States)

    Shao, Ensi; Lin, Li; Chen, Chen; Chen, Hanze; Zhuang, Haohan; Wu, Songqing; Sha, Li; Guan, Xiong; Huang, Zhipeng

    2016-01-01

    Bacillus thuringiensis (Bt) Cry toxins have been used widely in pest managements. However, Cry toxins are not effective against sap-sucking insects (Hemiptera), which limits the application of Bt for pest management. In order to extend the insecticidal spectrum of Bt toxins to the rice brown planthopper (BPH), Nilaparvata lugens, we modified Cry1Ab putative receptor binding domains with selected BPH gut-binding peptides (GBPs). Three surface exposed loops in the domain II of Cry1Ab were replaced with two GBPs (P2S and P1Z) respectively. Bioassay results showed that toxicity of modified toxin L2-P2S increased significantly (~9 folds) against BPH nymphs. In addition, damage of midgut cells was observed from the nymphs fed with L2-P2S. Our results indicate that modifying Cry toxins based on the toxin-gut interactions can broaden the insecticidal spectrum of Bt toxin. This method provides another approach for the development of transgenic crops with novel insecticidal activity against hemipteran insects and insect populations resistant to current Bt transgenic crops. PMID:26830331

  1. Loop replacements with gut-binding peptides in Cry1Ab domain II enhanced toxicity against the brown planthopper, Nilaparvata lugens (Stål).

    Science.gov (United States)

    Shao, Ensi; Lin, Li; Chen, Chen; Chen, Hanze; Zhuang, Haohan; Wu, Songqing; Sha, Li; Guan, Xiong; Huang, Zhipeng

    2016-01-01

    Bacillus thuringiensis (Bt) Cry toxins have been used widely in pest managements. However, Cry toxins are not effective against sap-sucking insects (Hemiptera), which limits the application of Bt for pest management. In order to extend the insecticidal spectrum of Bt toxins to the rice brown planthopper (BPH), Nilaparvata lugens, we modified Cry1Ab putative receptor binding domains with selected BPH gut-binding peptides (GBPs). Three surface exposed loops in the domain II of Cry1Ab were replaced with two GBPs (P2S and P1Z) respectively. Bioassay results showed that toxicity of modified toxin L2-P2S increased significantly (~9 folds) against BPH nymphs. In addition, damage of midgut cells was observed from the nymphs fed with L2-P2S. Our results indicate that modifying Cry toxins based on the toxin-gut interactions can broaden the insecticidal spectrum of Bt toxin. This method provides another approach for the development of transgenic crops with novel insecticidal activity against hemipteran insects and insect populations resistant to current Bt transgenic crops. PMID:26830331

  2. Comparative study of tight-binding and ab initio electronic structure calculations focused on magnetic anisotropy in ordered CoPt alloy

    Energy Technology Data Exchange (ETDEWEB)

    Zemen, J., E-mail: zemen@fzu.cz [School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom); Institute of Physics ASCR, v. v. i., Cukrovarnická 10, 162 00 Praha 6 (Czech Republic); Mašek, J. [Institute of Physics ASCR, v. v. i., Na Slovance 2, 182 21 Praha 8 (Czech Republic); Kučera, J. [Institute of Physics ASCR, v. v. i., Cukrovarnická 10, 162 00 Praha 6 (Czech Republic); Mol, J.A. [Kavli Institute of Nanoscience, Delft University of Technology, Lorentzweg 1, 2628 CJ Delft (Netherlands); Institute of Physics ASCR, v. v. i., Cukrovarnická 10, 162 00 Praha 6 (Czech Republic); Motloch, P. [Institute of Physics ASCR, v. v. i., Cukrovarnická 10, 162 00 Praha 6 (Czech Republic); Jungwirth, T. [Institute of Physics ASCR, v. v. i., Cukrovarnická 10, 162 00 Praha 6 (Czech Republic); School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom)

    2014-04-01

    An empirical multiorbital (spd) tight binding (TB) model including magnetism and spin–orbit coupling is applied to calculations of magnetic anisotropy energy (MAE) in CoPt L1{sub 0} structure. A realistic Slater–Koster parametrisation for single-element transition metals is adapted for the ordered binary alloy. Spin magnetic moment and density of states are calculated using a full-potential linearised augmented plane-wave (LAPW) ab initio method and our TB code with different variants of the interatomic parameters. Detailed mutual comparison of this data allows for determination of a subset of the compound TB parameters tuning of which improves the agreement of the TB and LAPW results. MAE calculated as a function of band filling using the refined parameters is in broad agreement with ab initio data for all valence states and in quantitative agreement with ab initio and experimental data for the natural band filling. Our work provides a practical basis for further studies of relativistic magnetotransport anisotropies by means of local Green's function formalism which is directly compatible with our TB approach. - Highlights: • Calculations of electronic structure properties of bulk ordered CoPt alloy using tight-binding (TB) and density functional theory (DFT) approach. • Refinement of existing single-element TB parameters for a binary alloy based on a comparison of band structure and spin magnetic moment per atom to DFT results. • Quantitative agreement of magnetic anisotropy energy (MAE) obtained by TB and DFT on a range of band fillings. • Successful description of ground state spin–orbit coupling phenomena using an extended TB model suitable for subsequent magnetotransport simulations.

  3. Directed evolution of estrogen receptor proteins with altered ligand-binding specificities.

    Science.gov (United States)

    Islam, Kazi Mohammed Didarul; Dilcher, Meik; Thurow, Corinna; Vock, Carsten; Krimmelbein, Ilga Kristine; Tietze, Lutz Friedjan; Gonzalez, Victor; Zhao, Huimin; Gatz, Christiane

    2009-01-01

    Transcriptional activators that respond to ligands with no cellular targets are powerful tools that can confer regulated expression of a transgene in almost all biological systems. In this study, we altered the ligand-binding specificity of the human estrogen receptor alpha (hER alpha) so that it would recognize a non-steroidal synthetic compound with structural similarities to the phytoestrogen resveratrol. For this purpose, we performed iterative rounds of site-specific saturation mutagenesis of a fixed set of ligand-contacting residues and subsequent random mutagenesis of the entire ligand-binding domain. Selection of the receptor mutants and quantification of the interaction were carried out by exploiting a yeast two-hybrid system that reports the ligand-dependent interaction between hER alpha and steroid receptor coactivator-1 (SRC-1). The screen was performed with a synthetic ligand (CV3320) that promoted growth of the reporter yeast strain to half maximal levels at a concentration of 3.7 microM. The optimized receptor mutant (L384F/L387M/Y537S) showed a 67-fold increased activity to the synthetic ligand CV3320 (half maximal yeast growth at 0.055 microM) and a 10-fold decreased activity to 17beta-estradiol (E2; half maximal yeast growth at 4 nM). The novel receptor-ligand pair partially fulfills the requirements for a specific 'gene switch' as it responds to concentrations of the synthetic ligand which do not activate the wildtype receptor. Due to its residual responsiveness to E2 at concentrations (4 nM) that might occur in vivo, further improvements have to be performed to render the system applicable in organisms with endogenous E2 synthesis.

  4. Expression of potato RNA-binding proteins StUBA2a/b and StUBA2c induces hypersensitive-like cell death and early leaf senescence in Arabidopsis.

    Science.gov (United States)

    Na, Jong-Kuk; Kim, Jae-Kwang; Kim, Dool-Yi; Assmann, Sarah M

    2015-07-01

    The Arabidopsis thaliana genome encodes three RNA-binding proteins (RBPs), UBP1-associated protein 2a (UBA2a), UBA2b, and UBA2c, that contain two RNA-recognition motif (RRM) domains. They play important roles in wounding response and leaf senescence, and are homologs of Vicia faba abscisic-acid-activated protein kinase-interacting protein 1 (VfAKIP1). The potato (Solanum tuberosum) genome encodes at least seven AKIP1-like RBPs. Here, two potato RBPs have been characterized, StUBA2a/b and StUBA2c, that are homologous to VfAKIP1 and Arabidopsis UBA2s. Transient expression of StUBA2s induced a hypersensitive-like cell death phenotype in tobacco leaves, and an RRM-domain deletion assay of StUBA2s revealed that the first RRM domain is crucial for the phenotype. Unlike overexpression of Arabidopsis UBA2s, constitutive expression of StUBA2a/b in Arabidopsis did not cause growth arrest and lethality at the young seedling stage, but induced early leaf senescence. This phenotype was associated with increased expression of defence- and senescence-associated genes, including pathogen-related genes (PR) and a senescence-associated gene (SAG13), and it was aggravated upon flowering and ultimately resulted in a shortened life cycle. Leaf senescence of StUBA2a/b Arabidopsis plants was enhanced under darkness and was accompanied by H2O2 accumulation and altered expression of autophagy-associated genes, which likely cause cellular damage and are proximate causes of the early leaf senescence. Expression of salicylic acid signalling and biosynthetic genes was also upregulated in StUBA2a/b plants. Consistent with the localization of UBA2s-GFPs and VfAKIP1-GFP, soluble-modified GFP-StUBA2s localized in the nucleus within nuclear speckles. StUBA2s potentially can be considered for transgenic approaches to induce potato shoot senescence, which is desirable at harvest. PMID:25944928

  5. Genomic analysis of hepatic Farnesoid X Receptor (FXR) binding sites reveals altered binding in obesity and direct gene repression by FXR

    OpenAIRE

    Lee, Jiyoung; Seok, Sun Mi; Yu, Pengfei; Kim, Kyungsu; Smith, Zachary; Rivas-Astroza, Marcelo; Zhong, Sheng; Kemper, Jongsook Kim

    2012-01-01

    The nuclear bile acid receptor, Farnesoid X Receptor (FXR), is an important transcriptional regulator of liver metabolism. Despite recent advances in understanding its functions, how FXR regulates genomic targets and whether the transcriptional regulation by FXR is altered in obesity remain largely unknown. Here, we analyzed hepatic genome-wide binding sites of FXR in normal and dietary obese mice by chromatin immunoprecipitation-sequencing (ChIP-seq) analysis. A total of 15,263 and 5,272 FXR...

  6. Formation and properties of astrophysical carbonaceous dust. I: ab-initio calculations of the configuration and binding energies of small carbon clusters

    CERN Document Server

    Mauney, Christopher; Lazzati, Davide

    2014-01-01

    The binding energies of n < 100 carbon clusters are calculated using the ab-initio density functional theory code Quantum Espresso. Carbon cluster geometries are determined using several levels of classical techniques and further refined using density functional theory. The resulting energies are used to compute the work of cluster formation and the nucleation rate in a saturated, hydrogen-poor carbon gas. Compared to classical calculations that adopt the capillary approximation, we find that nucleation of carbon clusters is enhanced at low temperatures and depressed at high temperatures. This difference is ascribed to the different behavior of the critical cluster size. We find that the critical cluster size is at n = 27 or n = 8 for a broad range of temperatures and saturations, instead of being a smooth function of such parameters. The results of our calculations can be used to follow carbonaceous cluster/grain formation, stability, and growth in hydrogen poor environments, such as the inner layers of c...

  7. Alterations in penicillin binding protein gene of Streptococcus pneumoniae and their correlation with susceptibility patterns.

    Science.gov (United States)

    Ohsaki, Yoshinobu; Tachibana, Mineji; Nakanishi, Kyoko; Nakao, Shoko; Saito, Kumiko; Toyoshima, Eri; Sato, Maki; Takahashi, Toru; Osanai, Shinobu; Itoh, Yoshihisa; Kikuchi, Kenjiro

    2003-08-01

    Penicillin binding protein (pbp) gene alterations of 328 clinical isolates of Streptococcus pneumoniae were examined for a correlation with their antibiotic-resistance. The frequency of penicillin G (PEN-G) resistance was determined to clarify susceptibility to several antibiotics, namely PEN-G, ampicillin, sulbactam/ampicillin, cefozopram, panipenem (PAPM), clarithromycin (CLR), azithromycin (AZM) and levofloxacin (LVX). Oligonucleotide primers for three pbp genes (pbp1a, pbp2x and pbp2b) were used to detect mutations in pbp. Of the strains, 25.9% were classified as Pen-Gs, 68.0% as Pen-Gir and 6.1% as Pen-Gr. The polymerase chain reaction product for wild-type pbp1a was found in 185 isolates, that for wild-type pbp2x was found in 66 isolates and that for wild-type pbp2b was found in 213 isolates. None of these three genes was detectable in 100 isolates while all of them were detected in 64 isolates (1aw/2xw/2bw). Of those 64 isolates with 1aw/2xw/2bw, the minimum inhibitory concentration (MIC) of PEN-G was or =4.0 mg/l included one Pen-Gs and two Pen-Gir isolates. The MICs of CLR correlated significantly with those of AZM. The MIC of CLR was > or =1 mg/l for 216 isolates, and the MIC of AZM was > or =1 mg/l for 244 of them. These data suggested that PAPM may be effective against S. pneumoniae infection, although acquisition of resistance should be considered. LVX also seemed to be effective against S. pneumoniae.

  8. Mapping of the C3b-binding site of CR1 and construction of a (CR1)2-F(ab')2 chimeric complement inhibitor.

    Science.gov (United States)

    Kalli, K R; Hsu, P H; Bartow, T J; Ahearn, J M; Matsumoto, A K; Klickstein, L B; Fearon, D T

    1991-12-01

    CR1/CR2 chimeric receptors in which various short consensus repeats (SCRs) of CR1 were attached to CR2 were transiently expressed on COS cells, and assessed for the binding of polymerized C3b (pC3b) and anti-CR2 by immunofluorescence. Of COS cells expressing chimeras containing SCR 1-4, 1-3, 2-4, 1-2, and 2-3 of the long homologous repeats (LHRs) -B or -C, 96%, 66%, 23%, 0%, and 0%, respectively, bound pC3b. K562 cells were stably transfected with wild-type CR1, deletion mutants of CR1, and the CR1/CR2 chimeras, respectively, and assayed for binding of 125I-pC3b. The dissociation constants (Kd) for pC3b of wild-type CR1 and the LHR-BD and -CD constructs were in the range of 1.0-2.7 nM, and of the CR1/CR2 chimeras containing SCRs 1-4, 1-3, and 2-4 of LHR-B or -C were 1.8-2.4, 6-9, and 22-36 nM, respectively. The factor I-cofactor function of the CR1/CR2 chimeras paralleled the C3b-binding function of the constructs. A CR1/immunoglobulin (Ig) chimeric protein was prepared by fusing SCRs 1-4 of LHR-B to the heavy chains of a murine F(ab')2 anti-nitrophenacetyl (NP) monoclonal antibody. The (CR1)2-F(ab')2 chimera, which retained its specificity for NP, was as effective as soluble, full-length CR1 in binding pC3b, serving as a cofactor for factor I-mediated cleavage of C3b, and inhibiting activation of the alternative pathway, indicating that the bivalent expression of these SCRs reconstitutes the alternative pathway inhibitory function of CR1. The feasibility of creating CR1/Ig chimeras makes possible a new strategy of targeting complement inhibition by the use of Ig fusion partners having particular antigenic specificities. PMID:1836011

  9. Mapping of the C3b-binding site of CR1 and construction of a (CR1)2-F(ab')2 chimeric complement inhibitor.

    Science.gov (United States)

    Kalli, K R; Hsu, P H; Bartow, T J; Ahearn, J M; Matsumoto, A K; Klickstein, L B; Fearon, D T

    1991-12-01

    CR1/CR2 chimeric receptors in which various short consensus repeats (SCRs) of CR1 were attached to CR2 were transiently expressed on COS cells, and assessed for the binding of polymerized C3b (pC3b) and anti-CR2 by immunofluorescence. Of COS cells expressing chimeras containing SCR 1-4, 1-3, 2-4, 1-2, and 2-3 of the long homologous repeats (LHRs) -B or -C, 96%, 66%, 23%, 0%, and 0%, respectively, bound pC3b. K562 cells were stably transfected with wild-type CR1, deletion mutants of CR1, and the CR1/CR2 chimeras, respectively, and assayed for binding of 125I-pC3b. The dissociation constants (Kd) for pC3b of wild-type CR1 and the LHR-BD and -CD constructs were in the range of 1.0-2.7 nM, and of the CR1/CR2 chimeras containing SCRs 1-4, 1-3, and 2-4 of LHR-B or -C were 1.8-2.4, 6-9, and 22-36 nM, respectively. The factor I-cofactor function of the CR1/CR2 chimeras paralleled the C3b-binding function of the constructs. A CR1/immunoglobulin (Ig) chimeric protein was prepared by fusing SCRs 1-4 of LHR-B to the heavy chains of a murine F(ab')2 anti-nitrophenacetyl (NP) monoclonal antibody. The (CR1)2-F(ab')2 chimera, which retained its specificity for NP, was as effective as soluble, full-length CR1 in binding pC3b, serving as a cofactor for factor I-mediated cleavage of C3b, and inhibiting activation of the alternative pathway, indicating that the bivalent expression of these SCRs reconstitutes the alternative pathway inhibitory function of CR1. The feasibility of creating CR1/Ig chimeras makes possible a new strategy of targeting complement inhibition by the use of Ig fusion partners having particular antigenic specificities.

  10. Partial genetic deletion of neuregulin 1 and adolescent stress interact to alter NMDA receptor binding in the medial prefrontal cortex

    Directory of Open Access Journals (Sweden)

    Tariq Waseem Chohan

    2014-09-01

    Full Text Available Schizophrenia is thought to arise due to a complex interaction between genetic and environmental factors during early neurodevelopment. We have recently shown that partial genetic deletion of the schizophrenia susceptibility gene neuregulin 1 (Nrg1 and adolescent stress interact to disturb sensorimotor gating, neuroendocrine activity and dendritic morphology in mice. Both stress and Nrg1 may have converging effects upon N-methyl-D-aspartate receptors (NMDARs which are implicated in the pathogenesis of schizophrenia, sensorimotor gating and dendritic spine plasticity. Using an identical repeated restraint stress paradigm to our previous study, here we determined NMDAR binding across various brain regions in adolescent Nrg1 heterozygous (HET and wild-type (WT mice using [3H] MK-801 autoradiography. Repeated restraint stress increased NMDAR binding in the ventral part of the lateral septum (LSV and the dentate gyrus (DG of the hippocampus irrespective of genotype. Partial genetic deletion of Nrg1 interacted with adolescent stress to promote an altered pattern of NMDAR binding in the infralimbic (IL subregion of the medial prefrontal cortex. In the IL, whilst stress tended to increase NMDAR binding in WT mice, it decreased binding in Nrg1 HET mice. However in the DG, stress selectively increased the expression of NMDAR binding in Nrg1 HET mice but not WT mice. These results demonstrate a Nrg1-stress interaction during adolescence on NMDAR binding in the medial prefrontal cortex.

  11. Ginkgo biloba extract alters the binding of the sodium [123I] iodide (Na123I) on blood constituents

    International Nuclear Information System (INIS)

    We evaluated the in vitro effect of an aqueous extract of Ginkgo biloba (EGb) on the distribution in blood cells (BC) and plasma (P) and on the binding of Na123I to the blood constituents using precipitation with trichloroacetic acid. The radioactivity percentages insoluble (SF) and insoluble fraction (IF) of blood constituents were determined. The EGb interfered (p123I in the P (from 69.64 to 86.13) and BC (from 30.36 to 13.87) and altered the fixation of the Na123I in IF-P and in IF-BC. - Highlights: ► Interaction between the Ginkgo biloba and blood constituents radiolabeled. ► Modification of the binding of sodium iodide (Na123I) to the blood constituents. ► This alteration should have influence in a diagnosis of nuclear medicine.

  12. Probing the structure and function of the estrogen receptor ligand binding domain by analysis of mutants with altered transactivation characteristics.

    OpenAIRE

    Eng, F C; Lee, H.S.; Ferrara, J; Willson, T M; White, J H

    1997-01-01

    We have developed a genetic screen for the yeast Saccharomyces cerevisiae to isolate estrogen receptor (ER) mutants with altered transactivation characteristics. Use of a "reverse" ER, in which the mutagenized ligand binding domain was placed at the N terminus of the receptor, eliminated the isolation of truncated constitutively active mutants. A library was screened with a low-affinity estrogen, 2-methoxyestrone (2ME), at concentrations 50-fold lower than those required for activation of the...

  13. Binding of the Galanthus nivalis agglutinin to thymocytes reveals alterations in surface glycosylation during T-cell development.

    Science.gov (United States)

    Sinkora, J; Kolínská, J; Reháková, Z; Cerný, J; Doubravská, L

    2002-02-01

    Surface binding of the Galanthus nivalis agglutinin (GNA) to thymocyte subsets has been studied in pigs and rodents by multicolour flow cytometry. In all the species examined, analogous staining profiles have been recorded. Counter-staining with anti-CD3epsilon, anti-CD4 and anti-CD8 monoclonal antibodies (MoAb) revealed that a significant increase of the GNA targets on the cell surface occurred during early thymocyte differentiation and reached its maximum at the level of the CD3loCD4+CD8+ small cortical thymocyte. This was followed by a decrease in the GNA binding capacity upon terminal maturation to the single positive thymocytes. PAGE analysis has revealed a dominant GNA-binding glycoprotein (molar mass approx. 90 kDa) present on thymocyte plasma membranes and absent on the surface of splenic lymphocytes, although both the whole cell lysates from both organs contained GNA ligands of the same size. Our findings are in agreement with previous data showing that immature thymocytes differ from their mature counterparts and peripheral T lymphocytes in the surface glycosylation pattern, and support the hypothesis that lectin-glycoprotein interaction plays a significant role in the cell-to-cell crosstalk in the thymic cortex.

  14. Alteration in IGF-I binding in the cerebral cortex and cerebellum of neonatal rats during protein-calorie malnutrition.

    Science.gov (United States)

    Maheshwari, H G; Mermelstein, S; vonSchlegell, A S; Shambaugh, G E

    1997-03-01

    Neonatal brain development in the rat is adversely affected by malnutrition. Alterations in tissue binding of IGF-I in the malnourished brain were tested in rat pups from mothers who were fed a 20% protein diet (C) or a 4% protein diet (M) starting from day 21 of gestation and continued throughout suckling. IGF-I binding in both cortex and cerebellum decreased progressively in C and M groups from day 6 to day 13. At day 9, 11, and 13, the binding was significantly greater (p < 0.02) in M compared to C groups. To investigate whether these changes might be related to the alteration in receptor activity, membranes were incubated with 125I-IGF in the presence of excess insulin with or without unlabeled IGF-I. In the absence of insulin, specific IGF-I binding in the M group was increased by 41.8 +/- 13.8% (mean +/- SEM p < 0.05) relative to C group. Insulin produced a consistent but incomplete inhibition of binding in both C and M, of 75% and 67% respectively. In addition, the specific IGF-I binding in the presence of insulin was increased in M group by 70.2 +/- 9.4% relative to C, p < 0.05. To characterize the nature of this binding, cerebral cortical membranes, from both groups, incubated with 125I-IGF-I were cross-linked, and electrophoresed on 6% and 10% SDS-PAGE gels under reducing conditions. Autoradiography of the 6% gel showed two specific bands at 115 kD and 240 kD, consistent with monomeric and dimeric forms of the IGF-I receptor, which were inhibited by excess insulin. In contrast, a 10% gel showed an additional band at 35 kD (IGF-binding protein) that was not inhibited by insulin. In both gels, membrane preparations from the M group showed a heightened intensity of the bands relative to C. The increase in binding protein relative to the receptor suggests a disequilibrium that may limit the availability of exogenous IGF-I to the tissues.

  15. Ca2+ binding sites in calmodulin and troponin C alter interhelical angle movements.

    Science.gov (United States)

    Goto, Kunihiko; Toyama, Akira; Takeuchi, Hideo; Takayama, Kazuyoshi; Saito, Tsutomu; Iwamoto, Masatoshi; Yeh, Jay Z; Narahashi, Toshio

    2004-03-12

    Molecular dynamics analyses were performed to examine conformational changes in the C-domain of calmodulin and the N-domain of troponin C induced by binding of Ca(2+) ions. Analyses of conformational changes in calmodulin and troponin C indicated that the shortening of the distance between Ca(2+) ions and Ca(2+) binding sites of helices caused widening of the distance between Ca(2+) binding sites of helices on opposite sides, while the hydrophobic side chains in the center of helices hardly moved due to their steric hindrance. This conformational change acts as the clothespin mechanism. PMID:15013750

  16. Conformational alterations in the CD4 binding cavity of HIV-1 gp120 influencing gp120-CD4 interactions and fusogenicity of HIV-1 envelopes derived from brain and other tissues

    Directory of Open Access Journals (Sweden)

    Ramsland Paul A

    2011-06-01

    Full Text Available Abstract Background CD4-binding site (CD4bs alterations in gp120 contribute to HIV-1 envelope (Env mediated fusogenicity and the ability of gp120 to utilize low levels of cell-surface CD4. In a recent study, we constructed three-dimensional models of gp120 to illustrate CD4bs conformations associated with enhanced fusogenicity and enhanced CD4-usage of a modestly-sized panel of blood-derived HIV-1 Envs (n = 16. These conformations were characterized by a wider aperture of the CD4bs cavity, as constrained by the inner-most atoms at the gp120 V1V2 stem and the V5 loop. Here, we sought to provide further validation of the utility of these models for understanding mechanisms that influence Env function, by characterizing the structure-function relationships of a larger panel of Envs derived from brain and other tissues (n = 81. Findings Three-dimensional models of gp120 were generated by our recently validated homology modelling protocol. Analysis of predicted CD4bs structures showed correlations between the aperture width of the CD4bs cavity and ability of the Envs to mediate cell-cell fusion, scavenge low-levels of cell-surface CD4, bind directly to soluble CD4, and bind to the Env mAb IgG1b12 whose epitope overlaps the gp120 CD4bs. These structural alterations in the CD4bs cavity were associated with repositioning of the V5 loop. Conclusions Using a large, independent panel of Envs, we can confirm the utility of three-dimensional gp120 structural models for illustrating CD4bs alterations that can affect Env function. Furthermore, we now provide new evidence that these CD4bs alterations augment the ability of gp120 to interact with CD4 by increasing the exposure of the CD4bs.

  17. Synthesis of nisin AB dicarba analogs using ring-closing metathesis: influence of sp(3) versus sp(2) hybridization of the α-carbon atom of residues dehydrobutyrine-2 and dehydroalanine-5 on the lipid II binding affinity.

    Science.gov (United States)

    Slootweg, Jack C; van Herwerden, Eric F; van Doremalen, Mark F M; Breukink, Eefjan; Liskamp, Rob M J; Rijkers, Dirk T S

    2015-06-01

    Herein the synthesis of two nisin AB dicarba analogs is described, focusing on amino acid modifications at positions 2 and 5. The nisin mimics were synthesized by a combination of solid phase synthesis of the linear peptides, followed by macrocyclization via ring-closing metathesis and fragment assembly by means of solution phase chemistry. The two N-terminal nisin AB-fragment mimics contain either the native dehydrobutyrine (Dhb)/dehydroalanine (Dha) amino acid residues or alanine at position 2 and 5, respectively. The native dehydrobutyrine at position 2 and dehydroalanine at position 5 were introduced as their precursors, namely threonine and serine, respectively, and subsequent dehydration was carried out by EDCI/CuCl as the condensing agent. Both AB-fragment mimics were analyzed in a lipid II binding assay and it was found that the Ala2/Ala5 AB-mimic (2) showed a reduced activity, while the Dhb2/Dha5 AB-mimic (3) was as active as the native AB-fragment (1).

  18. Prediction and experimental characterization of nsSNPs altering human PDZ-binding motifs.

    Directory of Open Access Journals (Sweden)

    David Gfeller

    Full Text Available Single nucleotide polymorphisms (SNPs are a major contributor to genetic and phenotypic variation within populations. Non-synonymous SNPs (nsSNPs modify the sequence of proteins and can affect their folding or binding properties. Experimental analysis of all nsSNPs is currently unfeasible and therefore computational predictions of the molecular effect of nsSNPs are helpful to guide experimental investigations. While some nsSNPs can be accurately characterized, for instance if they fall into strongly conserved or well annotated regions, the molecular consequences of many others are more challenging to predict. In particular, nsSNPs affecting less structured, and often less conserved regions, are difficult to characterize. Binding sites that mediate protein-protein or other protein interactions are an important class of functional sites on proteins and can be used to help interpret nsSNPs. Binding sites targeted by the PDZ modular peptide recognition domain have recently been characterized. Here we use this data to show that it is possible to computationally identify nsSNPs in PDZ binding motifs that modify or prevent binding to the proteins containing the motifs. We confirm these predictions by experimentally validating a selected subset with ELISA. Our work also highlights the importance of better characterizing linear motifs in proteins as many of these can be affected by genetic variations.

  19. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    DEFF Research Database (Denmark)

    Douthwaite, S; Aagaard, C

    1993-01-01

    that are induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still......The antibiotic erythromycin inhibits protein synthesis by binding to the 50 S ribosomal subunit, where the drug interacts with the unpaired bases 2058A and 2059A in the peptidyl transferase loop of 23 S rRNA. We used a chemical modification approach to analyse conformational changes...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  20. Heat-induced alterations in cashew allergen solubility and IgE binding

    Science.gov (United States)

    Cashew nuts are included in a group of 8 foods that commonly cause food allergies. IgE binding to allergens within the nuts can cause allergic reactions that can be severe. Foods containing cashew nuts must be labeled to prevent accidental exposure to people who suffer from allergy to cashew nuts....

  1. Binding among Select Episodic Elements Is Altered via Active Short-Term Retrieval

    Science.gov (United States)

    Bridge, Donna J.; Voss, Joel L.

    2015-01-01

    Of the many elements that comprise an episode, are any disproportionately bound to the others? We tested whether active short-term retrieval selectively increases binding. Individual objects from multiobject displays were retrieved after brief delays. Memory was later tested for the other objects. Cueing with actively retrieved objects facilitated…

  2. Cyanobacteria contain a structural homologue of the Hfq protein with altered RNA-binding properties

    DEFF Research Database (Denmark)

    Bøggild, Andreas; Overgaard, Martin; Valentin-Hansen, Poul;

    2009-01-01

    proteins from the cyanobacteria Synechocystis sp. PCC 6803 and Anabaena PCC 7120 at 1.3 and 2.3 A resolution, respectively, and show that they retain the classic Sm fold despite low sequence conservation. In addition, the intersubunit contacts and RNA-binding site are divergent, and we show biochemically...

  3. Cyanobacteria contain a structural homologue of the Hfq protein with altered RNA binding properties

    DEFF Research Database (Denmark)

    Bøggild, Andreas; Overgaard, Martin; Valentin-Hansen, Poul;

    2009-01-01

    proteins from the cyanobacteria Synechocystis sp. PCC 6803 and Anabaena PCC 7120 at 1.3 and 2.3 A resolution, respectively, and show that they retain the classic Sm fold despite low sequence conservation. In addition, the intersubunit contacts and RNA-binding site are divergent, and we show biochemically...

  4. IgG subclass and heavy chain domains contribute to binding and protection by mAbs to the poly γ-D-glutamic acid capsular antigen of Bacillus anthracis.

    Directory of Open Access Journals (Sweden)

    Maria Hovenden

    Full Text Available Bacterial capsules are common targets for antibody-mediated immunity. The capsule of Bacillus anthracis is unusual among capsules because it is composed of a polymer of poly-γ-d-glutamic acid (γdPGA. We previously generated murine IgG3 monoclonal antibodies (mAbs to γdPGA that were protective in a murine model of pulmonary anthrax. IgG3 antibodies are characteristic of the murine response to polysaccharide antigens. The goal of the present study was to produce subclass switch variants of the γdPGA mAbs (IgG3 → IgG1 → IgG2b → IgG2a and assess the contribution of subclass to antibody affinity and protection. Subclass switch antibodies had identical variable regions but differed in their heavy chains. The results showed that a switch from the protective IgG3 to IgG1, IgG2b or IgG2a was accompanied by i a loss of protective activity ii a change in mAb binding to the capsular matrix, and iii a loss of affinity. These results identify a role for the heavy chain constant region in mAb binding. Hybrid mAbs were constructed in which the CH1, CH2 or CH3 heavy chain constant domains from a non-protective, low binding IgG2b mAb were swapped into the protective IgG3 mAb. The IgG3 mAb that contained the CH1 domain from IgG2b showed no loss of affinity or protection. In contrast, swapping the CH2 or CH3 domains from IgG2b into IgG3 produced a reduction in affinity and a loss of protection. These studies identify a role for the constant region of IgG heavy chains in affinity and protection against an encapsulated bacterial pathogen.

  5. Binding of a neutralizing antibody to dengue virus alters the arrangement of surface glycoproteins

    Energy Technology Data Exchange (ETDEWEB)

    Lok, Shee-Mei; Kostyuchenko, Victor; Nybakken, Grant E.; Holdaway, Heather A.; Battisti, Anthony J.; Sukupolvi-Petty, Soila; Sedlak, Dagmar; Fremont, Daved H.; Chipman, Paul R.; Roehrig, John T.; Diamond, Michael S.; Kuhn, Richard J.; Rossmann, Michael G. (Purdue); (WU-MED); (CDC)

    2008-04-02

    The monoclonal antibody 1A1D-2 has been shown to strongly neutralize dengue virus serotypes 1, 2 and 3, primarily by inhibiting attachment to host cells. A crystal structure of its antigen binding fragment (Fab) complexed with domain III of the viral envelope glycoprotein, E, showed that the epitope would be partially occluded in the known structure of the mature dengue virus. Nevertheless, antibody could bind to the virus at 37 degrees C, suggesting that the virus is in dynamic motion making hidden epitopes briefly available. A cryo-electron microscope image reconstruction of the virus:Fab complex showed large changes in the organization of the E protein that exposed the epitopes on two of the three E molecules in each of the 60 icosahedral asymmetric units of the virus. The changes in the structure of the viral surface are presumably responsible for inhibiting attachment to cells.

  6. Burn injury reveals altered phenotype in mannan-binding lectin-deficient mice

    DEFF Research Database (Denmark)

    Møller-Kristensen, Mette; Hamblin, MR; Thiel, Steffen;

    2007-01-01

    Burn injury destroys skin, the second largest innate immune organ in the body, and triggers chaotic immune and inflammatory responses. The pattern recognition molecule, mannan-binding lectin (MBL), plays an important role in the first-line host defense against infectious agents. MBL initiates...... the lectin complement pathway and acts as an opsonin. Recent studies suggest that MBL also modulates inflammatory responses. We report that local responses after burn in MBL null mice differ from those found in wild-type (WT) mice in the following important biological markers: spontaneous eschar separation......, thinned epidermis and dermis, upregulation of soluble factors including cytokines, chemokines, cell adhesion molecules, a growth factor-binding protein, and matrix metalloproteinases. Mice lacking C1q, C4, or C3 did not show the lack of eschar separation seen in MBL null-burn phenotype. These findings...

  7. Chicken avidin-related proteins show altered biotin-binding and physico-chemical properties as compared with avidin.

    Science.gov (United States)

    Laitinen, Olli H; Hytönen, Vesa P; Ahlroth, Mervi K; Pentikäinen, Olli T; Gallagher, Ciara; Nordlund, Henri R; Ovod, Vladimir; Marttila, Ari T; Porkka, Eevaleena; Heino, Sanna; Johnson, Mark S; Airenne, Kari J; Kulomaa, Markku S

    2002-01-01

    Chicken avidin and bacterial streptavidin are proteins familiar from their use in various (strept)avidin-biotin technological applications. Avidin binds the vitamin biotin with the highest affinity known for non-covalent interactions found in nature. The gene encoding avidin (AVD) has homologues in chicken, named avidin-related genes (AVRs). In the present study we used the AVR genes to produce recombinant AVR proteins (AVRs 1, 2, 3, 4/5, 6 and 7) in insect cell cultures and characterized their biotin-binding affinity and biochemical properties. Amino acid sequence analysis and molecular modelling were also used to predict and explain the properties of the AVRs. We found that the AVR proteins are very similar to avidin, both structurally and functionally. Despite the numerous amino acid substitutions in the subunit interface regions, the AVRs form extremely stable tetramers similar to those of avidin. Differences were found in some physico-chemical properties of the AVRs as compared with avidin, including lowered pI, increased glycosylation and, most notably, reversible biotin binding for two AVRs (AVR1 and AVR2). Molecular modelling showed how the replacement Lys(111)-->isoleucine in AVR2 alters the shape of the biotin-binding pocket and thus results in reversible binding. Both modelling and biochemical analyses showed that disulphide bonds can form and link monomers in AVR4/5, a property not found in avidin. These, together with the other properties of the AVRs described in the present paper, may offer advantages over avidin and streptavidin, making the AVRs applicable for improved avidin-biotin technological applications. PMID:11964162

  8. Development of recombinant Aleuria aurantia lectins with altered binding specificities to fucosylated glycans

    OpenAIRE

    Romano, Patrick R.; Mackay, Andrew; Vong, Minh; deSa, Johann; Lamontagne, Anne; Comunale, Mary Ann; Hafner, Julie; Block, Timothy; Lec, Ryszard; Mehta, Anand

    2011-01-01

    Changes in glycosylation have long been associated with disease. While there are many methods to detect changes in glycosylation, plant derived lectins are often used to determine changes on specific proteins or molecules of interest. One change in glycosylation that has been observed by us and by others is a disease or antigen associated increase in fucosylation on N-linked glycans. To measure this change, the fucose binding Aleuria aurantia lectin (AAL) is often utilized in plate and soluti...

  9. Altering Antibody-Drug Conjugate Binding to the Neonatal Fc Receptor Impacts Efficacy and Tolerability.

    Science.gov (United States)

    Hamblett, Kevin J; Le, Tiep; Rock, Brooke M; Rock, Dan A; Siu, Sophia; Huard, Justin N; Conner, Kip P; Milburn, Robert R; O'Neill, Jason W; Tometsko, Mark E; Fanslow, William C

    2016-07-01

    Antibody-drug conjugates (ADC) rely on the target-binding specificity of an antibody to selectively deliver potent drugs to cancer cells. IgG antibody half-life is regulated by neonatal Fc receptor (FcRn) binding. Histidine 435 of human IgG was mutated to alanine (H435A) to explore the effect of FcRn binding on the pharmacokinetics, efficacy, and tolerability of two separate maytansine-based ADC pairs with noncleavable linkers, (c-DM1 and c-H435A-DM1) and (7v-Cys-may and 7v-H435A-Cys-may). The in vitro cell-killing potency of each pair of ADCs was similar, demonstrating that H435A showed no measurable impact on ADC bioactivity. The H435A mutant antibodies showed no detectable binding to human or mouse FcRn in vitro, whereas their counterpart wild-type IgG ADCs were found to bind to FcRn at pH = 6.0. In xenograft bearing SCID mice expressing mouse FcRn, the AUC of 7v-Cys-may was 1.6-fold higher than that of 7v-H435A-may, yet the observed efficacy was similar. More severe thrombocytopenia was observed with 7v-H435A-Cys-may as compared to 7v-Cys-may at multiple dose levels. The AUC of c-DM1 was approximately 3-fold higher than that of c-H435A-DM1 in 786-0 xenograft bearing SCID mice, which led to a 3-fold difference in efficacy by dose. Murine FcRn knockout, human FcRn transgenic line 32 SCID animals bearing 786-0 xenografts showed an amplified exposure difference between c-DM1 and c-H435A-DM1 as compared to murine FcRn expressing SCID mice, leading to a 10-fold higher dose required for efficacy despite a 6-fold higher AUC of the c-H435A-DM1. The accelerated clearance observed for the noncleavable maytansine ADCs with the H435A FcRn mutation led to reduced efficacy at equivalent doses and exacerbation of clinical pathology parameters (decreased tolerability) at equivalent doses. The results show that reduced ADC clearance mediated by FcRn modulation can improve therapeutic index. PMID:27248573

  10. Specific Binding of 17D3 Anti-pZP mAb to Porcine and Human Zona Pellucida but not to Other Tissue Antigens Identified by ABC Immunohistochemistry

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Objective To characterize the binding effects of 1 7D3 anti-pZP monoclonal antibody (mAb) on porcine and human ZP, ovary and other important tissues Methods The 1 7D3 anti-pZP mAb was produced by immunizing mouse with porcine zona pellucida and hybridoma and monoclonal antibody preparation. An ABCimmunohistochemistry was used to evaluate reaction of mAb 17D3pZP to porcine and human ZP antigens as well as important human tissue antigens.Results mAb 1 7D3pZP specifically bound to porcine and human ZP antigen, but not to other cells of ovaries and other important human tissue antigens.Conclusion 17D3 anti-pZP mAb can recognize porcine and human ZP antigen without cross-reaction with other human tissue antigens including ovary, so it may further help us to abstract and purify corresponding target antigen and settle basis for producing human ZP contraceptive vaccine.

  11. A role for heme in Alzheimer's disease: Heme binds amyloid β and has altered metabolism

    OpenAIRE

    Atamna, Hani; Frey, William H.

    2004-01-01

    Heme is a common factor linking several metabolic perturbations in Alzheimer's disease (AD), including iron metabolism, mitochondrial complex IV, heme oxygenase, and bilirubin. Therefore, we determined whether heme metabolism was altered in temporal lobes obtained at autopsy from AD patients and age-matched nondemented subjects. AD brain demonstrated 2.5-fold more heme-b (P < 0.01) and 26% less heme-a (P = 0.16) compared with controls, resulting in a highly significant 2.9-fold decrease in he...

  12. Neuroprotective Effect of Ginseng against Alteration of Calcium Binding Proteins Immunoreactivity in the Mice Hippocampus after Radiofrequency Exposure

    Directory of Open Access Journals (Sweden)

    Dhiraj Maskey

    2013-01-01

    Full Text Available Calcium binding proteins (CaBPs such as calbindin D28-k, parvalbumin, and calretinin are able to bind Ca2+ with high affinity. Changes in Ca2+ concentrations via CaBPs can disturb Ca2+ homeostasis. Brain damage can be induced by the prolonged electromagnetic field (EMF exposure with loss of interacellular Ca2+ balance. The present study investigated the radioprotective effect of ginseng in regard to CaBPs immunoreactivity (IR in the hippocampus through immunohistochemistry after one-month exposure at 1.6 SAR value by comparing sham control with exposed and ginseng-treated exposed groups separately. Loss of dendritic arborization was noted with the CaBPs in the Cornu Ammonis areas as well as a decrease of staining intensity of the granule cells in the dentate gyrus after exposure while no loss was observed in the ginseng-treated group. A significant difference in the relative mean density was noted between control and exposed groups but was nonsignificant in the ginseng-treated group. Decrease in CaBP IR with changes in the neuronal staining as observed in the exposed group would affect the hippocampal trisynaptic circuit by alteration of the Ca2+ concentration which could be prevented by ginseng. Hence, ginseng could contribute as a radioprotective agent against EMF exposure, contributing to the maintenance of Ca2+ homeostasis by preventing impairment of intracellular Ca2+ levels in the hippocampus.

  13. Altered localization and functionality of TAR DNA Binding Protein 43 (TDP-43) in niemann- pick disease type C.

    Science.gov (United States)

    Dardis, A; Zampieri, S; Canterini, S; Newell, K L; Stuani, C; Murrell, J R; Ghetti, B; Fiorenza, M T; Bembi, B; Buratti, E

    2016-01-01

    Niemann-Pick type C (NPC) disease is a lysosomal storage disorder characterized by the occurrence of visceral and neurological symptoms. At present, the molecular mechanisms causing neurodegeneration in this disease are unknown. Here we report the altered expression and/or mislocalization of the TAR-DNA binding protein 43 (TDP-43) in both NPC mouse and in a human neuronal model of the disease. We also report the neuropathologic study of a NPC patient's brain, showing that while TDP-43 is below immunohistochemical detection in nuclei of cerebellar Purkinje cells, it has a predominant localization in the cytoplasm of these cells. From a functional point of view, the TDP-43 mislocalization, that occurs in a human experimental neuronal model system, is associated with specific alterations in TDP-43 controlled genes. Most interestingly, treatment with N-Acetyl-cysteine (NAC) or beta-cyclodextrin (CD) can partially restore TDP-43 nuclear localization. Taken together, the results of these studies extend the role of TDP-43 beyond the Amyotrophic lateral sclerosis (ALS)/frontotemporal dementia (FTD)/Alzheimer disease (AD) spectrum. These findings may open novel research/therapeutic avenues for a better understanding of both NPC disease and the TDP-43 proteinopathy disease mechanism. PMID:27193329

  14. Gestational treatment with cocaine and fluoxetine alters oxytocin receptor number and binding affinity in lactating rat dams.

    Science.gov (United States)

    Johns, Josephine M; Lubin, Deborah A; Walker, Cheryl H; Joyner, Paul; Middleton, Christopher; Hofler, Vivian; McMurray, Matthew

    2004-01-01

    Cocaine administered chronically throughout gestation has been correlated with deficits in maternal behavior, increased maternal aggressive behavior and decreased oxytocin levels in rats. In addition to its effects on oxytocin levels, cocaine is a potent serotonergic, dopaminergic and noradrenergic reuptake inhibitor. Alterations in the dopaminergic and serotonergic systems have been suggested as possibly having a role in cocaine-induced maternal aggression. This study was in part, an attempt to understand some of the mechanisms by which cocaine increases postpartum aggression, particularly as they relate to changes in the oxytocin system. Oxytocin receptor number and binding affinity in the medial preoptic area of the hypothalamus, ventral tegmental area, hippocampus and amygdala were determined for lactating rat dams on postpartum day 6 (PPD 6) that were gestationally treated with cocaine, fluoxetine, saline or an amfonelic acid/fluoxetine drug combination. Cocaine and fluoxetine treatment both resulted in a significant up-regulation of oxytocin receptor number and lower receptor affinity in the amygdala of lactating rat dams compared to saline controls and the amfonelic acid/fluoxetine combination treatment group. Cocaine treatment also resulted in a significant down-regulation of oxytocin receptors in the medial preoptic area and both cocaine and fluoxetine treated dams had the highest affinity for oxytocin receptors in this brain region. Results of the present study support previous data indicating that alterations in oxytocinergic and perhaps serotonergic system dynamics in the amygdala may play a role in cocaine-induced postpartum aggression. PMID:15380831

  15. Gestational treatment with cocaine and fluoxetine alters oxytocin receptor number and binding affinity in lactating rat dams

    Science.gov (United States)

    Johns, Josephine M.; Lubin, Deborah A.; Walker, Cheryl H.; Joyner, Paul; Middleton, Christopher; Hofler, Vivian; McMurray, Matthew

    2011-01-01

    Cocaine administered chronically throughout gestation has been correlated with deficits in maternal behavior, increased maternal aggressive behavior and decreased oxytocin levels in rats. In addition to its effects on oxytocin levels, cocaine is a potent serotonergic, dopaminergic and noradrenergic reuptake inhibitor. Alterations in the dopaminergic and serotonergic systems have been suggested as possibly having a role in cocaine-induced maternal aggression. This study was in part, an attempt to understand some of the mechanisms by which cocaine increases postpartum aggression, particularly as they relate to changes in the oxytocin system. Oxytocin receptor number and binding affinity in the medial preoptic area of the hypothalamus, ventral tegmental area, hippocampus and amygdala were determined for lactating rat dams on postpartum day 6 (PPD 6) that were gestationally treated with cocaine, fluoxetine, saline or an amfonelic acid/fluoxetine drug combination. Cocaine and fluoxetine treatment both resulted in a significant up-regulation of oxytocin receptor number and lower receptor affinity in the amygdala of lactating rat dams compared to saline controls and the amfonelic acid/fluoxetine combination treatment group. Cocaine treatment also resulted in a significant down-regulation of oxytocin receptors in the medial preoptic area and both cocaine and fluoxetine treated dams had the highest affinity for oxytocin receptors in this brain region. Results of the present study support previous data indicating that alterations in oxytocinergic and perhaps serotonergic system dynamics in the amygdala may play a role in cocaine-induced postpartum aggression. PMID:15380831

  16. Photorhabdus adhesion modification protein (Pam) binds extracellular polysaccharide and alters bacterial attachment

    LENUS (Irish Health Repository)

    Jones, Robert T

    2010-05-12

    Abstract Background Photorhabdus are Gram-negative nematode-symbiotic and insect-pathogenic bacteria. The species Photorhabdus asymbiotica is able to infect humans as well as insects. We investigated the secreted proteome of a clinical isolate of P. asymbiotica at different temperatures in order to identify proteins relevant to the infection of the two different hosts. Results A comparison of the proteins secreted by a clinical isolate of P. asymbiotica at simulated insect (28°C) and human (37°C) temperatures led to the identification of a small and highly abundant protein, designated Pam, that is only secreted at the lower temperature. The pam gene is present in all Photorhabdus strains tested and shows a high level of conservation across the whole genus, suggesting it is both ancestral to the genus and probably important to the biology of the bacterium. The Pam protein shows limited sequence similarity to the 13.6 kDa component of a binary toxin of Bacillus thuringiensis. Nevertheless, injection or feeding of heterologously produced Pam showed no insecticidal activity to either Galleria mellonella or Manduca sexta larvae. In bacterial colonies, Pam is associated with an extracellular polysaccharide (EPS)-like matrix, and modifies the ability of wild-type cells to attach to an artificial surface. Interestingly, Surface Plasmon Resonance (SPR) binding studies revealed that the Pam protein itself has adhesive properties. Although Pam is produced throughout insect infection, genetic knockout does not affect either insect virulence or the ability of P. luminescens to form a symbiotic association with its host nematode, Heterorhabditis bacteriophora. Conclusions We studied a highly abundant protein, Pam, which is secreted in a temperature-dependent manner in P. asymbiotica. Our findings indicate that Pam plays an important role in enhancing surface attachment in insect blood. Its association with exopolysaccharide suggests it may exert its effect through mediation of

  17. Photorhabdus adhesion modification protein (Pam binds extracellular polysaccharide and alters bacterial attachment

    Directory of Open Access Journals (Sweden)

    Joyce Susan A

    2010-05-01

    Full Text Available Abstract Background Photorhabdus are Gram-negative nematode-symbiotic and insect-pathogenic bacteria. The species Photorhabdus asymbiotica is able to infect humans as well as insects. We investigated the secreted proteome of a clinical isolate of P. asymbiotica at different temperatures in order to identify proteins relevant to the infection of the two different hosts. Results A comparison of the proteins secreted by a clinical isolate of P. asymbiotica at simulated insect (28°C and human (37°C temperatures led to the identification of a small and highly abundant protein, designated Pam, that is only secreted at the lower temperature. The pam gene is present in all Photorhabdus strains tested and shows a high level of conservation across the whole genus, suggesting it is both ancestral to the genus and probably important to the biology of the bacterium. The Pam protein shows limited sequence similarity to the 13.6 kDa component of a binary toxin of Bacillus thuringiensis. Nevertheless, injection or feeding of heterologously produced Pam showed no insecticidal activity to either Galleria mellonella or Manduca sexta larvae. In bacterial colonies, Pam is associated with an extracellular polysaccharide (EPS-like matrix, and modifies the ability of wild-type cells to attach to an artificial surface. Interestingly, Surface Plasmon Resonance (SPR binding studies revealed that the Pam protein itself has adhesive properties. Although Pam is produced throughout insect infection, genetic knockout does not affect either insect virulence or the ability of P. luminescens to form a symbiotic association with its host nematode, Heterorhabditis bacteriophora. Conclusions We studied a highly abundant protein, Pam, which is secreted in a temperature-dependent manner in P. asymbiotica. Our findings indicate that Pam plays an important role in enhancing surface attachment in insect blood. Its association with exopolysaccharide suggests it may exert its effect

  18. Fotfavoriten AB

    OpenAIRE

    Søilen, Klaus Solberg; HUBER, Stefan

    2004-01-01

    Fotfavoriten AB, a foot care company located in Sollefttå in Northern Sweden, is an example of how local government fires staff only to reengage them as entrepreneurs delivering similar service. The case is typical for the social sector and may mark a trend. The result is often felt to be positive both by the entrepreneur, who is now more directly in charge of her or his earnings, and the end consumer. The CEO of Fotfavoriten AB, Eva Wörmann, waited a long time before she dared to take the ne...

  19. A chemometric analysis of ligand-induced changes in intrinsic fluorescence of folate binding protein indicates a link between altered conformational structure and physico-chemical characteristics

    DEFF Research Database (Denmark)

    Bruun, Susanne W; Holm, Jan; Hansen, Steen Ingemann;

    2009-01-01

    Ligand binding alters the conformational structure and physico-chemical characteristics of bovine folate binding protein (FBP). For the purpose of achieving further information we analyzed ligand (folate and methotrexate)-induced changes in the fluorescence landscape of FBP. Fluorescence excitation...... of folate accords fairly well with the disappearance of strongly hydrophobic tryptophan residues from the solvent-exposed surface of FBP. The PARAFAC has thus proven useful to establish a hitherto unexplained link between parallel changes in conformational structure and physico-chemical characteristics...... of FBP induced by folate binding. Parameters for ligand binding derived from PARAFAC analysis of the fluorescence data were qualitatively and quantitatively similar to those obtained from binding of radiofolate to FBP. Herein, methotrexate exhibited a higher affinity for FBP than in competition...

  20. IGF-binding proteins in type 1 diabetes are more severely altered in the presence of complications

    Directory of Open Access Journals (Sweden)

    Ashok eSharma

    2016-01-01

    Full Text Available Aims: Reduced levels of free and total insulin-like growth factor 1 (IGF-I have been observed in Type-1 Diabetes (T1D patients. The bioavailability of IGF-I from the circulation to the target cells is controlled by multifunctional IGF binding proteins (IGFBPs. The aim of this study was to profile serum IGFBPs in T1D and its complications.Design: We measured the IGFBP levels in 3662 patient serum samples from our ongoing Phenome and Genome of Diabetes Autoimmunity (PAGODA study. IGFBP levels of four different groups of T1D patients (with 0, 1, 2, ≥3 complications were compared with healthy controls. Results: Three serum IGFBPs (IGFBP-1, 2 and 6 are significantly higher in T1D patients and these alterations are greater in the presence of diabetic complications. IGFBP-3 is lower in patients with diabetic complications. Analyses using quintiles revealed that risk of T1D complications increases with increasing concentrations of IGFBP-2 (5th quintile ORs: 18-60, p<10-26, IGFBP-1 (5th quintile ORs: 8-20, p<10-15 and IGFBP-6 (5th quintile ORs: 3-148, p<10-3. IGFBP-3 has a negative association with T1D complications (5th quintile ORs: 0.12-0.25, p<10-5. Conclusions: we found that elevated serum levels of IGFBP-1, 2 and 6 were associated with T1D and its complications and IGFBP-3 level was found to be decreased in T1D with complications. Given the known role of these IGFBPs, the overall impact of these alterations suggest a negative effect on IGF signaling.

  1. MBD3 expression and DNA binding patterns are altered in a rat model of temporal lobe epilepsy.

    Science.gov (United States)

    Bednarczyk, Joanna; Dębski, Konrad J; Bot, Anna M; Lukasiuk, Katarzyna

    2016-01-01

    The aim of the present study was to examine involvement of MBD3 (methyl-CpG-binding domain protein 3), a protein involved in reading DNA methylation patterns, in epileptogenesis and epilepsy. We used a well-characterized rat model of temporal lobe epilepsy that is triggered by status epilepticus, evoked by electrical stimulation of the amygdala. Stimulated and sham-operated animals were sacrificed 14 days after stimulation. We found that MBD3 transcript was present in neurons, oligodendrocytes, and astrocytes in both control and epileptic animals. We detected the nuclear localization of MBD3 protein in neurons, mature oligodendrocytes, and a subpopulation of astrocytes but not in microglia. Amygdala stimulation significantly increased the level of MBD3 immunofluorescence. Immunoprecipitation followed by mass spectrometry and Western blot revealed that MBD3 in the adult brain assembles the NuRD complex, which also contains MTA2, HDAC2, and GATAD2B. Using chromatin immunoprecipitation combined with deep sequencing, we observed differences in the occupancy of DNA regions by MBD3 protein between control and stimulated animals. This was not followed by subsequent changes in the mRNA expression levels of selected MBD3 targets. Our data demonstrate for the first time alterations in the MBD3 expression and DNA occupancy in the experimental model of epilepsy. PMID:27650712

  2. ABS 497 Complete Class

    OpenAIRE

    admin

    2015-01-01

    ABS 497 Complete Class   To purchase this material click below link   http://www.assignmentcloud.com/ABS-497/ABS-497-Complete-Class-Guide   For more classes visit   www.assignmentcloud.com   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 ...

  3. Altered binding of 125I-labeled calmodulin to a 46.5-kilodalton protein in skin fibroblasts cultured from patients with cystic fibrosis

    International Nuclear Information System (INIS)

    The levels of calmodulin and calmodulin-binding proteins have been determined in cultured skin fibroblasts from patients with cystic fibrosis (CF) and age- and sex-matched controls. Calmodulin ranged from 0.20 to 0.76 microgram/mg protein; there was no difference between calmodulin concentration in fibroblasts from CF patients and controls. Calmodulin-binding proteins of 230, 212, 204, 164, 139, 70, 59, 46.5, and 41 kD were identified. A protein with a mobility identical to the 59-kD calmodulin-binding protein was labeled by antiserum against calmodulin-dependent phosphatase. Although Ca2+/calmodulin-dependent phosphatase activity was detected, there was no different in activity between control and CF fibroblasts or in the level of phosphatase protein as determined by radioimmunoassay. Lower amounts of 125I-calmodulin were bound to the 46.5-kD calmodulin-binding protein in CF fibroblasts as compared with controls. The 46.5-kD calmodulin-binding protein may be reduced in CF fibroblasts or its structure may be altered resulting in a reduced binding capacity and/or affinity for calmodulin and perhaps reflecting, either directly or indirectly, the genetic defect responsible for cystic fibrosis

  4. Reference: DREDR1ATRD29AB [PLACE

    Lifescience Database Archive (English)

    Full Text Available ization and expression of two Arabidopsis DREB2 genes encoding DRE-binding proteins...DREDR1ATRD29AB Nakashima K, Shinwari ZK, Sakuma Y, Seki M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K Organ

  5. Epitope mapping of a mAb against the factor H binding protein (fHbp) of N. meningitidis by phage display

    OpenAIRE

    Zippilli, Lorenza

    2012-01-01

    No broadly protective vaccine is yet available for the prevention of group B meningococcal disease. One promising vaccine lead is the factor H binding protein (fHbp), a surface-exposed lipoprotein, which is present in all strains of Neisseria meningitidis. This protein binds human factor H (fH), contributing to the ability of these bacteria to avoid complement-mediated killing. The fHbp is a component of a serogroup B meningococcal vaccine currently in late-phase clinical development. Ba...

  6. Acute social defeat does not alter cerebral 5-HT2A receptor binding in male Wistar rats

    DEFF Research Database (Denmark)

    Visser, Anniek K D; Meerlo, Peter; Ettrup, Anders;

    2014-01-01

    suppressed growth, but did not affect anxiety-like behavior in an open field test. A positron emission tomography scan with the 5-HT2A R tracer [11C]MDL 100907 1 day and 3 weeks after defeat did not show significant changes in receptor binding. To verify these results, [3H]MDL 100907 binding assays were...

  7. X-RAY STUDIES REVEAL LANTHANIDE BINDING-SITES AT THE A/B5 INTERFACE OF ESCHERICHIA-COLI HEAT LABILE ENTEROTOXIN

    NARCIS (Netherlands)

    SIXMA, TK; VANSCHELTINGA, ACT; KALK, KH; WARTNA, ES; HOL, WGJ

    1992-01-01

    The crystal structure determination of heat labile enterotoxin (LT) bound to two different lanthanide ions, erbium and samarium, revealed two distinct ion binding sites in the interface of the A subunit and the B pentamer of the toxin. One of the interface sites is conserved in the very similar chol

  8. Inhibition of Binding of the AB5-Type Enterotoxins LT-I and Cholera Toxin to Ganglioside GM1 by Galactose-Rich Dietary Components

    NARCIS (Netherlands)

    Becker, P.M.; Widjaja-Greefkes, H.C.A.; Wikselaar, van P.G.

    2010-01-01

    Cholera, travelers' diarrhea, or colibacillosis in pigs can possibly be prevented or attenuated by dietary provision of competitive inhibitors that react with the GM1-binding sites of the enterotoxins cholera toxin (CT), human Escherichia coli heat-labile enterotoxin of serogroup I (LTh-I), and porc

  9. Diet-induced alterations in intestinal and extrahepatic lipid metabolism in liver fatty acid binding protein knockout mice

    OpenAIRE

    Newberry, Elizabeth P.; Kennedy, Susan M; Xie, Yan; Luo, Jianyang; Davidson, Nicholas O.

    2008-01-01

    Liver fatty acid binding protein (L-FABP) is highly expressed in both enterocytes and hepatocytes and binds multiple ligands, including saturated (SFA), unsaturated fatty acids (PUFA), and cholesterol. L-fabp−/− mice were protected against obesity and hepatic steatosis on a high saturated fat (SF), high cholesterol “Western” diet and manifested a similar phenotype when fed with a high SF, low cholesterol diet. There were no significant differences in fecal fat content or food consumption betw...

  10. Galectin-1-binding glycoforms of haptoglobin with altered intracellular trafficking, and increase in metastatic breast cancer patients.

    Directory of Open Access Journals (Sweden)

    Michael C Carlsson

    Full Text Available Sera from 25 metastatic breast cancer patients and 25 healthy controls were subjected to affinity chromatography using immobilized galectin-1. Serum from the healthy subjects contained on average 1.2 mg per ml (range 0.7-2.2 galectin-1 binding glycoproteins, whereas serum from the breast cancer patients contained on average 2.2 mg/ml (range 0.8-3.9, with a higher average for large primary tumours. The major bound glycoproteins were α-2-macroglobulin, IgM and haptoglobin. Both the IgM and haptoglobin concentrations were similar in cancer compared to control sera, but the percentage bound to galectin-1 was lower for IgM and higher for haptoglobin: about 50% (range 20-80 in cancer sera and about 30% (range 25-50 in healthy sera. Galectin-1 binding and non-binding fractions were separated by affinity chromatography from pooled haptoglobin from healthy sera. The N-glycans of each fraction were analyzed by mass spectrometry, and the structural differences and galectin-1 mutants were used to identify possible galectin-1 binding sites. Galectin-1 binding and non-binding fractions were also analyzed regarding their haptoglobin function. Both were similar in forming complex with haemoglobin and mediate its uptake into alternatively activated macrophages. However, after uptake there was a dramatic difference in intracellular targeting, with the galectin-1 non-binding fraction going to a LAMP-2 positive compartment (lysosomes, while the galectin-1 binding fraction went to larger galectin-1 positive granules. In conclusion, galectin-1 detects a new type of functional biomarker for cancer: a specific type of glycoform of haptoglobin, and possibly other serum glycoproteins, with a different function after uptake into tissue cells.

  11. Characterization of the mechanism of action of the genetically modified Cry1AbMod toxin that is active against Cry1Ab-resistant insects.

    Science.gov (United States)

    Muñóz-Garay, Carlos; Portugal, Leivi; Pardo-López, Liliana; Jiménez-Juárez, Nuria; Arenas, Ivan; Gómez, Isabel; Sánchez-López, Rosana; Arroyo, Raquel; Holzenburg, Andreas; Savva, Christos G; Soberón, Mario; Bravo, Alejandra

    2009-10-01

    Bacillus thuringiensis Cry toxins are used in the control of insect pests. They are pore-forming toxins with a complex mechanism that involves the sequential interaction with receptors. They are produced as protoxins, which are activated by midgut proteases. Activated toxin binds to cadherin receptor, inducing an extra cleavage including helix alpha-1, facilitating the formation of a pre-pore oligomer. The toxin oligomer binds to secondary receptors such as aminopeptidase and inserts into lipid rafts forming pores and causing larval death. The primary threat to efficacy of Bt-toxins is the evolution of insect resistance. Engineered Cry1AMod toxins, devoid of helix alpha-1, could be used for the control of resistance in lepidopterans by bypassing the altered cadherin receptor, killing resistant insects affected in this receptor. Here we analyzed the mechanism of action of Cry1AbMod. We found that alkaline pH and the presence of membrane lipids facilitates the oligomerization of Cry1AbMod. In addition, tryptophan fluorescence emission spectra, ELISA binding to pure aminopeptidase receptor, calcein release assay and analysis of ionic-conductance in planar lipid bilayers, indicated that the secondary steps in mode of action that take place after interaction with cadherin receptor such as oligomerization, receptor binding and pore formation are similar in the Cry1AbMod and in the wild type Cry1Ab. Finally, the membrane-associated structure of Cry1AbMod oligomer was analyzed by electron crystallography showing that it forms a complex with a trimeric organization. PMID:19559004

  12. Mapping of the C3b-binding site of CR1 and construction of a (CR1)2- F(ab')2 chimeric complement inhibitor

    OpenAIRE

    1991-01-01

    CR1/CR2 chimeric receptors in which various short consensus repeats (SCRs) of CR1 were attached to CR2 were transiently expressed on COS cells, and assessed for the binding of polymerized C3b (pC3b) and anti- CR2 by immunofluorescence. Of COS cells expressing chimeras containing SCR 1-4, 1-3, 2-4, 1-2, and 2-3 of the long homologous repeats (LHRs) - B or -C, 96%, 66%, 23%, 0%, and 0%, respectively, bound pC3b. K562 cells were stably transfected with wild-type CR1, deletion mutants of CR1, and...

  13. Alteration of the carbohydrate-binding specificity of a C-type lectin CEL-I mutant with an EPN carbohydrate-binding motif.

    Science.gov (United States)

    Hatakeyama, Tomomitsu; Ishimine, Tomohiro; Baba, Tomohiro; Kimura, Masanari; Unno, Hideaki; Goda, Shuichiro

    2013-07-01

    CEL-I is a Gal/GalNAc-specific C-type lectin isolated from the sea cucumber Cucumaria echinata. This lectin is composed of two carbohydrate-recognition domains (CRDs) with the carbohydrate-recognition motif QPD (Gln-Pro- Asp), which is generally known to exist in galactose-specific C-type CRDs. In the present study, a mutant CEL-I with EPN (Glu-Pro-Asn) motif, which is thought to be responsible for the carbohydrate-recognition of mannose-specific Ctype CRDs, was produced in Escherichia coli, and its effects on the carbohydrate-binding specificity were examined using polyamidoamine dendrimer (PD) conjugated with carbohydrates. Although wild-type CEL-I effectively formed complexes with N-acetylgalactosamine (GalNAc)-PD but not with mannose-PD, the mutant CEL-I showed relatively weak but definite affinity for mannose-PD. These results indicated that the QPD and EPN motifs play a significant role in the carbohydrate-recognition mechanism of CEL-I, especially in the discrimination of galactose and mannose. Additional mutations in the recombinant CEL-I binding site may further increase its specificity for mannose, and should provide insights into designing novel carbohydrate-recognition proteins. PMID:23157284

  14. Structural characterization of S100A15 reveals a novel zinc coordination site among S100 proteins and altered surface chemistry with functional implications for receptor binding

    Directory of Open Access Journals (Sweden)

    Murray Jill I

    2012-07-01

    Full Text Available Abstract Background S100 proteins are a family of small, EF-hand containing calcium-binding signaling proteins that are implicated in many cancers. While the majority of human S100 proteins share 25-65% sequence similarity, S100A7 and its recently identified paralog, S100A15, display 93% sequence identity. Intriguingly, however, S100A7 and S100A15 serve distinct roles in inflammatory skin disease; S100A7 signals through the receptor for advanced glycation products (RAGE in a zinc-dependent manner, while S100A15 signals through a yet unidentified G-protein coupled receptor in a zinc-independent manner. Of the seven divergent residues that differentiate S100A7 and S100A15, four cluster in a zinc-binding region and the remaining three localize to a predicted receptor-binding surface. Results To investigate the structural and functional consequences of these divergent clusters, we report the X-ray crystal structures of S100A15 and S100A7D24G, a hybrid variant where the zinc ligand Asp24 of S100A7 has been substituted with the glycine of S100A15, to 1.7 Å and 1.6 Å resolution, respectively. Remarkably, despite replacement of the Asp ligand, zinc binding is retained at the S100A15 dimer interface with distorted tetrahedral geometry and a chloride ion serving as an exogenous fourth ligand. Zinc binding was confirmed using anomalous difference maps and solution binding studies that revealed similar affinities of zinc for S100A15 and S100A7. Additionally, the predicted receptor-binding surface on S100A7 is substantially more basic in S100A15 without incurring structural rearrangement. Conclusions Here we demonstrate that S100A15 retains the ability to coordinate zinc through incorporation of an exogenous ligand resulting in a unique zinc-binding site among S100 proteins. The altered surface chemistry between S100A7 and S100A15 that localizes to the predicted receptor binding site is likely responsible for the differential recognition of distinct

  15. Universal stress protein Rv2624c alters abundance of arginine and enhances intracellular survival by ATP binding in mycobacteria

    Science.gov (United States)

    Jia, Qiong; Hu, Xinling; Shi, Dawei; Zhang, Yan; Sun, Meihao; Wang, Jianwei; Mi, Kaixia; Zhu, Guofeng

    2016-01-01

    The universal stress protein family is a family of stress-induced proteins. Universal stress proteins affect latency and antibiotic resistance in mycobacteria. Here, we showed that Mycobacterium smegmatis overexpressing M. tuberculosis universal stress protein Rv2624c exhibits increased survival in human monocyte THP-1 cells. Transcriptome analysis suggested that Rv2624c affects histidine metabolism, and arginine and proline metabolism. LC-MS/MS analysis showed that Rv2624c affects the abundance of arginine, a modulator of both mycobacteria and infected THP-1 cells. Biochemical analysis showed that Rv2624c is a nucleotide-binding universal stress protein, and an Rv2624c mutant incapable of binding ATP abrogated the growth advantage in THP-1 cells. Rv2624c may therefore modulate metabolic pathways in an ATP-dependent manner, changing the abundance of arginine and thus increasing survival in THP-1 cells. PMID:27762279

  16. Alteration of tropomyosin-binding properties of tropomodulin-1 affects its capping ability and localization in skeletal myocytes.

    Science.gov (United States)

    Moroz, Natalia A; Novak, Stefanie M; Azevedo, Ricardo; Colpan, Mert; Uversky, Vladimir N; Gregorio, Carol C; Kostyukova, Alla S

    2013-02-15

    Tropomodulin (Tmod) is an actin-capping protein that binds to the two tropomyosins (TM) at the pointed end of the actin filament to prevent further actin polymerization and depolymerization. Therefore, understanding the role of Tmod is very important when studying actin filament dependent processes such as muscle contraction and intracellular transport. The capping ability of Tmod is highly influenced by TM and is 1000-fold greater in the presence of TM. There are four Tmod isoforms (Tmod1-4), three of which, Tmod1, Tmod3, and Tmod4, are expressed in skeletal muscles. The affinity of Tmod1 to skeletal striated TM (stTM) is higher than that of Tmod3 and Tmod4 to stTM. In this study, we tested mutations in the TM-binding sites of Tmod1, using circular dichroism (CD) and prediction analysis (PONDR). The mutations R11K, D12N, and Q144K were chosen because they decreased the affinity of Tmod1 to stTM, making it similar to that of affinity of Tmod3 and Tmod4 to stTM. Significant reduction of inhibition of actin pointed-end polymerization in the presence of stTM was shown for Tmod1 (R11K/D12N/Q144K) as compared with WT Tmod1. When GFP-Tmod1 and mutants were expressed in primary chicken skeletal myocytes, decreased assembly of Tmod1 mutants was revealed. This indicates a direct correlation between TM-binding and the actin-capping abilities of Tmod. Our data confirmed the hypothesis that assembly of Tmod at the pointed-end of the actin filament depends on its TM-binding affinity.

  17. Ginkgo biloba extract alters the binding of the sodium [{sup 123}I] iodide (Na{sup 123}I) on blood constituents

    Energy Technology Data Exchange (ETDEWEB)

    Aleixo, Luiz Claudio Martins [Universidade do Estado do Rio de Janeiro, Instituto de Biologia Roberto Alcantara Gomes, Departamento de Biofisica e Biometria, 28 de Setembro, 87, 20551-030, Rio de Janeiro, RJ (Brazil); Comissao Nacional de Energia Nuclear, Instituto de Engenharia Nuclear, Cidade Universitaria, Ilha do Fundao, Via Cinco s/n, 21945-450 Rio de Janeiro (Brazil); Moreno, Silvana Ramos Farias, E-mail: srfmoreno@hotmail.com [Departamento de Patologia, Universidade Federal Fluminense, 24030-210, Niteroi, RJ (Brazil); Programa de Pos-Graduacao em Ciencias Medicas, Universidade Federal Fluminense, 24030-210, Niteroi, RJ (Brazil); Freitas, Rosimeire de Souza [Universidade do Estado do Rio de Janeiro, Instituto de Biologia Roberto Alcantara Gomes, Departamento de Biofisica e Biometria, 28 de Setembro, 87, 20551-030, Rio de Janeiro, RJ (Brazil); Thomaz, Helio [Comissao Nacional de Energia Nuclear, Instituto de Engenharia Nuclear, Cidade Universitaria, Ilha do Fundao, Via Cinco s/n, 21945-450 Rio de Janeiro (Brazil); Santos-Filho, Sebastiao David [Universidade do Estado do Rio de Janeiro, Instituto de Biologia Roberto Alcantara Gomes, Departamento de Biofisica e Biometria, 28 de Setembro, 87, 20551-030, Rio de Janeiro, RJ (Brazil)

    2012-01-15

    We evaluated the in vitro effect of an aqueous extract of Ginkgo biloba (EGb) on the distribution in blood cells (BC) and plasma (P) and on the binding of Na{sup 123}I to the blood constituents using precipitation with trichloroacetic acid. The radioactivity percentages insoluble (SF) and insoluble fraction (IF) of blood constituents were determined. The EGb interfered (p<0.05) on the distribution of Na{sup 123}I in the P (from 69.64 to 86.13) and BC (from 30.36 to 13.87) and altered the fixation of the Na{sup 123}I in IF-P and in IF-BC. - Highlights: Black-Right-Pointing-Pointer Interaction between the Ginkgo biloba and blood constituents radiolabeled. Black-Right-Pointing-Pointer Modification of the binding of sodium iodide (Na{sup 123}I) to the blood constituents. Black-Right-Pointing-Pointer This alteration should have influence in a diagnosis of nuclear medicine.

  18. Gestational treatment with cocaine and fluoxetine alters oxytocin receptor number and binding affinity in lactating rat dams

    OpenAIRE

    Johns, Josephine M.; Lubin, Deborah A.; Walker, Cheryl H.; Joyner, Paul; Middleton, Christopher; Hofler, Vivian; McMurray, Matthew

    2004-01-01

    Cocaine administered chronically throughout gestation has been correlated with deficits in maternal behavior, increased maternal aggressive behavior and decreased oxytocin levels in rats. In addition to its effects on oxytocin levels, cocaine is a potent serotonergic, dopaminergic and noradrenergic reuptake inhibitor. Alterations in the dopaminergic and serotonergic systems have been suggested as possibly having a role in cocaine-induced maternal aggression. This study was in part, an attempt...

  19. A SAM-dependent methyltransferase cotranscribed with arsenate reductase alters resistance to peptidyl transferase center-binding antibiotics in Azospirillum brasilense Sp7.

    Science.gov (United States)

    Singh, Sudhir; Singh, Chhaya; Tripathi, Anil Kumar

    2014-05-01

    The genome of Azospirillum brasilense harbors a gene encoding S-adenosylmethionine-dependent methyltransferase, which is located downstream of an arsenate reductase gene. Both genes are cotranscribed and translationally coupled. When they were cloned and expressed individually in an arsenate-sensitive strain of Escherichia coli, arsenate reductase conferred tolerance to arsenate; however, methyltransferase failed to do so. Sequence analysis revealed that methyltransferase was more closely related to a PrmB-type N5-glutamine methyltransferase than to the arsenate detoxifying methyltransferase ArsM. Insertional inactivation of prmB gene in A. brasilense resulted in an increased sensitivity to chloramphenicol and resistance to tiamulin and clindamycin, which are known to bind at the peptidyl transferase center (PTC) in the ribosome. These observations suggested that the inability of prmB:km mutant to methylate L3 protein might alter hydrophobicity in the antibiotic-binding pocket of the PTC, which might affect the binding of chloramphenicol, clindamycin, and tiamulin differentially. This is the first report showing the role of PrmB-type N5-glutamine methyltransferases in conferring resistance to tiamulin and clindamycin in any bacterium.

  20. A Highly Tilted Binding Mode by a Self-Reactive T Cell Receptor Results in Altered Engagement of Peptide and MHC

    Energy Technology Data Exchange (ETDEWEB)

    D Sethi; D Schubert; A Anders; A Heroux; D Bonsor; C Thomas; E Sundberg; J Pyrdol; K Wucherpfennig

    2011-12-31

    Self-reactive T cells that escape elimination in the thymus can cause autoimmune pathology, and it is therefore important to understand the structural mechanisms of self-antigen recognition. We report the crystal structure of a T cell receptor (TCR) from a patient with relapsing-remitting multiple sclerosis that engages its self-peptide-major histocompatibility complex (pMHC) ligand in an unusual manner. The TCR is bound in a highly tilted orientation that prevents interaction of the TCR-{alpha} chain with the MHC class II {beta} chain helix. In this structure, only a single germline-encoded TCR loop engages the MHC protein, whereas in most other TCR-pMHC structures all four germline-encoded TCR loops bind to the MHC helices. The tilted binding mode also prevents peptide contacts by the short complementarity-determining region (CDR) 3{beta} loop, and interactions that contribute to peptide side chain specificity are focused on the CDR3{alpha} loop. This structure is the first example in which only a single germline-encoded TCR loop contacts the MHC helices. Furthermore, the reduced interaction surface with the peptide may facilitate TCR cross-reactivity. The structural alterations in the trimolecular complex are distinct from previously characterized self-reactive TCRs, indicating that there are multiple unusual ways for self-reactive TCRs to bind their pMHC ligand.

  1. Fluorinated per-acetylated GalNAc metabolically alters glycan structures on leukocyte PSGL-1 and reduces cell binding to selectins.

    Science.gov (United States)

    Marathe, Dhananjay D; Buffone, Alexander; Chandrasekaran, E V; Xue, Jun; Locke, Robert D; Nasirikenari, Mehrab; Lau, Joseph T Y; Matta, Khushi L; Neelamegham, Sriram

    2010-02-11

    Novel strategies to control the binding of adhesion molecules belonging to the selectin family are required for the treatment of inflammatory diseases. We tested the possibility that synthetic monosaccharide analogs can compete with naturally occurring sugars to alter the O-glycan content on human leukocyte cell surface selectin-ligand, P-selectin glycoprotein ligand-1 (PSGL-1). Resulting reduction in the sialyl Lewis-X-bearing epitopes on this ligand may reduce cell adhesion. Consistent with this hypothesis, 50muM per-acetylated 4F-GalNAc added to the growth media of promyelocytic HL-60 cells reduced the expression of the cutaneous lymphocyte associated-antigen (HECA-452 epitope) by 82% within 2 cell doubling cycles. Cell binding to all 3 selectins (L-, E-, and P-selectin) was reduced in vitro. 4F-GalNAc was metabolically incorporated into PSGL-1, and this was accompanied by an approximately 20% reduction in PSGL-1 glycan content. A 70% to 85% reduction in HECA-452 binding epitope and N-acetyl lactosamine content in PSGL-1 was also noted on 4F-GalNAc addition. Intravenous 4F-GalNAc infusion reduced leukocyte migration to the peritoneum in a murine model of thioglycolate-induced peritonitis. Thus, the compound has pharmacologic activity. Overall, the data suggest that 4F-GalNAc may be applied as a metabolic inhibitor to reduce O-linked glycosylation, sialyl Lewis-X formation, and leukocyte adhesion via the selectins.

  2. The kinesin-13 KLP10A motor regulates oocyte spindle length and affects EB1 binding without altering microtubule growth rates

    Directory of Open Access Journals (Sweden)

    Kevin K. Do

    2014-06-01

    Full Text Available Kinesin-13 motors are unusual in that they do not walk along microtubules, but instead diffuse to the ends, where they remove tubulin dimers, regulating microtubule dynamics. Here we show that Drosophila kinesin-13 klp10A regulates oocyte meiosis I spindle length and is haplo-insufficient – KLP10A, reduced by RNAi or a loss-of-function P element insertion mutant, results in elongated and mispositioned oocyte spindles, and abnormal cortical microtubule asters and aggregates. KLP10A knockdown by RNAi does not significantly affect microtubule growth rates in oocyte spindles, but, unexpectedly, EB1 binding and unbinding are slowed, suggesting a previously unobserved role for kinesin-13 in mediating EB1 binding interactions with microtubules. Kinesin-13 may regulate spindle length both by disassembling subunits from microtubule ends and facilitating EB1 binding to plus ends. We also observe an increased number of paused microtubules in klp10A RNAi knockdown spindles, consistent with a reduced frequency of microtubule catastrophes. Overall, our findings indicate that reduced kinesin-13 decreases microtubule disassembly rates and affects EB1 interactions with microtubules, rather than altering microtubule growth rates, causing spindles to elongate and abnormal cortical microtubule asters and aggregates to form.

  3. Altered levels of laminin receptor mRNA in various human carcinoma cells that have different abilities to bind laminin

    DEFF Research Database (Denmark)

    Wewer, U M; Liotta, L A; Jaye, M;

    1986-01-01

    isolated after screening a human endothelial lambda gt11 cDNA library with a monoclonal antibody directed against a domain of the laminin receptor involved in ligand binding. Definitive identification of the cDNA clones was based on comparison of cDNA sequence with the amino acid sequence of a cyanogen...... bromide-generated octapeptide of purified placental laminin receptor. The laminin receptor mRNA is approximately 1700 bases long. The level of laminin receptor mRNA in a variety of human carcinoma-derived cell lines correlated with the number of laminin receptors on the cell surfaces of those cells...

  4. HUMAN LIVER FATTY ACID BINDING PROTEIN (L-FABP) T94A VARIANT ALTERS STRUCTURE, STABILITY, AND INTERACTION WITH FIBRATES

    OpenAIRE

    Martin, Gregory G.; McIntosh, Avery L.; Huang, Huan; Gupta, Shipra; Atshaves, Barbara P.; Landrock, Kerstin K.; Landrock, Danilo; Kier, Ann B.; Schroeder, Friedhelm

    2013-01-01

    Although the human L-FABP T94A variant arises from the most commonly occurring SNP in the entire FABP family, there is a complete lack of understanding regarding the role of this polymorphism in human disease. It has been hypothesized that the T94A substitution results in complete loss of ligand binding ability and function analogous to L-FABP gene ablation. This possibility was addressed using recombinant human WT T94T and T94A variant L-FABP and cultured primary human hepatocytes. Non-conse...

  5. Thermodynamic prediction of glass formation tendency, cluster-in-jellium model for metallic glasses, ab initio tight-binding calculations, and new density functional theory development for systems with strong electron correlation

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Yongxin [Iowa State Univ., Ames, IA (United States)

    2009-01-01

    also plays an important role, as it may directly track the movement of every atom. Simulation time is a major limit for molecular dynamics, not only because of “slow” computer speed, but also because of the accumulation error in the numerical treatment of the motion equations. There is also a great concern about the reliability of the emperical potentials if using classical molecular dynamics. Ab initio methods based on density functional theory(DFT) do not have this problem, however, it suffers from small simulation cells and is more demanding computationally. When crystal phase is involved, size effect of the simulation cell is more pronounced since long-range elastic energy would be established. Simulation methods which are more efficient in computation but yet have similar reliability as the ab initio methods, like tight-binding method, are highly desirable. While the complexity of metallic glasses comes from the atomistic level, there is also a large field which deals with the complexity from electronic level. The only “ab initio” method applicable to solid state systems is density functional theory with local density approximation( LDA) or generalized gradient approximation(GGA) for the exchange-correlation energy. It is very successful for simple sp element, where it reaches an high accuracy for determining the surface reconstruction. However, there is a large class of materials with strong electron correlation, where DFT based on LDA or GGA fails in a fundamental way. An “ab initio” method which can generally apply to correlated materials, as LDA for simple sp element, is still to be developed. The thesis is prepared to address some of the above problems.

  6. A sugar beet chlorophyll a/b binding protein promoter void of G-box like elements confers strong and leaf specific reporter gene expression in transgenic sugar beet

    Directory of Open Access Journals (Sweden)

    Kloos Dorothee U

    2004-12-01

    Full Text Available Abstract Background Modification of leaf traits in sugar beet requires a strong leaf specific promoter. With such a promoter, expression in taproots can be avoided which may otherwise take away available energy resources for sugar accumulation. Results Suppression Subtractive Hybridization (SSH was utilized to generate an enriched and equalized cDNA library for leaf expressed genes from sugar beet. Fourteen cDNA fragments corresponding to thirteen different genes were isolated. Northern blot analysis indicates the desired tissue specificity of these genes. The promoters for two chlorophyll a/b binding protein genes (Bvcab11 and Bvcab12 were isolated, linked to reporter genes, and transformed into sugar beet using promoter reporter gene fusions. Transient and transgenic analysis indicate that both promoters direct leaf specific gene expression. A bioinformatic analysis revealed that the Bvcab11 promoter is void of G-box like regulatory elements with a palindromic ACGT core sequence. The data indicate that the presence of a G-box element is not a prerequisite for leaf specific and light induced gene expression in sugar beet. Conclusions This work shows that SSH can be successfully employed for the identification and subsequent isolation of tissue specific sugar beet promoters. These promoters are shown to drive strong leaf specific gene expression in transgenic sugar beet. The application of these promoters for expressing resistance improving genes against foliar diseases is discussed.

  7. Cyclic glycine-proline regulates IGF-1 homeostasis by altering the binding of IGFBP-3 to IGF-1

    Science.gov (United States)

    Guan, Jian; Gluckman, Peter; Yang, Panzao; Krissansen, Geoff; Sun, Xueying; Zhou, Yongzhi; Wen, Jingyuan; Phillips, Gemma; Shorten, Paul R.; McMahon, Chris D.; Wake, Graeme C.; Chan, Wendy H. K.; Thomas, Mark F.; Ren, April; Moon, Steve; Liu, Dong-Xu

    2014-03-01

    The homeostasis of insulin-like growth factor-1 (IGF-1) is essential for metabolism, development and survival. Insufficient IGF-1 is associated with poor recovery from wounds whereas excessive IGF-1 contributes to growth of tumours. We have shown that cyclic glycine-proline (cGP), a metabolite of IGF-1, can normalise IGF-1 function by showing its efficacy in improving the recovery from ischemic brain injury in rats and inhibiting the growth of lymphomic tumours in mice. Further investigation in cell culture suggested that cGP promoted the activity of IGF-1 when it was insufficient, but inhibited the activity of IGF-1 when it was excessive. Mathematical modelling revealed that the efficacy of cGP was a modulated IGF-1 effect via changing the binding of IGF-1 to its binding proteins, which dynamically regulates the balance between bioavailable and non-bioavailable IGF-1. Our data reveal a novel mechanism of auto-regulation of IGF-1, which has physiological and pathophysiological consequences and potential pharmacological utility.

  8. Cocaine alters mu but not delta or kappa opioid receptor-stimulated in situ [35S]GTPgammaS binding in rat brain.

    Science.gov (United States)

    Schroeder, Joseph A; Niculescu, Michelle; Unterwald, Ellen M

    2003-01-01

    Chronic cocaine administration produces alterations in mu and kappa opioid receptor density as well as striatal and accumbens opioid-regulated adenylyl cyclase activity, suggesting a psychostimulant responsive interaction between opioidergic and dopaminergic systems. Stimulation of G-protein-coupled opioid receptors inhibits adenylyl cyclase production of cyclic AMP. The present study employed in situ [(35)S]GTPgammaS binding to measure opioid receptor-stimulated activation of G-proteins in response to acute and chronic cocaine exposure. Male Fischer rats received acute (1 or 3 days) or chronic (14 days) binge pattern cocaine administration. Three and 14 days of cocaine injections resulted in greater increases in the ability of the mu receptor agonist DAMGO to stimulate [(35)S]GTPgammaS binding in both the core and the shell of the nucleus accumbens, all regions of the caudate putamen and the cingulate cortex compared with saline-matched controls. The greatest increases in DAMGO-stimulated [(35)S]GTPgammaS binding were observed in the dorsal areas of the caudate putamen in animals that received 14 days of cocaine. No significant changes in delta (DPDPE), or kappa (dynorphin A(1-17)) receptor-stimulated [(35)S]GTPgammaS binding were found in any brain region in response to cocaine administration. These results demonstrate that binge pattern cocaine administration induce changes in mu but not delta or kappa opioid receptor-mediated G-protein activity. This study provides support for the hypothesis that the addictive properties of both psychostimulants and opiates may share common neurochemical signaling substrates. PMID:12422370

  9. A Molecular Model for Cocaine Binding by the Immunotherapeutic Human/Mouse Chimeric Monoclonal Antibody 2E2

    OpenAIRE

    Lape, Michael; Paula, Stefan; Ball, William J.

    2010-01-01

    Immunotherapy by cocaine-binding monoclonal antibodies (mAbs) has emerged as a promising strategy for the treatment of cocaine addiction. The human (γ1 heavy chain)/murine (λ light chain) chimeric mAb 2E2 has excellent affinity and specificity for cocaine and recent animal studies have demonstrated 2E2’s ability in vivo to reduce cocaine levels in the brain as well as alter cocaine self-administration behavior in rats. In this study, we used mAb 2E2 amino acid sequence information to create a...

  10. Excessive gestational weight gain and obesity contribute to altered expression of maternal insulin-like growth factor binding protein-3

    Directory of Open Access Journals (Sweden)

    Ferraro ZM

    2013-10-01

    Full Text Available Zachary M Ferraro,1 Qing Qiu,2 Andrée Gruslin,3,4 Kristi B Adamo1,3,5 1Healthy Active Living and Obesity Research Group, Children's Hospital of Eastern Ontario Research Institute, Ottawa, ON, Canada; 2The Ottawa Hospital Research Institute, Ottawa, ON, Canada; 3Faculty of Health Sciences, School of Human Kinetics, University of Ottawa, Ottawa, ON, Canada; 4Departments of Obstetrics and Gynecology, Division of Maternal-Fetal Medicine and Cellular and Molecular Medicine, University of Ottawa, Ottawa, ON, Canada; 5Department of Pediatrics, University of Ottawa, Ottawa, ON, Canada Background: Excessive gestational weight gain (GWG increases risk of large for gestational age neonates and subsequent tracking of excess weight throughout the life course for both mother and child. Although the physiological mechanisms underlying these associations are incomplete, the insulin-like growth factor (IGF axis has garnered attention for its role in fetal growth and development. Our purpose was to characterize the IGF axis protein expression patterns in mother–infant dyads in respect of excessive GWG. Methods: We obtained fasting serum samples and corresponding cord blood from eight controls (ADHERE group: ie, those who gained in accordance with 2009 Institute of Medicine GWG recommendations and 13 exceeders (EXCEED group: ie, those who exceeded Institute of Medicine GWG recommendations. At study completion, we examined protein expression of IGF-I, IGF-II, IGF binding protein (IGFBP-1, IGFBP-3, IGFBP-4, and hormone concentrations in both maternal and cord blood. Results: Between-group comparisons were made and revealed elevated maternal leptin (P ≤ 0.05 concentrations in gravidas who exceeded recommendations. There was a significantly higher number of obese women in the EXCEED group (P < 0.05. After adjustment, maternal leptin levels were positively correlated with maternal homeostasis model of assessment for insulin resistance score and excessive GWG (P

  11. Antisense expression of a gene encoding a calcium-binding protein in transgenic tobacco leads to altered morphology and enhanced chlorophyll

    Indian Academy of Sciences (India)

    Girdhar K Pandey; Amita Pandey; Vanga Siva Reddy; Renu Deswal; Alok Bhattacharya; Kailash C Upadhyaya; Sudhir K Sopory

    2007-03-01

    Entamoeba histolytica contains a novel calcium-binding protein like calmodulin, which was discovered earlier, and we have reported the presence of its homologue(s) and a dependent protein kinase in plants. To understand the functions of these in plants, a cDNA encoding a calcium-binding protein isolated from Entamoeba histolytica (EhCaBP) was cloned into vector pBI121 in antisense orientation and transgenic tobacco plants were raised. These plants showed variation in several phenotypic characters, of which two distinct features, more greenness and leaf thickness, were inherited in subsequent generations. The increase in the level of total chlorophyll in different plants ranged from 60% to 70%. There was no major change in chloroplast structure and in the protein level of D1, D2, LHCP and RuBP carboxylase. These morphological changes were not seen in antisense calmodulin transgenic tobacco plants, nor was the calmodulin level altered in EhCaBP antisense plants.

  12. Altered chromatin structure associated with methylation-induced gene silencing in cancer cells: correlation of accessibility, methylation, MeCP2 binding and acetylation

    Science.gov (United States)

    Nguyen, Carvell T.; Gonzales, Felicidad A.; Jones, Peter A.

    2001-01-01

    Silencing of tumor-suppressor genes by hypermethylation of promoter CpG islands is well documented in human cancer and may be mediated by methyl-CpG-binding proteins, like MeCP2, that are associated in vivo with chromatin modifiers and transcriptional repressors. However, the exact dynamic between methylation and chromatin structure in the regulation of gene expression is not well understood. In this study, we have analyzed the methylation status and chromatin structure of three CpG islands in the p14(ARF)/p16(INK4A) locus in a series of normal and cancer cell lines using methylation-sensitive digestion, MspI accessibility in intact nuclei and chromatin immunoprecipitation (ChIP) assays. We demonstrate the existence of an altered chromatin structure associated with the silencing of tumor-suppressor genes in human cancer cell lines involving CpG island methylation, chromatin condensation, histone deacetylation and MeCP2 binding. The data showed that MeCP2 could bind to methylated CpG islands in both promoters and exons; MeCP2 does not interfere with transcription when bound at an exon, suggesting a more generalized role for the protein beyond transcriptional repression. In the absence of methylation, it is demonstrated that CpG islands located in promoters versus exons display marked differences in the levels of acetylation of associated histone H3, suggesting that chromatin remodeling can be achieved by methylation-independent processes and perhaps explaining why non-promoter CpG islands are more susceptible to de novo methylation than promoter islands. PMID:11713309

  13. Kalirin Binds the NR2B Subunit of the NMDA Receptor, Altering Its Synaptic Localization and Function

    KAUST Repository

    Kiraly, D. D.

    2011-08-31

    The ability of dendritic spines to change size and shape rapidly is critical in modulating synaptic strength; these morphological changes are dependent upon rearrangements of the actin cytoskeleton. Kalirin-7 (Kal7), a Rho guanine nucleotide exchange factor localized to the postsynaptic density (PSD), modulates dendritic spine morphology in vitro and in vivo. Kal7 activates Rac and interacts with several PSD proteins, including PSD-95, DISC-1, AF-6, and Arf6. Mice genetically lacking Kal7 (Kal7KO) exhibit deficient hippocampal long-term potentiation (LTP) as well as behavioral abnormalities in models of addiction and learning. Purified PSDs from Kal7KO mice contain diminished levels of NR2B, an NMDA receptor subunit that plays a critical role in LTP induction. Here we demonstrate that Kal7KO animals have decreased levels of NR2B-dependent NMDA receptor currents in cortical pyramidal neurons as well as a specific deficit in cell surface expression of NR2B. Additionally, we demonstrate that the genotypic differences in conditioned place preference and passive avoidance learning seen in Kal7KO mice are abrogated when animals are treated with an NR2B-specific antagonist during conditioning. Finally, we identify a stable interaction between the pleckstrin homology domain of Kal7 and the juxtamembrane region of NR2B preceding its cytosolic C-terminal domain. Binding of NR2B to a protein that modulates the actin cytoskeleton is important, as NMDA receptors require actin integrity for synaptic localization and function. These studies demonstrate a novel and functionally important interaction between the NR2B subunit of the NMDA receptor and Kalirin, proteins known to be essential for normal synaptic plasticity.

  14. A Western Corn Rootworm Cadherin-like Protein is not Involved in the Binding and Toxicity of Cry34/35Ab1 and Cry3Aa Bacillus Thuringiensis Proteins

    Science.gov (United States)

    The western corn rootworm (WCR) Diabrotica virgifera virgifera LeConte is an important insect pest of corn. Bacillus thuringiensis (Bt) insecticidal proteins Cry3Aa (as mCry3A) and Cry34Ab1/Cry35Ab1 have been expressed in transgenic corn and are used to control the insect in the U.S. To date, there ...

  15. Prediction of altered 3'- UTR miRNA-binding sites from RNA-Seq data: the swine leukocyte antigen complex (SLA as a model region.

    Directory of Open Access Journals (Sweden)

    Marie-Laure Endale Ahanda

    Full Text Available THE SLA (swine leukocyte antigen, MHC: SLA genes are the most important determinants of immune, infectious disease and vaccine response in pigs; several genetic associations with immunity and swine production traits have been reported. However, most of the current knowledge on SLA is limited to gene coding regions. MicroRNAs (miRNAs are small molecules that post-transcriptionally regulate the expression of a large number of protein-coding genes in metazoans, and are suggested to play important roles in fine-tuning immune mechanisms and disease responses. Polymorphisms in either miRNAs or their gene targets may have a significant impact on gene expression by abolishing, weakening or creating miRNA target sites, possibly leading to phenotypic variation. We explored the impact of variants in the 3'-UTR miRNA target sites of genes within the whole SLA region. The combined predictions by TargetScan, PACMIT and TargetSpy, based on different biological parameters, empowered the identification of miRNA target sites and the discovery of polymorphic miRNA target sites (poly-miRTSs. Predictions for three SLA genes characterized by a different range of sequence variation provided proof of principle for the analysis of poly-miRTSs from a total of 144 M RNA-Seq reads collected from different porcine tissues. Twenty-four novel SNPs were predicted to affect miRNA-binding sites in 19 genes of the SLA region. Seven of these genes (SLA-1, SLA-6, SLA-DQA, SLA-DQB1, SLA-DOA, SLA-DOB and TAP1 are linked to antigen processing and presentation functions, which is reminiscent of associations with disease traits reported for altered miRNA binding to MHC genes in humans. An inverse correlation in expression levels was demonstrated between miRNAs and co-expressed SLA targets by exploiting a published dataset (RNA-Seq and small RNA-Seq of three porcine tissues. Our results support the resource value of RNA-Seq collections to identify SNPs that may lead to altered mi

  16. Prediction of altered 3'- UTR miRNA-binding sites from RNA-Seq data: the swine leukocyte antigen complex (SLA) as a model region.

    Science.gov (United States)

    Endale Ahanda, Marie-Laure; Fritz, Eric R; Estellé, Jordi; Hu, Zhi-Liang; Madsen, Ole; Groenen, Martien A M; Beraldi, Dario; Kapetanovic, Ronan; Hume, David A; Rowland, Robert R R; Lunney, Joan K; Rogel-Gaillard, Claire; Reecy, James M; Giuffra, Elisabetta

    2012-01-01

    THE SLA (swine leukocyte antigen, MHC: SLA) genes are the most important determinants of immune, infectious disease and vaccine response in pigs; several genetic associations with immunity and swine production traits have been reported. However, most of the current knowledge on SLA is limited to gene coding regions. MicroRNAs (miRNAs) are small molecules that post-transcriptionally regulate the expression of a large number of protein-coding genes in metazoans, and are suggested to play important roles in fine-tuning immune mechanisms and disease responses. Polymorphisms in either miRNAs or their gene targets may have a significant impact on gene expression by abolishing, weakening or creating miRNA target sites, possibly leading to phenotypic variation. We explored the impact of variants in the 3'-UTR miRNA target sites of genes within the whole SLA region. The combined predictions by TargetScan, PACMIT and TargetSpy, based on different biological parameters, empowered the identification of miRNA target sites and the discovery of polymorphic miRNA target sites (poly-miRTSs). Predictions for three SLA genes characterized by a different range of sequence variation provided proof of principle for the analysis of poly-miRTSs from a total of 144 M RNA-Seq reads collected from different porcine tissues. Twenty-four novel SNPs were predicted to affect miRNA-binding sites in 19 genes of the SLA region. Seven of these genes (SLA-1, SLA-6, SLA-DQA, SLA-DQB1, SLA-DOA, SLA-DOB and TAP1) are linked to antigen processing and presentation functions, which is reminiscent of associations with disease traits reported for altered miRNA binding to MHC genes in humans. An inverse correlation in expression levels was demonstrated between miRNAs and co-expressed SLA targets by exploiting a published dataset (RNA-Seq and small RNA-Seq) of three porcine tissues. Our results support the resource value of RNA-Seq collections to identify SNPs that may lead to altered miRNA regulation patterns.

  17. ABS 497 ASH Tutorial / Uoptutorial

    OpenAIRE

    Latifa Baka

    2015-01-01

    For more course tutorials visit www.uoptutorial.com   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 ...

  18. ABS 497 ASH TUTORIAL / Uoptutorial

    OpenAIRE

    Remo

    2015-01-01

    For more course tutorials visit www.uoptutorial.com   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4...

  19. ABS 497 Courses/snaptutorial

    OpenAIRE

    charles

    2015-01-01

    For more classes visit www.snaptutorial.com   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 DQ ...

  20. An altered gp100 peptide ligand with decreased binding by TCR and CD8alpha dissects T cell cytotoxicity from production of cytokines and activation of NFAT

    Directory of Open Access Journals (Sweden)

    Niels eSchaft

    2013-09-01

    Full Text Available Altered peptide ligands (APLs provide useful tools to study T cell activation and potentially direct immune responses to improve treatment of cancer patients. To better understand and exploit APLs, we studied the relationship between APLs and T cell function in more detail. Here, we tested a broad panel of gp100(280-288 APLs with respect to T cell cytotoxicity, production of cytokines and activation of Nuclear Factor of Activated T cells (NFAT by human T cells gene-engineered with a gp100-HLA-A2-specific TCRalpha/beta. We demonstrated that gp100-specific cytotoxicity, production of cytokines, and activation of NFAT were not affected by APLs with single amino acid substitutions, except for an APL with an amino acid substitution at position 3 (APL A3, which did not elicit any T cell response. A gp100 peptide with a double amino acid mutation (APL S4S6 elicited T cell cytotoxicity and production of IFNgamma, and to a lesser extent TNFalpha, IL-4, and IL-5, but not production of IL-2 and IL-10, or activation of NFAT. Notably, TCR-mediated functions showed decreases in sensitivities for S4S6 versus gp100 wt peptide, which were minor for cytotoxicity but at least a 1000-fold more prominent for the production of cytokines. TCR-engineered T cells did not bind A3-HLA-A2, but did bind S4S6-HLA-A2 although to a lowered extent compared to wt peptide-HLA-A2. Moreover, S4S6-induced T cell function demonstrated an enhanced dependency on CD8alpha. Taken together, most gp100 APLs functioned as agonists, but A3 and S4S6 peptides acted as a null ligand and partial agonist, respectively. Our results further suggest that TCR-mediated cytotoxicity can be dissected from production of cytokines and activation of NFAT, and that the agonist potential of peptide mutants relates to the extent of binding by TCR and CD8alpha. These findings may facilitate the design of APLs to advance the study of T cell activation and their use for therapeutic applications.

  1. Distinct alterations in ATP-binding cassette transporter expression in liver, kidney, small intestine, and brain in adjuvant-induced arthritic rats.

    Science.gov (United States)

    Kawase, Atsushi; Norikane, Sari; Okada, Ayaka; Adachi, Mamiko; Kato, Yukio; Iwaki, Masahiro

    2014-08-01

    Pathophysiological changes of infection or inflammation are associated with alterations in the production of numerous absorption, distribution, metabolism and excretion-related proteins. However, little information is available on the effects of inflammation on the expression levels and activities of ATP-binding cassette (ABC) transporters. We examined the effect of acute (on day 7) and chronic (on day 21) inflammation on the expression of ABC transporters in some major tissues in rat. Adjuvant-induced arthritis (AA) in rats was used as an animal model for inflammation. The mRNA levels of mdr1a and mdr1b encoding P-glycoprotein (P-gp) decreased significantly in livers of AA rats on day 21. Hepatic protein levels of P-gp, Mrp2, and Bcrp decreased significantly in membranes but not homogenates of AA rats after 7 days and after 21 days of treatment with adjuvant. Contrary to liver, protein levels of P-gp and Mrp2, but not Bcrp in kidney, increased significantly in membranes. The biliary excretion of rhodamine 123 was decreased in rats with chronic inflammation owing to decreases in efflux activities of P-gp. Our results showed that the expression of transporters in response to inflammation was organ dependent. In particular, hepatic and renal P-gp and Mrp2 exhibited opposite changes in membrane protein levels.

  2. Verdivurdering av SAS AB

    OpenAIRE

    Gangås, Silje Garberg

    2013-01-01

    Formålet med denne mastergradsavhandlingen har vært å beregne den teoretiske verdien på det børsnoterte selskapet SAS AB og på bakgrunn av denne gi en handlingsanbefaling på selskapets aksje. Forskningsspørsmålet for oppgaven er utledet som følger: ”Hva er verdien av SAS AB?” SAS AB er inne i en fundamental omstillingsprosses hvor den nye strategien, 4XNG, ble presentert og påbegynt november 2012. Omstillingsprosessen innebærer blant annet en omfattende omstrukturering i organisasjonen ...

  3. Resistance to juvenile hormone and an insect growth regulator in Drosophila is associated with an altered cytosolic juvenile hormone-binding protein

    International Nuclear Information System (INIS)

    The Met mutant of Drosophila melanogaster is highly resistant to juvenile hormone III (JH III) or its chemical analog, methoprene, an insect growth regulator. Five major mechanisms of insecticide resistance were examined in Met and susceptible Met+ flies. These two strains showed only minor differences when penetration, excretion, tissue sequestration, or metabolism of [3H]JH III was measured. In contrast, when we examined JH III binding by a cytosolic binding protein from a JH target tissue, Met strains had a 10-fold lower binding affinity than did Met+ strains. Studies using deficiency-bearing chromosomes provide strong evidence that the Met locus controls the binding protein characteristics and may encode the protein. These studies indicate that resistance in Met flies results from reduced binding affinity of a cytosolic binding protein for JH III

  4. Knock-down of methyl CpG-binding protein 2 (MeCP2 causes alterations in cell proliferation and nuclear lamins expression in mammalian cells

    Directory of Open Access Journals (Sweden)

    Babbio Federica

    2012-07-01

    Full Text Available Abstract Background MeCP2 (CpG-binding protein 2 is a nuclear multifunctional protein involved in several cellular processes, like large-scale chromatin reorganization and architecture, and transcriptional regulation. In recent years, a non-neuronal role for MeCP2 has emerged in cell growth and proliferation. Mutations in the MeCP2 gene have been reported to determine growth disadvantages in cultured lymphocyte cells, and its functional ablation suppresses cell growth in glial cells and proliferation in mesenchymal stem cells and prostate cancer cells. MeCP2 interacts with lamin B receptor (LBR and with Heterochromatin Protein 1 (HP1 at the nuclear envelope (NE, suggesting that it could be part of complexes involved in attracting heterochromatin at the nuclear periphery and in mediating gene silencing. The nuclear lamins, major components of the lamina, have a role in maintaining NE integrity, in orchestrating mitosis, in DNA replication and transcription, in regulation of mitosis and apoptosis and in providing anchoring sites for chromatin domains. In this work, we inferred that MeCP2 might have a role in nuclear envelope stability, thereby affecting the proliferation pattern of highly proliferating systems. Results By performing knock-down (KD of MeCP2 in normal murine (NIH-3 T3 and in human prostate transformed cells (PC-3 and LNCaP, we observed a strong proliferation decrease and a defect in the cell cycle progression, with accumulation of cells in S/G2M, without triggering a strong apoptotic and senescent phenotype. In these cells, KD of MeCP2 evidenced a considerable decrease of the levels of lamin A, lamin C, lamin B1 and LBR proteins. Moreover, by confocal analysis we confirmed the reduction of lamin A levels, but we also observed an alteration in the shape of the nuclear lamina and an irregular nuclear rim. Conclusions Our results that indicate reduced levels of NE components, are consistent with a hypothesis that the deficiency of Me

  5. Regional distribution and alterations of lectin binding to colorectal mucin in mucosal biopsies from controls and subjects with inflammatory bowel diseases.

    OpenAIRE

    Jacobs, L R; Huber, P W

    1985-01-01

    Glycoconjugate composition of colorectal goblet cell mucin was characterized according to the anatomical distribution of lectin-binding sites in mucosal biopsies from 35 control subjects and 55 patients with inflammatory bowel disease. 24 of the controls had mucosal inflammation on biopsy, without clinical evidence of inflammatory bowel disease. These inflamed controls showed a similar rate of presence of lectin-binding sites as the normal noninflamed group. In the controls, the frequency of ...

  6. Tobacco plants expressing the Cry1AbMod toxin suppress tolerance to Cry1Ab toxin of Manduca sexta cadherin-silenced larvae.

    Science.gov (United States)

    Porta, Helena; Jiménez, Gladys; Cordoba, Elizabeth; León, Patricia; Soberón, Mario; Bravo, Alejandra

    2011-07-01

    Cry toxins produced by Bacillus thuringiensis bacteria are insecticidal proteins used worldwide in the control of different insect pests. Alterations in toxin-receptor interaction represent the most common mechanism to induce resistance to Cry toxins in lepidopteran insects. Cry toxins bind with high affinity to the cadherin protein present in the midgut cells and this interaction facilitates the proteolytic removal of helix α-1 and pre-pore oligomer formation. Resistance to Cry toxins has been linked with mutations in the cadherin gene. One strategy effective to overcome larval resistance to Cry1A toxins is the production of Cry1AMod toxins that lack helix α-1. Cry1AMod are able to form oligomeric structures without binding to cadherin receptor and were shown to be toxic to cadherin-silenced Manduca sexta larvae and Pectinophora gossypiella strain with resistance linked to mutations in a cadherin gene. We developed Cry1AbMod tobacco transgenic plants to analyze if Cry1AMod toxins can be expressed in transgenic crops, do not affect plant development and are able to control insect pests. Our results show that production of the Cry1AbMod toxin in transgenic plants does not affect plant development, since these plants exhibited healthy growth, produced abundant seeds, and were virtually undistinguishable from control plants. Most importantly, Cry1AbMod protein produced in tobacco plants retains its functional toxic activity against susceptible and tolerant M. sexta larvae due to the silencing of cadherin receptor by RNAi. These results suggest that CryMod toxins could potentially be expressed in other transgenic crops to protect them against both toxin-susceptible and resistant lepidopteran larvae affected in cadherin gene. PMID:21621616

  7. Alpha-synuclein gene deletion decreases brain palmitate uptake and alters the palmitate metabolism in the absence of alpha-synuclein palmitate binding

    DEFF Research Database (Denmark)

    Golovko, Mikhail Y; Færgeman, Nils J.; Cole, Nelson B;

    2005-01-01

    Alpha-synuclein is an abundant protein in the central nervous system that is associated with a number of neurodegenerative disorders, including Parkinson's disease. Its physiological function is poorly understood, although recently it was proposed to function as a fatty acid binding protein. To b....... Thus, alpha-synuclein has effects on 16:0 uptake and metabolism similar to those of an FABP, but unlike FABP, it does not directly bind 16:0; hence, the mechanism underlying these effects is different from that of a classical FABP....

  8. IgG Conformer's Binding to Amyloidogenic Aggregates.

    Directory of Open Access Journals (Sweden)

    Monichan Phay

    Full Text Available Amyloid-reactive IgGs isolated from pooled blood of normal individuals (pAbs have demonstrated clinical utility for amyloid diseases by in vivo targeting and clearing amyloidogenic proteins and peptides. We now report the following three novel findings on pAb conformer's binding to amyloidogenic aggregates: 1 pAb aggregates have greater activity than monomers (HMW species > dimers > monomers, 2 pAbs interactions with amyloidogenic aggregates at least partially involves unconventional (non-CDR interactions of F(ab regions, and 3 pAb's activity can be easily modulated by trace aggregates generated during sample processing. Specifically, we show that HMW aggregates and dimeric pAbs present in commercial preparations of pAbs, intravenous immunoglobulin (IVIg, had up to ~200- and ~7-fold stronger binding to aggregates of Aβ and transthyretin (TTR than the monomeric antibody. Notably, HMW aggregates were primarily responsible for the enhanced anti-amyloid activities of Aβ- and Cibacron blue-isolated IVIg IgGs. Human pAb conformer's binding to amyloidogenic aggregates was retained in normal human sera, and mimicked by murine pAbs isolated from normal pooled plasmas. An unconventional (non-CDR component to pAb's activity was indicated from control human mAbs, generated against non-amyloid targets, binding to aggregated Aβ and TTR. Similar to pAbs, HMW and dimeric mAb conformers bound stronger than their monomeric forms to amyloidogenic aggregates. However, mAbs had lower maximum binding signals, indicating that pAbs were required to saturate a diverse collection of binding sites. Taken together, our findings strongly support further investigations on the physiological function and clinical utility of the inherent anti-amyloid activities of monomeric but not aggregated IgGs.

  9. A portion of heifers attaining “early puberty” do not display estrus, are anovulatory and have altered sex hormone binding globulin concentrations

    Science.gov (United States)

    Cows with excess androstenedione (High A4) in the follicular fluid of dominant follicles attain puberty earlier than their low androstenedione counterparts. Furthermore, High A4 cows are anovulatory (chronic or sporadic) and have lower Sex Hormone Binding Globulin (SHBG) compared to Low A4 ovulator...

  10. Alterations of retinol-binding protein 4 species in patients with different stages of chronic kidney disease and their relation to lipid parameters

    DEFF Research Database (Denmark)

    Henze, Andrea; Frey, Simone K; Raila, Jens;

    2010-01-01

    Retinol-binding protein 4 (RBP4) is elevated in patients with chronic kidney disease (CKD) and has been discussed as marker of kidney function. In addition to an elevated concentration, the existence of truncated RBP4 species, RBP4-L (truncated at last C-terminal leucine) and RBP4-LL (truncated...

  11. A Functional Variant at the miR-214 Binding Site in the Methylenetetrahydrofolatereductase Gene Alters Susceptibility to Gastric Cancer in a Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Qiaoyun Chen

    2015-05-01

    Full Text Available Background and Aims: Single nucleotide polymorphisms in miRNA binding sites, which are located in mRNA 3' untranslated regions (3'-UTRs, were recently found to influence microRNA-target interactions. Specifically, such polymorphisms can modulatebinding affinity or create or destroy miRNA-binding sites; such variants have also been found to be associated with cancer risk. In this study, we explored the effect of a functional variant at the miR-214 binding site in the methylenetetrahydrofolate reductase gene (rs114673809 on gastric cancer (GC risk in a hospital-based case-control study in a Chinese Han population. Methods and Results: We genotyped the rs114673809 polymorphism in 345 gastric cancer patients and 376 cancer-free controls using the polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP technique. The functions of rs114673809 were investigated using a luciferase activity assay and validated by immunoblotting. We found that participants carrying the rs114673809 AA genotype or A allele had a significantly increased risk of gastric cancer (OR = 1.667, 95% CI = 1.044-2.660, P = 0.034; OR = 1.261, 95% CI = 1.017-1.563, P = 0.037, respectively compared to those carrying the GG genotype and G allele. In addition, rs114673809 modified the binding of hsa-miR-214 to MTHFR as well as MTHFR protein levels in gastric cancer patients. Conclusion: Our data suggested that rs114673809, which is located at the miR-214 binding site in the 3'-UTR of MTHFR, may play an important role in the development of gastric cancer in a Chinese Han population.

  12. Replacement of the C-terminal tetrapeptide (314PAPV317 to 314SSSM317) in interferon regulatory factor-2 alters its N-terminal DNA-binding activity

    Indian Academy of Sciences (India)

    Krishna Prakash; Pramod C Rath

    2010-12-01

    Interferon regulatory factor-2 (IRF-2) is an important transcription factor involved in cell growth regulation, immune response and cancer. IRF-2 can function as a transcriptional repressor and activator depending on its DNA-binding activity and protein–protein interactions. We compared the amino acid sequences of IRF-2 and found a C-terminal tetrapeptide (314PAPV317) of mouse IRF-2 to be different (314SSSM317) from human IRF-2. Recombinant GST-IRF-2 with 314PAPV317 (wild type) and 314SSSM317 (mutant) expressed in Escherichia coli were assessed for DNA-binding activity with 32P-(GAAAGT)4 by electrophoretic mobility shift assay (EMSA). Wild type- and mutant GST-IRF-2 showed similar expression patterns and immunoreactivities but different DNA-binding activities. Mutant (mt) IRF-2 formed higher-molecular-mass, more and stronger DNA–protein complexes in comparison to wild type (wt) IRF-2. Anti-IRF-2 antibody stabilized the DNA–protein complexes formed by both wt IRF-2 and mt IRF-2, resolving the differences. This suggests that PAPV and SSSM sequences at 314-317 in the C-terminal region of mouse and human IRF-2 contribute to conformation of IRF-2 and influence DNA-binding activity of the N-terminal region, indicating intramolecular interactions. Thus, evolution of IRF-2 from murine to human genome has resulted in subtle differences in C-terminal amino acid motifs, which may contribute to qualitative changes in IRF-2-dependent DNA-binding activity and gene expression.

  13. Plant Recycling for Molecular Biofarming to Produce Recombinant Anti-cancer mAb

    Directory of Open Access Journals (Sweden)

    Deuk-Su Kim

    2016-07-01

    Full Text Available The expression and glycosylation patterns of anti-colorectal cancer therapeutic monoclonal antibody (mAb CO17-1A recognizing the tumor-associated antigen GA733-2, expressed in human colorectal carcinoma cells, were observed in the leaf and stem tissues of primary (T2; 0 cycle secondary (1 cycle, and tertiary (2 cycle growths of seedlings obtained from the stem cut of T2 plants. The bottom portion of the stem of T2 seedlings was cut to induce the 1 cycle shoot growth, which was again cut to induce the 2 cycle shoot growth. In the 1 and 2 cycle growths, the periods for floral organ formation was shorter (35 days than that (100 days for the 0 cycle growth. The genes of heavy and light chains of mAb CO17-1A existed at the top, middle, and basal portions of the leaves and stem obtained from the 0, 1, and 2 cycle plants. The protein levels in the leaves and stem tissues from the 1 and 2 cycles were similar to those in the tissues from the 0 cycle. The glycosylation level and pattern in the leaf and stem did not alter dramatically over the different cycles. Surface plasmon resonance (SPR confirmed that mAbs CO17-1A obtained from leaf and stem tissues of the 0, 1, and 2 cycles had similar binding affinity for the GA733-2 antigen. These data suggest that the shoot growth by bottom stem cutting is applicable to speed up the growth of plant biomass expressing anti-colorectal cancer mAb without variation of expression, glycosylation, and functionality.

  14. MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression.

    Directory of Open Access Journals (Sweden)

    Steven W Paugh

    2016-02-01

    Full Text Available MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10(-16 for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription.

  15. MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression.

    Science.gov (United States)

    Paugh, Steven W; Coss, David R; Bao, Ju; Laudermilk, Lucas T; Grace, Christy R; Ferreira, Antonio M; Waddell, M Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F; Panetta, John C; Wilkinson, Mark R; Pui, Ching-Hon; Naeve, Clayton W; Uberbacher, Edward C; Bonten, Erik J; Evans, William E

    2016-02-01

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, ptriplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

  16. Binding of the Respiratory Chain Inhibitor Antimycin to theMitochondrial bc1 Complex: A New Crystal Structure Reveals an AlteredIntramolecular Hydrogen-Bonding Pattern

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Li-shar; Cobessi, David; Tung, Eric Y.; Berry, Edward A.

    2005-05-10

    Antimycin A (antimycin), one of the first known and most potent inhibitors of the mitochondrial respiratory chain, binds to the quinone reduction site of the cytochrome bc1 complex.Structure-activity-relationship studies have shown that the N-formylamino-salicyl-amide group is responsible for most of the binding specificity, and suggested that a low pKa for the phenolic OH group and an intramolecular H-bond between that OH and the carbonyl O of the salicylamide linkage are important. Two previous X-ray structures of antimycin bound to vertebrate bc1 complex gave conflicting results. A new structure reported here of the bovine mitochondrial bc1 complex at 2.28Angstrom resolution with antimycin bound, allows us for the first time to reliably describe the binding of antimycin and shows that the intramolecular hydrogen bond described in solution and in the small-molecule structure is replaced by one involving the NH rather than carbonyl O of the amide linkage, with rotation of the amide group relative to the aromatic ring. The phenolic OH and formylamino N form H-bonds with conserved Asp228 of cyt b, and the formylamino O H-bonds via a water molecule to Lys227. A strong density the right size and shape for a diatomic molecule is found between the other side of the dilactone ring and the alpha-A helix.

  17. ABS 497 ASH Tutorial/Uoptutorial

    OpenAIRE

    Kathi

    2015-01-01

    ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 DQ 2 Problems of Adolescence ABS 497 Week 5 DQ Macro Social Systems...

  18. Hyperspectral surface materials map of quadrangles 3664 and 3764, Char Shengo (123), Shibirghan (124), Jalajin (117), and Kham-Ab (118) quadrangles, Afghanistan, showing carbonates, phyllosilicates, sulfates, altered minerals, and other materials

    Science.gov (United States)

    Kokaly, Raymond F.; King, Trude V.V.; Hoefen, Todd M.; Livo, Keith E.; Johnson, Michaela R.; Giles, Stuart A.

    2013-01-01

    This map shows the spatial distribution of selected carbonates, phyllosilicates, sulfates, altered minerals, and other materials derived from analysis of airborne HyMap™ imaging spectrometer (hyperspectral) data of Afghanistan collected in late 2007. The map is one in a series of U.S. Geological Survey/Afghanistan Geological Survey quadrangle maps covering Afghanistan. Flown at an altitude of 50,000 feet (15,240 meters (m)), the HyMap™ imaging spectrometer measured reflected sunlight in 128 channels, covering wavelengths between 0.4 and 2.5 μm. The data were georeferenced, atmospherically corrected and converted to apparent surface reflectance, empirically adjusted using ground-based reflectance measurements, and combined into a mosaic with 23-m pixel spacing. Variations in water vapor and dust content of the atmosphere, in solar angle, and in surface elevation complicated correction; therefore, some classification differences may be present between adjacent flight lines. The reflectance spectrum of each pixel of HyMap™ imaging spectrometer data was compared to the reference materials in a spectral library of minerals, vegetation, water, and other materials. Minerals occurring abundantly at the surface and those having unique spectral features were easily detected and discriminated, while minerals having slightly different compositions but similar spectral features were less easily discriminated; thus, some map classes consist of several minerals having similar spectra, such as “Epidote or chlorite.” A designation of “Not classified” was assigned to the pixel when there was no match with reference spectra.

  19. The AB Staff Plan

    CERN Document Server

    Boillot, J; Delahaye, J P; Myers, S; CERN. Geneva. AB Department

    2003-01-01

    The present report summarises the staff plan of the newly created Accelerators and Beams (AB) Division following the restructuring of the Accelerator Sector and covering the period 2003 to 2010. It underlines the refocusing of the staff on priority work, especially the LHC Project and is coherent with the recently adopted CERN Long Term Plan (LTP). It compares the requested and available manpower (both staff and industrial support) for each Project, Programme and Activity (PPA) split in work packages and highlights the missing manpower for each category of personnel.

  20. The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves.

    Directory of Open Access Journals (Sweden)

    Rui An

    Full Text Available Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues. We are interested in dissecting these regulatory circuits genetically and report here the isolation of two Arabidopsis dominant mutants, abnormal shoot5-1D (abs5-1D and abs7-1D identified through activation tagging screens. Both abs5-1D and abs7-1D display an intriguing upwardly curly leaf phenotype. Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively. Protoplast transient expression assays confirmed that both ABS5/T5L1 and ABS7/MYB101 are targeted to the nucleus. Interestingly, the expression domains of auxin response reporter DR5::GUS were abnormal in leaves of abs5-1D and ABS5/T5L1 over-expression lines. Moreover, cotyledon venation analysis showed that more areoles and free-ending veins are formed in abs5-1D. We found that the epidermis-specific expressions of ABS5/T5L1 or ABS7/MYB101 driven by the Arabidopsis Meristem Layer 1 promoter (PAtML1 were sufficient to recapitulate the curly leaf phenotype of abs5-1D or abs7-1D. In addition, PAtML1::ABS5 lines exhibited similar changes in DR5::GUS expression patterns as those found in 35S-driven ABS5/T5L1 over-expression lines. Our work demonstrated that enhanced expressions of two transcription factors, ABS5/T5L1 and ABS7/MYB101, are able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis.

  1. Alterations in benzo(A)pyrene metabolism and in vivo binding to hepatic DNA in rats red diets containing menhaden oil

    Energy Technology Data Exchange (ETDEWEB)

    Wade, A.E.; Dharwadkar, S.

    1987-01-01

    Polyunsaturated fatty acids of the omega-6 type have been shown to support the mixed function oxidases (MFO) responsible for carcinogen activation and to promote tumorigenesis in laboratory animals. The omega-3 fatty acids contained in menhaden oil (MO) have been shown to enhance MFO activity and increase the binding of Benzo(a)pyrene (B(a)P) metabolites to calf thymus DNA in an in vitro microsomal system. Rats fed two levels of MO (0.5% and 20%) for 11 days received a single i.p. dose of (/sup 3/H)B(a)P (5 m Ci/kg) dissolved in DMSO. At selected time intervals thereafter rats were killed, blood withdrawn, livers removed and DNA extracted. Hepatic microsomes were recovered from control rats on each diet at the time of B(a)P administration to assess MFO activities. Binding of B(a)P to DNA was higher in rats fed the 20% MO diet suggesting an increased rate of B(a)P activation. Blood levels of B(a)P were elevated at 16 and 24 hours post B(a)P, however no differences in urine concentrations were observed. Elevations in concentration of cytochrome P-450, ethoxycoumarin dealkylase, and glutathione S-transferase suggest that omega-3 fatty acids of menhaden fish oil support MFO related reactions not unlike the omega-6 fatty acids.

  2. Identification of a 34 kDa protein altered in the LF-1 mutant as the herbicide-binding D1 protein of photosystem II

    International Nuclear Information System (INIS)

    The LF-1 mutant of Scenedesmus has a complete block on the oxidizing side of its PSII reaction center. However, the reaction center as well as the reducing side of PSII is fully functional in this mutant. Compared to the wildtype (WT) the only detected protein difference in the PSII complex of LF-1 is the change in mobility of a 34 kDa protein to 36 kDa. This protein has been implicated to have a major role in Mn-binding and water-oxidation. The authors have recently shown that photoaffinity labeling of thylakoids with azido-[14C]-atrazine tags the 34 kDa protein in WT and the 36 kDa protein in LF-1. It has been shown that the azido-atrazine labeled protein, called D1, functions in herbicide binding and Q/sub A/ to Q/sub B/ electron transfer on the reducing side of PSII. Polyclonal antibodies directed against the D1 protein of Amaranthus hybridus (Ohad, et al., EMBOJ 1985) were found to recognize the Scenedesmus 34 kDa (WT) and 36 kDa (LF-1) proteins. The implied dual function for the D1 protein on the reducing as well as the oxidizing side of PSII reaction center will be discussed

  3. Analysis of human CD36 gene sequence alterations in the oxidized low-density lipoprotein-binding region using denaturing high-performance liquid chromatography.

    Science.gov (United States)

    Rać, Monika Ewa; Suchy, Janina; Kurzawski, Grzegorz; Safranow, Krzysztof; Jakubowska, Katarzyna; Olszewska, Maria; Garanty-Bogacka, Barbara; Rać, Michał; Poncyljusz, Wojciech; Chlubek, Dariusz

    2010-08-01

    Denaturing high-performance liquid chromatography (DHPLC) has been employed as a prescreening tool to reduce the amount of DNA sequencing. It could be a simple and cost-effective screening method for mutations and polymorphisms in exons 4, 5, and 6 of the CD36 gene, which encode the protein region responsible for the removal of oxidized low-density lipoprotein. Genomic DNA was isolated from 306 Caucasian infants of Polish origin. Six single-nucleotide substitutions were detected by DHPLC and confirmed by direct sequencing. The A591T, G550A, and C572T alterations have not been described so far. Each of two nonsynonymous substitutions (Asp184Asn, Pro191Leu) was found in one subject (0.2% minor allele frequency). The results suggest that nonsynonymous alterations in the analyzed CD36 region are rare in Caucasians. DHPLC is a specific and cost-effective technique that may prove to be particularly useful for the identification of polymorphisms and mutations in the CD36 gene. PMID:20722468

  4. AB Manpower Plan 2007

    CERN Document Server

    Myers, Stephen

    2007-01-01

    The present exercise is not as such a "manpower plan" but a purely budgetary comparison of known plus requested resources with the known commitments over the period 2007-2012. From a purely budgetary point of view, AB will have the capacity to maintain all those recently hired staff who fulfill the criteria for long term employment at CERN. Following this budgetary exercise, AB proposes to perform a CERN-wide staff work plan so as to compare the manpower available to the quantity of work to be done in the totality of the work-packages. If there is a significant mismatch between these two quantities then we propose the following measures which would create personnel economies and allow us to redress the mismatch by increased recruitment: a new job severance scheme; CERN restructuring; use of the new CERN-ITER agreement; more flexibility in transfers from Materials to Personnel budgets. Failing this a re-examination of possible closure of lower priority facilities may be needed.

  5. ABS 497 ASH Tutorial Course/Uoptutorial

    OpenAIRE

    thanu

    2015-01-01

    For More Course Tutorials Visit www.uoptutorial.com   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 ...

  6. Monoclonal Anti—CD4 Antibody MT310 Binds HIV-1 gp120 Binding Site on CD4

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Tests show the monoclonal anti—CD4 antibody (mAb) MT310 recognizes the gp120-binding site on CD4 as part of its mechanism for strongly inhibiting human immunodeficiency virus type 1 (HIV-1) infection of CD4+ T cells. In competition tests, mAb MT310 and mAb Leu3a (an anti-CD4 mAb recognizing the gp120-binding site) all inhibited gp120-binding to CD4+ T lymphocytes, while mAb MT405 did not. This result suggests that MT310, like Leu3a, recognizes the gp120-binding site on CD4. To further confirm whether MT310 recognizes the gp120-binding site on CD4, we prepared rabbit anti-idiotypic antisera (Ab2) against MT310 (Ab1). The anti-idiotypic antisera against MT310 inhibited binding of MT310 and Leu3a to human CD4+ T lymphocytes, but did not block binding of MT151 with the second domain of CD4, while rabbit anti-idiotypic antisera to MT151 could block binding of itself to these cells, but could not inhibit the binding of MT310 and Leu3a, further indicating that MT310 recognized the gp120-binding site on CD4.

  7. Integrated multiplex ligation dependent probe amplification (MLPA) assays for the detection of alterations in the HEXB, GM2A and SMARCAL1 genes to support the diagnosis of Morbus Sandhoff, M. Tay-Sachs variant AB and Schimke immuno-osseous dysplasia in humans.

    Science.gov (United States)

    Sobek, Anna K U; Evers, Christina; Dekomien, Gabriele

    2013-02-01

    Multiplex ligation dependent probe amplification (MLPA) assays were designed for the genes HEXB (OMIM: 606873), GM2A (OMIM: 613109) and SMARCAL1 (OMIM: 606622) of humans. Two sets of synthetic MLPA probes for these coding exons were tested. Changes in copy numbers were detected as well as single nucleotide polymorphisms (SNPs) by complementary DNA sequence analyses. The MLPA method was shown to be reliable for mutation detection and identified five published and 12 new mutations. In all cases from a Morbus Sandhoff cohort of patients, exclusively one variation in copy number was observed and linked to a nucleotide alteration called c.1614-14C>A. This deletion comprised exons 1-5. One of these cases is described in detail. Deletions were neither detected in the GM2A nor the SMARCAL1 genes. The MLPA assays complement routine diagnostics for M. Sandhoff (OMIM: 268800), M. Tay-Sachs variant AB (OMIM: 272750) and Schimke immuno-osseous dysplasia (OMIM: 242900). PMID:23010210

  8. Effects of altered gravity on the expression of Calcium -binding and matrix proteins in the inner ear of developing fish following ∆g-expositions.

    Science.gov (United States)

    Hilbig, Reinhard; Hendrik Anken, Ralf; Weigele, Jochen

    The results of the Foton-M3 mission (OmegaHab) give evidence that the otoliths of the fish form OmegaHab were larger as compared to the ground control. Additionally the shape (raphe) and morphology especially the mode of crystallization of the otoliths were affected during growth in weightlessness. The reason for these changes is assumed to originate from changes in the composition of the otolith matrix and Ca-binding proteins (OMP). The OMPs play an important role in controlling the crystallization process and additionally the morphology of crystals, determining the crystallpolymorph and the strength of the crystals. The matrix of otoliths is a complex functional structure containing several calcium-binding proteins, structural proteins and protease inhibitors. Furthermore it is composed of otolith matrix protein-1, Otolin, Otoconin, SPARC and Neuroserpin, which is a specific expression in the otolth matrix for chichlid fish. During embryonic development of the fish inner ear, these proteins show a spacial and temporal expression pattern. The formation of the inner ear -including otoliths and sensory cells -starting from the otocyst-anlage -can be subdivided in several major developmental stages e.g. the forming of the otic cavity (stage 7/8), the tetha cell or seeding stage (stage 8, 9), the development of the semicircular channels (stage 12), the transition to further daily growth (post stage15) and the development of the third otolith, asteriscus (stage 23). These developmental phases contain different constitutions or involvements of matrix proteins. We investigated the matrixprotein composition of the chichlid fish Oreochromis mossambicus and found that the otolith matrix differentiate between other fishes. In this case some matrix proteins seem to be uniform in fishes, other known matrix proteins are lacking and we have also references to new candidates for matrix proteins chichlids. In this case we investigated the expression of the matrix proteins otolith

  9. Selective translational repression of HIV-1 RNA by Sam68DeltaC occurs by altering PABP1 binding to unspliced viral RNA

    Directory of Open Access Journals (Sweden)

    Soros Vanessa

    2008-10-01

    Full Text Available Abstract HIV-1 structural proteins are translated from incompletely spliced 9 kb and 4 kb mRNAs, which are transported to the cytoplasm by Crm1. It has been assumed that once in the cytoplasm, translation of incompletely spliced HIV-1 mRNAs occurs in the same manner as host mRNAs. Previous analyses have demonstrated that Sam68 and a mutant thereof, Sam68ΔC, have dramatic effects on HIV gene expression, strongly enhancing and inhibiting viral structural protein synthesis, respectively. While investigating the inhibition of incompletely spliced HIV-1 mRNAs by Sam68ΔC, we determined that the effect was independent of the perinuclear bundling of the viral RNA. Inhibition was dependent upon the nuclear export pathway used, as translation of viral RNA exported via the Tap/CTE export pathway was not blocked by Sam68ΔC. We demonstrate that inhibition of HIV expression by Sam68ΔC is correlated with a loss of PABP1 binding with no attendant change in polyadenosine tail length of the affected RNAs. The capacity of Sam68ΔC to selectively inhibit translation of HIV-1 RNAs exported by Crm1 suggests that it is able to recognize unique characteristics of these viral RNPs, a property that could lead to new therapeutic approaches to controlling HIV-1 replication.

  10. Altered Expression of Glycan-binding Protein in Hepatocellular Carcinoma Cell Lines%肝癌细胞系差异性表达的糖结合蛋白研究

    Institute of Scientific and Technical Information of China (English)

    钟耀刚; 秦鑫敏; 杜昊骐; 党刘毅; 李铮

    2014-01-01

    糖结合蛋白(t)lycan-binding protein,GBP)在细胞生命周期中扮演着重要角色,如细胞识别、运输、免疫、代谢、增殖分化及细胞间的相互作用等.目前,对GBP的改变对细胞生物过程产生影响的研究甚少.本研究用糖芯片技术对肝癌细胞系HepG2和正常肝细胞系L02表达的GBP进行研究;糖细胞化学验证确定差异表达GBP在肝癌细胞系中的变化和分布.结果显示,8种糖探针(如SL、LNT和GalNAc等)和5种糖探针(如Man、Man-9-Glycan,Xyl等)分别对应的GBP在HepG2细胞中表达上调或下调.糖细胞化学结果显示:GalNAc识别的GBPs主要表达在HepG2的胞膜、中央胞质、核周胞质区域,而在L02的相同区域表达减弱;NeuAc识别的GBPs主要表达在L02的胞膜区及核周胞质区,而在HepG2细胞的相同区域表达减弱.这些数据为寻找新的肝癌发病机制和抗肿瘤策略提供了有用信息.%Glycan-binding protein play important biological roles in biological processes.We use carbohydrate microarray to study the alteration of GBP in hepatocellular carcinoma cell line HepG2 and L02.Carbohydrate histochemistry was used to further validate the GBP and assess the distribution.As a result,8 carbohydrate probes (e.g.SL,LNT,and GalNAc) showed increased signal while 5 carbohydrate probes (e.g.Man,Man-9-Glycan,and Xyl) showed decreased signal in HepG2 compared with L02 cell line.Meanwhile,GalNAc staining showed moderate binding to the cytoplasma membrane,central cytoplasm,and perinuclear cytoplasm in the L02,and the binding intensified in the same regions of the HepG2.NeuAc staining showed moderate binding to the cytoplasma membrane,and perinuclear cytoplasm in the HepG2,and the binding intensified in the same regions of the L02.In conclusion,the precision alteration of GBP related to HepG2 may provide useful information to find new molecular mechanism of hepatocellular carcinoma and antitumor therapeutic strategies.

  11. Cytokines modulate the sensitivity of human fibroblasts to stimulation with insulin-like growth factor-I (IGF-I) by altering endogenous IGF-binding protein production.

    Science.gov (United States)

    Yateman, M E; Claffey, D C; Cwyfan Hughes, S C; Frost, V J; Wass, J A; Holly, J M

    1993-04-01

    Human dermal fibroblasts produce a number of insulin-like growth factor-binding proteins (IGFBPs) including the main circulating form, IGFBP-3. It has been suggested that the regulation of IGFBP secretion may play a major role in modulating insulin-like growth factor (IGF) bioactivity. We have quantified the effects of two cytokines, transforming growth factor-beta 1 (TGF-beta 1) and tumour necrosis factor-alpha (TNF-alpha) which have opposing actions on fibroblast IGFBP-3 production, and examined their subsequent role in IGF-I mitogenesis. TGF-beta 1 caused a dose-dependent increase in IGFBP-3 in serum-free fibroblast-conditioned media. TGF-beta 1 (1 microgram/l) resulted in immunoreactive IGFBP-3 levels reaching 286.5 +/- 22.4% of control after 20 h, the increase being confirmed by Western ligand blot. TNF-alpha caused a dose-dependent decrease in fibroblast IGFBP-3 secretion, 1 microgram TNF-alpha/l reducing IGFBP-3 levels to 32.1 +/- 11.% of control. This effect was not due to cytotoxicity and was not cell-density-dependent. Fibroblast proliferation was examined using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric cytochemical bioassay. The addition of IGF-I resulted in dose-dependent growth stimulation after 48 h, the effective range being 20-100 micrograms/l. The IGF-I analogue Long-R3-IGF-I which has little affinity for the IGFBPs was approximately 20-fold more potent in this assay, and was unaffected by exogenous IGFBP-3.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7684061

  12. A Functional 3'UTR Polymorphism (rs2235749) of Prodynorphin Alters microRNA-365 Binding in Ventral Striatonigral Neurons to Influence Novelty Seeking and Positive Reward Traits.

    Science.gov (United States)

    Egervari, Gabor; Jutras-Aswad, Didier; Landry, Joseph; Miller, Michael L; Anderson, Sarah Ann; Michaelides, Michael; Jacobs, Michelle M; Peter, Cyril; Yiannoulos, Georgia; Liu, Xun; Hurd, Yasmin L

    2016-09-01

    Genetic factors impact behavioral traits relevant to numerous psychiatric disorders and risk-taking behaviors, and different lines of evidence have indicated that discrete neurobiological systems contribute to such individual differences. In this study, we explored the relationship of genetic variants of the prodynorphin (PDYN) gene, which is enriched in the striatonigral/striatomesencephalic pathway, a key neuronal circuit implicated in positive 'Go' behavioral choice and action. Our multidisciplinary approach revealed that the single nucleotide polymorphism (SNP) rs2235749 (in high linkage disequilibrium with rs910080) modifies striatal PDYN expression via impaired binding of miR-365, a microRNA that targets the PDYN 3'-untranslated region (3'UTR), and is significantly associated to novelty- and reward-related behavioral traits in humans and translational animal models. Carriers of the rs2235749G allele exhibited increased levels of PDYN 3'UTR in vitro and had elevated mRNA expression in the medial nucleus accumbens shell (NAcSh) and caudate nucleus in postmortem human brains. There was an association of rs2235749 with novelty-seeking trait and a strong genotype-dose association with positive reinforcement behavior in control subjects, which differed in cannabis-dependent individuals. Using lentiviral miRZip-365 constructs selectively expressed in Pdyn-neurons of the NAcSh, we demonstrated that the Pdyn-miR365 interaction in the NAcSh directly influences novelty-seeking exploratory behavior and facilitates self-administration of natural reward. Overall, this translational study suggests that genetically determined miR-365-mediated epigenetic regulation of PDYN expression in mesolimbic striatonigral/striatomesencephalic circuits possibly contributes to novelty seeking and positive reinforcement traits.

  13. In vitro resistance selections for Plasmodium falciparum dihydroorotate dehydrogenase inhibitors give mutants with multiple point mutations in the drug-binding site and altered growth.

    Science.gov (United States)

    Ross, Leila S; Gamo, Francisco Javier; Lafuente-Monasterio, Maria José; Singh, Onkar M P; Rowland, Paul; Wiegand, Roger C; Wirth, Dyann F

    2014-06-27

    Malaria is a preventable and treatable disease; yet half of the world's population lives at risk of infection, and an estimated 660,000 people die of malaria-related causes every year. Rising drug resistance threatens to make malaria untreatable, necessitating both the discovery of new antimalarial agents and the development of strategies to identify and suppress the emergence and spread of drug resistance. We focused on in-development dihydroorotate dehydrogenase (DHODH) inhibitors. Characterizing resistance pathways for antimalarial agents not yet in clinical use will increase our understanding of the potential for resistance. We identified resistance mechanisms of Plasmodium falciparum (Pf) DHODH inhibitors via in vitro resistance selections. We found 11 point mutations in the PfDHODH target. Target gene amplification and unknown mechanisms also contributed to resistance, albeit to a lesser extent. These mutant parasites were often hypersensitive to other PfDHODH inhibitors, which immediately suggested a novel combination therapy approach to preventing resistance. Indeed, a combination of wild-type and mutant-type selective inhibitors led to resistance far less often than either drug alone. The effects of point mutations in PfDHODH were corroborated with purified recombinant wild-type and mutant-type PfDHODH proteins, which showed the same trends in drug response as the cognate cell lines. Comparative growth assays demonstrated that two mutant parasites grew less robustly than their wild-type parent, and the purified protein of those mutants showed a decrease in catalytic efficiency, thereby suggesting a reason for the diminished growth rate. Co-crystallography of PfDHODH with three inhibitors suggested that hydrophobic interactions are important for drug binding and selectivity.

  14. Subchronic treatment with phencyclidine in adolescence leads to impaired exploratory behavior in adult rats without altering social interaction or N-methyl-D-aspartate receptor binding levels.

    Science.gov (United States)

    Metaxas, A; Willems, R; Kooijman, E J M; Renjaän, V A; Klein, P J; Windhorst, A D; Donck, L Ver; Leysen, J E; Berckel, B N M van

    2014-11-01

    Although both the onset of schizophrenia and human phencyclidine (PCP) abuse typically present within the interval from adolescence to early adulthood, the majority of preclinical research employing the PCP model of schizophrenia has been conducted on neonatal or adult animals. The present study was designed to evaluate the behavioral and neurochemical sequelae of subchronic exposure to PCP in adolescence. Male 35-42-day-old Sprague Dawley rats were subcutaneously administered either saline (10 ml · kg(-1) ) or PCP hydrochloride (10 mg · kg(-1) ) once daily for a period of 14 days (n = 6/group). The animals were allowed to withdraw from treatment for 2 weeks, and their social and exploratory behaviors were subsequently assessed in adulthood by using the social interaction test. To examine the effects of adolescent PCP administration on the regulation of N-methyl-D-aspartate receptors (NMDARs), quantitative autoradiography was performed on brain sections of adult, control and PCP-withdrawn rats by using 20 nM (3) H-MK-801. Prior subchronic exposure to PCP in adolescence had no enduring effects on the reciprocal contact and noncontact social behavior of adult rats. Spontaneous rearing in response to the novel testing arena and time spent investigating its walls and floor were reduced in PCP-withdrawn animals compared with control. The long-term behavioral effects of PCP occurred in the absence of persistent deficits in spontaneous locomotion or self-grooming activity and were not mediated by altered NMDAR density. Our results document differential effects of adolescent PCP administration on the social and exploratory behaviors of adult rats, suggesting that distinct neurobiological mechanisms are involved in mediating these behaviors. PMID:24953757

  15. Bruksmakt och maktbruk : Robertsfors AB 1897-1968

    OpenAIRE

    Holmström, Per

    1988-01-01

    This thesis studies seven strategic decisions made in the family-owned forestry company Robertsfors AB, in Northern Sweden. During the present century Ro­bertsfors AB has developed from a patriarchally concern controlled into a capi­talistic industrial company. This also meant a radical change in the decision­making process. Two factors were decisive in this process: the managing direc­tor's values, and altered power relationships both within the company and exter­nally in relation to e g sta...

  16. abs417ashcoursesTutorial /uophelp

    OpenAIRE

    smith

    2015-01-01

    For more course tutorials visit www.uophelp.com     ABS 417 Week 1 DQ 1 ( The Power of Many )    ABS 417 Week 1 DQ 2 ( Social Change Model )    ABS 417 Week 2 DQ 1 ( Empowerment, Disempowerment and Social Change )   ABS 417 Week 2 DQ 2 ( Non-Profit vs. For-Profit Organizations )    ABS 417 Week 2 Assignment ( Reflection Paper )    ABS 417 Week 3 DQ 1 ( Social Problems )  &nb...

  17. Exchanging murine and human immunoglobulin constant chains affects the kinetics and thermodynamics of antigen binding and chimeric antibody autoreactivity.

    Directory of Open Access Journals (Sweden)

    Marcela Torres

    Full Text Available Mouse-human chimeric antibodies composed of murine variable (V and human (C chains are useful therapeutic reagents. Consequently, we investigated whether heterologous C-regions from mice and humans affected specificity and affinity, and determined the contribution of C(H glycosylation to antigen binding. The interaction of a 12-mer peptide mimetic with monoclonal antibody (mAb 18B7 to Cryptococcus neoformans glucuronoxylomannan, and its chimeric (ch and deglycosylated forms were studied by surface plasmon resonance. The equilibrium and rate association constants for the chAb were higher than for mAb 18B7. V region affinity was not affected by C(H region glycosylation whereas heterologous C region of the same isotype altered the Ab binding affinity and the specificity for self-antigens. Structural models displayed local differences that implied changes on the connectivity of residues. These findings suggest that V region conformational changes can be dictated by the C(H domains through an allosteric effect involving networks of highly connected amino acids.

  18. Tumor-promoting function of single nucleotide polymorphism rs1836724 (C3388T) alters multiple potential legitimate microRNA binding sites at the 3'-untranslated region of ErbB4 in breast cancer.

    Science.gov (United States)

    Bagheri, Fatemeh; Mesrian Tanha, Hamzeh; Mojtabavi Naeini, Marjan; Ghaedi, Kamran; Azadeh, Mansoureh

    2016-05-01

    ErbB4 can act as either a tumor-suppressor gene or an oncogene in breast cancer. Multiple genetic factors including single nucleotide polymorphisms (SNPs) affect gene expression patterns. Multiple 3'-untranslated region (3'-UTR) SNPs reside within the target binding site of microRNAs, which can strengthen or weaken binding to target genes. The present study aimed to predict potential 3'‑UTR variants of ErbB4 that alter the target binding site of microRNAs (miRNAs) and to clarify the association of the potential variant with the risk of developing breast cancer. In silico prediction was performed to identify potential functional SNPs within miRNA target binding sites in the 3'‑UTR of ErbB4. Thus, 146 patients and controls were genotyped using restriction fragment length polymorphism-polymerase chain reaction. In addition to the Cochran-Armitage test for trend, allele and genotype frequency differences were determined to investigate the association between rs1836724 and the susceptibility to breast cancer. Bioinformatics analysis identified rs1836724 to be a polymorphism in the seed region of four miRNA binding sites (hsa-miR335-5p, hsa-miR-28-5p, has‑miR‑708‑5p and has‑miR‑665), which may participate in the development of breast cancer. Logistic regression data indicated that the T allele of the polymorphism [OR (95% CI)=1.72 (1.056‑2.808), P=0.029] is associated with the risk of breast cancer. Using bioinformatics tools, a correlation was indicated between the presence of the T allele and a reduction in ErbB4 RNA silencing based on miRNA interaction. Furthermore, case subgroup data analysis revealed an association between the C/T genotype and an ER positive phenotype [OR (95% CI)=6.00 (1.082‑33.274), P=0.028] compared with the T/T genotype. ErbB4 and estrogen receptor 1 (ESR1) are regulated by identical miRNAs thus there may be a competition for binding sites. Due to this pattern, if the interaction between miRNAs with one gene is reduced, it

  19. Opstellen Aaltjes Beheersing Strategie (ABS)

    NARCIS (Netherlands)

    Beers, van T.G.

    2009-01-01

    Dit artikel gaat dieper in op het opstellen van een Aaltjes Beheersing Strategie (ABS): inventarisatie, preventie, vruchtwisseling en aanvullende maatregelen. Per onderdeel worden aandachtspunten genoemd en er worden tips gegeven.

  20. IFN-gamma and prostaglandin E2 inhibit IL-4-induced expression of Fc epsilon R2/CD23 on B lymphocytes through different mechanisms without altering binding of IL-4 to its receptor

    Energy Technology Data Exchange (ETDEWEB)

    Galizzi, J.P.; Cabrillat, H.; Rousset, F.; Menetrier, C.; de Vries, J.E.; Banchereau, J.

    1988-09-15

    Human rIL-4 specifically induces the expression of the low affinity receptor for IgE (Fc epsilon R2/CD23) on normal B cells and on the Burkitt lymphoma cell line Jijoye. IL-4 does not induce the generation of the second messenger cAMP in Jijoye cells. PGE2 (at 10(-7) M) was found to inhibit by 50% the IL-4 mediated Fc epsilon R2/CD23 induction on Jijoye cells. The PGE2 half maximum inhibitory concentration (1 nM) was comparable to that inducing a half maximal increase of intracellular cAMP (4nM PGE2). 8-bromo-cAMP (10(-3) M), forskolin (10(-5) M), and cholera toxin (100 ng/ml), which increase intracellular cAMP levels, also inhibited by 40 to 80% the IL-4 induced Fc epsilon R2/CD23 expression on Jijoye cells. PGE2 8-bromo-cAMP, forskolin, and cholera toxin also inhibited the IL-4-induced Fc epsilon R2/CD23 expression on normal B lymphocytes. Taken together these data suggest that PGE2 inhibits the IL-4 induced Fc epsilon R2/CD23 through an increase of intracellular cAMP. In contrast, IFN-gamma, which strongly inhibits IL-4-mediated Fc epsilon R2/CD23 expression on Jijoye cells, did not increase intracellular cAMP levels and thus probably acts through another mechanism. IFN-gamma and PGE2 did not inhibit binding of IL-4 to its receptor. It could be excluded that IFN-gamma and PGE2 were acting via an alteration/desensitization of the IL-4R inasmuch as 24 h pre-incubation of Jijoye cells with these agents affected neither the affinity of 125I-IL-4 for its receptor (Kd = 0.8 to 1.5 x 10(-10) M) nor the maximal number of binding sites per Jijoye cells (Bmax = 390 to 550). Furthermore, IFN-gamma and PGE2 did not affect the internalization and degradation of 125I-IL-4. These data demonstrate that PGE2 and IFN-gamma inhibit the IL-4-mediated induction of Fc epsilon R2/CD23 on B lymphocytes via different mechanisms that do not alter the interaction of IL-4 with its receptor.

  1. Prediction on Antigenic Epitope Characteristics of Bt Cry2Ab Protein in Transgenic Crops

    Institute of Scientific and Technical Information of China (English)

    Jierong GAO; Ying HE; Zehong ZOU; Ailin TAO; Yuncan AI

    2012-01-01

    Abstract [Objective] This study aimed to predict the structural characteristics of Bt Cry2Ab protein in transgenic crops with bioinformatic analysis to provide the theoreti- cal clues for design of antibody Cry2Ab. [Method] The amino acid sequence of Cry2Ab protein was searched from NCBI database. The B cell epitopes were pre- dicted with DNAStar. The binding affinity between Cry2Ab protein and MHC-II molecules was analyzed with NetMHCII 2.2 Server to predict the T cell epitopes. [Result] Prediction result suggested the potential B cell epitope of Cry2Ab locating in the region of 208-215. Analysis of the binding affinity between Cry2Ab and MHC-II molecules suggested the regions of 177-185, 299-307 and 255-263 were the po- tential T cell epitopes. Human with HLA-DRB10101 alleles and HLA-DRB10701 al- leles were more sensitive to Cry2Ab protein. [Conclusion] This study facilitates to un- derstand the structural characteristics of Cry2Ab protein and provides a new clue to improve the assessment method for potential allergenicity of genetically modified food.

  2. Preparation of F(ab')2 fragments of immunoglobulin G.

    Science.gov (United States)

    Killion, J J; Holtgrewe, E M

    1983-11-01

    We describe a simple protocol for the preparation of F(ab')2 fragments of immunoglobulin G, based upon the known Fc- binding properties of protein A-Sepharose. The fragment preparations of xenogeneic and allogeneic anti-IgG were noncytotoxic to intact target cells, and were able to block the cytotoxicity of intact antibody. This method should therefore be useful for functional studies not requiring biochemical homogeneity.

  3. Ab initio study of neutron drops with chiral Hamiltonians

    Directory of Open Access Journals (Sweden)

    H.D. Potter

    2014-12-01

    Full Text Available We report ab initio calculations for neutron drops in a 10 MeV external harmonic-oscillator trap using chiral nucleon–nucleon plus three-nucleon interactions. We present total binding energies, internal energies, radii and odd–even energy differences for neutron numbers N=2–18 using the no-core shell model with and without importance truncation. Furthermore, we present total binding energies for N=8,16,20,28,40,50 obtained in a coupled-cluster approach. Comparisons with quantum Monte Carlo results, where available, using Argonne v8′ with three-nucleon interactions reveal important dependences on the chosen Hamiltonian.

  4. Yeast killer toxin-like candidacidal Ab6 antibodies elicited through the manipulation of the idiotypic cascade.

    Science.gov (United States)

    Polonelli, Luciano; Beninati, Concetta; Teti, Giuseppe; Felici, Franco; Ciociola, Tecla; Giovati, Laura; Sperindè, Martina; Lo Passo, Carla; Pernice, Ida; Domina, Maria; Arigò, Milena; Papasergi, Salvatore; Mancuso, Giuseppe; Conti, Stefania; Magliani, Walter

    2014-01-01

    A mouse anti-anti-anti-idiotypic (Id) IgM monoclonal antibody (mAb K20, Ab4), functionally mimicking a Wyckerhamomyces anomalus (Pichia anomala) killer toxin (KT) characterized by fungicidal activity against yeasts presenting specific cell wall receptors (KTR) mainly constituted by β-1,3-glucan, was produced from animals presenting anti-KT Abs (Ab3) following immunization with a rat IgM anti-Id KT-like mAb (mAb K10, Ab2). MAb K10 was produced by immunization with a KT-neutralizing mAb (mAb KT4, Ab1) bearing the internal image of KTR. MAb K20, likewise mAb K10, proved to be fungicidal in vitro against KT-sensitive Candida albicans cells, an activity neutralized by mAb KT4, and was capable of binding to β-1,3-glucan. MAb K20 and mAb K10 competed with each other and with KT for binding to C. albicans KTR. MAb K20 was used to identify peptide mimics of KTR by the selection of phage clones from random peptide phage display libraries. Using this strategy, four peptides (TK 1-4) were selected and used as immunogen in mice in the form of either keyhole limpet hemocyanin (KLH) conjugates or peptide-encoding minigenes. Peptide and DNA immunization could induce serum Abs characterized by candidacidal activity, which was inhibited by laminarin, a soluble β-1,3-glucan, but not by pustulan, a β-1,6-glucan. These findings show that the idiotypic cascade can not only overcome the barrier of animal species but also the nature of immunogens and the type of technology adopted. PMID:25162681

  5. Yeast killer toxin-like candidacidal Ab6 antibodies elicited through the manipulation of the idiotypic cascade.

    Directory of Open Access Journals (Sweden)

    Luciano Polonelli

    Full Text Available A mouse anti-anti-anti-idiotypic (Id IgM monoclonal antibody (mAb K20, Ab4, functionally mimicking a Wyckerhamomyces anomalus (Pichia anomala killer toxin (KT characterized by fungicidal activity against yeasts presenting specific cell wall receptors (KTR mainly constituted by β-1,3-glucan, was produced from animals presenting anti-KT Abs (Ab3 following immunization with a rat IgM anti-Id KT-like mAb (mAb K10, Ab2. MAb K10 was produced by immunization with a KT-neutralizing mAb (mAb KT4, Ab1 bearing the internal image of KTR. MAb K20, likewise mAb K10, proved to be fungicidal in vitro against KT-sensitive Candida albicans cells, an activity neutralized by mAb KT4, and was capable of binding to β-1,3-glucan. MAb K20 and mAb K10 competed with each other and with KT for binding to C. albicans KTR. MAb K20 was used to identify peptide mimics of KTR by the selection of phage clones from random peptide phage display libraries. Using this strategy, four peptides (TK 1-4 were selected and used as immunogen in mice in the form of either keyhole limpet hemocyanin (KLH conjugates or peptide-encoding minigenes. Peptide and DNA immunization could induce serum Abs characterized by candidacidal activity, which was inhibited by laminarin, a soluble β-1,3-glucan, but not by pustulan, a β-1,6-glucan. These findings show that the idiotypic cascade can not only overcome the barrier of animal species but also the nature of immunogens and the type of technology adopted.

  6. An ab initio Non-Equilibrium Green Function Approach to Charge Transport: Dithiolethine

    Institute of Scientific and Technical Information of China (English)

    Alexander Schnurpfeil; SONG Bo; Martin Albrecht

    2006-01-01

    @@ We present a novel ab initio non-equilibrium approach to calculate the current across a molecular junction. The method rests on a wavefunction-based full ab initio description of the central region of the junction combined with a tight binding approximation for the electrodes in the frame of the Keldysh Green function formalism. Our procedure is demonstrated for a dithiolethine molecule located between silver electrodes. The main conducting channel is identified and the full current-voltage characteristic is calculated.

  7. Glycotope sharing between snail hemolymph and larval schistosomes: larval transformation products alter shared glycan patterns of plasma proteins.

    Science.gov (United States)

    Yoshino, Timothy P; Wu, Xiao-Jun; Liu, Hongdi; Gonzalez, Laura A; Deelder, André M; Hokke, Cornelis H

    2012-01-01

    Recent evidence supports the involvement of inducible, highly diverse lectin-like recognition molecules in snail hemocyte-mediated responses to larval Schistosoma mansoni. Because host lectins likely are involved in initial parasite recognition, we sought to identify specific carbohydrate structures (glycans) shared between larval S. mansoni and its host Biomphalaria glabrata to address possible mechanisms of immune avoidance through mimicry of elements associated with the host immunoreactivity. A panel of monoclonal antibodies (mABs) to specific S. mansoni glycans was used to identify the distribution and abundance of shared glycan epitopes (glycotopes) on plasma glycoproteins from B. glabrata strains that differ in their susceptibilities to infection by S. mansoni. In addition, a major aim of this study was to determine if larval transformation products (LTPs) could bind to plasma proteins, and thereby alter the glycotopes exposed on plasma proteins in a snail strain-specific fashion. Plasma fractions ( 100 kDa) from susceptible (NMRI) and resistant (BS-90) snail strains were subjected to SDS-PAGE and immunoblot analyses using mAB to LacdiNAc (LDN), fucosylated LDN variants, Lewis X and trimannosyl core glycans. Results confirmed a high degree of glycan sharing, with NMRI plasma exhibiting a greater distribution/abundance of LDN, F-LDN and F-LDN-F than BS-90 plasma (LTPs significantly altered the reactivity of specific mABs to shared glycotopes on blots, mainly through the binding of LTPs to plasma proteins resulting in either glycotope blocking or increased glycotope attachment to plasma. Many LTP-mediated changes in shared glycans were snail-strain specific, especially those in the 100 kDa fraction. Our data suggest that differential binding of S. mansoni LTPs to plasma proteins of susceptible and resistant B. glabrata strains may significantly impact early anti-larval immune reactivity, and in turn, compatibility, in this parasite-host system. PMID:22448293

  8. Idiotype-anti-idiotype regulation. I. Immunization with a levan-binding myeloma protein leads to the appearance of auto-anti-(anti-idiotype) antibodies and to the activation of silent clones

    Science.gov (United States)

    1981-01-01

    BALB/c mice immunized multiple times with ABPC48 (A48 or Ab1), a BALB/c bacterial levan (BL)-binding myeloma proteins, produce anti-Ab1 antibodies (Ab2). Immunization with only tow doses of AB1 often leads to the production of anti (antiA48) (Ab3) as does immunization with hemocyanin conjugates of Ab2. Finally, immunization with hemocyanin conjugates of Abf3 leads to the production of anti- (anti-[anti-A48]) (Ab4). Normal BALB/c mice immunized with BL produce an anti BL antibody response containing no detectable Ab1 idiotype (Id)-bearing molecules. Mice producing Ab3 express substantial amounts of Ab1 Id in their anti- BL response whereas mice producing Ab2 and Ab4 show a generalized inhibition in their anti BL response. These results indicate that states of immunity within an idiotypic chain may have marked effect on antibody responses to the antigen (i.e., BL) which is the putative initiator of the chain. Strikingly, the chain itself has an interesting feature. That is, Ab3 and Ab1 share a cross-reactive Id in that both are bound by Ab4 and Ab2. We propose a model of Id-anti-Id systems to explain this unexpected result. This is based on the concept of regulatory idiotopes on Ab1 molecules which initiate Ab2 (anti- idiotope) responses. In contrast, Ab2 molecules generally fail to initiate anti-Ab2 Id responses eigher because any individual idiotope is present at very low concentration or because Ab2 molecules tend to lack regulatory idiotopes. Thus, Ab2 molecules immunize syngeneic animals because they interact with cells bearing Ab1 like regulatory idiotopes. Thus, Ab3 will share regulatory idiotopes with Ab1. Ab4 and Ab2 will share the ability to bind the Ab1-like regulatory idiotope. PMID:7252415

  9. Equity valuation : Atlas Copco AB

    OpenAIRE

    Santos, Ricardo Manuel Castro Lopes Alba

    2016-01-01

    This Dissertation presents a literature review of some of the most appraised theories on equity valuation models. A thoughtful analysis is made, presenting the main advantages and restrictions of each model and setting the path for a discussion about improvements to be made on this field of study. A practical implementation follows, proposing a fair value estimation of Atlas Copco AB shares. Atlas Copco is a Swedish-based capital goods company, operating across four differen...

  10. Thermonuclear Reflect AB-Reactor

    CERN Document Server

    Bolonkin, Alexander

    2008-01-01

    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  11. AB Levitator and Electricity Storage

    CERN Document Server

    Bolonkin, A

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative weight ratio of this engine is 0.01 - 0.1 (from thrust). For some types of AB engine (toroidal form) the thrust easily may be changed in any direction without turning of engine. The author computed many projects using different versions of offered AB engine: small device for levitation-flight of a human (including flight from Earth to Outer Space), fly VTOL car (track), big VTOL aircrat, suspended low altitude stationary satellite, powerful Space Shuttle-like booster for travel to the Moon and Mars without spending energ...

  12. Generation of Monoclonal Antibodies against Non-structural Protein 3AB of Foot-and-Mouth Disease Virus

    Institute of Scientific and Technical Information of China (English)

    Tong Lin; Junjun Shao; Huiyun Chang; Shandian Gao; Guozheng Cong; Junzheng Du

    2012-01-01

    To identify linear epitopes on the non-structural protein 3AB of foot-and-mouth disease virus (FMDV),BABL/c mice were immunized with the 3AB protein and splenocytes of BALB/c mice were fused with myeloma Sp2/0 cells.Two hybridoma monoclonal antibodies (mAbs) cell lines against the 3AB protein of foot-and-mouth disease virus (FMDV) were obtained,named C6 and E7 respectively.The microneutralization titer was 1∶1024 for mAb C6,and 1∶512 for E7.Both mAbs contain kappa light chains,and were of subclass IgG2b.In order to define the mAbs binding epitopes,the reactivity of these mAbs against FMDV were examined by indirect ELISA.The results showed that both mAbs can react with FMDV,but had no cross-reactivity with Swine Vesicular Disease (SVD) antigens.The titers in abdomen liquor were 1∶5×106 for C6 and 1∶2×106 for E7.In conclusion,the mAbs obtained from this study are specific for the detection of FMDV,can be used for etiological and immunological researches on FMDV,and have potential use in diagnosis and future vaccine designs.

  13. Differential screening of phage-ab libraries by oligonucleotide microarray technology.

    Directory of Open Access Journals (Sweden)

    Paolo Monaci

    Full Text Available A novel and efficient tagArray technology was developed that allows rapid identification of antibodies which bind to receptors with a specific expression profile, in the absence of biological information. This method is based on the cloning of a specific, short nucleotide sequence (tag in the phagemid coding for each phage-displayed antibody fragment (phage-Ab present in a library. In order to set up and validate the method we identified about 10,000 different phage-Abs binding to receptors expressed in their native form on the cell surface (10 k Membranome collection and tagged each individual phage-Ab. The frequency of each phage-Ab in a given population can at this point be inferred by measuring the frequency of its associated tag sequence through standard DNA hybridization methods. Using tiny amounts of biological samples we identified phage-Abs binding to receptors preferentially expressed on primary tumor cells rather than on cells obtained from matched normal tissues. These antibodies inhibited cell proliferation in vitro and tumor development in vivo, thus representing therapeutic lead candidates.

  14. High-throughput screening of monoclonal antibodies against plant cell wall glycans by hierarchical clustering of their carbohydrate microarray binding profiles

    DEFF Research Database (Denmark)

    Moller, Isabel; Marcus, Susan E.; Haeger, Ash;

    2007-01-01

    Antibody-producing hybridoma cell lines were created following immunisation with a crude extract of cell wall polymers from the plant Arabidopsis thaliana. In order to rapidly screen the specificities of individual monoclonal antibodies (mAbs), their binding to microarrays containing 50 cell wall...... investigated using subsequent immunochemical and biochemical analyses and two novel mAbs are described in detail. mAb LM13 binds to an arabinanase-sensitive pectic epitope and mAb LM14, binds to an epitope occurring on arabinogalactan-proteins. Both mAbs display novel patterns of recognition of cell walls in...... plant materials....

  15. ABS: Sequence alignment by scanning

    KAUST Repository

    Bonny, Mohamed Talal

    2011-08-01

    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  16. AP calculus AB/BC

    CERN Document Server

    Schwartz, Stu

    2013-01-01

    All Access for the AP® Calculus AB & BC Exams Book + Web + Mobile Everything you need to prepare for the Advanced Placement® exam, in a study system built around you! There are many different ways to prepare for an Advanced Placement® exam. What's best for you depends on how much time you have to study and how comfortable you are with the subject matter. To score your highest, you need a system that can be customized to fit you: your schedule, your learning style, and your current level of knowledge. This book, and the free online tools that come with it, will help you personalize your AP® Cal

  17. Magnetoband structures of AB-stacked zigzag nanographite ribbons

    Energy Technology Data Exchange (ETDEWEB)

    Chang, C.P.; Chiu, C.W.; Shyu, F.L.; Chen, R.B.; Lin, M.F

    2002-12-30

    Magnetoband structures of AB-stacked zigzag nanographite ribbons are studied by the tight-binding model. The magnetic field changes band width, energy space, and energy dispersions (the produce of Landau subbands and Landau levels). It causes many zero energy points. Such points and corresponding localized states are studied in detail. There are certain important differences between localized states and edge states. Oscillation period of Landau subbands are determined by these points. The interribbon interactions also affect magnetoband structures, such as energy dispersions, band width, oscillation period of Landau subbands, and flux dependence of Hofstadter butterflies.

  18. Ab initio calculations and modelling of atomic cluster structure

    DEFF Research Database (Denmark)

    Solov'yov, Ilia; Lyalin, Andrey G.; Solov'yov, Andrey V.;

    2004-01-01

    The optimized structure and electronic properties of small sodium and magnesium clusters have been investigated using it ab initio theoretical methods based on density-functional theory and post-Hartree-Fock many-body perturbation theory accounting for all electrons in the system. A new theoretical...... framework for modelling the fusion process of noble gas clusters is presented. We report the striking correspondence of the peaks in the experimentally measured abundance mass spectra with the peaks in the size-dependence of the second derivative of the binding energy per atom calculated for the chain...... of the noble gas clusters up to 150 atoms....

  19. Investigations of immunogenic, allergenic and adjuvant properties of Cry1Ab protein after intragastric exposure in a food allergy model in mice

    OpenAIRE

    Andreassen, Monica; Bøhn, Thomas; Wikmark, Odd-Gunnar; Bodin, Johanna; Traavik, Terje; Løvik, Martinus; Nygaard, Unni Cecilie

    2016-01-01

    Background In genetically modified (GM) crops there is a risk that the inserted genes may introduce new allergens and/or adjuvants into the food and feed chain. The MON810 maize, expressing the insecticidal Cry1Ab toxin, is grown in many countries worldwide. In animal models, intranasal and intraperitoneal immunisations with the purified Cry1Ab proteins have induced immune responses, and feeding trials with Cry1Ab-containing feed have revealed some altered immune responses. Previous investiga...

  20. Microwave Study of Recycled ABS Resins

    Institute of Scientific and Technical Information of China (English)

    A; M; Hasna

    2002-01-01

    This article provides a review of the research unde rt aken in order to determine the suitability of utilizing microwave technology in the production of Recycled ABS Acrylonitrile Butadiene Styrene resin for mouldin gs. The experimental investigation determined the suitability of the existing re cycled ABS material, the mould material used with respect to performance and lon gevity, potential commercial plant and equipment, end mould compression. Introduction Frequency Characterization of ABS The first ...

  1. abs497ashcoursesTutorial /uophelp

    OpenAIRE

    davids

    2015-01-01

    For more course tutorials visit www.uophelp.com       I.        ABS 497 Week 1 Assignment Community Change   II.        ABS 497 Week 1 DQ 1 Fabian's Story III.        ABS 497 Week 1 DQ 2 Doug's Story IV.        ABS 497 Week 2 DQ 1 Parenting Styles   V.      &nb...

  2. ABS test equipment design%ABS 测试设备设计

    Institute of Scientific and Technical Information of China (English)

    王宇鹏

    2013-01-01

      This article simply introduces the structure and operating principle of ABS. and a new equipment for ABS signal testing is designed and put into use.%  简要介绍了 ABS 的组成及其工作原理,并结合自身情况,设计了测试 ABS 信号的设备,并投入使用。

  3. Ab-Initio Molecular Dynamics

    CERN Document Server

    Kühne, Thomas D

    2012-01-01

    Computer simulations and molecular dynamics in particular, is a very powerful method to provide detailed and essentially exact informations of classical many-body problems. With the advent of \\textit{ab-initio} molecular dynamics, where the forces are computed on-the-fly by accurate electronic structure calculations, the scope of either method has been greatly extended. This new approach, which unifies Newton's and Schr\\"odinger's equations, allows for complex simulations without relying on any adjustable parameter. This review is intended to outline the basic principles as well as a survey of the field. Beginning with the derivation of Born-Oppenheimer molecular dynamics, the Car-Parrinello method as well as novel hybrid scheme that unifies best of either approach are discussed. The predictive power is demonstrated by a series of applications ranging from insulators to semiconductors and even metals in condensed phases.

  4. FcRn binding is not sufficient for achieving systemic therapeutic levels of immunoglobulin G after oral delivery of enteric-coated capsules in cynomolgus macaques.

    Science.gov (United States)

    Muzammil, Salman; Mabus, John R; Cooper, Philip R; Brezski, Randall J; Bement, Courtney B; Perkinson, Rob; Huebert, Norman D; Thompson, Suzanne; Levine, Dalia; Kliwinski, Connie; Bradley, Dino; Hornby, Pamela J

    2016-06-01

    Although much speculation has surrounded intestinally expressed FcRn as a means for systemic uptake of orally administered immunoglobulin G (IgG), this has not been validated in translational models beyond neonates or in FcRn-expressing cells in vitro. Recently, IgG1 intestinal infusion acutely in anesthetized cynomolgus resulted in detectable serum monoclonal antibody (mAb) levels. In this study, we show that IgG2 has greater protease resistance to intestinal enzymes in vitro and mice in vivo, due to protease resistance in the hinge region. An IgG2 mAb engineered for FcRn binding, was optimally formulated, lyophilized, and loaded into enteric-coated capsules for oral dosing in cynomolgus. Small intestinal pH 7.5 was selected for enteric delivery based on gastrointestinal pH profiling of cynomolgus by operator-assisted IntelliCap System(®). Milling of the lyophilized IgG2 M428L FcRn-binding variant after formulation in 10 mmol/L histidine, pH 5.7, 8.5% sucrose, 0.04% PS80 did not alter the physicochemical properties nor the molecular integrity compared to the batch released in PBS. Size 3 hard gel capsules (23.2 mg IgG2 M428L ~3 mg/kg) were coated with hydroxypropyl methylcellulose acetate succinate for rapid dissolution at pH 7.5 in small intestine and FcRn binding of encapsulated mAb confirmed. Initial capsule dosing by endoscopic delivery into the small intestine achieved 0.2 + 0.1 ng/mL (n = 5) peak at 24 h. Weekly oral capsule dosing for 6 weeks achieved levels of 0.4 + 0.2 ng/mL and, despite increasing the dose and frequency, remained below 1 ng/mL. In conclusion, lyophilized milled mAb retains FcRn binding and molecular integrity for small intestinal delivery. The low systemic exposure has demonstrated the limitations of intestinal FcRn in non-human primates and the unfeasibility of employing this for therapeutic levels of mAb. Local mAb delivery with limited systemic exposure may be sufficient as a therapeutic for intestinal diseases. PMID

  5. Smectite alteration

    International Nuclear Information System (INIS)

    This report contains the proceedings of a second workshop in Washington DC December 8-9, 1983 on the alteration of smectites intended for use as buffer materials in the long-term containment of nuclear wastes. It includes extended summaries of all presentations and a transcript of the detailed scientific discussion. The discussions centered on three main questions: What is the prerequisite for and what is the precise mechanism by which smectite clays may be altered to illite. What are likly sources of potassium with respect to the KBS project. Is it likely that the conversion of smectite to illite will be of importance in the 10 5 to the 10 6 year time frame. The workshop was convened to review considerations and conclusions in connection to these questions and also to broaden the discussion to consider the use of smectite clays as buffer materials for similar applications in different geographical and geological settings. SKBF/KBS technical report 83-03 contains the proceedings from the first workshop on these matters that was held at the State University of New York, Buffalo May 26-27, 1982. (Author)

  6. Ultrasound Biomicroscopy Comparison of Ab Interno and Ab Externo Intraocular Lens Scleral Fixation.

    Science.gov (United States)

    Horiguchi, Lie; Garcia, Patricia Novita; Malavazzi, Gustavo Ricci; Allemann, Norma; Gomes, Rachel L R

    2016-01-01

    Purpose. To compare ab interno and ab externo scleral fixation of posterior chamber intraocular lenses (PCIOL) using ultrasound biomicroscopy (UBM). Methods. Randomized patients underwent ab externo or ab interno scleral fixation of a PCIOL. Ultrasound biomicroscopy was performed 3 to 6 months postoperatively, to determine PCIOL centration, IOL distance to the iris at 12, 3, 6, and 9 hours, and haptics placement in relation to the ciliary sulcus. Results. Fifteen patients were enrolled in the study. The ab externo technique was used in 7 eyes (46.6%) and the ab interno in 8 eyes (53.3%). In the ab externo technique, 14 haptics were located: 4 (28.57%) in the ciliary sulcus; 2 (14.28%) anterior to the sulcus; and 8 (57.14%) posterior to the sulcus, 6 in the ciliary body and 2 posterior to the ciliary body. In the ab interno group, 4 haptics (25.0%) were in the ciliary sulcus, 2 (12.50%) anterior to the sulcus, and 10 (75.0%) posterior to the sulcus, 4 in the ciliary body and 6 posterior to the ciliary body. Conclusions. Ab externo and ab interno scleral fixation techniques presented similar results in haptic placement. Ab externo technique presented higher vertical tilt when compared to the ab interno.

  7. Ultrasound Biomicroscopy Comparison of Ab Interno and Ab Externo Intraocular Lens Scleral Fixation

    Directory of Open Access Journals (Sweden)

    Lie Horiguchi

    2016-01-01

    Full Text Available Purpose. To compare ab interno and ab externo scleral fixation of posterior chamber intraocular lenses (PCIOL using ultrasound biomicroscopy (UBM. Methods. Randomized patients underwent ab externo or ab interno scleral fixation of a PCIOL. Ultrasound biomicroscopy was performed 3 to 6 months postoperatively, to determine PCIOL centration, IOL distance to the iris at 12, 3, 6, and 9 hours, and haptics placement in relation to the ciliary sulcus. Results. Fifteen patients were enrolled in the study. The ab externo technique was used in 7 eyes (46.6% and the ab interno in 8 eyes (53.3%. In the ab externo technique, 14 haptics were located: 4 (28.57% in the ciliary sulcus; 2 (14.28% anterior to the sulcus; and 8 (57.14% posterior to the sulcus, 6 in the ciliary body and 2 posterior to the ciliary body. In the ab interno group, 4 haptics (25.0% were in the ciliary sulcus, 2 (12.50% anterior to the sulcus, and 10 (75.0% posterior to the sulcus, 4 in the ciliary body and 6 posterior to the ciliary body. Conclusions. Ab externo and ab interno scleral fixation techniques presented similar results in haptic placement. Ab externo technique presented higher vertical tilt when compared to the ab interno.

  8. Ultrasound Biomicroscopy Comparison of Ab Interno and Ab Externo Intraocular Lens Scleral Fixation

    Science.gov (United States)

    Horiguchi, Lie; Garcia, Patricia Novita; Malavazzi, Gustavo Ricci; Allemann, Norma

    2016-01-01

    Purpose. To compare ab interno and ab externo scleral fixation of posterior chamber intraocular lenses (PCIOL) using ultrasound biomicroscopy (UBM). Methods. Randomized patients underwent ab externo or ab interno scleral fixation of a PCIOL. Ultrasound biomicroscopy was performed 3 to 6 months postoperatively, to determine PCIOL centration, IOL distance to the iris at 12, 3, 6, and 9 hours, and haptics placement in relation to the ciliary sulcus. Results. Fifteen patients were enrolled in the study. The ab externo technique was used in 7 eyes (46.6%) and the ab interno in 8 eyes (53.3%). In the ab externo technique, 14 haptics were located: 4 (28.57%) in the ciliary sulcus; 2 (14.28%) anterior to the sulcus; and 8 (57.14%) posterior to the sulcus, 6 in the ciliary body and 2 posterior to the ciliary body. In the ab interno group, 4 haptics (25.0%) were in the ciliary sulcus, 2 (12.50%) anterior to the sulcus, and 10 (75.0%) posterior to the sulcus, 4 in the ciliary body and 6 posterior to the ciliary body. Conclusions. Ab externo and ab interno scleral fixation techniques presented similar results in haptic placement. Ab externo technique presented higher vertical tilt when compared to the ab interno. PMID:27293878

  9. Binding Procurement

    Science.gov (United States)

    Rao, Gopalakrishna M.; Vaidyanathan, Hari

    2007-01-01

    This viewgraph presentation reviews the use of the binding procurement process in purchasing Aerospace Flight Battery Systems. NASA Engineering and Safety Center (NESC) requested NASA Aerospace Flight Battery Systems Working Group to develop a set of guideline requirements document for Binding Procurement Contracts.

  10. Antigen-Antibody Interaction Database (AgAbDb): a compendium of antigen-antibody interactions.

    Science.gov (United States)

    Kulkarni-Kale, Urmila; Raskar-Renuse, Snehal; Natekar-Kalantre, Girija; Saxena, Smita A

    2014-01-01

    Antigen-Antibody Interaction Database (AgAbDb) is an immunoinformatics resource developed at the Bioinformatics Centre, University of Pune, and is available online at http://bioinfo.net.in/AgAbDb.htm. Antigen-antibody interactions are a special class of protein-protein interactions that are characterized by high affinity and strict specificity of antibodies towards their antigens. Several co-crystal structures of antigen-antibody complexes have been solved and are available in the Protein Data Bank (PDB). AgAbDb is a derived knowledgebase developed with an objective to compile, curate, and analyze determinants of interactions between the respective antigen-antibody molecules. AgAbDb lists not only the residues of binding sites of antigens and antibodies, but also interacting residue pairs. It also helps in the identification of interacting residues and buried residues that constitute antibody-binding sites of protein and peptide antigens. The Antigen-Antibody Interaction Finder (AAIF), a program developed in-house, is used to compile the molecular interactions, viz. van der Waals interactions, salt bridges, and hydrogen bonds. A module for curating water-mediated interactions has also been developed. In addition, various residue-level features, viz. accessible surface area, data on epitope segment, and secondary structural state of binding site residues, are also compiled. Apart from the PDB numbering, Wu-Kabat numbering and explicit definitions of complementarity-determining regions are provided for residues of antibodies. The molecular interactions can be visualized using the program Jmol. AgAbDb can be used as a benchmark dataset to validate algorithms for prediction of B-cell epitopes. It can as well be used to improve accuracy of existing algorithms and to design new algorithms. AgAbDb can also be used to design mimotopes representing antigens as well as aid in designing processes leading to humanization of antibodies. PMID:25048123

  11. Bacillus thuringiensis delta-endotoxin binding to brush border membrane vesicles of rice stem borers.

    Science.gov (United States)

    Alcantara, Edwin P; Aguda, Remedios M; Curtiss, April; Dean, Donald H; Cohen, Michael B

    2004-04-01

    The receptor binding step in the molecular mode of action of five delta-endotoxins (Cry1Ab, Cry1Ac, Cry1C, Cry2A, and Cry9C) from Bacillus thuringiensis was examined to find toxins with different receptor sites in the midgut of the striped stem borer (SSB) Chilo suppressalis (Walker) and yellow stem borer (YSB) Scirpophaga incertulas (Walker) (Lepidoptera: Pyralidae). Homologous competition assays were used to estimate binding affinities (K(com)) of (125)I-labelled toxins to brush border membrane vesicles (BBMV). The SSB BBMV affinities in decreasing order was: Cry1Ab = Cry1Ac > Cry9C > Cry2A > Cry1C. In YSB, the order of decreasing affinities was: Cry1Ac > Cry1Ab > Cry9C = Cry2A > Cry1C. The number of binding sites (B(max)) estimated by homologous competition binding among the Cry toxins did not affect toxin binding affinity (K(com)) to both insect midgut BBMVs. Results of the heterologous competition binding assays suggest that Cry1Ab and Cry1Ac compete for the same binding sites in SSB and YSB. Other toxins bind with weak (Cry1C, Cry2A) or no affinity (Cry9C) to Cry1Ab and Cry1Ac binding sites in both species. Cry2A had the lowest toxicity to 10-day-old SSB and Cry1Ab and Cry1Ac were the most toxic. Taken together, the results of this study show that Cry1Ab or Cry1Ac could be combined with either Cry1C, Cry2A, or Cry9C for more durable resistance in transgenic rice. Cry1Ab should not be used together with Cry1Ac because a mutation in one receptor site could diminish binding of both toxins. PMID:15027071

  12. Skp2B overexpression alters a prohibitin-p53 axis and the transcription of PAPP-A, the protease of insulin-like growth factor binding protein 4.

    Directory of Open Access Journals (Sweden)

    Harish Chander

    Full Text Available BACKGROUND: We previously reported that the degradation of prohibitin by the SCF(Skp2B ubiquitin ligase results in a defect in the activity of p53. We also reported that MMTV-Skp2B transgenic mice develop mammary gland tumors that are characterized by an increased proteolytic cleavage of the insulin-like growth factor binding protein 4 (IGFBP-4, an inhibitor of IGF signaling. However, whether a link exists between a defect in p53 activity and proteolysis of IGFBP-4 was not established. METHODS AND RESULTS: We analyzed the levels of pregnancy-associated plasma protein A (PAPP-A, the protease of IGFBP-4, in MMTV-Skp2B transgenic mice and found that PAPP-A levels are elevated. Further, we found a p53 binding site in intron 1 of the PAPP-A gene and that both wild type and mutant p53 bind to this site. However, binding of wild type p53 results in the transcriptional repression of PAPP-A, while binding of mutant p53 results in the transcriptional activation of PAPP-A. Since MMTV-Skp2B mice express wild type p53 and yet show elevated levels of PAPP-A, at first, these observations appeared contradictory. However, further analysis revealed that the defect in p53 activity in Skp2B overexpressing cells does not only abolish the activity of wild type of p53 but actually mimics that of mutant p53. Our results suggest that in absence of prohibitin, the half-life of p53 is increased and like mutant p53, the conformation of p53 is denatured. CONCLUSIONS: These observations revealed a novel function of prohibitin as a chaperone of p53. Further, they suggest that binding of denatured p53 in intron 1 causes an enhancer effect and increases the transcription of PAPP-A. Therefore, these findings indicate that the defect in p53 function and the increased proteolysis of IGFBP-4, we had observed, represent two components of the same pathway, which contributes to the oncogenic function of Skp2B.

  13. Increased abundance of the adaptor protein containing pleckstrin homology domain, phosphotyrosine binding domain and leucine zipper motif (APPL1) in patients with obesity and type 2 diabetes: evidence for altered adiponectin signalling

    OpenAIRE

    Holmes, R.M.; Yi, Z; De Filippis, E.; Berria, R.; S. Shahani; P. Sathyanarayana; Sherman, V.; K. Fujiwara; Meyer, C.; Christ-Roberts, C.; Hwang, H; Finlayson, J.; Dong, L. Q.; Mandarino, L. J.; Bajaj, M.

    2011-01-01

    Aims/hypothesis The adiponectin signalling pathway is largely unknown, but recently the adaptor protein containing pleckstrin homology domain, phosphotyrosine binding domain and leucine zipper motif (APPL1), has been shown to interact directly with adiponectin receptor (ADIPOR)1. APPL1 is present in C2C12 myoblasts and mouse skeletal muscle, but its presence in human skeletal muscle has not been investigated. Methods Samples from type 2 diabetic, and lean and non-diabetic obese participants w...

  14. Multiwavelength Observations of AB Doradus

    CERN Document Server

    Slee, O B; Johnston-Hollitt, M; Budding, E

    2014-01-01

    We have observed the bright, magnetically active multiple star AB Doradus in a multiwavelength campaign centring around two large facility allocations in November 2006 and January, 2007. Our observations have covered at least three large flares. These flares were observed to produce significant hardening of the X-ray spectra during their very initial stages. We monitored flare-related effects using the Suzaku X-ray satellite and the Australia Telescope Compact Array at 3.6 and 6 cm. Observations at 11 and 21 cm were also included, but they were compromised by interference. From our multiwavelength coverage we find that the observed effects can be mainly associated with a large active region near longitude zero. The second major X-ray and microwave flare of Jan 8, 2007 was observed with a favourable geometry that allowed its initial high-energy impulsive phase to be observed in the higher frequency range of Suzaku's XIS detectors. The fractional circular polarisation was measured for the complete runs, for 25 ...

  15. GINGA Observations of AB Doradus

    Science.gov (United States)

    Vilhu, O.; Tsuru, T.; Collier Cameron, A.

    We report GINGA observations of the pre main sequence star AB Doradus (HD 36705), performed during 8 - 12 January, 1990. Some rotational modulation might be present. four X-ray flares were detected. Three of these events were similar to the EINSTEIN HRI-flare (Vilhu and Linsky, 1987), with decay times around 25 min. The last flare had long rise and decay times (100 min), resembling the EXOSAT flares observed by Collier Cameron et.al. (1988). The mean flare spectrum can be fitted by a thermal bremstrahlung with temperature 5.0 keV, or by a power-law model with photon index 2.2. The 3 upper limit of the Iron line equivalent width in the flare spectrum is 1 keV, weaker than predicted by thermal models. This Iron line anomaly was first discussed in the case of UX Ari by Tsuru et. al. (1989). However, normal equivalent widths can be derived from several EXOSAT spectra of active cool stars (Pallavicini and Tagliaferri, 1990). We discuss the possibility that the continuum from non-thermal electrons (producing also the microwave emission) could occasionally lower the apparent equivalent width. The mechanism works for reasonably low magnetic field strengths and electon power-law indexes. However, a large population of non-thermal electrons is needed (comparable to the thermal one). Stronger magnetic fields could explain the radio emission with less electrons, but then the non-thermal X-ray continuum remains small.

  16. Collective rotation from ab initio theory

    CERN Document Server

    Caprio, M A; Vary, J P; Smith, R

    2015-01-01

    Through ab initio approaches in nuclear theory, we may now seek to quantitatively understand the wealth of nuclear collective phenomena starting from the underlying internucleon interactions. No-core configuration interaction (NCCI) calculations for p-shell nuclei give rise to rotational bands, as evidenced by rotational patterns for excitation energies, electromagnetic moments, and electromagnetic transitions. In this review, NCCI calculations of 7-9Be are used to illustrate and explore ab initio rotational structure, and the resulting predictions for rotational band properties are compared with experiment. We highlight the robustness of ab initio rotational predictions across different choices for the internucleon interaction.

  17. AP calculus AB & BC crash course

    CERN Document Server

    Rosebush, J

    2012-01-01

    AP Calculus AB & BC Crash Course - Gets You a Higher Advanced Placement Score in Less Time Crash Course is perfect for the time-crunched student, the last-minute studier, or anyone who wants a refresher on the subject. AP Calculus AB & BC Crash Course gives you: Targeted, Focused Review - Study Only What You Need to Know Crash Course is based on an in-depth analysis of the AP Calculus AB & BC course description outline and actual AP test questions. It covers only the information tested on the exams, so you can make the most of your valuable study time. Written by experienced math teachers, our

  18. A cadherin-like protein influences Bacillus thuringiensis Cry1Ab toxicity in the oriental armyworm, Mythimna separata.

    Science.gov (United States)

    Wang, Ling; Jiang, Xingfu; Luo, Lizhi; Stanley, David; Sappington, Thomas W; Zhang, Lei

    2013-06-01

    Cadherins comprise a family of calcium-dependent cell adhesion proteins that act in cell-cell interactions. Cadherin-like proteins (CADs) in midguts of some insects act as receptors that bind some of the toxins produced by the Bacillus thuringiensis (Bt). We cloned a CAD gene associated with larval midguts prepared from Mythimna separata. The full-length cDNA (MsCAD1, GenBank Accession No. JF951432) is 5642 bp, with an open reading frame encoding a 1757 amino acid and characteristics typical of insect CADs. Expression of MsCAD1 is predominantly in midgut tissue, with highest expression in the 3rd- to 6th-instars and lowest in newly hatched larvae. Knocking-down MsCAD1 decreased Cry1Ab susceptibility, indicated by reduced developmental time, increased larval weight and reduced larval mortality. We expressed MsCAD1 in E. coli and recovered the recombinant protein, rMsCAD1, which binds Cry1Ab toxin. Truncation analysis and binding experiments revealed that a contiguous 209-aa, located in CR11 and CR12, is the minimal Cry1Ab binding region. These results demonstrate that MsCAD1 is associated with Cry1Ab toxicity and is one of the Cry1Ab receptors in this insect. The significance of this work lies in identifying MsCAD1 as a Cry1Ab receptor, which helps understand the mechanism of Cry1Ab toxicity and of potential resistance to Bt in M. separata. PMID:23754724

  19. Theoretical studies of binding of mannose-binding protein to monosaccharides

    Science.gov (United States)

    Aida-Hyugaji, Sachiko; Takano, Keiko; Takada, Toshikazu; Hosoya, Haruo; Kojima, Naoya; Mizuochi, Tsuguo; Inoue, Yasushi

    2004-11-01

    Binding properties of mannose-binding protein (MBP) to monosaccharides are discussed based on ab initio molecular orbital calculations for cluster models constructed. The calculated binding energies indicate that MBP has an affinity for N-acetyl- D-glucosamine, D-mannose, L-fucose, and D-glucose rather than D-galactose and N-acetyl- D-galactosamine, which is consistent with the biochemical experimental results. Electrostatic potential surfaces at the binding site of four monosaccharides having binding properties matched well with that of MBP. A vacant frontier orbital was found to be localized around the binding site of MBP, suggesting that MBP-monosaccharide interaction may occur through electrostatic and orbital interactions.

  20. Altered phosphorylation and intracellular distribution of a (CUG)n triplet repeat RNA-binding protein in patients with myotonic dystrophy and in myotonin protein kinase knockout mice

    OpenAIRE

    Roberts, Robert; Timchenko, Nikolaj A.; Miller, Jill W.; Reddy, Sita; Caskey, C. Thomas; Maurice S Swanson; Timchenko, Lubov T.

    1997-01-01

    Myotonic dystrophy (DM) is associated with expansion of CTG repeats in the 3′-untranslated region of the myotonin protein kinase (DMPK) gene. The molecular mechanism whereby expansion of the (CUG)n repeats in the 3′-untranslated region of DMPK gene induces DM is unknown. We previously isolated a protein with specific binding to CUG repeat sequences (CUG-BP/hNab50) that possibly plays a role in mRNA processing and/or transport. Here we present evidence that the phos...

  1. Ab initio calculations of phosphorus and arsenic clustering parameters for the improvement of process simulation models

    Energy Technology Data Exchange (ETDEWEB)

    Sahli, Beat [Integrated Systems Laboratory, ETH Zurich, Gloriastrasse 35, 8092 Zurich (Switzerland)], E-mail: sahli@iis.ee.ethz.ch; Vollenweider, Kilian [Integrated Systems Laboratory, ETH Zurich, Gloriastrasse 35, 8092 Zurich (Switzerland); Zographos, Nikolas; Zechner, Christoph [Synopsys Switzerland LLC, Affolternstrasse 52, 8050 Zurich (Switzerland)

    2008-12-05

    We present the results of extensive ab initio simulations for phosphorus clusters, arsenic clusters and mixed phosphorus/arsenic clusters in silicon. The specific defects and the parameters that are investigated are selected according to the needs of state-of-the-art diffusion and activation models, taking into account the availability of experimental data, the capabilities of current ab initio methods and the requirements for advanced technology development. The calculated binding energies are used to determine a good starting point for the calibration of a new clustering model implemented in an atomistic process simulator. The defect species V, I, P, PV, PI, As, AsV, AsI and clusters containing up to four dopant atoms and up to one V or I are considered in all relevant charge states. The ab initio results are discussed as well as the challenges arising in the transfer of this information into the process simulation model.

  2. Crystallization of BMP receptor type IA bound to the antibody Fab fragment AbD1556

    International Nuclear Information System (INIS)

    The crystallization of BMP receptor type IA bound to the neutralizing antibody Fab fragment AbD1556 obtained by phage-display selection is reported. An antibody Fab fragment, AbD1556, was selected against the extracellular domain of BMP receptor type IA, which blocks the binding of BMP-2 to BMPR-IA and thereby neutralizes BMP-2 activity. To study the mechanism by which BMPR-IA is recognized and bound by the Fab fragment, the complex of AbD1556 bound to BMPR-IA was prepared and crystallized. Crystals of this binary complex belonged to the monoclinic space group P21, with unit-cell parameters a = 89.32, b = 129.25, c = 100.24 Å, β = 92.27°

  3. Main: DREDR1ATRD29AB [PLACE

    Lifescience Database Archive (English)

    Full Text Available DREDR1ATRD29AB S000152 23-June-2006 (last modified) kehi Related to responsiveness ...dependent in the ABA-responsive expression of the rd29A in Arabidopsis; DRE; drought; water stress; oxidativ

  4. Ultrasensitive human thyrotropin (h TSH) immunoradiometric assay (IRMA) set up, through identification and minimization of non specific bindings

    International Nuclear Information System (INIS)

    An IRMA of h TSH, based on magnetic solid phase separation, was studied especially for what concerns its non specific bindings. These were identified as a product of the interaction between an altered form of radioiodinated anti-h TSH monoclonal antibody (125 I-m AB) and the uncoupled magnetizable cellulose particle (matrix). Apparently this form of 125 I-m AB is a type of aggregate that can be partly resolved from the main peak on Sephadex G-200 and further minimized via a single pre-incubation with the same matrix. Solid phase saturation with milk proteins, tracer storage at 40 C and serum addition during incubation were also found particularly effective is preventing its formation. These findings were used in order to reproducibly decrease non specific bindings to values 60/BO) up to values of 300-500. This way we obtained h TSH radio assays with functional sensitivities of about 0.05 m IU/L and analytical sensitivities of the order of 0.02 m IU/L, which classify them at least as among the best second generation assays and that are excellent indeed for magnetic IRMA s. A more optimistic sensitivity calculation, based on Rodbard's definition, provided values down to 0.008 m IU/L. Such sensitivities, moreover, were obtained in a very reproducible way and all over the useful tracer life. (author). 83 refs, 13 figs, 25 tabs

  5. Structural Analysis of Human and Macaque mAbs 2909 and 2.5B: Implications for the Configuration of the Quaternary Neutralizing Epitope of HIV-1 gp120

    Energy Technology Data Exchange (ETDEWEB)

    Spurrier, Brett; Sampson, Jared M.; Totrov, Maxim; Li, Huiguang; O; Neal, Timothy; Williams, Constance; Robinson, James; Gorny, Miroslaw K.; Zolla-Pazner, Susan; Kong, Xiang-Peng (Molsoft); (Tulane); (NYUSM)

    2011-08-25

    The quaternary neutralizing epitope (QNE) of HIV-1 gp120 is preferentially expressed on the trimeric envelope spikes of intact HIV virions, and QNE-specific monoclonal antibodies (mAbs) potently neutralize HIV-1. Here, we present the crystal structures of the Fabs of human mAb 2909 and macaque mAb 2.5B. Both mAbs have long beta hairpin CDR H3 regions >20 {angstrom} in length that are each situated at the center of their respective antigen-binding sites. Computational analysis showed that the paratopes include the whole CDR H3, while additional CDR residues form shallow binding pockets. Structural modeling suggests a way to understand the configuration of QNEs and the antigen-antibody interaction for QNE mAbs. Our data will be useful in designing immunogens that may elicit potent neutralizing QNE Abs.

  6. Alterations of serum concentrations of thyroid hormones and sex hormone-binding globulin, nuclear binding of tri-iodothyronine and thyroid hormone-stimulated cellular uptake of oxygen and glucose in mononuclear blood cells from patients with non-thyroidal illness

    DEFF Research Database (Denmark)

    Kvetny, J; Matzen, L

    1990-01-01

    with healthy control subjects (1.45 +/- 0.30 nmol/l). Neither serum TSH nor sex hormone-binding globulin differed from that of the control group. Nuclear T3 binding capacity was increased (P less than 0.05) in patients with NTI (10.1 +/- 3.0 fmol/100 micrograms DNA) compared with controls (2.5 +/- 0.9 fmol/100......Nuclear tri-iodothyronine (T3) binding and thyroid hormone-stimulated oxygen consumption and glucose uptake were examined in mononuclear blood cells from patients with non-thyroidal illness (NTI) in which serum T3 was significantly (P less than 0.05) depressed (0.62 +/- 0.12 (S.D.) nmol/l) compared.......05) compared with controls (0.24 +/- 0.10 mmol/l per mg DNA per h). In contrast, neither unstimulated nor thyroid hormone-stimulated oxygen consumption differed. We conclude that both increased nuclear T3 binding and increased thyroid hormone-induced glucose uptake may represent counter-regulatory mechanisms...

  7. Ab initio Molecular Dynamics Study on Small Carbon Nanotubes

    Institute of Scientific and Technical Information of China (English)

    叶林晖; 刘邦贵; 王鼎盛

    2001-01-01

    Ab initio molecular dynamics simulations are performed on small single wall nanotubes. By structural relaxation,the equilibrium C-C bond lengths and bond angles are determined. Our result shows that for both zigzag and armchair nanotubes there are two nonequivalent bond lengths. One bond stretches from that of the graphene sheet, while the other shrinks. Small variations on bond angles are also shown. Energy bands are calculated for the optimized structures. It is found that the intrinsic curvature of the very small nanotube greatly modifies the energy band which can no longer be well described in the tight-binding zone-folding picture. In our calculation very small nanotubes are metallic. The energy per atom fits quite well with the relation of E(R) = E0 + f/R2 even for the extreme small radius. The implications of the results on the properties of small nanotubes are discussed.

  8. Characterization of molecular mechanisms controlling fabAB transcription in Pseudomonas aeruginosa.

    Directory of Open Access Journals (Sweden)

    Herbert P Schweizer

    Full Text Available BACKGROUND: The FabAB pathway is one of the unsaturated fatty acid (UFA synthesis pathways for Pseudomonas aeruginosa. It was previously noted that this operon was upregulated in biofilms and repressed by exogenous UFAs. Deletion of a 30 nt fabA upstream sequence, which is conserved in P. aeruginosa, P. putida, and P. syringae, led to a significant decrease in fabA transcription, suggesting positive regulation by an unknown positive regulatory mechanism. METHODS/PRINCIPAL FINDINGS: Here, genetic and biochemical approaches were employed to identify a potential fabAB activator. Deletion of candidate genes such as PA1611 or PA1627 was performed to determine if any of these gene products act as a fabAB activator. However, none of these genes were involved in the regulation of fabAB transcription. Use of mariner-based random mutagenesis to screen for fabA activator(s showed that several genes encoding unknown functions, rpoN and DesA may be involved in fabA regulation, but probably via indirect mechanisms. Biochemical attempts performed did fail to isolate an activator of fabAB operon. CONCLUSION/SIGNIFICANCE: The data suggest that fabA expression might not be regulated by protein-binding, but by a distinct mechanism such as a regulatory RNA-based mechanism.

  9. Ab initio molecular dynamics with nuclear quantum effects at classical cost: ring polymer contraction for density functional theory

    CERN Document Server

    Marsalek, Ondrej

    2015-01-01

    Path integral molecular dynamics simulations, combined with an ab initio evaluation of interactions using electronic structure theory, incorporate the quantum mechanical nature of both the electrons and nuclei, which are essential to accurately describe systems containing light nuclei. However, path integral simulations have traditionally required a computational cost around two orders of magnitude greater than treating the nuclei classically, making them prohibitively costly for most applications. Here we show that the cost of path integral simulations can be dramatically reduced by extending our ring polymer contraction approach to ab initio molecular dynamics simulations. By using density functional tight binding as a reference system, we show that our ab initio ring polymer contraction (AI-RPC) scheme gives rapid and systematic convergence to the full path integral density functional theory result. We demonstrate the efficiency of this approach in ab initio simulations of liquid water and the reactive pro...

  10. Study of Thermal Properties of Mixed (PP/EPR/ABS with Five Model Compatibilizers

    Directory of Open Access Journals (Sweden)

    Pierre Marcel Anicet Noah

    2016-01-01

    Full Text Available The influences of incorporating compatibilizers E-EA-MAH, E-MA-GMA, E-AM, SEBS KRATON G, or PP-g-MAH on the thermal properties of mixed (polypropylene/ethylene propylene rubber/acrylonitrile butadiene styrene (PP/EPR/ABS have been investigated. DSC investigations have revealed that the incorporation of 5% of ABS in the copolymer (PP/EPR does not fundamentally affect the thermal properties of the basic copolymer; additionally, the addition of 1.5% of each of the compatibilizers in the basic mixture does not significantly alter the crystallization temperature values and the melting of the -P- sequences. There is a variation of melting enthalpy values of the -P- sequences of 18.23% using SEBS KRATON G and of 10.38% using E-AM-GMA. When the rate of each of the compatibilizers increases to 5%, overall crystallization enthalpies of -P- sequences are almost kept unchanged, except for the case of using the compatibilizer E-AM-GMA with a variation of 8.42%. There is a minor variation of the melting enthalpy of -P- sequences with higher levels of compatibilizer. The incorporation of 5% ABS copolymer in the PP/EPR does not significantly alter the thermal properties of the basic structure of (PP/EPR/ABS.

  11. N3LO NN interaction adjusted to light nuclei in ab exitu approach

    Science.gov (United States)

    Shirokov, A. M.; Shin, I. J.; Kim, Y.; Sosonkina, M.; Maris, P.; Vary, J. P.

    2016-10-01

    We use phase-equivalent transformations to adjust off-shell properties of similarity renormalization group evolved chiral effective field theory NN interaction (Idaho N3LO) to fit selected binding energies and spectra of light nuclei in an ab exitu approach. We then test the transformed interaction on a set of additional observables in light nuclei to verify that it provides reasonable descriptions of these observables with an apparent reduced need for three- and many-nucleon interactions.

  12. Ab initio theory of galvanomagnetic phenomena in ferromagnetic metals and disordered alloys

    OpenAIRE

    Turek, Ilja; Kudrnovsky, Josef; Drchal, Vaclav

    2011-01-01

    We present an ab initio theory of transport quantities of metallic ferromagnets developed in the framework of the fully relativistic tight-binding linear muffin-tin orbital method. The approach is based on the Kubo-Streda formula for the conductivity tensor, on the coherent potential approximation for random alloys, and on the concept of interatomic electron transport. The developed formalism is applied to pure 3d transition metals (Fe, Co, Ni) and to random Ni-based ferromagnetic alloys (Ni-...

  13. Regulation of the AcrAB multidrug efflux pump in Salmonella enterica serovar Typhimurium in response to indole and paraquat.

    Science.gov (United States)

    Nikaido, Eiji; Shirosaka, Ikue; Yamaguchi, Akihito; Nishino, Kunihiko

    2011-03-01

    Salmonella enterica serovar Typhimurium has at least nine multidrug efflux pumps. Among these, AcrAB is constitutively expressed and is the most efficient, playing a role in both drug resistance and virulence. The acrAB locus is induced by indole, Escherichia coli-conditioned medium, and bile salts. This induction is dependent on RamA through the binding sequence in the upstream region of acrA that binds RamA. In the present study, we made a detailed investigation of the ramA and acrAB induction mechanisms in Salmonella in response to indole, a biological oxidant for bacteria. We found that acrAB and ramA induction in response to indole is dependent on RamR. However, the cysteine residues of RamR do not play a role in the induction of ramA in response to indole, and the oxidative effect of indole is therefore not related to ramA induction via RamR. Furthermore, we showed that paraquat, a superoxide generator, induces acrAB but not ramA. We further discovered that the mechanism of acrAB induction in response to paraquat is dependent on SoxS. The data indicate that there are at least two independent induction pathways for acrAB in response to extracellular signals such as indole and paraquat. We propose that Salmonella utilizes these regulators for acrAB induction in response to extracellular signals in order to adapt itself to environmental conditions. PMID:21148208

  14. Down regulation of a gene for cadherin, but not alkaline phosphatase, associated with Cry1Ab resistance in the sugarcane borer Diatraea saccharalis.

    Directory of Open Access Journals (Sweden)

    Yunlong Yang

    Full Text Available The sugarcane borer, Diatraea saccharalis, is a major target pest of transgenic corn expressing Bacillus thuringiensis (Bt proteins (i.e., Cry1Ab in South America and the mid-southern region of the United States. Evolution of insecticide resistance in such target pests is a major threat to the durability of transgenic Bt crops. Understanding the pests' resistance mechanisms will facilitate development of effective strategies for delaying or countering resistance. Alterations in expression of cadherin- and alkaline phosphatase (ALP have been associated with Bt resistance in several species of pest insects. In this study, neither the activity nor gene regulation of ALP was associated with Cry1Ab resistance in D. saccharalis. Total ALP enzymatic activity was similar between Cry1Ab-susceptible (Cry1Ab-SS and -resistant (Cry1Ab-RR strains of D. saccharalis. In addition, expression levels of three ALP genes were also similar between Cry1Ab-SS and -RR, and cDNA sequences did not differ between susceptible and resistant larvae. In contrast, altered expression of a midgut cadherin (DsCAD1 was associated with the Cry1Ab resistance. Whereas cDNA sequences of DsCAD1 were identical between the two strains, the transcript abundance of DsCAD1 was significantly lower in Cry1Ab-RR. To verify the involvement of DsCAD1 in susceptibility to Cry1Ab, RNA interference (RNAi was employed to knock-down DsCAD1 expression in the susceptible larvae. Down-regulation of DsCAD1 expression by RNAi was functionally correlated with a decrease in Cry1Ab susceptibility. These results suggest that down-regulation of DsCAD1 is associated with resistance to Cry1Ab in D. saccharalis.

  15. Conformational stability and aggregation of therapeutic monoclonal antibodies studied with ANS and Thioflavin T binding.

    Science.gov (United States)

    Kayser, Veysel; Chennamsetty, Naresh; Voynov, Vladimir; Helk, Bernhard; Trout, Bernhardt L

    2011-01-01

    Characterization of aggregation profiles of monoclonal antibodies (mAb) is gaining importance because an increasing number of mAb-based therapeutics are entering clinical studies and gaining marketing approval. To develop a successful formulation, it is imperative to identify the critical biochemical properties of each potential mAb drug candidate. We investigated the conformational change and aggregation of a human IgG1 using external dye-binding experiments with fluorescence spectroscopy and compared the aggregation profiles obtained to the results of size-exclusion chromatography. We show that using an appropriate dye at selected mAb concentration, unfolding or aggregation can be studied. In addition, dye-binding experiments may be used as conventional assays to study therapeutic mAb stability. PMID:21540645

  16. Ab initio valence calculations in chemistry

    CERN Document Server

    Cook, D B

    1974-01-01

    Ab Initio Valence Calculations in Chemistry describes the theory and practice of ab initio valence calculations in chemistry and applies the ideas to a specific example, linear BeH2. Topics covered include the Schrödinger equation and the orbital approximation to atomic orbitals; molecular orbital and valence bond methods; practical molecular wave functions; and molecular integrals. Open shell systems, molecular symmetry, and localized descriptions of electronic structure are also discussed. This book is comprised of 13 chapters and begins by introducing the reader to the use of the Schrödinge

  17. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    Energy Technology Data Exchange (ETDEWEB)

    Souto, F.J.; Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Kmetyk, L.N. [Sandia National Labs., Albuquerque, NM (United States)

    1994-10-01

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS.

  18. Generation and characterization of a tetraspanin CD151/integrin α6β1-binding domain competitively binding monoclonal antibody for inhibition of tumor progression in HCC

    Science.gov (United States)

    Cai, Jia-Bin; Huang, Xiao-Yong; Wu, Chao; Zhang, Lu; Kang, Qiang; Liu, Li-Xin; Xie, Nan; Shen, Zao-Zhuo; Hu, Mei-Yu; Cao, Ya; Qiu, Shuang-Jian; Sun, Hui-Chuan; Zhou, Jian; Fan, Jia; Shi, Guo-Ming

    2016-01-01

    Our previous studies revealed that tetraspanin CD151 plays multiple roles in the progression of hepatocellular carcinoma (HCC) by forming a functional complex with integrin α6β1. Herein, we generated a monoclonal antibody (mAb) that dissociates the CD151/integrin α6β1 complex, and we evaluated its bioactivity in HCCs. A murine mAb, tetraspanin CD151 (IgG1, called CD151 mAb 9B), was successfully generated against the CD151-integrin α6β1 binding site of CD151 extracellular domains. Co-immunoprecipitation using CD151 mAb 9B followed by Western blotting detected a 28 kDa protein. Both immunofluorescent and immunohistochemical staining showed a good reactivity of CD151 mAb 9B in the plasma membrane and cytoplasm of HCC cells, as well as in liver cells. In vitro assays demonstrated that CD151 mAb 9B could inhibit neoangiogenesis and both the mobility and the invasiveness of HCC cells. An in vivo assay showed that CD151 mAb 9B inhibited tumor growth potential and HCC cells metastasis. We successfully produced a CD151 mAb 9B targeting the CD151/integrin α6β1-binding domain, which not only can displayed good reactivity to the CD151 antigen but also prevented tumor progression in HCC. PMID:26756217

  19. Direct electrical transduction of antibody binding to a covalent virus layer using electrochemical impedance.

    Science.gov (United States)

    Yang, Li-Mei C; Diaz, Juan E; McIntire, Theresa M; Weiss, Gregory A; Penner, Reginald M

    2008-08-01

    Electrochemical impedance spectroscopy is used to detect the binding of a 148.2 kDa antibody to a "covalent virus layer" (CVL) immobilized on a gold electrode. The CVL consisted of M13 phage particles covalently anchored to a 3 mm diameter gold disk electrode. The ability of the CVL to distinguish this antibody ("p-Ab") from a second, nonbinding antibody ("n-Ab") was evaluated as a function of the frequency and phase of the measured current relative to the applied voltage. The binding of p-Ab to the CVL was correlated with a change in the resistance, reducing it at low frequency (1-40 Hz) while increasing it at high frequency (2-140 kHz). The capacitance of the CVL was virtually uncorrelated with p-Ab binding. At both low and high frequency, the electrode resistance was linearly dependent on the p-Ab concentration from 20 to 266 nM but noise compromised the reproducibility of the p-Ab measurement at frequencies below 40 Hz. A "signal-to-noise" ratio for antibody detection was computed based upon the ratio between the measured resistance change upon p-Ab binding and the standard deviation of this change obtained from multiple measurements. In spite of the fact that the impedance change upon p-Ab binding in the low frequency domain was more than 100 times larger than that measured at high frequency, the S/N ratio at high frequency was higher and virtually independent of frequency from 4 to 140 kHz. Attempts to release p-Ab from the CVL using 0.05 M HCl, as previously described for mass-based detection, caused a loss of sensitivity that may be associated with a transition of these phage particles within the CVL from a linear to a coiled conformation at low pH. PMID:18590279

  20. Pregnane X Receptor Represses HNF4α Gene to Induce Insulin-Like Growth Factor-Binding Protein IGFBP1 that Alters Morphology of and Migrates HepG2 Cells.

    Science.gov (United States)

    Kodama, Susumu; Yamazaki, Yuichi; Negishi, Masahiko

    2015-10-01

    Upon treatment with the pregnane X receptor (PXR) activator rifampicin (RIF), human hepatocellular carcinoma HepG2-derived ShP51 cells that stably express PXR showed epithelial-mesenchymal transition (EMT)-like morphological changes and migration. Our recent DNA microarrays have identified hepatocyte nuclear factor (HNF) 4α and insulin-like growth factor-binding protein (IGFBP) 1 mRNAs to be downregulated and upregulated, respectively, in RIF-treated ShP51 cells, and these regulations were confirmed by the subsequent real-time polymerase chain reaction and Western blot analyses. Using this cell system, we demonstrated here that the PXR-HNF4α-IGFBP1 pathway is an essential signal for PXR-induced morphological changes and migration. First, we characterized the molecular mechanism underlying the PXR-mediated repression of the HNF4α gene. Chromatin conformation capture and chromatin immunoprecipitation (ChIP) assays revealed that PXR activation by RIF disrupted enhancer-promoter communication and prompted deacetylation of histone H3 in the HNF4α P1 promoter. Cell-based reporter and ChIP assays showed that PXR targeted the distal enhancer of the HNF4α P1 promoter and stimulated dissociation of HNF3β from the distal enhancer. Subsequently, small interfering RNA knockdown of HNF4α connected PXR-mediated gene regulation with the PXR-induced cellular responses, showing that the knockdown resulted in the upregulation of IGFBP1 and EMT-like morphological changes without RIF treatment. Moreover, recombinant IGFBP1 augmented migration, whereas an anti-IGFBP1 antibody attenuated both PXR-induced morphological changes and migration in ShP51 cells. PXR indirectly activated the IGFBP1 gene by repressing the HNF4α gene, thus enabling upregulation of IGFBP1 to change the morphology of ShP51 cells and cause migration. These results provide new insights into PXR-mediated cellular responses toward xenobiotics including therapeutics. PMID:26232425

  1. Zooming into the binding groove of HLA molecules : which positions and which substitutions change peptide binding most?

    NARCIS (Netherlands)

    van Deutekom, Hanneke W M; Kesmir, C.

    2015-01-01

    Human leukocyte antigen (HLA) genes are the most polymorphic genes in the human genome. Almost all polymorphic residues are located in the peptide-binding groove, resulting in different peptide-binding preferences. Whether a single amino acid change can alter the peptide-binding repertoire of an HLA

  2. H/KDEL receptors mediate host cell intoxication by a viral A/B toxin in yeast

    Science.gov (United States)

    Becker, Björn; Blum, Andrea; Gießelmann, Esther; Dausend, Julia; Rammo, Domenik; Müller, Nina C.; Tschacksch, Emilia; Steimer, Miriam; Spindler, Jenny; Becherer, Ute; Rettig, Jens; Breinig, Frank; Schmitt, Manfred J.

    2016-01-01

    A/B toxins such as cholera toxin, Pseudomonas exotoxin and killer toxin K28 contain a KDEL-like amino acid motif at one of their subunits which ensures retrograde toxin transport through the secretory pathway of a target cell. As key step in host cell invasion, each toxin binds to distinct plasma membrane receptors that are utilized for cell entry. Despite intensive efforts, some of these receptors are still unknown. Here we identify the yeast H/KDEL receptor Erd2p as membrane receptor of K28, a viral A/B toxin carrying an HDEL motif at its cell binding β-subunit. While initial toxin binding to the yeast cell wall is unaffected in cells lacking Erd2p, binding to spheroplasts and in vivo toxicity strongly depend on the presence of Erd2p. Consistently, Erd2p is not restricted to membranes of the early secretory pathway but extends to the plasma membrane where it binds and internalizes HDEL-cargo such as K28 toxin, GFPHDEL and Kar2p. Since human KDEL receptors are fully functional in yeast and restore toxin sensitivity in the absence of endogenous Erd2p, toxin uptake by H/KDEL receptors at the cell surface might likewise contribute to the intoxication efficiency of A/B toxins carrying a KDEL-motif at their cytotoxic A-subunit(s). PMID:27493088

  3. Characterization of Asia 1 sdAb from Camels Bactrianus (C. bactrianus) and Conjugation with Quantum Dots for Imaging FMDV in BHK-21 Cells

    OpenAIRE

    Shuanghui Yin; Shunli Yang; Youjun Shang; Shiqi Sun; Guangqing Zhou; Ye Jin; Hong Tian; Jinyan Wu; Xiangtao Liu

    2013-01-01

    Foot-and-mouth disease (FMD), caused by FMD virus (FMDV), is a highly contagious viral disease affecting cloven-hoofed animals. Camelids have a unique immunoglobulin profile, with the smallest functional heavy-chain antibodies (sdAb or VHH) naturally devoid of light chains with antigen-binding capacity. We screened and characterized five sdAbs against FMDV by immunized library from C. bactrianus with Asia 1 virus-like particles (VLPs). Three of five recombinant sdAbs were stably expressed in ...

  4. Ab interno trabeculectomy: A comprehensive review

    Directory of Open Access Journals (Sweden)

    Ting Ting Liu

    2013-07-01

    Full Text Available PURPOSE To summarize the original literature on ab interno trabeculectomy with the Trabectome system and to review its efficacy and safety in the treatment of glaucoma. METHOD A literature search in PubMed was performed on ab interno trabeculectomy with the Trabectome system, and clinical relevant information was reviewed and summarized. RESULTS Ab interno trabeculectomy with the Trabectome system on average lowered intraocular pressure (IOP to the mid-teens, and decreased the number of required glaucoma medications. Greater preoperative IOP correlated to a greater percent reduction in IOP. The success rates varied among studies, and the definition of success differed by authors. Intraoperative blood reflux was found in nearly all cases. Incidences of early hypotony and IOP spikes were low. No cases of endophthalmitis, wound leak, aqueous misdirection, choroidal hemorrhage or effusions, and irreversible visual acuity decrease (≥2 Snellen lines have been reported. Available studies had a significant amount of data overlap. Only limited data on long-term results was available. There was no randomized controlled trial to date. CONCLUSIONS Ab interno trabeculectomy with the Trabectome system is an effective and safe surgical approach for patients with various types of open angle glaucoma. On average, the procedure at least in the short term lowers IOP to the mid teens regardless of preoperative IOP with or without the aid of topical medications.

  5. Reference: DREDR1ATRD29AB [PLACE

    Lifescience Database Archive (English)

    Full Text Available DREDR1ATRD29AB Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, N... ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590; ...

  6. Lithium Insertion In Silicon Nanowires: An ab Initio Study

    KAUST Repository

    Zhang, Qianfan

    2010-09-08

    The ultrahigh specific lithium ion storage capacity of Si nanowires (SiNWs) has been demonstrated recently and has opened up exciting opportunities for energy storage. However, a systematic theoretical study on lithium insertion in SiNWs remains a challenge, and as a result, understanding of the fundamental interaction and microscopic dynamics during lithium insertion is still lacking. This paper focuses on the study of single Li atom insertion into SiNWs with different sizes and axis orientations by using full ab initio calculations. We show that the binding energy of interstitial Li increases as the SiNW diameter grows. The binding energies at different insertion sites, which can be classified as surface, intermediate, and core sites, are quite different. We find that surface sites are energetically the most favorable insertion positions and that intermediate sites are the most unfavorable insertion positions. Compared with the other growth directions, the [110] SiNWs with different diameters always present the highest binding energies on various insertion locations, which indicates that [110] SiNWs are more favorable by Li doping. Furthermore, we study Li diffusion inside SiNWs. The results show that the Li surface diffusion has a much higher chance to occur than the surface to core diffusion, which is consistent with the experimental observation that the Li insertion in SiNWs is layer by layer from surface to inner region. After overcoming a large barrier crossing surface-to-intermediate region, the diffusion toward center has a higher possibility to occur than the inverse process. © 2010 American Chemical Society.

  7. KINETIC ANALYSIS OF CO-CONDENSATION POLYMERIZATION OF AB2 AND AB MONOMERS

    Institute of Scientific and Technical Information of China (English)

    Min-qiang Yu; Zhi-ping Zhou; De-yue Yan

    2004-01-01

    This work deals with the kinetics of co-condensation polymerization of AB2 and AB monomers, giving expressions of the two-dimensional molecular weight distribution function and the number/weight average molecular weights of the resulting copolymers. The two-dimensional molecular weight distribution depends on two indices, n and l, which are the respective numbers of AB2 and AB units in a copolymer species. The evolution of the two-dimensional weight and z distributions during the co-condensation polymerization has been evaluated systematically. Finally, the two-dimensional distribution was transformed into a one-dimensional molecular weight distribution with only one variable (the molecular weight of the products instead of the degree of polymerization). The calculated results show that the highly branched copolymer has a very broad molecular weight distribution when the co-condensation polymerization approaches completion.

  8. On the Strain Rate Sensitivity of Abs and Abs Plus Fused Deposition Modeling Parts

    Science.gov (United States)

    Vairis, A.; Petousis, M.; Vidakis, N.; Savvakis, K.

    2016-06-01

    In this work the effect of strain rate on the tensile strength of fused deposition modeling parts built with Acrylonitrile-butadiene-styrene (ABS) and ABS plus material is presented. ASTM D638-02a specimens were built with ABS and ABS plus and they were tested on a Schenck Trebel Co. tensile test machine at three different test speeds, equal, lower, and higher to the test speed required by the ASTM D638-02a standard. The experimental tensile strength results were compared and evaluated. The fracture surfaces of selected specimens were examined with a scanning electron microscope, to determine failure mode of the filament strands. It was found that, as the test speed increases, specimens develop higher tensile strength and have higher elastic modulus. Specimens tested in the highest speed of the experiment had on average about 10% higher elastic modulus and developed on average about 11% higher tensile strength.

  9. Leaching behaviour of the Swedish KBS-glasses ABS 39 and ABS 41

    International Nuclear Information System (INIS)

    The planned Swedish KBS glass corrosion investigation program comprises experiments with inactive glasses containing simulated waste, prolonged in-situ tests, the characterization of corrosion products, immiscibility studies, and corrosion experiments with hot glass. This presentation gives a short description of the entire program. It focuses thereafter on some recent leaching results with the inactive KBS glass qualities ABS 39 and ABS 41, which were leached in a manner similar to the PNL MCC-1 test procedure. 5 figures, 9 tables

  10. Thermomechanical properties of ABS/PA AND ABS/PC blends

    OpenAIRE

    GUINAULT, Alain; Sollogoub, Cyrille

    2009-01-01

    International audience The significant increase of Waste Electric and Electronic Equipment (WEEE) has led to an important research in upgrading recycled engineering plastics by means of a blending technique. Classical twin-screw extrusion is compared to a new blending technique, where two polymers are combined together and then flow in several static mixers. This technique allows to obtain different morphologies of compatibilized ABS/PA or ABS/PC blends and the aim of this work is to evalu...

  11. An efficient magnetic tight-binding method for transition metals and alloys

    DEFF Research Database (Denmark)

    Barreteau, Cyrille; Spanjaard, Daniel; Desjonquères, Marie-Catherine

    2016-01-01

    An efficient parameterized self-consistent tight-binding model for transition metals using s, p and d valence atomic orbitals as a basis set is presented. The parameters of our tight-binding model for pure elements are determined from a fit to bulk ab-initio calculations. A very simple procedure ...

  12. Repeated swim stress alters brain benzodiazepine receptors measured in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Weizman, R.; Weizman, A.; Kook, K.A.; Vocci, F.; Deutsch, S.I.; Paul, S.M.

    1989-06-01

    The effects of repeated swim stress on brain benzodiazepine receptors were examined in the mouse using both an in vivo and in vitro binding method. Specific in vivo binding of (/sup 3/H)Ro15-1788 to benzodiazepine receptors was decreased in the hippocampus, cerebral cortex, hypothalamus, midbrain and striatum after repeated swim stress (7 consecutive days of daily swim stress) when compared to nonstressed mice. In vivo benzodiazepine receptor binding was unaltered after repeated swim stress in the cerebellum and pons medulla. The stress-induced reduction in in vivo benzodiazepine receptor binding did not appear to be due to altered cerebral blood flow or to an alteration in benzodiazepine metabolism or biodistribution because there was no difference in (14C)iodoantipyrine distribution or whole brain concentrations of clonazepam after repeated swim stress. Saturation binding experiments revealed a change in both apparent maximal binding capacity and affinity after repeated swim stress. Moreover, a reduction in clonazepam's anticonvulsant potency was also observed after repeated swim stress (an increase in the ED50 dose for protection against pentylenetetrazol-induced seizures), although there was no difference in pentylenetetrazol-induced seizure threshold between the two groups. In contrast to the results obtained in vivo, no change in benzodiazepine receptor binding kinetics was observed using the in vitro binding method. These data suggest that environmental stress can alter the binding parameters of the benzodiazepine receptor and that the in vivo and in vitro binding methods can yield substantially different results.

  13. Repeated swim stress alters brain benzodiazepine receptors measured in vivo

    International Nuclear Information System (INIS)

    The effects of repeated swim stress on brain benzodiazepine receptors were examined in the mouse using both an in vivo and in vitro binding method. Specific in vivo binding of [3H]Ro15-1788 to benzodiazepine receptors was decreased in the hippocampus, cerebral cortex, hypothalamus, midbrain and striatum after repeated swim stress (7 consecutive days of daily swim stress) when compared to nonstressed mice. In vivo benzodiazepine receptor binding was unaltered after repeated swim stress in the cerebellum and pons medulla. The stress-induced reduction in in vivo benzodiazepine receptor binding did not appear to be due to altered cerebral blood flow or to an alteration in benzodiazepine metabolism or biodistribution because there was no difference in [14C]iodoantipyrine distribution or whole brain concentrations of clonazepam after repeated swim stress. Saturation binding experiments revealed a change in both apparent maximal binding capacity and affinity after repeated swim stress. Moreover, a reduction in clonazepam's anticonvulsant potency was also observed after repeated swim stress [an increase in the ED50 dose for protection against pentylenetetrazol-induced seizures], although there was no difference in pentylenetetrazol-induced seizure threshold between the two groups. In contrast to the results obtained in vivo, no change in benzodiazepine receptor binding kinetics was observed using the in vitro binding method. These data suggest that environmental stress can alter the binding parameters of the benzodiazepine receptor and that the in vivo and in vitro binding methods can yield substantially different results

  14. Unexpected effects of gene deletion on mercury interactions with the methylation-deficient mutant hgcAB

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Hui [ORNL; Hurt, Jr., Richard Ashley [ORNL; Johs, Alexander [ORNL; Parks, Jerry M [ORNL; Morrell-Falvey, Jennifer L [ORNL; Liang, Liyuan [ORNL; Elias, Dwayne A [ORNL; Gu, Baohua [ORNL

    2014-01-01

    The hgcA and hgcB gene pair is essential for mercury (Hg) methylation by certain anaerobic bacteria,1 but little is known about how deletion of hgcAB affects cell surface interactions and intracellular uptake of Hg. Here, we compare hgcAB mutants with the wild-type (WT) strains of both Geobacter sulfurreducens PCA and Desulfovibrio desulfuricans ND132 and observe differences in Hg redox transformations, adsorption, and uptake in laboratory incubation studies. In both strains, deletion of hgcAB increased the reduction of Hg(II) but decreased the oxidation of Hg(0) under anaerobic conditions. The measured cellular thiol content in hgcAB mutants was lower than the WT, accounting for decreased adsorption and uptake of Hg. Despite the lack of methylation activity, Hg uptake by the hgcAB continued, albeit at a slower rate than the WT. These findings demonstrate that deletion of the hgcAB gene not only eliminates Hg methylation but also alters cell physiology, resulting in changes to Hg redox reactions, sorption, and uptake by cells.

  15. Anti-interleukin-1 alpha autoantibodies in humans: Characterization, isotype distribution, and receptor-binding inhibition--higher frequency in Schnitzler's syndrome (urticaria and macroglobulinemia)

    Energy Technology Data Exchange (ETDEWEB)

    Saurat, J.H.; Schifferli, J.; Steiger, G.; Dayer, J.M.; Didierjean, L. (Department of Dermatology, University Hospital, Geneva (Switzerland))

    1991-08-01

    Since autoantibodies (Abs) to cytokines may modify their biologic activities, high-affinity binding factors for interleukin-1 alpha (IL-1 alpha BF) were characterized in human sera. IL-1 alpha BF was identified as IgG (1) by sucrose density-gradient centrifugation followed by immunodiffusion autoradiography, (2) by ligand-blotting method, (3) by ligand binding to affinity-immobilized serum IgG, and (4) by IgG affinity purification followed by sucrose density-gradient centrifugation. IL-1 alpha binding activity resided in the F(ab)2 fragment. The apparent equilibrium constant was in the range of IgG found after immunization with conventional antigens (i.e., 10(-9) to 10(-10) mol/L). Anti-IL-1 alpha IgG auto-Abs represented only an extremely small fraction of total IgG (less than 1/10(-5)). Some sera with IL-1 alpha BF and purified IgG thereof were able to inhibit by 96% to 98% the binding of human recombinant IL-1 alpha to its receptor on murine thymoma EL4-6.1 cells, whereas other sera did not. When 125I-labeled anti-IL-1 alpha IgG complexes were injected into rats, they prolonged the plasma half-life of 125I-labeled IL-1 alpha several fold and altered its tissue distribution. The predominant class was IgG (12/19), mainly IgG4 (9/19), but in five of the sera, anti-IL-1 alpha IgA was also detected. In a screening of 271 sera, IL-1 alpha BF was detected in 17/98 normal subjects and was not more frequent in several control groups of patients, except in patients with Schnitzler's syndrome (fever, chronic urticaria, bone pain, and monoclonal IgM paraprotein) (6/9; p less than 0.005). The pathologic significance of these auto-Abs remains to be determined.

  16. Anti-interleukin-1 alpha autoantibodies in humans: Characterization, isotype distribution, and receptor-binding inhibition--higher frequency in Schnitzler's syndrome (urticaria and macroglobulinemia)

    International Nuclear Information System (INIS)

    Since autoantibodies (Abs) to cytokines may modify their biologic activities, high-affinity binding factors for interleukin-1 alpha (IL-1 alpha BF) were characterized in human sera. IL-1 alpha BF was identified as IgG (1) by sucrose density-gradient centrifugation followed by immunodiffusion autoradiography, (2) by ligand-blotting method, (3) by ligand binding to affinity-immobilized serum IgG, and (4) by IgG affinity purification followed by sucrose density-gradient centrifugation. IL-1 alpha binding activity resided in the F(ab)2 fragment. The apparent equilibrium constant was in the range of IgG found after immunization with conventional antigens (i.e., 10(-9) to 10(-10) mol/L). Anti-IL-1 alpha IgG auto-Abs represented only an extremely small fraction of total IgG (less than 1/10(-5)). Some sera with IL-1 alpha BF and purified IgG thereof were able to inhibit by 96% to 98% the binding of human recombinant IL-1 alpha to its receptor on murine thymoma EL4-6.1 cells, whereas other sera did not. When 125I-labeled anti-IL-1 alpha IgG complexes were injected into rats, they prolonged the plasma half-life of 125I-labeled IL-1 alpha several fold and altered its tissue distribution. The predominant class was IgG (12/19), mainly IgG4 (9/19), but in five of the sera, anti-IL-1 alpha IgA was also detected. In a screening of 271 sera, IL-1 alpha BF was detected in 17/98 normal subjects and was not more frequent in several control groups of patients, except in patients with Schnitzler's syndrome (fever, chronic urticaria, bone pain, and monoclonal IgM paraprotein) (6/9; p less than 0.005). The pathologic significance of these auto-Abs remains to be determined

  17. Variability in the cadherin gene in an Ostrinia nubilalis strain selected for Cry1Ab resistance.

    Science.gov (United States)

    Bel, Yolanda; Siqueira, Herbert A A; Siegfried, Blair D; Ferré, Juan; Escriche, Baltasar

    2009-03-01

    Transgenic corn expressing Cry1Ab (a Bacillus thuringiensis toxin) is highly effective in the control of Ostrinia nubilalis. For its toxic action, Cry1Ab has to bind to specific insect midgut proteins. To date, in three Lepidoptera species resistance to a Cry1A toxin has been conferred by mutations in cadherin, a protein of the Lepidoptera midgut membrane. The implication of cadherin in the resistance of an Ostrinia nubilalis colony (Europe-R) selected with Bacillus thuringiensis Cry1Ab protoxin was investigated. Several major mutations in the cadherin (cdh) gene were found, which introduced premature termination codons and/or large deletions (ranging from 1383 to 1701bp). The contribution of these major mutations to the resistance was analyzed in resistant individuals that survived exposure to a high concentration of Cry1Ab protoxin. The results indicated that the presence of major mutations was drastically reduced in individuals that survived exposure. Previous inheritance experiments with the Europe-R strain indicated the involvement of more than one genetic locus and reduced amounts of the cadherin receptor. The results of the present work support a polygenic inheritance of resistance in the Europe-R strain, in which mutations in the cdh gene would contribute to resistance by means of an additive effect. PMID:19114103

  18. Biological activities of binding site specific monoclonal antibodies to prolactin receptors of rabbit mammary gland

    International Nuclear Information System (INIS)

    The biological activity of three monoclonal antibodies (mAbs) against the rabbit mammary prolactin (PRL) receptor (M110, A82, and A917) were investigated using explants of rabbit mammary gland. The three mAbs which were all able to inhibit the binding of 125I-ovine prolactin to its receptor had different biological activities. Two mAbs (M110 and A82) were able to prevent the stimulating effect of PRL on casein synthesis when the molar ratio between the mAb and PRL was 100. One mAb (A917) was able to mimic the action of PRL on both casein and DNA ([3H]thymidine incorporation) synthesis, whereas the other two mAbs were without any stimulatory effect. For this stimulatory effect to be observed, bivalency of the antibody was essential, since monovalent fragments, which were able to inhibit PRL binding, had no agonistic activity. The ability of the mAbs to induce a down-regulation of receptors was also studied. These studies suggest that the binding domain of the receptor might be relatively complex, since only a part of this domain recognized by the antibody with PRL-like activity was able to induce hormonal action. Alternatively, only those antibodies able to microaggregate the receptors may possess PRL-like activity

  19. Genetics Home Reference: GM2-gangliosidosis, AB variant

    Science.gov (United States)

    ... of GM2-gangliosidosis, AB variant: Genetic Testing Registry: Tay-Sachs disease, variant AB These resources from MedlinePlus offer ... AB variant Activator Deficiency/GM2 Gangliosidosis Activator-deficient Tay-Sachs disease GM2 Activator Deficiency Disease GM2 gangliosidosis, type ...

  20. Active G protein-coupled receptors (GPCR), matrix metalloproteinases 2/9 (MMP2/9), heparin-binding epidermal growth factor (hbEGF), epidermal growth factor receptor (EGFR), erbB2, and insulin-like growth factor 1 receptor (IGF-1R) are necessary for trenbolone acetate-induced alterations in protein turnover rate of fused bovine satellite cell cultures.

    Science.gov (United States)

    Thornton, K J; Kamanga-Sollo, E; White, M E; Dayton, W R

    2016-06-01

    Trenbolone acetate (TBA), a testosterone analog, increases protein synthesis and decreases protein degradation in fused bovine satellite cell (BSC) cultures. However, the mechanism through which TBA alters these processes remains unknown. Recent studies indicate that androgens improve rate and extent of muscle growth through a nongenomic mechanism involving G protein-coupled receptors (GPCR), matrix metalloproteinases (MMP), heparin-binding epidermal growth factor (hbEGF), the epidermal growth factor receptor (EGFR), erbB2, and the insulin-like growth factor-1 receptor (IGF-1R). We hypothesized that TBA activates GPCR, resulting in activation of MMP2/9 that releases hbEGF, which activates the EGFR and/or erbB2. To determine whether the proposed nongenomic pathway is involved in TBA-mediated alterations in protein turnover, fused BSC cultures were treated with TBA in the presence or absence of inhibitors for GPCR, MMP2/9, hbEGF, EGFR, erbB2, or IGF-1R, and resultant protein synthesis and degradation rates were analyzed. Assays were replicated at least 9 times for each inhibitor experiment utilizing BSC cultures obtained from at least 3 different steers that had no previous exposure to steroid compounds. As expected, fused BSC cultures treated with 10 n TBA exhibited increased ( BSC cultures with 10 n TBA in the presence of inhibitors for GPCR, MMP2/9, hbEGF, EGFR, erbB2, or IGF-1R suppressed ( 0.05) effect on TBA-mediated decreases in protein degradation. However, inhibition of both EGFR and erbB2 in the presence of 10 n TBA resulted in decreased ( BSC cultures treated with 10 n TBA exhibit increased ( BSC cultures.

  1. Investigation of high level of AsAb, EmAb in fertility female serum infected by chlamydia trachomatis

    International Nuclear Information System (INIS)

    Objective: To investigate the mechanism of chlamydia trachomatis. AsAb, EmAb in female fertility. Methods: LPS antigen of chlamydia in reproduction tract of fertility female was detected by monoclonal antibody and immunology chromatography; the content of AsAb, EmAb in serum of fertility female was detected by ELISA. Results: Infections rate of chlamydia trachomatis in fertility female was higher than that in the control AsAb, EmAb in serum of the fertility patients who were infected with chlamydia trachomatis showed a significant difference from that in the control group. Conclusion: The level of AsAb, EmAb increases in patients who have been infected with chlamydia trachomatis and these cytokines is involved in the course of female fertility

  2. Ab initio mass tensor molecular dynamics

    OpenAIRE

    Tsuchida, Eiji

    2010-01-01

    Mass tensor molecular dynamics was first introduced by Bennett [J. Comput. Phys. 19, 267 (1975)] for efficient sampling of phase space through the use of generalized atomic masses. Here, we show how to apply this method to ab initio molecular dynamics simulations with minimal computational overhead. Test calculations on liquid water show a threefold reduction in computational effort without making the fixed geometry approximation. We also present a simple recipe for estimating the optimal ato...

  3. Reciprocity Theorems for Ab Initio Force Calculations

    CERN Document Server

    Wei, C; Mele, E J; Rappe, A M; Lewis, Steven P.; Rappe, Andrew M.

    1996-01-01

    We present a method for calculating ab initio interatomic forces which scales quadratically with the size of the system and provides a physically transparent representation of the force in terms of the spatial variation of the electronic charge density. The method is based on a reciprocity theorem for evaluating an effective potential acting on a charged ion in the core of each atom. We illustrate the method with calculations for diatomic molecules.

  4. Ab interno trabeculectomy: patient selection and perspectives

    Science.gov (United States)

    Vinod, Kateki; Gedde, Steven J

    2016-01-01

    Ab interno trabeculectomy is one among several recently introduced minimally invasive glaucoma surgeries that avoid a conjunctival incision and full-thickness sclerostomy involved in traditional glaucoma surgery. Ablation of the trabecular meshwork and inner wall of Schlemm’s canal is performed in an arcuate fashion via a clear corneal incision, alone or in combination with phacoemulsification cataract surgery. Intraocular pressure reduction following ab interno trabeculectomy is limited by resistance in distal outflow pathways and generally stabilizes in the mid-to-high teens. Relief of medication burden has been demonstrated by some studies. A very low rate of complications, most commonly transient hyphema and intraocular pressure elevations in the immediate postoperative period, have been reported. However, available data are derived from small retrospective and prospective case series. Randomized, controlled trials are needed to better elucidate the potential merits of ab interno trabeculectomy in the combined setting versus phacoemulsification cataract surgery alone and to compare it with other minimally invasive glaucoma surgeries. PMID:27574396

  5. Highly scalable Ab initio genomic motif identification

    KAUST Repository

    Marchand, Benoît

    2011-01-01

    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  6. Interatomic potentials for Al and Ni from experimental data and ab initio calculations

    Energy Technology Data Exchange (ETDEWEB)

    Mishin, Y.; Farkas, D.; Miehl, M.J.; Papaconstantopoulos, D.A.

    1999-07-01

    New embedded-atom potentials for Al and Ni have been developed by fitting to both experimental data and the results of ab initio calculations. The ab initio data were obtained in the form of energies of different alternative computer-generated crystalline structures of these metals. The potentials accurately reproduce basic equilibrium properties of Al and Ni such as the elastic constants, phonon dispersion curves, vacancy formation and migration energies, stacking fault energies, and surface energies. The equilibrium energies of various alternative structures not included in the fitting database are calculated with these potentials. The results are compared with predictions of total-energy tight-binding calculations for the same structures. The embedded-atom potentials correctly reproduce the structural stability trends, which suggests that they are transferable to different local environments encountered in atomistic simulations of lattice defects.

  7. Investigation of A+c- and Ab-Hypernuclei in Relativistic Mean-Field Model

    Institute of Scientific and Technical Information of China (English)

    TANYu-Hong; CAIChong-Hai; LILei; NINGPing-Zhi

    2003-01-01

    We investigate the properties of A+c- and Ab-hypernuclei within the framework of the relativistic mean-field model (RMF). It is found that no A+c bound states can exist if the A+c potential well depth |UA+c| in nuclear matter is less than 10 MeV. If |UA+c|is less than 20 MeV, A+c cannot bind to the heavier nuclei with atomic number larger than 100. We suggest it is preferable to search the A+c-hypernuclei from medium-heavy nuclear systems in experiment. Very small spin-orbit splitting for the A+c in hypernuclei is a/so observed, and for the Ab it is nearly zero.

  8. Emergent properties of nuclei from ab initio coupled-cluster calculations

    CERN Document Server

    Hagen, G; Hjorth-Jensen, M; Papenbrock, T

    2016-01-01

    Emergent properties such as nuclear saturation and deformation, and the effects on shell structure due to the proximity of the scattering continuum and particle decay channels are fascinating phenomena in atomic nuclei. In recent years, ab initio approaches to nuclei have taken the first steps towards tackling the computational challenge of describing these phenomena from Hamiltonians with microscopic degrees of freedom. This endeavor is now possible due to ideas from effective field theories, novel optimization strategies for nuclear interactions, ab initio methods exhibiting a soft scaling with mass number, and ever-increasing computational power. This paper reviews some of the recent accomplishments. We also present new results. The recently optimized chiral interaction NNLO$_{\\rm sat}$ is shown to provide an accurate description of both charge radii and binding energies in selected light- and medium-mass nuclei up to $^{56}$Ni. We derive an efficient scheme for including continuum effects in coupled-clust...

  9. Glycotope sharing between snail hemolymph and larval schistosomes: larval transformation products alter shared glycan patterns of plasma proteins.

    Directory of Open Access Journals (Sweden)

    Timothy P Yoshino

    Full Text Available Recent evidence supports the involvement of inducible, highly diverse lectin-like recognition molecules in snail hemocyte-mediated responses to larval Schistosoma mansoni. Because host lectins likely are involved in initial parasite recognition, we sought to identify specific carbohydrate structures (glycans shared between larval S. mansoni and its host Biomphalaria glabrata to address possible mechanisms of immune avoidance through mimicry of elements associated with the host immunoreactivity. A panel of monoclonal antibodies (mABs to specific S. mansoni glycans was used to identify the distribution and abundance of shared glycan epitopes (glycotopes on plasma glycoproteins from B. glabrata strains that differ in their susceptibilities to infection by S. mansoni. In addition, a major aim of this study was to determine if larval transformation products (LTPs could bind to plasma proteins, and thereby alter the glycotopes exposed on plasma proteins in a snail strain-specific fashion. Plasma fractions ( 100 kDa from susceptible (NMRI and resistant (BS-90 snail strains were subjected to SDS-PAGE and immunoblot analyses using mAB to LacdiNAc (LDN, fucosylated LDN variants, Lewis X and trimannosyl core glycans. Results confirmed a high degree of glycan sharing, with NMRI plasma exhibiting a greater distribution/abundance of LDN, F-LDN and F-LDN-F than BS-90 plasma ( 100 kDa fraction. Our data suggest that differential binding of S. mansoni LTPs to plasma proteins of susceptible and resistant B. glabrata strains may significantly impact early anti-larval immune reactivity, and in turn, compatibility, in this parasite-host system.

  10. Binding characteristics of swine erythrocyte insulin receptors

    International Nuclear Information System (INIS)

    Crossbred gilts had 8.8 +/- 1.1% maximum binding of [125I]insulin to insulin receptors on erythrocytes. The number of insulin-binding sites per cell was 137 +/- 19, with a binding affinity ranging from 7.4 X 10(7)M-1 to 11.2 X 10(7)M-1 and mean of 8.8 X 10(7)M-1. Pregnant sows had a significant increase in maximum binding due to an increase in number of receptor sites per cell. Lactating sows fed a high-fiber diet and a low-fiber diet did not develop a significant difference in maximum binding of insulin. Sows fed the low-fiber diet had a significantly higher number of binding sites and a significantly lower binding affinity than did sows fed a high-fiber diet. Receptor-binding affinity was lower in the low-fiber diet group than in cycling gilts, whereas data from sows fed the high-fiber diet did not differ from data for cycling gilts. Data from this study indicated that insulin receptors of swine erythrocytes have binding characteristics similar to those in other species. Pregnancy and diet will alter insulin receptor binding in swine

  11. Glycolipid binding preferences of Shiga toxin variants.

    Directory of Open Access Journals (Sweden)

    Sayali S Karve

    Full Text Available The major virulence factor of Shiga toxin producing E. coli, is Shiga toxin (Stx, an AB5 toxin that consists of a ribosomal RNA-cleaving A-subunit surrounded by a pentamer of receptor-binding B subunits. The two major isoforms, Stx1 and Stx2, and Stx2 variants (Stx2a-h significantly differ in toxicity. The exact reason for this toxicity difference is unknown, however different receptor binding preferences are speculated to play a role. Previous studies used enzyme linked immunosorbent assay (ELISA to study binding of Stx1 and Stx2a toxoids to glycolipid receptors. Here, we studied binding of holotoxin and B-subunits of Stx1, Stx2a, Stx2b, Stx2c and Stx2d to glycolipid receptors globotriaosylceramide (Gb3 and globotetraosylceramide (Gb4 in the presence of cell membrane components such as phosphatidylcholine (PC, cholesterol (Ch and other neutral glycolipids. In the absence of PC and Ch, holotoxins of Stx2 variants bound to mixtures of Gb3 with other glycolipids but not to Gb3 or Gb4 alone. Binding of all Stx holotoxins significantly increased in the presence of PC and Ch. Previously, Stx2a has been shown to form a less stable B-pentamer compared to Stx1. However, its effect on glycolipid receptor binding is unknown. In this study, we showed that even in the absence of the A-subunit, the B-subunits of both Stx1 and Stx2a were able to bind to the glycolipids and the more stable B-pentamer formed by Stx1 bound better than the less stable pentamer of Stx2a. B-subunit mutant of Stx1 L41Q, which shows similar stability as Stx2a B-subunits, lacked glycolipid binding, suggesting that pentamerization is more critical for binding of Stx1 than Stx2a.

  12. Characterization of Asia 1 sdAb from camels bactrianus (C. bactrianus and conjugation with quantum dots for imaging FMDV in BHK-21 cells.

    Directory of Open Access Journals (Sweden)

    Shuanghui Yin

    Full Text Available Foot-and-mouth disease (FMD, caused by FMD virus (FMDV, is a highly contagious viral disease affecting cloven-hoofed animals. Camelids have a unique immunoglobulin profile, with the smallest functional heavy-chain antibodies (sdAb or VHH naturally devoid of light chains with antigen-binding capacity. We screened and characterized five sdAbs against FMDV by immunized library from C. bactrianus with Asia 1 virus-like particles (VLPs. Three of five recombinant sdAbs were stably expressed in E.coli, remained highly soluble, and were serotype-specific for VP1 protein of FMDV Asia 1 by ELISA. These failed to completely neutralize the Asia 1 virus. According to the KD value of binding affinity to three sdAbs, which ranged from 0.44 to 0.71 nm by SPR, sdAb-C6 was selected and conjugated with Zn/CdSe quantum dots (QDs to form a QDs-C6 probe, which was used to trace and image the subcellular location of FMDV in BHK-21 cells. The results show that FMD virions were observed from 3 h.p.i., and most of virions were distributed on one side of the nucleus in the cytoplasm. We demonstrate the utility of sdAbs as functionalized QDs are powerful tools for FMDV research.

  13. Mechanism of quinine-dependent monoclonal antibody binding to platelet glycoprotein IIb/IIIa.

    Science.gov (United States)

    Bougie, Daniel W; Peterson, Julie; Rasmussen, Mark; Aster, Richard H

    2015-10-29

    Drug-dependent antibodies (DDAbs) that cause acute thrombocytopenia upon drug exposure are nonreactive in the absence of the drug but bind tightly to a platelet membrane glycoprotein, usually α(IIb)/β3 integrin (GPIIb/IIIa) when the drug is present. How a drug promotes binding of antibody to its target is unknown and is difficult to study with human DDAbs, which are poly-specific and in limited supply. We addressed this question using quinine-dependent murine monoclonal antibodies (mAbs), which, in vitro and in vivo, closely mimic antibodies that cause thrombocytopenia in patients sensitive to quinine. Using surface plasmon resonance (SPR) analysis, we found that quinine binds with very high affinity (K(D) ≈ 10⁻⁹ mol/L) to these mAbs at a molar ratio of ≈ 2:1 but does not bind detectably to an irrelevant mAb. Also using SPR analysis, GPIIb/IIIa was found to bind monovalently to immobilized mAb with low affinity in the absence of quinine and with fivefold greater affinity (K(D) ≈ 2.2 × 10⁻⁶) when quinine was present. Measurements of quinine-dependent binding of intact mAb and fragment antigen-binding (Fab) fragments to platelets showed that affinity is increased 10 000- to 100 000-fold by bivalent interaction between antibody and its target. Together, the findings indicate that the first step in drug-dependent binding of a DDAb is the interaction of the drug with antibody, rather than with antigen, as has been widely thought, where it induces structural changes that enhance the affinity/specificity of antibody for its target epitope. Bivalent binding may be essential for a DDAb to cause thrombocytopenia.

  14. Analyzing binding data.

    Science.gov (United States)

    Motulsky, Harvey J; Neubig, Richard R

    2010-07-01

    Measuring the rate and extent of radioligand binding provides information on the number of binding sites, and their affinity and accessibility of these binding sites for various drugs. This unit explains how to design and analyze such experiments.

  15. A comparison of the biodistribution and biokinetics of {sup 99m}Tc-anti-CD66 mAb BW 250/183 and {sup 99m}Tc-anti-CD45 mAb YTH 24.5 with regard to suitability for myeloablative radioimmunotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Buchmann, Inga [Department of Nuclear Medicine, University Hospital, Ulm (Germany); Klinik und Poliklinik fuer Nuklearmedizin, Gebaeude 210, Johannes-Gutenberg-Universitaet Mainz, 55101, Mainz (Germany); Kull, Thomas; Glatting, Gerhard; Kotzerke, Jorg; Rattat, Dirk; Reske, Sven N. [Department of Nuclear Medicine, University Hospital, Ulm (Germany); Bunjes, Donald; Dohner, Hartmut [Department of Hematology, University Hospital, Ulm (Germany); Hale, Geoffrey [Sir William Dunn School of Pathology, Oxford (United Kingdom)

    2003-05-01

    Radioimmunotherapy (RIT) with radiolabelled monoclonal antibodies (mAbs) is an effective method of achieving myeloablation in leukaemia patients prior to stem cell transplantation (SCT). We wished to compare the approaches of specific binding to leukaemic blasts and non-specific binding to benign red marrow cells, which results in a myeloablative ''cross-fire'' effect. Therefore, we prospectively evaluated the biodistribution and biokinetics of the anti-CD45 mAb YTH 24.5 and the anti-CD66 mAb BW 250/183 with regard to their suitability for myeloablative RIT. The red marrow selective anti-CD66 mAb BW 250/183 (IgG1) binds to normal granulopoietic cells. In contrast, the anti-CD45 mAb YTH 24.5 (IgG2b) binds to 85-90% of acute leukaemic blasts and almost all haematopoietic white cells. Patients with leukaemic blast infiltration of the marrow <25% and assigned for RIT and SCT were included. Twelve patients (eight male, four female; median age 46{+-}7 years) with AML (5), CML (5) or ALL (2) were examined. Both mAbs were labelled with technetium-99m. Within 48 h, 906{+-}209 MBq {sup 99m}Tc-anti-CD66 mAb and 760{+-}331 MBq {sup 99m}Tc-anti-CD45 mAb were injected consecutively. Scintigraphic and urinary measurements were performed 1, 2, 4 and 24 h after injection. Serum activities were evaluated 2, 5, 10, 15, 30 and 60 min and 2, 4 and 24 h after injection. Compared with the anti-CD45 mAb, the anti-CD66 mAb showed an approximately fourfold higher accumulation in the red marrow, a 2.5-fold lower accumulation in the liver and similar accumulation in the kidneys. The serum activity (% of the injected dose) initially decreased faster for the anti-CD45 mAb but was similar for the two mAbs 24 h after injection: 3.3%{+-}1.2% (anti-CD66 mAb) and 2.4%{+-}1.1% (anti-CD45 mAb). The cumulated urinary excretion was 17%{+-}6.6% (anti-CD66 mAb) and 27.3%{+-}7.9% (anti-CD45 mAb) 24 h after application. In these patients with low tumour load, the anti-CD66 mAb BW 250

  16. 汽车ABS/ASR/ACC集成化系统%Integrated ABS/ASR/ACC System for the Car

    Institute of Scientific and Technical Information of China (English)

    刘昭度; 卢江; 时开斌; 安巍

    2001-01-01

    叙述了ACC系统和ABS/ASR系统在改善汽车高速行驶主动安全性方面的功用,阐述了ACC系统是ABS/ASR系统功能的延伸、逻辑的发展及它们之间的内在联系,指出了在ABS/ASR的基础上只需增加测距装置和添加巡航控制子程序,就可方便地实现ABS/ASR/ACC集成化系统,并给出了集成化系统的控制框图和控制方法,论述了ABS/ASR/ACC集成化系统比孤立的ABS/ASR和ACC系统的优越性.%The individual functions of ACC and ABS/ASR are described in the improvements of active safety while the road vehicles travel at a high speed. Being a logic extension of and many inherent connections with ABS/BSR, ACC is easily integrated with ABS/ASR to form an integrated system by adding the headway distance*$-detecting device to the existing ABS/ASR system and expanding the ABS/ASR software. The algorithm flowcharts and control methods of the ABS/ASR/ACC are given. The advantages of the ABS/ASR/ACC system compared with those using the stand alone systems ABS, ASR and ACC are mentioned in details.

  17. Ab initio studies of equations of state and chemical reactions of reactive structural materials

    Science.gov (United States)

    Zaharieva, Roussislava

    subject of studies of the shock or thermally induced chemical reactions of the two solids comprising these reactive materials, from first principles, is a relatively new field of study. The published literature on ab initio techniques or quantum mechanics based approaches consists of the ab initio or ab initio-molecular dynamics studies in related fields that contain a solid and a gas. One such study in the literature involves a gas and a solid. This is an investigation of the adsorption of gasses such as carbon monoxide (CO) on Tungsten. The motivation for these studies is to synthesize alternate or synthetic fuel technology by Fischer-Tropsch process. In this thesis these studies are first to establish the procedure for solid-solid reaction and then to extend that to consider the effects of mechanical strain and temperature on the binding energy and chemisorptions of CO on tungsten. Then in this thesis, similar studies are also conducted on the effect of mechanical strain and temperature on the binding energies of Titanium and hydrogen. The motivations are again to understand the method and extend the method to such solid-solid reactions. A second motivation is to seek strained conditions that favor hydrogen storage and strain conditions that release hydrogen easily when needed. Following the establishment of ab initio and ab initio studies of chemical reactions between a solid and a gas, the next step of research is to study thermally induced chemical reaction between two solids (Ni+Al). Thus, specific new studies of the thesis are as follows: (1) Ab initio Studies of Binding energies associated with chemisorption of (a) CO on W surfaces (111, and 100) at elevated temperatures and strains and (b) adsorption of hydrogen in titanium base. (2) Equations of state of mixtures of reactive material structures from ab initio methods. (3) Ab initio studies of the reaction initiation, transition states and reaction products of intermetallic mixtures of (Ni+Al) at elevated

  18. Ab Initio Molecular Dynamics: A Virtual Laboratory

    OpenAIRE

    Hobbi Mobarhan, Milad

    2014-01-01

    In this thesis, we perform ab initio molecular dynamics (MD) simulations at the Hartree-Fock level, where the forces are computed on-the-fly using the Born-Oppenheimer approximation. The theory behind the Hartree-Fock method is discussed in detail and an implementation of this method based on Gaussian basis functions is explained. We also demonstrate how to calculate the analytic energy derivatives needed for obtaining the forces acting on the nuclei. Hartree-Fock calculations on the ground s...

  19. Asiakassuhdehallinnan kehityssuunnitelma : Case: Oy Combi Cool Ab

    OpenAIRE

    Puikkonen, Touko

    2011-01-01

    Tässä insinöörityössä tutustuttiin Oy Combi Cool Ab:n asiakassuhdehallintaan ja siinä havaittuihin puutteisiin ja kehitystarpeisiin. Työn tarkoituksena oli luoda yritykselle ajan tasalla oleva asiakasrekisteri ja sen pohjalta kehittää asiakassuhdehallintaa etenkin myynnin, oston ja johdon henkilöstön tarpeita ajatellen muovaamalla siitä henkilöstön myynti- ja asiakaspalvelutyöskentelyä tehostava toimiva kokonaisuus. Combi Cool on vuonna 1985 perustettu kylmäalan tukkuliike, joka on vajaan 30 ...

  20. Ab Initio Study on Hypothetical Silver Nitride

    Institute of Scientific and Technical Information of China (English)

    DELIGOZ Engin; COLAKOGLU Kemal; CIFTCI Yasemin Oztekin

    2008-01-01

    We perform the ab initio calculations based on norm-conserving pseudopotentials and density functional theory to investigate the structural, elastic, and thermodynamical properties for silver nitride (AgN) compound that is a member of the 4d transition metal group and has not been synthesized yet. The obtained results are compared with the other available theoretical data, and the agreement is, generally, quite good. We also present the pressure-dependent behaviour of some mechanical and thermodynamical properties for the same compounds.

  1. Testing Distributed ABS System with Fault Injection

    Science.gov (United States)

    Trawczyński, Dawid; Sosnowski, Janusz; Gawkowski, Piotr

    The paper deals with the problem of adapting software implemented fault injection technique (SWIFI) to evaluate dependability of reactive microcontroller systems. We present an original methodology of disturbing controller operation and analyzing fault effects taking into account reactions of the controlled object and the impact of the system environment. Faults can be injected randomly (in space and time) or targeted at the most sensitive elements of the controller to check it at high stresses. This approach allows identifying rarely encountered problems, usually missed in classical approaches. The developed methodology has been used successfully to verify dependability of ABS system. Experimental results are commented in the paper.

  2. Ab initio no core calculations of light nuclei and preludes to Hamiltonian quantum field theory

    Energy Technology Data Exchange (ETDEWEB)

    Vary, J.P.; Maris, P.; /Iowa State U.; Shirokov, A.M.; /Iowa State U. /SINP, Moscow; Honkanen, H.; li, J.; /Iowa State U.; Brodsky, S.J.; /SLAC; Harindranath, A.; /Saha Inst.; Teramond, G.F.de; /Costa Rica U.

    2009-08-03

    Recent advances in ab initio quantum many-body methods and growth in computer power now enable highly precise calculations of nuclear structure. The precision has attained a level sufficient to make clear statements on the nature of 3-body forces in nuclear physics. Total binding energies, spin-dependent structure effects, and electroweak properties of light nuclei play major roles in pinpointing properties of the underlying strong interaction. Eventually,we anticipate a theory bridge with immense predictive power from QCD through nuclear forces to nuclear structure and nuclear reactions. Light front Hamiltonian quantum field theory offers an attractive pathway and we outline key elements.

  3. Ab initio molecular simulations on specific interactions between amyloid beta and monosaccharides

    Science.gov (United States)

    Nomura, Kazuya; Okamoto, Akisumi; Yano, Atsushi; Higai, Shin'ichi; Kondo, Takashi; Kamba, Seiji; Kurita, Noriyuki

    2012-09-01

    Aggregation of amyloid β (Aβ) peptides, which is a key pathogenetic event in Alzheimer's disease, can be caused by cell-surface saccharides. We here investigated stable structures of the solvated complexes of Aβ with some types of monosaccharides using molecular simulations based on protein-ligand docking and classical molecular mechanics methods. Moreover, the specific interactions between Aβ and the monosaccharides were elucidated at an electronic level by ab initio fragment molecular orbital calculations. Based on the results, we proposed which type of monosaccharide prefers to have large binding affinity to Aβ and inhibit the Aβ aggregation.

  4. Characterization of the mycobacterial AdnAB DNA motor provides insights into the evolution of bacterial motor-nuclease machines.

    Science.gov (United States)

    Unciuleac, Mihaela-Carmen; Shuman, Stewart

    2010-01-22

    Mycobacterial AdnAB exemplifies a family of heterodimeric motor-nucleases involved in processing DNA double strand breaks (DSBs). The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal RecB-like nuclease module. Here we conducted a biochemical characterization of the AdnAB motor, using a nuclease-inactivated heterodimer. AdnAB is a vigorous single strand DNA (ssDNA)-dependent ATPase (k(cat) 415 s(-1)), and the affinity of the motor for the ssDNA cofactor increases 140-fold as DNA length is extended from 12 to 44 nucleotides. Using a streptavidin displacement assay, we demonstrate that AdnAB is a 3' --> 5' translocase on ssDNA. AdnAB binds stably to DSB ends. In the presence of ATP, the motor unwinds the DNA duplex without requiring an ssDNA loading strand. We integrate these findings into a model of DSB unwinding in which the "leading" AdnB and "lagging" AdnA motor domains track in tandem, 3' to 5', along the same DNA single strand. This contrasts with RecBCD, in which the RecB and RecD motors track in parallel along the two separated DNA single strands. The effects of 5' and 3' terminal obstacles on ssDNA cleavage by wild-type AdnAB suggest that the AdnA nuclease receives and processes the displaced 5' strand, while the AdnB nuclease cleaves the displaced 3' strand. We present evidence that the distinctive "molecular ruler" function of the ATP-dependent single strand DNase, whereby AdnAB measures the distance from the 5'-end to the sites of incision, reflects directional pumping of the ssDNA through the AdnAB motor into the AdnB nuclease. These and other findings suggest a scenario for the descent of the RecBCD- and AddAB-type DSB-processing machines from an ancestral AdnAB-like enzyme. PMID:19920138

  5. Development of an in vitro binding assay for ecdysone receptor of mysid shrimp (Americamysis bahia)

    Energy Technology Data Exchange (ETDEWEB)

    Yokota, Hirofumi, E-mail: h-yokota@mail.kobe-c.ac.jp [Department of Biosphere Sciences, School of Human Sciences, Kobe College 4-1, Okadayama, Nishinomiya-shi, Hyogo 662-8505 (Japan); Eguchi, Sayaka [Department of Biosphere Sciences, School of Human Sciences, Kobe College 4-1, Okadayama, Nishinomiya-shi, Hyogo 662-8505 (Japan); Nakai, Makoto [Hita Laboratory, Chemicals Evaluation and Research Institute (CERI), 3-822, Ishii-machi, Hita-shi, Oita 877-0061 (Japan)

    2011-10-15

    Highlights: We successfully performed cDNA cloning of EcR and USP of mysid shrimp. We then expressed the ligand-binding domains of the corresponding receptor peptides. The translated peptides could bind to ecdysone agonists as heterodimers. These results indicate that they are functional hormone receptors of mysid shrimp. - Abstract: A global effort has been made to establish screening and testing methods that can identify the effects of endocrine-disrupting chemicals (EDCs) on invertebrates. The purpose of our study was to develop an in vitro receptor binding assay for ecdysone receptor (EcR) in mysid shrimp (Americamysis bahia). We cloned mysid shrimp EcR cDNA (2888 nucleotides) and ultraspiracle (USP) cDNA (2116 nucleotides), and determined that they encode predicted proteins of length 570 and 410 amino acids, respectively. The deduced amino acid sequences of these proteins shared 36-71% homology for EcR and 44-65% for USP with those of other arthropods. Phylogenetic analysis revealed that mysid shrimp EcR was classified into an independent cluster together with the EcRs of another mysid species, Neomysis integer and the cluster diverged early from those of the other taxonomic orders of crustaceans. We then expressed the ligand-binding domains (DEF regions) of mysid shrimp EcR (abEcRdef) and USP (abUSPdef) as glutathione S-transferase (GST)-fusion peptides in Escherichia coli. After purifying the fusion peptides by affinity chromatography and removing the GST labels, we subjected the peptides to a ligand-receptor binding assay. [{sup 3}H]-ponasterone A did not bind to abEcRdef or abUSPdef peptides alone but bound strongly to the abEcRdef/abUSPdef mixture with dissociation constant (K{sub d}) = 2.14 nM. Competitive binding assays showed that the IC{sub 50} values for ponasterone A, muristerone A, 20-hydroxyecdysone, and {alpha}-ecdysone were 1.2, 1.9, 35, and 1200 nM, respectively. In contrast, the IC{sub 50} values for two dibenzoylhydrazine ligands

  6. Quantum phases of AB 2 fermionic chains

    Science.gov (United States)

    Murcia-Correa, L. S.; Franco, R.; Silva-Valencia, J.

    2016-02-01

    A fermionic chain is a one-dimensional system with fermions that interact locally and can jump between sites in the lattice, in particular an AB n chain type, where A and B are sites that exhibit a difference in energy level of Δ and site B is repeated n-times, such that the unit cell has n +1 sites. A limit case of this model, called the ionic Hubbard model (n = 1), has been widely studied due to its interesting physics and applications. In this paper, we study the ground state of an AB 2 chain, which describes the material R 4[Pt 2(P 2O5H2)4X] · nH 2 O. Specifically, we consider a filling with two electrons per unit cell, and using the density matrix renormalization group method we found that the system exhibits the band insulator and Mott correlated insulator phases, as well as an intermediate phase between them. For couplings of Δ = 2,10 and 20, we estimate the critical points that separate these phases through the structure factor and the energy gap in the sector of charge and spin, finding that the position of the critical point rises as a function of Δ.

  7. Biosorption of Acid Blue 290 (AB 290) and Acid Blue 324 (AB 324) dyes on Spirogyra rhizopus

    International Nuclear Information System (INIS)

    In this study, the biosorption of Acid Blue 290 and Acid Blue 324 on Spirogyra rhizopus, a green algae growing on fresh water, was studied with respect to initial pH, temperature, initial dye concentration and biosorbent concentration. The optimum initial pH and temperature values for AB 290 and AB 324 biosorption were found to be 2.0, 30 deg. C and 3.0, 25 deg. C, respectively. It was observed that the adsorbed AB 290 and AB 324 amounts increased with increasing the initial dye concentration up to 1500 and 750 mg/L, respectively. The Langmuir, Freundlich, Redlich-Peterson and Koble-Corrigan isotherm models were applied to the experimental equilibrium data and the isotherm constants were determined by using Polymath 4.1 software. The monolayer coverage capacities of S. rhizopus for AB 290 and AB 324 dyes were found as 1356.6 mg/g and 367.0 mg/g, respectively. The intraparticle diffusion model and the pseudo-second order kinetic model were applied to the experimental data in order to describe the removal mechanism of these acidic dyes by S. rhizopus. The pseudo-second order kinetic model described very well the biosorption kinetics of AB 290 and AB 324 dyes. Thermodynamic studies showed that the biosorption of AB 290 and AB 324 on S. rhizopus was exothermic in nature

  8. Characterization of mAbs to chicken anemia virus and epitope mapping on its viral protein, VP1.

    Science.gov (United States)

    Trinh, Dai Q; Ogawa, Haruko; Bui, Vuong N; Baatartsogt, Tugsbaatar; Kizito, Mugimba K; Yamaguchi, Shigeo; Imai, Kunitoshi

    2015-05-01

    Three (MoCAV/F2, MoCAV/F8 and MoCAV/F11) of four mouse mAbs established against the A2/76 strain of chicken anemia virus (CAV) showed neutralization activity. Immunoprecipitation showed a band at ~50 kDa in A2/76-infected cell lysates by neutralizing mAbs, corresponding to the 50 kDa capsid protein (VP1) of CAV, and the mAbs reacted with recombinant VP1 proteins expressed in Cos7 cells. MoCAV/F2 and MoCAV/F8 neutralized the 14 CAV strains tested, whereas MoCAV/F11 did not neutralize five of the strains, indicating distinct antigenic variation amongst the strains. In blocking immunofluorescence tests with the A2/76-infected cells, binding of MoCAV/F11 was not inhibited by the other mAbs. MoCAV/F2 inhibited the binding of MoCAV/F8 to the antigens and vice versa, suggesting that the two mAbs recognized the same epitope. However, mutations were found in different parts of VP1 of the escape mutants of each mAb: EsCAV/F2 (deletion of T89+A90), EsCAV/F8 (I261T) and EsCAV/F11 (E144G). Thus, the epitopes recognized by MoCAV/F2 and MoCAV/F8 seemed to be topographically close in the VP1 structure, suggesting that VP1 has at least two different neutralizing epitopes. However, MoCAV/F8 did not react with EsCAV/F2 or EsCAV/F8, suggesting that binding of MoCAV/F8 to the epitope requires coexistence of the epitope recognized by MoCAV/F2. In addition, MoCAV/F2, with a titre of 1 : 12 800 to the parent strain, neutralized EsCAV/F2 and EsCAV/F8 with low titres of 32 and 152, respectively. The similarity of the reactivity of MoCAV/F2 and MoCAV/F8 to VP1 may also suggest the existence of a single epitope recognized by these mAbs. PMID:25568186

  9. Arsenic at very low concentrations alters glucocorticoid receptor (GR)-mediated gene activation but not GR-mediated gene repression: complex dose-response effects are closely correlated with levels of activated GR and require a functional GR DNA binding domain.

    Science.gov (United States)

    Bodwell, Jack E; Kingsley, Lauren A; Hamilton, Joshua W

    2004-08-01

    Arsenic (As) contamination of drinking water is considered a principal environmental health threat throughout the world. Chronic intake is associated with an increased risk of cancer, diabetes, and cardiovascular disease, and recent studies suggest increased health risks at levels as low as 5-10 ppb. We report here that 0.05-1 microM (6-120 ppb) As showed stimulatory effects on glucocorticoid receptor (GR)-mediated gene activation in rat EDR3 hepatoma cells of both the endogenous tyrosine aminotransferase (TAT) gene and the reporter genes containing TAT glucocorticoid response elements. At slightly higher concentrations (1-3 microM), the effects of As became inhibitory. Thus, over this narrow concentration range, the effects of As changed from a 2- to 4-fold stimulation to a greater than 2-fold suppression in activity. Interestingly, the inhibitory effect of GR on both AP1- and NF-kappa B-mediated gene activation was not affected by As. The magnitude of GR stimulation and inhibition by As was highly dependent on the cellular level of hormone-activated GR. Mutational deletion studies indicated that the central DNA binding domain (DBD) of GR is the minimal region required for the As effect and does not require free sulfhydryls. Point mutations located within the DBD that have known structural consequences significantly altered the GR response to As. In particular, point mutations in the DBD that confer a DNA-bound GR confirmation abolished the low dose As stimulatory effect but enhanced the inhibitory response, further indicating that the DBD is important for mediating these As effects. PMID:15310238

  10. Workshop on automated beam steering and shaping (ABS). Proceedings

    International Nuclear Information System (INIS)

    A workshop on Automated Beam Steering and Shaping (ABS) was held at CERN in December 1998. This was the first workshop dedicated to this subject. The workshop had two major goals: to review the present status of ABS algorithms and systems around the world and to create a worldwide ABS community. These proceedings contain summary reports from all sessions, contributions from several presentations held at the workshop, and a complete set of abstracts for all presentations. (orig.)

  11. Registration of immunoglobuline AB/AG reaction with planar polarization interferometer

    Science.gov (United States)

    Nabok, Alexei V.; Starodub, Nickolaj F.; Ray, Asim K.; Hassan, Aseel K.

    2000-12-01

    Immobilization of human immunoglobuline (IgG) (AG) and goat on human IGG antibodies (AB) as well as AB/AG specific reaction were studied with planar polarization interferometry (PPI). In this novel method, polarized laser beam was coupled into the planar waveguide made on silicon wafer and consisted of 20nm Si3N4 layer sandwiched between two 1.5 micrometers SiO2 layers with the sensing window etched in the top SIO2 layer. One of the immune components was deposited by means of polyelectrolyte self- assembly on top of the Si3N3 layer within the sensing window, P-component of the polarized light is sensitive to adsorption, while s-component serves as a reference. Thus the outcoming light intensity depends on the phase shift between s- and p-components. Different sequences of immobilization of the immune components were studied with both surface plasmon resonance (SPR) and PPI methods. It was shown that predeposition of a monolayer of protein A, which is believed to affect the orientation of the immune components, causes an additional increase in the sensitivity. PPI method allowed us to improve substantially the sensitivity towards AB/AG reaction as compared to traditional SPR method. Particularly, of specific binding of 3ng/ml AG was registered.

  12. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine.

    Science.gov (United States)

    Gilbert, Gary E; Novakovic, Valerie A; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W

    2015-09-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  13. Ab initio study of beryllium-decorated fullerenes for hydrogen storage

    Science.gov (United States)

    Lee, Hoonkyung; Huang, Bing; Duan, Wenhui; Ihm, Jisoon

    2010-04-01

    We have found that a beryllium (Be) atom on nanostructured materials with H2 molecules generates a Kubas-like dihydrogen complex [Lee, Huang, Duan, and Ihm, Appl. Phys. Lett. 96, 143120 (2010)]. Here, we investigate the feasibility of Be-decorated fullerenes for hydrogen storage using ab initio calculations. We find that the aggregation of Be atoms on pristine fullerenes is energetically preferred, resulting in the dissociation of the dihydrogen. In contrast, for boron (B)-doped fullerenes, Be atoms prefer to be individually attached to B sites of the fullerenes, and a maximum of one H2 molecule binds to each Be atom in a form of dihydrogen with a binding energy of ˜0.3 eV. Our results show that individual dispersed Be-decorated B-doped fullerenes can serve as a room-temperature hydrogen storage medium.

  14. Ab initio study of the electronic properties of the planar Ga5N5 cluster

    Institute of Scientific and Technical Information of China (English)

    Zheng Hao-Ping; Hao Jing-An

    2005-01-01

    The first-principles, all electron, ab initio calculations have been performed for an the amazing stable planar structure of Ga5N5 cluster based on the density functional theory. Electronic structure, Electron affinity, ionization potential, and binding energy are obtained. No spin magnetic moment is found. The results show that the planar structure of the Ga5N5 cluster is stable. It is found that for the planar structure of Ga5N5 cluster, three nitrogen atoms in the N3 subunit bind together with large electon transfer although no free N3 can exist. This may be important to the stability of the planar structure of the Ga5N5 cluster which has the lowest ground-state energy.

  15. Ab-initio calculations of charge symmetry breaking in the A=4 hypernuclei

    CERN Document Server

    Gazda, Daniel

    2015-01-01

    We report on ab-initio NCSM calculations of the A=4 mirror Lambda hypernuclei Lambda-4H and Lambda-4He, using the Bonn-Juelich LO chiral EFT YN potentials plus a CSB Lambda0--Sigma0 mixing vertex. In addition to reproducing rather well the 0+ (g.s.) and 1+ (exc.) binding energies, these four-body calculations demonstrate for the first time that the observed CSB splitting of mirror levels, reaching hundreds of keV for 0+ (g.s.), can be reproduced using realistic theoretical interaction models, although with a non-negligible momentum cutoff dependence. Our results are discussed in relation to recent measurements of the Lambda-4H (0+ g.s.) binding energy [MAMI A1 Collaboration, Phys. Rev. Lett. 114, 232501 (2015)] and the Lambda-4He (1+ exc.) excitation energy [J-PARC E13 Collaboration, Phys. Rev. Lett. 115, 222501 (2015)].

  16. Shared Binding Sites in Lepidoptera for Bacillus thuringiensis Cry1Ja and Cry1A Toxins

    OpenAIRE

    Herrero, Salvador; González-Cabrera, Joel; Tabashnik, Bruce E; Ferré, Juan

    2001-01-01

    Bacillus thuringiensis toxins act by binding to specific target sites in the insect midgut epithelial membrane. The best-known mechanism of resistance to B. thuringiensis toxins is reduced binding to target sites. Because alteration of a binding site shared by several toxins may cause resistance to all of them, knowledge of which toxins share binding sites is useful for predicting cross-resistance. Conversely, cross-resistance among toxins suggests that the toxins share a binding site. At lea...

  17. Singularities of Type-Q ABS Equations

    Directory of Open Access Journals (Sweden)

    James Atkinson

    2011-07-01

    Full Text Available The type-Q equations lie on the top level of the hierarchy introduced by Adler, Bobenko and Suris (ABS in their classification of discrete counterparts of KdV-type integrable partial differential equations. We ask what singularities are possible in the solutions of these equations, and examine the relationship between the singularities and the principal integrability feature of multidimensional consistency. These questions are considered in the global setting and therefore extend previous considerations of singularities which have been local. What emerges are some simple geometric criteria that determine the allowed singularities, and the interesting discovery that generically the presence of singularities leads to a breakdown in the global consistency of such systems despite their local consistency property. This failure to be globally consistent is quantified by introducing a natural notion of monodromy for isolated singularities.

  18. Ab initio alpha-alpha scattering

    CERN Document Server

    Elhatisari, Serdar; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-01-01

    Processes involving alpha particles and alpha-like nuclei comprise a major part of stellar nucleosynthesis and hypothesized mechanisms for thermonuclear supernovae. In an effort towards understanding alpha processes from first principles, we describe in this letter the first ab initio calculation of alpha-alpha scattering. We use lattice effective field theory to describe the low-energy interactions of nucleons and apply a technique called the adiabatic projection method to reduce the eight-body system to an effective two-cluster system. We find good agreement between lattice results and experimental phase shifts for S-wave and D-wave scattering. The computational scaling with particle number suggests that alpha processes involving heavier nuclei are also within reach in the near future.

  19. Ab initio molar volumes and Gaussian radii.

    Science.gov (United States)

    Parsons, Drew F; Ninham, Barry W

    2009-02-12

    Ab initio molar volumes are calculated and used to derive radii for ions and neutral molecules using a spatially diffuse model of the electron distribution with Gaussian spread. The Gaussian radii obtained can be used for computation of nonelectrostatic ion-ion dispersion forces that underlie Hofmeister specific ion effects. Equivalent hard-sphere radii are also derived, and these are in reasonable agreement with crystalline ionic radii. The Born electrostatic self-energy is derived for a Gaussian model of the electronic charge distribution. It is shown that the ionic volumes used in electrostatic calculations of strongly hydrated cosmotropic ions ought best to include the first hydration shell. Ionic volumes for weakly hydrated chaotropic metal cations should exclude electron overlap (in electrostatic calculations). Spherical radii are calculated as well as nonisotropic ellipsoidal radii for nonspherical ions, via their nonisotropic static polarizability tensors. PMID:19140766

  20. Ab Initio Path to Heavy Nuclei

    CERN Document Server

    Binder, Sven; Calci, Angelo; Roth, Robert

    2014-01-01

    We present the first ab initio calculations of nuclear ground states up into the domain of heavy nuclei, spanning the range from 16-O to 132-Sn based on two- plus three-nucleon interactions derived within chiral effective field theory. We employ the similarity renormalization group for preparing the Hamiltonian and use coupled-cluster theory to solve the many-body problem for nuclei with closed sub-shells. Through an analysis of theoretical uncertainties resulting from various truncations in this framework, we identify and eliminate the technical hurdles that previously inhibited the step beyond medium-mass nuclei, allowing for reliable validations of nuclear Hamiltonians in the heavy regime. Following this path we show that chiral Hamiltonians qualitatively reproduce the systematics of nuclear ground-state energies up to the neutron-rich Sn isotopes.

  1. Fragile X mental retardation protein interacts with the RNA-binding protein Caprin1 in neuronal RiboNucleoProtein complexes [corrected].

    Directory of Open Access Journals (Sweden)

    Rachid El Fatimy

    Full Text Available Fragile X syndrome is caused by the absence of the Fragile X Mental Retardation Protein (FMRP, an RNA-binding protein. FMRP is associated with messenger RiboNucleoParticles (mRNPs present in polyribosomes and its absence in neurons leads to alteration in synaptic plasticity as a result of translation regulation defects. The molecular mechanisms by which FMRP plays a role in translation regulation remain elusive. Using immunoprecipitation approaches with monoclonal Ab7G1-1 and a new generation of chicken antibodies, we identified Caprin1 as a novel FMRP-cellular partner. In vivo and in vitro evidence show that Caprin1 interacts with FMRP at the level of the translation machinery as well as in trafficking neuronal granules. As an RNA-binding protein, Caprin1 has in common with FMRP at least two RNA targets that have been identified as CaMKIIα and Map1b mRNAs. In view of the new concept that FMRP species bind to RNA regardless of known structural motifs, we propose that protein interactors might modulate FMRP functions.

  2. Ab initio alpha-alpha scattering

    Science.gov (United States)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.

    2015-12-01

    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  3. Ablation dynamics in laser sclerotomy ab externo

    Science.gov (United States)

    Brinkmann, Ralf; Droege, Gerit; Mohrenstecher, Dirk; Scheu, M.; Birngruber, Reginald

    1996-01-01

    Laser sclerostomy ab externo with flashlamp excited mid-IR laser systems emitting in the 2-3 micrometer spectral range is in phase II clinical trials. Although acutely high success rates were achieved, the restenosis rate after several months is about 40%. Laser pulses of several hundreds of microseconds, known to induce thermo-mechanical explosive evaporation were used for this procedure. We investigated the ablation dynamics in tissue and the cavitation bubble dynamics in water by means of an Er:YAG laser system to estimate the extent of mechanical damage zones in the sclera and in the anterior chamber, which may contribute to the clinical failure. We found substantial mechanical tissue deformation during the ablation process caused by the cavitation effects. Stress waves up to several bar generated by explosive evaporization were measured. The fast mechanical stretching and collapsing of the scleral tissue induced by cavitation resulted in tissue dissection as could be proved by flash photography and histology. The observed high restenosis might be a result of a subsequent enhanced wound healing process. Early fistula occlusions due to iris adherences, observed in about 20% of the clinical cases may be attributed to intraocular trauma induced by vapor bubble expansion through the anterior chamber after scleral perforation. An automatic feedback system minimizing adverse effects by steering and terminating the laser process during scleral fistulization is demonstrated. Moreover, a new approach in laser sclerostomy ab externo is presented using a cw-IR laser diode system emitting at the 1.94 micrometer mid-IR water absorption peak. This system was used in vitro and showed smaller damage zones compared to the pulsed laser radiation.

  4. Ab initio alpha-alpha scattering.

    Science.gov (United States)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  5. Ab initio work function of elemental metals

    DEFF Research Database (Denmark)

    Skriver, Hans Lomholt; Rosengaard, N. M.

    1992-01-01

    We have used a recently developed self-consistent Green’s-function technique based on tight-binding linear-muffin-tin-orbital theory to calculate the work function for the close-packed surfaces of 37 elemental metals. The results agree with the limited experimental data obtained from single...

  6. Protein binding assay for hyaluronate

    Energy Technology Data Exchange (ETDEWEB)

    Lacy, B.E.; Underhill, C.B.

    1986-11-01

    A relatively quick and simple assay for hyaluronate was developed using the specific binding protein, hyaluronectin. The hyaluronectin was obtained by homogenizing the brains of Sprague-Dawley rats, and then centrifuging the homogenate. The resulting supernatant was used as a source of crude hyaluronectin. In the binding assay, the hyaluronectin was mixed with (/sup 3/H)hyaluronate, followed by an equal volume of saturated (NH/sub 4/)/sub 2/SO/sub 4/, which precipitated the hyaluronectin and any (/sup 3/H)hyaluronate associated with it, but left free (/sup 3/H)hyaluronate in solution. The mixture was then centrifuged, and the amount of bound (/sup 3/H)hyaluronate in the precipitate was determined. Using this assay, the authors found that hyaluronectin specifically bound hyaluronate, since other glycosaminoglycans failed to compete for the binding protein. In addition, the interaction between hyaluronectin and hyaluronate was of relatively high affinity, and the size of the hyaluronate did not appear to substantially alter the amount of binding. To determine the amount of hyaluronate in an unknown sample, they used a competition assay in which the binding of a set amount of (/sup 3/H)hyaluronate was blocked by the addition of unlabeled hyaluronate. By comparing the degree of competition of the unknown samples with that of known amounts of hyaluronate, it was possible to determine the amount of hyaluronate in the unknowns. They have found that this method is sensitive to 1 ..mu..g or less of hyaluronate, and is unaffected by the presence of proteins.

  7. Perturbation schedule does not alter retention of a locomotor adaptation across days

    OpenAIRE

    Hussain, Sara J.; Morton, Susanne M.

    2014-01-01

    Motor adaptation in response to gradual vs. abrupt perturbation schedules may involve different neural mechanisms, potentially leading to different levels of motor memory. However, no study has investigated whether perturbation schedules alter memory of a locomotor adaptation across days. We measured adaptation and retention (memory) of altered interlimb symmetry during walking in two groups of participants over 2 days. On day 1, participants adapted to either a single, large perturbation (ab...

  8. Characterization of engineered actin binding proteins that control filament assembly and structure.

    Directory of Open Access Journals (Sweden)

    Crista M Brawley

    Full Text Available BACKGROUND: Eukaryotic cells strictly regulate the structure and assembly of their actin filament networks in response to various stimuli. The actin binding proteins that control filament assembly are therefore attractive targets for those who wish to reorganize actin filaments and reengineer the cytoskeleton. Unfortunately, the naturally occurring actin binding proteins include only a limited set of pointed-end cappers, or proteins that will block polymerization from the slow-growing end of actin filaments. Of the few that are known, most are part of large multimeric complexes that are challenging to manipulate. METHODOLOGY/PRINCIPAL FINDINGS: We describe here the use of phage display mutagenesis to generate of a new class of binding protein that can be targeted to the pointed-end of actin. These proteins, called synthetic antigen binders (sABs, are based on an antibody-like scaffold where sequence diversity is introduced into the binding loops using a novel "reduced genetic code" phage display library. We describe effective strategies to select and screen for sABs that ensure the generated sABs bind to the pointed-end surface of actin exclusively. CONCLUSIONS/SIGNIFICANCE: From our set of pointed-end binders, we identify three sABs with particularly useful properties to systematically probe actin dynamics: one protein that caps the pointed end, a second that crosslinks actin filaments, and a third that severs actin filaments and promotes disassembly.

  9. Dicty_cDB: FCL-AB06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AB06 (Link to dictyBase) - - - Contig-U15603-1 FCL-AB06P ...(Link to Original site) FCL-AB06F 694 FCL-AB06Z 573 FCL-AB06P 1267 - - Show FCL-AB06 Library FCL (Link to library) Clone ID FCL-...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB06Q....Seq.d/ Representative seq. ID FCL-AB06P (Link to Original site) Representative DNA sequence >FCL-AB06 (FCL-AB06Q) /CSM/FCL/FCL-...AB/FCL-AB06Q.Seq.d/ CAATTTTATCGGAACCATCAATTCATGCAGGTTCTGTATTTAGTATTAATTTAACCAAAT CTAGACA

  10. Kopplung von Dichtefunktional- und ab-initio-Methoden

    OpenAIRE

    Goll, Erich

    2008-01-01

    Im Rahmen der Doktorarbeit wurde untersucht, inwieweit die Kopplung von Dichtefunktionalmethoden und ab-initio-Korrelationsmethoden der Quantenchemie eine Verbesserung bezüglich beider Grenzmethoden erbringt. Die Kopplung erfolgt durch eine Aufspaltung des interelektronischen Hamiltonoperators (abstoßende Coulombwechselwirkung). Die kurzreichweitige Wechselwirkung wird mit Dichtefunktionaltheorie behandelt, die langreichweitige mit Hilfe von ab-initio-Methoden. Diese Aufteilung soll dazu dien...

  11. A Case of Laptop Computer-Induced Erythema Ab Igne

    Directory of Open Access Journals (Sweden)

    Nurettin Özgür Doğan

    2014-12-01

    Full Text Available Erythema ab igne, also known as toasted skin syndrome, is a skin reaction characterized by reticulate erythema, brown pigmentation, and telangiectasia. In some cases, epidermal atrophy and scaling are also identified. The condition is usually caused by prolonged exposure to a source of heat or infrared radiation. Here, we report a case of erythema ab igne associated with laptop computer use.

  12. ABS, MBS and CDO compared : An empirical analysis

    NARCIS (Netherlands)

    Vink, D.; Thibeault, A.

    2008-01-01

    The capital market in which the asset-backed securities are issued and traded is composed of three main categories: ABS, MBS and CDOs. We were able to examine a total number of 3,951 loans (worth €730.25 billion) of which 1,129 (worth €208.94 billion) have been classified as ABS. MBS issues represen

  13. ABS, MBS and CDO pricing comparisons : An empirical analysis

    NARCIS (Netherlands)

    Vink, D.; Thibeault, A.

    2008-01-01

    The capital market in which asset-backed securities are issued and traded is composed of three main categories: ABS, MBS and CDOs. The authors examined a total of 3,466 loans (worth €548.51 billion) of which 1,102 (worth €163.90 billion) have been classified as ABS. MBS issues represent 1,782 issues

  14. Taking the Starch out of Oral Biofilm Formation: Molecular Basis and Functional Significance of Salivary α-Amylase Binding to Oral Streptococci

    OpenAIRE

    Nikitkova, Anna E.; Haase, Elaine M.; Scannapieco, Frank A.

    2013-01-01

    α-Amylase-binding streptococci (ABS) are a heterogeneous group of commensal oral bacterial species that comprise a significant proportion of dental plaque microfloras. Salivary α-amylase, one of the most abundant proteins in human saliva, binds to the surface of these bacteria via specific surface-exposed α-amylase-binding proteins. The functional significance of α-amylase-binding proteins in oral colonization by streptococci is important for understanding how salivary components influence or...

  15. Sm and DNA Binding by dual reactive B cells requires distinct V{sub H}, V{sub {kappa}}, and V{sub H} CDR3 structures

    Energy Technology Data Exchange (ETDEWEB)

    Retter, M.W.; Eisenberg, R.A.; Cohen, P.L. [Univ. of North Carolina, Chapel Hill, NC (United States)] [and others

    1995-08-15

    We have previously demonstrated an overlap of the anti-Sm and anti-DNA responses in MRL/Mp-Ipr/Ipr mice. The Ab produced by many anti-Sm hybridomas bind DNA and are encoded by Ig V genes used by anti-DNA hybridomas. In addition, some anti-Sm Ab that bind DNA have acquired mutations that improve DNA binding, indicating that DNA is a selecting Ag in the anti-Sm response. To gain insight into the basis for the dual binding ability of these Ab, we coexpressed the H chain from the anti-Sm hybridoma 2-12 with nine different L chains. Hybridoma 2-12 binds Sm but not DNA, yet expresses the same J558 V{sub H} gene as three anti-Sm hybridomas that bind ssDNA and at least one anti-DNA hybridoma that does not bind Sm. We found that most of the transfectoma Ab bind Sm, but their avidities vary over more than 3 orders of magnitude. Five of the nine transfectoma Ab bind ssDNA, and none bind dsDNA. In general, the ability to bind each Ag follows the binding ability of the hybridoma from which the L chain is derived. H Chain swapping experiments indicate that the H chain, V{sub H} CDR3 in particular contributes to the binding of both Sm and DNA. We conclude that Sm and DNA select for distinct features of V{sub H}, V{sub {kappa}}, and V{sub H} CDR3, suggesting selection by both Ag in the anti-Sm response.

  16. Role of Streptococcus gordonii Amylase-Binding Protein A in Adhesion to Hydroxyapatite, Starch Metabolism, and Biofilm Formation

    OpenAIRE

    Rogers, Jeffrey D.; Palmer, Robert J.; Kolenbrander, Paul E; Scannapieco, Frank A.

    2001-01-01

    Interactions between bacteria and salivary components are thought to be important in the establishment and ecology of the oral microflora. α-Amylase, the predominant salivary enzyme in humans, binds to Streptococcus gordonii, a primary colonizer of the tooth. Previous studies have implicated this interaction in adhesion of the bacteria to salivary pellicles, catabolism of dietary starches, and biofilm formation. Amylase binding is mediated at least in part by the amylase-binding protein A (Ab...

  17. Total iron binding capacity

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003489.htm Total iron binding capacity To use the sharing features on this page, please enable JavaScript. Total iron binding capacity (TIBC) is a blood test to ...

  18. Dead cells in melanoma tumors provide abundant antigen for targeted delivery of ionizing radiation by a mAb to melanin

    OpenAIRE

    Dadachova, Ekaterina; Nosanchuk, Joshua D.; Shi, Li; Schweitzer, Andrew D.; Frenkel, Annie; Nosanchuk, Jerome S.; Casadevall, Arturo

    2004-01-01

    Melanoma is a cancer with a rising incidence, and metastatic disease is almost always lethal. We investigated the feasibility of targeting melanin, an intracellular melanocyte pigment, to deliver cytotoxic radiation to human melanoma cells in vivo by using a melanin-binding mAb (6D2). Nude mice bearing MNT1 pigmented human melanoma tumors were treated with mAb 6D2 labeled with 1.5 mCi (1 Ci = 37 GBq) of the β-emitter 188-Rhenium (188Re) and manifested inhibition of tumor growth and prolonged ...

  19. Plant Hormone Binding Sites

    OpenAIRE

    Napier, Richard

    2004-01-01

    • Aims Receptors for plant hormones are becoming identified with increasing rapidity, although a frustrating number remain unknown. There have also been many more hormone‐binding proteins described than receptors. This Botanical Briefing summarizes what has been discovered about hormone binding sites, their discovery and descriptions, and will not dwell on receptor functions or activities except where these are relevant to understand binding.

  20. Analysis of binding heterogeneity.

    NARCIS (Netherlands)

    Nederlof, M.M.

    1992-01-01

    Binding heterogeneity, due to different functional groups on a reactive surface, plays an important role in the binding of small molecules or ions to many adsorbents, both in industrial processes and in natural environments. The binding heterogeneity is described by a distribution of affinity consta

  1. Serum and plasma fibronectin binds to complement reacted immune complexes primarily via Clq

    DEFF Research Database (Denmark)

    Baatrup, G; Svehag, S E

    1986-01-01

    The binding of fibronectin to human Clq, C3b, and complement-reacted immune complexes (IC) was investigated by enzyme-linked immunosorbent assays. Microplates were coated with BSA followed by incubation with rabbit-anti-BSA IgG or F(ab')2 fragments of rabbit anti-BSA. Incubation of the solid phase...... with serum at 37 degrees C caused attachment of Clq and C3b. Addition of EDTA to the serum inhibited the binding of C3b, but not Clq, whereas substitution of the anti-BSA IgG on the solid phase with the F(ab')2 fragments abrogated the Clq, but not the C3b binding. Fibronectin binding was observed after...

  2. Preparation of grafted ABS and compatibilization of r-PET/ABS blends by the grafted ABS%ABS接枝物的制备及其对r-PET/ABS的增容作用

    Institute of Scientific and Technical Information of China (English)

    陈智军; 王益龙; 郑辰

    2012-01-01

    Two kinds of grafted acrylonitrile-butadiene-styrene copolymer(ABS), i.e. maleic anhydride (MAH) grafted ABS(ABS-g-MAH) and glycidyl methacrylate (GMA) grafted ABS (ABS-g-GMA), were prepared via reactive extrusion and were used as compatibilizer for recycled polyethylene glycol terephthalate (r-PET)/ABS blends. The results show that ABS-g-MAH and ABS-g-GMA can greatly improve the impact strength of the blends. ABS-g-MAH is superior to ABS-g-GMA in compatibilization effect. The optimal compatibilization effect is acquired when the grafting ratio of ABS-g-MAH is 1.35% and the mass content of the copolymer is 5%. Under such conditions, the notched and unnotched *Charpy impact strength of the r-PET/ABS/ABS-g--MAH blends rise by 42% and 23%, respectively, in comparison with those of r-PET/ ABS. The observation by scanning electron microscope(SEM) shows that adding grafted ABS can make ABS be dispersed more homogeneously in the r-PET continuous phase and make particle size more even.%通过反应挤出法制备马来酸酐(MAH)接枝丙烯腈-丁二烯-苯乙烯三元共聚物(ABS)(ABS-g-MAH)和甲基丙烯酸缩水甘油酯(GMA)接枝ABS(ABS-g-GMA),将其用于增容回收聚对苯二甲酸乙二酯(PET)瓶片(r-PET)/ABS共混物,发现能显著提高其混物的冲击强度.ABS-g-MAH的增容效果优于ABS-g-GMA;ABS-g-MAH的接枝率为1.35%,w(ABS-g-MAH)为5%时对r-PET/ABS的增容作用最佳,此时r-PET/ABS/ABS-g-MAH的简支梁缺口冲击强度和无缺口冲击强度比r-PET/ABS分别提高了42%和23%.扫描电子显微镜观察表明,加入ABS接枝物能使ABS在r-PET连续相中的分散更均匀,粒径尺寸更均一.

  3. Antigen-binding site protection during radiolabeling leads to a higher immunoreactive fraction

    International Nuclear Information System (INIS)

    It is generally accepted that the immunointegrity of an antibody (Ab) depends on the preservation of its antigen-binding sites. Our goal was to radiolabel an antibody at several iodine:antibody molar ratios under conditions protecting its combining site and to compare its immunoreactive fraction (IRF) and electrophoretic mobility with those of the same antibody radiolabeled without protection. The data indicate that an antibody radiolabeled while its antigen-binding site is occupied by its antigen had the same IRF, regardless of the number of iodine atoms per antibody molecule. On the other hand, even at an I:Ab ratio of 1:1, the IRF of the same antibody radiolabeled without protection was lower than that of a protected one and decreased with increasing I:Ab ratios. In addition, the iodination of these Ab changes their electrophoretic mobility; however, when the Ab is labeled in the protected state, the degree of change is less. The binding of an antibody to its antigen prior to radiolabeling, therefore, enhances its immuno-integrity and prevents major conformational changes as reflected by electrophoresis

  4. Structural and biophysical characterization of Bacillus thuringiensis insecticidal proteins Cry34Ab1 and Cry35Ab1.

    Directory of Open Access Journals (Sweden)

    Matthew S Kelker

    Full Text Available Bacillus thuringiensis strains are well known for the production of insecticidal proteins upon sporulation and these proteins are deposited in parasporal crystalline inclusions. The majority of these insect-specific toxins exhibit three domains in the mature toxin sequence. However, other Cry toxins are structurally and evolutionarily unrelated to this three-domain family and little is known of their three dimensional structures, limiting our understanding of their mechanisms of action and our ability to engineer the proteins to enhance their function. Among the non-three domain Cry toxins, the Cry34Ab1 and Cry35Ab1 proteins from B. thuringiensis strain PS149B1 are required to act together to produce toxicity to the western corn rootworm (WCR Diabrotica virgifera virgifera Le Conte via a pore forming mechanism of action. Cry34Ab1 is a protein of ∼14 kDa with features of the aegerolysin family (Pfam06355 of proteins that have known membrane disrupting activity, while Cry35Ab1 is a ∼44 kDa member of the toxin_10 family (Pfam05431 that includes other insecticidal proteins such as the binary toxin BinA/BinB. The Cry34Ab1/Cry35Ab1 proteins represent an important seed trait technology having been developed as insect resistance traits in commercialized corn hybrids for control of WCR. The structures of Cry34Ab1 and Cry35Ab1 have been elucidated to 2.15 Å and 1.80 Å resolution, respectively. The solution structures of the toxins were further studied by small angle X-ray scattering and native electrospray ion mobility mass spectrometry. We present here the first published structure from the aegerolysin protein domain family and the structural comparisons of Cry34Ab1 and Cry35Ab1 with other pore forming toxins.

  5. Hydrogen Bonding of 1,2-Azaborines in the Binding Cavity of T4 Lysozyme Mutants: Structures and Thermodynamics.

    Science.gov (United States)

    Lee, Hyelee; Fischer, Marcus; Shoichet, Brian K; Liu, Shih-Yuan

    2016-09-21

    Protein crystallography and calorimetry were used to characterize the binding of 1,2-azaborines to model cavities in T4 lysozyme in direct comparison to their carbonaceous counterparts. In the apolar L99A cavity, affinity for Ab dropped only slightly versus benzene. In the cavity designed to accommodate a single hydrogen bond (L99A/M102Q), Gln102═O···H-N hydrogen bonding for Ab and BEtAb was observed in the crystallographic complexes. The strength of the hydrogen bonding was estimated as 0.94 and 0.64 kcal/mol for Ab and BEtAb, respectively. This work unambiguously demonstrates that 1,2-azaborines can be readily accommodated in classic aryl recognition pockets and establishes one of 1,2-azaborine's distinguishing features from its carbonaceous isostere benzene: its ability to serve as an NH hydrogen bond donor in a biological setting. PMID:27603116

  6. Ab interno trabeculectomy in the adult patient.

    Science.gov (United States)

    SooHoo, Jeffrey R; Seibold, Leonard K; Kahook, Malik Y

    2015-01-01

    Glaucoma is a potentially blinding disease that affects millions of people worldwide. The mainstay of treatment is lowering of intraocular pressure (IOP) through the use of medications, laser and/or incisional surgery. The trabecular meshwork (TM) is thought to be the site of significant resistance to aqueous outflow in open angle glaucoma. Theoretically, an incision through TM or TM removal should decrease this resistance and lead to a significant reduction in IOP. This approach, commonly referred to as goniotomy or trabeculotomy, has been validated in the pediatric population and has been associated with long-term IOP control. In adults, however, removal of TM tissue has been historically associated with more limited and short-lived success. More recent evidence, reveals that even adult patients may benefit significantly from removal of diseased TM tissue and can lead to a significant reduction in IOP that is long-lasting and safe. In this review, we discuss current evidence and techniques for ab interno trabeculectomy using various devices in the adult patient.

  7. Ab initio calculation of the Hoyle state

    CERN Document Server

    Epelbaum, Evgeny; Lee, Dean; Meißner, Ulf-G

    2011-01-01

    The Hoyle state plays a crucial role in the hydrogen burning of stars heavier than our sun and in the production of carbon and other elements necessary for life. This excited state of the carbon-12 nucleus was postulated by Hoyle^{1} as a necessary ingredient for the fusion of three alpha particles to produce carbon at stellar temperatures. Although the Hoyle state was seen experimentally more than a half century ago^{2,3}, nuclear theorists have not yet uncovered the nature of this state from first principles. In this letter we report the first ab initio calculation of the low-lying states of carbon-12 using supercomputer lattice simulations and a theoretical framework known as effective field theory. In addition to the ground state and excited spin-2 state, we find a resonance at -85(3) MeV with all of properties of the Hoyle state and in agreement with the experimentally observed energy. These lattice simulations provide insight into the structure of this unique state and new clues as to the amount of fine...

  8. Current techniques for AB0-incompatible living donor liver transplantation

    Science.gov (United States)

    Rummler, Silke; Bauschke, Astrid; Bärthel, Erik; Jütte, Heike; Maier, Katrin; Ziehm, Patrice; Malessa, Christina; Settmacher, Utz

    2016-01-01

    For a long time, it was considered medical malpractice to neglect the blood group system during transplantation. Because there are far more patients waiting for organs than organs available, a variety of attempts have been made to transplant AB0-incompatible (AB0i) grafts. Improvements in AB0i graft survival rates have been achieved with immunosuppression regimens and plasma treatment procedures. Nevertheless, some grafts are rejected early after AB0i living donor liver transplantation (LDLT) due to antibody mediated rejection or later biliary complications that affect the quality of life. Therefore, the AB0i LDLT is an option only for emergency situations, and it requires careful planning. This review compares the treatment possibilities and their effect on the patients’ graft outcome from 2010 to the present. We compared 11 transplant center regimens and their outcomes. The best improvement, next to plasma treatment procedures, has been reached with the prophylactic use of rituximab more than one week before AB0i LDLT. Unfortunately, no standardized treatment protocols are available. Each center treats its patients with its own scheme. Nevertheless, the transplant results are homogeneous. Due to refined treatment strategies, AB0i LDLT is a feasible option today and almost free of severe complications. PMID:27683633

  9. Antibodies That Efficiently Form Hexamers upon Antigen Binding Can Induce Complement-Dependent Cytotoxicity under Complement-Limiting Conditions

    Science.gov (United States)

    Cook, Erika M.; Lindorfer, Margaret A.; van der Horst, Hilma; Oostindie, Simone; Beurskens, Frank J.; Schuurman, Janine; Zent, Clive S.; Burack, Richard; Parren, Paul W. H. I.

    2016-01-01

    Recently, we demonstrated that IgG Abs can organize into ordered hexamers after binding their cognate Ags expressed on cell surfaces. This process is dependent on Fc:Fc interactions, which promote C1q binding, the first step in classical pathway complement activation. We went on to engineer point mutations that stimulated IgG hexamer formation and complement-dependent cytotoxicity (CDC). The hexamer formation–enhanced (HexaBody) CD20 and CD38 mAbs support faster, more robust CDC than their wild-type counterparts. To further investigate the CDC potential of these mAbs, we used flow cytometry, high-resolution digital imaging, and four-color confocal microscopy to examine their activity against B cell lines and primary chronic lymphocytic leukemia cells in sera depleted of single complement components. We also examined the CDC activity of alemtuzumab (anti-CD52) and mAb W6/32 (anti-HLA), which bind at high density to cells and promote substantial complement activation. Although we observed little CDC for mAb-opsonized cells reacted with sera depleted of early complement components, we were surprised to discover that the Hexabody mAbs, as well as ALM and W6/32, were all quite effective at promoting CDC in sera depleted of individual complement components C6 to C9. However, neutralization studies conducted with an anti-C9 mAb verified that C9 is required for CDC activity against cell lines. These highly effective complement-activating mAbs efficiently focus activated complement components on the cell, including C3b and C9, and promote CDC with a very low threshold of MAC binding, thus providing additional insight into their enhanced efficacy in promoting CDC. PMID:27474078

  10. Use of monoclonal antibodies for the characterization of novel DNA- binding proteins recognized by human autoimmune sera

    OpenAIRE

    1985-01-01

    Autoantibodies to a DNA-binding heterodimer consisting of 70,000 and 80,000 dalton subunits were identified in 30-50% of human autoimmune sera from patients with systemic lupus erythematosus (SLE), mixed connective tissue disease (MCTD), and scleroderma. Three murine monoclonal antibodies (mAb) against the heterodimer were produced in BALB/c mice by immunizing with isolated human B cell nuclei. By immunofluorescence, the mAb and autoimmune sera demonstrated both speckled nucleoplasmic stainin...

  11. Analyzing radioligand binding data.

    Science.gov (United States)

    Motulsky, Harvey; Neubig, Richard

    2002-08-01

    Radioligand binding experiments are easy to perform, and provide useful data in many fields. They can be used to study receptor regulation, discover new drugs by screening for compounds that compete with high affinity for radioligand binding to a particular receptor, investigate receptor localization in different organs or regions using autoradiography, categorize receptor subtypes, and probe mechanisms of receptor signaling, via measurements of agonist binding and its regulation by ions, nucleotides, and other allosteric modulators. This unit reviews the theory of receptor binding and explains how to analyze experimental data. Since binding data are usually best analyzed using nonlinear regression, this unit also explains the principles of curve fitting with nonlinear regression.

  12. Abacavir and the altered peptide repertoire model: clinical implications

    OpenAIRE

    Mallal S; Phillips E.

    2012-01-01

    Structural and biochemical studies showing that abacavir binds non-covalently to the floor of the peptide binding groove of HLA-B*5701 with exquisite specificity to alter the self-peptides that load on the molecule to be presented to the immune system have recently been published [1–4]. This precise mechanistic explanation of why abacavir binds to HLA-B*5701 and no other allele accounts for the 100% negative predictive value of HLA-B*5701 testing for hypersensitivity which underpins it...

  13. On the hierarchical parallelization of ab initio simulations

    CERN Document Server

    Ruiz-Barragan, Sergi; Shiga, Motoyuki

    2016-01-01

    A hierarchical parallelization has been implemented in a new unified code PIMD-SMASH for ab initio simulation where the replicas and the Born-Oppenheimer forces are parallelized. It is demonstrated that ab initio path integral molecular dynamics simulations can be carried out very efficiently for systems up to a few tens of water molecules. The code was then used to study a Diels-Alder reaction of cyclopentadiene and butenone by ab initio string method. A reduction in the reaction energy barrier is found in the presence of hydrogen-bonded water, in accordance with experiment.

  14. Ab initio derivation of model energy density functionals

    Science.gov (United States)

    Dobaczewski, Jacek

    2016-08-01

    I propose a simple and manageable method that allows for deriving coupling constants of model energy density functionals (EDFs) directly from ab initio calculations performed for finite fermion systems. A proof-of-principle application allows for linking properties of finite nuclei, determined by using the nuclear nonlocal Gogny functional, to the coupling constants of the quasilocal Skyrme functional. The method does not rely on properties of infinite fermion systems but on the ab initio calculations in finite systems. It also allows for quantifying merits of different model EDFs in describing the ab initio results.

  15. Attention Alters Perceived Attractiveness.

    Science.gov (United States)

    Störmer, Viola S; Alvarez, George A

    2016-04-01

    Can attention alter the impression of a face? Previous studies showed that attention modulates the appearance of lower-level visual features. For instance, attention can make a simple stimulus appear to have higher contrast than it actually does. We tested whether attention can also alter the perception of a higher-order property-namely, facial attractiveness. We asked participants to judge the relative attractiveness of two faces after summoning their attention to one of the faces using a briefly presented visual cue. Across trials, participants judged the attended face to be more attractive than the same face when it was unattended. This effect was not due to decision or response biases, but rather was due to changes in perceptual processing of the faces. These results show that attention alters perceived facial attractiveness, and broadly demonstrate that attention can influence higher-level perception and may affect people's initial impressions of one another. PMID:26966228

  16. Comparison of Ensemble and Single Molecule Methods for Particle Characterization and Binding Analysis of a PEGylated Single-Domain Antibody.

    Science.gov (United States)

    Schneeweis, Lumelle A; Obenauer-Kutner, Linda; Kaur, Parminder; Yamniuk, Aaron P; Tamura, James; Jaffe, Neil; O'Mara, Brian W; Lindsay, Stuart; Doyle, Michael; Bryson, James

    2015-12-01

    Domain antibodies (dAbs) are single immunoglobulin domains that form the smallest functional unit of an antibody. This study investigates the behavior of these small proteins when covalently attached to the polyethylene glycol (PEG) moiety that is necessary for extending the half-life of a dAb. The effect of the 40 kDa PEG on hydrodynamic properties, particle behavior, and receptor binding of the dAb has been compared by both ensemble solution and surface methods [light scattering, isothermal titration calorimetry (ITC), surface Plasmon resonance (SPR)] and single-molecule atomic force microscopy (AFM) methods (topography, recognition imaging, and force microscopy). The large PEG dominates the properties of the dAb-PEG conjugate such as a hydrodynamic radius that corresponds to a globular protein over four times its size and a much reduced association rate. We have used AFM single-molecule studies to determine the mechanism of PEG-dependent reductions in the effectiveness of the dAb observed by SPR kinetic studies. Recognition imaging showed that all of the PEGylated dAb molecules are active, suggesting that some may transiently become inactive if PEG sterically blocks binding. This helps explain the disconnect between the SPR, determined kinetically, and the force microscopy and ITC results that demonstrated that PEG does not change the binding energy.

  17. High adsorption capacity of heavy metals on two-dimensional MXenes: an ab initio study with molecular dynamics simulation.

    Science.gov (United States)

    Guo, Xun; Zhang, Xitong; Zhao, Shijun; Huang, Qing; Xue, Jianming

    2016-01-01

    Density functional theory (DFT) calculation is employed to study the adsorption properties of Pb and Cu on recently synthesized two-dimensional materials MXenes, including Ti3C2, V2C1 and Ti2C1. The influence of surface decoration with functional groups such as H, OH and F have also been investigated. Most of these studied MXenes exhibit excellent capability to adsorb Pb and Cu, especially the adsorption capacity of Pb on Ti2C1 is as high as 2560 mg g(-1). Both the binding energies and the adsorption capacities are sensitive to the functional groups attached to the MXenes' surface. Ab initio molecular dynamics (ab-init MD) simulation confirms that Ti2C1 remains stable at room temperature after adsorbing Pb atoms. Our calculations imply that these newly emerging two-dimensional MXenes are promising candidates for wastewater treatment and ion separation. PMID:26602974

  18. The β-propeller gene Rv1057 of Mycobacterium tuberculosis has a complex promoter directly regulated by both the MprAB and TrcRS two-component systems

    Science.gov (United States)

    Pang, Xiuhua; Cao, Guangxiang; Neuenschwander, Pierre F.; Haydel, Shelley E.; Hou, Guihua; Howard, Susan T.

    2011-01-01

    SUMMARY The β-propeller gene Rv1057 of Mycobacterium tuberculosis is activated by envelope stress and was first characterized as a regulatory target of the TrcRS two-component system (TCS). Rv1057 expression is repressed by TrcRS, and the Rv1057 proximal promoter contains a TrcR binding site. In this study, we determined that Rv1057 is also directly regulated by MprAB, a TCS associated with envelope stress. Multiple potential MprA binding sites (MprA boxes) were identified in the 1 kb intergenic region upstream of Rv1057, and four sites were shown to bind MprA. Although MprA boxes were found in the proximal promoter, analyses suggest that MprA and TrcR do not compete for binding in this region. An MprAB-dependent, detergent-inducible transcriptional start point for Rv1057 was identified downstream of the MprA boxes, and a second TrcR binding site and small ORF of the 13E12 family were discovered in the distal promoter. MprAB was required for activation of Rv1057 during growth in macrophages and under detergent stress, and lacZ promoter constructs suggest the entire intergenic region is utilized during MprAB-dependent activation of Rv1057. These findings indicate that Rv1057 has an extensive and complex promoter, and provide evidence for coordinated regulation of stress response genes by TCSs. PMID:22099420

  19. Eritema ab igne: relato de um caso Erythema ab igne: a case report

    Directory of Open Access Journals (Sweden)

    Magda Blessmann Weber

    2005-04-01

    Full Text Available A lesão cutânea do eritema ab igne é caracterizada por eritema reticulado, hiperpigmentação, descamação fina, atrofia epidérmica e telangiectasias. Atualmente, a região lombar é a mais atingida, devido ao uso de bolsas de água quente, para alívio de dores crônicas, e por constantes exposições a calor profundo em sessões de fisioterapia. Os autores alertam sobre uma dermatose pouco diagnosticada e que talvez seja mais prevalente pela alta freqüência com que são realizados tratamentos fisioterápicos.The cutaneous lesion of erythema ab igne is characterized by a reticulate erythema, hyperpigmentation, fine scaling, epidermal atrophy and telangiectasis. Currently the lumbar region is the most affected, due to the use of hot water bottles to relieve chronic pains, and by constant exposure to deep heat in physiotherapy sessions. The authors call attention to a dermatosis that is not often diagnosed, and that may be more prevalent, because of the high frequency with which such physiotherapeutic treatments are performed.

  20. Energy conservation campaign at Sandvik AB in Sandviken

    Energy Technology Data Exchange (ETDEWEB)

    Larsson, Rune

    1979-07-01

    Sandvik AB's performed an analysis showing oil consumption for steam production was increasing considerably. Energy conservation measures were implemented to decrease the oil consumption and to make lasting changes.

  1. Tensile deformation mechanisms of ABS/PMMA/EMA blends

    Science.gov (United States)

    Wang, S. H.; Gao, J.; Lin, S. X.; Zhang, P.; Huang, J.; Xu, L. L.

    2014-08-01

    The tensile deformation mechanisms of acrylonitrile - butadiene - styrene (ABS) / polymethyl methacrylate (PMMA) blends toughened by ethylene methacrylate (EMA) copolymer was investigated by analysing the fracture morphology. ABS/PMMA was blended with EMA copolymer by melt mixing technique using co-rotating twin extruder. Tensile tests show that the elongation at break of ABS/PMMA blends can be efficiently improved with the increase in EMA content. Fracture morphology of ABS/PMMA/EMA blends reveals that the material yield induced by hollowing-out of EMA particles and its propagation into yield zone is the main toughening mechanism. Moreover, the appearance that EMA particles in the central area are given priority to hollowing-out may be related to the skin-core structure of the injection moulded parts caused by the different cooling rate between surface and inside in the process of injection moulding.

  2. Rescue of failed filtering blebs with ab interno trephination.

    Science.gov (United States)

    Shihadeh, Wisam A; Ritch, Robert; Liebmann, Jeffrey M

    2006-06-01

    We evaluated the effectiveness of ab interno automated trephination as a technique for rescuing failed mature filtering blebs. A retrospective chart review of 40 failed blebs of 38 patients who had a posttrephination follow-up period of at least 3 months was done. With success defined as intraocular pressure (IOP) control with other modalities of management. Complications were few. We believe that ab interno trephination is an excellent option for rescuing selected failed filtering blebs.

  3. Evaluation of the Urotest AB antibacterial substance detection test.

    OpenAIRE

    Blondeau, J. M.; Yaschuk, Y; Galenzoski, D; Hrabok, D; Isaacson, M; Lee, L.(Department of Physics, Yale University, New Haven, CT, USA); Link, H; Walshaw, L

    1994-01-01

    The Urotest AB was used to detect antimicrobial substances in urine samples. Of 1022 urine specimens evaluated, Urotest AB detected inhibitors in 38.9%. Of 159 urine specimens from patients thought to be taking an antibiotic, inhibitors were detected in 80.5%. This test may help to explain culture negative urine samples from symptomatic patients, and could help elucidate treatment failures and the epidemiology of antibiotic resistance.

  4. Young Modulus of Crystalline Polyethylene from ab Initio Molecular Dynamics

    OpenAIRE

    Hageman, J.C.L.; Meier, Robert J.; M. Heinemann; de Groot, R. A.

    1997-01-01

    The Young modulus for crystalline polyethylene is calculated using ab initio molecular dynamics based on density functional theory in the local density approximation (DFT-LDA). This modulus, which can be seen as the ultimate value for the Young modulus of polyethylene fibers, is found to be 334 GPa. For the first time the modulus is evaluated ab initio (no bias from experimental data) with demonstrated basis set convergence.

  5. Ab initio molecular dynamics with nuclear quantum effects at classical cost: Ring polymer contraction for density functional theory.

    Science.gov (United States)

    Marsalek, Ondrej; Markland, Thomas E

    2016-02-01

    Path integral molecular dynamics simulations, combined with an ab initio evaluation of interactions using electronic structure theory, incorporate the quantum mechanical nature of both the electrons and nuclei, which are essential to accurately describe systems containing light nuclei. However, path integral simulations have traditionally required a computational cost around two orders of magnitude greater than treating the nuclei classically, making them prohibitively costly for most applications. Here we show that the cost of path integral simulations can be dramatically reduced by extending our ring polymer contraction approach to ab initio molecular dynamics simulations. By using density functional tight binding as a reference system, we show that our ring polymer contraction scheme gives rapid and systematic convergence to the full path integral density functional theory result. We demonstrate the efficiency of this approach in ab initio simulations of liquid water and the reactive protonated and deprotonated water dimer systems. We find that the vast majority of the nuclear quantum effects are accurately captured using contraction to just the ring polymer centroid, which requires the same number of density functional theory calculations as a classical simulation. Combined with a multiple time step scheme using the same reference system, which allows the time step to be increased, this approach is as fast as a typical classical ab initio molecular dynamics simulation and 35× faster than a full path integral calculation, while still exactly including the quantum sampling of nuclei. This development thus offers a route to routinely include nuclear quantum effects in ab initio molecular dynamics simulations at negligible computational cost. PMID:26851913

  6. Ab initio molecular dynamics with nuclear quantum effects at classical cost: Ring polymer contraction for density functional theory

    International Nuclear Information System (INIS)

    Path integral molecular dynamics simulations, combined with an ab initio evaluation of interactions using electronic structure theory, incorporate the quantum mechanical nature of both the electrons and nuclei, which are essential to accurately describe systems containing light nuclei. However, path integral simulations have traditionally required a computational cost around two orders of magnitude greater than treating the nuclei classically, making them prohibitively costly for most applications. Here we show that the cost of path integral simulations can be dramatically reduced by extending our ring polymer contraction approach to ab initio molecular dynamics simulations. By using density functional tight binding as a reference system, we show that our ring polymer contraction scheme gives rapid and systematic convergence to the full path integral density functional theory result. We demonstrate the efficiency of this approach in ab initio simulations of liquid water and the reactive protonated and deprotonated water dimer systems. We find that the vast majority of the nuclear quantum effects are accurately captured using contraction to just the ring polymer centroid, which requires the same number of density functional theory calculations as a classical simulation. Combined with a multiple time step scheme using the same reference system, which allows the time step to be increased, this approach is as fast as a typical classical ab initio molecular dynamics simulation and 35× faster than a full path integral calculation, while still exactly including the quantum sampling of nuclei. This development thus offers a route to routinely include nuclear quantum effects in ab initio molecular dynamics simulations at negligible computational cost

  7. Ab initio molecular dynamics with nuclear quantum effects at classical cost: Ring polymer contraction for density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Marsalek, Ondrej; Markland, Thomas E., E-mail: tmarkland@stanford.edu [Department of Chemistry, Stanford University, Stanford, California 94305 (United States)

    2016-02-07

    Path integral molecular dynamics simulations, combined with an ab initio evaluation of interactions using electronic structure theory, incorporate the quantum mechanical nature of both the electrons and nuclei, which are essential to accurately describe systems containing light nuclei. However, path integral simulations have traditionally required a computational cost around two orders of magnitude greater than treating the nuclei classically, making them prohibitively costly for most applications. Here we show that the cost of path integral simulations can be dramatically reduced by extending our ring polymer contraction approach to ab initio molecular dynamics simulations. By using density functional tight binding as a reference system, we show that our ring polymer contraction scheme gives rapid and systematic convergence to the full path integral density functional theory result. We demonstrate the efficiency of this approach in ab initio simulations of liquid water and the reactive protonated and deprotonated water dimer systems. We find that the vast majority of the nuclear quantum effects are accurately captured using contraction to just the ring polymer centroid, which requires the same number of density functional theory calculations as a classical simulation. Combined with a multiple time step scheme using the same reference system, which allows the time step to be increased, this approach is as fast as a typical classical ab initio molecular dynamics simulation and 35× faster than a full path integral calculation, while still exactly including the quantum sampling of nuclei. This development thus offers a route to routinely include nuclear quantum effects in ab initio molecular dynamics simulations at negligible computational cost.

  8. Oligomerization of mannan-binding lectin dictates binding properties and complement activation

    DEFF Research Database (Denmark)

    Kjaer, Troels R; Jensen, Lisbeth; Hansen, Annette;

    2016-01-01

    altered self-surfaces. Associated with the collagen-like stems of these PRMs are three mannan-binding lectin (MBL)-associated serine proteases (MASPs) and two MBL-associated proteins (MAps). The most studied of the PRMs, MBL, is present in serum mainly as trimeric and tetrameric oligomers of the...... structural subunit. We hypothesized that oligomerization of MBL may influence both the potential to bind to microorganisms and the interaction with the MASPs and MAps, thus influencing the ability to initiate complement activation. When testing binding at 37°C, we found higher binding of tetrameric MBL to...... Staphylococcus aureus (S. aureus) than trimeric and dimeric MBL. In serum, we found that tetrameric MBL was the main oligomeric form present in complexes with the MASPs and MAp44. Such preference was confirmed using purified forms of recombinant MBL (rMBL) oligomers, where tetrameric rMBL interacted stronger...

  9. 基于ABS的ABS/ASR集成液压系统设计%ABS/ASR Integrated Hydraulic System Based on ABS

    Institute of Scientific and Technical Information of China (English)

    马岳峰; 刘昭度; 吴利军; 王国业

    2004-01-01

    介绍一种基于JETTA GTX轿车ABS液压系统的ABS/ASR集成液压系统改造方案,该ABS/ASR集成液压系统在原有ABS液压系统的基础上增加较少的液压元件实现全部ABS功能和ASR制动干预控制功能,改造后的集成系统工作可靠,不影响原有的常规制动和ABS制动过程.

  10. Receptor binding studies of the living heart

    International Nuclear Information System (INIS)

    Receptors form a class of intrinsic membrane proteins (or glycoproteins) defined by the high affinity and specificity with which they bind ligands. Many receptors are associated directly or indirectly with membrane ion channels that open or close after a conformational change of the receptor induced by the binding of the neurotransmitter. Changes in number and/or affinity of cardiac neurotransmitter receptors have been associated with myocardial ischemia and infarction, congestive heart failure, and cardiomyopathy as well as diabetes or thyroid-induced heart muscle disease. These alterations of cardiac receptors have been demonstrated in vitro on membrane homogenates from samples collected mainly during surgery or postmortem. The disadvantage of these in vitro binding techniques is that receptors lose their natural environment and their relationships with the other components of the tissue

  11. Structural insights and ab initio sequencing within the DING proteins family

    International Nuclear Information System (INIS)

    DING proteins constitute a recently discovered protein family that is ubiquitous in eukaryotes. The structural insights and the physiological involvements of these intriguing proteins are hereby deciphered. DING proteins constitute an intriguing family of phosphate-binding proteins that was identified in a wide range of organisms, from prokaryotes and archae to eukaryotes. Despite their seemingly ubiquitous occurrence in eukaryotes, their encoding genes are missing from sequenced genomes. Such a lack has considerably hampered functional studies. In humans, these proteins have been related to several diseases, like atherosclerosis, kidney stones, inflammation processes and HIV inhibition. The human phosphate binding protein is a human representative of the DING family that was serendipitously discovered from human plasma. An original approach was developed to determine ab initio the complete and exact sequence of this 38 kDa protein by utilizing mass spectrometry and X-ray data in tandem. Taking advantage of this first complete eukaryotic DING sequence, a immunohistochemistry study was undertaken to check the presence of DING proteins in various mice tissues, revealing that these proteins are widely expressed. Finally, the structure of a bacterial representative from Pseudomonas fluorescens was solved at sub-angstrom resolution, allowing the molecular mechanism of the phosphate binding in these high-affinity proteins to be elucidated

  12. Structural insights and ab initio sequencing within the DING proteins family

    Energy Technology Data Exchange (ETDEWEB)

    Elias, Mikael, E-mail: mikael.elias@weizmann.ac.il [Weizmann Institute of Science, Rehovot (Israel); Liebschner, Dorothee [CRM2, Nancy Université (France); Gotthard, Guillaume; Chabriere, Eric [AFMB, Université Aix-Marseille II (France)

    2011-01-01

    DING proteins constitute a recently discovered protein family that is ubiquitous in eukaryotes. The structural insights and the physiological involvements of these intriguing proteins are hereby deciphered. DING proteins constitute an intriguing family of phosphate-binding proteins that was identified in a wide range of organisms, from prokaryotes and archae to eukaryotes. Despite their seemingly ubiquitous occurrence in eukaryotes, their encoding genes are missing from sequenced genomes. Such a lack has considerably hampered functional studies. In humans, these proteins have been related to several diseases, like atherosclerosis, kidney stones, inflammation processes and HIV inhibition. The human phosphate binding protein is a human representative of the DING family that was serendipitously discovered from human plasma. An original approach was developed to determine ab initio the complete and exact sequence of this 38 kDa protein by utilizing mass spectrometry and X-ray data in tandem. Taking advantage of this first complete eukaryotic DING sequence, a immunohistochemistry study was undertaken to check the presence of DING proteins in various mice tissues, revealing that these proteins are widely expressed. Finally, the structure of a bacterial representative from Pseudomonas fluorescens was solved at sub-angstrom resolution, allowing the molecular mechanism of the phosphate binding in these high-affinity proteins to be elucidated.

  13. Ab initio Studies on Intermolecular Interaction of Formamide and Hydroxyacetonitrile Dimers

    Institute of Scientific and Technical Information of China (English)

    JU Xue-hai; XIE Lun-jia; XIA Qi-ying; XIAO He-ming

    2004-01-01

    The structures, the binding energies and the thermodynamic properties of formamide and hydroxyacetonitrile(HAN) dimers have been studied by means of the self-consistent ab initio Hartree-Fock and the second-order Mφller-Plesset correlation energy correction methods. The counterpoise procedure was used to check the basis set superposition error(BSSE) of the binding energies. There exist cyclic structures in a formamide dimer(Ⅰ), a HAN dimer(Ⅱ) and their heterodimer(Ⅲ). The corrected binding energies for dimers Ⅰ, Ⅱ and Ⅲ are respectively -45.53, -45.83 and -43.89 kJ/mol at the MP2/aug-cc-p VDZ//HF/aug-cc-p VDZ level. The change of the Gibbs free energies(ΔG) in the process of Ⅰ+Ⅱ→2Ⅲ was predicted to be -2.74 kJ/mol at 298.15 K. Dimer Ⅲ can be spontaneously produced in the mixture of formamide and HAN, which is in agreement with the experimental fact that most cyanohydrins are capable of interacting with dipeptide cyclo-His-Phe(CHP).

  14. Python bindings for libcloudph++

    OpenAIRE

    Jarecka, Dorota; Arabas, Sylwester; Del Vento, Davide

    2015-01-01

    This technical note introduces the Python bindings for libcloudph++. The libcloudph++ is a C++ library of algorithms for representing atmospheric cloud microphysics in numerical models. The bindings expose the complete functionality of the library to the Python users. The bindings are implemented using the Boost.Python C++ library and use NumPy arrays. This note includes listings with Python scripts exemplifying the use of selected library components. An example solution for using the Python ...

  15. DNS & Bind Cookbook

    CERN Document Server

    Liu, Cricket

    2011-01-01

    The DNS & BIND Cookbook presents solutions to the many problems faced by network administrators responsible for a name server. Following O'Reilly's popular problem-and-solution cookbook format, this title is an indispensable companion to DNS & BIND, 4th Edition, the definitive guide to the critical task of name server administration. The cookbook contains dozens of code recipes showing solutions to everyday problems, ranging from simple questions, like, "How do I get BIND?" to more advanced topics like providing name service for IPv6 addresses. It's full of BIND configuration files that yo

  16. Python bindings for libcloudph++

    CERN Document Server

    Jarecka, Dorota; Del Vento, Davide

    2015-01-01

    This technical note introduces the Python bindings for libcloudph++. The libcloudph++ is a C++ library of algorithms for representing atmospheric cloud microphysics in numerical models. The bindings expose the complete functionality of the library to the Python users. The bindings are implemented using the Boost.Python C++ library and use NumPy arrays. This note includes listings with Python scripts exemplifying the use of selected library components. An example solution for using the Python bindings to access libcloudph++ from Fortran is presented.

  17. Ab Initio No-Core Shell Model

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, B R; Navratil, P; Vary, J P

    2011-04-11

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory ({chi}EFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The

  18. Ab Initio No-Core Shell Model

    International Nuclear Information System (INIS)

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory (χEFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The resulting NN

  19. Recombinant norovirus-specific scFv inhibit virus-like particle binding to cellular ligands

    Directory of Open Access Journals (Sweden)

    Hardy Michele E

    2008-01-01

    Full Text Available Abstract Background Noroviruses cause epidemic outbreaks of gastrointestinal illness in all age-groups. The rapid onset and ease of person-to-person transmission suggest that inhibitors of the initial steps of virus binding to susceptible cells have value in limiting spread and outbreak persistence. We previously generated a monoclonal antibody (mAb 54.6 that blocks binding of recombinant norovirus-like particles (VLP to Caco-2 intestinal cells and inhibits VLP-mediated hemagglutination. In this study, we engineered the antigen binding domains of mAb 54.6 into a single chain variable fragment (scFv and tested whether these scFv could function as cell binding inhibitors, similar to the parent mAb. Results The scFv54.6 construct was engineered to encode the light (VL and heavy (VH variable domains of mAb 54.6 separated by a flexible peptide linker, and this recombinant protein was expressed in Pichia pastoris. Purified scFv54.6 recognized native VLPs by immunoblot, inhibited VLP-mediated hemagglutination, and blocked VLP binding to H carbohydrate antigen expressed on the surface of a CHO cell line stably transfected to express α 1,2-fucosyltransferase. Conclusion scFv54.6 retained the functional properties of the parent mAb with respect to inhibiting norovirus particle interactions with cells. With further engineering into a form deliverable to the gut mucosa, norovirus neutralizing antibodies represent a prophylactic strategy that would be valuable in outbreak settings.

  20. Nuclear binding near a quantum phase transition

    CERN Document Server

    Elhatisari, Serdar; Rokash, Alexander; Alarcón, Jose Manuel; Du, Dechuan; Klein, Nico; Lu, Bing-nan; Meißner, Ulf-G; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Lee, Dean; Rupak, Gautam

    2016-01-01

    How do protons and neutrons bind to form nuclei? This is the central question of ab initio nuclear structure theory. While the answer may seem as simple as the fact that nuclear forces are attractive, the full story is more complex and interesting. In this work we present numerical evidence from ab initio lattice simulations showing that nature is near a quantum phase transition, a zero-temperature transition driven by quantum fluctuations. Using lattice effective field theory, we perform Monte Carlo simulations for systems with up to twenty nucleons. For even and equal numbers of protons and neutrons, we discover a first-order transition at zero temperature from a Bose-condensed gas of alpha particles (4He nuclei) to a nuclear liquid. Whether one has an alpha-particle gas or nuclear liquid is determined by the strength of the alpha-alpha interactions, and we show that the alpha-alpha interactions depend on the strength and locality of the nucleon-nucleon interactions. The existence of the nearby first-order ...

  1. Nuclear Binding Near a Quantum Phase Transition

    Science.gov (United States)

    Elhatisari, Serdar; Li, Ning; Rokash, Alexander; Alarcón, Jose Manuel; Du, Dechuan; Klein, Nico; Lu, Bing-nan; Meißner, Ulf-G.; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Lee, Dean; Rupak, Gautam

    2016-09-01

    How do protons and neutrons bind to form nuclei? This is the central question of ab initio nuclear structure theory. While the answer may seem as simple as the fact that nuclear forces are attractive, the full story is more complex and interesting. In this work we present numerical evidence from ab initio lattice simulations showing that nature is near a quantum phase transition, a zero-temperature transition driven by quantum fluctuations. Using lattice effective field theory, we perform Monte Carlo simulations for systems with up to twenty nucleons. For even and equal numbers of protons and neutrons, we discover a first-order transition at zero temperature from a Bose-condensed gas of alpha particles (4He nuclei) to a nuclear liquid. Whether one has an alpha-particle gas or nuclear liquid is determined by the strength of the alpha-alpha interactions, and we show that the alpha-alpha interactions depend on the strength and locality of the nucleon-nucleon interactions. This insight should be useful in improving calculations of nuclear structure and important astrophysical reactions involving alpha capture on nuclei. Our findings also provide a tool to probe the structure of alpha cluster states such as the Hoyle state responsible for the production of carbon in red giant stars and point to a connection between nuclear states and the universal physics of bosons at large scattering length.

  2. Emergent properties of nuclei from ab initio coupled-cluster calculations

    Science.gov (United States)

    Hagen, G.; Hjorth-Jensen, M.; Jansen, G. R.; Papenbrock, T.

    2016-06-01

    Emergent properties such as nuclear saturation and deformation, and the effects on shell structure due to the proximity of the scattering continuum and particle decay channels are fascinating phenomena in atomic nuclei. In recent years, ab initio approaches to nuclei have taken the first steps towards tackling the computational challenge of describing these phenomena from Hamiltonians with microscopic degrees of freedom. This endeavor is now possible due to ideas from effective field theories, novel optimization strategies for nuclear interactions, ab initio methods exhibiting a soft scaling with mass number, and ever-increasing computational power. This paper reviews some of the recent accomplishments. We also present new results. The recently optimized chiral interaction NNLO{}{{sat}} is shown to provide an accurate description of both charge radii and binding energies in selected light- and medium-mass nuclei up to 56Ni. We derive an efficient scheme for including continuum effects in coupled-cluster computations of nuclei based on chiral nucleon–nucleon and three-nucleon forces, and present new results for unbound states in the neutron-rich isotopes of oxygen and calcium. The coupling to the continuum impacts the energies of the {J}π =1/{2}-,3/{2}-,7/{2}-,3/{2}+ states in {}{17,23,25}O, and—contrary to naive shell-model expectations—the level ordering of the {J}π =3/{2}+,5/{2}+,9/{2}+ states in {}{53,55,61}Ca. ).

  3. Ab initio molecular dynamics of solvation effects on reactivity at electrified interfaces

    Science.gov (United States)

    Herron, Jeffrey A.; Morikawa, Yoshitada; Mavrikakis, Manos

    2016-08-01

    Using ab initio molecular dynamics as implemented in periodic, self-consistent (generalized gradient approximation Perdew-Burke-Ernzerhof) density functional theory, we investigated the mechanism of methanol electrooxidation on Pt(111). We investigated the role of water solvation and electrode potential on the energetics of the first proton transfer step, methanol electrooxidation to methoxy (CH3O) or hydroxymethyl (CH2OH). The results show that solvation weakens the adsorption of methoxy to uncharged Pt(111), whereas the binding energies of methanol and hydroxymethyl are not significantly affected. The free energies of activation for breaking the C-H and O-H bonds in methanol were calculated through a Blue Moon Ensemble using constrained ab initio molecular dynamics. Calculated barriers for these elementary steps on unsolvated, uncharged Pt(111) are similar to results for climbing-image nudged elastic band calculations from the literature. Water solvation reduces the barriers for both C-H and O-H bond activation steps with respect to their vapor-phase values, although the effect is more pronounced for C-H bond activation, due to less disruption of the hydrogen bond network. The calculated activation energy barriers show that breaking the C-H bond of methanol is more facile than the O-H bond on solvated negatively biased or uncharged Pt(111). However, with positive bias, O-H bond activation is enhanced, becoming slightly more facile than C-H bond activation.

  4. Specific antibody-receptor interactions trigger InlAB-independent uptake of listeria monocytogenes into tumor cell lines

    Directory of Open Access Journals (Sweden)

    Hotz Christian

    2011-07-01

    Full Text Available Abstract Background Specific cell targeting is an important, yet unsolved problem in bacteria-based therapeutic applications, like tumor or gene therapy. Here, we describe the construction of a novel, internalin A and B (InlAB-deficient Listeria monocytogenes strain (Lm-spa+, which expresses protein A of Staphylococcus aureus (SPA and anchors SPA in the correct orientation on the bacterial cell surface. Results This listerial strain efficiently binds antibodies allowing specific interaction of the bacterium with the target recognized by the antibody. Binding of Trastuzumab (Herceptin® or Cetuximab (Erbitux® to Lm-spa+, two clinically approved monoclonal antibodies directed against HER2/neu and EGFR/HER1, respectively, triggers InlAB-independent internalization into non-phagocytic cancer cell lines overexpressing the respective receptors. Internalization, subsequent escape into the host cell cytosol and intracellular replication of these bacteria are as efficient as of the corresponding InlAB-positive, SPA-negative parental strain. This specific antibody/receptor-mediated internalization of Lm-spa+ is shown in the murine 4T1 tumor cell line, the isogenic 4T1-HER2 cell line as well as the human cancer cell lines SK-BR-3 and SK-OV-3. Importantly, this targeting approach is applicable in a xenograft mouse tumor model after crosslinking the antibody to SPA on the listerial cell surface. Conclusions Binding of receptor-specific antibodies to SPA-expressing L. monocytogenes may represent a promising approach to target L. monocytogenes to host cells expressing specific receptors triggering internalization.

  5. Ab initio study of pressure induced structural and electronic properties in TmPo

    Energy Technology Data Exchange (ETDEWEB)

    Makode, Chandrabhan, E-mail: cbmakode@gmail.com; Pataiya, Jagdish; Sanyal, Sankar P. [Department of Physics, Barkatullah University, Bhopal-462026 (India); Panwar, Y. S.; Aynyas, Mahendra [Department of Physics, C.S.A. Govt. P.G. College, Sehore-466001 (India)

    2015-06-24

    We report an ab initio calculation of pressure induced structural phase transition and electronic properties of Thulium Polonide (TmPo).The total energy as a function of volume is obtained by means of self-consistent tight binding linear muffin-tin-orbital (TB-LMTO) method within the local density approximation (LDA). It is found that TmPo is stable in NaCl-type (B{sub 1}-phase) structure to CsCl-type (B{sub 2}-phase) structure of this compound in the pressure range of 7.0 GPa. We also calculate the lattice parameter (a{sub 0}), bulk modulus (B{sub 0}), band structure and density of states. From energy diagram it is observed that TmPo exhibit metallic behavior. The calculated values of equilibrium lattice parameter and bulk modulus are in general good agreement.

  6. Comparative Proteome of Acetobacter pasteurianus Ab3 During the High Acidity Rice Vinegar Fermentation.

    Science.gov (United States)

    Wang, Zhe; Zang, Ning; Shi, Jieyan; Feng, Wei; Liu, Ye; Liang, Xinle

    2015-12-01

    As a traditional Asian food for several centuries, vinegar is known to be produced by acetic acid bacteria. The Acetobacter species is the primary starter for vinegar fermentation and has evolutionarily acquired acetic acid resistance, in which Acetobacter pasteurianus Ab3 is routinely used for industrial production of rice vinegar with a high acidity (9 %, w/v). In contrast to the documented short-term and low acetic acid effects on A. pasteurianus, here we investigated the molecular and cellular signatures of long-term and high acetic acid responses by proteomic profiling with bidimensional gel electrophoresis and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI TOF/MS) analyses. Protein spots of interest were selected based on the threshold ANOVA p value of 0.05 and minimal twofold of differential expression, leading to the identification of 26 proteins that are functionally enriched in oxidoreductase activity, cell membrane, and metabolism. The alterations in protein functioning in respiratory chain and protein denaturation may underlay cellular modifications at the outer membrane. Significantly, we found that at higher acidity fermentation phase, the A. pasteurianus Ab3 cells would adapt to distinct physiological processes from that of an ordinary vinegar fermentation with intermediate acidity, indicating increasing energy requirement and dependency of membrane integrity during the transition of acetic acid production. Together, our study provided new insights into the adaptation mechanisms in A. pasteurianus to high acetic acid environments and yield novel regulators and key pathways during the development of acetic acid resistance.

  7. Melanin-binding radiopharmaceuticals

    Energy Technology Data Exchange (ETDEWEB)

    Packer, S; Fairchild, R G; Watts, K P; Greenberg, D; Hannon, S J

    1980-01-01

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed. (PSB)

  8. DNS BIND Server Configuration

    Directory of Open Access Journals (Sweden)

    Radu MARSANU

    2011-01-01

    Full Text Available After a brief presentation of the DNS and BIND standard for Unix platforms, the paper presents an application which has a principal objective, the configuring of the DNS BIND 9 server. The general objectives of the application are presented, follow by the description of the details of designing the program.

  9. Structural and electronic properties of lead nanowires: Ab-initio study

    International Nuclear Information System (INIS)

    Highlights: → In the present revised manuscript entitled 'Structural and Electronic Properties of Lead Nanowires: Ab-initio study', we have analyzed the stability, electronic properties as well as ground state properties of various atomic configurations of Lead nanowires. → The two-atom zigzag shaped lead nanowire with highest binding energy and lowest total energy has been confirmed as the most stable structure out of the six atomic configurations taken into consideration. → The electronic band structure and density of states have been described in detail with a remarkable observation in case of three-atom triangular lead nanowire having a very small band gap while other atomic configurations are found to be metallic. → The bulk modulus and pressure derivatives for all the stable geometries have also been computed and discussed in the manuscript. The mechanical strength of nanowires has also been discussed in terms of its bulk modulus. → The two-atom ladder shaped nanowire with highest bulk modulus, defends this structure as mechanically stronger than the other tested structure. - Abstract: Ab-initio self-consistent study has been performed to analyze the stability of lead nanowires in its six stable configurations like linear, zigzag, triangular, ladder, square and dumbbell. In the present study, the lowest energy structures have been analyzed under the revised Perdew-Burke-Ernzerhof (revPBE) parameterization of generalized gradient approximation (GGA) potential. The two-atom zigzag shaped atomic configuration with highest binding energy and lowest total energy has been confirmed as the most stable structure out of the six atomic configurations. The electronic band structure and density of states have been discussed in detail with a remarkable observation in case of three-atom triangular lead nanowire having a very small band gap while other configurations are found to be metallic. Bulk modulus, pressure derivatives and lattice parameters for different

  10. Radii and Binding Energies in Oxygen Isotopes: A Challenge for Nuclear Forces.

    Science.gov (United States)

    Lapoux, V; Somà, V; Barbieri, C; Hergert, H; Holt, J D; Stroberg, S R

    2016-07-29

    We present a systematic study of both nuclear radii and binding energies in (even) oxygen isotopes from the valley of stability to the neutron drip line. Both charge and matter radii are compared to state-of-the-art ab initio calculations along with binding energy systematics. Experimental matter radii are obtained through a complete evaluation of the available elastic proton scattering data of oxygen isotopes. We show that, in spite of a good reproduction of binding energies, ab initio calculations with conventional nuclear interactions derived within chiral effective field theory fail to provide a realistic description of charge and matter radii. A novel version of two- and three-nucleon forces leads to considerable improvement of the simultaneous description of the three observables for stable isotopes but shows deficiencies for the most neutron-rich systems. Thus, crucial challenges related to the development of nuclear interactions remain.

  11. Radii and Binding Energies in Oxygen Isotopes: A Challenge for Nuclear Forces.

    Science.gov (United States)

    Lapoux, V; Somà, V; Barbieri, C; Hergert, H; Holt, J D; Stroberg, S R

    2016-07-29

    We present a systematic study of both nuclear radii and binding energies in (even) oxygen isotopes from the valley of stability to the neutron drip line. Both charge and matter radii are compared to state-of-the-art ab initio calculations along with binding energy systematics. Experimental matter radii are obtained through a complete evaluation of the available elastic proton scattering data of oxygen isotopes. We show that, in spite of a good reproduction of binding energies, ab initio calculations with conventional nuclear interactions derived within chiral effective field theory fail to provide a realistic description of charge and matter radii. A novel version of two- and three-nucleon forces leads to considerable improvement of the simultaneous description of the three observables for stable isotopes but shows deficiencies for the most neutron-rich systems. Thus, crucial challenges related to the development of nuclear interactions remain. PMID:27517768

  12. Radii and binding energies in oxygen isotopes: a puzzle for nuclear forces

    CERN Document Server

    Lapoux, V; Barbieri, C; Hergert, H; Holt, J D; Stroberg, R

    2016-01-01

    We present a systematic study of both nuclear radii and binding energies in (even) oxygen isotopes from the valley of stability to the neutron drip line. Both charge and matter radii are compared to state-of-the-art {\\it ab initio} calculations along with binding energy systematics. Experimental matter radii are obtained through a complete evaluation of the available elastic proton scattering data of oxygen isotopes. We show that, in spite of a good reproduction of binding energies, {\\it ab initio} calculations with conventional nuclear interactions derived within chiral effective field theory fail to provide a realistic description of charge and matter radii. A novel version of two- and three-nucleon forces leads to considerable improvement of the simultaneous description of the three observables for stable isotopes, but shows deficiencies for the most neutron-rich systems. Thus, crucial challenges related to the development of nuclear interactions remain.

  13. Experimental and theoretical characterization of the high-affinity cation binding site of the purple membrane

    OpenAIRE

    Pardo, Leonardo; Sepulcre Sánchez, Francesc; Cladera Cerdà, Josep Bartomeu; Duñach, Mireia; Labarta, A.; Tejada, J.; Padrós Morell, Esteve

    1998-01-01

    Binding of Mn2+ or Mg2+ to the high-affinity site of the purple membrane from Halobacterium salinarium has been studied by superconducting quantum interference device magnetometry or by ab initio quantum mechanical calculations, respectively. The binding of Mn2+ cation, in a low-spin state, to the high-affinity site occurs through a major octahedral local symmetry character with a minor rhombic distortion and a coordination number of six. A molecular model of this binding site in the Schiff b...

  14. Dicty_cDB: FCL-AB19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AB19 (Link to dictyBase) - - - Contig-U15232-1 FCL-AB19Z ...(Link to Original site) - - FCL-AB19Z 697 - - - - Show FCL-AB19 Library FCL (Link to library) Clone ID FCL-A... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB19Q.Seq.d/ Representative seq. ID FCL-...AB19Z (Link to Original site) Representative DNA sequence >FCL-AB19 (FCL-AB19Q) /CSM/FCL/FCL-AB/FCL-...KLINFSIFQ* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value FCL-

  15. A New Generation of Cool White Dwarf Atmosphere Models Using Ab Initio Calculations

    CERN Document Server

    Blouin, Simon; Kowalski, Piotr M

    2016-01-01

    Due to their high photospheric density, cool helium-rich white dwarfs (particularly DZ, DQpec and ultracool) are often poorly described by current atmosphere models. As part of our ongoing efforts to design atmosphere models suitable for all cool white dwarfs, we investigate how the ionization ratio of heavy elements and the H$_2$-He collision-induced absorption (CIA) spectrum are altered under fluid-like densities. For the conditions encountered at the photosphere of cool helium-rich white dwarfs, our ab initio calculations show that the ionization of most metals is inhibited and that the H$_2$-He CIA spectrum is significantly distorted for densities higher than 0.1 g/cm$^3$.

  16. Ab Initio Studies of Stratospheric Ozone Depletion Chemistry

    Science.gov (United States)

    Lee, Timothy J.; Head-Gordon, Martin; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    An overview of the current understanding of ozone depletion chemistry, particularly with regards the formation of the so-called Antarctic ozone hole, will be presented together with an outline as to how ab initio quantum chemistry can be used to further our understanding of stratospheric chemistry. The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of fluorine, chlorine, bromine and nitrogen oxide species will be demonstrated by presentation of some example studies. The ab initio results will be shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the theoretical results are shown to fill in the gaps and to resolve experimental controversies. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of halogen oxide species will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of experimental studies.

  17. Rotating wall vessel exposure alters protein secretion and global gene expression in Staphylococcus aureus

    Science.gov (United States)

    Rosado, Helena; O'Neill, Alex J.; Blake, Katy L.; Walther, Meik; Long, Paul F.; Hinds, Jason; Taylor, Peter W.

    2012-04-01

    Staphylococcus aureus is routinely recovered from air and surface samples taken aboard the International Space Station (ISS) and poses a health threat to crew. As bacteria respond to the low shear forces engendered by continuous rotation conditions in a Rotating Wall Vessel (RWV) and the reduced gravitational field of near-Earth flight by altering gene expression, we examined the effect of low-shear RWV growth on protein secretion and gene expression by three S. aureus isolates. When cultured under 1 g, the total amount of protein secreted by these strains varied up to fourfold; under continuous rotation conditions, protein secretion by all three strains was significantly reduced. Concentrations of individual proteins were differentially reduced and no evidence was found for increased lysis. These data suggest that growth under continuous rotation conditions reduces synthesis or secretion of proteins. A limited number of changes in gene expression under continuous rotation conditions were noted: in all isolates vraX, a gene encoding a polypeptide associated with cell wall stress, was down-regulated. A vraX deletion mutant of S. aureus SH1000 was constructed: no differences were found between SH1000 and ΔvraX with respect to colony phenotype, viability, protein export, antibiotic susceptibility, vancomycin kill kinetics, susceptibility to cold or heat and gene modulation. An ab initio protein-ligand docking simulation suggests a major binding site for β-lactam drugs such as imipenem. If such changes to the bacterial phenotype occur during spaceflight, they will compromise the capacity of staphylococci to cause systemic infection and to circumvent antibacterial chemotherapy.

  18. Ab initio simulation of transport phenomena in rarefied gases.

    Science.gov (United States)

    Sharipov, Felix; Strapasson, José L

    2012-09-01

    Ab initio potentials are implemented into the direct simulation Monte Carlo (DSMC) method. Such an implementation allows us to model transport phenomena in rarefied gases without any fitting parameter of intermolecular collisions usually extracted from experimental data. Applying the method proposed by Sharipov and Strapasson [Phys. Fluids 24, 011703 (2012)], the use of ab initio potentials in the DSMC requires the same computational efforts as the widely used potentials such as hard spheres, variable hard sphere, variable soft spheres, etc. At the same time, the ab initio potentials provide more reliable results than any other one. As an example, the transport coefficients of a binary mixture He-Ar, viz., viscosity, thermal conductivity, and thermal diffusion factor, have been calculated for several values of the mole fraction. PMID:23030889

  19. Simplest AB-Thermonuclear Space Propulsion and Electric Generator

    CERN Document Server

    Bolonkin, A

    2007-01-01

    The author applies, develops and researches mini-sized Micro- AB Thermonuclear Reactors for space propulsion and space power systems. These small engines directly convert the high speed charged particles produced in the thermonuclear reactor into vehicle thrust or vehicle electricity with maximum efficiency. The simplest AB-thermonuclear propulsion offered allows spaceships to reach speeds of 20,000 50,000 km/s (1/6 of light speed) for fuel ratio 0.1 and produces a huge amount of useful electric energy. Offered propulsion system permits flight to any planet of our Solar system in short time and to the nearest non-Sun stars by E-being or intellectual robots during a single human life period. Key words: AB-propulsion, thermonuclear propulsion, space propulsion, thermonuclear power system.

  20. Structural, magnetic and electronic properties of FexCoyIrz (x + y + z = 5, 6) clusters: an ab initio study

    KAUST Repository

    Devi, Assa Aravindh Sasikala

    2014-05-01

    Investigations on freestanding binary and ternary clusters of Fe (x) Co (y) Ir (z) (x + y + z = 5, 6) are carried out using ab initio density functional theory techniques. The geometry, chemical order, binding energy, magnetic moment and electronic structure of the clusters are analyzed for the entire range of composition. Composition dependent structural transition is observed in the five atom clusters, while octahedral geometry prevailed in clusters with six atoms. Both the clusters show increment in binding energy with the increase in number of heterogeneous bonds. Analysis based on the chemical order parameter indicates that clusters favor mixing rather than segregation. The clusters exhibit ferromagnetic ordering and the inter-dependence of optimal cluster geometry to the magnetic moments and electronic structure is observed.

  1. Surface Modification of AB2. and AB5 Hydrogen Storage Alloy Electrodes by the Hot-Charging Treatment

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The effect of the hot-charging treatment on the performance ofAB2 and AB5 hydrogen storage alloy electrodes was investigated. The result showed that the treatment can markedly improve the voltage plateau ratio (VPR), the high rate discharge ability (HRDA), the diffusion coefficient of hydrogen DH and the discharge capacity of the AB2 hydrogen storage alloy electrode. The SEM analysis showed that the hot-charging treatment brings about a Ni-rich surface due to the dissolution of Zr oxides. It is also very helpful for the improvement of the kinetic properties of AB2 hydrogen storage alloy electrode because the microcracking o.f the surface results in fresh surface. This can be the basic modification treatment for NiMH battery used in electric vehicles (EVs) in the future. But for AB5 type alloys, the treatment has the disadvantage of impairing the comprehensive electrochemical properties, because the surface of the alloy may be corroded during the treatment. The mechanism of the surface modification of the electrode is also proposed.

  2. Stimulation of UvrD helicase by UvrAB.

    Science.gov (United States)

    Atkinson, John; Guy, Colin P; Cadman, Chris J; Moolenaar, Geri F; Goosen, Nora; McGlynn, Peter

    2009-04-01

    Helicases play critical roles in all aspects of nucleic acid metabolism by catalyzing the remodeling of DNA and RNA structures. UvrD is an abundant helicase in Escherichia coli with well characterized functions in mismatch and nucleotide excision repair and a possible role in displacement of proteins such as RecA from single-stranded DNA. The mismatch repair protein MutL is known to stimulate UvrD. Here we show that the nucleotide excision repair proteins UvrA and UvrB can together stimulate UvrD-catalyzed unwinding of a range of DNA substrates containing strand discontinuities, including forked DNA substrates. The stimulation is specific for UvrD, as UvrAB failed to stimulate Rep helicase, a UvrD homologue. Moreover, although UvrAB can promote limited strand displacement, stimulation of UvrD did not require the strand displacement function of UvrAB. We conclude that UvrAB, like MutL, modulate UvrD helicase activity. This stimulation likely plays a role in DNA strand and protein displacement by UvrD in nucleotide excision repair. Promotion of UvrD-catalyzed unwinding of nicked duplexes by UvrAB may also explain the need for UvrAB and UvrD in Okazaki fragment processing in cells lacking DNA polymerase I. More generally, these data support the idea that helicase activity is regulated in vivo, with helicases acting as part of multisubunit complexes rather than in isolation. PMID:19208629

  3. The R1441C mutation alters the folding properties of the ROC domain of LRRK2

    OpenAIRE

    Li, Yongchao; Dunn, Laura; Greggio, Elisa; Krumm, Brian; Jackson, Graham S.; Cookson, Mark R; Lewis, Patrick A.; Deng, Junpeng

    2009-01-01

    Abstract LRRK2 is a 250kDa multidomain protein, mutations in which cause familial Parkinson's disease. Previously, we have demonstrated that the R1441C mutation in the ROC domain decreases GTPase activity. Here we show that the R1441C alters the folding properties of the ROC domain, lowering its thermodynamic stability. Similar to small GTPases, binding of different guanosine nucleotides alters the stability of the ROC domain, suggesting that there is an alteration in conformation ...

  4. AB Levitrons and their Applications to Earth's Motionless Satellites

    CERN Document Server

    Bolonkin, Alexander

    2007-01-01

    Author offers the new and distinctly revolutionary method of levitation in artificial magnetic field. It is shown that a very big space station and small satellites may be suspended over the Earth's surface and used as motionless radio-TV translators, telecommunication boosters, absolute geographic position locators, personal and mass entertainment and as planet-observation platforms. Presented here is the theory of big AB artificial magnetic field and levitation in it is generally developed. Computation of three macro-projects: space station at altitude 100 km, TV-communication antenna at height 500 m, and multi-path magnetic highway. Key words: levitation, AB Levitrons, motionless space satellite.

  5. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    International Nuclear Information System (INIS)

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1962. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses (≥ 100 mrem/quarter) is for the whole of AB Atomenergi during this year 74. 2 manrem corresponding to about 50 mrem/year and person or 1 % of the maximum permissible dose. 32500 gamma films and 6200 neutron films have been evaluated. The total number of urine analyses is 2700 and of whole body measurements 10

  6. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    International Nuclear Information System (INIS)

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1963. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses during the year is for AB Atomenergi 64.2 manrem which, distributed over the whole company personnel, corresponds to about 40 mrem per year and person or about 1 % of the maximum permissible dose. 37800 gamma films and 6700 neutron films have been evaluated. The total number of urine analyses is 3603 and of whole body measurements 211

  7. Intern kontroll : - En studie om Schroff Scandinavia ABs interna kontroll

    OpenAIRE

    Huldt, Martin; Björksved, Patrick

    2014-01-01

    Sammanfattning: ”Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll” Datum:  2014-06-11 Nivå: Kandidatuppsats i företagsekonomi, 15 ECTS Institution: Akademin för Ekonomi, Samhälle och Teknik, EST,                 Mälardalen Högskola Författare: Patrick Björksved, Martin Huldt Titel: Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll Handledare : Magnus Linderström Nyckelord: Intern kontroll, intern revision, intern styrning, COSO-modellen, Lean product...

  8. Utveckling av ergoterapitjänster vid Helsingfors ergoterapi Ab

    OpenAIRE

    Sandells, Linn

    2015-01-01

    Syftet med examensarbetet är att ta fram kvalitativa rekommendationer på ergoterapitjänster för barn i behov av särskilt stöd. Det har gjorts genom en processinriktad metod, rekommendationerna på ergoterapitjänster har tagits fram för Helsingfors ergoterapi Ab. Aktivitetsrättvisa är den teoretiska referensramen i arbetet. Den frågeställning som besvarats är vilka ergoterapitjänster kan rekommenderas till Helsingfors ergoterapi Ab. För att uppnå resultatet har materialinsamling och intervjuer ...

  9. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    Directory of Open Access Journals (Sweden)

    G. Misra

    2011-01-01

    Full Text Available Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P, volume (V and temperature (T that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This ab initio method is extended to derive the equation of state for Mercuric Calcogenides. The present equation of state has also been tested for the prediction of End Point. The computed results compare well with Quantum statistical data.

  10. Towards new horizons in ab initio nuclear structure theory

    International Nuclear Information System (INIS)

    We review recent advances in ab initio nuclear structure theory, which have changed the horizons of this field. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to further soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative QCD-based predictions are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (authors)

  11. Recent achievements in ab initio modelling of liquid water

    CERN Document Server

    Khaliullin, Rustam Z

    2013-01-01

    The application of newly developed first-principle modeling techniques to liquid water deepens our understanding of the microscopic origins of its unusual macroscopic properties and behaviour. Here, we review two novel ab initio computational methods: second-generation Car-Parrinello molecular dynamics and decomposition analysis based on absolutely localized molecular orbitals. We show that these two methods in combination not only enable ab initio molecular dynamics simulations on previously inaccessible time and length scales, but also provide unprecedented insights into the nature of hydrogen bonding between water molecules. We discuss recent applications of these methods to water clusters and bulk water.

  12. Use of ab initio quantum chemical methods in battery technology

    Energy Technology Data Exchange (ETDEWEB)

    Deiss, E. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-06-01

    Ab initio quantum chemistry can nowadays predict physical and chemical properties of molecules and solids. An attempt should be made to use this tool more widely for predicting technologically favourable materials. To demonstrate the use of ab initio quantum chemistry in battery technology, the theoretical energy density (energy per volume of active electrode material) and specific energy (energy per mass of active electrode material) of a rechargeable lithium-ion battery consisting of a graphite electrode and a nickel oxide electrode has been calculated with this method. (author) 1 fig., 1 tab., 7 refs.

  13. SHBG (Sex Hormone Binding Globulin)

    Science.gov (United States)

    ... as: Testosterone-estrogen Binding Globulin; TeBG Formal name: Sex Hormone Binding Globulin Related tests: Testosterone , Free Testosterone, ... I should know? How is it used? The sex hormone binding globulin (SHBG) test may be used ...

  14. Functional and structural alterations induced by copper in xanthine oxidase

    Institute of Scientific and Technical Information of China (English)

    Mahnaz Hadizadeh; Ezzatollah Keyhani; Jacqueline Keyhani; Cyrus Khodadadi

    2009-01-01

    Xanthine oxidase (XO),a key enzyme in purine metab-olism,produces reactive oxygen species causing vascu-lar injuries and chronic heart failure.Here,copper's ability to alter XO activity and structure was investi-gated in vitro after pre-incubation of the enzyme with increasing Cu2+ concentrations for various periods of time.The enzymatic activity was measured by following XO-catalyzed xanthine oxidation to uric acid under steady-state kinetics conditions.Structural alterations were assessed by electronic absorption,fluorescence,and circular dichroism spectroscopy.Results showed that Cu2+ either stimulated or inhibited XO activity,depending on metal concentration and pre-incubation length,the latter also determining the inhibition type.Cu2+-XO complex formation was characterized by modifications in XO electronic absorption bands,intrinsic fluorescence,and α-helical and β-sheet content.Apparent dissociation constant values implied high- and low-affinity Cu2+ binding sites in the vicinity of the enzyme's reactive centers.Data indicated that Cu2+ binding to high-affinity sites caused alterations around XO molybdenum and flavin adenine dinucleo-tide centers,changes in secondary structure,and mod-erate activity inhibition;binding to low affinity sites caused alterations around all XO reactive centers including FeS,changes in tertiary structure as reflected by alterations in spectral properties,and drastic activity inhibition.Stimulation was attributed to transient stabilization of XO optimal conformation.Results also emphasized the potential role of copper in the regu-lation of XO activity stemming from its binding properties.

  15. Stabilizing a flexible interdomain hinge region harboring the SMB binding site drives uPAR into its closed conformation.

    Science.gov (United States)

    Zhao, Baoyu; Gandhi, Sonu; Yuan, Cai; Luo, Zhipu; Li, Rui; Gårdsvoll, Henrik; de Lorenzi, Valentina; Sidenius, Nicolai; Huang, Mingdong; Ploug, Michael

    2015-03-27

    The urokinase-type plasminogen activator receptor (uPAR) is a multidomain glycolipid-anchored membrane protein, which facilitates extracellular matrix remodeling by focalizing plasminogen activation to cell surfaces via its high-affinity interaction with uPA. The modular assembly of its three LU (Ly6/uPAR-like) domains is inherently flexible and binding of uPA drives uPAR into its closed conformation, which presents the higher-affinity state for vitronectin thus providing an allosteric regulatory mechanism. Using a new class of epitope-mapped anti-uPAR monoclonal antibodies (mAbs), we now demonstrate that the reciprocal stabilization is indeed also possible. By surface plasmon resonance studies, we show that these mAbs and vitronectin have overlapping binding sites on uPAR and that they share Arg91 as hotspot residue in their binding interfaces. The crystal structure solved for one of these uPAR·mAb complexes at 3.0Å clearly shows that this mAb preselects the closed uPAR conformation with an empty but correctly assembled large hydrophobic binding cavity for uPA. Accordingly, these mAbs inhibit the uPAR-dependent lamellipodia formation and migration on vitronectin-coated matrices irrespective of the conformational status of uPAR and its occupancy with uPA. This is the first study to the best of our knowledge, showing that the dynamic assembly of the three LU domains in uPARwt can be driven toward the closed form by an external ligand, which is not engaging the hydrophobic uPA binding cavity. As this binding interface is also exploited by the somatomedin B domain of vitronectin, therefore, this relationship should be taken into consideration when exploring uPAR-dependent cell adhesion and migration in vitronectin-rich environments. PMID:25659907

  16. Alteration in insulin action

    DEFF Research Database (Denmark)

    Tanti, J F; Gual, P; Grémeaux, T;

    2004-01-01

    Insulin resistance, when combined with impaired insulin secretion, contributes to the development of type 2 diabetes. Insulin resistance is characterised by a decrease in insulin effect on glucose transport in muscle and adipose tIssue. Tyrosine phosphorylation of insulin receptor substrate 1 (IRS......-1) and its binding to phosphatidylinositol 3-kinase (PI 3-kinase) are critical events in the insulin signalling cascade leading to insulin-stimulated glucose transport. Modification of IRS-1 by serine phosphorylation could be one of the mechanisms leading to a decrease in IRS-1 tyrosine...... to phosphorylate these serine residues have been identified. These exciting results suggest that serine phosphorylation of IRS-1 is a possible hallmark of insulin resistance in biologically insulin responsive cells or tIssues. Identifying the pathways by which "diabetogenic" factors activate IRS-1 kinases...

  17. Insect Resistance to Bacillus thuringiensis Toxin Cry2Ab Is Conferred by Mutations in an ABC Transporter Subfamily A Protein.

    Directory of Open Access Journals (Sweden)

    Wee Tek Tay

    2015-11-01

    Full Text Available The use of conventional chemical insecticides and bacterial toxins to control lepidopteran pests of global agriculture has imposed significant selection pressure leading to the rapid evolution of insecticide resistance. Transgenic crops (e.g., cotton expressing the Bt Cry toxins are now used world wide to control these pests, including the highly polyphagous and invasive cotton bollworm Helicoverpa armigera. Since 2004, the Cry2Ab toxin has become widely used for controlling H. armigera, often used in combination with Cry1Ac to delay resistance evolution. Isolation of H. armigera and H. punctigera individuals heterozygous for Cry2Ab resistance in 2002 and 2004, respectively, allowed aspects of Cry2Ab resistance (level, fitness costs, genetic dominance, complementation tests to be characterised in both species. However, the gene identity and genetic changes conferring this resistance were unknown, as was the detailed Cry2Ab mode of action. No cross-resistance to Cry1Ac was observed in mutant lines. Biphasic linkage analysis of a Cry2Ab-resistant H. armigera family followed by exon-primed intron-crossing (EPIC marker mapping and candidate gene sequencing identified three independent resistance-associated INDEL mutations in an ATP-Binding Cassette (ABC transporter gene we named HaABCA2. A deletion mutation was also identified in the H. punctigera homolog from the resistant line. All mutations truncate the ABCA2 protein. Isolation of further Cry2Ab resistance alleles in the same gene from field H. armigera populations indicates unequal resistance allele frequencies and the potential for Bt resistance evolution. Identification of the gene involved in resistance as an ABC transporter of the A subfamily adds to the body of evidence on the crucial role this gene family plays in the mode of action of the Bt Cry toxins. The structural differences between the ABCA2, and that of the C subfamily required for Cry1Ac toxicity, indicate differences in the

  18. Insect Resistance to Bacillus thuringiensis Toxin Cry2Ab Is Conferred by Mutations in an ABC Transporter Subfamily A Protein.

    Science.gov (United States)

    Tay, Wee Tek; Mahon, Rod J; Heckel, David G; Walsh, Thomas K; Downes, Sharon; James, William J; Lee, Sui-Fai; Reineke, Annette; Williams, Adam K; Gordon, Karl H J

    2015-11-01

    The use of conventional chemical insecticides and bacterial toxins to control lepidopteran pests of global agriculture has imposed significant selection pressure leading to the rapid evolution of insecticide resistance. Transgenic crops (e.g., cotton) expressing the Bt Cry toxins are now used world wide to control these pests, including the highly polyphagous and invasive cotton bollworm Helicoverpa armigera. Since 2004, the Cry2Ab toxin has become widely used for controlling H. armigera, often used in combination with Cry1Ac to delay resistance evolution. Isolation of H. armigera and H. punctigera individuals heterozygous for Cry2Ab resistance in 2002 and 2004, respectively, allowed aspects of Cry2Ab resistance (level, fitness costs, genetic dominance, complementation tests) to be characterised in both species. However, the gene identity and genetic changes conferring this resistance were unknown, as was the detailed Cry2Ab mode of action. No cross-resistance to Cry1Ac was observed in mutant lines. Biphasic linkage analysis of a Cry2Ab-resistant H. armigera family followed by exon-primed intron-crossing (EPIC) marker mapping and candidate gene sequencing identified three independent resistance-associated INDEL mutations in an ATP-Binding Cassette (ABC) transporter gene we named HaABCA2. A deletion mutation was also identified in the H. punctigera homolog from the resistant line. All mutations truncate the ABCA2 protein. Isolation of further Cry2Ab resistance alleles in the same gene from field H. armigera populations indicates unequal resistance allele frequencies and the potential for Bt resistance evolution. Identification of the gene involved in resistance as an ABC transporter of the A subfamily adds to the body of evidence on the crucial role this gene family plays in the mode of action of the Bt Cry toxins. The structural differences between the ABCA2, and that of the C subfamily required for Cry1Ac toxicity, indicate differences in the detailed mode

  19. Abacavir and the altered peptide repertoire model: clinical implications

    Directory of Open Access Journals (Sweden)

    Mallal S

    2012-11-01

    Full Text Available Structural and biochemical studies showing that abacavir binds non-covalently to the floor of the peptide binding groove of HLA-B*5701 with exquisite specificity to alter the self-peptides that load on the molecule to be presented to the immune system have recently been published [1–4]. This precise mechanistic explanation of why abacavir binds to HLA-B*5701 and no other allele accounts for the 100% negative predictive value of HLA-B*5701 testing for hypersensitivity which underpins its utility as a screening test. The specificity of the interaction between abacavir, peptide and HLA-B*5701 provides strong evidence that abacavir will not cause any off-target, HLA restricted immune-mediated side effects in HLA-B*5701 negative individuals. The rapid and direct non-covalent binding of abacavir to HLA-B*5701 without the requirement for metabolism of the drug explain the clinical symptoms of hypersensitivity including dose-related escalation of symptoms and rapid offset of symptoms following drug cessation. Importantly, if abacavir were being developed today its propensity to bind HLA-B*5701, alter the peptide repertoire presented, and the functional consequences of this interaction between HLA-B*5701 and abacavir could be determined in vitro and before use in man. This provides an important pre-clinical screening strategy to identify compounds in development that bind HLA and alter peptide presentation which could then be structurally modified to abrogate this property to avert hypersensitivity while retaining on-target effects.

  20. Novel targets of the CbrAB/Crc carbon catabolite control system revealed by transcript abundance in Pseudomonas aeruginosa.

    Directory of Open Access Journals (Sweden)

    Elisabeth Sonnleitner

    Full Text Available The opportunistic human pathogen Pseudomonas aeruginosa is able to utilize a wide range of carbon and nitrogen compounds, allowing it to grow in vastly different environments. The uptake and catabolism of growth substrates are organized hierarchically by a mechanism termed catabolite repression control (Crc whereby the Crc protein establishes translational repression of target mRNAs at CA (catabolite activity motifs present in target mRNAs near ribosome binding sites. Poor carbon sources lead to activation of the CbrAB two-component system, which induces transcription of the small RNA (sRNA CrcZ. This sRNA relieves Crc-mediated repression of target mRNAs. In this study, we have identified novel targets of the CbrAB/Crc system in P. aeruginosa using transcriptome analysis in combination with a search for CA motifs. We characterized four target genes involved in the uptake and utilization of less preferred carbon sources: estA (secreted esterase, acsA (acetyl-CoA synthetase, bkdR (regulator of branched-chain amino acid catabolism and aroP2 (aromatic amino acid uptake protein. Evidence for regulation by CbrAB, CrcZ and Crc was obtained in vivo using appropriate reporter fusions, in which mutation of the CA motif resulted in loss of catabolite repression. CbrB and CrcZ were important for growth of P. aeruginosa in cystic fibrosis (CF sputum medium, suggesting that the CbrAB/Crc system may act as an important regulator during chronic infection of the CF lung.

  1. GJ 282 AB (WDS 07400-0336 AB = BGH 3 AB) and GICLAS 112-29: A Very Wide System in Process of Dissociation

    Science.gov (United States)

    Rica, F. M.; Benavides, R.

    2016-04-01

    Very wide binaries are interesting objects that shed light on the binary formation process and their dynamical evolution. Poveda et al. (2009) studied the possible physical relation of the near (14.2 pc) and wide (~58") binary star GJ 282 AB and the extremely wide (1.09º; ~55,000 AU) companion, NLTT 18149, and they concluded that this very wide system is in the process of dynamical disintegration. In this work, we confirm the same conclusion but using a different method. We first study dynamically GJ 282 AB, confirmed that it is a bound system and then we determine possible orbital solutions. Later, we calculate the relative velocity of NLTT 18149 with respect to the GJ 282 AB's center mass using their (U, V, W) galactocentric velocity. The relative velocity, Vrel = 1.98 ± 0.16 km s-1, is much larger than the escape velocity (0.25 ± 0.01 km s-1). Therefore, with a significance level of 11s, we also conclude that this very wide system is in a process of dynamical disintegration.

  2. Structural Alterations of Segmented Macular Inner Layers in Aquaporin4-Antibody-Positive Optic Neuritis Patients in a Chinese Population.

    Directory of Open Access Journals (Sweden)

    Chunxia Peng

    Full Text Available This study aimed to analyse the structural injury of the peripapillary retinal nerve fibre layer (pRNFL and segmented macular layers in optic neuritis (ON in aquaporin4-antibody (AQP4-Ab seropositivity(AQP4-Ab-positiveON patients and in AQP4-Ab seronegativity (AQP4-Ab-negative ON patients in order to evaluate their correlations with the best-corrected visual acuity (BCVA and the value of the early diagnosis of neuromyelitis optica (NMO.This is a retrospective, cross-sectional and control observational study.In total, 213 ON patients (291 eyes and 50 healthy controls (HC (100 eyes were recruited in this study. According to a serum AQP4-Ab assay, 98 ON patients (132 eyes were grouped as AQP4-Ab-positive ON and 115 ON patients (159 eyes were grouped as AQP4-Ab-negative ON cohorts. All subjects underwent scanning with spectralis optical coherence tomography (OCT and BCVA tests. pRNFL and segmented macular layer measurements were analysed.The pRNFL thickness in AQP4-Ab-positive ON eyes showed a more serious loss during 0-2 months (-27.61μm versus -14.47 μm and ≥6 months (-57.91μm versus -47.19μm when compared with AQP4-Ab-negative ON eyes. AQP4-Ab-positive ON preferentially damaged the nasal lateral pRNFL. The alterations in the macular ganglion cell layer plus the inner plexiform layer (GCIP in AQP4-Ab-positive ON eyes were similar to those in AQP4-Ab-negative ON eyes. AQP4-Ab-positive ON eyes had entirely different injury patterns in the inner nuclear layer (INL compared with AQP4-Ab-negative ON eyes during the first 6 months after the initial ON attack. These differences were as follows: the INL volume of AQP4-Ab-positive ON eyes had a gradual growing trend compared with AQP4-Ab-negative ON eyes, and it increased rapidly during 0-2 months, reached its peak during 2-4 months, and then decreased gradually. The pRNFL and GCIP in AQP4-Ab-positive ON eyes had positive correlations with BCVA. When the pRNFL thickness decreased to 95%CI (50.77

  3. Ab initio computational studies on molecular conformation of N-methyl-glyphosate

    Science.gov (United States)

    Kaliannan, P.; Naseer Ali, M. Mohamed; Venuvanalingam, P.

    Conformational analysis of N-methyl-glyphosate has been carried out using an ab initio molecular orbital (MO) method at the HF/3-21G* levels of theory and the results are compared with the results of a previously studied compound, namely glyphosate. The potential energy surface of the molecule obtained by varying the central torsion angles (Φ, Ψ) was investigated in detail. Fourteen conformers with 5 kcal mol-1 energy cut-off have been selected from the potential energy surface for geometry optimization to locate the true minimum on the conformational space. The minimum has been found to be at (-62°, 110°) for the central torsion angles. This conformation is stabilized by hydrogen bond interactions (O-H···O and C-H···O) and the interactions due to protons nearer to each other. This cationic field leads to the formation of a hydrophobic patch in this structure, as well as in the structures closer to the global minimum. This patch may destabilize the favourable interaction of N-methyl-glyphosate with the surrounding amino acid residues in the binding cavity as they form the cationic field throughout the glyphosate binding region.

  4. Nonlocal torque operators in ab initio theory of the Gilbert damping in random ferromagnetic alloys

    Science.gov (United States)

    Turek, I.; Kudrnovský, J.; Drchal, V.

    2015-12-01

    We present an ab initio theory of the Gilbert damping in substitutionally disordered ferromagnetic alloys. The theory rests on introduced nonlocal torques which replace traditional local torque operators in the well-known torque-correlation formula and which can be formulated within the atomic-sphere approximation. The formalism is sketched in a simple tight-binding model and worked out in detail in the relativistic tight-binding linear muffin-tin orbital method and the coherent potential approximation (CPA). The resulting nonlocal torques are represented by nonrandom, non-site-diagonal, and spin-independent matrices, which simplifies the configuration averaging. The CPA-vertex corrections play a crucial role for the internal consistency of the theory and for its exact equivalence to other first-principles approaches based on the random local torques. This equivalence is also illustrated by the calculated Gilbert damping parameters for binary NiFe and FeCo random alloys, for pure iron with a model atomic-level disorder, and for stoichiometric FePt alloys with a varying degree of L 10 atomic long-range order.

  5. The Mycobacterium tuberculosis high-affinity iron importer, IrtA, contains an FAD-binding domain.

    Science.gov (United States)

    Ryndak, Michelle B; Wang, Shuishu; Smith, Issar; Rodriguez, G Marcela

    2010-02-01

    Iron is an essential nutrient not freely available to microorganisms infecting mammals. To overcome iron deficiency, bacteria have evolved various strategies including the synthesis and secretion of high-affinity iron chelators known as siderophores. The siderophores produced and secreted by Mycobacterium tuberculosis, exomycobactins, compete for iron with host iron-binding proteins and, together with the iron-regulated ABC transporter IrtAB, are required for the survival of M. tuberculosis in iron deficient conditions and for normal replication in macrophages and in mice. This study further characterizes the role of IrtAB in M. tuberculosis iron acquisition. Our results demonstrate a role for IrtAB in iron import and show that the amino terminus domain of IrtA is a flavin-adenine dinucleotide-binding domain essential for iron acquisition. These results suggest a model in which the amino terminus of IrtA functions to couple iron transport and assimilation.

  6. Oligomerization of Mannan-binding Lectin Dictates Binding Properties and Complement Activation.

    Science.gov (United States)

    Kjaer, T R; Jensen, L; Hansen, A; Dani, R; Jensenius, J C; Dobó, J; Gál, P; Thiel, S

    2016-07-01

    The complement system is a part of the innate immune system and is involved in recognition and clearance of pathogens and altered-self structures. The lectin pathway of the complement system is initiated when soluble pattern recognition molecules (PRMs) with collagen-like regions bind to foreign or altered self-surfaces. Associated with the collagen-like stems of these PRMs are three mannan-binding lectin (MBL)-associated serine proteases (MASPs) and two MBL-associated proteins (MAps). The most studied of the PRMs, MBL, is present in serum mainly as trimeric and tetrameric oligomers of the structural subunit. We hypothesized that oligomerization of MBL may influence both the potential to bind to micro organisms and the interaction with the MASPs and MAps, thus influencing the ability to initiate complement activation. When testing binding at 37 °C, we found higher binding of tetrameric MBL to Staphylococcus aureus (S. aureus) than trimeric and dimeric MBL. In serum, we found that tetrameric MBL was the main oligomeric form present in complexes with the MASPs and MAp44. Such preference was confirmed using purified forms of recombinant MBL (rMBL) oligomers, where tetrameric rMBL interacted stronger with all of the MASPs and MAp44, compared to trimeric MBL. As a direct consequence of the weaker interaction with the MASPs, we found that trimeric rMBL was inferior to tetrameric rMBL in activating the complement system. Our data suggest that the oligomeric state of MBL is crucial both for the binding properties and the effector function of MBL.

  7. LFA-1 and Mac-1 integrins bind to the serine/threonine-rich domain of thrombomodulin.

    Science.gov (United States)

    Kawamoto, Eiji; Okamoto, Takayuki; Takagi, Yoshimi; Honda, Goichi; Suzuki, Koji; Imai, Hiroshi; Shimaoka, Motomu

    2016-05-13

    LFA-1 (αLβ2) and Mac-1 (αMβ2) integrins regulate leukocyte trafficking in health and disease by binding primarily to IgSF ligand ICAM-1 and ICAM-2 on endothelial cells. Here we have shown that the anti-coagulant molecule thrombomodulin (TM), found on the surface of endothelial cells, functions as a potentially new ligand for leukocyte integrins. We generated a recombinant extracellular domain of human TM and Fc fusion protein (TM-domains 123-Fc), and showed that pheripheral blood mononuclear cells (PBMCs) bind to TM-domains 123-Fc dependent upon integrin activation. We then demonstrated that αL integrin-blocking mAb, αM integrin-blocking mAb, and β2 integrin-blocking mAb inhibited the binding of PBMCs to TM-domains 123-Fc. Furthermore, we show that the serine/threonine-rich domain (domain 3) of TM is required for the interaction with the LFA-1 (αLβ2) and Mac-1 (αMβ2) integrins to occur on PBMCs. These results demonstrate that the LFA-1 and Mac-1 integrins on leukocytes bind to TM, thereby establishing the molecular and structural basis underlying LFA-1 and Mac-1 integrin interaction with TM on endothelial cells. In fact, integrin-TM interactions might be involved in the dynamic regulation of leukocyte adhesion with endothelial cells. PMID:27055590

  8. Temperatura e embalagem para abóbora minimamente processada Temperature and packaging of minimally processed pumpkin (Curcubita moschata

    Directory of Open Access Journals (Sweden)

    Ana Veruska Cruzda Silva

    2009-06-01

    Full Text Available O objetivo deste trabalho foi avaliar temperaturas de armazenamento e embalagens para abóbora minimamente processada. Pedaços de abóbora foram cortados em tamanho de 5 x 10 cm, embalados em bandejas de poliestireno recobertas com filme polivinilcloreto e em embalagem de polietileno de alta densidade a vácuo. O produto foi mantido a 5 e 10 °C por um período de 12 dias. A cada três dias avaliou-se o teor de sólidos solúveis, acidez total titulável, pH, vitamina C e coloração. Os resultados mostraram não haver diferenças significativas entre as duas temperaturas de refrigeração utilizadas na conservação da abóbora. Entretanto, a embalagem com filme PVC permitiu maior conservação dos atributos de qualidade da abóbora até o 9º dia, com exceção da cor, que sofreu menores alterações quando usada embalagem a vácuo.The present work aimed to evaluate the efficiency of different storage temperatures and packing materials for pumpkin fresh cuts. Pumpkin cuts of 5 x 10 cm were packed in polystyrene trays covered with polivynilchloride film or in vacuum high density polyethylene bags. The trays and bags were kept at 5 and 10 °C for 12 days. Soluble solids, total titratable acidity, pH, vitamin C, and color of pumpkin cuts were evaluated every 3 days. The different temperatures did not affect the storage of the pumpkins. However, packaging with PVC film allowed a longer conservation by keeping the pumpkin quality attributes up to the 9th day, except for the color which undergone minor alterations when stored within a vacuum pack.

  9. 7 CFR Exhibits A-B to Subpart G... - [Reserved

    Science.gov (United States)

    2010-01-01

    ... PRIMARILY FOR REAL ESTATE PURPOSES RURAL HOUSING LOANS AND GRANTS Rural Housing Site Loan Policies... 7 Agriculture 12 2010-01-01 2010-01-01 false A Exhibits A-B to Subpart G to Part 1822 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL...

  10. Move of Purchasing Offices TS – AB* – AT*

    CERN Multimedia

    FI Department

    2008-01-01

    The TS – AB* - AT* Purchasing Offices and the Purchasing Pool have moved to Building 5 – 2nd and *3rd floors. The phone and fax numbers are unchanged. We apologize for any inconvenience caused by the move. Thank you for your understanding. Finance Department – Purchasing Service.

  11. Ab initio molecular dynamics simulation of laser melting of silicon

    NARCIS (Netherlands)

    Silvestrelli, P.-L.; Alavi, A.; Parrinello, M.; Frenkel, D.

    1996-01-01

    The method of ab initio molecular dynamics, based on finite temperature density functional theory, is used to simulate laser heating of crystal silicon. We have found that a high concentration of excited electrons dramatically weakens the covalent bond. As a result, the system undergoes a melting tr

  12. Food for Thought on the "ABS Academic Journal Quality Guide"

    Science.gov (United States)

    Hussain, Simon

    2011-01-01

    This paper discusses issues relating to the use of the Association of Business Schools' (ABS) "Academic Journal Quality Guide" within UK business schools. It also looks at several specific issues raised by the Chair of the British Accounting Association/British Accounting and Finance Association regarding the ratings for top…

  13. Discovery of New Substrates for LuxAB Bacterial Bioluminescence.

    Science.gov (United States)

    Jiang, Tianyu; Wang, Weishan; Wu, Xingkang; Wu, Wenxiao; Bai, Haixiu; Ma, Zhao; Shen, Yuemao; Yang, Keqian; Li, Minyong

    2016-08-01

    In this article, four novel substrates with long halftime have been designed and synthesized successfully for luxAB bacterial bioluminescence. After in vitro and in vivo biological evaluation, these molecules can emit obvious bioluminescence emission with known bacterial luciferase, thus indicating a new promising approach to developing the bacterial bioluminescent system. PMID:26896339

  14. 78 FR 33010 - Airworthiness Directives; Saab AB, Saab Aerosystems Airplanes

    Science.gov (United States)

    2013-06-03

    ... in an aircraft maintenance manual is incorrect for Saab 340B airplane. This proposed AD would require... information identified in this proposed AD, contact Saab AB, Saab Aeronautics, SE-581 88, Link ping, Sweden... Aircraft Maintenance Manual (AMM), which quotes an elevator position of 4 degrees trailing edge down...

  15. Discovery of New Substrates for LuxAB Bacterial Bioluminescence.

    Science.gov (United States)

    Jiang, Tianyu; Wang, Weishan; Wu, Xingkang; Wu, Wenxiao; Bai, Haixiu; Ma, Zhao; Shen, Yuemao; Yang, Keqian; Li, Minyong

    2016-08-01

    In this article, four novel substrates with long halftime have been designed and synthesized successfully for luxAB bacterial bioluminescence. After in vitro and in vivo biological evaluation, these molecules can emit obvious bioluminescence emission with known bacterial luciferase, thus indicating a new promising approach to developing the bacterial bioluminescent system.

  16. Ultra-Low Voltage Class AB Switched Current Memory Cell

    DEFF Research Database (Denmark)

    Igor, Mucha

    1996-01-01

    This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with...

  17. Cyanogen Azide. Ionization Potentials and Ab Initio SCF MO Calculation

    DEFF Research Database (Denmark)

    Bak, Börge; Jansen, Peter; Stafast, Herbert

    1975-01-01

    The Ne(I) and He(I) photoelectron(PE) spectra of cyanogen azide, NCN3, have been recorded at high resolution. Their interpretation is achieved by comparison with the PE spectrum of HN3 and an ab initio LCGO SCF MO calculation. Deviations from Koopmans' theorem of quite different magnitudes are fo...

  18. Relaxation of Small Molecules: an ab initio Study

    Institute of Scientific and Technical Information of China (English)

    CAO Yi-Gang; JIAO Zheng-Kuan; A. Antons; K. Schroeder; S. Blügel2

    2002-01-01

    Using an ab initio total energy and force method, we have relaxed several group IV and group V elementalclusters, in detail the arsenic and antimony dimers, silicon, phosphorus, arsenic and antimony tetramers. The obtainedbond lengths and cohesive energies are more accurate than other calculating methods, and in excellent agreement withthe experimental results.

  19. Relaxation of Small Molecules:an ab initio Study

    Institute of Scientific and Technical Information of China (English)

    CAOYi-Gang; A.Antons; 等

    2002-01-01

    Using an ab inito total energy and force method,we have relaxed several group IV and group V elemental clusters,in detail the arsenic and antimony dimers,silicon,phosphorus,arsenic and antimony tetraners,The obtained bond lengths and cohesive energies are more accurate than other calculating methods,and in excellent agreement with the experimental results.

  20. Young Modulus of Crystalline Polyethylene from ab Initio Molecular Dynamics

    NARCIS (Netherlands)

    Hageman, J.C.L.; Meier, Robert J.; Heinemann, M.; Groot, R.A. de

    1997-01-01

    The Young modulus for crystalline polyethylene is calculated using ab initio molecular dynamics based on density functional theory in the local density approximation (DFT-LDA). This modulus, which can be seen as the ultimate value for the Young modulus of polyethylene fibers, is found to be 334 GPa.

  1. AB 1725 Model Accountability System. California Community Colleges. Revised.

    Science.gov (United States)

    California Community Colleges, Sacramento. Board of Governors.

    This report proposes a model accountability system for the California community colleges to comply with the directives of Assembly Bill 1725 (AB 1725). The purpose of the accountability system is to provide colleges and districts, the board of governors, and the California legislature with information that will allow for the continued improvement…

  2. The alteration and significance of retinol binding protein 4(RBP4)in breast milk of patients with gestational diabetes mellitus%妊娠期糖尿病患者乳汁视黄醇结合蛋白4水平变化及意义

    Institute of Scientific and Technical Information of China (English)

    杜蒙恺; 张爱华; 肖云霞; 程琪; 陈丹青; 郑开颜

    2015-01-01

    Objective To understand the alteration of retinol binding protein 4 (RBP4)in breast milk of women with gestational diabetes mellitus (GDM)and its clinical significance.Methods Sixty pregnant women diagnosed with GDM were selected as the cases.In the case group,breastfeeding amount reached more than 80% were defined as high -breastfeeding group while less than 20% were defined as low -breastfeeding.At the same time,45 nomal pregnant women were selected as the controls.Cord blood samples were collected during the delivery.Colostrums and mature milk samples were collected after the delivery.RBP4 and insulin concentrations were measured using enzyme -linked immunosorbent assay (ELISA ) and radioimmunoassay (RIA ) respectively.Infant birth weight and weight gain during postpartum reexamination were recorded.Results The concentrations of RBP4 and insulin in cord blood of GDM group (1 4.9 ± 2.6 μg/L and 8.3 ±1 .9 μU /mL)were higher than that in control group(1 2.4 ±2.7 μg/L and 6.0 ±2.1 μU /mL,P <0.001 ).RBP4 and insulin concentrations in colostrums of GDM group (1 6.9 ±4.2 μg/L and 1 1 .3 ±3.1 μU /mL)were higher than in controls (1 3.3 ±4.5 μg/L and 9.2 ±2.8 μU /mL,P <0.01 ).While in mature milk,RBP4 concentrations of GDMgroup were higher than that in controls (1 6.1 ±4.0 μg/L vs.1 2.5 ±3.1 μg/L,P <0.01 ).Insulin concentrationsof two groups were not significantly different.Comparing with low -breastfeeding group,RBP4 concentrations in mature milk of high -breastfeeding group were significantly lower (P <0.01 ).Cord blood RBP4 levels were positively correlated with infant birth weight (r =0.43,P <0.01 ).At the same time,in the colostrums,RBP4 levels were positively correlated with insulin levels (r =0.45,P <0.01 )and maternal weight gain during pregnancy (r =0.37,P <0.01 ).RBP4 concentrations in mature milk of high -breastfeeding group were negatively correlated with weight gain of infants (r =-0.49,P <0.01 ).Conclusion RBP4 in breast milk may be

  3. Characterization of 6-mercaptopurine binding to bovine serum albumin and its displacement from the binding sites by quercetin and rutin

    International Nuclear Information System (INIS)

    Binding of a drug to the serum albumins as major serum transport proteins can be influenced by other ligands leading to alteration of its pharmacological properties. In the present study, binding characteristics of 6-mercaptopurine (6-MP) with bovine serum albumin (BSA) together with its displacement from its binding site by quercetin and rutin have been investigated by the spectroscopic method. According to the binding parameters, a static quenching component in overall dynamic quenching process is operative in the interaction between 6-MP and BSA. The binding of 6-MP to BSA occurred spontaneously due to entropy-driven hydrophobic interactions. The synchronous fluorescence spectroscopy study revealed that the secondary structure of BSA is changed in the presence of 6-MP and both Tyr and Trp residues participate in the interaction between 6-MP and BSA with the later one being more dominant. The binding constant value of 6-MP–BSA in the presence of quercetin and rutin increased. 6-MP was displaced by ibuprofen indicating that the binding site of 6-MP on albumin is site II. Therefore, the change of the pharmacokinetic and pharmacodynamic properties of 6-MP by quercetin and rutin through alteration of binding capacity of 6-MP to the serum albumin cannot be ruled out. In addition, the displacement study showed that 6-MP is located in site II of BSA. - Highlights: ► Participation of both Tyr and particularly Trp residues in the interaction between 6-MP and BSA. ► Involvement of a static quenching component in an overall dynamic quenching process. ► Ability of quercetin and rutin to change the binding constants of 6-MP–BSA complex. ► Binding of 6-MP to BSA through entropy-driven hydrophobic interactions

  4. Characterization of 6-mercaptopurine binding to bovine serum albumin and its displacement from the binding sites by quercetin and rutin

    Energy Technology Data Exchange (ETDEWEB)

    Ehteshami, Mehdi [Nutrition Research Center, School of Health and Nutrition, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Rasoulzadeh, Farzaneh [Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Mahboob, Soltanali [Nutrition Research Center, School of Health and Nutrition, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Rashidi, Mohammad-Reza, E-mail: rashidi@tbzmed.ac.ir [Research Center for Pharmaceutical Nanotechnology, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of)

    2013-03-15

    Binding of a drug to the serum albumins as major serum transport proteins can be influenced by other ligands leading to alteration of its pharmacological properties. In the present study, binding characteristics of 6-mercaptopurine (6-MP) with bovine serum albumin (BSA) together with its displacement from its binding site by quercetin and rutin have been investigated by the spectroscopic method. According to the binding parameters, a static quenching component in overall dynamic quenching process is operative in the interaction between 6-MP and BSA. The binding of 6-MP to BSA occurred spontaneously due to entropy-driven hydrophobic interactions. The synchronous fluorescence spectroscopy study revealed that the secondary structure of BSA is changed in the presence of 6-MP and both Tyr and Trp residues participate in the interaction between 6-MP and BSA with the later one being more dominant. The binding constant value of 6-MP-BSA in the presence of quercetin and rutin increased. 6-MP was displaced by ibuprofen indicating that the binding site of 6-MP on albumin is site II. Therefore, the change of the pharmacokinetic and pharmacodynamic properties of 6-MP by quercetin and rutin through alteration of binding capacity of 6-MP to the serum albumin cannot be ruled out. In addition, the displacement study showed that 6-MP is located in site II of BSA. - Highlights: Black-Right-Pointing-Pointer Participation of both Tyr and particularly Trp residues in the interaction between 6-MP and BSA. Black-Right-Pointing-Pointer Involvement of a static quenching component in an overall dynamic quenching process. Black-Right-Pointing-Pointer Ability of quercetin and rutin to change the binding constants of 6-MP-BSA complex. Black-Right-Pointing-Pointer Binding of 6-MP to BSA through entropy-driven hydrophobic interactions.

  5. Tropomodulin isoforms utilize specific binding functions to modulate dendrite development.

    Science.gov (United States)

    Gray, Kevin T; Suchowerska, Alexandra K; Bland, Tyler; Colpan, Mert; Wayman, Gary; Fath, Thomas; Kostyukova, Alla S

    2016-06-01

    Tropomodulins (Tmods) cap F-actin pointed ends and have altered expression in the brain in neurological diseases. The function of Tmods in neurons has been poorly studied and their role in neurological diseases is entirely unknown. In this article, we show that Tmod1 and Tmod2, but not Tmod3, are positive regulators of dendritic complexity and dendritic spine morphology. Tmod1 increases dendritic branching distal from the cell body and the number of filopodia/thin spines. Tmod2 increases dendritic branching proximal to the cell body and the number of mature dendritic spines. Tmods utilize two actin-binding sites and two tropomyosin (Tpm)-binding sites to cap F-actin. Overexpression of Tmods with disrupted Tpm-binding sites indicates that Tmod1 and Tmod2 differentially utilize their Tpm- and actin-binding sites to affect morphology. Disruption of Tmod1's Tpm-binding sites abolished the overexpression phenotype. In contrast, overexpression of the mutated Tmod2 caused the same phenotype as wild type overexpression. Proximity ligation assays indicate that the mutated Tmods are shuttled similarly to wild type Tmods. Our data begins to uncover the roles of Tmods in neural development and the mechanism by which Tmods alter neural morphology. These observations in combination with altered Tmod expression found in several neurological diseases also suggest that dysregulation of Tmod expression may be involved in the pathology of these diseases. © 2016 Wiley Periodicals, Inc. PMID:27126680

  6. Mapping of the C3d receptor (CR2)-binding site and a neoantigenic site in the C3d domain of the third component of complement.

    OpenAIRE

    LAMBRIS, J. D.; Ganu, V S; Hirani, S.; Müller-Eberhard, H. J.

    1985-01-01

    The C3d domain of C3 contains the site that binds to the C3d receptor (CR2) which is expressed on B lymphocytes. It also contains a neoantigenic determinant that is recognized by monoclonal antibody (mAb) 130 and is expressed when C3b is cleaved to iC3b and subsequently to C3dg or C3d. mAb 130 inhibits the binding of C3d to CR2. In this study, the locations of the CR2-binding site and of the neoantigen recognized by mAb 130 within the C3d domain were investigated. Treatment of human C3d with ...

  7. Altered fingerprints: analysis and detection.

    Science.gov (United States)

    Yoon, Soweon; Feng, Jianjiang; Jain, Anil K

    2012-03-01

    The widespread deployment of Automated Fingerprint Identification Systems (AFIS) in law enforcement and border control applications has heightened the need for ensuring that these systems are not compromised. While several issues related to fingerprint system security have been investigated, including the use of fake fingerprints for masquerading identity, the problem of fingerprint alteration or obfuscation has received very little attention. Fingerprint obfuscation refers to the deliberate alteration of the fingerprint pattern by an individual for the purpose of masking his identity. Several cases of fingerprint obfuscation have been reported in the press. Fingerprint image quality assessment software (e.g., NFIQ) cannot always detect altered fingerprints since the implicit image quality due to alteration may not change significantly. The main contributions of this paper are: 1) compiling case studies of incidents where individuals were found to have altered their fingerprints for circumventing AFIS, 2) investigating the impact of fingerprint alteration on the accuracy of a commercial fingerprint matcher, 3) classifying the alterations into three major categories and suggesting possible countermeasures, 4) developing a technique to automatically detect altered fingerprints based on analyzing orientation field and minutiae distribution, and 5) evaluating the proposed technique and the NFIQ algorithm on a large database of altered fingerprints provided by a law enforcement agency. Experimental results show the feasibility of the proposed approach in detecting altered fingerprints and highlight the need to further pursue this problem. PMID:21808092

  8. Ultrasensitive human thyrotropin (h TSH) immunoradiometric assay (IRMA) set up, through identification and minimization of non specific bindings; Ensaio imunoradiometrico ultra-sensivel de tireotrofina humana (hTSH) obtido mediante a identificacao e minimizacao de ligacoes inespecificas

    Energy Technology Data Exchange (ETDEWEB)

    Peroni, C.N.

    1994-12-31

    An IRMA of h TSH, based on magnetic solid phase separation, was studied especially for what concerns its non specific bindings. These were identified as a product of the interaction between an altered form of radioiodinated anti-h TSH monoclonal antibody ({sup 125} I-m AB) and the uncoupled magnetizable cellulose particle (matrix). Apparently this form of {sup 125} I-m AB is a type of aggregate that can be partly resolved from the main peak on Sephadex G-200 and further minimized via a single pre-incubation with the same matrix. Solid phase saturation with milk proteins, tracer storage at 4{sup 0} C and serum addition during incubation were also found particularly effective is preventing its formation. These findings were used in order to reproducibly decrease non specific bindings to values <0.1% (or <70 cpm), increasing thus the signal-to-noise ratio (B{sub 60}/B{sub O}) up to values of 300-500. This way we obtained h TSH radio assays with functional sensitivities of about 0.05 m IU/L and analytical sensitivities of the order of 0.02 m IU/L, which classify them at least as among the best second generation assays and that are excellent indeed for magnetic IRMA s. A more optimistic sensitivity calculation, based on Rodbard`s definition, provided values down to 0.008 m IU/L. Such sensitivities, moreover, were obtained in a very reproducible way and all over the useful tracer life. (author). 83 refs, 13 figs, 25 tabs.

  9. Cloning and characterisation of a nuclear, site specific ssDNA binding protein.

    Science.gov (United States)

    Smidt, M P; Russchen, B; Snippe, L; Wijnholds, J; Ab, G

    1995-07-11

    Estradiol inducible, liver-specific expression of the apoVLDL II gene is mediated through the estrogen receptor and a variety of other DNA-binding proteins. In the present study we report the cloning and characterisation of a single-strand DNA binding protein that interacts with the lower strand of a complex regulatory site, which includes the major estrogen responsive element and a site that resembles the rat albumin site D (apoVLDL II site D). Based on its binding specificity determined with electro-mobility shift assays, the protein is named single-strand D-box binding factor (ssDBF). Analysis of the deduced 302 amino acid sequence revealed that the protein belongs to the heteronuclear ribonucleoprotein A/B family (hnRNP A/B) and resembles other known eukaryotic single-strand DNA binding proteins. Transient transfection experiments in a chicken liver cell-line showed that the protein represses estrogen-induced transcription. A protein with similar binding characteristics is present in liver nuclear extract. The relevance of the occurrence of this protein to the expression of the apoVLDL II gene is discussed. PMID:7630716

  10. The Binding Characterization of Cry Insecticidal Proteins to the Brush Border Membrane Vesicles of Helicoverpa armigera, Spodoptera exigua, Spodoptera litura and Agrotis ipsilon

    Institute of Scientific and Technical Information of China (English)

    LU Qiong; CAO Guang-chun; ZHANG Li-li; LIANG Ge-mei; GAO Xi-wu; ZHANG Yong-jun; GUO Yu-yuan

    2013-01-01

    Cry toxins produced by Bacillus thuringiensis (Bt) are effective biological insecticides against certain insect species. However, there are potential risks of the evolved resistance of insects to Cry toxin owing to decreased binding of toxins to target sites in the brush border membranes of the larva midgut. The Cry toxins with different binding sites in the larval midgut have been considered to be a good combination to deploy in delaying resistance evolution. Bioassay results demonstrated that the toxicity of different Cry toxins ranked differently for each species. The toxicity ranking was Cry1Ac>Cry1Ab>Cry2Ab for Helicoverpa armigera, Cry1B>Cry1C>Cry2Ab for Spodoptera exigua, and Cry2Ab>Cry1B>Cry1C for S. litura. Only Cry2Ab was toxic to Agrotis ipsilon. Binding experiments were performed with 125I-Cry1Ab, 125I-Cry1Ac, 125I-Cry1B, 125I-Cry1C, 125I-Cry2Ab and the brush border membranes vesicles (BBMV) from H. armigera, S. exigua, S. litura and A. ipsilon. The binding of Cry1Ab and Cry1Ac was shown to be saturable by incubating with increasing concentrations of H. armigera BBMV (Kd=(45.00±2.01) nmol L-1 and (12.80±0.18) nmol L-1, respectively;Bmax=(54.95±1.79) ng and (55.44±0.91) ng, separately). The binding of Cry1B was shown to be saturable by incubating with increasing concentrations of S. exigua BBMV (Kd=(23.26±1.66) nmol L-1;Bmax=(65.37±1.87) ng). The binding of 125I-Cry toxins was shown to be non-saturable by incubating with increasing concentrations of S. litura and A. ipsilon BBMV. In contrast, Cry1B and Cry1C showed some combination with the BBMV of S. litura, and a certain amount of Cry2Ab could bind to the BBMV of A. ipsilon. These observations suggest that a future strategy could be devised for the focused combination of specific cry genes in transgenic crops to control target pests, widen the spectrum of insecticide effectiveness and postpone insect resistance evolution.

  11. Protective mAbs and Cross-Reactive mAbs Raised by Immunization with Engineered Marburg Virus GPs.

    Directory of Open Access Journals (Sweden)

    Marnie L Fusco

    2015-06-01

    Full Text Available The filoviruses, which include the marburg- and ebolaviruses, have caused multiple outbreaks among humans this decade. Antibodies against the filovirus surface glycoprotein (GP have been shown to provide life-saving therapy in nonhuman primates, but such antibodies are generally virus-specific. Many monoclonal antibodies (mAbs have been described against Ebola virus. In contrast, relatively few have been described against Marburg virus. Here we present ten mAbs elicited by immunization of mice using recombinant mucin-deleted GPs from different Marburg virus (MARV strains. Surprisingly, two of the mAbs raised against MARV GP also cross-react with the mucin-deleted GP cores of all tested ebolaviruses (Ebola, Sudan, Bundibugyo, Reston, but these epitopes are masked differently by the mucin-like domains themselves. The most efficacious mAbs in this panel were found to recognize a novel "wing" feature on the GP2 subunit that is unique to Marburg and does not exist in Ebola. Two of these anti-wing antibodies confer 90 and 100% protection, respectively, one hour post-exposure in mice challenged with MARV.

  12. Genetic Alterations in Glioma

    International Nuclear Information System (INIS)

    Gliomas are the most common type of primary brain tumor and have a dismal prognosis. Understanding the genetic alterations that drive glioma formation and progression may help improve patient prognosis by identification of novel treatment targets. Recently, two major studies have performed in-depth mutation analysis of glioblastomas (the most common and aggressive subtype of glioma). This systematic approach revealed three major pathways that are affected in glioblastomas: The receptor tyrosine kinase signaling pathway, the TP53 pathway and the pRB pathway. Apart from frequent mutations in the IDH1/2 gene, much less is known about the causal genetic changes of grade II and III (anaplastic) gliomas. Exceptions include TP53 mutations and fusion genes involving the BRAF gene in astrocytic and pilocytic glioma subtypes, respectively. In this review, we provide an update on all common events involved in the initiation and/or progression across the different subtypes of glioma and provide future directions for research into the genetic changes

  13. Music alters visual perception.

    Directory of Open Access Journals (Sweden)

    Jacob Jolij

    Full Text Available BACKGROUND: Visual perception is not a passive process: in order to efficiently process visual input, the brain actively uses previous knowledge (e.g., memory and expectations about what the world should look like. However, perception is not only influenced by previous knowledge. Especially the perception of emotional stimuli is influenced by the emotional state of the observer. In other words, how we perceive the world does not only depend on what we know of the world, but also by how we feel. In this study, we further investigated the relation between mood and perception. METHODS AND FINDINGS: We let observers do a difficult stimulus detection task, in which they had to detect schematic happy and sad faces embedded in noise. Mood was manipulated by means of music. We found that observers were more accurate in detecting faces congruent with their mood, corroborating earlier research. However, in trials in which no actual face was presented, observers made a significant number of false alarms. The content of these false alarms, or illusory percepts, was strongly influenced by the observers' mood. CONCLUSIONS: As illusory percepts are believed to reflect the content of internal representations that are employed by the brain during top-down processing of visual input, we conclude that top-down modulation of visual processing is not purely predictive in nature: mood, in this case manipulated by music, may also directly alter the way we perceive the world.

  14. Altered calcium signaling in cancer cells.

    Science.gov (United States)

    Stewart, Teneale A; Yapa, Kunsala T D S; Monteith, Gregory R

    2015-10-01

    It is the nature of the calcium signal, as determined by the coordinated activity of a suite of calcium channels, pumps, exchangers and binding proteins that ultimately guides a cell's fate. Deregulation of the calcium signal is often deleterious and has been linked to each of the 'cancer hallmarks'. Despite this, we do not yet have a full understanding of the remodeling of the calcium signal associated with cancer. Such an understanding could aid in guiding the development of therapies specifically targeting altered calcium signaling in cancer cells during tumorigenic progression. Findings from some of the studies that have assessed the remodeling of the calcium signal associated with tumorigenesis and/or processes important in invasion and metastasis are presented in this review. The potential of new methodologies is also discussed. This article is part of a Special Issue entitled: Membrane channels and transporters in cancers.

  15. ParABS system in chromosome partitioning in the bacterium Myxococcus xanthus.

    Directory of Open Access Journals (Sweden)

    Antonio A Iniesta

    Full Text Available Chromosome segregation is an essential cellular function in eukaryotic and prokaryotic cells. The ParABS system is a fundamental player for a mitosis-like process in chromosome partitioning in many bacterial species. This work shows that the social bacterium Myxococcus xanthus also uses the ParABS system for chromosome segregation. Its large prokaryotic genome of 9.1 Mb contains 22 parS sequences near the origin of replication, and it is shown here that M. xanthus ParB binds preferentially to a consensus parS sequence in vitro. ParB and ParA are essential for cell viability in M. xanthus as in Caulobacter crescentus, but unlike in many other bacteria. Absence of ParB results in anucleate cells, chromosome segregation defects and loss of viability. Analysis of ParA subcellular localization shows that it clusters at the poles in all cells, and in some, in the DNA-free cell division plane between two chromosomal DNA masses. This ParA localization pattern depends on ParB but not on FtsZ. ParB inhibits the nonspecific interaction of ParA with DNA, and ParA colocalizes with chromosomal DNA only when ParB is depleted. The subcellular localization of ParB suggests a single ParB-parS complex localized at the edge of the nucleoid, next to a polar ParA cluster, with a second ParB-parS complex migrating after the replication of parS takes place to the opposite nucleoid edge, next to the other polar ParA cluster.

  16. Large basis ab initio shell model investigation of 9Be and 11Be

    Energy Technology Data Exchange (ETDEWEB)

    Forssen, C; Navratil, P; Ormand, W E; Caurier, E

    2004-11-19

    We are presenting the first ab initio structure investigation of the loosely bound {sup 11}Be nucleus, together with a study of the lighter isotope {sup 9}Be. The nuclear structure of these isotopes is particularly interesting due to the appearance of a parity-inverted ground state in {sup 11}Be. Our study is performed in the framework of the ab initio no-core shell model. Results obtained using four different, high-precision two-nucleon interactions, in model spaces up to 9{h_bar}{Omega}, are shown. For both nuclei, and all potentials, we reach convergence in the level ordering of positive- and negative-parity spectra separately. Concerning their relative position, the positive-parity states are always too high in excitation energy, but a fast drop with respect to the negative-parity spectrum is observed when the model space is increased. This behavior is most dramatic for {sup 11}Be. In the largest model space we were able to reach, the 1/2{sup +} level has dropped down to become either the first or the second excited state, depending on which interaction we use. We also observe a contrasting behavior in the convergence patterns for different two-nucleon potentials, and argue that a three-nucleon interaction is needed to explain the parity inversion. Furthermore, large-basis calculations of {sup 13}C and {sup 11}B are performed. This allows us to study the systematics of the position of the first unnatural-parity state in the N = 7 isotone and the A = 11 isobar. The {sup 11}B run in the 9{h_bar}{Omega} model space involves a matrix with dimension exceeding 1.1 x 10{sup 9}, and is our largest calculation so far. We present results on binding energies, excitation spectra, level configurations, radii, electromagnetic observables, and {sup 10}Be + n overlap functions.

  17. NestedMICA as an ab initio protein motif discovery tool

    Directory of Open Access Journals (Sweden)

    Down Thomas A

    2008-01-01

    Full Text Available Abstract Background Discovering overrepresented patterns in amino acid sequences is an important step in protein functional element identification. We adapted and extended NestedMICA, an ab initio motif finder originally developed for finding transcription binding site motifs, to find short protein signals, and compared its performance with another popular protein motif finder, MEME. NestedMICA, an open source protein motif discovery tool written in Java, is driven by a Monte Carlo technique called Nested Sampling. It uses multi-class sequence background models to represent different "uninteresting" parts of sequences that do not contain motifs of interest. In order to assess NestedMICA as a protein motif finder, we have tested it on synthetic datasets produced by spiking instances of known motifs into a randomly selected set of protein sequences. NestedMICA was also tested using a biologically-authentic test set, where we evaluated its performance with respect to varying sequence length. Results Generally NestedMICA recovered most of the short (3–9 amino acid long test protein motifs spiked into a test set of sequences at different frequencies. We showed that it can be used to find multiple motifs at the same time, too. In all the assessment experiments we carried out, its overall motif discovery performance was better than that of MEME. Conclusion NestedMICA proved itself to be a robust and sensitive ab initio protein motif finder, even for relatively short motifs that exist in only a small fraction of sequences. Availability NestedMICA is available under the Lesser GPL open-source license from: http://www.sanger.ac.uk/Software/analysis/nmica/

  18. Comprehensive human transcription factor binding site map for combinatory binding motifs discovery.

    Directory of Open Access Journals (Sweden)

    Arnoldo J Müller-Molina

    Full Text Available To know the map between transcription factors (TFs and their binding sites is essential to reverse engineer the regulation process. Only about 10%-20% of the transcription factor binding motifs (TFBMs have been reported. This lack of data hinders understanding gene regulation. To address this drawback, we propose a computational method that exploits never used TF properties to discover the missing TFBMs and their sites in all human gene promoters. The method starts by predicting a dictionary of regulatory "DNA words." From this dictionary, it distills 4098 novel predictions. To disclose the crosstalk between motifs, an additional algorithm extracts TF combinatorial binding patterns creating a collection of TF regulatory syntactic rules. Using these rules, we narrowed down a list of 504 novel motifs that appear frequently in syntax patterns. We tested the predictions against 509 known motifs confirming that our system can reliably predict ab initio motifs with an accuracy of 81%-far higher than previous approaches. We found that on average, 90% of the discovered combinatorial binding patterns target at least 10 genes, suggesting that to control in an independent manner smaller gene sets, supplementary regulatory mechanisms are required. Additionally, we discovered that the new TFBMs and their combinatorial patterns convey biological meaning, targeting TFs and genes related to developmental functions. Thus, among all the possible available targets in the genome, the TFs tend to regulate other TFs and genes involved in developmental functions. We provide a comprehensive resource for regulation analysis that includes a dictionary of "DNA words," newly predicted motifs and their corresponding combinatorial patterns. Combinatorial patterns are a useful filter to discover TFBMs that play a major role in orchestrating other factors and thus, are likely to lock/unlock cellular functional clusters.

  19. Veltuzumab, an anti-CD20 mAb for the treatment of non-Hodgkin's lymphoma, chronic lymphocytic leukemia and immune thrombocytopenic purpura.

    Science.gov (United States)

    Milani, Cannon; Castillo, Jorge

    2009-04-01

    Veltuzumab is a humanized, second-generation anti-CD20 mAb currently under development by Immunomedics Inc for the potential treatment of B-cell non-Hodgkin's lymphoma (NHL) and chronic lymphocytic leukemia (CLL). Licensee Nycomed is developing veltuzumab for the potential treatment of rheumatoid arthritis and immune thrombocytopenic purpura (ITP). Veltuzumab contains 90 to 95% human antibody sequences with identical antigen framework regions to epratuzumab (a humanized anti-CD22 mAb) and similar antigen-binding determinants to rituximab (chimeric, anti-CD20 mAb and the first-line treatment of aggressive and indolent NHL). In vitro studies have demonstrated that veltuzumab has enhanced binding avidities and a stronger effect on complement-dependent cytotoxicity compared with rituximab in selected cell lines. In dose-finding phase I/II clinical trials in patients with low-grade NHL, intravenous veltuzumab demonstrated a substantial rate of complete responses in concurrence with shorter and more tolerable infusions compared with rituximab. Currently there has been no evidence of an immune response to repeated administrations, and no serious adverse events related to veltuzumab treatment in patients with NHL. Veltuzumab is undergoing clinical trials using a low-dose subcutaneous formulation in patients with NHL, CLL and ITP. Prospective, randomized clinical trials are needed to clarify the role veltuzumab will play in a market where the therapy of B-cell lymphoproliferative disorders is dominated by rituximab. PMID:19330725

  20. Realization of prediction of materials properties by ab initio computer simulation

    Indian Academy of Sciences (India)

    Yoshiyuki Kawazoe

    2003-01-01

    Ab initio treatment is becoming realistic to predict physical, chemical, and even mechanical properties of academically and industrially interesting materials. There is, however, some limitation in size and time of the system up to the order of several hundred atoms and ∼ 1 pico second, even if we use the fastest supercomputer efficiently. Therefore, it is very difficult to simulate realistic materials with grain boundaries and important reactions like diffusion in materials. To improve this situation, two ways have been invented. One way is to upgrade approximations to match the necessary levels according to inhomogeneous electron gas theory beyond the present day standard, i.e. local density approximation (LDA). The reason is simply that the system we are interested in is composed of many particles interacting with Coulomb forces governed by quantum mechanics. (Complete knowledge is available, and only what we should do is to make better approximations to explain the phenomena!). Another is to extract the necessary parameters from the ab initio calculations on systems with limited number of atoms, and apply these results into cluster variation, direct, or any other sophisticated methods based on classical concepts such as statistical mechanics. In this paper, several typical examples recently worked out by our research group are introduced to indicate that these methodologies are actually possible to be successfully used to predict materials properties before experiments based on the present day state-of-art supercomputing systems. It includes scientific visualization of the results of ab initio molecular dynamics simulation on atom insertion process to C60 and to carbon nanotube, tight-binding calculation of single electron conductance properties in nanotube to create nano-scale diode virtually by computer, which will be a base of future nanoscale electric device in nanometer size, Li + H reaction without Born–Oppenheimer approximation, structural phase

  1. An HIV-1 envelope immunogen with W427S mutation in CD4 binding site induced more T follicular helper memory cells and reduced non-specific antibody responses.

    Directory of Open Access Journals (Sweden)

    Hao-Tong Yu

    Full Text Available The CD4 binding site (CD4BS of the HIV-1 envelope glycoprotein (Env contains epitopes for broadly neutralizing antibody (nAb and is the target for the vaccine development. However, the CD4BS core including residues 425-430 overlaps the B cell superantigen site and may be related to B cell exhaustion in HIV-1 infection. Furthermore, production of nAb and high-affinity plasma cells needs germinal center reaction and the help of T follicular helper (Tfh cells. We believe that strengthening the ability of Env CD4BS in inducing Tfh response and decreasing the effects of the superantigen are the strategies for eliciting nAb and development of HIV-1 vaccine. We constructed a gp120 mutant W427S of an HIV-1 primary R5 strain and examined its ability in the elicitation of Ab and the production of Tfh by immunization of BALB/c mice. We found that the trimeric wild-type gp120 can induce more non-specific antibody-secreting plasma cells, higher serum IgG secretion, and more Tfh cells by splenocyte. The modified W427S gp120 elicits higher levels of specific binding antibodies as well as nAbs though it produces less Tfh cells. Furthermore, higher Tfh cell frequency does not correlate to the specific binding Abs or nAbs indicating that the wild-type gp120 induced some non-specific Tfh that did not contribute to the production of specific Abs. This gp120 mutant led to more memory Tfh production, especially, the effector memory Tfh cells. Taken together, W427S gp120 could induce higher level of specific binding and neutralizing Ab production that may be associated with the reduction of non-specific Tfh but strengthening of the memory Tfh.

  2. Cholesterol Corrects Altered Conformation of MHC-II Protein in Leishmania donovani Infected Macrophages: Implication in Therapy

    Science.gov (United States)

    Chakrabarti, Saikat; Roy, Syamal

    2016-01-01

    Background Previously we reported that Kala-azar patients show progressive decrease in serum cholesterol as a function of splenic parasite burden. Splenic macrophages (MΦ) of Leishmania donovani (LD) infected mice show decrease in membrane cholesterol, while LD infected macrophages (I-MΦ) show defective T cell stimulating ability that could be corrected by liposomal delivery of cholesterol. T helper cells recognize peptide antigen in the context of class II MHC molecule. It is known that the conformation of a large number of membrane proteins is dependent on membrane cholesterol. In this investigation we tried to understand the influence of decreased membrane cholesterol in I-MΦ on the conformation of MHC-II protein and peptide-MHC-II stability, and its bearing on the antigen specific T-cell activation. Methodology/Principal Findings MΦ of CBA/j mice were infected with Leishmania donovani (I-MΦ). Two different anti-Aκ mAbs were used to monitor the status of MHC-II protein under parasitized condition. One of them (11.5–2) was conformation specific, whereas the other one (10.2.16) was not. Under parasitized condition, the binding of 11.5–2 decreased significantly with respect to the normal counterpart, whereas that of 10.2.16 remained unaltered. The binding of 11.5–2 was restored to normal upon liposomal delivery of cholesterol in I-MΦ. By molecular dynamics (MD) simulation studies we found that there was considerable conformational fluctuation in the transmembrane domain of the MHC-II protein in the presence of membrane cholesterol than in its absence, which possibly influenced the distal peptide binding groove. This was evident from the faster dissociation of the cognate peptide from peptide-MHC complex under parasitized condition, which could be corrected by liposomal delivery of cholesterol in I-MΦ. Conclusion The decrease in membrane cholesterol in I-MΦ may lead to altered conformation of MHC II, and this may contribute to a faster dissociation of

  3. Cellulose binding domain proteins

    Energy Technology Data Exchange (ETDEWEB)

    Shoseyov, Oded (Karmey Yosef, IL); Shpiegl, Itai (Rehovot, IL); Goldstein, Marc (Davis, CA); Doi, Roy (Davis, CA)

    1998-01-01

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  4. Sequential memory: Binding dynamics

    Science.gov (United States)

    Afraimovich, Valentin; Gong, Xue; Rabinovich, Mikhail

    2015-10-01

    Temporal order memories are critical for everyday animal and human functioning. Experiments and our own experience show that the binding or association of various features of an event together and the maintaining of multimodality events in sequential order are the key components of any sequential memories—episodic, semantic, working, etc. We study a robustness of binding sequential dynamics based on our previously introduced model in the form of generalized Lotka-Volterra equations. In the phase space of the model, there exists a multi-dimensional binding heteroclinic network consisting of saddle equilibrium points and heteroclinic trajectories joining them. We prove here the robustness of the binding sequential dynamics, i.e., the feasibility phenomenon for coupled heteroclinic networks: for each collection of successive heteroclinic trajectories inside the unified networks, there is an open set of initial points such that the trajectory going through each of them follows the prescribed collection staying in a small neighborhood of it. We show also that the symbolic complexity function of the system restricted to this neighborhood is a polynomial of degree L - 1, where L is the number of modalities.

  5. Lectin binding in meningiomas.

    Science.gov (United States)

    Kleinert, R; Radner, H

    1987-01-01

    Forty-two meningiomas of different morphological sub-type were examined to determine their pattern of binding to 11 different lectins which characterize cell surface components such as carbohydrate residues. Histiocytic and xanthoma cells within meningiomas could be demonstrated with six different lectins: wheat germ agglutinin (WGA), peanut agglutinin (PNA) Bauhinia purpurea agglutinin (BPA), Helix pomatia agglutinin (HPA), Vicia fava agglutinin (VFA) and Soyabean agglutinin (SBA). Vascular elements including endothelial cells and intimal cells, bound Ulex europaeus agglutinin type 1 (UEA 1), WGA and HPA. The fibrous stroma in fibrous and fibroblastic meningiomas bound PNA, Laburnum alpinum agglutinin (LAA) and SBA. Tumour cells in meningotheliomatous meningiomas and some areas of anaplastic meningiomas bound Concanavalin A, PNA, LAA and VFA whereas tumour cells in fibrous and fibroblastic meningiomas bound BPA, LAA and VFA. Lectin binding has proved to be of value in detecting histiocytic and xanthoma cells together with vascular elements within meningiomas. In addition, the different lectin binding patterns allow different histological sub-types of meningioma to be distinguished although the biological significance of the binding patterns is unclear. PMID:3658105

  6. Altering petrology through microbial dissimilatory phosphite oxidation

    Science.gov (United States)

    Zhu, H.; Figueroa, I.; Coates, J. D.

    2013-12-01

    Microbial enhanced oil recovery (MEOR) takes advantage of various microbial metabolisms to increase hydrocarbon and energy yield by improving oil flow and flood water sweep in a reservoir during tertiary recovery. Wormholing at the injection well is believed to be the result of the large drop in pressure when water exits the injection well and enters the unconsolidated reservoir matrix. One possible means of prevent this event is to consolidate the rock matrix immediately around the injection well to create a permeable zone of stable petrology. Many microbial processes are known to result in the precipitation of ionic components into their environment creating solid-phase minerals. Such processes could be judiciously applied to bind unconsolidated matrices in order to form a permeable concreted rock matrix, which would minimize wormholing events and thus improve floodwater sweep. However, to date, apart from the application of urea oxidation creating calcium carbonate precipitation, there has been little investigation of the applicability of these precipitated bioconcretions to MEOR strategies and none to control wormholing events. Here we present a novel approach to altering rock petrology to concrete unconsolidated matrices in the near well environment by the biogenesis of authigenic minerals through microbial dissimilatory phosphite oxidation. Desulfotignum phosphitoxidans, strain FiPS-3 is currently the only isolated organism capable of using phosphite (HPO32-) as an electron donor for growth. This process, known as dissimilatory phosphite oxidation (DPO), can be coupled to either sulfate reduction or homoacetogenesis and leads to the accumulation of inorganic phosphate in the medium. The resulting insoluble mineral phases can coat the rock environment resulting in a concretion binding the unconsolidated matrix particles into a single phase. In this study we demonstrate that DPO can effectively produce calcium or magnesium phosphate minerals in packed glass

  7. Augmented wave ab initio EFG calculations: some methodological warnings

    Energy Technology Data Exchange (ETDEWEB)

    Errico, Leonardo A. [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Renteria, Mario [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Petrilli, Helena M. [Instituto de Fisica-DFMT, Universidade de Sao Paulo, C.P. 66318, 05315-970 Sao Paulo, SP (Brazil)]. E-mail: hmpetril@macbeth.if.usp.br

    2007-02-01

    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO{sub 2}. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects.

  8. Understanding phonon transport in thermoelectric materials using ab initio approaches

    Science.gov (United States)

    Broido, David

    Good thermoelectric materials have low phonon thermal conductivity, kph. Accurate theories to describe kph are important components in developing predictive models of thermoelectric efficiency that can help guide synthesis and measurement efforts. We have developed ab initio approaches to calculate kph, in which phonon modes and phonon scattering rates are computed using interatomic force constants determined from density functional theory, and a full solution of the Boltzmann transport equation for phonons is implemented. A recent approach to calculate interatomic force constants using ab initio molecular dynamics has yielded a good description of the thermal properties of Bi2Te3. But, the complexity of new promising candidate thermoelectric materials introduces computational challenges in assessing their thermal properties. An example is germanane, a germanium based hydrogen-terminated layered semiconductor, which we will discuss in this talk.

  9. Chemical and Electrochemical Metallic Covering of ABS polymers

    Directory of Open Access Journals (Sweden)

    Florentina Cziple

    2009-10-01

    Full Text Available The aim of this paper is the deposition of metallic layers on the surface of ABS plastic material, by means of two consecutive procedures, namely: the first is represented by the conductibility through chemical or electro-chemical metallic covering of the polymeric support and the second procedure is the electrodeposition of the metal through galvanization. The chemical mehtod consists in the submission of ABS polymers to some conductibility operations of the plastic material surface through chemical copper plating (chemical roughing, degreasing with ultra-sounds, chemical sensitivation, activation and proper conductibility of the material surface. The electrochemical deposition of nickel was made on the plastic material activated in the mixture solution of graphite with potassium carbonate.

  10. The density matrix renormalization group for ab initio quantum chemistry

    CERN Document Server

    Wouters, Sebastian

    2014-01-01

    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. Its underlying wavefunction ansatz, the matrix product state (MPS), is a low-rank decomposition of the full configuration interaction tensor. The virtual dimension of the MPS, the rank of the decomposition, controls the size of the corner of the many-body Hilbert space that can be reached with the ansatz. This parameter can be systematically increased until numerical convergence is reached. The MPS ansatz naturally captures exponentially decaying correlation functions. Therefore DMRG works extremely well for noncritical one-dimensional systems. The active orbital spaces in quantum chemistry are however often far from one-dimensional, and relatively large virtual dimensions are required to use DMRG for ab initio quantum chemistry (QC-DMRG). The QC-DMRG algorithm, its computational cost, and its properties are discussed. Two important aspects to reduce the computational co...

  11. Toward the Ab-initio Description of Medium Mass Nuclei

    CERN Document Server

    Barbieri, C; Soma, V; Duguet, T; Navratil, P

    2012-01-01

    As ab-initio calculations of atomic nuclei enter the A=40-100 mass range, a great challenge is how to approach the vast majority of open-shell (degenerate) isotopes. We add realistic three-nucleon interactions to the state of the art many-body Green's function theory of closed-shells, and find that physics of neutron driplines is reproduced with very good quality. Further, we introduce the Gorkov formalism to extend ab-initio theory to semi-magic, fully open-shell, isotopes. Proof-of-principle calculations for Ca-44 and Ni-74 confirm that this approach is indeed feasible. Combining these two advances (open-shells and three-nucleon interactions) requires longer, technical, work but it is otherwise within reach.

  12. Ab-initio calculations on melting of thorium

    Science.gov (United States)

    Mukherjee, D.; Sahoo, B. D.; Joshi, K. D.; Kaushik, T. C.; Gupta, Satish C.

    2016-05-01

    Ab-initio molecular dynamics study has been performed on face centered cubic structured thorium to determine its melting temperature at room pressure. The ion-electron interaction potential energy calculated as a function of temperature for three volumes (a0)3 and (1.02a0)3 and (1.04a0)3 increases gradually with temperature and undergoes a sharp jump at ~2200 K, ~2100 K and ~1800 K, respectively. Here, a0 = 5.043 Å is the equilibrium lattice parameter at 0 K obtained from ab-initio calculations. These jumps in interaction energy are treated as due to the onset of melting and corresponding temperatures as melting point. The melting point of 2100 K is close to the experimental value of 2023K. Further, the same has been verified by plotting the atomic arrangement evolved at various temperatures and corresponding pair correlation functions.

  13. Serine Proteases an Ab Initio Molecular Dynamics Study

    CERN Document Server

    De Santis, L

    1999-01-01

    In serine proteases (SP's), the H-bond between His-57 and Asp-102, and that between Gly-193 and the transition state intermediate play a crucial role for enzymatic function. To shed light on the nature of these interactions, we have carried out ab initio molecular dynamics simulations on complexes representing adducts between the reaction intermediate and elastase (one protein belonging to the SP family). Our calculations indicate the presence of a low--barrier H-bond between His-57 and Asp-102, in complete agreement with NMR experiments on enzyme--transition state analog complexes. Comparison with an ab initio molecular dynamics simulation on a model of the substrate--enzyme adduct indicates that the Gly-193--induced strong stabilization of the intermediate is accomplished by charge/dipole interactions and not by H-bonding as previously suggested. Inclusion of the protein electric field in the calculations does not affect significantly the charge distribution.

  14. Broad and potent HIV-1 neutralization by a human antibody that binds the gp41-120 interface

    Science.gov (United States)

    Huang, Jinghe; Kang, Byong H.; Pancera, Marie; Lee, Jeong Hyun; Tong, Tommy; Feng, Yu; Georgiev, Ivelin S.; Chuang, Gwo-Yu; Druz, Aliaksandr; Doria-Rose, Nicole A.; Laub, Leo; Sliepen, Kwinten; van Gils, Marit J.; de la Peña, Alba Torrents; Derking, Ronald; Klasse, Per-Johan; Migueles, Stephen A.; Bailer, Robert T.; Alam, Munir; Pugach, Pavel; Haynes, Barton F.; Wyatt, Richard T.; Sanders, Rogier W.; Binley, James M.; Ward, Andrew B.; Mascola, John R.; Kwong, Peter D.; Connors, Mark

    2014-01-01

    The isolation of human monoclonal antibodies (mAbs) is providing important insights regarding the specificities that underlie broad neutralization of HIV-1 (reviewed in1). Here we report a broad and extremely potent HIV-specific mAb, termed 35O22, which binds novel HIV-1 envelope glycoprotein (Env) epitope. 35O22 neutralized 62% of 181 pseudoviruses with an IC50<50 μg/ml. The median IC50 of neutralized viruses was 0.033 μg/ml, among the most potent thus far described. 35O22 did not bind monomeric forms of Env tested, but did bind the trimeric BG505 SOSIP.664. Mutagenesis and a reconstruction by negative-stain electron microscopy of the Fab in complex with trimer revealed it to bind a conserved epitope, which stretched across gp120 and gp41. The specificity of 35O22 represents a novel site of vulnerability on HIV Env, which serum analysis indicates to be commonly elicited by natural infection. Binding to this new site of vulnerability may thus be an important complement to current mAb-based approaches to immunotherapies, prophylaxis, and vaccine design. PMID:25186731

  15. The density matrix renormalization group for ab initio quantum chemistry

    OpenAIRE

    Wouters, Sebastian

    2015-01-01

    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. It is used as a numerically exact solver for highly correlated regions in molecules. While the method works extremely well for one-dimensional systems, the correlated regions of interest are often far from one-dimensional. In this introductory talk, I will discuss the DMRG algorithm from a quantum information perspective, how quantum information theory h...

  16. Molexpl: a tool for ab initio data exploration and visualization

    OpenAIRE

    Wang, Xueying; Onofrio, Nicolas,; Strachan, Alejandro

    2015-01-01

    Density functional theory (DFT) based on ab initio theory, is a powerful method to resolve the electronic structure of atoms, molecules and solids. However, in practical, DFT is limited to few hundreds of atoms. To overcome this limitation, researchers have developed empirical interatomic potentials implemented in molecular dynamics (MD) simulations. MD ignores the movements of electrons and describes bonding and non-bonding interaction as a function of the distance between atoms called force...

  17. Social Media Marketing : CASE: OY SUOMEN LYYRA AB

    OpenAIRE

    Eriksson, Irene

    2012-01-01

    This bachelor thesis was commissioned by Oy Suomen Lyyra Ab, the largest student online media and student card producer for higher education students in Finland. The the-sis objective was to understanding the current social media situation and activity among the students of higher education in Finland, the social media networks that the case company currently uses as well as understanding how to use these networks for successful marketing activities. The quantitative research was conducted in...

  18. Integrated Design of Antibodies for Systems Biology Using Ab Designer

    OpenAIRE

    Pisitkun, Trairak; Dummer, Patrick; Somparn, Poorichaya; Hirankarn, Nattiya; Kopp, Jeffrey B.; Knepper, Mark A.

    2014-01-01

    In the current era of large-scale biology, systems biology has evolved as a powerful approach to identify complex interactions within biological systems. In addition to high throughput identification and quantification techniques, methods based on high-quality mono-specific antibodies remain an essential element of the approach. To assist the large-scale design and production of peptide-directed antibodies for systems biology studies, we developed a fully integrated online application, AbDesi...

  19. GAUSSIAN 76: an ab initio molecular orbital program

    Energy Technology Data Exchange (ETDEWEB)

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.

    1978-06-01

    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  20. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    OpenAIRE

    G. Misra; S. Tenguria; Gautam, M.

    2011-01-01

    Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P), volume (V) and temperature (T) that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This a...

  1. Ab-initio calculations for dilute magnetic semiconductors

    OpenAIRE

    Belhadji, Brahim

    2008-01-01

    This thesis focusses on ab-initio calculations for the electronic structure and the magnetic properties of dilute magnetic semiconductors (DMS). In particular we aim at the understanding of the complex exchange interactions in these systems. Our calculations are based on density functional theory, being ideally suited for a description of the material specific properties of the considered DMS. Moreover we use the KKR Green function method in connection with the coherent potential approximatio...

  2. Thermochemical data for CVD modeling from ab initio calculations

    Energy Technology Data Exchange (ETDEWEB)

    Ho, P. [Sandia National Labs., Albuquerque, NM (United States); Melius, C.F. [Sandia National Labs., Livermore, CA (United States)

    1993-12-31

    Ab initio electronic-structure calculations are combined with empirical bond-additivity corrections to yield thermochemical properties of gas-phase molecules. A self-consistent set of heats of formation for molecules in the Si-H, Si-H-Cl, Si-H-F, Si-N-H and Si-N-H-F systems is presented, along with preliminary values for some Si-O-C-H species.

  3. Near Resonant Electronic and Rotational Energy Transfer AB(1П, J) + C(slj) → AB(1П, J') + C(slj')

    Institute of Scientific and Technical Information of China (English)

    WANG Wei-Li; SONG Peng; SHEN Yang; MA Feng-Cai

    2005-01-01

    In our previous theoretical study, the theoretical model of the collision-induced electronic and rotational energy transfer of AB(1∑, J) + C(slj) → AB(1∑, J') + C(slj') was presented. To further study the collision-induced electronic and rotational energy transfer theoretically on AB(1∏,J)+C(slj)→AB(1∏,J1)+C(slj') a theoretical model is presented, based on the time-dependent first-order Born approximation, taking into account the anisotropic LennardJones interaction potential and "straight-line" trajectory approximation. The changing tendency of the transitional probabilities with the anisotropic parameter is discussed.

  4. Pressure tracking control of vehicle ABS using piezo valve modulator

    Science.gov (United States)

    Jeon, Juncheol; Choi, Seung-Bok

    2011-03-01

    This paper presents a wheel slip control for the ABS(anti-lock brake system) of a passenger vehicle using a controllable piezo valve modulator. The ABS is designed to optimize for braking effectiveness and good steerability. As a first step, the principal design parameters of the piezo valve and pressure modulator are appropriately determined by considering the braking pressure variation during the ABS operation. The proposed piezo valve consists of a flapper, pneumatic circuit and a piezostack actuator. In order to get wide control range of the pressure, the pressure modulator is desired. The modulator consists of a dual-type cylinder filled with different substances (fluid and gas) and a piston rod moving vertical axis to transmit the force. Subsequently, a quarter car wheel slip model is formulated and integrated with the governing equation of the piezo valve modulator. A sliding mode controller to achieve the desired slip rate is then designed and implemented. Braking control performances such as brake pressure and slip rate are evaluated via computer simulations.

  5. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Draayer, Jerry P. [Louisiana State Univ., Baton Rouge, LA (United States)

    2014-09-28

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  6. A highly accurate ab initio potential energy surface for methane

    Science.gov (United States)

    Owens, Alec; Yurchenko, Sergei N.; Yachmenev, Andrey; Tennyson, Jonathan; Thiel, Walter

    2016-09-01

    A new nine-dimensional potential energy surface (PES) for methane has been generated using state-of-the-art ab initio theory. The PES is based on explicitly correlated coupled cluster calculations with extrapolation to the complete basis set limit and incorporates a range of higher-level additive energy corrections. These include core-valence electron correlation, higher-order coupled cluster terms beyond perturbative triples, scalar relativistic effects, and the diagonal Born-Oppenheimer correction. Sub-wavenumber accuracy is achieved for the majority of experimentally known vibrational energy levels with the four fundamentals of 12CH4 reproduced with a root-mean-square error of 0.70 cm-1. The computed ab initio equilibrium C-H bond length is in excellent agreement with previous values despite pure rotational energies displaying minor systematic errors as J (rotational excitation) increases. It is shown that these errors can be significantly reduced by adjusting the equilibrium geometry. The PES represents the most accurate ab initio surface to date and will serve as a good starting point for empirical refinement.

  7. Acceleration of the Convergence in ab initio Atomic Relaxations

    Science.gov (United States)

    Zhao, Zhengji; Wang, Lin-Wang; Meza, Juan

    2006-03-01

    Atomic relaxations is often required to accurately describe the properties of nanosystems. In ab initio calculations, a common practice is to use a standard search algorithm, such as BFGS (Broyden-Fletcher-Goldfarb-Shanno) or CG (conjugate gradient) method, which starts the atomic relaxations without any knowledge of the Hessian matrix of the system. For example, the initial Hessian in BFGS method is often set to identity, and there is no preconditioning to CG method. One way to accelerate the convergence of the atomic relaxations is to estimate an approximate Hessian matrix of the system and then use it as the initial Hessian in BFGS method or a preconditioner in CG method. Previous attempts to obtain the approximated Hessian were focused on the use of classical force field models which rely on the existence of good parameters. Here, we present an alternative method to estimate the Hessian matrix of a nanosystem. First, we decompose the system into motifs which consist of a few atoms, then calculate the Hessian matrix elements on different motif types from ab initio calculations for small prototype systems. Then we generate the Hessian Matrix of the whole system by putting together these motif Hessians. We have applied our motif-based Hessian matrix in ab initio atomic relaxations in several bulk (with/without impurity) and quantum dot systems, and have found a speed up factor of 2 to 4 depending on the system size.

  8. Studies on the runaway reaction of ABS polymerization process

    Energy Technology Data Exchange (ETDEWEB)

    Hu, K.-H. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China); Kao, C.-S. [Department of Safety, Health and Environmental Engineering, National United University, Taiwan (China); Duh, Y.-S. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China)], E-mail: yihshingduh@yahoo.com.tw

    2008-11-15

    Taiwan has the largest acrylonitrile-butadiene-styrene (ABS) copolymer production in the world. Preventing on unexpected exothermic reactions and related emergency relief hazard is essential in the safety control of ABS emulsion polymerization. A VSP2 (Vent Sizing Package 2) apparatus is capable of studying both normal and abnormal conditions (e.g., cooling failure, mischarge, etc.) of industrial process. In this study, the scenarios were verified from the following abnormal conditions: loss of cooling, double charge of initiator, overcharge of monomer, without charge of solvent, and external fire. An external fire with constant heating will promote higher self-heat rate and this is recommended as the worst case scenario of emulsion polymerization on butadiene. Cooling failure coupled with bulk system of reactant was determined to be the credible worst case in ABS emulsion polymerization. Finally, the emergency vent sizing based on thermokinetics from VSP associated with DIERS methodology were used for evaluating the vent sizing and compared to that of the industrial plants.

  9. Converting of Matter to Nuclear Energy by AB-Generator

    Directory of Open Access Journals (Sweden)

    Alexander Bolonkin

    2009-01-01

    Full Text Available Problem statement: Researcher offered a new nuclear generator which allowed to convert any matter to nuclear energy in accordance with Einstein equation E = mc2. The method was based upon tapping the energy potential of a Micro Black Hole (MBH and Hawking radiation created by this MBH. Researcher did not meet the idea and its research in literature to develop the method for getting a cheap energy. Approach: As is well-known, vacuum continuously produced virtual pairs of particles and antiparticles, in particular, photons and anti-photons. MBH event horizon allowed separating them. Anti-photons can be moved to MBH and be annihilated, decreasing mass of MBH, resulting photons leave the MBH neighborhood as Hawking radiation. The offered nuclear generator (named by Researcher as AB-generator utilized Hawking radiation and injected the matter into MBH and kept MBH in a stable state with near-constant mass. Results: AB-generator can be produced gigantic energy outputs and should be cheaper than a conventional electric station by a factor of hundreds of times. One also may be used in aerospace as a photon rocket or as a power source for many vehicles. Conclusion: Many scientists expect Large Hadron Collider at CERN may be produced one MBH every second. A technology to capture them may be developed; than they may be used for the AB-generator.

  10. Monte Carlo simulation of AB-copolymers with saturating bonds

    CERN Document Server

    Chertovich, A V; Khokhlov, A R; Bohr, J

    2003-01-01

    Structural transitions in a single AB-copolymer chain where saturating bonds can be formed between A-and B-units are studied by means of Monte Carlo computer simulations using the bond fluctuation model. Three transitions are found, coil-globule, coil-hairpin and globule-hairpin, depending on the nature of a particular AB-sequence: statistical random sequence, diblock sequence and 'random-complementary' sequence (one-half of such an AB-sequence is random with Bernoulli statistics while the other half is complementary to the first one). The properties of random-complementary sequences are closer to those of diblock sequences than to the properties of random sequences. The model (although quite rough) is expected to represent some basic features of real RNA molecules, i.e. the formation of secondary structure of RNA due to hydrogen bonding of corresponding bases and stacking interactions of the base pairs in helixes. We introduce the notation of RNA-like copolymers and discuss in what sense the sequences studie...

  11. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Science.gov (United States)

    Makhov, Dmitry V.; Glover, William J.; Martinez, Todd J.; Shalashilin, Dmitrii V.

    2014-08-01

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as "cloning," in analogy to the "spawning" procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, "trains," as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  12. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Makhov, Dmitry V.; Shalashilin, Dmitrii V. [Department of Chemistry, University of Leeds, Leeds LS2 9JT (United Kingdom); Glover, William J.; Martinez, Todd J. [Department of Chemistry and The PULSE Institute, Stanford University, Stanford, California 94305, USA and SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)

    2014-08-07

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  13. A Complete and Accurate Ab Initio Repeat Finding Algorithm.

    Science.gov (United States)

    Lian, Shuaibin; Chen, Xinwu; Wang, Peng; Zhang, Xiaoli; Dai, Xianhua

    2016-03-01

    It has become clear that repetitive sequences have played multiple roles in eukaryotic genome evolution including increasing genetic diversity through mutation, changes in gene expression and facilitating generation of novel genes. However, identification of repetitive elements can be difficult in the ab initio manner. Currently, some classical ab initio tools of finding repeats have already presented and compared. The completeness and accuracy of detecting repeats of them are little pool. To this end, we proposed a new ab initio repeat finding tool, named HashRepeatFinder, which is based on hash index and word counting. Furthermore, we assessed the performances of HashRepeatFinder with other two famous tools, such as RepeatScout and Repeatfinder, in human genome data hg19. The results indicated the following three conclusions: (1) The completeness of HashRepeatFinder is the best one among these three compared tools in almost all chromosomes, especially in chr9 (8 times of RepeatScout, 10 times of Repeatfinder); (2) in terms of detecting large repeats, HashRepeatFinder also performed best in all chromosomes, especially in chr3 (24 times of RepeatScout and 250 times of Repeatfinder) and chr19 (12 times of RepeatScout and 60 times of Repeatfinder); (3) in terms of accuracy, HashRepeatFinder can merge the abundant repeats with high accuracy. PMID:26272474

  14. Ab initio nuclear structure - the large sparse matrix eigenvalue problem

    International Nuclear Information System (INIS)

    The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several ab initio methods have now emerged that provide nearly exact solutions for some nuclear properties. The ab initio no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds 1010 and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving this large sparse matrix eigenvalue problem. We also outline the challenges that lie ahead for achieving further breakthroughs in fundamental nuclear theory using these ab initio approaches.

  15. Ab initio van der waals interactions in simulations of water alter structure from mainly tetrahedral to high-density-like

    DEFF Research Database (Denmark)

    Møgelhøj, Andreas; Kelkkanen, Kari André; Wikfeldt, K Thor;

    2011-01-01

    , from the much lower and broader first peak in the oxygen-oxygen pair-correlation function (PCF) and loss of structure in the outer hydration shells. Inclusion of vdW interactions is shown to shift the balance of resulting structures from open tetrahedral to more close-packed. The resulting O-O PCF...... shows some resemblance with experiment for high-density water ( Soper , A. K. and Ricci , M. A. Phys. Rev. Lett. 2000 , 84 , 2881 ), but not directly with experiment for ambient water. Considering the accuracy of the new functionals for interaction energies, we investigate whether the simulation...

  16. Monoclonal antibodies to HLA-E bind epitopes carried by unfolded β2 m-free heavy chains.

    Science.gov (United States)

    Tremante, Elisa; Lo Monaco, Elisa; Ingegnere, Tiziano; Sampaoli, Camilla; Fraioli, Rocco; Giacomini, Patrizio

    2015-08-01

    Since HLA-E heavy chains accumulate free of their light β2 -microglobulin (β2 m) subunit, raising mAbs to folded HLA-E heterodimers has been difficult, and mAb characterization has been controversial. Herein, mAb W6/32 and 5 HLA-E-restricted mAbs (MEM-E/02, MEM-E/07, MEM-E/08, DT9, and 3D12) were tested on denatured, acid-treated, and natively folded (both β2 m-associated and β2 m-free) HLA-E molecules. Four distinct conformations were detected, including unusual, partially folded (and yet β2 m-free) heavy chains reactive with mAb DT9. In contrast with previous studies, epitope mapping and substitution scan on thousands of overlapping peptides printed on microchips revealed that mAbs MEM-E/02, MEM-E/07, and MEM-E/08 bind three distinct α1 and α2 domain epitopes. All three epitopes are linear since they span just 4-6 residues and are "hidden" in folded HLA-E heterodimers. They contain at least one HLA-E-specific residue that cannot be replaced by single substitutions with polymorphic HLA-A, HLA-B, HLA-C, HLA-F, and HLA-G residues. Finally, also the MEM-E/02 and 3D12 epitopes are spatially distinct. In summary, HLA-E-specific residues are dominantly immunogenic, but only when heavy chains are locally unfolded. Consequently, the available mAbs fail to selectively bind conformed HLA-E heterodimers, and HLA-E expression may have been inaccurately assessed in some previous oncology, reproductive immunology, virology, and transplantation studies. PMID:25982269

  17. Towards hydrogen metallization: an Ab initio approach; Vers la metallisation de l`hydrogene: approche AB initio

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, St

    1998-12-31

    The quest for metallic hydrogen is a major goal for both theoretical and experimental condensed matter physics. Hydrogen and deuterium have been compressed up to 200 GPa in diamond anvil cells, without any clear evidence for a metallic behaviour. Loubeyere has recently suggested that hydrogen could metallize, at pressures within experimental range, in a new Van der Waals compound: Ar(H{sub 2}){sub 2} which is characterized at ambient pressure by an open and anisotropic sublattice of hydrogen molecules, stabilized by an argon skeleton. This thesis deals with a detailed ab initio investigation, by Car-Parrinello molecular dynamics methods, of the evolution under pressure of this compound. In a last chapter, we go to much higher pressures and temperatures, in order to compare orbital and orbital free ab initio methods for the dense hydrogen plasma. (author) 109 refs.

  18. A ProActive Backend for ABS: from Modelling to Deployment

    OpenAIRE

    Rochas, Justine; Henrio, Ludovic

    2014-01-01

    ABS is an object-oriented modeling language that is based on a concurrent object group model, derived itself from the active object model. Its goal is to describe distributed and concurrent applications in order to verify their properties and make them safer. Thanks to the ABS Tool Suite, ABS programs can be translated into the Java programming language (among others), and executed in the JVM. This paper presents a new ABS backend that translates ABS programs into ProActive programs. ProActiv...

  19. EFFICIENCY OF RECOMBINANT TNF-BINDING PROTEIN FROM VARIOLA VIRUS IN A MODEL OF COLLAGEN-INDUCED ARTHRITIS

    Directory of Open Access Journals (Sweden)

    D. D. Tsyrendorzhiev

    2013-01-01

    Full Text Available Abstract. This paper presents the results of the research on the effectiveness of recombinant TNF-binding protein of variola virus (VARV-CrmB in a model of collagen-induced arthritis (CIA in mice (CBAxC57Bl6 F1. The introduction of VARV-CrmB and polyclonal antibody to recombinant mouse TNF (poly-AbMuTNF led to an improvement of clinical manifestations of CIA by reducing the swelling and increasing the mobility of mice limbs. The introduction of VARV-CrmB and poly-AbMuTNF reduced the number of neutrophilic granulocytes and granulocytic precursors. The introduction of VARV-CrmB and poly-AbMuTNF into mice decreased collagenolysis in the blood serum and the content of glycosaminoglycans at the early stages of experimentation. Treatment with VARV-CrmB and poly-AbMuTNF of mice with CIA significantly decreased the chemiluminescence response of blood leukocytes. VARV-CrmB exerted more pronounced inhibitory effect on the production of reactive oxygen metabolites by blood leukocytes of mice with CIA than poly-AbMuTNF. Improvement of clinical condition of the mice with CIA has a more prolonged effect following introduction of the VARV-CrmB than after injection of poly-AbMuTNF. The results suggest the recombinant viral protein VARVCrmB to be a new potential TNF-antagonist.

  20. First-principles Hubbard U approach for small molecule binding in metal-organic frameworks

    Science.gov (United States)

    Mann, Gregory W.; Lee, Kyuho; Cococcioni, Matteo; Smit, Berend; Neaton, Jeffrey B.

    2016-05-01

    We apply first-principles approaches with Hubbard U corrections for calculation of small molecule binding energetics to open-shell transition metal atoms in metal-organic frameworks (MOFs). Using density functional theory with van der Waals dispersion-corrected functionals, we determine Hubbard U values ab initio through an established linear response procedure for M-MOF-74, for a number of different metal centers (M = Ti, V, Cr, Mn, Fe, Co, Ni, and Cu). While our ab initio U values differ from those used in previous work, we show that they result in lattice parameters and electronic contributions to CO2-MOF binding energies that lead to excellent agreement with experiments and previous results, yielding lattice parameters within 3%. In addition, U-dependent calculations for an example system, Co-MOF-74, suggest that the CO2 binding energy grows monotonically with the value of Hubbard U, with the binding energy shifting 4 kJ/mol (or 0.041 eV) over the range of U = 0-5.4 eV. These results provide insight into an approximate but computationally efficient means for calculation of small molecule binding energies to open-shell transition metal atoms in MOFs and suggest that the approach can be predictive with good accuracy, independent of the cations used and the availability of experimental data.

  1. Mapping the binding site of a cross-reactive Plasmodium falciparum PfEMP1 monoclonal antibody inhibitory of ICAM-1 binding

    DEFF Research Database (Denmark)

    Lennartz, Frank; Bengtsson, Anja; Olsen, Rebecca W;

    2015-01-01

    The virulence of Plasmodium falciparum is linked to the ability of infected erythrocytes (IE) to adhere to the vascular endothelium, mediated by P. falciparum erythrocyte membrane protein 1 (PfEMP1). In this article, we report the functional characterization of an mAb that recognizes a panel of PfEMP......1s and inhibits ICAM-1 binding. The 24E9 mouse mAb was raised against PFD1235w DBLβ3_D4, a domain from the group A PfEMP1s associated with severe malaria. 24E9 recognizes native PfEMP1 expressed on the IE surface and shows cross-reactivity with and cross-inhibition of the ICAM-1 binding capacity...... of domain cassette 4 PfEMP1s. 24E9 Fab fragments bind DBLβ3_D4 with nanomolar affinity and inhibit ICAM-1 binding of domain cassette 4-expressing IE. The antigenic regions targeted by 24E9 Fab were identified by hydrogen/deuterium exchange mass spectrometry and revealed three discrete peptides...

  2. Epigenetic alterations in gastric carcinogenesis

    Institute of Scientific and Technical Information of China (English)

    In-Seon CHOI; Tsung-Teh WU

    2005-01-01

    Gastric cancer is believed to result in part from the accumulation of multiple genetic alterations leading to oncogene overexpression and tumor suppressor loss. Epigenetic alterations as a distinct and crucial mechanism to silence a variety of methylated tissue-specific and imprinted genes, have been extensively studied in gastric carcinoma and play important roles in gastric carcinogenesis. This review will briefly discuss the basic aspects of DNA methylation and CpG island methylation, in particular the epigenetic alterations of certain critical genes implicated in gastric carcinogenesis and its relevance of clinical implications.

  3. Novel structural features of CDK inhibition revealed by an ab initio computational method combined with dynamic simulations

    CERN Document Server

    Heady, Lucy; Mancera, Ricardo L; Joyce, Sian; Venkitaraman, Ashok R; Artacho, Emilio; Skylaris, Chris-Kriton; Ciacchi, Lucio Colombi; Payne, Mike C

    2008-01-01

    The rational development of specific inhibitors for the ~500 protein kinases encoded in the human genome is impeded by a poor understanding of the structural basis for the activity and selectivity of small molecules that compete for ATP binding. Combining classical dynamic simulations with a novel ab initio computational approach linear-scalable to molecular interactions involving thousands of atoms, we have investigated the binding of five distinct inhibitors to the cyclin-dependent kinase CDK2. We report here that polarization and dynamic hydrogen bonding effects, so far undetected by crystallography, affect both their activity and selectivity. The effects arise from the specific solvation patterns of water molecules in the ATP binding pocket or the intermittent formation of hydrogen bonds during the dynamics of CDK/inhibitor interactions and explain the unexpectedly high potency of certain inhibitors such as 3-(3H-imidazol-4-ylmethylene)-5-methoxy-1,3-dihydro-indol-2-one (SU9516). The Lys89 residue in the ...

  4. Liver fatty acid-binding protein binds monoacylglycerol in vitro and in mouse liver cytosol.

    Science.gov (United States)

    Lagakos, William S; Guan, Xudong; Ho, Shiu-Ying; Sawicki, Luciana Rodriguez; Corsico, Betina; Kodukula, Sarala; Murota, Kaeko; Stark, Ruth E; Storch, Judith

    2013-07-01

    Liver fatty acid-binding protein (LFABP; FABP1) is expressed both in liver and intestinal mucosa. Mice null for LFABP were recently shown to have altered metabolism of not only fatty acids but also monoacylglycerol, the two major products of dietary triacylglycerol hydrolysis (Lagakos, W. S., Gajda, A. M., Agellon, L., Binas, B., Choi, V., Mandap, B., Russnak, T., Zhou, Y. X., and Storch, J. (2011) Am. J. Physiol. Gastrointest. Liver Physiol. 300, G803-G814). Nevertheless, the binding and transport of monoacylglycerol (MG) by LFABP are uncertain, with conflicting reports in the literature as to whether this single chain amphiphile is in fact bound by LFABP. In the present studies, gel filtration chromatography of liver cytosol from LFABP(-/-) mice shows the absence of the low molecular weight peak of radiolabeled monoolein present in the fractions that contain LFABP in cytosol from wild type mice, indicating that LFABP binds sn-2 MG in vivo. Furthermore, solution-state NMR spectroscopy demonstrates two molecules of sn-2 monoolein bound in the LFABP binding pocket in positions similar to those found for oleate binding. Equilibrium binding affinities are ∼2-fold lower for MG compared with fatty acid. Finally, kinetic studies examining the transfer of a fluorescent MG analog show that the rate of transfer of MG is 7-fold faster from LFABP to phospholipid membranes than from membranes to membranes and occurs by an aqueous diffusion mechanism. These results provide strong support for monoacylglycerol as a physiological ligand for LFABP and further suggest that LFABP functions in the efficient intracellular transport of MG. PMID:23658011

  5. Liver Fatty Acid-binding Protein Binds Monoacylglycerol in Vitro and in Mouse Liver Cytosol*

    Science.gov (United States)

    Lagakos, William S.; Guan, Xudong; Ho, Shiu-Ying; Sawicki, Luciana Rodriguez; Corsico, Betina; Kodukula, Sarala; Murota, Kaeko; Stark, Ruth E.; Storch, Judith

    2013-01-01

    Liver fatty acid-binding protein (LFABP; FABP1) is expressed both in liver and intestinal mucosa. Mice null for LFABP were recently shown to have altered metabolism of not only fatty acids but also monoacylglycerol, the two major products of dietary triacylglycerol hydrolysis (Lagakos, W. S., Gajda, A. M., Agellon, L., Binas, B., Choi, V., Mandap, B., Russnak, T., Zhou, Y. X., and Storch, J. (2011) Am. J. Physiol. Gastrointest. Liver Physiol. 300, G803–G814). Nevertheless, the binding and transport of monoacylglycerol (MG) by LFABP are uncertain, with conflicting reports in the literature as to whether this single chain amphiphile is in fact bound by LFABP. In the present studies, gel filtration chromatography of liver cytosol from LFABP−/− mice shows the absence of the low molecular weight peak of radiolabeled monoolein present in the fractions that contain LFABP in cytosol from wild type mice, indicating that LFABP binds sn-2 MG in vivo. Furthermore, solution-state NMR spectroscopy demonstrates two molecules of sn-2 monoolein bound in the LFABP binding pocket in positions similar to those found for oleate binding. Equilibrium binding affinities are ∼2-fold lower for MG compared with fatty acid. Finally, kinetic studies examining the transfer of a fluorescent MG analog show that the rate of transfer of MG is 7-fold faster from LFABP to phospholipid membranes than from membranes to membranes and occurs by an aqueous diffusion mechanism. These results provide strong support for monoacylglycerol as a physiological ligand for LFABP and further suggest that LFABP functions in the efficient intracellular transport of MG. PMID:23658011

  6. Inclusion of a non-immunoglobulin binding protein in two-site ELISA for quantification of human serum proteins without interference by heterophilic serum antibodies.

    Science.gov (United States)

    Andersson, Mårten; Rönnmark, Jenny; Areström, Iréne; Nygren, Per Ake; Ahlborg, Niklas

    2003-12-01

    Measurement of human serum molecules with two-site ELISA can be biased by the presence of human heterophilic anti-animal immunoglobulin antibodies (HAIA) that cause false-positive signals by cross-linking the monoclonal (mAb) and/or polyclonal antibodies (pAb) used for the pre- (capture) and post-analyte steps (detection). To evaluate a novel ELISA format designed to avoid interference by HAIA, a target-specific non-immunoglobulin (Ig) affinity protein (affibody) was used to replace one of the antibodies. First, a human IgA-binding affibody (Z(IgA)) selected by phage display technology from a combinatorial library of a single Staphylococcus aureus protein A domain was used. The detection range of IgA standard using an ELISA based on Z(IgA) for capture and goat pAb against IgA (pAb(IgA)) for detection was comparable with that of using pAb(IgA) for both capture and detection. Secondly, another affibody (Z(Apo)) was combined with mAb and used to detect recombinant human apolipoprotein A-1. The affibody/antibody ELISAs were also used to quantify human serum levels of IgA and apolipoprotein A1. To verify that human serum did not cause false-positive signals in the affibody/antibody ELISA format, the ability of human serum to cross-link affibodies, mAb (mouse or rat) and/or pAb (goat) displaying non-matched specificities was assessed; affibodies and antibodies were not cross-linked whereas all combinations of mAb and/or pAb were cross-linked. The combination of affibodies and antibodies for analysis of human serum molecules represents a novel two-site ELISA format which precludes false-positive signals caused by HAIA. PMID:14659914

  7. Megalin binds and mediates cellular internalization of folate binding protein

    DEFF Research Database (Denmark)

    Birn, Henrik; Zhai, Xiaoyue; Holm, Jan;

    2005-01-01

    Folate is an essential vitamin involved in a number of biological processes. High affinity folate binding proteins (FBPs) exist both as glycosylphosphatidylinositol-linked, membrane associated folate binding proteins and as soluble FBPs in plasma and some secretory fluids such as milk, saliva...... to bind and mediate cellular uptake of FBP. Surface plasmon resonance analysis shows binding of bovine and human milk FBP to immobilized megalin, but not to low density lipoprotein receptor related protein. Binding of (125)I-labeled folate binding protein (FBP) to sections of kidney proximal tubule, known...... to express high levels of megalin, is inhibitable by excess unlabeled FBP and by receptor associated protein, a known inhibitor of binding to megalin. Immortalized rat yolk sac cells, representing an established model for studying megalin-mediated uptake, reveal (125)I-labeled FBP uptake which is inhibited...

  8. Monoclonal antibodies against rabbit mammary prolactin receptors. Specific antibodies to the hormone binding domain

    International Nuclear Information System (INIS)

    Three monoclonal antibodies (M110, A82, and A917) were obtained by fusing myeloma cells and spleen cells from mice immunized with partially purified rabbit mammary gland prolactin (PRL) receptors. All 3 antibodies were capable of complete inhibition of 125I-ovine prolactin (oPRL) binding to rabbit mammary PRL receptors in either particulate or soluble form. M110 showed slightly greater potency than oPRL in competing for 125I-oPRL binding. These antibodies also inhibited PRL binding to microsomal fractions from rabbit liver, kidney, adrenal, ovary, and pig mammary gland, although A82 showed poor inhibition in pig mammary gland. There was no cross-reaction of any of the 3 monoclonal antibodies (mAbs) for the other species tested: human (T-47D breast cancer cells) and rat (liver, ovary). In order to confirm that these antibodies are specific to the binding domain, antibodies were purified, iodinated, and binding characteristics were investigated. 125I-M110 and 125I-A82 binding was completely inhibited by lactogenic hormones, whereas nonlactogenic hormones did not cross-react. Competition of 125I-M110 by oPRL was comparable to that of 125I-oPRL by unlabeled oPRL, while 125I-A917 binding was only partially competed (30-60%) by lactogenic hormones. Tissue and species specificity of labeled antibody binding paralleled results of binding inhibition experiments using 125I-oPRL. In addition, A82 and A917 completely inhibited 125I-M110 binding. In contrast, 125I-A82 binding was stimulated by A917 and 125I-A917 binding was stimulated by A82

  9. Evolution of the acyl-CoA binding protein (ACBP)

    DEFF Research Database (Denmark)

    Burton, Mark; Rose, Timothy M; Faergeman, Nils J;

    2005-01-01

    Acyl-CoA-binding protein (ACBP) is a 10 kDa protein that binds C12-C22 acyl-CoA esters with high affinity. In vitro and in vivo experiments suggest that it is involved in multiple cellular tasks including modulation of fatty acid biosynthesis, enzyme regulation, regulation of the intracellular ac......-specific paralogues have evolved altered functions. The appearance of ACBP very early on in evolution points towards a fundamental role of ACBP in acyl-CoA metabolism, including ceramide synthesis and in signalling....

  10. Pulmonary alterations in Behcet's disease

    International Nuclear Information System (INIS)

    Purpose: This study aims to demonstrate pulmonary alterations (PA) in patients with Behcet's disease by using CT. Materials and methods: CTs of 50 patients with Behcet's disease and 20 others in a control group have been evaluated retrospectively for PA (septal, reticular, nodular, atelectatic opacities). Results: Eight out of 50 patients (16%) with Behcet's disease showed PA. Three out of 20 (15%) in the control group showed PA. No differences were observed between Behcet's disease patients and the control group regarding pulmonary alterations (p = 0.917). No differences were observed in the disease duration, ages and sex in either group in those with and without PA. Conclusion: Pulmonary alterations can be seen in patients with Behcet's disease, but these alterations are not significant.

  11. 40 CFR 174.506 - Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. 174.506 Section 174.506 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED...

  12. Ab initio quasiparticle bandstructure of ABA and ABC-stacked graphene trilayers

    Science.gov (United States)

    Menezes, Marcos; Capaz, Rodrigo; Louie, Steven

    2013-03-01

    We obtain the quasiparticle band structure of ABA and ABC-stacked graphene trilayers through ab initio density functional theory (DFT) and many-body quasiparticle calculations within the GW approximation. To interpret our results, we fit the DFT and GW π bands to a low energy tight-binding model, which is found to reproduce very well the observed features near the K point. The values of the extracted hopping parameters are reported and compared with available theoretical and experimental data. For both stackings, the quasiparticle corrections lead to a renormalization of the Fermi velocity, an effect also observed in previous calculations on monolayer graphene. They also increase the separation between the higher energy bands, which is proportional to the nearest neighbor interlayer hopping parameter γ1. Both features are brought to closer agreement with experiment through the quasiparticle corrections. Finally, other effects, such as trigonal warping, electron-hole assymetry and energy gaps are discussed in terms of the associated parameters. This work was supported by the Brazilian funding agencies: CAPES, CNPq, FAPERJ and INCT-Nanomateriais de Carbono. It was also supported by NSF grant No. DMR10-1006184 and U.S. DOE under Contract No. DE-AC02-05CH11231.

  13. Ab-initio study of germanium di-interstitial using a hybrid functional (HSE)

    Science.gov (United States)

    Igumbor, E.; Ouma, C. N. M.; Webb, G.; Meyer, W. E.

    2016-01-01

    In this work, we present ab-initio calculation results of Ge di-interstitials (I2(Ge)) in the framework of the density functional theory (DFT) using the Heyd, Scuseria, and Ernzerhof (HSE) hybrid functional. The formation energy, transition levels and minimum energy configurations were obtained for I2(Ge) -2, -1, 0, +1 and +2 charge states. The calculated formation energies show that for all charge states of I2(Ge), the double tetrahedral (T) configuration formed the most stable defect with a binding energy of 1.24 eV in the neutral state. We found the (+2/+1) charge state transition level for the T lying below the conduction band minimum and (+2/+1) for the split[110]-tetrahedral configuration lying deep at 0.41 eV above the valence band maximum. The di-interstitials in Ge exhibited the properties of both shallow and deep donor levels at (+2/+1) within the band gap and depending on the configurations. I2(Ge) gave rise to negative-U, with effective-U values of -0.61 and -1.6 eV in different configurations. We have compared our results with calculations of di-interstitials in silicon and available experimental data.

  14. Ab-Initio Based Computation of Rate Constants for Spin Forbidden Metalloprotein-Substrate Reactions

    Science.gov (United States)

    Ozkanlar, Abdullah; Rodriguez, Jorge H.

    2007-03-01

    Some chemical and biochemical reactions are non-adiabatic processes whereby the total spin angular momentum, before and after the reaction, is not conserved. These are named spin- forbidden reactions. The application of ab-initio methods, such as spin density functional theory (SDFT), to the prediction of rate constants is a challenging task of fundamental and practical importance. We apply non-adiabatic transition state theory (NA-TST) in conjuntion with SDFT to predict the rate constant of the spin- forbidden recombination of carbon monoxide with iron tetracarbonyl. To model the surface hopping probability between singlet and triplet states, the Landau-Zener formalism is used. The lowest energy point for singlet-triplet crossing, known as minimum energy crossing point (MECP), was located and used to compute, in a semi-quantum approach, reaction rate constants at 300 K. The predicted rates are in very good agreement with experiment. In addition, we present results for the spin- forbidden ligand binding reactions of iron-containing heme proteins such as myoglobin.

  15. Crystallization and preliminary X-ray crystallographic analysis of the sclerostin-neutralizing Fab AbD09097.

    Science.gov (United States)

    Boschert, Verena; Muth, Eva Maria; Knappik, Achim; Frisch, Christian; Mueller, Thomas D

    2015-04-01

    The secreted cystine-knot protein sclerostin was first identified from genetic screening of patients suffering from the rare bone-overgrowth diseases sclerosteosis and van Buchem disease. Sclerostin acts a negative regulator of bone growth through inhibiting the canonical Wnt signalling cascade by binding to and blocking the Wnt co-receptor LRP5/6. Its function in blocking osteoblastogenesis makes it an important target for osteoanabolic therapy approaches to treat osteoporosis, which is characterized by a progressive decrease in bone mass and density. In this work, the production, crystallization and preliminary X-ray diffraction data analysis of a sclerostin-neutralizing human Fab antibody fragment, AbD09097, obtained from a naive antibody library are reported. Crystals of the Fab AbD09097 belonged to space group P21, with unit-cell parameters a = 45.19, b = 78.49, c = 59.20 Å, β = 95.71° and diffracted X-rays to a resolution of 1.8 Å.

  16. Characterization of a novel domain ‘GATE’ in the ABC protein DrrA and its role in drug efflux by the DrrAB complex

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Han; Rahman, Sadia; Li, Wen; Fu, Guoxing; Kaur, Parjit, E-mail: pkaur@gsu.edu

    2015-03-27

    A novel domain, GATE (Glycine-loop And Transducer Element), is identified in the ABC protein DrrA. This domain shows sequence and structural conservation among close homologs of DrrA as well as distantly-related ABC proteins. Among the highly conserved residues in this domain are three glycines, G215, G221 and G231, of which G215 was found to be critical for stable expression of the DrrAB complex. Other conserved residues, including E201, G221, K227 and G231, were found to be critical for the catalytic and transport functions of the DrrAB transporter. Structural analysis of both the previously published crystal structure of the DrrA homolog MalK and the modeled structure of DrrA showed that G215 makes close contacts with residues in and around the Walker A motif, suggesting that these interactions may be critical for maintaining the integrity of the ATP binding pocket as well as the complex. It is also shown that G215A or K227R mutation diminishes some of the atomic interactions essential for ATP catalysis and overall transport function. Therefore, based on both the biochemical and structural analyses, it is proposed that the GATE domain, located outside of the previously identified ATP binding and hydrolysis motifs, is an additional element involved in ATP catalysis. - Highlights: • A novel domain ‘GATE’ is identified in the ABC protein DrrA. • GATE shows high sequence and structural conservation among diverse ABC proteins. • GATE is located outside of the previously studied ATP binding and hydrolysis motifs. • Conserved GATE residues are critical for stability of DrrAB and for ATP catalysis.

  17. Probing the binding of trypsin to glutathione-stabilized gold nanoparticles in aqueous solution.

    Science.gov (United States)

    Wang, Gongke; Liu, Xingbing; Yan, Changling; Bai, Guangyue; Lu, Yan

    2015-11-01

    We investigate the interaction of trypsin with glutathione-stabilized Au nanoparticles (NPs) using fluorescence, synchronous fluorescence and ultraviolet (UV) absorption spectroscopy. We find that trypsin binds strongly to the Au NPs with a static quenching mechanism, and that the interaction is characteristic of positive cooperative binding. Furthermore, we determine the binding constants and the thermodynamic parameters, which suggest that the main binding forces between the glutathione-stabilized Au NPs and trypsin are electrostatic interactions and hydrogen bonding. Analysis of UV-vis absorption spectra suggests that aggregation of the Au NPs occurs in the trypsin/Au NPs system, which significantly alters the conformation of the protein.

  18. Carboplatin binding to histidine

    Energy Technology Data Exchange (ETDEWEB)

    Tanley, Simon W. M. [University of Manchester, Brunswick Street, Manchester M13 9PL (United Kingdom); Diederichs, Kay [University of Konstanz, D-78457 Konstanz (Germany); Kroon-Batenburg, Loes M. J. [Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Levy, Colin [University of Manchester, 131 Princess Street, Manchester M1 7DN (United Kingdom); Schreurs, Antoine M. M. [Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Helliwell, John R., E-mail: john.helliwell@manchester.ac.uk [University of Manchester, Brunswick Street, Manchester M13 9PL (United Kingdom)

    2014-08-29

    An X-ray crystal structure showing the binding of purely carboplatin to histidine in a model protein has finally been obtained. This required extensive crystallization trials and various novel crystal structure analyses. Carboplatin is a second-generation platinum anticancer agent used for the treatment of a variety of cancers. Previous X-ray crystallographic studies of carboplatin binding to histidine (in hen egg-white lysozyme; HEWL) showed the partial conversion of carboplatin to cisplatin owing to the high NaCl concentration used in the crystallization conditions. HEWL co-crystallizations with carboplatin in NaBr conditions have now been carried out to confirm whether carboplatin converts to the bromine form and whether this takes place in a similar way to the partial conversion of carboplatin to cisplatin observed previously in NaCl conditions. Here, it is reported that a partial chemical transformation takes place but to a transplatin form. Thus, to attempt to resolve purely carboplatin binding at histidine, this study utilized co-crystallization of HEWL with carboplatin without NaCl to eliminate the partial chemical conversion of carboplatin. Tetragonal HEWL crystals co-crystallized with carboplatin were successfully obtained in four different conditions, each at a different pH value. The structural results obtained show carboplatin bound to either one or both of the N atoms of His15 of HEWL, and this particular variation was dependent on the concentration of anions in the crystallization mixture and the elapsed time, as well as the pH used. The structural details of the bound carboplatin molecule also differed between them. Overall, the most detailed crystal structure showed the majority of the carboplatin atoms bound to the platinum centre; however, the four-carbon ring structure of the cyclobutanedicarboxylate moiety (CBDC) remained elusive. The potential impact of the results for the administration of carboplatin as an anticancer agent are described.

  19. GQ Lup Ab Visible & Near-Infrared Photometric Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Marois, C; Macintosh, B; Barman, T

    2006-08-07

    We have re-analyzed archival HST R and I band images and Subaru CH{sub 4}, H, Ks and L{prime} data of the recently discovered planetary mass companion (PMC) GQ Lup Ab. With these we produce the first R and I band photometry of the companion and fit a radius and effective temperature using detailed model atmospheres. We find an effective temperature of 2338 {+-} 100K, and a radius of 0.37 {+-} 0.05R{sub {circle_dot}} and luminosity of log(L/L{sub {circle_dot}}) = -2.43 {+-} 0.07 (at 140pc). Since we fit wavelengths that span most of the emitted radiation from GQ Lup this luminosity estimate is robust, with uncertainty dominated by the distance uncertainty. The radius obtained for 140pc (0.37R{sub {circle_dot}}) is significantly larger than the one originally derived. The mass of the object is much more model-dependent than the radiative properties, but for the GAIA dusty models we find a mass between 9-20 M{sub Jup}, in the range of the brown dwarf and PMC deuterium burning boundary. Assuming a distance of 140pc, observations fit to 1{sigma} the Baraffe evolution model for a {approx} 15 M{sub Jup} brown dwarf. Additionally, the F606W photometric band is significantly overluminous compared to model predictions. Such overluminosity could be explained by a bright H{alpha} emission from chromospheric activity, interaction with another undetected companion, or accretion. Assuming that GQ Lup Ab has a bright H{alpha} emission line, its H{alpha} emission strength is 10{sup -1.71 {+-} 0.10} L{sub bol}, significantly larger than field late-type dwarfs. GQ Lup Ab might be strongly accreting and still be in its formation phase.

  20. Computational Investigation of Glycosylation Effects on a Family 1 Carbohydrate-Binding Module

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, C. B.; Talib, M. F.; McCabe, C.; Bu, L.; Adney, W. S.; Himmel, M. E.; Crowley, M. F.; Beckham, G. T.

    2012-01-27

    Carbohydrate-binding modules (CBMs) are ubiquitous components of glycoside hydrolases, which degrade polysaccharides in nature. CBMs target specific polysaccharides, and CBM binding affinity to cellulose is known to be proportional to cellulase activity, such that increasing binding affinity is an important component of performance improvement. To ascertain the impact of protein and glycan engineering on CBM binding, we use molecular simulation to quantify cellulose binding of a natively glycosylated Family 1 CBM. To validate our approach, we first examine aromatic-carbohydrate interactions on binding, and our predictions are consistent with previous experiments, showing that a tyrosine to tryptophan mutation yields a 2-fold improvement in binding affinity. We then demonstrate that enhanced binding of 3-6-fold over a nonglycosylated CBM is achieved by the addition of a single, native mannose or a mannose dimer, respectively, which has not been considered previously. Furthermore, we show that the addition of a single, artificial glycan on the anterior of the CBM, with the native, posterior glycans also present, can have a dramatic impact on binding affinity in our model, increasing it up to 140-fold relative to the nonglycosylated CBM. These results suggest new directions in protein engineering, in that modifying glycosylation patterns via heterologous expression, manipulation of culture conditions, or introduction of artificial glycosylation sites, can alter CBM binding affinity to carbohydrates and may thus be a general strategy to enhance cellulase performance. Our results also suggest that CBM binding studies should consider the effects of glycosylation on binding and function.

  1. Ab initio structure determination via powder X-ray diffraction

    Indian Academy of Sciences (India)

    Digamber G Porob; T N Guru Row

    2001-10-01

    Structure determination by powder X-ray diffraction data has gone through a recent surge since it has become important to get to the structural information of materials which do not yield good quality single crystals. Although the method of structure completion when once the starting model is provided is facile through the Rietveld refinement technique, the structure solution ab initio os still not push-button technology. In this article a survey of the recent development in this area is provided with an illustration of the structure determination of -NaBi3V2O10.

  2. Electrostriction coefficient of ferroelectric materials from ab initio computation

    Directory of Open Access Journals (Sweden)

    Z. Jiang

    2016-06-01

    Full Text Available Electrostriction is an important material property that characterizes how strain changes with the development of polarization inside a material. We show that ab initio techniques developed in recent years can be exploited to compute and understand electrostriction of ferroelectric materials. Here, electrostriction coefficients of ferroelectric BaTiO3, PbTiO3, as well as dielectric BaZrO3, are obtained and analyzed. Possible causes of the difference between experimental and numerical results are discussed. We also identified that relative displacements between certain ions at a given polarization could be a good indicator of a material’s electrostriction property.

  3. Tailoring magnetoresistance at the atomic level: An ab initio study

    KAUST Repository

    Tao, Kun

    2012-01-05

    The possibility of manipulating the tunneling magnetoresistance (TMR) of antiferromagnetic nanostructures is predicted in the framework of ab initio calculations. By the example of a junction composed of an antiferromagnetic dimer and a spin-polarized scanning tunneling microscopy tip we show that the TMR can be tuned and even reversed in sign by lateral and vertical movements of the tip. Moreover, our finite-bias calculations demonstrate that the magnitude and the sign of the TMR can also be tuned by an external voltage. © 2012 American Physical Society.

  4. Accelerating ab initio molecular dynamics simulations by linear prediction methods

    Science.gov (United States)

    Herr, Jonathan D.; Steele, Ryan P.

    2016-09-01

    Acceleration of ab initio molecular dynamics (AIMD) simulations can be reliably achieved by extrapolation of electronic data from previous timesteps. Existing techniques utilize polynomial least-squares regression to fit previous steps' Fock or density matrix elements. In this work, the recursive Burg 'linear prediction' technique is shown to be a viable alternative to polynomial regression, and the extrapolation-predicted Fock matrix elements were three orders of magnitude closer to converged elements. Accelerations of 1.8-3.4× were observed in test systems, and in all cases, linear prediction outperformed polynomial extrapolation. Importantly, these accelerations were achieved without reducing the MD integration timestep.

  5. Equations of state of heavy metals: ab initio approaches

    International Nuclear Information System (INIS)

    The determination of equations of states of heavy metals through ab initio calculation, i.e. without any adjustable parameter, allows to access to pressure and temperature thermodynamic conditions sometimes inaccessible to experiment. To perform such calculations, density functional theory (DFT) is a good starting point: when electronic densities are homogeneous enough, the local density approximation (LDA) remarkably accounts for thermodynamic properties of heavy metals, such as tantalum, or the light actinides, as well for static properties - equilibrium volume, elastic constants - as for dynamical quantities like phonon spectra. For heavier elements, like neptunium or plutonium, relativistic effects and strong electronic interactions must be taken into account, which requires more sophisticated theoretical approaches. (authors)

  6. Ab initio Study of He Stability in hcp-Ti

    Institute of Scientific and Technical Information of China (English)

    DAI Yun-Ya; YANG Li; PENG Shu-Ming; LONG Xing-Gui; GAO Fei; ZU Xiao-Tao

    2010-01-01

    @@ The stability of He in hcp-Ti is studied using the ab initio method based on the density functional theory.The results indicate that a single He atom prefers to occupy the tetrahedral site rather than the octahedral site.The interaction of He defects with Ti atoms is employed to explain the relative stabilities of He point defects in hcp-Ti.The relative stability of He defects in hcp-Ti is useful for He clustering and bubble nucleation in metal tritides,which provides the basis for development of improved atomistic models.

  7. Polymeric nitrogen in a graphene matrix: An ab initio study

    Science.gov (United States)

    Timoshevskii, V.; Ji, Wei; Abou-Rachid, Hakima; Lussier, Louis-Simon; Guo, H.

    2009-09-01

    A hybrid material where polymeric nitrogen chains are sandwiched between graphene sheets in the form of a three-dimensional crystal, is predicted by means of ab initio simulations. It is demonstrated that chainlike polymeric nitrogen phase becomes stable at ambient pressure when intercalated in a multilayer graphene matrix. The physical origin of this stabilization is identified by studying the electronic properties of the system. This approach of stabilizing polymeric nitrogen by means of external three-dimensional matrix constitutes a path toward synthesizing different types of nitrogen-based high-energy materials.

  8. Ab-initio study of transition metal hydrides

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Ramesh [Dept. of Physics, Feroze Gandhi Insititute of Engineering and Technology, Raebareli-229001 (India); Shukla, Seema, E-mail: sharma.yamini62@gmail.com; Dwivedi, Shalini, E-mail: sharma.yamini62@gmail.com; Sharma, Yamini, E-mail: sharma.yamini62@gmail.com [Theoretical Condensed Matter Physics Laboratory, Dept. of Physics Feroze Gandhi College, Raebareli-229001 (India)

    2014-04-24

    We have performed ab initio self consistent calculations based on Full potential linearized augmented plane wave (FP-LAPW) method to investigate the optical and thermal properties of yttrium hydrides. From the band structure and density of states, the optical absorption spectra and specific heats have been calculated. The band structure of Yttrium metal changes dramatically due to hybridization of Y sp orbitals with H s orbitals and there is a net charge transfer from metal to hydrogen site. The electrical resistivity and specific heats of yttrium hydrides are lowered but the thermal conductivity is slightly enhanced due to increase in scattering from hydrogen sites.

  9. Ab initio study of phase equilibria in TiCx

    DEFF Research Database (Denmark)

    Korzhavyi, P.A.; Pourovskii, L.V.; Hugosson, H.W.;

    2002-01-01

    The phase diagram for the vacancy-ordered structures in the substoichiometric TiCx (x = 0.5-1.0) has been established from Monte Carlo simulations with the long-range pair and multisite effective interactions obtained from ab initio calculations. Three ordered superstructures of vacancies (Ti2C, Ti......3C2, and Ti6C5) are found to be ground state configurations. Their stability has been verified by full-potential total energy calculations of the fully relaxed structures....

  10. Accelerating Ab Initio Nuclear Physics Calculations with GPUs

    CERN Document Server

    Potter, Hugh; Maris, Pieter; Sosonkina, Masha; Vary, James; Binder, Sven; Calci, Angelo; Langhammer, Joachim; Roth, Robert; Çatalyürek, Ümit; Saule, Erik

    2014-01-01

    This paper describes some applications of GPU acceleration in ab initio nuclear structure calculations. Specifically, we discuss GPU acceleration of the software package MFDn, a parallel nuclear structure eigensolver. We modify the matrix construction stage to run partly on the GPU. On the Titan supercomputer at the Oak Ridge Leadership Computing Facility, this produces a speedup of approximately 2.2x - 2.7x for the matrix construction stage and 1.2x - 1.4x for the entire run.

  11. Acidity of HOCH, HSCN, HNCO, HNCS: a treatment from the viewpoint of ab initio approach

    Directory of Open Access Journals (Sweden)

    ALEXEI N. PANKRATOV

    2005-10-01

    Full Text Available The electronic structures of the molecules HOCN, HSCN, HNCO, HNCS and the anions [OCN]-, [SCN]- have been investigated ab initio at the RHF/6-31G(d, RHF/6-31G(d,p, MP2/6-31G(d//RHF/6-31G(d and MP2/6-31G(d,p//RHF/6-31G(d,p theory levels. The thermodynamic stability of the HNCO and HNCS molecules was shown to be higher than that of the HOCH and HSCN molecules, respectively.The following series of the alteration of the protolytes strength HSCN > HOCH, HNCS > HNCO, HOCN > HNCO, HSCN > HNCS was substantiated. The computations taking into account the electronic correlation (MP2/6-31G(d//RHF/6-31G(d and MP2/6-31G(d,p//RHF/6-31G(d,p reflect the general sequence of change in the proton-donor properties: HSCN > HOCN > HNCS > HNCO, coinciding with the order of descending hydrophobicity of the compounds. The comparative proton-donor ability of the above acids in aqueous solutions is determined basically from the electronic structure and size of their molecules and anions [OCN]-, [SCN]-, but not on medium effects.

  12. Ab initio energetics of LaBO3(001) (B=Mn, Fe, Co, and Ni) for solid oxide fuel cell cathodes

    DEFF Research Database (Denmark)

    Lee, Yueh-Lin; Kleis, Jesper; Rossmeisl, Jan;

    2009-01-01

    LaBO3 (B=Mn, Fe, Co, and Ni) perovskites form a family of materials of significant interest for cathodes of solid oxide fuel cells (SOFCs). In this paper ab initio methods are used to study both bulk and surface properties of relevance for SOFCs, including vacancy formation and oxygen binding......(2-) with a surface oxygen for B=Ni. Entropy effects are predicted to stabilize the monomer oxygen surface state for all B cations at higher temperatures. Overall oxygen coverage of the (001) BO2 surface is predicted to be quite low at SOFC operating conditions. These results will aid in understanding the oxygen...

  13. Identification of Eps15 as antigen recognized by the monoclonal antibodies aa2 and ab52 of the Wuerzburg Hybridoma Library against Drosophila brain.

    Directory of Open Access Journals (Sweden)

    Partho Halder

    Full Text Available The Wuerzburg Hybridoma Library against the Drosophila brain represents a collection of around 200 monoclonal antibodies that bind to specific structures in the Drosophila brain. Here we describe the immunohistochemical staining patterns, the Western blot signals of one- and two-dimensional electrophoretic separation, and the mass spectrometric characterization of the target protein candidates recognized by the monoclonal antibodies aa2 and ab52 from the library. Analysis of a mutant of a candidate gene identified the Drosophila homolog of the Epidermal growth factor receptor Pathway Substrate clone 15 (Eps15 as the antigen for these two antibodies.

  14. Altered cell wall properties are responsible for ammonium-reduced aluminium accumulation in rice roots.

    Science.gov (United States)

    Wang, Wei; Zhao, Xue Qiang; Chen, Rong Fu; Dong, Xiao Ying; Lan, Ping; Ma, Jian Feng; Shen, Ren Fang

    2015-07-01

    The phytotoxicity of aluminium (Al) ions can be alleviated by ammonium (NH4(+)) in rice and this effect has been attributed to the decreased Al accumulation in the roots. Here, the effects of different nitrogen forms on cell wall properties were compared in two rice cultivars differing in Al tolerance. An in vitro Al-binding assay revealed that neither NH4(+) nor NO3(-) altered the Al-binding capacity of cell walls, which were extracted from plants not previously exposed to N sources. However, cell walls extracted from NH4(+)-supplied roots displayed lower Al-binding capacity than those from NO3(-)-supplied roots when grown in non-buffered solutions. Fourier-transform infrared microspectroscopy analysis revealed that, compared with NO3(-)-supplied roots, NH4(+)-supplied roots possessed fewer Al-binding groups (-OH and COO-) and lower contents of pectin and hemicellulose. However, when grown in pH-buffered solutions, these differences in the cell wall properties were not observed. Further analysis showed that the Al-binding capacity and properties of cell walls were also altered by pHs alone. Taken together, our results indicate that the NH4(+)-reduced Al accumulation was attributed to the altered cell wall properties triggered by pH decrease due to NH4(+) uptake rather than direct competition for the cell wall binding sites between Al(3+) and NH4(+).

  15. Pharmacokinetics of radioimmunotherapeutic agent of direct labeling mAb 188Re-HAb18

    Institute of Scientific and Technical Information of China (English)

    Chao Lou; Zhi-Nan Chen; Hui-Jie Bian; Jie Li; Shou-Bo Zhou

    2002-01-01

    AIM: To labed Anti-hepatoma monoclonal antibody (mAb)fragment HAb18 F (ab')2 was labeled with 188 Re for thepharmacokinetic model of 188 Re-HAb18 F (ab')2 and toevaluate its pharmacokinetic parameters in hepatoma-bearing nude mice.METHODS: HAb18 F(ab')2 was directly labeled with 188Reusing 2-mercaptoethanol (2-ME) as reducing agents.Labeling efficiency and immunoreactivity of 188 Re-HAb18 F( ab')2 were evaluated by Whatman 3MM paperchromatography and live cell assay, respectively.Biodiatribution analysis was also conducted in nude micebearing human hepatoma in which animals were sacrificed atdifferent time points(1, 4, 18, 24 and 24h) after 188Re-HAb18F(ab' )2 was injected through tail-vein into hepatoma-bearingnude mice. The blood and radioactivity of organs and masswere measured. The concentrations of 188 Re-HAb18 F(ab')2were evaluated with a pharmacokinetic 3P97 software.RESULTS: The optimum labeling efficiency andimmunoreactive fraction were 91.7% and 0.78%,respectively. The parameters of 188Re-HAb18 F(ab')2 were:T1/2, 2.29h; Vd, 1.49 × 10-9L@ Bq- 1; AUC, 20.49 × 109Bq@ h@L-1 ;CL, 0.45 × 10-3L@ h- 1. 188Re- HAb18 F(ab')2 could locatespecially in hepatoma with high selective reactivity of HAb18F(ab')2. 188 Re-HAb18 F(ab')2 was mainly eliminated bykidney. The maximal tumor to blood ratio was at 48h, andmaximal tumor to liver ratio was at 18h.CONCLUTION: The pharmacokinetics of 188Re-HAb18 F(ab')2fit a I-compartment model. 188 Re-HAb18 F(ab')2 can beuptaken selectively at the hepatoma site.

  16. Actin-Dependent Alterations of Dendritic Spine Morphology in Shankopathies

    Science.gov (United States)

    Sarowar, Tasnuva

    2016-01-01

    Shank proteins (Shank1, Shank2, and Shank3) act as scaffolding molecules in the postsynaptic density of many excitatory neurons. Mutations in SHANK genes, in particular SHANK2 and SHANK3, lead to autism spectrum disorders (ASD) in both human and mouse models. Shank3 proteins are made of several domains—the Shank/ProSAP N-terminal (SPN) domain, ankyrin repeats, SH3 domain, PDZ domain, a proline-rich region, and the sterile alpha motif (SAM) domain. Via various binding partners of these domains, Shank3 is able to bind and interact with a wide range of proteins including modulators of small GTPases such as RICH2, a RhoGAP protein, and βPIX, a RhoGEF protein for Rac1 and Cdc42, actin binding proteins and actin modulators. Dysregulation of all isoforms of Shank proteins, but especially Shank3, leads to alterations in spine morphogenesis, shape, and activity of the synapse via altering actin dynamics. Therefore, here, we highlight the role of Shank proteins as modulators of small GTPases and, ultimately, actin dynamics, as found in multiple in vitro and in vivo models. The failure to mediate this regulatory role might present a shared mechanism in the pathophysiology of autism-associated mutations, which leads to dysregulation of spine morphogenesis and synaptic signaling.

  17. Risperidone treatment increases CB1 receptor binding in rat brain

    DEFF Research Database (Denmark)

    Secher, Anna; Husum, Henriette; Holst, Birgitte;

    2010-01-01

    BACKGROUND/AIMS: Body weight gain is a common side effect of treatment with antipsychotics, but the mechanisms underlying this weight gain are unknown. Several factors may be involved in antipsychotic-induced body weight gain including the cannabinoid receptor 1 (CB(1)), the serotonin receptor 2C...... positively correlated with visceral fat mass. Risperidone treatment increased CB(1) receptor binding in the arcuate nucleus (40%), hippocampus (25-30%) and amygdala (35%) without concurrent alterations in the CB(1) receptor mRNA. Risperidone treatment increased adiponectin mRNA. CONCLUSION: The present study...... showed that risperidone treatment altered CB(1) receptor binding in the rat brain. Risperidone-induced adiposity and metabolic dysfunction in the clinic may be explained by increased CB(1) receptor density in brain regions involved in appetite and regulation of metabolic function....

  18. Ab initio molecular dynamics study of the properties of cerium in liquid sodium at 1000 K temperature

    Energy Technology Data Exchange (ETDEWEB)

    Samin, Adib; Li, Xiang; Zhang, Jinsuo [Nuclear Engineering Program, Department of Mechanical and Aerospace Engineering, The Ohio State University, 201 W 19th Avenue, Columbus, Ohio 43210 (United States); Mariani, R. D. [Idaho National Laboratory, Materials and Fuels Complex, Idaho Falls, Idaho 83415 (United States); Unal, Cetin [Los Alamos National Laboratory, P.O. Box 1663, Los Alamos, New Mexico 87545 (United States)

    2015-12-21

    For liquid-sodium-cooled fast nuclear reactor systems, it is crucial to understand the behavior of lanthanides and other potential fission products in liquid sodium or other liquid metal solutions such as liquid cesium-sodium. In this study, we focus on lanthanide behavior in liquid sodium. Using ab initio molecular dynamics, we found that the solubility of cerium in liquid sodium at 1000 K was less than 0.78 at. %, and the diffusion coefficient of cerium in liquid sodium was calculated to be 5.57 × 10{sup −9} m{sup 2}/s. Furthermore, it was found that cerium in small amounts may significantly alter the heat capacity of the liquid sodium system. Our results are consistent with the experimental results for similar materials under similar conditions.

  19. Ab initio molecular dynamics study of the properties of cerium in liquid sodium at 1000 K temperature

    Science.gov (United States)

    Samin, Adib; Li, Xiang; Zhang, Jinsuo; Mariani, R. D.; Unal, Cetin

    2015-12-01

    For liquid-sodium-cooled fast nuclear reactor systems, it is crucial to understand the behavior of lanthanides and other potential fission products in liquid sodium or other liquid metal solutions such as liquid cesium-sodium. In this study, we focus on lanthanide behavior in liquid sodium. Using ab initio molecular dynamics, we found that the solubility of cerium in liquid sodium at 1000 K was less than 0.78 at. %, and the diffusion coefficient of cerium in liquid sodium was calculated to be 5.57 × 10-9 m2/s. Furthermore, it was found that cerium in small amounts may significantly alter the heat capacity of the liquid sodium system. Our results are consistent with the experimental results for similar materials under similar conditions.

  20. Electrocatalytic reduction of nitrate and selenate by NapAB.

    Science.gov (United States)

    Gates, Andrew J; Butler, Clive S; Richardson, David J; Butt, Julea N

    2011-01-01

    Bacterial cellular metabolism is renowned for its metabolic diversity and adaptability. However, certain environments present particular challenges. Aerobic metabolism of highly reduced carbon substrates by soil bacteria such as Paracoccus pantotrophus presents one such challenge since it may result in excessive electron delivery to the respiratory redox chain when compared with the availability of terminal oxidant, O2. The level of a periplasmic ubiquinol-dependent nitrate reductase, NAP, is up-regulated in the presence of highly reduced carbon substrates. NAP oxidizes ubiquinol at the periplasmic face of the cytoplasmic membrane and reduces nitrate in the periplasm. Thus its activity counteracts the accumulation of excess reducing equivalents in ubiquinol, thereby maintaining the redox poise of the ubiquinone/ubiquinol pool without contributing to the protonmotive force across the cytoplasmic membrane. Although P. pantotrophus NapAB shows a high level of substrate specificity towards nitrate, the enzyme has also been reported to reduce selenate in spectrophotometric solution assays. This transaction draws on our current knowledge concerning the bacterial respiratory nitrate reductases and extends the application of PFE (protein film electrochemistry) to resolve and quantify the selenate reductase activity of NapAB. PMID:21265780