
Sample records for ab binding alters

  1. Alterations in chlorophyll a/b binding proteins in Solanaceae cybrids. (United States)

    Babiychuk, E; Schantz, R; Cherep, N; Weil, J H; Gleba, Y; Kushnir, S


    In this study we have constructed a number of plants (cybrids), in which the nuclear genome of Nicotiana plumbaginifolia is combined with the plastome of Atropa belladonna, or the nuclear genome of N. tabacum with plastomes of Lycium barbarum, Scopolia carniolica, Physochlaine officinalis or Nolana paradoxa. Our biochemical and immunological analyses prove that in these cybrids the biogenesis of the chlorophyll a/b binding proteins (CAB) of the light harvesting complex II (LHCII) is altered. Besides normal sized CAB polypeptides of 27, 25.5 and 25 kDa, which become less abundant, the cybrids analyzed have additional polypeptides of 26, 24.5 and 24 kDa. Direct protein micro-sequencing showed that at least two truncated 26 kDa CAB polypeptides in plant cells containing a nucleus of N. plumbaginifolia and plastids of A. belladonna are encoded by the type 1 Lhcb genes. These polypeptides are 11-12 amino acids shorter at the N-terminus than the expected size. Based on the available data we conclude that the biogenesis of the LHCII in vivo may depend on plastome-encoded factor(s). These results suggest that plastome-encoded factors that cause specific protein degradation and/or abnormal processing might determine compartmental genetic incompatibility in plants. PMID:8544830

  2. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with western corn rootworm midgut membrane binding sites.

    Directory of Open Access Journals (Sweden)

    Huarong Li

    Full Text Available BACKGROUND: Bacillus thuringiensis (Bt Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interactions are one line of evidence that Bt protein mechanisms of action differ and that the probability of receptor-mediated cross-resistance is low. METHODOLOGY/PRINCIPAL FINDINGS: Binding site interactions were investigated between Cry34Ab1/Cry35Ab1 and coleopteran active insecticidal proteins Cry3Aa, Cry6Aa, and Cry8Ba on western corn rootworm midgut brush border membrane vesicles (BBMV. Competitive binding of radio-labeled proteins to western corn rootworm BBMV was used as a measure of shared binding sites. Our work shows that (125I-Cry35Ab1 binds to rootworm BBMV, Cry34Ab1 enhances (125I-Cry35Ab1 specific binding, and that (125I-Cry35Ab1 with or without unlabeled Cry34Ab1 does not share binding sites with Cry3Aa, Cry6Aa, or Cry8Ba. Two primary lines of evidence presented here support the lack of shared binding sites between Cry34Ab1/Cry35Ab1 and the aforementioned proteins: 1 No competitive binding to rootworm BBMV was observed for competitor proteins when used in excess with (125I-Cry35Ab1 alone or combined with unlabeled Cry34Ab1, and 2 No competitive binding to rootworm BBMV was observed for unlabeled Cry34Ab1 and Cry35Ab1, or a combination of the two, when used in excess with (125I-Cry3Aa, or (125I-Cry8Ba. CONCLUSIONS/SIGNIFICANCE: Combining two or more insecticidal proteins active against the same target pest is one tactic to delay the onset of resistance to either protein. We conclude that Cry34Ab1/Cry35Ab1 are compatible with Cry3Aa, Cry6Aa, or Cry8Ba

  3. AB-Bind: Antibody binding mutational database for computational affinity predictions. (United States)

    Sirin, Sarah; Apgar, James R; Bennett, Eric M; Keating, Amy E


    Antibodies (Abs) are a crucial component of the immune system and are often used as diagnostic and therapeutic agents. The need for high-affinity and high-specificity antibodies in research and medicine is driving the development of computational tools for accelerating antibody design and discovery. We report a diverse set of antibody binding data with accompanying structures that can be used to evaluate methods for modeling antibody interactions. Our Antibody-Bind (AB-Bind) database includes 1101 mutants with experimentally determined changes in binding free energies (ΔΔG) across 32 complexes. Using the AB-Bind data set, we evaluated the performance of protein scoring potentials in their ability to predict changes in binding free energies upon mutagenesis. Numerical correlations between computed and observed ΔΔG values were low (r = 0.16-0.45), but the potentials exhibited predictive power for classifying variants as improved vs weakened binders. Performance was evaluated using the area under the curve (AUC) for receiver operator characteristic (ROC) curves; the highest AUC values for 527 mutants with |ΔΔG| > 1.0 kcal/mol were 0.81, 0.87, and 0.88 using STATIUM, FoldX, and Discovery Studio scoring potentials, respectively. Some methods could also enrich for variants with improved binding affinity; FoldX and Discovery Studio were able to correctly rank 42% and 30%, respectively, of the 80 most improved binders (those with ΔΔG < -1.0 kcal/mol) in the top 5% of the database. This modest predictive performance has value but demonstrates the continuing need to develop and improve protein energy functions for affinity prediction. PMID:26473627

  4. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 Interactions with Western Corn Rootworm Midgut Membrane Binding Sites


    Huarong Li; Monica Olson; Gaofeng Lin; Timothy Hey; Sek Yee Tan; Narva, Kenneth E.


    BACKGROUND: Bacillus thuringiensis (Bt) Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry) proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interact...

  5. A streptavidin mutant with altered ligand-binding specificity


    Reznik, Gabriel O.; Vajda, Sandor; Sano, Takeshi; Cantor, Charles R.


    The biotin-binding site of streptavidin was modified to alter its ligand-binding specificity. In natural streptavidin, the side chains of N23 and S27 make two of the three hydrogen bonds with the ureido oxygen of biotin. These two residues were mutated to severely weaken biotin binding while attempting to maintain the affinity for two biotin analogs, 2-iminobiotin and diaminobiotin. Redesigning of the biotin-binding site used the difference in local electrostatic charge distribution between b...

  6. Benchmarking ab initio binding energies of hydrogen-bonded molecular clusters based on FTIR spectroscopy

    DEFF Research Database (Denmark)

    Bork, Nicolai Christian; Du, Lin; Reiman, Heidi;


    Gibbs free binding energies in molecular complexes and clusters based on gas phase FTIR spectroscopy. The acetonitrile-HCl molecular complex is identified via its redshifted H-Cl stretching vibrational mode. We determine the Gibbs free binding energy, ΔG°295 K, to between 4.8 and 7.9 kJ mol(-1) and......Models of formation and growth of atmospheric aerosols are highly dependent on accurate cluster binding energies. These are most often calculated by ab initio electronic structure methods but remain associated with significant uncertainties. We present a computational benchmarking study of the...

  7. Electronic transport properties of fullerene functionalized carbon nanotubes: Ab initio and tight-binding calculations


    Fürst, Joachim Alexander; J Hashemi; Markussen, Troels; Brandbyge, Mads; Jauho, Antti-Pekka; Nieminen, R. M.


    Fullerene functionalized carbon nanotubes-NanoBuds-form a novel class of hybrid carbon materials, which possesses many advantageous properties as compared to the pristine components. Here, we report a theoretical study of the electronic transport properties of these compounds. We use both ab initio techniques and tight-binding calculations to illustrate these materials' transmission properties and give physical arguments to interpret the numerical results. Specifically, above the Fermi energy...

  8. Electronic transport properties of fullerene functionalized carbon nanotubes: Ab initio and tight-binding calculations


    Fürst, J. A.; J Hashemi; Markussen, T.; Brandbyge, M.; Jauho, A.P.; Nieminen, Risto M.


    Fullerene functionalized carbon nanotubes—NanoBuds—form a novel class of hybrid carbon materials, which possesses many advantageous properties as compared to the pristine components. Here, we report a theoretical study of the electronic transport properties of these compounds. We use both ab initio techniques and tight-binding calculations to illustrate these materials’ transmission properties and give physical arguments to interpret the numerical results. Specifically, above the Fermi energy...

  9. Structural analysis of the DNA-binding domain of the Erwinia amylovora RcsB protein and its interaction with the RcsAB box. (United States)

    Pristovsek, Primoz; Sengupta, Kaushik; Löhr, Frank; Schäfer, Birgit; von Trebra, Markus Wehland; Rüterjans, Heinz; Bernhard, Frank


    The transcriptional regulator RcsB interacts with other coactivators to control the expression of biosynthetic operons in enterobacteria. While in a heterodimer complex with the regulator RcsA the RcsAB box consensus is recognized, DNA binding sites for RcsB without RcsA have also been identified. The conformation of RcsB might therefore be modulated upon interaction with various coactivators, resulting in the recognition of different DNA targets. We report the solution structure of the C-terminal DNA-binding domain of the RcsB protein from Erwinia amylovora spanning amino acid residues 129-215 solved by heteronuclear magnetic resonance (NMR) spectroscopy. The C-terminal domain is composed of four alpha-helices where two central helices form a helix-turn-helix motif similar to the structures of the regulatory proteins GerE, NarL, and TraR. Amino acid residues involved in the RcsA independent DNA binding of RcsB were identified by titration studies with a RcsAB box consensus fragment. Data obtained from NMR spectroscopy together with surface plasmon resonance measurements demonstrate that the RcsAB box is specifically recognized by the RcsAB heterodimer as well as by RcsB alone. However, the binding constant of RcsB alone at target promoters from Escherichia coli, E. amylovora, and Pantoea stewartii was approximately 1 order of magnitude higher compared with that of the RcsAB heterodimer. We present evidence that the obvious role of RcsA is not to alter the DNA binding specificity of RcsB but to stabilize RcsB-DNA complexes. PMID:12740396

  10. Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

    Energy Technology Data Exchange (ETDEWEB)

    Matsushita, Y., E-mail:; Murakawa, T., E-mail:; Shimamura, K., E-mail:; Oishi, M., E-mail:; Ohyama, T., E-mail:; Kurita, N., E-mail: [Department of Computer Science and Engineering, Toyohashi University of Technology, Tempaku-cho, Toyohashi, Aichi, 441-8580 (Japan)


    The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA.

  11. Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

    International Nuclear Information System (INIS)

    The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA

  12. Binding of human leukocytes to fibronectin is augmented by an anti-CD44 mAb (TL-1) and blocked by another anti-CD44 mAb (Hermes-3) but not by anti-VLA-4/VLA-5 mAbs. (United States)

    Cao, L; Yoshino, T; Kawasaki, N; Yanai, H; Kawahara, K; Kondo, E; Omonishi, K; Takahashi, K; Akagi, T

    Fibronectin (FN) forms meshworks in extracellular spaces, and it plays an important role in cellular trafficking. Lymphoid cells are activated by binding to FN of the VLA-4 and VLA-5 receptors. CD44 also acts as a receptor of FN, but the mechanism and physiologic regulation of their binding are poorly understood. We have developed an anti-CD44 monoclonal antibody (mAb) (TL-1) in which lymphoid cells are activated and form homotypic cell aggregation. In this study, we found that the adhesion of CEM, HSB2, and LAD lymphoid cells to FN was augmented by TL-1 treatment and was apparently blocked by another anti-CD44 mAb (Hermes-3), but TL-1 Fab' fragments treatment did not induce FN-binding. A similar phenomenon is reported in the binding of the CD44 molecule to HA. This augmentation was not inhibited by the CS1 and RGD peptides of FN or by anti-VLA-4 and -VLA-5 mAbs; it was energy-dependent and associated with cytoplasmic actin filaments. Tl-1 treatment did not alter the cell surface expression of CD44 molecules. These findings above suggested that activated and/or altered cell surface distribution of CD44 molecules via a conformational change augmented the avidity of its binding to FN, which may be similar to lymphocyte-hyaluronate and lymphocyte-endothelial cell binding. As the Hermes-3 binding site is also involved in the interaction between lymphocytes and endothelial cells, activation of lymphocytes via CD44 molecules may facilitate the binding of lymphocytes to endothelial cells, extravasation, and migration to inflammatory sites rich in FN. PMID:9145328

  13. Characterization of DNA sequences that mediate nuclear protein binding to the regulatory region of the Pisum sativum (pea) chlorophyl a/b binding protein gene AB80: identification of a repeated heptamer motif. (United States)

    Argüello, G; García-Hernández, E; Sánchez, M; Gariglio, P; Herrera-Estrella, L; Simpson, J


    Two protein factors binding to the regulatory region of the pea chlorophyl a/b binding protein gene AB80 have been identified. One of these factors is found only in green tissue but not in etiolated or root tissue. The second factor (denominated ABF-2) binds to a DNA sequence element that contains a direct heptamer repeat TCTCAAA. It was found that presence of both of the repeats is essential for binding. ABF-2 is present in both green and etiolated tissue and in roots and factors analogous to ABF-2 are present in several plant species. Computer analysis showed that the TCTCAAA motif is present in the regulatory region of several plant genes. PMID:1303797

  14. Electromechanical effects in carbon nanotubes: Ab initio and analytical tight-binding calculations (United States)

    Verissimo-Alves, M.; Koiller, Belita; Chacham, H.; Capaz, R. B.


    We perform ab initio calculations of charged graphene and single-wall carbon nanotubes (CNTs). A wealth of electromechanical behaviors is obtained. (1) Both nanotubes and graphene expand upon electron injection. (2) Upon hole injection, metallic nanotubes and graphene display a nonmonotonic behavior. Upon increasing hole densities, the lattice constant initially contracts, reaches a minimum, and then starts to expand. The hole densities at minimum lattice constants are 0.3 |e|/atom for graphene and between 0.1 and 0.3|e|/atom for the metallic nanotubes studied. (3) Semiconducting CNT’s with small diameters (d≲20 Å) always expand upon hole injection. (4) Semiconducting CNT’s with large diameters (d≳20 Å) display a behavior intermediate between those of metallic and large-gap CNT’s. (5) The strain versus extra charge displays a linear plus power-law behavior, with characteristic exponents for graphene, metallic, and semiconducting CNT’s. All these features are physically understood within a simple tight-binding total-energy model.

  15. Shared midgut binding sites for Cry1A.105, Cry1Aa, Cry1Ab, Cry1Ac and Cry1Fa proteins from Bacillus thuringiensis in two important corn pests, Ostrinia nubilalis and Spodoptera frugiperda.

    Directory of Open Access Journals (Sweden)

    Carmen Sara Hernández-Rodríguez

    Full Text Available First generation of insect-protected transgenic corn (Bt-corn was based on the expression of Cry1Ab or Cry1Fa proteins. Currently, the trend is the combination of two or more genes expressing proteins that bind to different targets. In addition to broadening the spectrum of action, this strategy helps to delay the evolution of resistance in exposed insect populations. One of such examples is the combination of Cry1A.105 with Cry1Fa and Cry2Ab to control O. nubilalis and S. frugiperda. Cry1A.105 is a chimeric protein with domains I and II and the C-terminal half of the protein from Cry1Ac, and domain III almost identical to Cry1Fa. The aim of the present study was to determine whether the chimeric Cry1A.105 has shared binding sites either with Cry1A proteins, with Cry1Fa, or with both, in O. nubilalis and in S. frugiperda. Brush-border membrane vesicles (BBMV from last instar larval midguts were used in competition binding assays with (125I-labeled Cry1A.105, Cry1Ab, and Cry1Fa, and unlabeled Cry1A.105, Cry1Aa, Cry1Ab, Cry1Ac, Cry1Fa, Cry2Ab and Cry2Ae. The results showed that Cry1A.105, Cry1Ab, Cry1Ac and Cry1Fa competed with high affinity for the same binding sites in both insect species. However, Cry2Ab and Cry2Ae did not compete for the binding sites of Cry1 proteins. Therefore, according to our results, the development of cross-resistance among Cry1Ab/Ac, Cry1A.105, and Cry1Fa proteins is possible in these two insect species if the alteration of shared binding sites occurs. Conversely, cross-resistance between these proteins and Cry2A proteins is very unlikely in such case.

  16. Surface-induced alteration of adsorbate electronic structure and intramolecular vibrational coupling: The vibrational spectrum of 2-propoxide on Mo(110) as determined by [ital ab] [ital initio] calculations and experiments

    Energy Technology Data Exchange (ETDEWEB)

    Uvdal, P. (MAX-Chemistry, Department of Chemistry, Box 124, Lund University, S-22100 Lund (Sweden)); MacKerell, A.D. Jr. (Department of Pharmaceutical Sciences, School of Pharmacy, University of Maryland at Baltimore, Baltimore, Maryland 21201 (United States)); Wiegand, B.C.; Friend, C.M. (Department of Chemistry, Harvard University, Cambridge, Massachusetts 02138 (United States))


    Interactions with the molybdenum surface have a strong influence on the vibrational spectrum of 2-propoxide on Mo(110). Using [ital ab] [ital initio] electronic-structure calculations the vibrational spectrum of the adsorbed 2-propoxide is determined. All major effects, experimentally observed by electron-energy-loss spectroscopy, are well reproduced by the calculation. Kinematic effects do not explain the observed changes. Calculations indicate that the changes in vibrational spectra are due to alterations of the intramolecular potential function and charge redistribution upon binding to the Mo.

  17. Isolation, characterization and evolutionary relatedness of three members from the soybean multigene family encoding chlorophyll a/b binding proteins.


    Walling, L L; Chang, Y.C.; Demmin, D S; Holzer, F M


    The soybean light-harvesting complex II (LHC II) was composed of one major and three minor chlorophyll a/b (Cab) binding proteins. This study demonstrated that the soybean genome contained at least 11 genes that code for these Cab proteins. Three members of the soybean Cab gene family were characterized. Cab 3 coded for a 25.7 kD mature apoprotein with a 32 amino acid transit peptide. Comparisons with previously published Cab protein sequences indicated that Cab 3 coded for the major Cab prot...

  18. Electronic transport properties of fullerene functionalized carbon nanotubes: Ab initio and tight-binding calculations

    DEFF Research Database (Denmark)

    Fürst, Joachim Alexander; Hashemi, J.; Markussen, Troels;


    Fullerene functionalized carbon nanotubes-NanoBuds-form a novel class of hybrid carbon materials, which possesses many advantageous properties as compared to the pristine components. Here, we report a theoretical study of the electronic transport properties of these compounds. We use both ab init...

  19. Loss of liver FA binding protein significantly alters hepatocyte plasma membrane microdomains[S


    McIntosh, Avery L.; Atshaves, Barbara P.; Storey, Stephen M.; Landrock, Kerstin K.; Landrock, Danilo; Martin, Gregory G.; Kier, Ann B.; Schroeder, Friedhelm


    Although lipid-rich microdomains of hepatocyte plasma membranes serve as the major scaffolding regions for cholesterol transport proteins important in cholesterol disposition, little is known regarding intracellular factors regulating cholesterol distribution therein. On the basis of its ability to bind cholesterol and alter hepatic cholesterol accumulation, the cytosolic liver type FA binding protein (L-FABP) was hypothesized to be a candidate protein regulating these microdomains. Compared ...

  20. DNA oligonucleotide-cis-platin Binding: Ab initio interpretation of the vibrational spectra

    Czech Academy of Sciences Publication Activity Database

    Andrushchenko, Valery; Wieser, H.; Bouř, Petr


    Roč. 111, č. 39 (2007), s. 9714-9723. ISSN 1089-5639 R&D Projects: GA AV ČR IAA400550702; GA ČR GA202/07/0732 Institutional research plan: CEZ:AV0Z40550506 Keywords : cis-platin * DNA * vibrational spektra * ab initio Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.918, year: 2007

  1. AB202. Altered micro RNA expression in patients with non-obstructive azoospermia


    Zhang, Xiansheng; Liang, Chaozhao


    Background MicroRNAs (miRNAs), a class of small non-coding RNA molecules, are indicated to play essential roles in spermatogenesis. However, little is known about the expression patterns or function of miRNAs in human testes involved in infertility. Methods In this study, the miRNA expression profiles of testes of patients with non-obstructive azoospermia (NOA) and normal controls were performed by using microarray technologies. Results Altered microRNA expression in NOA patients was found, w...

  2. Geometry, Energy, and Some Electronic Properties of Carbon Polyprismanes: Ab Initio and Tight-Binding Study


    Konstantin P. Katin; Shostachenko, Stanislav A.; Avkhadieva, Alina I.; Mikhail M. Maslov


    We report geometry, energy, and some electronic properties of [n,4]- and [n,5]prismanes (polyprismanes): a special type of carbon nanotubes constructed from dehydrogenated cycloalkane C4- and C5-rings, respectively. Binding energies, interatomic bonds, and the energy gaps between the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) have been calculated using density functional approach and nonorthogonal tight-binding model for the systems up to thir...

  3. Altered SPECT (123)I-iomazenil Binding in the Cingulate Cortex of Children with Anorexia Nervosa. (United States)

    Nagamitsu, Shinichiro; Sakurai, Rieko; Matsuoka, Michiko; Chiba, Hiromi; Ozono, Shuichi; Tanigawa, Hitoshi; Yamashita, Yushiro; Kaida, Hayato; Ishibashi, Masatoshi; Kakuma, Tatsuki; Croarkin, Paul E; Matsuishi, Toyojiro


    Several lines of evidence suggest that anxiety plays a key role in the development and maintenance of anorexia nervosa (AN) in children. The purpose of this study was to examine cortical GABA(A)-benzodiazepine receptor binding before and after treatment in children beginning intensive AN treatment. Brain single-photon emission computed tomography (SPECT) measurements using (123)I-iomazenil, which binds to GABA(A)-benzodiazepine receptors, was performed in 26 participants with AN who were enrolled in a multimodal treatment program. Sixteen of the 26 participants underwent a repeat SPECT scan immediately before discharge at conclusion of the intensive treatment program. Eating behavior and mood disturbances were assessed using Eating Attitudes Test with 26 items (EAT-26) and the short form of the Profile of Mood States (POMS). Clinical outcome scores were evaluated after a 1-year period. We examined association between relative iomazenil-binding activity in cortical regions of interest and psychometric profiles and determined which psychometric profiles show interaction effects with brain regions. Further, we determined if binding activity could predict clinical outcome and treatment changes. Higher EAT-26 scores were significantly associated with lower iomazenil-binding activity in the anterior and posterior cingulate cortex. Higher POMS subscale scores were significantly associated with lower iomazenil-binding activity in the left frontal, parietal cortex, and posterior cingulate cortex (PCC). "Depression-Dejection" and "Confusion" POMS subscale scores, and total POMS score showed interaction effects with brain regions in iomazenil-binding activity. Decreased binding in the anterior cingulate cortex and left parietal cortex was associated with poor clinical outcomes. Relative binding increases throughout the PCC and occipital gyrus were observed after weight gain in children with AN. These findings suggest that cortical GABAergic receptor binding is altered in

  4. Altered SPECT 123I-iomazenil Binding in the Cingulate Cortex of Children with Anorexia Nervosa (United States)

    Nagamitsu, Shinichiro; Sakurai, Rieko; Matsuoka, Michiko; Chiba, Hiromi; Ozono, Shuichi; Tanigawa, Hitoshi; Yamashita, Yushiro; Kaida, Hayato; Ishibashi, Masatoshi; Kakuma, Tatsuki; Croarkin, Paul E.; Matsuishi, Toyojiro


    Several lines of evidence suggest that anxiety plays a key role in the development and maintenance of anorexia nervosa (AN) in children. The purpose of this study was to examine cortical GABA(A)-benzodiazepine receptor binding before and after treatment in children beginning intensive AN treatment. Brain single-photon emission computed tomography (SPECT) measurements using 123I-iomazenil, which binds to GABA(A)-benzodiazepine receptors, was performed in 26 participants with AN who were enrolled in a multimodal treatment program. Sixteen of the 26 participants underwent a repeat SPECT scan immediately before discharge at conclusion of the intensive treatment program. Eating behavior and mood disturbances were assessed using Eating Attitudes Test with 26 items (EAT-26) and the short form of the Profile of Mood States (POMS). Clinical outcome scores were evaluated after a 1-year period. We examined association between relative iomazenil-binding activity in cortical regions of interest and psychometric profiles and determined which psychometric profiles show interaction effects with brain regions. Further, we determined if binding activity could predict clinical outcome and treatment changes. Higher EAT-26 scores were significantly associated with lower iomazenil-binding activity in the anterior and posterior cingulate cortex. Higher POMS subscale scores were significantly associated with lower iomazenil-binding activity in the left frontal, parietal cortex, and posterior cingulate cortex (PCC). “Depression–Dejection” and “Confusion” POMS subscale scores, and total POMS score showed interaction effects with brain regions in iomazenil-binding activity. Decreased binding in the anterior cingulate cortex and left parietal cortex was associated with poor clinical outcomes. Relative binding increases throughout the PCC and occipital gyrus were observed after weight gain in children with AN. These findings suggest that cortical GABAergic receptor binding is altered

  5. Altered SPECT 123I iomazenil Binding in the Cingulate Cortex of Children with Anorexia Nervosa

    Directory of Open Access Journals (Sweden)

    Shinichiro eNagamitsu


    Full Text Available Several lines of evidence suggest that anxiety plays a key role in the development and maintenance of anorexia nervosa (AN in children. The purpose of this study was to examine cortical GABA(A-benzodiazepine receptor binding before and after treatment in children beginning intensive AN treatment. Brain single photon emission computed tomography (SPECT measurements using 123I iomazenil, which binds to GABA(A-benzodiazepine receptors, was performed in 26 participants with AN who were enrolled in a multimodal treatment program. Sixteen of the 26 participants underwent a repeat SPECT scan immediately before discharge at conclusion of the intensive treatment program. Eating behavior and mood disturbances were assessed using Eating Attitudes Test with 26 items (EAT-26 and the short form of the Profile of Mood States (POMS. Clinical outcome scores were evaluated after a 1-year period. We examined association between relative iomazenil binding activity in cortical regions of interest (ROIs and psychometric profiles, and determined which psychometric profiles show interaction effects with brain regions. Further, we determined if binding activity could predict clinical outcome and treatment changes. Higher EAT-26 scores were significantly associated with lower iomazenil binding activity in the anterior posterior cingulate cortex (ACC. Higher POMS subscale scores were significantly associated with lower iomazenil binding activity in the left frontal, parietal cortex, and posterior cingulate cortex (PCC. Depression-Dejection, and Confusion POMS subscale scores, and total POMS score, showed interaction effects with brain regions in iomazenil binding activity. Decreased binding in the ACC and left parietal cortex was associated with poor clinical outcomes. Relative binding increases throughout the PCC and occipital gyrus were observed after weight gain in children with AN. These findings suggest that cortical GABAergic receptor binding is altered in children

  6. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    International Nuclear Information System (INIS)

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo (125I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of control cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease

  7. Alterations in transcription factor binding in radioresistant human melanoma cells after ionizing radiation

    International Nuclear Information System (INIS)

    We analyzed alterations in transcription factor binding to specific, known promoter DNA consensus sequences between irradiated and unirradiated radioresistant human melanoma (U1-Mel) cells. The goal of this study was to begin to investigate which transcription factors and DNA-binding sites are responsible for the induction of specific transcripts and proteins after ionizing radiation. Transcription factor binding was observed using DNA band-shift assays and oligonucleotide competition analyses. Confluence-arrested U1-Mel cells were irradiated (4.5 Gy) and harvested at 4 h. Double-stranded oligonucleotides containing known DNA-binding consensus sites for specific transcription factors were used. Increased DNA binding activity after ionizing radiation was noted with oligonucleotides containing the CREB, NF-kB and Sp1 consensus sites. No changes in protein binding to AP-1, AP-2, AP-3, or CTF/NF1, GRE or Oct-1 consensus sequences were noted. X-ray activation of select transcription factors, which bind certain consensus sites in promoters, may cause specific induction or repression of gene transcription. 22 refs., 2 figs

  8. Alteration in transcription factor binding in murine thymocytes after low dose radiation

    International Nuclear Information System (INIS)

    Objective: To study the effect of low dose radiation on gene transcription regulation of murine thymocytes. Methods: Alteration in transcription factor binding in murine thymocytes 4 h after whole body irradiation (WBI) with 75 mGy X-rays was investigated with gel mobility shift assay. Results: Increased binding to CREB, NF-kB and APl consensus sequences was found with nuclear extracts prepared from thymocytes of irradiated versus sham-irradiated mice. Binding to the CREB, NF-kB and APl consensus sequences by nuclear extracts derived from irradiated mice was 6-fold, 4,3-fold and 2-fold higher than that from sham-irradiated respectively. The present report demonstrates that WBI with 75 mGy X-rays is capable of increasing expression of CREB, NF-kB and APl in murine thymocytes. competition with the cold oligonucleotide containing the consensus sequences for CREB and NF-kB resulted in loss of the shifted band, indicating specific binding. Conclusions: X-ray activation of select transcription factors, which bind certain consensus sites in promoters, may cause specific induction of gene transcription

  9. Alteration of methotrexate binding to human serum albumin induced by oxidative stress. Spectroscopic comparative study (United States)

    Maciążek-Jurczyk, M.; Sułkowska, A.; Równicka-Zubik, J.


    Changes of oxidative modified albumin conformation by comparison of non-modified (HSA) and modified (oHSA) human serum albumin absorption spectra, Red Edge Excitation Shift (REES) effect and fluorescence synchronous spectra were investigated. Studies of absorption spectra indicated that changes in the value of absorbance associated with spectral changes in the region from 200 to 250 nm involve structural alterations related to variations in peptide backbone conformation. Analysis of the REES effect allowed for the observation of changes caused by oxidation in the region of the hydrophobic pocket containing the tryptophanyl residue. Synchronous fluorescence spectroscopy confirmed changes of the position of the tryptophanyl and tyrosil residues fluorescent band. Effect of oxidative stress on binding of methotrexate (MTX) was investigated by spectrofluorescence, UV-VIS and 1HNMR spectroscopy. MTX caused the fluorescence quenching of non-modified (HSA) and modified (oHSA) human serum albumin molecule. The values of binding constants, Hill's coefficients and a number of binding sites in the protein molecule in the high affinity binding site were calculated for the binary MTX-HSA and MTX-oHSA systems. For these systems, qualitative analysis in the low affinity binding sites was performed with the use of the 1HNMR technique.

  10. Phosphorylation or Mutation of the ERK2 Activation Loop Alters Oligonucleotide Binding. (United States)

    McReynolds, Andrea C; Karra, Aroon S; Li, Yan; Lopez, Elias Daniel; Turjanski, Adrian G; Dioum, Elhadji; Lorenz, Kristina; Zaganjor, Elma; Stippec, Steve; McGlynn, Kathleen; Earnest, Svetlana; Cobb, Melanie H


    The mitogen-activated protein kinase ERK2 is able to elicit a wide range of context-specific responses to distinct stimuli, but the mechanisms underlying this versatility remain in question. Some cellular functions of ERK2 are mediated through regulation of gene expression. In addition to phosphorylating numerous transcriptional regulators, ERK2 is known to associate with chromatin and has been shown to bind oligonucleotides directly. ERK2 is activated by the upstream kinases MEK1/2, which phosphorylate both tyrosine 185 and threonine 183. ERK2 requires phosphorylation on both sites to be fully active. Some additional ERK2 phosphorylation sites have also been reported, including threonine 188. It has been suggested that this phospho form has distinct properties. We detected some ERK2 phosphorylated on T188 in bacterial preparations of ERK2 by mass spectrometry and further demonstrate that phosphomimetic substitution of this ERK2 residue impairs its kinase activity toward well-defined substrates and also affects its DNA binding. We used electrophoretic mobility shift assays with oligonucleotides derived from the insulin gene promoter and other regions to examine effects of phosphorylation and mutations on the binding of ERK2 to DNA. We show that ERK2 can bind oligonucleotides directly. Phosphorylation and mutations alter DNA binding and support the idea that signaling functions may be influenced through an alternate phosphorylation site. PMID:26950759

  11. Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)*


    Unciuleac, Mihaela-Carmen; Shuman, Stewart


    Mycobacterial AdnAB is a heterodimeric DNA helicase-nuclease and 3′ to 5′ DNA translocase implicated in the repair of double strand breaks (DSBs). The AdnA and AdnB subunits are each composed of an N-terminal motor domain and a C-terminal nuclease domain. Inclusion of mycobacterial single strand DNA-binding protein (SSB) in reactions containing linear plasmid dsDNA allowed us to study the AdnAB helicase under conditions in which the unwound single strands are coated by SSB and thereby prevent...

  12. BAFF- and APRIL-dependent maintenance of Ab titers after immunization with T-dependent Ag and CD1d-binding ligand


    Shah, Hemangi B.; Joshi, Sunil K.; Rampuria, Pragya; Devera, T. Scott; Lang, Gillian A.; Stohl, William; Lang, Mark L.


    CD1d-restricted invariant Natural Killer T (iNKT) cells boost humoral immunity to T-dependent Ags that are co-administered with the CD1d-binding glycolipid Ag α-galactosylceramide (α-GC). Observations that mice lacking iNKT cells have decaying Ab responses following vaccination has led to the hypothesis that iNKT cells express plasma cell (PC) survival factors that sustain specific Ab titers. Bone marrow (BM) chimeric mice in which the entire hematopoetic compartment or iNKT cells selectively...

  13. Antibody Binding Alters the Characteristics and Contents of Extracellular Vesicles Released by Histoplasma capsulatum. (United States)

    Matos Baltazar, Ludmila; Nakayasu, Ernesto S; Sobreira, Tiago J P; Choi, Hyungwon; Casadevall, Arturo; Nimrichter, Leonardo; Nosanchuk, Joshua D


    Histoplasma capsulatum produces extracellular vesicles containing virulence-associated molecules capable of modulating host machinery, benefiting the pathogen. Treatment of H. capsulatum cells with monoclonal antibodies (MAbs) can change the outcome of infection in mice. We evaluated the sizes, enzymatic contents, and proteomic profiles of the vesicles released by fungal cells treated with either protective MAb 6B7 (IgG1) or nonprotective MAb 7B6 (IgG2b), both of which bind H. capsulatum heat shock protein 60 (Hsp60). Our results showed that treatment with either MAb was associated with changes in size and vesicle loading. MAb treatments reduced vesicle phosphatase and catalase activities compared to those of vesicles from untreated controls. We identified 1,125 proteins in vesicles, and 250 of these manifested differences in abundance relative to that of proteins in vesicles isolated from yeast cells exposed to Hsp60-binding MAbs, indicating that surface binding of fungal cells by MAbs modified protein loading in the vesicles. The abundance of upregulated proteins in vesicles upon MAb 7B6 treatment was 44.8% of the protein quantities in vesicles from fungal cells treated with MAb 6B7. Analysis of orthologous proteins previously identified in vesicles from other fungi showed that different ascomycete fungi have similar proteins in their extracellular milieu, many of which are associated with virulence. Our results demonstrate that antibody binding can modulate fungal cell responses, resulting in differential loading of vesicles, which could alter fungal cell susceptibility to host defenses. This finding provides additional evidence that antibody binding modulates microbial physiology and suggests a new function for specific immunoglobulins through alterations of fungal secretion. IMPORTANCE Diverse fungal species release extracellular vesicles, indicating that this is a common pathway for the delivery of molecules to the extracellular space. However, there has

  14. Effect of impurity doping on tunneling conductance in AB-stacked bi-layer graphene: A tight-binding study (United States)

    Rout, G. C.; Sahu, Sivabrata; Panda, S. K.


    We report here a microscopic tight-binding model calculation for AB-stacked bilayer graphene in presence of biasing potential between the two layers and the impurity effects to study the evolution of the total density of states with special emphasis on opening of band gap near Dirac point. We have calculated the electron Green's functions for both the A and B sub-lattices by Zubarev technique. The imaginary part of the Green's function gives the partial and total density of states of electrons. The density of states are computed numerically for 1000 × 1000 grid points of the electron momentum. The evolution of the opening of band gap near van-Hove singularities as well as near Dirac point is investigated by varying the different interlayer hoppings and the biasing potentials. The inter layer hopping splits the density of states at van-Hove singularities and produces a V-shaped gap near Dirac point. Further the biasing potential introduces a U shaped gap near Dirac point with a density minimum at the applied potential(i.e. at V/2).

  15. Human Herpesvirus-6A/B Binds to Spermatozoa Acrosome and Is the Most Prevalent Herpesvirus in Semen from Sperm Donors

    DEFF Research Database (Denmark)

    Kaspersen, Maja Døvling; Larsen, Peter; Kofod-Olsen, Emil;


    2.7%; HHV-6A/B in 13.5%; HHV-7 in 4.2%, whereas none of the samples had detectable VZV or HHV-8. Subsequently, we examined longitudinally data on ejaculates from 11 herpesvirus-positive donors. Serial analyses revealed that a donor who tested positive for herpesvirus at one time point did not...... necessarily remain positive over time. For the most frequently found herpesvirus, HHV-6A/B, we examined its association with sperm. For HHV-6A/B PCR-positive semen samples, HHV-6A/B could be detected on the sperm by flow cytometry. Conversely, PCR-negative semen samples were negative by flow cytometry. HHV-6B...... was shown to associate with sperm within minutes in a concentration dependent manner. Confocal microscopy demonstrated that HHV-6B associated with the sperm head, but only to sperm with an intact acrosome. Taken together, our data suggest that HHV-6A/B could be transported to the uterus via binding to...

  16. Assessment of altered binding specificity of bacteriophage for ciprofloxacin-induced antibiotic-resistant Salmonella Typhimurium. (United States)

    Kim, Jeongjin; Jo, Ara; Ding, Tian; Lee, Hyeon-Yong; Ahn, Juhee


    This study describes a new effort toward understanding the interaction mechanisms between antibiotic-resistant Salmonella Typhimurium and phages. The antibiotic susceptibility, β-lactamase activity, bacterial motility, gene expression, and lytic activity were evaluated in ciprofloxacin-induced antibiotic-sensitive Salmonella Typhimurium (ASST(CIP)) and ciprofloxacin-induced antibiotic-resistant S. Typhimurium (ARST(CIP)), which were compared to the wild-type strains (ASST(WT) and ARST(WT)). The MIC values of ampicillin, norfloxacin, chloramphenicol, and tetracycline were significantly increased to > 512, 16, 16, and 256 μg/ml, respectively, in the ARST(CIP). The lowest and highest extracellular lactamase activities were observed in ASST(WT) (6.85 μmol/min/ml) and ARST(CIP) (48.83 μmol/min/ml), respectively. The acrA, lpfE, and hilA genes were significantly upregulated by more than tenfold in both ASST(CIP) and ARST(CIP). The induction of multiple antibiotic resistance resulted from the increased efflux pump activity (AcrAB-TolC). The highest phage adsorption rates were more than 95 % for ASST(WT), ASST(CIP), and ARST(WT), while the lowest adsorption rate was 52 % for ARST(CIP) at 15 min of infection. The least lytic activity of phage was 20 % against the ARST(CIP), followed by ASST(CIP) (30 %). The adsorption rate of phage against ARST(CIP) was 52 % at 15 min of infection, which resulted in the decrease in lytic activity (12 %). Understanding the interaction of phage and bacteria is essential for the practical application of phage to control and detect antibiotic-resistant bacteria. The results provide useful information for understanding the binding specificity of phages for multiple antibiotic-resistant pathogens. PMID:27000396

  17. Ab initio van der waals interactions in simulations of water alter structure from mainly tetrahedral to high-density-like

    DEFF Research Database (Denmark)

    Møgelhøj, Andreas; Kelkkanen, Kari André; Wikfeldt, K Thor;


    The structure of liquid water at ambient conditions is studied in ab initio molecular dynamics simulations in the NVE ensemble using van der Waals (vdW) density-functional theory, i.e., using the new exchange-correlation functionals optPBE-vdW and vdW-DF2, where the latter has softer nonlocal...... protocol could cause the deviation. An O-O PCF consisting of a linear combination of 70% from vdW-DF2 and 30% from low-density liquid water, as extrapolated from experiments, reproduces near-quantitatively the experimental O-O PCF for ambient water. This suggests the possibility that the new functionals...... shows some resemblance with experiment for high-density water ( Soper , A. K. and Ricci , M. A. Phys. Rev. Lett. 2000 , 84 , 2881 ), but not directly with experiment for ambient water. Considering the accuracy of the new functionals for interaction energies, we investigate whether the simulation...

  18. Comparative study of tight-binding and ab initio electronic structure calculations focused on magnetic anisotropy in ordered CoPt alloy (United States)

    Zemen, J.; Mašek, J.; Kučera, J.; Mol, J. A.; Motloch, P.; Jungwirth, T.


    An empirical multiorbital (spd) tight binding (TB) model including magnetism and spin-orbit coupling is applied to calculations of magnetic anisotropy energy (MAE) in CoPt L10 structure. A realistic Slater-Koster parametrisation for single-element transition metals is adapted for the ordered binary alloy. Spin magnetic moment and density of states are calculated using a full-potential linearised augmented plane-wave (LAPW) ab initio method and our TB code with different variants of the interatomic parameters. Detailed mutual comparison of this data allows for determination of a subset of the compound TB parameters tuning of which improves the agreement of the TB and LAPW results. MAE calculated as a function of band filling using the refined parameters is in broad agreement with ab initio data for all valence states and in quantitative agreement with ab initio and experimental data for the natural band filling. Our work provides a practical basis for further studies of relativistic magnetotransport anisotropies by means of local Green's function formalism which is directly compatible with our TB approach.

  19. Comparative study of tight-binding and ab initio electronic structure calculations focused on magnetic anisotropy in ordered CoPt alloy

    Energy Technology Data Exchange (ETDEWEB)

    Zemen, J., E-mail: [School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom); Institute of Physics ASCR, v. v. i., Cukrovarnická 10, 162 00 Praha 6 (Czech Republic); Mašek, J. [Institute of Physics ASCR, v. v. i., Na Slovance 2, 182 21 Praha 8 (Czech Republic); Kučera, J. [Institute of Physics ASCR, v. v. i., Cukrovarnická 10, 162 00 Praha 6 (Czech Republic); Mol, J.A. [Kavli Institute of Nanoscience, Delft University of Technology, Lorentzweg 1, 2628 CJ Delft (Netherlands); Institute of Physics ASCR, v. v. i., Cukrovarnická 10, 162 00 Praha 6 (Czech Republic); Motloch, P. [Institute of Physics ASCR, v. v. i., Cukrovarnická 10, 162 00 Praha 6 (Czech Republic); Jungwirth, T. [Institute of Physics ASCR, v. v. i., Cukrovarnická 10, 162 00 Praha 6 (Czech Republic); School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom)


    An empirical multiorbital (spd) tight binding (TB) model including magnetism and spin–orbit coupling is applied to calculations of magnetic anisotropy energy (MAE) in CoPt L1{sub 0} structure. A realistic Slater–Koster parametrisation for single-element transition metals is adapted for the ordered binary alloy. Spin magnetic moment and density of states are calculated using a full-potential linearised augmented plane-wave (LAPW) ab initio method and our TB code with different variants of the interatomic parameters. Detailed mutual comparison of this data allows for determination of a subset of the compound TB parameters tuning of which improves the agreement of the TB and LAPW results. MAE calculated as a function of band filling using the refined parameters is in broad agreement with ab initio data for all valence states and in quantitative agreement with ab initio and experimental data for the natural band filling. Our work provides a practical basis for further studies of relativistic magnetotransport anisotropies by means of local Green's function formalism which is directly compatible with our TB approach. - Highlights: • Calculations of electronic structure properties of bulk ordered CoPt alloy using tight-binding (TB) and density functional theory (DFT) approach. • Refinement of existing single-element TB parameters for a binary alloy based on a comparison of band structure and spin magnetic moment per atom to DFT results. • Quantitative agreement of magnetic anisotropy energy (MAE) obtained by TB and DFT on a range of band fillings. • Successful description of ground state spin–orbit coupling phenomena using an extended TB model suitable for subsequent magnetotransport simulations.

  20. Comparative study of tight-binding and ab initio electronic structure calculations focused on magnetic anisotropy in ordered CoPt alloy

    International Nuclear Information System (INIS)

    An empirical multiorbital (spd) tight binding (TB) model including magnetism and spin–orbit coupling is applied to calculations of magnetic anisotropy energy (MAE) in CoPt L10 structure. A realistic Slater–Koster parametrisation for single-element transition metals is adapted for the ordered binary alloy. Spin magnetic moment and density of states are calculated using a full-potential linearised augmented plane-wave (LAPW) ab initio method and our TB code with different variants of the interatomic parameters. Detailed mutual comparison of this data allows for determination of a subset of the compound TB parameters tuning of which improves the agreement of the TB and LAPW results. MAE calculated as a function of band filling using the refined parameters is in broad agreement with ab initio data for all valence states and in quantitative agreement with ab initio and experimental data for the natural band filling. Our work provides a practical basis for further studies of relativistic magnetotransport anisotropies by means of local Green's function formalism which is directly compatible with our TB approach. - Highlights: • Calculations of electronic structure properties of bulk ordered CoPt alloy using tight-binding (TB) and density functional theory (DFT) approach. • Refinement of existing single-element TB parameters for a binary alloy based on a comparison of band structure and spin magnetic moment per atom to DFT results. • Quantitative agreement of magnetic anisotropy energy (MAE) obtained by TB and DFT on a range of band fillings. • Successful description of ground state spin–orbit coupling phenomena using an extended TB model suitable for subsequent magnetotransport simulations

  1. Genomic analysis of hepatic Farnesoid X Receptor (FXR) binding sites reveals altered binding in obesity and direct gene repression by FXR


    Lee, Jiyoung; Seok, Sun Mi; Yu, Pengfei; Kim, Kyungsu; Smith, Zachary; Rivas-Astroza, Marcelo; Zhong, Sheng; Kemper, Jongsook Kim


    The nuclear bile acid receptor, Farnesoid X Receptor (FXR), is an important transcriptional regulator of liver metabolism. Despite recent advances in understanding its functions, how FXR regulates genomic targets and whether the transcriptional regulation by FXR is altered in obesity remain largely unknown. Here, we analyzed hepatic genome-wide binding sites of FXR in normal and dietary obese mice by chromatin immunoprecipitation-sequencing (ChIP-seq) analysis. A total of 15,263 and 5,272 FXR...

  2. Expression of potato RNA-binding proteins StUBA2a/b and StUBA2c induces hypersensitive-like cell death and early leaf senescence in Arabidopsis. (United States)

    Na, Jong-Kuk; Kim, Jae-Kwang; Kim, Dool-Yi; Assmann, Sarah M


    The Arabidopsis thaliana genome encodes three RNA-binding proteins (RBPs), UBP1-associated protein 2a (UBA2a), UBA2b, and UBA2c, that contain two RNA-recognition motif (RRM) domains. They play important roles in wounding response and leaf senescence, and are homologs of Vicia faba abscisic-acid-activated protein kinase-interacting protein 1 (VfAKIP1). The potato (Solanum tuberosum) genome encodes at least seven AKIP1-like RBPs. Here, two potato RBPs have been characterized, StUBA2a/b and StUBA2c, that are homologous to VfAKIP1 and Arabidopsis UBA2s. Transient expression of StUBA2s induced a hypersensitive-like cell death phenotype in tobacco leaves, and an RRM-domain deletion assay of StUBA2s revealed that the first RRM domain is crucial for the phenotype. Unlike overexpression of Arabidopsis UBA2s, constitutive expression of StUBA2a/b in Arabidopsis did not cause growth arrest and lethality at the young seedling stage, but induced early leaf senescence. This phenotype was associated with increased expression of defence- and senescence-associated genes, including pathogen-related genes (PR) and a senescence-associated gene (SAG13), and it was aggravated upon flowering and ultimately resulted in a shortened life cycle. Leaf senescence of StUBA2a/b Arabidopsis plants was enhanced under darkness and was accompanied by H2O2 accumulation and altered expression of autophagy-associated genes, which likely cause cellular damage and are proximate causes of the early leaf senescence. Expression of salicylic acid signalling and biosynthetic genes was also upregulated in StUBA2a/b plants. Consistent with the localization of UBA2s-GFPs and VfAKIP1-GFP, soluble-modified GFP-StUBA2s localized in the nucleus within nuclear speckles. StUBA2s potentially can be considered for transgenic approaches to induce potato shoot senescence, which is desirable at harvest. PMID:25944928

  3. CD4-binding site alterations in CCR5-using HIV-1 envelopes influencing gp120-CD4 interactions and fusogenicity

    International Nuclear Information System (INIS)

    CD4-binding site (CD4bs) alterations in gp120 contribute to different pathophysiological phenotypes of CCR5-using (R5) HIV-1 strains, but the potential structural basis is unknown. Here, we characterized functionally diverse R5 envelope (Env) clones (n = 16) to elucidate potential structural alterations within the gp120 CD4bs that influence Env function. Initially, we showed that the magnitude of gp120-CD4-binding correlates with increased fusogenicity and reduced CD4 dependence. Analysis of three-dimensional gp120 structural models revealed two CD4bs variants, D279 and N362, that were associated with reduced CD4 dependence. Further structural analysis showed that a wider aperture of the predicted CD4bs cavity, as constrained by the inner-most atoms at the gp120 V1V2 stem and the V5 loop, was associated with amino acid alterations within V5 and correlated with increased gp120-CD4 binding and increased fusogenicity. Our results provide evidence that the gp120 V5 loop may alter CD4bs conformation and contribute to increased gp120-CD4 interactions and Env fusogenicity.

  4. Partial genetic deletion of neuregulin 1 and adolescent stress interact to alter NMDA receptor binding in the medial prefrontal cortex

    Directory of Open Access Journals (Sweden)

    Tariq Waseem Chohan


    Full Text Available Schizophrenia is thought to arise due to a complex interaction between genetic and environmental factors during early neurodevelopment. We have recently shown that partial genetic deletion of the schizophrenia susceptibility gene neuregulin 1 (Nrg1 and adolescent stress interact to disturb sensorimotor gating, neuroendocrine activity and dendritic morphology in mice. Both stress and Nrg1 may have converging effects upon N-methyl-D-aspartate receptors (NMDARs which are implicated in the pathogenesis of schizophrenia, sensorimotor gating and dendritic spine plasticity. Using an identical repeated restraint stress paradigm to our previous study, here we determined NMDAR binding across various brain regions in adolescent Nrg1 heterozygous (HET and wild-type (WT mice using [3H] MK-801 autoradiography. Repeated restraint stress increased NMDAR binding in the ventral part of the lateral septum (LSV and the dentate gyrus (DG of the hippocampus irrespective of genotype. Partial genetic deletion of Nrg1 interacted with adolescent stress to promote an altered pattern of NMDAR binding in the infralimbic (IL subregion of the medial prefrontal cortex. In the IL, whilst stress tended to increase NMDAR binding in WT mice, it decreased binding in Nrg1 HET mice. However in the DG, stress selectively increased the expression of NMDAR binding in Nrg1 HET mice but not WT mice. These results demonstrate a Nrg1-stress interaction during adolescence on NMDAR binding in the medial prefrontal cortex.

  5. Human herpesvirus-6A/B binds to spermatozoa acrosome and is the most prevalent herpesvirus in semen from sperm donors.

    Directory of Open Access Journals (Sweden)

    Maja D Kaspersen

    Full Text Available An analysis of all known human herpesviruses has not previously been reported on sperm from normal donors. Using an array-based detection method, we determined the cross-sectional frequency of human herpesviruses in semen from 198 Danish sperm donors. Fifty-five of the donors had at least one ejaculate that was positive for one or more human herpesvirus. Of these 27.3% (n = 15 had a double herpesvirus infection. If corrected for the presence of multiple ejaculates from some donors, the adjusted frequency of herpesviruses in semen was 27.2% with HSV-1 in 0.4%; HSV-2 in 0.1%; EBV in 6.3%; HCMV in 2.7%; HHV-6A/B in 13.5%; HHV-7 in 4.2%, whereas none of the samples had detectable VZV or HHV-8. Subsequently, we examined longitudinally data on ejaculates from 11 herpesvirus-positive donors. Serial analyses revealed that a donor who tested positive for herpesvirus at one time point did not necessarily remain positive over time. For the most frequently found herpesvirus, HHV-6A/B, we examined its association with sperm. For HHV-6A/B PCR-positive semen samples, HHV-6A/B could be detected on the sperm by flow cytometry. Conversely, PCR-negative semen samples were negative by flow cytometry. HHV-6B was shown to associate with sperm within minutes in a concentration dependent manner. Confocal microscopy demonstrated that HHV-6B associated with the sperm head, but only to sperm with an intact acrosome. Taken together, our data suggest that HHV-6A/B could be transported to the uterus via binding to the sperm acrosome. Moreover, we find a 10 times higher frequency of HHV-7 in semen from healthy individuals than previously detected. Further research is required to determine the potential risk of using herpesvirus-positive donor semen. Longitudinally analyses of ejaculate series indicate that implementation of quarantine for a donor shown to shed a herpesvirus is not a tenable solution.

  6. Ginkgo biloba extract alters the binding of the sodium [123I] iodide (Na123I) on blood constituents

    International Nuclear Information System (INIS)

    We evaluated the in vitro effect of an aqueous extract of Ginkgo biloba (EGb) on the distribution in blood cells (BC) and plasma (P) and on the binding of Na123I to the blood constituents using precipitation with trichloroacetic acid. The radioactivity percentages insoluble (SF) and insoluble fraction (IF) of blood constituents were determined. The EGb interfered (p123I in the P (from 69.64 to 86.13) and BC (from 30.36 to 13.87) and altered the fixation of the Na123I in IF-P and in IF-BC. - Highlights: ► Interaction between the Ginkgo biloba and blood constituents radiolabeled. ► Modification of the binding of sodium iodide (Na123I) to the blood constituents. ► This alteration should have influence in a diagnosis of nuclear medicine.

  7. Cultured fibroblast monolayers secrete a protein that alters the cellular binding of somatomedin-C/insulinlike growth factor I

    International Nuclear Information System (INIS)

    We studied somatomedin-C/insulinlike growth factor (Sm-C/IGF-I) binding to human fibroblasts in both adherent monolayers and in suspension cultures. The addition of Sm-C/IGF-I in concentrations between 0.5 and 10 ng/ml to monolayers cultures resulted in a paradoxical increase in 125I-Sm-C/IGF-I binding and concentrations between 25 and 300 ng/ml were required to displace the labeled peptide. The addition of unlabeled insulin resulted in no displacement of labeled Sm-C/IGF-I from the adherent cells. When fibroblast suspensions were used Sm-C/IGF-I concentrations between 1 and 10 ng/ml caused displacement, the paradoxical increase in 125I-Sm-C/IGF-I binding was not detected, and insulin displaced 60% of the labeled peptide. Affinity cross-linking to fibroblast monolayers revealed a 43,000-mol wt 125I-Sm-C-binding-protein complex that was not detected after cross-linking to suspended cells. The 43,000-mol wt complex was not detected after cross-linking to smooth muscle cell monolayers, and binding studies showed that 125I-Sm-C/IGF-I was displaced greater than 90% by Sm-C/IGF-I using concentrations between 0.5 and 10 ng/ml. Because fibroblast-conditioned medium contains the 43,000-mol wt complex, smooth muscle cells were incubated with conditioned medium for 24 h prior to initiation of the binding studies. 125I-Sm-C/IGF-I-binding increased 1.6-fold compared to control cultures and after cross-linking the 43,000-mol wt complex could be detected on the smooth muscle cell surface. Human fibroblast monolayers secrete a protein that binds 125I-Sm-C/IGF-I which can be transferred to the smooth muscle cell surface and alters 125I-Sm-C/IGF-I binding

  8. Probing the structure and function of the estrogen receptor ligand binding domain by analysis of mutants with altered transactivation characteristics.


    Eng, F C; Lee, H.S.; Ferrara, J; Willson, T M; White, J H


    We have developed a genetic screen for the yeast Saccharomyces cerevisiae to isolate estrogen receptor (ER) mutants with altered transactivation characteristics. Use of a "reverse" ER, in which the mutagenized ligand binding domain was placed at the N terminus of the receptor, eliminated the isolation of truncated constitutively active mutants. A library was screened with a low-affinity estrogen, 2-methoxyestrone (2ME), at concentrations 50-fold lower than those required for activation of the...

  9. Formation and properties of astrophysical carbonaceous dust. I: ab-initio calculations of the configuration and binding energies of small carbon clusters

    CERN Document Server

    Mauney, Christopher; Lazzati, Davide


    The binding energies of n < 100 carbon clusters are calculated using the ab-initio density functional theory code Quantum Espresso. Carbon cluster geometries are determined using several levels of classical techniques and further refined using density functional theory. The resulting energies are used to compute the work of cluster formation and the nucleation rate in a saturated, hydrogen-poor carbon gas. Compared to classical calculations that adopt the capillary approximation, we find that nucleation of carbon clusters is enhanced at low temperatures and depressed at high temperatures. This difference is ascribed to the different behavior of the critical cluster size. We find that the critical cluster size is at n = 27 or n = 8 for a broad range of temperatures and saturations, instead of being a smooth function of such parameters. The results of our calculations can be used to follow carbonaceous cluster/grain formation, stability, and growth in hydrogen poor environments, such as the inner layers of c...

  10. Mobility gaps in disordered graphene-based materials: an ab initio -based tight-binding approach to mesoscopic transport

    Energy Technology Data Exchange (ETDEWEB)

    Biel, Blanca [Dpto. Electronica y Tecnologia de Computadores, Facultad de Ciencias, and CITIC, Universidad de Granada (Spain); Cresti, Alessandro; Triozon, Francois [CEA, LETI, MINATEC, Grenoble (France); Avriller, Remi [Departamento de Fysica Teorica de la Materia Condensada C-V, Facultad de Ciencias, Universidad Autonoma de Madrid (Spain); Dubois, Simon; Charlier, Jean-Christophe [PCPM and ETSF, Universit' e Catholique de Louvain (Belgium); Lopez-Bezanilla, Alejandro [CEA, INAC, SPSMS, Grenoble (France); Blase, X. [Institut N' eel, CNRS et Universit' e Joseph Fourier, Grenoble (France); Roche, Stephan [CIN2 (CSIC-ICN), Campus UAB, Barcelona (Spain); CEA, INAC, SP2M, Grenoble (France)


    As is common knowledge, armchair graphene nanoribbons (aGNRs) share many electronic features with carbon nanotubes (CNTs). Nevertheless, crucial differences emerge when disorder comes into play. It is thus instructive, both from a theoretical and a technological perspective, to analyze the impact of possible types of disorder on the transport properties of these graphene-based materials. Here we report such a comparative study between CNTs and GNRs, which points out the similarities and differences emerging as a consequence of doping by substitutional boron and nitrogen impurities. The role of edge defects (absent in CNTs) is also contrasted with chemical doping disorder. All disorder models have been derived from accurate ab initio calculations of the electronic structures (copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  11. Nucleosome Binding Alters the Substrate Bonding Environment of Histone H3 Lysine 36 Methyltransferase NSD2. (United States)

    Poulin, Myles B; Schneck, Jessica L; Matico, Rosalie E; Hou, Wangfang; McDevitt, Patrick J; Holbert, Marc; Schramm, Vern L


    Nuclear receptor-binding SET domain protein 2 (NSD2) is a histone H3 lysine 36 (H3K36)-specific methyltransferase enzyme that is overexpressed in a number of cancers, including multiple myeloma. NSD2 binds to S-adenosyl-l-methionine (SAM) and nucleosome substrates to catalyze the transfer of a methyl group from SAM to the ε-amino group of histone H3K36. Equilibrium binding isotope effects and density functional theory calculations indicate that the SAM methyl group is sterically constrained in complex with NSD2, and that this steric constraint is released upon nucleosome binding. Together, these results show that nucleosome binding to NSD2 induces a significant change in the chemical environment of enzyme-bound SAM. PMID:27183271

  12. Ca2+ binding sites in calmodulin and troponin C alter interhelical angle movements. (United States)

    Goto, Kunihiko; Toyama, Akira; Takeuchi, Hideo; Takayama, Kazuyoshi; Saito, Tsutomu; Iwamoto, Masatoshi; Yeh, Jay Z; Narahashi, Toshio


    Molecular dynamics analyses were performed to examine conformational changes in the C-domain of calmodulin and the N-domain of troponin C induced by binding of Ca(2+) ions. Analyses of conformational changes in calmodulin and troponin C indicated that the shortening of the distance between Ca(2+) ions and Ca(2+) binding sites of helices caused widening of the distance between Ca(2+) binding sites of helices on opposite sides, while the hydrophobic side chains in the center of helices hardly moved due to their steric hindrance. This conformational change acts as the clothespin mechanism. PMID:15013750

  13. Alterations in opiate receptor binding in MPTP-induced hemiparkinsonian monkeys. (United States)

    Porrino, L J; Viola, J J; Crane, A M; Pontieri, F E


    Quantitative autoradiography was used to study [3H]naloxone binding in the striatum of normal monkeys and monkeys made hemiparkinsonian by the unilateral infusion of the neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). The density of [3H]naloxone binding sites was significantly higher in the caudate and putamen on the MPTP-treated side of hemiparkinsonian monkeys, as compared with binding on the untreated side and in the striatum of normal monkeys. A more extensive patchy distribution of binding sites was evident throughout the striatum on the MPTP-treated side than seen in the striatum of the untreated side or in normal striatum. PMID:1652716

  14. Myristylation alters DNA-binding activity and transactivation of FBR (gag-fos) protein.


    Kamata, N; Jotte, R M; Holt, J. T.


    FBR murine sarcoma virus (gag-fos) protein, a virally transduced Fos protein, exhibits decreased gene transactivation in comparison with the cellular Fos protein. Biochemical analysis suggests that myristylation of the virally encoded N-terminal gag region results in decreased DNA binding and transcriptional activation without affecting heterodimerization with Jun protein. These findings demonstrate that protein myristylation can modulate gene regulation by a DNA-binding protein.

  15. Altered SPECT 123I-iomazenil Binding in the Cingulate Cortex of Children with Anorexia Nervosa


    Nagamitsu, Shinichiro; Sakurai, Rieko; Matsuoka, Michiko; Chiba, Hiromi; Ozono, Shuichi; Tanigawa, Hitoshi; Yamashita, Yushiro; KAIDA, HAYATO; ISHIBASHI, MASATOSHI; Kakuma, Tatsuki; Croarkin, Paul E; Matsuishi, Toyojiro


    Several lines of evidence suggest that anxiety plays a key role in the development and maintenance of anorexia nervosa (AN) in children. The purpose of this study was to examine cortical GABA(A)-benzodiazepine receptor binding before and after treatment in children beginning intensive AN treatment. Brain single-photon emission computed tomography (SPECT) measurements using 123I-iomazenil, which binds to GABA(A)-benzodiazepine receptors, was performed in 26 participants with AN who were enroll...

  16. Altered [125I]epidermal growth factor binding and receptor distribution in psoriasis

    International Nuclear Information System (INIS)

    Stimulation of growth and differentiation of human epidermis by epidermal growth factor (EGF) is mediated by its binding to specific receptors. Whether EGF receptors primarily mediate cell division or differentiation in hyperproliferative disease such as psoriasis vulgaris is unclear. To study the pathogenesis of psoriasis, 4-mm2 punch biopsy specimens of normal, uninvolved, and involved psoriatic skin were assayed for EGF receptors by autoradiographic, immunohistochemical, and biochemical methods. Using autoradiographic and immunohistochemical methods, basal keratinocytes were found to contain the greatest number of EGF binding sites and immunoreactive receptors as compared to the upper layers of the epidermis in both normal epidermis and psoriatic skin. No EGF receptor differences between normal and psoriatic epidermis were observed in this layer. In the upper layers of the epidermis, a 2-fold increase in EGF binding capacity was observed in psoriatic skin as compared with normal thin or thick skin. Biochemical methods indicated that [125I]EGF binding was increased in psoriatic epidermis as compared with similar thickness normal epidermis when measured on a protein basis. Epidermal growth factor was shown to increase phosphorylation of the EGF receptor in skin. EGF receptors retained in the nonmitotic stratum spinosum and parakeratotic stratum corneum may reflect the incomplete, abnormal differentiation that occurs in active psoriatic lesions. Alternatively, retained EGF receptors may play a direct role in inhibiting cellular differentiation in the suprabasal layers

  17. Chicken avidin-related proteins show altered biotin-binding and physico-chemical properties as compared with avidin. (United States)

    Laitinen, Olli H; Hytönen, Vesa P; Ahlroth, Mervi K; Pentikäinen, Olli T; Gallagher, Ciara; Nordlund, Henri R; Ovod, Vladimir; Marttila, Ari T; Porkka, Eevaleena; Heino, Sanna; Johnson, Mark S; Airenne, Kari J; Kulomaa, Markku S


    Chicken avidin and bacterial streptavidin are proteins familiar from their use in various (strept)avidin-biotin technological applications. Avidin binds the vitamin biotin with the highest affinity known for non-covalent interactions found in nature. The gene encoding avidin (AVD) has homologues in chicken, named avidin-related genes (AVRs). In the present study we used the AVR genes to produce recombinant AVR proteins (AVRs 1, 2, 3, 4/5, 6 and 7) in insect cell cultures and characterized their biotin-binding affinity and biochemical properties. Amino acid sequence analysis and molecular modelling were also used to predict and explain the properties of the AVRs. We found that the AVR proteins are very similar to avidin, both structurally and functionally. Despite the numerous amino acid substitutions in the subunit interface regions, the AVRs form extremely stable tetramers similar to those of avidin. Differences were found in some physico-chemical properties of the AVRs as compared with avidin, including lowered pI, increased glycosylation and, most notably, reversible biotin binding for two AVRs (AVR1 and AVR2). Molecular modelling showed how the replacement Lys(111)-->isoleucine in AVR2 alters the shape of the biotin-binding pocket and thus results in reversible binding. Both modelling and biochemical analyses showed that disulphide bonds can form and link monomers in AVR4/5, a property not found in avidin. These, together with the other properties of the AVRs described in the present paper, may offer advantages over avidin and streptavidin, making the AVRs applicable for improved avidin-biotin technological applications. PMID:11964162

  18. Binding of a neutralizing antibody to dengue virus alters the arrangement of surface glycoproteins

    Energy Technology Data Exchange (ETDEWEB)

    Lok, Shee-Mei; Kostyuchenko, Victor; Nybakken, Grant E.; Holdaway, Heather A.; Battisti, Anthony J.; Sukupolvi-Petty, Soila; Sedlak, Dagmar; Fremont, Daved H.; Chipman, Paul R.; Roehrig, John T.; Diamond, Michael S.; Kuhn, Richard J.; Rossmann, Michael G. (Purdue); (WU-MED); (CDC)


    The monoclonal antibody 1A1D-2 has been shown to strongly neutralize dengue virus serotypes 1, 2 and 3, primarily by inhibiting attachment to host cells. A crystal structure of its antigen binding fragment (Fab) complexed with domain III of the viral envelope glycoprotein, E, showed that the epitope would be partially occluded in the known structure of the mature dengue virus. Nevertheless, antibody could bind to the virus at 37 degrees C, suggesting that the virus is in dynamic motion making hidden epitopes briefly available. A cryo-electron microscope image reconstruction of the virus:Fab complex showed large changes in the organization of the E protein that exposed the epitopes on two of the three E molecules in each of the 60 icosahedral asymmetric units of the virus. The changes in the structure of the viral surface are presumably responsible for inhibiting attachment to cells.

  19. Burn Injury Reveals Altered Phenotype in Mannan-Binding Lectin-Deficient Mice


    Møller-Kristensen, Mette; Hamblin, Michael R.; Thiel, Steffen; Jensenius, Jens Chr.; Takahashi, Kazue


    Burn injury destroys skin, the second largest innate immune organ in the body, and triggers chaotic immune and inflammatory responses. The pattern recognition molecule, mannan-binding lectin (MBL), plays an important role in the first-line host defense against infectious agents. MBL initiates the lectin complement pathway and acts as an opsonin. Recent studies suggest that MBL also modulates inflammatory responses. We report that local responses after burn in MBL null mice differ from those f...

  20. Development of recombinant Aleuria aurantia lectins with altered binding specificities to fucosylated glycans


    Romano, Patrick R.; Mackay, Andrew; Vong, Minh; deSa, Johann; Lamontagne, Anne; Comunale, Mary Ann; Hafner, Julie; Block, Timothy; Lec, Ryszard; Mehta, Anand


    Changes in glycosylation have long been associated with disease. While there are many methods to detect changes in glycosylation, plant derived lectins are often used to determine changes on specific proteins or molecules of interest. One change in glycosylation that has been observed by us and by others is a disease or antigen associated increase in fucosylation on N-linked glycans. To measure this change, the fucose binding Aleuria aurantia lectin (AAL) is often utilized in plate and soluti...

  1. Alterations in the structure and DNA binding of Ah receptor in the presence of polyamines

    International Nuclear Information System (INIS)

    Polyamines, putrescine, spermidine, and spermine are organic cations present in all cells. They have multiple regulatory roles in cell growth and differentiation. 2,3,7,8-Tetrachlorodigenzo-p-dioxin (TCDD), and related polycyclic aromatic hydrocarbons exert their adverse effects by binding to an intracellular protein (Ah receptor). Interaction of Ah receptor with specific DNA sequences triggers gene regulatory effects of TCDD. The authors examined the effect of polyamines on the structure and DNA binding of Ah receptor isolated from a human squamous carcinoma cell line, A431. [3H]TCDD-labeled Hf receptor was sedimented in the 9S region of sucrose gradients in hypotenic buffer. Polyamines caused a concentration dependent condensation and precipitation of Ah receptor. In the presence of 1 mM spermine the receptor was completely precipitated which could be recovered from the bottom of the sucrose gradients. This precipitation did not occur with RNase-treated Ah receptor. Incubation of RNase-treated Ah receptor with 1 mM spermidine increased its DNA binding 10-fold compared to controls having equivalent ionic strength. These results suggest that endogenous polyamines may influence the structural organization and gene regulatory effects of TCDD

  2. Alterations in substance P binding in brain nuclei of spontaneously hypertensive rats

    International Nuclear Information System (INIS)

    Substance P binding sites were characterized in brain nuclei of young (4-wk-old) and adult (16-wk-old) spontaneously hypertensive rats (SHR) and age-matched normotensive Wistar-Kyoto (WKY) control rats by quantitative autoradiography. Young SHR presented higher affinity constants (K/sub A/) than young WKY. The changes were restricted to locus coeruleus, the area postrema, the dorsal motor nucleus of the vagus, and to discrete areas located in lobes 9 and 10 of the vermis cerebelli of SHR. There were no differences in the maximal binding capacity (B/sub max/) except in the nucleus ambiguus where the B/sub max/ was lower than WKY. Conversely, the number of substance P binding sites was higher in the locus coeruleus, the nucleus tegmentalis dorsalis, the nucleus ambiguus, the dorsal motor nucleus of the vagus, the hypoglossal nucleus, the inferior olivary nucleus, and lobes 9 and 10 of the vermis cerebelli of adult SHR when compared with adult WKY. The results support the hypothesis of a role for brain substance P in blood pressure regulation and in genetic hypertension in rats

  3. Alteration in DNA binding pattern of conformationally locked NC(O)N system: A spectroscopic investigation. (United States)

    Velappan, Anand Babu; Maity, Banibrata; Kasper, Benjamin; McKnight, Ruel E; Seth, Debabrata; Debnath, Joy


    The binding mode of a conformationally locked NC(O)N planar system with deoxyribonucleic acid (DNA) is investigated using various spectroscopic and enzymatic assays. Compound 1 and its four different salts (comp. 2-5) were prepared for this purpose. They showed certain changes in their respective DNA-compound complex at ground state and excited state as measured by UV-vis and fluorescence emission spectra. The Stern-Volmer quenching constant (KSV) for the neutral species (1) is found 8545M(-1), whereas, for its salts 2, 3, 4 and 5 the quenching constants were 33510M(-1), 11352M(-1), 19693M(-1) and 27270M(-1) respectively. Nevertheless, the binding constant values remain comparable in neutral and salt forms except for 5. To elucidate the reason we took their CD spectra and ran a topoisomerase I (Topo I) assay. These experimental data revel the fact that compound 1 (neutral form) binds at the minor groove of DNA, whereas, its salt (2) has an extended intercalating property. PMID:26791583

  4. Altering Antibody-Drug Conjugate Binding to the Neonatal Fc Receptor Impacts Efficacy and Tolerability. (United States)

    Hamblett, Kevin J; Le, Tiep; Rock, Brooke M; Rock, Dan A; Siu, Sophia; Huard, Justin N; Conner, Kip P; Milburn, Robert R; O'Neill, Jason W; Tometsko, Mark E; Fanslow, William C


    Antibody-drug conjugates (ADC) rely on the target-binding specificity of an antibody to selectively deliver potent drugs to cancer cells. IgG antibody half-life is regulated by neonatal Fc receptor (FcRn) binding. Histidine 435 of human IgG was mutated to alanine (H435A) to explore the effect of FcRn binding on the pharmacokinetics, efficacy, and tolerability of two separate maytansine-based ADC pairs with noncleavable linkers, (c-DM1 and c-H435A-DM1) and (7v-Cys-may and 7v-H435A-Cys-may). The in vitro cell-killing potency of each pair of ADCs was similar, demonstrating that H435A showed no measurable impact on ADC bioactivity. The H435A mutant antibodies showed no detectable binding to human or mouse FcRn in vitro, whereas their counterpart wild-type IgG ADCs were found to bind to FcRn at pH = 6.0. In xenograft bearing SCID mice expressing mouse FcRn, the AUC of 7v-Cys-may was 1.6-fold higher than that of 7v-H435A-may, yet the observed efficacy was similar. More severe thrombocytopenia was observed with 7v-H435A-Cys-may as compared to 7v-Cys-may at multiple dose levels. The AUC of c-DM1 was approximately 3-fold higher than that of c-H435A-DM1 in 786-0 xenograft bearing SCID mice, which led to a 3-fold difference in efficacy by dose. Murine FcRn knockout, human FcRn transgenic line 32 SCID animals bearing 786-0 xenografts showed an amplified exposure difference between c-DM1 and c-H435A-DM1 as compared to murine FcRn expressing SCID mice, leading to a 10-fold higher dose required for efficacy despite a 6-fold higher AUC of the c-H435A-DM1. The accelerated clearance observed for the noncleavable maytansine ADCs with the H435A FcRn mutation led to reduced efficacy at equivalent doses and exacerbation of clinical pathology parameters (decreased tolerability) at equivalent doses. The results show that reduced ADC clearance mediated by FcRn modulation can improve therapeutic index. PMID:27248573

  5. MSH1 Is a Plant Organellar DNA Binding and Thylakoid Protein under Precise Spatial Regulation to Alter Development. (United States)

    Virdi, Kamaldeep S; Wamboldt, Yashitola; Kundariya, Hardik; Laurie, John D; Keren, Ido; Kumar, K R Sunil; Block, Anna; Basset, Gilles; Luebker, Steve; Elowsky, Christian; Day, Philip M; Roose, Johnna L; Bricker, Terry M; Elthon, Thomas; Mackenzie, Sally A


    As metabolic centers, plant organelles participate in maintenance, defense, and signaling. MSH1 is a plant-specific protein involved in organellar genome stability in mitochondria and plastids. Plastid depletion of MSH1 causes heritable, non-genetic changes in development and DNA methylation. We investigated the msh1 phenotype using hemi-complementation mutants and transgene-null segregants from RNAi suppression lines to sub-compartmentalize MSH1 effects. We show that MSH1 expression is spatially regulated, specifically localizing to plastids within the epidermis and vascular parenchyma. The protein binds DNA and localizes to plastid and mitochondrial nucleoids, but fractionation and protein-protein interactions data indicate that MSH1 also associates with the thylakoid membrane. Plastid MSH1 depletion results in variegation, abiotic stress tolerance, variable growth rate, and delayed maturity. Depletion from mitochondria results in 7%-10% of plants altered in leaf morphology, heat tolerance, and mitochondrial genome stability. MSH1 does not localize within the nucleus directly, but plastid depletion produces non-genetic changes in flowering time, maturation, and growth rate that are heritable independent of MSH1. MSH1 depletion alters non-photoactive redox behavior in plastids and a sub-set of mitochondrially altered lines. Ectopic expression produces deleterious effects, underlining its strict expression control. Unraveling the complexity of the MSH1 effect offers insight into triggers of plant-specific, transgenerational adaptation behaviors. PMID:26584715

  6. Burn injury reveals altered phenotype in mannan-binding lectin-deficient mice

    DEFF Research Database (Denmark)

    Møller-Kristensen, Mette; Hamblin, MR; Thiel, Steffen; Jensenius, Jens Christian; Takahashi, K


    lectin complement pathway and acts as an opsonin. Recent studies suggest that MBL also modulates inflammatory responses. We report that local responses after burn in MBL null mice differ from those found in wild-type (WT) mice in the following important biological markers: spontaneous eschar separation......, thinned epidermis and dermis, upregulation of soluble factors including cytokines, chemokines, cell adhesion molecules, a growth factor-binding protein, and matrix metalloproteinases. Mice lacking C1q, C4, or C3 did not show the lack of eschar separation seen in MBL null-burn phenotype. These findings...

  7. Cyanobacteria contain a structural homologue of the Hfq protein with altered RNA-binding properties

    DEFF Research Database (Denmark)

    Bøggild, Andreas; Overgaard, Martin; Valentin-Hansen, Poul;


    regulating mRNA turnover in eukaryotes. However, bacterial Hfq proteins are homohexameric, whereas eukaryotic Sm/Lsm proteins are heteroheptameric. Recently, Hfq proteins with poor sequence conservation were identified in archaea and cyanobacteria. In this article, we describe crystal structures of the Hfq...... proteins from the cyanobacteria Synechocystis sp. PCC 6803 and Anabaena PCC 7120 at 1.3 and 2.3 A resolution, respectively, and show that they retain the classic Sm fold despite low sequence conservation. In addition, the intersubunit contacts and RNA-binding site are divergent, and we show biochemically...

  8. Cyanobacteria contain a structural homologue of the Hfq protein with altered RNA binding properties

    DEFF Research Database (Denmark)

    Bøggild, Andreas; Overgaard, Martin; Valentin-Hansen, Poul;


    regulating mRNA turnover in eukaryotes. However, bacterial Hfq proteins are homohexameric, whereas eukaryotic Sm/Lsm proteins are heteroheptameric. Recently, Hfq proteins with poor sequence conservation were identified in archaea and cyanobacteria. In this article, we describe crystal structures of the Hfq...... proteins from the cyanobacteria Synechocystis sp. PCC 6803 and Anabaena PCC 7120 at 1.3 and 2.3 A resolution, respectively, and show that they retain the classic Sm fold despite low sequence conservation. In addition, the intersubunit contacts and RNA-binding site are divergent, and we show biochemically...

  9. A role for heme in Alzheimer's disease: Heme binds amyloid β and has altered metabolism


    Atamna, Hani; Frey, William H.


    Heme is a common factor linking several metabolic perturbations in Alzheimer's disease (AD), including iron metabolism, mitochondrial complex IV, heme oxygenase, and bilirubin. Therefore, we determined whether heme metabolism was altered in temporal lobes obtained at autopsy from AD patients and age-matched nondemented subjects. AD brain demonstrated 2.5-fold more heme-b (P < 0.01) and 26% less heme-a (P = 0.16) compared with controls, resulting in a highly significant 2.9-fold decrease in he...

  10. IgG subclass and heavy chain domains contribute to binding and protection by mAbs to the poly γ-D-glutamic acid capsular antigen of Bacillus anthracis.

    Directory of Open Access Journals (Sweden)

    Maria Hovenden

    Full Text Available Bacterial capsules are common targets for antibody-mediated immunity. The capsule of Bacillus anthracis is unusual among capsules because it is composed of a polymer of poly-γ-d-glutamic acid (γdPGA. We previously generated murine IgG3 monoclonal antibodies (mAbs to γdPGA that were protective in a murine model of pulmonary anthrax. IgG3 antibodies are characteristic of the murine response to polysaccharide antigens. The goal of the present study was to produce subclass switch variants of the γdPGA mAbs (IgG3 → IgG1 → IgG2b → IgG2a and assess the contribution of subclass to antibody affinity and protection. Subclass switch antibodies had identical variable regions but differed in their heavy chains. The results showed that a switch from the protective IgG3 to IgG1, IgG2b or IgG2a was accompanied by i a loss of protective activity ii a change in mAb binding to the capsular matrix, and iii a loss of affinity. These results identify a role for the heavy chain constant region in mAb binding. Hybrid mAbs were constructed in which the CH1, CH2 or CH3 heavy chain constant domains from a non-protective, low binding IgG2b mAb were swapped into the protective IgG3 mAb. The IgG3 mAb that contained the CH1 domain from IgG2b showed no loss of affinity or protection. In contrast, swapping the CH2 or CH3 domains from IgG2b into IgG3 produced a reduction in affinity and a loss of protection. These studies identify a role for the constant region of IgG heavy chains in affinity and protection against an encapsulated bacterial pathogen.

  11. Photocontrol of the expression of genes encoding chlorophyll a/b binding proteins and small subunit of ribulose-1,5-bisphosphate carboxylase in etiolated seedlings of Lycopersicon esculentum (L. ) and Nicotiana tabacum (L. )

    Energy Technology Data Exchange (ETDEWEB)

    Wehmeyer, B. (Univ. of Pennsylvania, Philadelphia (USA) Albert-Ludwigs-Universitaet, Freiburg (West Germany)); Cashmore, A.R. (Univ. of Pennsylvania, Philadelphia (USA)); Schaefer, E. (Albert-Ludwigs-Universitaet, Freiburg (West Germany))


    Phytochrome and the blue ultraviolet-A photoreceptor control light-induced expression of genes encoding the chlorophyll a/b binding protein of photosystem II and photosystem I and the genes for the small subunit of the ribulose-1,5-bisphosphate carboxylase in etiolated seedlings of Lycopersicon esculentum (tomato) and Nicotiana tabacum (tobacco). A high irradiance response also controls the induction of these genes. Genes encoding photosystem II- and I-associated chlorophyll a/b binding proteins both exhibit a transient rapid increase in expression in response to light pulse or to continuous irradiation. In contrast, genes encoding the small subunit exhibit a continuous increase in expression in response to light. These distinct expression characteristics are shown to reflect differences at the level of transcription.

  12. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    DEFF Research Database (Denmark)

    Douthwaite, S; Aagaard, C


    induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still...... protects against chemical modification in the mutant peptidyl transferase loops, but the affinity of the drug interaction is reduced 20-fold in the 2057A mutant, 10(3)-fold in the 2058U mutant and 10(4)-fold in the 2058G mutant. Single mutations at position 2032 in the adjacent hairpin loop, which have...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  13. Neuroprotective Effect of Ginseng against Alteration of Calcium Binding Proteins Immunoreactivity in the Mice Hippocampus after Radiofrequency Exposure

    Directory of Open Access Journals (Sweden)

    Dhiraj Maskey


    Full Text Available Calcium binding proteins (CaBPs such as calbindin D28-k, parvalbumin, and calretinin are able to bind Ca2+ with high affinity. Changes in Ca2+ concentrations via CaBPs can disturb Ca2+ homeostasis. Brain damage can be induced by the prolonged electromagnetic field (EMF exposure with loss of interacellular Ca2+ balance. The present study investigated the radioprotective effect of ginseng in regard to CaBPs immunoreactivity (IR in the hippocampus through immunohistochemistry after one-month exposure at 1.6 SAR value by comparing sham control with exposed and ginseng-treated exposed groups separately. Loss of dendritic arborization was noted with the CaBPs in the Cornu Ammonis areas as well as a decrease of staining intensity of the granule cells in the dentate gyrus after exposure while no loss was observed in the ginseng-treated group. A significant difference in the relative mean density was noted between control and exposed groups but was nonsignificant in the ginseng-treated group. Decrease in CaBP IR with changes in the neuronal staining as observed in the exposed group would affect the hippocampal trisynaptic circuit by alteration of the Ca2+ concentration which could be prevented by ginseng. Hence, ginseng could contribute as a radioprotective agent against EMF exposure, contributing to the maintenance of Ca2+ homeostasis by preventing impairment of intracellular Ca2+ levels in the hippocampus.

  14. Altered localization and functionality of TAR DNA Binding Protein 43 (TDP-43) in niemann- pick disease type C. (United States)

    Dardis, A; Zampieri, S; Canterini, S; Newell, K L; Stuani, C; Murrell, J R; Ghetti, B; Fiorenza, M T; Bembi, B; Buratti, E


    Niemann-Pick type C (NPC) disease is a lysosomal storage disorder characterized by the occurrence of visceral and neurological symptoms. At present, the molecular mechanisms causing neurodegeneration in this disease are unknown. Here we report the altered expression and/or mislocalization of the TAR-DNA binding protein 43 (TDP-43) in both NPC mouse and in a human neuronal model of the disease. We also report the neuropathologic study of a NPC patient's brain, showing that while TDP-43 is below immunohistochemical detection in nuclei of cerebellar Purkinje cells, it has a predominant localization in the cytoplasm of these cells. From a functional point of view, the TDP-43 mislocalization, that occurs in a human experimental neuronal model system, is associated with specific alterations in TDP-43 controlled genes. Most interestingly, treatment with N-Acetyl-cysteine (NAC) or beta-cyclodextrin (CD) can partially restore TDP-43 nuclear localization. Taken together, the results of these studies extend the role of TDP-43 beyond the Amyotrophic lateral sclerosis (ALS)/frontotemporal dementia (FTD)/Alzheimer disease (AD) spectrum. These findings may open novel research/therapeutic avenues for a better understanding of both NPC disease and the TDP-43 proteinopathy disease mechanism. PMID:27193329

  15. Gestational treatment with cocaine and fluoxetine alters oxytocin receptor number and binding affinity in lactating rat dams. (United States)

    Johns, Josephine M; Lubin, Deborah A; Walker, Cheryl H; Joyner, Paul; Middleton, Christopher; Hofler, Vivian; McMurray, Matthew


    Cocaine administered chronically throughout gestation has been correlated with deficits in maternal behavior, increased maternal aggressive behavior and decreased oxytocin levels in rats. In addition to its effects on oxytocin levels, cocaine is a potent serotonergic, dopaminergic and noradrenergic reuptake inhibitor. Alterations in the dopaminergic and serotonergic systems have been suggested as possibly having a role in cocaine-induced maternal aggression. This study was in part, an attempt to understand some of the mechanisms by which cocaine increases postpartum aggression, particularly as they relate to changes in the oxytocin system. Oxytocin receptor number and binding affinity in the medial preoptic area of the hypothalamus, ventral tegmental area, hippocampus and amygdala were determined for lactating rat dams on postpartum day 6 (PPD 6) that were gestationally treated with cocaine, fluoxetine, saline or an amfonelic acid/fluoxetine drug combination. Cocaine and fluoxetine treatment both resulted in a significant up-regulation of oxytocin receptor number and lower receptor affinity in the amygdala of lactating rat dams compared to saline controls and the amfonelic acid/fluoxetine combination treatment group. Cocaine treatment also resulted in a significant down-regulation of oxytocin receptors in the medial preoptic area and both cocaine and fluoxetine treated dams had the highest affinity for oxytocin receptors in this brain region. Results of the present study support previous data indicating that alterations in oxytocinergic and perhaps serotonergic system dynamics in the amygdala may play a role in cocaine-induced postpartum aggression. PMID:15380831

  16. ATP-binding cassette transporter A7 (ABCA7) loss of function alters Alzheimer amyloid processing. (United States)

    Satoh, Kanayo; Abe-Dohmae, Sumiko; Yokoyama, Shinji; St George-Hyslop, Peter; Fraser, Paul E


    The ATP-binding cassette transporter A7 (ABCA7) has been identified as a susceptibility factor of late onset Alzheimer disease in genome-wide association studies. ABCA7 has been shown to mediate phagocytosis and affect membrane trafficking. The current study examined the impact of ABCA7 loss of function on amyloid precursor protein (APP) processing and generation of amyloid-β (Aβ). Suppression of endogenous ABCA7 in several different cell lines resulted in increased β-secretase cleavage and elevated Aβ. ABCA7 knock-out mice displayed an increased production of endogenous murine amyloid Aβ42 species. Crossing ABCA7-deficient animals to an APP transgenic model resulted in significant increases in the soluble Aβ as compared with mice expressing normal levels of ABCA7. Only modest changes in the amount of insoluble Aβ and amyloid plaque densities were observed once the amyloid pathology was well developed, whereas Aβ deposition was enhanced in younger animals. In vitro studies indicated a more rapid endocytosis of APP in ABCA7 knock-out cells that is mechanistically consistent with the increased Aβ production. These in vitro and in vivo findings indicate a direct role of ABCA7 in amyloid processing that may be associated with its primary biological function to regulate endocytic pathways. Several potential loss-of-function ABCA7 mutations and deletions linked to Alzheimer disease that in some instances have a greater impact than apoE allelic variants have recently been identified. A reduction in ABCA7 expression or loss of function would be predicted to increase amyloid production and that may be a contributing factor in the associated Alzheimer disease susceptibility. PMID:26260791

  17. Photorhabdus adhesion modification protein (Pam) binds extracellular polysaccharide and alters bacterial attachment

    LENUS (Irish Health Repository)

    Jones, Robert T


    Abstract Background Photorhabdus are Gram-negative nematode-symbiotic and insect-pathogenic bacteria. The species Photorhabdus asymbiotica is able to infect humans as well as insects. We investigated the secreted proteome of a clinical isolate of P. asymbiotica at different temperatures in order to identify proteins relevant to the infection of the two different hosts. Results A comparison of the proteins secreted by a clinical isolate of P. asymbiotica at simulated insect (28°C) and human (37°C) temperatures led to the identification of a small and highly abundant protein, designated Pam, that is only secreted at the lower temperature. The pam gene is present in all Photorhabdus strains tested and shows a high level of conservation across the whole genus, suggesting it is both ancestral to the genus and probably important to the biology of the bacterium. The Pam protein shows limited sequence similarity to the 13.6 kDa component of a binary toxin of Bacillus thuringiensis. Nevertheless, injection or feeding of heterologously produced Pam showed no insecticidal activity to either Galleria mellonella or Manduca sexta larvae. In bacterial colonies, Pam is associated with an extracellular polysaccharide (EPS)-like matrix, and modifies the ability of wild-type cells to attach to an artificial surface. Interestingly, Surface Plasmon Resonance (SPR) binding studies revealed that the Pam protein itself has adhesive properties. Although Pam is produced throughout insect infection, genetic knockout does not affect either insect virulence or the ability of P. luminescens to form a symbiotic association with its host nematode, Heterorhabditis bacteriophora. Conclusions We studied a highly abundant protein, Pam, which is secreted in a temperature-dependent manner in P. asymbiotica. Our findings indicate that Pam plays an important role in enhancing surface attachment in insect blood. Its association with exopolysaccharide suggests it may exert its effect through mediation of

  18. Photorhabdus adhesion modification protein (Pam binds extracellular polysaccharide and alters bacterial attachment

    Directory of Open Access Journals (Sweden)

    Joyce Susan A


    Full Text Available Abstract Background Photorhabdus are Gram-negative nematode-symbiotic and insect-pathogenic bacteria. The species Photorhabdus asymbiotica is able to infect humans as well as insects. We investigated the secreted proteome of a clinical isolate of P. asymbiotica at different temperatures in order to identify proteins relevant to the infection of the two different hosts. Results A comparison of the proteins secreted by a clinical isolate of P. asymbiotica at simulated insect (28°C and human (37°C temperatures led to the identification of a small and highly abundant protein, designated Pam, that is only secreted at the lower temperature. The pam gene is present in all Photorhabdus strains tested and shows a high level of conservation across the whole genus, suggesting it is both ancestral to the genus and probably important to the biology of the bacterium. The Pam protein shows limited sequence similarity to the 13.6 kDa component of a binary toxin of Bacillus thuringiensis. Nevertheless, injection or feeding of heterologously produced Pam showed no insecticidal activity to either Galleria mellonella or Manduca sexta larvae. In bacterial colonies, Pam is associated with an extracellular polysaccharide (EPS-like matrix, and modifies the ability of wild-type cells to attach to an artificial surface. Interestingly, Surface Plasmon Resonance (SPR binding studies revealed that the Pam protein itself has adhesive properties. Although Pam is produced throughout insect infection, genetic knockout does not affect either insect virulence or the ability of P. luminescens to form a symbiotic association with its host nematode, Heterorhabditis bacteriophora. Conclusions We studied a highly abundant protein, Pam, which is secreted in a temperature-dependent manner in P. asymbiotica. Our findings indicate that Pam plays an important role in enhancing surface attachment in insect blood. Its association with exopolysaccharide suggests it may exert its effect

  19. Serological and binding characteristics of a monoclonal antibody (MoAb) to a human high molecular weight-melanoma associated antigen (HMW-MAA) for tumor imaging

    International Nuclear Information System (INIS)

    By means of the hybridoma technology several monoclonal antibodies (MoAb) are developed to human melanoma associated antigens expressed on the cell surface as well as in the cytoplasm of melanoma cells. Because the first type of antigens can be exploited for in vivo tumor detection and as targets of immunotherapy, an extensive serological scrutiny of MoAb 225.28S which recognizes a membrane-bound HMW-MAA is performed. The results of this evaluation and the use of radiolabelled MoAb 225.28S for melanoma radioimaging are reported. (Auth.)

  20. IGF-binding proteins in type 1 diabetes are more severely altered in the presence of complications

    Directory of Open Access Journals (Sweden)

    Ashok eSharma


    Full Text Available Aims: Reduced levels of free and total insulin-like growth factor 1 (IGF-I have been observed in Type-1 Diabetes (T1D patients. The bioavailability of IGF-I from the circulation to the target cells is controlled by multifunctional IGF binding proteins (IGFBPs. The aim of this study was to profile serum IGFBPs in T1D and its complications.Design: We measured the IGFBP levels in 3662 patient serum samples from our ongoing Phenome and Genome of Diabetes Autoimmunity (PAGODA study. IGFBP levels of four different groups of T1D patients (with 0, 1, 2, ≥3 complications were compared with healthy controls. Results: Three serum IGFBPs (IGFBP-1, 2 and 6 are significantly higher in T1D patients and these alterations are greater in the presence of diabetic complications. IGFBP-3 is lower in patients with diabetic complications. Analyses using quintiles revealed that risk of T1D complications increases with increasing concentrations of IGFBP-2 (5th quintile ORs: 18-60, p<10-26, IGFBP-1 (5th quintile ORs: 8-20, p<10-15 and IGFBP-6 (5th quintile ORs: 3-148, p<10-3. IGFBP-3 has a negative association with T1D complications (5th quintile ORs: 0.12-0.25, p<10-5. Conclusions: we found that elevated serum levels of IGFBP-1, 2 and 6 were associated with T1D and its complications and IGFBP-3 level was found to be decreased in T1D with complications. Given the known role of these IGFBPs, the overall impact of these alterations suggest a negative effect on IGF signaling.

  1. The A31P missense mutation in cardiac myosin binding protein C alters protein structure but does not cause haploinsufficiency. (United States)

    van Dijk, Sabine J; Bezold Kooiker, Kristina; Mazzalupo, Stacy; Yang, Yuanzhang; Kostyukova, Alla S; Mustacich, Debbie J; Hoye, Elaine R; Stern, Joshua A; Kittleson, Mark D; Harris, Samantha P


    Mutations in MYBPC3, the gene encoding cardiac myosin binding protein C (cMyBP-C), are a major cause of hypertrophic cardiomyopathy (HCM). While most mutations encode premature stop codons, missense mutations causing single amino acid substitutions are also common. Here we investigated effects of a single proline for alanine substitution at amino acid 31 (A31P) in the C0 domain of cMyBP-C, which was identified as a natural cause of HCM in cats. Results using recombinant proteins showed that the mutation disrupted C0 structure, altered sensitivity to trypsin digestion, and reduced recognition by an antibody that preferentially recognizes N-terminal domains of cMyBP-C. Western blots detecting A31P cMyBP-C in myocardium of cats heterozygous for the mutation showed a reduced amount of A31P mutant protein relative to wild-type cMyBP-C, but the total amount of cMyBP-C was not different in myocardium from cats with or without the A31P mutation indicating altered rates of synthesis/degradation of A31P cMyBP-C. Also, the mutant A31P cMyBP-C was properly localized in cardiac sarcomeres. These results indicate that reduced protein expression (haploinsufficiency) cannot account for effects of the A31P cMyBP-C mutation and instead suggest that the A31P mutation causes HCM through a poison polypeptide mechanism that disrupts cMyBP-C or myocyte function. PMID:26777460

  2. Alterations of benzodiazepine receptor binding potential in anxiety and somatoform disorders measured by 123I-iomazenil SPECT

    International Nuclear Information System (INIS)

    123I-iomazenil (IMZ), a newly developed radioligand which acts on benzodiazepine receptors (BZR) as a partial inverse agonist, made it possible to evaluate the function of central BZR by single photon emission tomography (SPECT). To examine the alterations of the binding potential (BP) in the anxiety state, 123I-IMZ SPECT was performed in five patients with anxiety and somatoform disorders, and five epileptic patients without anxiety symptoms served as a reference. The BP of BZR was determined by using a table look-up procedure based on a three-compartment, two-parameter model in the bilateral superior frontal, inferior frontal, temporal, parietal, occipital, and cerebellar cortex. The mean BP of patients with anxiety and somatoform disorders was significantly decreased in the superior frontal, temporal, and parietal cortex, in comparison with that of epileptic patients. A significant correlation was observed between the anxiety levels scored on the Hamilton anxiety scale and BP in the right temporal cortex and left superior frontal cortex. These changes in BZR revealed by SPECT suggest the usefulness of 123I-IMZ SPECT to objectively evaluate anxiety levels in patients with anxiety symptoms. (author)

  3. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    International Nuclear Information System (INIS)

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the Bmax and Kd for thioflavin t binding to the peripheral anionic site. However, these changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in Bmax did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in Bmax, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in Kd represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing Kd, and dimethylphosphorylation of Ser203 decreasing Kd. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203

  4. Fotfavoriten AB


    Søilen, Klaus Solberg; HUBER, Stefan


    Fotfavoriten AB, a foot care company located in Sollefttå in Northern Sweden, is an example of how local government fires staff only to reengage them as entrepreneurs delivering similar service. The case is typical for the social sector and may mark a trend. The result is often felt to be positive both by the entrepreneur, who is now more directly in charge of her or his earnings, and the end consumer. The CEO of Fotfavoriten AB, Eva Wörmann, waited a long time before she dared to take the ne...

  5. Epidermal growth factor treatment of A431 cells alters the binding capacity and electrophoretic mobility of the cytoskeletally associated epidermal growth factor receptor

    International Nuclear Information System (INIS)

    Epidermal growth factor receptor interacts with structural elements of A431 cells and remains associated with the cytoskeleton following extraction with nonionic detergents. Extraction of cells with 0.15% Triton X-100 resulted in detection of only approximately 40% of the EGF binding sites on the cytoskeleton. If the cells were exposed to EGF prior to extraction, approximately twofold higher levels of low-affinity EGF binding sites were detected. The difference in number of EGF binding sites was not a consequence of differences in numbers of EGF receptors associated with the cytoskeleton; equal amounts of 35S-labeled receptor were immunoprecipitated from the cytoskeletons of both control and EGF-treated cells. The effect of EGF pretreatment on binding activity was coincident with a change in the mobility of the receptor from a doublet of Mr approximately 160-180 kDa to a single sharp band at 180 kDa. The alteration in receptor mobility was not a simple consequence of receptor phosphorylation in that the alteration was not reversed by alkaline phosphatase treatment, nor was the shift produced by treatment of the cells with phorbol ester. The two EGF receptor species demonstrated differential susceptibility to V8 proteinase digestion. The EGF-induced 180 kDa species was preferentially digested by the proteinase relative to the 160 kDa species, indicating that EGF binding results in a conformational change in the receptor. The EGF-mediated preservation of binding activity and altered conformation may be related to receptor oligomerization

  6. Alterations of Penicillin-Binding Proteins 1A, 2X, and 2B in Streptococcus pneumoniae Isolates for Which Amoxicillin MICs Are Higher than Penicillin MICs


    Kosowska, K.; Jacobs, M R; Bajaksouzian, S.; Koeth, L.; Appelbaum, P. C.


    Penicillin-binding proteins (PBPs) of 15 selected penicillin- and amoxicillin-resistant Streptococcus pneumoniae isolates (MICs of 2 to 8 and 8 to 16 μg/ml, respectively) were studied. In addition to typical changes in PBPs 1A and 2X, these strains had 10 unique changes in PBP 2B, including a 618A-G substitution, which may be the key alteration associated with amoxicillin resistance.

  7. Altered binding of 125I-labeled calmodulin to a 46.5-kilodalton protein in skin fibroblasts cultured from patients with cystic fibrosis

    International Nuclear Information System (INIS)

    The levels of calmodulin and calmodulin-binding proteins have been determined in cultured skin fibroblasts from patients with cystic fibrosis (CF) and age- and sex-matched controls. Calmodulin ranged from 0.20 to 0.76 microgram/mg protein; there was no difference between calmodulin concentration in fibroblasts from CF patients and controls. Calmodulin-binding proteins of 230, 212, 204, 164, 139, 70, 59, 46.5, and 41 kD were identified. A protein with a mobility identical to the 59-kD calmodulin-binding protein was labeled by antiserum against calmodulin-dependent phosphatase. Although Ca2+/calmodulin-dependent phosphatase activity was detected, there was no different in activity between control and CF fibroblasts or in the level of phosphatase protein as determined by radioimmunoassay. Lower amounts of 125I-calmodulin were bound to the 46.5-kD calmodulin-binding protein in CF fibroblasts as compared with controls. The 46.5-kD calmodulin-binding protein may be reduced in CF fibroblasts or its structure may be altered resulting in a reduced binding capacity and/or affinity for calmodulin and perhaps reflecting, either directly or indirectly, the genetic defect responsible for cystic fibrosis

  8. Selective metal binding to Cys-78 within endonuclease V causes an inhibition of catalytic activities without altering nontarget and target DNA binding

    International Nuclear Information System (INIS)

    T4 endonuclease V is a pyrimidine dimer-specific DNA repair enzyme which has been previously shown not to require metal ions for either of its two catalytic activities or its DNA binding function. However, we have investigated whether the single cysteine within the enzyme was able to bind metal salts and influence the various activities of this repair enzyme. A series of metals (Hg2+, Ag+, Cu+) were shown to inactivate both endonuclease Vs pyrimidine dimer-specific DNA glycosylase activity and the subsequent apurinic nicking activity. The binding of metal to endonuclease V did not interfere with nontarget DNA scanning or pyrimidine dimer-specific binding. The Cys-78 codon within the endonuclease V gene was changed by oligonucleotide site-directed mutagenesis to Thr-78 and Ser-78 in order to determine whether the native cysteine was directly involved in the enzyme's DNA catalytic activities and whether the cysteine was primarily responsible for the metal binding. The mutant enzymes were able to confer enhanced ultraviolet light (UV) resistance to DNA repair-deficient Escherichia coli at levels equal to that conferred by the wild type enzyme. The C78T mutant enzyme was purified to homogeneity and shown to be catalytically active on pyrimidine dimer-containing DNA. The catalytic activities of the C78T mutant enzyme were demonstrated to be unaffected by the addition of Hg2+ or Ag+ at concentrations 1000-fold greater than that required to inhibit the wild type enzyme. These data suggest that the cysteine is not required for enzyme activity but that the binding of certain metals to that amino acid block DNA incision by either preventing a conformational change in the enzyme after it has bound to a pyrimidine dimer or sterically interfering with the active site residue's accessibility to the pyrimidine dimer

  9. Activation of Prophage eib Genes for Immunoglobulin-Binding Proteins by Genes from the IbrAB Genetic Island of Escherichia coli ECOR-9


    Sandt, Carol H.; Hopper, James E.; Hill, Charles W.


    Four distinct Escherichia coli immunoglobulin-binding (eib) genes, each of which encodes a surface-exposed protein that binds immunoglobulins in a nonimmune manner, are carried by separate prophages in E. coli reference (ECOR) strain ECOR-9. Each eib gene was transferred to test E. coli strains, both in the form of multicopy recombinant plasmids and as lysogenized prophage. The derived lysogens express little or no Eib protein, in sharp contrast to the parental lysogen, suggesting that ECOR-9...

  10. Brain binding sites for atrial natriuretic factor (ANF): alterations in prehypertensive Dahl salt-sensitive (S/JR) rats

    International Nuclear Information System (INIS)

    The binding of radioiodinated atrial natriuretic factor (125I-ANF-28) to discrete areas of brain in 7 week old, inbred Dahl salt-sensitive (S/JR) and salt-resistant (R/JR) rats was studied utilizing quantitative film autoradiography. At this age, S/JR rats exhibit systolic blood pressures that are prehypertensive and tend to be slightly higher than systolic blood pressures of age-matched R/JR rats. Scatchard analysis of 125I-ANF-28 binding in forebrain revealed that S/JR rats have a significantly increased number of binding sites for 125I-ANF-28 in the subfornical organ as compared to R/JR controls. In contrast, values for 125I-ANF-28 binding capacity in the choroid plexus and area postrema were similar for both strains, and binding affinity constants for 125I-ANF-28 binding revealed no strain differences in any brain area examined. The elevation in the number of binding sites for atrial natriuretic factor may serve as a compensatory mechanism acting in part to lower fluid volume and sodium levels prior to the precipitous increase in blood pressure which occurs in S/JR rats by 10 weeks of age

  11. Diet-induced alterations in intestinal and extrahepatic lipid metabolism in liver fatty acid binding protein knockout mice


    Newberry, Elizabeth P.; Kennedy, Susan M; Xie, Yan; Luo, Jianyang; Davidson, Nicholas O.


    Liver fatty acid binding protein (L-FABP) is highly expressed in both enterocytes and hepatocytes and binds multiple ligands, including saturated (SFA), unsaturated fatty acids (PUFA), and cholesterol. L-fabp−/− mice were protected against obesity and hepatic steatosis on a high saturated fat (SF), high cholesterol “Western” diet and manifested a similar phenotype when fed with a high SF, low cholesterol diet. There were no significant differences in fecal fat content or food consumption betw...

  12. Epitope mapping of a mAb against the factor H binding protein (fHbp) of N. meningitidis by phage display


    Zippilli, Lorenza


    No broadly protective vaccine is yet available for the prevention of group B meningococcal disease. One promising vaccine lead is the factor H binding protein (fHbp), a surface-exposed lipoprotein, which is present in all strains of Neisseria meningitidis. This protein binds human factor H (fH), contributing to the ability of these bacteria to avoid complement-mediated killing. The fHbp is a component of a serogroup B meningococcal vaccine currently in late-phase clinical development. Ba...


    NARCIS (Netherlands)



    The crystal structure determination of heat labile enterotoxin (LT) bound to two different lanthanide ions, erbium and samarium, revealed two distinct ion binding sites in the interface of the A subunit and the B pentamer of the toxin. One of the interface sites is conserved in the very similar chol

  14. Acute social defeat does not alter cerebral 5-HT2A receptor binding in male Wistar rats

    DEFF Research Database (Denmark)

    Visser, Anniek K D; Meerlo, Peter; Ettrup, Anders;


    stress on this receptor subtype. In this study, we therefore assessed acute and long-term changes in 5HT2A R binding after social defeat stress in rats. Male Wistar rats were subjected to social defeat by placing them in the home cage of an aggressive, dominant Long Evans rat. Acute social defeat...... suppressed growth, but did not affect anxiety-like behavior in an open field test. A positron emission tomography scan with the 5-HT2A R tracer [11C]MDL 100907 1 day and 3 weeks after defeat did not show significant changes in receptor binding. To verify these results, [3H]MDL 100907 binding assays were...

  15. Alteration of the carbohydrate-binding specificity of a C-type lectin CEL-I mutant with an EPN carbohydrate-binding motif. (United States)

    Hatakeyama, Tomomitsu; Ishimine, Tomohiro; Baba, Tomohiro; Kimura, Masanari; Unno, Hideaki; Goda, Shuichiro


    CEL-I is a Gal/GalNAc-specific C-type lectin isolated from the sea cucumber Cucumaria echinata. This lectin is composed of two carbohydrate-recognition domains (CRDs) with the carbohydrate-recognition motif QPD (Gln-Pro- Asp), which is generally known to exist in galactose-specific C-type CRDs. In the present study, a mutant CEL-I with EPN (Glu-Pro-Asn) motif, which is thought to be responsible for the carbohydrate-recognition of mannose-specific Ctype CRDs, was produced in Escherichia coli, and its effects on the carbohydrate-binding specificity were examined using polyamidoamine dendrimer (PD) conjugated with carbohydrates. Although wild-type CEL-I effectively formed complexes with N-acetylgalactosamine (GalNAc)-PD but not with mannose-PD, the mutant CEL-I showed relatively weak but definite affinity for mannose-PD. These results indicated that the QPD and EPN motifs play a significant role in the carbohydrate-recognition mechanism of CEL-I, especially in the discrimination of galactose and mannose. Additional mutations in the recombinant CEL-I binding site may further increase its specificity for mannose, and should provide insights into designing novel carbohydrate-recognition proteins. PMID:23157284

  16. Structural characterization of S100A15 reveals a novel zinc coordination site among S100 proteins and altered surface chemistry with functional implications for receptor binding

    Directory of Open Access Journals (Sweden)

    Murray Jill I


    Full Text Available Abstract Background S100 proteins are a family of small, EF-hand containing calcium-binding signaling proteins that are implicated in many cancers. While the majority of human S100 proteins share 25-65% sequence similarity, S100A7 and its recently identified paralog, S100A15, display 93% sequence identity. Intriguingly, however, S100A7 and S100A15 serve distinct roles in inflammatory skin disease; S100A7 signals through the receptor for advanced glycation products (RAGE in a zinc-dependent manner, while S100A15 signals through a yet unidentified G-protein coupled receptor in a zinc-independent manner. Of the seven divergent residues that differentiate S100A7 and S100A15, four cluster in a zinc-binding region and the remaining three localize to a predicted receptor-binding surface. Results To investigate the structural and functional consequences of these divergent clusters, we report the X-ray crystal structures of S100A15 and S100A7D24G, a hybrid variant where the zinc ligand Asp24 of S100A7 has been substituted with the glycine of S100A15, to 1.7 Å and 1.6 Å resolution, respectively. Remarkably, despite replacement of the Asp ligand, zinc binding is retained at the S100A15 dimer interface with distorted tetrahedral geometry and a chloride ion serving as an exogenous fourth ligand. Zinc binding was confirmed using anomalous difference maps and solution binding studies that revealed similar affinities of zinc for S100A15 and S100A7. Additionally, the predicted receptor-binding surface on S100A7 is substantially more basic in S100A15 without incurring structural rearrangement. Conclusions Here we demonstrate that S100A15 retains the ability to coordinate zinc through incorporation of an exogenous ligand resulting in a unique zinc-binding site among S100 proteins. The altered surface chemistry between S100A7 and S100A15 that localizes to the predicted receptor binding site is likely responsible for the differential recognition of distinct

  17. G9a-mediated Lysine Methylation Alters the Function of CCAAT/Enhancer-binding Protein-β*S⃞


    Pless, Ole; Kowenz-Leutz, Elisabeth; Knoblich, Maria; Lausen, Jörn; Beyermann, Michael; Walsh, Martin J.; Leutz, Achim


    The functional capacity of the transcriptional regulatory CCAAT/enhancer-binding protein-β (C/EBPβ) is governed by protein interactions and post-translational protein modifications. In a proteome-wide interaction screen, the histone-lysine N-methyltransferase, H3 lysine 9-specific 3 (G9a), was found to directly interact with the C/EBPβ transactivation domain (TAD). Binding between G9a and C/EBPβ was confirmed by glutathione S-transferase pulldown and co-immunopreci...

  18. The Hypertrophic Cardiomyopathy Myosin Mutation R453C Alters ATP Binding and Hydrolysis of Human Cardiac β-Myosin*


    Bloemink, Marieke; Deacon, John; Langer, Stephen; Vera, Carlos; Combs, Ariana; Leinwand, Leslie; Geeves, Michael A.


    The human hypertrophic cardiomyopathy mutation R453C results in one of the more severe forms of the myopathy. Arg-453 is found in a conserved surface loop of the upper 50-kDa domain of the myosin motor domain and lies between the nucleotide binding pocket and the actin binding site. It connects to the cardiomyopathy loop via a long α-helix, helix O, and to Switch-2 via the fifth strand of the central β-sheet. The mutation is, therefore, in a position to perturb a wide range of myosin molecula...

  19. Comparative study of tight-binding and ab initio electronic structure calculations focused on magnetic anisotropy in ordered CoPt alloy

    Czech Academy of Sciences Publication Activity Database

    Zemen, Jan; Mašek, Jan; Kučera, Jan; Mol, J.A.; Motloch, P.; Jungwirth, Tomáš


    Roč. 356, Apr (2014), s. 87-94. ISSN 0304-8853 R&D Projects: GA MŠk(CZ) LM2011026 EU Projects: European Commission(XE) 268066 - 0MSPIN Grant ostatní: AVČR(CZ) Praemium Academiae Institutional support: RVO:68378271 Keywords : magnetic anisotropy * tight-binding model Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.970, year: 2014

  20. DcR3 binds to ovarian cancer via heparan sulfate proteoglycans and modulates tumor cells response to platinum with corresponding alteration in the expression of BRCA1

    International Nuclear Information System (INIS)

    Overcoming platinum resistance is a major obstacle in the treatment of Epithelial Ovarian Cancer (EOC). In our previous work Decoy Receptor 3 (DcR3) was found to be related to platinum resistance. The major objective of this work was to define the cellular interaction of DcR3 with EOC and to explore its effects on platinum responsiveness. We studied cell lines and primary cultures for the expression of and the cells ability to bind DcR3. Cells were cultured with DcR3 and then exposed to platinum. Cell viability was determined by MTT assay. Finally, the cells molecular response to DcR3 was studied using real time RT-PCR based differential expression arrays, standard RT-PCR, and Western blot. High DcR3 in the peritoneal cavity of women with EOC is associated with significantly shorter time to first recurrence after platinum based therapy (p = 0.02). None-malignant cells contribute DcR3 in the peritoneal cavity. The cell lines studied do not secrete DcR3; however they all bind exogenous DcR3 to their surface implying that they can be effected by DcR3 from other sources. DcR3s protein binding partners are minimally expressed or negative, however, all cells expressed the DcR3 binding Heparan Sulfate Proteoglycans (HSPGs) Syndecans-2, and CD44v3. DcR3 binding was inhibited by heparin and heparinase. After DcR3 exposure both SKOV-3 and OVCAR-3 became more resistant to platinum with 15% more cells surviving at high doses. On the contrary CaOV3 became more sensitive to platinum with 20–25% more cell death. PCR array analysis showed increase expression of BRCA1 mRNA in SKOV-3 and OVCAR-3 and decreased BRCA1 expression in CaOV-3 after exposure to DcR3. This was confirmed by gene specific real time PCR and Western blot analysis. Non-malignant cells contribute to the high levels of DcR3 in ovarian cancer. DcR3 binds readily to EOC cells via HSPGs and alter their responsiveness to platinum chemotherapy. The paradoxical responses seen were related to the expression pattern of

  1. Characterization of the mechanism of action of the genetically modified Cry1AbMod toxin that is active against Cry1Ab-resistant insects. (United States)

    Muñóz-Garay, Carlos; Portugal, Leivi; Pardo-López, Liliana; Jiménez-Juárez, Nuria; Arenas, Ivan; Gómez, Isabel; Sánchez-López, Rosana; Arroyo, Raquel; Holzenburg, Andreas; Savva, Christos G; Soberón, Mario; Bravo, Alejandra


    Bacillus thuringiensis Cry toxins are used in the control of insect pests. They are pore-forming toxins with a complex mechanism that involves the sequential interaction with receptors. They are produced as protoxins, which are activated by midgut proteases. Activated toxin binds to cadherin receptor, inducing an extra cleavage including helix alpha-1, facilitating the formation of a pre-pore oligomer. The toxin oligomer binds to secondary receptors such as aminopeptidase and inserts into lipid rafts forming pores and causing larval death. The primary threat to efficacy of Bt-toxins is the evolution of insect resistance. Engineered Cry1AMod toxins, devoid of helix alpha-1, could be used for the control of resistance in lepidopterans by bypassing the altered cadherin receptor, killing resistant insects affected in this receptor. Here we analyzed the mechanism of action of Cry1AbMod. We found that alkaline pH and the presence of membrane lipids facilitates the oligomerization of Cry1AbMod. In addition, tryptophan fluorescence emission spectra, ELISA binding to pure aminopeptidase receptor, calcein release assay and analysis of ionic-conductance in planar lipid bilayers, indicated that the secondary steps in mode of action that take place after interaction with cadherin receptor such as oligomerization, receptor binding and pore formation are similar in the Cry1AbMod and in the wild type Cry1Ab. Finally, the membrane-associated structure of Cry1AbMod oligomer was analyzed by electron crystallography showing that it forms a complex with a trimeric organization. PMID:19559004

  2. Expression of MyHC and Ca-binding mRNAs and proteins in rats with altered thyroid status

    Czech Academy of Sciences Publication Activity Database

    Vadászová, Adriana; Zachařová, Gisela; Escudero, Astrid; Maláčová, Daniela; Žurmanová, Jitka; Križanová, O.; Soukup, Tomáš

    Praha : UK Praha, 2006. s. 168-168. [Morphology 2006, 43. Mezinár. anatomický kongres a Histochemické symposium. 03.09.2006-06.09.2006, Praha] R&D Projects: GA ČR(CZ) GD305/03/H148; GA ČR(CZ) GA304/05/0327 Institutional research plan: CEZ:AV0Z50110509 Keywords : rat * skeletal muscle * myosin * Ca binding proteins * influence of thyroid hormones Subject RIV: ED - Physiology

  3. Ginkgo biloba extract alters the binding of the sodium [{sup 123}I] iodide (Na{sup 123}I) on blood constituents

    Energy Technology Data Exchange (ETDEWEB)

    Aleixo, Luiz Claudio Martins [Universidade do Estado do Rio de Janeiro, Instituto de Biologia Roberto Alcantara Gomes, Departamento de Biofisica e Biometria, 28 de Setembro, 87, 20551-030, Rio de Janeiro, RJ (Brazil); Comissao Nacional de Energia Nuclear, Instituto de Engenharia Nuclear, Cidade Universitaria, Ilha do Fundao, Via Cinco s/n, 21945-450 Rio de Janeiro (Brazil); Moreno, Silvana Ramos Farias, E-mail: [Departamento de Patologia, Universidade Federal Fluminense, 24030-210, Niteroi, RJ (Brazil); Programa de Pos-Graduacao em Ciencias Medicas, Universidade Federal Fluminense, 24030-210, Niteroi, RJ (Brazil); Freitas, Rosimeire de Souza [Universidade do Estado do Rio de Janeiro, Instituto de Biologia Roberto Alcantara Gomes, Departamento de Biofisica e Biometria, 28 de Setembro, 87, 20551-030, Rio de Janeiro, RJ (Brazil); Thomaz, Helio [Comissao Nacional de Energia Nuclear, Instituto de Engenharia Nuclear, Cidade Universitaria, Ilha do Fundao, Via Cinco s/n, 21945-450 Rio de Janeiro (Brazil); Santos-Filho, Sebastiao David [Universidade do Estado do Rio de Janeiro, Instituto de Biologia Roberto Alcantara Gomes, Departamento de Biofisica e Biometria, 28 de Setembro, 87, 20551-030, Rio de Janeiro, RJ (Brazil)


    We evaluated the in vitro effect of an aqueous extract of Ginkgo biloba (EGb) on the distribution in blood cells (BC) and plasma (P) and on the binding of Na{sup 123}I to the blood constituents using precipitation with trichloroacetic acid. The radioactivity percentages insoluble (SF) and insoluble fraction (IF) of blood constituents were determined. The EGb interfered (p<0.05) on the distribution of Na{sup 123}I in the P (from 69.64 to 86.13) and BC (from 30.36 to 13.87) and altered the fixation of the Na{sup 123}I in IF-P and in IF-BC. - Highlights: Black-Right-Pointing-Pointer Interaction between the Ginkgo biloba and blood constituents radiolabeled. Black-Right-Pointing-Pointer Modification of the binding of sodium iodide (Na{sup 123}I) to the blood constituents. Black-Right-Pointing-Pointer This alteration should have influence in a diagnosis of nuclear medicine.

  4. Gestational treatment with cocaine and fluoxetine alters oxytocin receptor number and binding affinity in lactating rat dams


    Johns, Josephine M.; Lubin, Deborah A.; Walker, Cheryl H.; Joyner, Paul; Middleton, Christopher; Hofler, Vivian; McMurray, Matthew


    Cocaine administered chronically throughout gestation has been correlated with deficits in maternal behavior, increased maternal aggressive behavior and decreased oxytocin levels in rats. In addition to its effects on oxytocin levels, cocaine is a potent serotonergic, dopaminergic and noradrenergic reuptake inhibitor. Alterations in the dopaminergic and serotonergic systems have been suggested as possibly having a role in cocaine-induced maternal aggression. This study was in part, an attempt...

  5. The kinesin-13 KLP10A motor regulates oocyte spindle length and affects EB1 binding without altering microtubule growth rates

    Directory of Open Access Journals (Sweden)

    Kevin K. Do


    Full Text Available Kinesin-13 motors are unusual in that they do not walk along microtubules, but instead diffuse to the ends, where they remove tubulin dimers, regulating microtubule dynamics. Here we show that Drosophila kinesin-13 klp10A regulates oocyte meiosis I spindle length and is haplo-insufficient – KLP10A, reduced by RNAi or a loss-of-function P element insertion mutant, results in elongated and mispositioned oocyte spindles, and abnormal cortical microtubule asters and aggregates. KLP10A knockdown by RNAi does not significantly affect microtubule growth rates in oocyte spindles, but, unexpectedly, EB1 binding and unbinding are slowed, suggesting a previously unobserved role for kinesin-13 in mediating EB1 binding interactions with microtubules. Kinesin-13 may regulate spindle length both by disassembling subunits from microtubule ends and facilitating EB1 binding to plus ends. We also observe an increased number of paused microtubules in klp10A RNAi knockdown spindles, consistent with a reduced frequency of microtubule catastrophes. Overall, our findings indicate that reduced kinesin-13 decreases microtubule disassembly rates and affects EB1 interactions with microtubules, rather than altering microtubule growth rates, causing spindles to elongate and abnormal cortical microtubule asters and aggregates to form.

  6. A Highly Tilted Binding Mode by a Self-Reactive T Cell Receptor Results in Altered Engagement of Peptide and MHC

    Energy Technology Data Exchange (ETDEWEB)

    D Sethi; D Schubert; A Anders; A Heroux; D Bonsor; C Thomas; E Sundberg; J Pyrdol; K Wucherpfennig


    Self-reactive T cells that escape elimination in the thymus can cause autoimmune pathology, and it is therefore important to understand the structural mechanisms of self-antigen recognition. We report the crystal structure of a T cell receptor (TCR) from a patient with relapsing-remitting multiple sclerosis that engages its self-peptide-major histocompatibility complex (pMHC) ligand in an unusual manner. The TCR is bound in a highly tilted orientation that prevents interaction of the TCR-{alpha} chain with the MHC class II {beta} chain helix. In this structure, only a single germline-encoded TCR loop engages the MHC protein, whereas in most other TCR-pMHC structures all four germline-encoded TCR loops bind to the MHC helices. The tilted binding mode also prevents peptide contacts by the short complementarity-determining region (CDR) 3{beta} loop, and interactions that contribute to peptide side chain specificity are focused on the CDR3{alpha} loop. This structure is the first example in which only a single germline-encoded TCR loop contacts the MHC helices. Furthermore, the reduced interaction surface with the peptide may facilitate TCR cross-reactivity. The structural alterations in the trimolecular complex are distinct from previously characterized self-reactive TCRs, indicating that there are multiple unusual ways for self-reactive TCRs to bind their pMHC ligand.

  7. A SAM-dependent methyltransferase cotranscribed with arsenate reductase alters resistance to peptidyl transferase center-binding antibiotics in Azospirillum brasilense Sp7. (United States)

    Singh, Sudhir; Singh, Chhaya; Tripathi, Anil Kumar


    The genome of Azospirillum brasilense harbors a gene encoding S-adenosylmethionine-dependent methyltransferase, which is located downstream of an arsenate reductase gene. Both genes are cotranscribed and translationally coupled. When they were cloned and expressed individually in an arsenate-sensitive strain of Escherichia coli, arsenate reductase conferred tolerance to arsenate; however, methyltransferase failed to do so. Sequence analysis revealed that methyltransferase was more closely related to a PrmB-type N5-glutamine methyltransferase than to the arsenate detoxifying methyltransferase ArsM. Insertional inactivation of prmB gene in A. brasilense resulted in an increased sensitivity to chloramphenicol and resistance to tiamulin and clindamycin, which are known to bind at the peptidyl transferase center (PTC) in the ribosome. These observations suggested that the inability of prmB:km mutant to methylate L3 protein might alter hydrophobicity in the antibiotic-binding pocket of the PTC, which might affect the binding of chloramphenicol, clindamycin, and tiamulin differentially. This is the first report showing the role of PrmB-type N5-glutamine methyltransferases in conferring resistance to tiamulin and clindamycin in any bacterium. PMID:24573606

  8. Formation and Properties of Astrophysical Carbonaceous Dust. I. Ab-initio Calculations of the Configuration and Binding Energies of Small Carbon Clusters (United States)

    Mauney, Christopher; Buongiorno Nardelli, Marco; Lazzati, Davide


    The binding energies of n work of cluster formation and the nucleation rate in a saturated, hydrogen-poor carbon gas. Compared to classical calculations that adopt the capillary approximation, we find that nucleation of carbon clusters is enhanced at low temperatures and depressed at high temperatures. This difference is ascribed to the different behavior of the critical cluster size. We find that the critical cluster size is at n = 27 or n = 8 for a broad range of temperatures and saturations, instead of being a smooth function of such parameters. The results of our calculations can be used to follow carbonaceous cluster/grain formation, stability, and growth in hydrogen-poor environments, such as the inner layers of core-collapse supernovae and supernova remnants.

  9. Acute S-ketamine application does not alter cerebral [18F]altanserin binding: a pilot PET study in humans

    International Nuclear Information System (INIS)

    Modeling short-term psychotic states with subanaesthetic doses of ketamine provides substantial experimental evidence in support of the glutamate hypothesis of schizophrenia. Ketamine exerts its pharmacological effects both directly via interactions with glutamate receptors and indirectly by stimulating presynaptic release of endogenous serotonin (5-HT). The aim of this feasibility study was to examine whether acute ketamine-induced 5-HT release interferes with the binding of the 5-HT2A receptor (5-HT2AR) radioligand [18F]altanserin and positron emission tomography (PET). Two subjects treated with ketamine and one subject treated with placebo underwent [18F]altanserin PET at distribution equilibrium conditions. Robust physiological, psychopathological and cognitive effects were present at ketamine plasma concentrations exceeding 100 μg/l during >70 min. Notwithstanding, we observed stable radioligand binding (changes ±95 % CI of -1.0 ± 1.6 % and +4.1 ± 1.8 % versus -1.2 ± 2.6 %) in large cortical regions presenting high basal uptake of both, [18F]altanserin and ketamine. Marginal decreases of 4 % of radioligand binding were observed in the frontal lobe, and 8 % in a posteriorly specified frontomesial subregion. This finding is not compatible with a specific radioligand displacement from 5-HT2AR which should occur proportionally throughout the whole brain. Instead, the spatial pattern of these minor reductions was congruent with ketamine-induced increases in cerebral blood flow observed in a previous study using [15O]butanol PET. This may caused by accelerated clearance of unspecifically bound [18F]altanserin from cerebral tissue with increased perfusion. In conclusion, this study suggests that [18F]altanserin PET is not sensitive to acute neurotransmitter fluctuations under ketamine. Advantageously, the stability of [18F]altanserin PET towards acute influences is a prerequisite for its future use to detect sub-acute and chronic effects of ketamine. (author)



    Martin, Gregory G.; McIntosh, Avery L.; Huang, Huan; Gupta, Shipra; Atshaves, Barbara P.; Landrock, Kerstin K.; Landrock, Danilo; Kier, Ann B.; Schroeder, Friedhelm


    Although the human L-FABP T94A variant arises from the most commonly occurring SNP in the entire FABP family, there is a complete lack of understanding regarding the role of this polymorphism in human disease. It has been hypothesized that the T94A substitution results in complete loss of ligand binding ability and function analogous to L-FABP gene ablation. This possibility was addressed using recombinant human WT T94T and T94A variant L-FABP and cultured primary human hepatocytes. Non-conse...

  11. Expresion of calcium binding proteins (CaBPs) in skeletal muscles of rats with altered thyroid status

    Czech Academy of Sciences Publication Activity Database

    Escudero, Astrid; Říčný, Jan; Soukup, Tomáš

    Fyziologický ústav AV ČR, v. v. i.. Roč. 56, č. 3 (2007), 8P-8P ISSN 0862-8408. [Fyziologické dny /83./. 06.02.2007-08.02.2007, Brno] R&D Projects: GA ČR(CZ) GA304/05/0327 Grant ostatní: MYORES(XE) 511978 Institutional research plan: CEZ:AV0Z50110509 Keywords : cpr1 * rat muscle phenotype * calcium binding protein * thyroid hormone effects Subject RIV: ED - Physiology

  12. Cyclic glycine-proline regulates IGF-1 homeostasis by altering the binding of IGFBP-3 to IGF-1 (United States)

    Guan, Jian; Gluckman, Peter; Yang, Panzao; Krissansen, Geoff; Sun, Xueying; Zhou, Yongzhi; Wen, Jingyuan; Phillips, Gemma; Shorten, Paul R.; McMahon, Chris D.; Wake, Graeme C.; Chan, Wendy H. K.; Thomas, Mark F.; Ren, April; Moon, Steve; Liu, Dong-Xu


    The homeostasis of insulin-like growth factor-1 (IGF-1) is essential for metabolism, development and survival. Insufficient IGF-1 is associated with poor recovery from wounds whereas excessive IGF-1 contributes to growth of tumours. We have shown that cyclic glycine-proline (cGP), a metabolite of IGF-1, can normalise IGF-1 function by showing its efficacy in improving the recovery from ischemic brain injury in rats and inhibiting the growth of lymphomic tumours in mice. Further investigation in cell culture suggested that cGP promoted the activity of IGF-1 when it was insufficient, but inhibited the activity of IGF-1 when it was excessive. Mathematical modelling revealed that the efficacy of cGP was a modulated IGF-1 effect via changing the binding of IGF-1 to its binding proteins, which dynamically regulates the balance between bioavailable and non-bioavailable IGF-1. Our data reveal a novel mechanism of auto-regulation of IGF-1, which has physiological and pathophysiological consequences and potential pharmacological utility.

  13. Alterations in dendrite and spine morphology of cortical pyramidal neurons in DISC1-binding zinc finger protein (DBZ Knockout mice

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Hattori


    Full Text Available Dendrite and dendritic spine formation are crucial for proper brain function. DISC1-binding zinc finger protein (DBZ was first identified as a Disrupted-In-Schizophrenia1 (DISC1 binding partner. DBZ is highly expressed in the cerebral cortex of developing and adult rodents and is involved in neurite formation, cell positioning, and the development of interneurons and oligodendrocytes. The functional roles of DBZ in postnatal brain remain unknown; thus we investigated cortical pyramidal neuron morphology in DBZ knockout (KO mice. Morphological analyses by Golgi staining alone in DBZ KO mice revealed decreased dendritic arborization, increased spine density. A morphological analysis of the spines revealed markedly increased numbers of thin spines. To investigate whole spine structure in detail, electron tomographic analysis using ultra-high voltage electron microscopy combined with Golgi staining was performed. Tomograms and three-dimensional models of spines revealed that the spines of DBZ KO mice exhibited two types of characteristic morphology, filopodia-like spines and abnormal thin-necked spines having an extremely thin spine neck. Moreover, conventional electron microscopy revealed significantly decreased number of postsynaptic densities (PSDs in spines of DBZ KO mice. In conclusion, DBZ deficiency impairs the morphogenesis of dendrites and spines in cortical pyramidal neurons.

  14. Alterations in dendrite and spine morphology of cortical pyramidal neurons in DISC1-binding zinc finger protein (DBZ) knockout mice. (United States)

    Koyama, Yoshihisa; Hattori, Tsuyoshi; Nishida, Tomoki; Hori, Osamu; Tohyama, Masaya


    Dendrite and dendritic spine formation are crucial for proper brain function. DISC1-binding zinc finger protein (DBZ) was first identified as a Disrupted-In-Schizophrenia1 (DISC1) binding partner. DBZ is highly expressed in the cerebral cortex of developing and adult rodents and is involved in neurite formation, cell positioning, and the development of interneurons and oligodendrocytes. The functional roles of DBZ in postnatal brain remain unknown; thus we investigated cortical pyramidal neuron morphology in DBZ knockout (KO) mice. Morphological analyses by Golgi staining alone in DBZ KO mice revealed decreased dendritic arborization, increased spine density. A morphological analysis of the spines revealed markedly increased numbers of thin spines. To investigate whole spine structure in detail, electron tomographic analysis using ultra-high voltage electron microscopy (UHVEM) combined with Golgi staining was performed. Tomograms and three-dimensional models of spines revealed that the spines of DBZ KO mice exhibited two types of characteristic morphology, filopodia-like spines and abnormal thin-necked spines having an extremely thin spine neck. Moreover, conventional electron microscopy revealed significantly decreased number of postsynaptic densities (PSDs) in spines of DBZ KO mice. In conclusion, DBZ deficiency impairs the morphogenesis of dendrites and spines in cortical pyramidal neurons. PMID:25983680

  15. Cocaine alters mu but not delta or kappa opioid receptor-stimulated in situ [35S]GTPgammaS binding in rat brain. (United States)

    Schroeder, Joseph A; Niculescu, Michelle; Unterwald, Ellen M


    Chronic cocaine administration produces alterations in mu and kappa opioid receptor density as well as striatal and accumbens opioid-regulated adenylyl cyclase activity, suggesting a psychostimulant responsive interaction between opioidergic and dopaminergic systems. Stimulation of G-protein-coupled opioid receptors inhibits adenylyl cyclase production of cyclic AMP. The present study employed in situ [(35)S]GTPgammaS binding to measure opioid receptor-stimulated activation of G-proteins in response to acute and chronic cocaine exposure. Male Fischer rats received acute (1 or 3 days) or chronic (14 days) binge pattern cocaine administration. Three and 14 days of cocaine injections resulted in greater increases in the ability of the mu receptor agonist DAMGO to stimulate [(35)S]GTPgammaS binding in both the core and the shell of the nucleus accumbens, all regions of the caudate putamen and the cingulate cortex compared with saline-matched controls. The greatest increases in DAMGO-stimulated [(35)S]GTPgammaS binding were observed in the dorsal areas of the caudate putamen in animals that received 14 days of cocaine. No significant changes in delta (DPDPE), or kappa (dynorphin A(1-17)) receptor-stimulated [(35)S]GTPgammaS binding were found in any brain region in response to cocaine administration. These results demonstrate that binge pattern cocaine administration induce changes in mu but not delta or kappa opioid receptor-mediated G-protein activity. This study provides support for the hypothesis that the addictive properties of both psychostimulants and opiates may share common neurochemical signaling substrates. PMID:12422370

  16. A Molecular Model for Cocaine Binding by the Immunotherapeutic Human/Mouse Chimeric Monoclonal Antibody 2E2


    Lape, Michael; Paula, Stefan; Ball, William J.


    Immunotherapy by cocaine-binding monoclonal antibodies (mAbs) has emerged as a promising strategy for the treatment of cocaine addiction. The human (γ1 heavy chain)/murine (λ light chain) chimeric mAb 2E2 has excellent affinity and specificity for cocaine and recent animal studies have demonstrated 2E2’s ability in vivo to reduce cocaine levels in the brain as well as alter cocaine self-administration behavior in rats. In this study, we used mAb 2E2 amino acid sequence information to create a...

  17. Excessive gestational weight gain and obesity contribute to altered expression of maternal insulin-like growth factor binding protein-3

    Directory of Open Access Journals (Sweden)

    Ferraro ZM


    Full Text Available Zachary M Ferraro,1 Qing Qiu,2 Andrée Gruslin,3,4 Kristi B Adamo1,3,5 1Healthy Active Living and Obesity Research Group, Children's Hospital of Eastern Ontario Research Institute, Ottawa, ON, Canada; 2The Ottawa Hospital Research Institute, Ottawa, ON, Canada; 3Faculty of Health Sciences, School of Human Kinetics, University of Ottawa, Ottawa, ON, Canada; 4Departments of Obstetrics and Gynecology, Division of Maternal-Fetal Medicine and Cellular and Molecular Medicine, University of Ottawa, Ottawa, ON, Canada; 5Department of Pediatrics, University of Ottawa, Ottawa, ON, Canada Background: Excessive gestational weight gain (GWG increases risk of large for gestational age neonates and subsequent tracking of excess weight throughout the life course for both mother and child. Although the physiological mechanisms underlying these associations are incomplete, the insulin-like growth factor (IGF axis has garnered attention for its role in fetal growth and development. Our purpose was to characterize the IGF axis protein expression patterns in mother–infant dyads in respect of excessive GWG. Methods: We obtained fasting serum samples and corresponding cord blood from eight controls (ADHERE group: ie, those who gained in accordance with 2009 Institute of Medicine GWG recommendations and 13 exceeders (EXCEED group: ie, those who exceeded Institute of Medicine GWG recommendations. At study completion, we examined protein expression of IGF-I, IGF-II, IGF binding protein (IGFBP-1, IGFBP-3, IGFBP-4, and hormone concentrations in both maternal and cord blood. Results: Between-group comparisons were made and revealed elevated maternal leptin (P ≤ 0.05 concentrations in gravidas who exceeded recommendations. There was a significantly higher number of obese women in the EXCEED group (P < 0.05. After adjustment, maternal leptin levels were positively correlated with maternal homeostasis model of assessment for insulin resistance score and excessive GWG (P

  18. A sugar beet chlorophyll a/b binding protein promoter void of G-box like elements confers strong and leaf specific reporter gene expression in transgenic sugar beet

    Directory of Open Access Journals (Sweden)

    Kloos Dorothee U


    Full Text Available Abstract Background Modification of leaf traits in sugar beet requires a strong leaf specific promoter. With such a promoter, expression in taproots can be avoided which may otherwise take away available energy resources for sugar accumulation. Results Suppression Subtractive Hybridization (SSH was utilized to generate an enriched and equalized cDNA library for leaf expressed genes from sugar beet. Fourteen cDNA fragments corresponding to thirteen different genes were isolated. Northern blot analysis indicates the desired tissue specificity of these genes. The promoters for two chlorophyll a/b binding protein genes (Bvcab11 and Bvcab12 were isolated, linked to reporter genes, and transformed into sugar beet using promoter reporter gene fusions. Transient and transgenic analysis indicate that both promoters direct leaf specific gene expression. A bioinformatic analysis revealed that the Bvcab11 promoter is void of G-box like regulatory elements with a palindromic ACGT core sequence. The data indicate that the presence of a G-box element is not a prerequisite for leaf specific and light induced gene expression in sugar beet. Conclusions This work shows that SSH can be successfully employed for the identification and subsequent isolation of tissue specific sugar beet promoters. These promoters are shown to drive strong leaf specific gene expression in transgenic sugar beet. The application of these promoters for expressing resistance improving genes against foliar diseases is discussed.

  19. Maximally localized Wannier functions in LaMnO3 within PBE + U, hybrid functionals and partially self-consistent GW: an efficient route to construct ab initio tight-binding parameters for eg perovskites (United States)

    Franchini, C.; Kováčik, R.; Marsman, M.; Sathyanarayana Murthy, S.; He, J.; Ederer, C.; Kresse, G.


    Using the newly developed VASP2WANNIER90 interface we have constructed maximally localized Wannier functions (MLWFs) for the eg states of the prototypical Jahn-Teller magnetic perovskite LaMnO3 at different levels of approximation for the exchange-correlation kernel. These include conventional density functional theory (DFT) with and without the additional on-site Hubbard U term, hybrid DFT and partially self-consistent GW. By suitably mapping the MLWFs onto an effective eg tight-binding (TB) Hamiltonian we have computed a complete set of TB parameters which should serve as guidance for more elaborate treatments of correlation effects in effective Hamiltonian-based approaches. The method-dependent changes of the calculated TB parameters and their interplay with the electron-electron (el-el) interaction term are discussed and interpreted. We discuss two alternative model parameterizations: one in which the effects of the el-el interaction are implicitly incorporated in the otherwise ‘noninteracting’ TB parameters and a second where we include an explicit mean-field el-el interaction term in the TB Hamiltonian. Both models yield a set of tabulated TB parameters which provide the band dispersion in excellent agreement with the underlying ab initio and MLWF bands.

  20. Maximally localized Wannier functions in LaMnO3 within PBE+U, hybrid functionals, and GW: an efficient route to construct ab-initio tight-binding parameters for eg perovskites (United States)

    Kovacik, Roman; Franchini, Cesare; Marsman, Martijn; Ederer, Claude


    Using the newly developed VASP2WANNIER90 interface we have constructed maximally localized Wannier functions [1] (MLWFs) for the eg states of the prototypical Jahn-Teller magnetic perovskite LaMnO3 at different levels of approximation for the exchange-correlation kernel. These include conventional density functional theory (DFT) with and without additional on-site Hubbard U term, hybrid-DFT, and single shot GW. By suitably mapping the MLWFs onto an effective eg tight-binding (TB) Hamiltonian [2,3] we have computed a complete set of TB parameters providing the band dispersion in excellent agreement with the underlying ab initio and MLWF bands. The method-dependent changes of the TB parameters and their interplay with the electron-electron interaction term are discussed and interpreted, outlining a guidance for more elaborate treatments of correlation effects in effective Hamiltonian-based approaches. [1],.,ouza,,.,arzari,,nd,.,anderbilt,,hys.Rev.B,5,,35109,2001).[2],.,ov'acik,nd,.,derer,,hys.Rev.B,1,,45108,2010).[3],.,ov'acik,nd,.,derer,,hys.Rev.B,4,,75118,2011).

  1. Assessment of IgE and IgG4 Binding Capacities of Cow's Milk Proteins Selectively Altered by Proteases. (United States)

    Charcosset, Alexandre; Adel-Patient, Karine; Dupont, Christophe; Bernard, Hervé


    Specific IgE and IgG4 have been reported to play key roles in the context of IgE-mediated cow's milk allergy (CMA), but the persistence of their epitopes in milk hydrolysates has not been evaluated. Using sera from 32 CMA patients, 6 CMA patients treated by epicutaneous therapy (CM-treated), and 4 CM-tolerant peanut allergic patients, we analyzed the IgE and IgG4 binding capacities related to major milk allergens in processed milk. Different proteases (plasmin, chymosin, α-chymotrypsin, or pepsin) were used progressively and selectively to hydrolyze β-lactoglobulin (β-LG) and casein (CN) in milk. We then showed that proteases differentially affect IgE or IgG4 immunoreactivities of CN and β-LG and also that we could not relate IgE and/or IgG4 levels or specificities to milk hydrolysates to the clinical status of the patients. PMID:27015440

  2. Alterations in chemical shifts and exchange broadening upon peptide boronic acid inhibitor binding to α-lytic protease

    International Nuclear Information System (INIS)

    α-Lytic protease, a bacterial serine protease of 198 aminoacids (19800 Da), has been used as a model system for studies of catalytic mechanism, structure-function relationships, and more recently for studies of pro region-assisted protein folding. We have assigned the backbones of the enzyme alone, and of its complex with the tetrahedral transition state mimic N-tert-butyloxycarbonyl-Ala-Pro-boroVal, using double- and triple-resonance 3D NMR spectroscopy on uniformly15N- and 13C/15N-labeled protein.Changes in backbone chemical shifts between the uncomplexed and inhibited form of the protein are correlated with distance from the inhibitor, the displacement of backbone nitrogens, and change in hydrogen bond strength upon inhibitor binding (derived from previously solved crystal structures).A comparison of the solution secondary structure of the uninhibited enzyme with that of the X-ray structure reveals no significant differences.Significant line broadening, indicating intermediate chemical exchange, was observed in many of the active site amides (including three broadened to invisibility), and in a majority of cases the broadening was reversed upon addition of the inhibitor. Implications and possible mechanisms of this line broadening are discussed

  3. Antisense expression of a gene encoding a calcium-binding protein in transgenic tobacco leads to altered morphology and enhanced chlorophyll

    Indian Academy of Sciences (India)

    Girdhar K Pandey; Amita Pandey; Vanga Siva Reddy; Renu Deswal; Alok Bhattacharya; Kailash C Upadhyaya; Sudhir K Sopory


    Entamoeba histolytica contains a novel calcium-binding protein like calmodulin, which was discovered earlier, and we have reported the presence of its homologue(s) and a dependent protein kinase in plants. To understand the functions of these in plants, a cDNA encoding a calcium-binding protein isolated from Entamoeba histolytica (EhCaBP) was cloned into vector pBI121 in antisense orientation and transgenic tobacco plants were raised. These plants showed variation in several phenotypic characters, of which two distinct features, more greenness and leaf thickness, were inherited in subsequent generations. The increase in the level of total chlorophyll in different plants ranged from 60% to 70%. There was no major change in chloroplast structure and in the protein level of D1, D2, LHCP and RuBP carboxylase. These morphological changes were not seen in antisense calmodulin transgenic tobacco plants, nor was the calmodulin level altered in EhCaBP antisense plants.

  4. Allelic variation in the Depressaria pastinacella CYP6AB3 protein enhances metabolism of plant allelochemicals by altering a proximal surface residue and potential interactions with cytochrome P450 reductase. (United States)

    Mao, Wenfu; Rupasinghe, Sanjeewa G; Zangerl, Arthur R; Berenbaum, May R; Schuler, Mary A


    CYP6AB3v1, a cytochrome P450 monooxygenase in Depressaria pastinacella (parsnip webworm), is highly specialized for metabolizing imperatorin, a toxic furanocoumarin in the apiaceous host plants of this insect. Cloning and heterologous expression of CYP6AB3v2, an allelic variant identified in D. pastinacella, reveals that it metabolizes imperatorin at a rate (V(max) of 10.02 pmol/min/pmol of cytochrome P450 monooxygenase (P450)) significantly higher than CYP6AB3v1 (V(max) of 2.41 pmol/min/pmol) when supplemented with even low levels of cytochrome P450 reductase. Comparisons of the NADPH consumption rates for these variants indicate that CYP6AB3v2 utilizes this electron source at a faster rate than does CYP6AB3v1. Molecular modeling of the five amino acid differences between these variants and their potential interactions with P450 reductase suggests that replacement of Val(92) on the proximal face of CYP6AB3v1 with Ala(92) in CYP6AB3v2 affects interactions with P450 reductase so as to enhance its catalytic activity. Allelic variation at this locus potentially allows D. pastinacella to adapt to both intraspecific and interspecific variation in imperatorin concentrations in its host plants. PMID:17244619

  5. Kalirin Binds the NR2B Subunit of the NMDA Receptor, Altering Its Synaptic Localization and Function

    KAUST Repository

    Kiraly, D. D.


    The ability of dendritic spines to change size and shape rapidly is critical in modulating synaptic strength; these morphological changes are dependent upon rearrangements of the actin cytoskeleton. Kalirin-7 (Kal7), a Rho guanine nucleotide exchange factor localized to the postsynaptic density (PSD), modulates dendritic spine morphology in vitro and in vivo. Kal7 activates Rac and interacts with several PSD proteins, including PSD-95, DISC-1, AF-6, and Arf6. Mice genetically lacking Kal7 (Kal7KO) exhibit deficient hippocampal long-term potentiation (LTP) as well as behavioral abnormalities in models of addiction and learning. Purified PSDs from Kal7KO mice contain diminished levels of NR2B, an NMDA receptor subunit that plays a critical role in LTP induction. Here we demonstrate that Kal7KO animals have decreased levels of NR2B-dependent NMDA receptor currents in cortical pyramidal neurons as well as a specific deficit in cell surface expression of NR2B. Additionally, we demonstrate that the genotypic differences in conditioned place preference and passive avoidance learning seen in Kal7KO mice are abrogated when animals are treated with an NR2B-specific antagonist during conditioning. Finally, we identify a stable interaction between the pleckstrin homology domain of Kal7 and the juxtamembrane region of NR2B preceding its cytosolic C-terminal domain. Binding of NR2B to a protein that modulates the actin cytoskeleton is important, as NMDA receptors require actin integrity for synaptic localization and function. These studies demonstrate a novel and functionally important interaction between the NR2B subunit of the NMDA receptor and Kalirin, proteins known to be essential for normal synaptic plasticity.

  6. Alterations in in-vivo benzodiazepine-receptor binding of C-11-Ro15-1788 (flumazepil)

    International Nuclear Information System (INIS)

    Alterations of the central benzodiazepine - receptor function caused by the change of physiological or psychological conditions, were recognized in both animal and human studies. Before the human study, animal experiments using tritiated Ro15-1788 were carried out. The stress was produced by forcing the mice to swim in a water-basin at 160C for 5 min. Within 3 min after the forced swimming, the tracer was injected. Brain radioactivities in stress-loaded mice increased over a period of 15 min after the intra-venous injection of tracers, while brain activities of carrier-added tracer decreased. In human study, approximately 5 mCi of C-11-Ro15-1788, which specific activity is 0.3-1.0 Ci/μmol, were intravenously injected to each case. Measurements of the brain activity were performed using positron-CT, with blood sample collection. 31 human studies were performed on. Cerebral cortex time activity curves in several volunteers in nervous and stressful state, showed the same pattern to that in the stress-loaded animal experiment. It is important that the significant different time course of cerebral activity after the injection of labelled Ro15-1788, was observed in stressful state, compared with control, in both human and animal study. From these results, it will be concluded the positron CT study using /sup 11/C-Ro15-1788 will become a new technic to detect the change of psychological conditions in human brain and to diagnose some kind of neuropsychiatric disease

  7. A Western Corn Rootworm Cadherin-like Protein is not Involved in the Binding and Toxicity of Cry34/35Ab1 and Cry3Aa Bacillus Thuringiensis Proteins (United States)

    The western corn rootworm (WCR) Diabrotica virgifera virgifera LeConte is an important insect pest of corn. Bacillus thuringiensis (Bt) insecticidal proteins Cry3Aa (as mCry3A) and Cry34Ab1/Cry35Ab1 have been expressed in transgenic corn and are used to control the insect in the U.S. To date, there ...

  8. The GABAA receptor α and β subunits but not the density of muscimol binding sites are altered in the auditory-linguistic association cortex of subjects with schizophrenia

    International Nuclear Information System (INIS)

    Full text: An increase in the density of postsynaptic GABAA receptors has recently been reported in the prefrontal cortex of subjects with schizophrenia. This increase has been hypothesised to represent an up-regulation in response a decrease in the density of GABAergic interneurons. In order to determine whether the GABAA receptor is also altered in the auditory-linguistic association cortex of the schizophrenic brain, we used quantitative autoradiography to measure the density of that receptor in tissue obtained at autopsy from 20 control subjects and 20 subjects with schizophrenia matched for sex and age. The density of GABAA receptors was measured as the difference in the binding of the specific ligand [3H]muscimol (100 nM) in the presence or in the absence of 105 M SR95531. There was no significant difference in the density of [3H]muscimol binding between tissue from schizophrenic (554.9±20,5 fmol/mg TE) and non-schizophrenic (580.1±26.2 fmol/mg TE) subjects. The abundance of the α and β subunits of the GABAA receptor was also measured in particulate membranes prepared from tissue from 6 control and 6 schizophrenic subjects using Western blots. Detection with monoclonal antibodies and chemiluminescence showed that in tissue from control subjects, there was a significant correlation between the levels of α and β subunits (r=0.817, p=0.047). However, there was no such correlation in tissue from schizophrenic subjects (r=0.265, p=0.61), where in 2 subjects large levels of β-subunit were not matched by similar levels of α subunit. These preliminary results suggest mat there may be a failure for up-regulated GABAA receptor subunits to assemble into functional receptors in this brain region for some subjects with schizophrenia. Copyright (1998) Australian Neuroscience Society

  9. An altered gp100 peptide ligand with decreased binding by TCR and CD8alpha dissects T cell cytotoxicity from production of cytokines and activation of NFAT

    Directory of Open Access Journals (Sweden)

    Niels eSchaft


    Full Text Available Altered peptide ligands (APLs provide useful tools to study T cell activation and potentially direct immune responses to improve treatment of cancer patients. To better understand and exploit APLs, we studied the relationship between APLs and T cell function in more detail. Here, we tested a broad panel of gp100(280-288 APLs with respect to T cell cytotoxicity, production of cytokines and activation of Nuclear Factor of Activated T cells (NFAT by human T cells gene-engineered with a gp100-HLA-A2-specific TCRalpha/beta. We demonstrated that gp100-specific cytotoxicity, production of cytokines, and activation of NFAT were not affected by APLs with single amino acid substitutions, except for an APL with an amino acid substitution at position 3 (APL A3, which did not elicit any T cell response. A gp100 peptide with a double amino acid mutation (APL S4S6 elicited T cell cytotoxicity and production of IFNgamma, and to a lesser extent TNFalpha, IL-4, and IL-5, but not production of IL-2 and IL-10, or activation of NFAT. Notably, TCR-mediated functions showed decreases in sensitivities for S4S6 versus gp100 wt peptide, which were minor for cytotoxicity but at least a 1000-fold more prominent for the production of cytokines. TCR-engineered T cells did not bind A3-HLA-A2, but did bind S4S6-HLA-A2 although to a lowered extent compared to wt peptide-HLA-A2. Moreover, S4S6-induced T cell function demonstrated an enhanced dependency on CD8alpha. Taken together, most gp100 APLs functioned as agonists, but A3 and S4S6 peptides acted as a null ligand and partial agonist, respectively. Our results further suggest that TCR-mediated cytotoxicity can be dissected from production of cytokines and activation of NFAT, and that the agonist potential of peptide mutants relates to the extent of binding by TCR and CD8alpha. These findings may facilitate the design of APLs to advance the study of T cell activation and their use for therapeutic applications.

  10. A SNP in the HTT promoter alters NF-κB binding and is a bidirectional genetic modifier of Huntington disease

    DEFF Research Database (Denmark)

    Bečanović, Kristina; Nørremølle, Anne; Neal, Scott J;


    . HTT promoter analysis identified a NF-κB binding site that regulates HTT promoter transcriptional activity. A non-coding SNP, rs13102260:G > A, in this binding site impaired NF-κB binding and reduced HTT transcriptional activity and HTT protein expression. The presence of the rs13102260 minor (A...

  11. Resistance to juvenile hormone and an insect growth regulator in Drosophila is associated with an altered cytosolic juvenile hormone-binding protein

    International Nuclear Information System (INIS)

    The Met mutant of Drosophila melanogaster is highly resistant to juvenile hormone III (JH III) or its chemical analog, methoprene, an insect growth regulator. Five major mechanisms of insecticide resistance were examined in Met and susceptible Met+ flies. These two strains showed only minor differences when penetration, excretion, tissue sequestration, or metabolism of [3H]JH III was measured. In contrast, when we examined JH III binding by a cytosolic binding protein from a JH target tissue, Met strains had a 10-fold lower binding affinity than did Met+ strains. Studies using deficiency-bearing chromosomes provide strong evidence that the Met locus controls the binding protein characteristics and may encode the protein. These studies indicate that resistance in Met flies results from reduced binding affinity of a cytosolic binding protein for JH III

  12. Knock-down of methyl CpG-binding protein 2 (MeCP2 causes alterations in cell proliferation and nuclear lamins expression in mammalian cells

    Directory of Open Access Journals (Sweden)

    Babbio Federica


    Full Text Available Abstract Background MeCP2 (CpG-binding protein 2 is a nuclear multifunctional protein involved in several cellular processes, like large-scale chromatin reorganization and architecture, and transcriptional regulation. In recent years, a non-neuronal role for MeCP2 has emerged in cell growth and proliferation. Mutations in the MeCP2 gene have been reported to determine growth disadvantages in cultured lymphocyte cells, and its functional ablation suppresses cell growth in glial cells and proliferation in mesenchymal stem cells and prostate cancer cells. MeCP2 interacts with lamin B receptor (LBR and with Heterochromatin Protein 1 (HP1 at the nuclear envelope (NE, suggesting that it could be part of complexes involved in attracting heterochromatin at the nuclear periphery and in mediating gene silencing. The nuclear lamins, major components of the lamina, have a role in maintaining NE integrity, in orchestrating mitosis, in DNA replication and transcription, in regulation of mitosis and apoptosis and in providing anchoring sites for chromatin domains. In this work, we inferred that MeCP2 might have a role in nuclear envelope stability, thereby affecting the proliferation pattern of highly proliferating systems. Results By performing knock-down (KD of MeCP2 in normal murine (NIH-3 T3 and in human prostate transformed cells (PC-3 and LNCaP, we observed a strong proliferation decrease and a defect in the cell cycle progression, with accumulation of cells in S/G2M, without triggering a strong apoptotic and senescent phenotype. In these cells, KD of MeCP2 evidenced a considerable decrease of the levels of lamin A, lamin C, lamin B1 and LBR proteins. Moreover, by confocal analysis we confirmed the reduction of lamin A levels, but we also observed an alteration in the shape of the nuclear lamina and an irregular nuclear rim. Conclusions Our results that indicate reduced levels of NE components, are consistent with a hypothesis that the deficiency of Me

  13. Verdivurdering av SAS AB


    Gangås, Silje Garberg


    Formålet med denne mastergradsavhandlingen har vært å beregne den teoretiske verdien på det børsnoterte selskapet SAS AB og på bakgrunn av denne gi en handlingsanbefaling på selskapets aksje. Forskningsspørsmålet for oppgaven er utledet som følger: ”Hva er verdien av SAS AB?” SAS AB er inne i en fundamental omstillingsprosses hvor den nye strategien, 4XNG, ble presentert og påbegynt november 2012. Omstillingsprosessen innebærer blant annet en omfattende omstrukturering i organisasjonen ...

  14. Regional distribution and alterations of lectin binding to colorectal mucin in mucosal biopsies from controls and subjects with inflammatory bowel diseases.


    Jacobs, L R; Huber, P W


    Glycoconjugate composition of colorectal goblet cell mucin was characterized according to the anatomical distribution of lectin-binding sites in mucosal biopsies from 35 control subjects and 55 patients with inflammatory bowel disease. 24 of the controls had mucosal inflammation on biopsy, without clinical evidence of inflammatory bowel disease. These inflamed controls showed a similar rate of presence of lectin-binding sites as the normal noninflamed group. In the controls, the frequency of ...

  15. ABS 415 Course Tutorial / tutorialrank




                     For more course tutorials visit Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational...

  16. Alpha-synuclein gene deletion decreases brain palmitate uptake and alters the palmitate metabolism in the absence of alpha-synuclein palmitate binding

    DEFF Research Database (Denmark)

    Golovko, Mikhail Y; Færgeman, Nils J.; Cole, Nelson B;


    Alpha-synuclein is an abundant protein in the central nervous system that is associated with a number of neurodegenerative disorders, including Parkinson's disease. Its physiological function is poorly understood, although recently it was proposed to function as a fatty acid binding protein. To b....... Thus, alpha-synuclein has effects on 16:0 uptake and metabolism similar to those of an FABP, but unlike FABP, it does not directly bind 16:0; hence, the mechanism underlying these effects is different from that of a classical FABP....



    Huang, Li-shar; Cobessi, David; Tung, Eric Y.; Berry, Edward A.


    Antimycin A (antimycin), one of the first known and most potent inhibitors of the mitochondrial respiratory chain, binds to the quinone reduction site of the cytochrome bc1 complex. Structure-activity-relationship studies have shown that the N-formylamino-salicyl-amide group is responsible for most of the binding specificity, and suggested that a low pKa for the phenolic OH group and an intramolecular H-bond between that OH and the carbonyl O of the salicylamide linkage are important. Tw...

  18. Tobacco plants expressing the Cry1AbMod toxin suppress tolerance to Cry1Ab toxin of Manduca sexta cadherin-silenced larvae. (United States)

    Porta, Helena; Jiménez, Gladys; Cordoba, Elizabeth; León, Patricia; Soberón, Mario; Bravo, Alejandra


    Cry toxins produced by Bacillus thuringiensis bacteria are insecticidal proteins used worldwide in the control of different insect pests. Alterations in toxin-receptor interaction represent the most common mechanism to induce resistance to Cry toxins in lepidopteran insects. Cry toxins bind with high affinity to the cadherin protein present in the midgut cells and this interaction facilitates the proteolytic removal of helix α-1 and pre-pore oligomer formation. Resistance to Cry toxins has been linked with mutations in the cadherin gene. One strategy effective to overcome larval resistance to Cry1A toxins is the production of Cry1AMod toxins that lack helix α-1. Cry1AMod are able to form oligomeric structures without binding to cadherin receptor and were shown to be toxic to cadherin-silenced Manduca sexta larvae and Pectinophora gossypiella strain with resistance linked to mutations in a cadherin gene. We developed Cry1AbMod tobacco transgenic plants to analyze if Cry1AMod toxins can be expressed in transgenic crops, do not affect plant development and are able to control insect pests. Our results show that production of the Cry1AbMod toxin in transgenic plants does not affect plant development, since these plants exhibited healthy growth, produced abundant seeds, and were virtually undistinguishable from control plants. Most importantly, Cry1AbMod protein produced in tobacco plants retains its functional toxic activity against susceptible and tolerant M. sexta larvae due to the silencing of cadherin receptor by RNAi. These results suggest that CryMod toxins could potentially be expressed in other transgenic crops to protect them against both toxin-susceptible and resistant lepidopteran larvae affected in cadherin gene. PMID:21621616

  19. Alterations of retinol-binding protein 4 species in patients with different stages of chronic kidney disease and their relation to lipid parameters

    DEFF Research Database (Denmark)

    Henze, Andrea; Frey, Simone K; Raila, Jens;


    Retinol-binding protein 4 (RBP4) is elevated in patients with chronic kidney disease (CKD) and has been discussed as marker of kidney function. In addition to an elevated concentration, the existence of truncated RBP4 species, RBP4-L (truncated at last C-terminal leucine) and RBP4-LL (truncated a...

  20. Replacement of the C-terminal tetrapeptide (314PAPV317 to 314SSSM317) in interferon regulatory factor-2 alters its N-terminal DNA-binding activity

    Indian Academy of Sciences (India)

    Krishna Prakash; Pramod C Rath


    Interferon regulatory factor-2 (IRF-2) is an important transcription factor involved in cell growth regulation, immune response and cancer. IRF-2 can function as a transcriptional repressor and activator depending on its DNA-binding activity and protein–protein interactions. We compared the amino acid sequences of IRF-2 and found a C-terminal tetrapeptide (314PAPV317) of mouse IRF-2 to be different (314SSSM317) from human IRF-2. Recombinant GST-IRF-2 with 314PAPV317 (wild type) and 314SSSM317 (mutant) expressed in Escherichia coli were assessed for DNA-binding activity with 32P-(GAAAGT)4 by electrophoretic mobility shift assay (EMSA). Wild type- and mutant GST-IRF-2 showed similar expression patterns and immunoreactivities but different DNA-binding activities. Mutant (mt) IRF-2 formed higher-molecular-mass, more and stronger DNA–protein complexes in comparison to wild type (wt) IRF-2. Anti-IRF-2 antibody stabilized the DNA–protein complexes formed by both wt IRF-2 and mt IRF-2, resolving the differences. This suggests that PAPV and SSSM sequences at 314-317 in the C-terminal region of mouse and human IRF-2 contribute to conformation of IRF-2 and influence DNA-binding activity of the N-terminal region, indicating intramolecular interactions. Thus, evolution of IRF-2 from murine to human genome has resulted in subtle differences in C-terminal amino acid motifs, which may contribute to qualitative changes in IRF-2-dependent DNA-binding activity and gene expression.

  1. A Functional Variant at the miR-214 Binding Site in the Methylenetetrahydrofolatereductase Gene Alters Susceptibility to Gastric Cancer in a Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Qiaoyun Chen


    Full Text Available Background and Aims: Single nucleotide polymorphisms in miRNA binding sites, which are located in mRNA 3' untranslated regions (3'-UTRs, were recently found to influence microRNA-target interactions. Specifically, such polymorphisms can modulatebinding affinity or create or destroy miRNA-binding sites; such variants have also been found to be associated with cancer risk. In this study, we explored the effect of a functional variant at the miR-214 binding site in the methylenetetrahydrofolate reductase gene (rs114673809 on gastric cancer (GC risk in a hospital-based case-control study in a Chinese Han population. Methods and Results: We genotyped the rs114673809 polymorphism in 345 gastric cancer patients and 376 cancer-free controls using the polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP technique. The functions of rs114673809 were investigated using a luciferase activity assay and validated by immunoblotting. We found that participants carrying the rs114673809 AA genotype or A allele had a significantly increased risk of gastric cancer (OR = 1.667, 95% CI = 1.044-2.660, P = 0.034; OR = 1.261, 95% CI = 1.017-1.563, P = 0.037, respectively compared to those carrying the GG genotype and G allele. In addition, rs114673809 modified the binding of hsa-miR-214 to MTHFR as well as MTHFR protein levels in gastric cancer patients. Conclusion: Our data suggested that rs114673809, which is located at the miR-214 binding site in the 3'-UTR of MTHFR, may play an important role in the development of gastric cancer in a Chinese Han population.

  2. IgG Conformer's Binding to Amyloidogenic Aggregates.

    Directory of Open Access Journals (Sweden)

    Monichan Phay

    Full Text Available Amyloid-reactive IgGs isolated from pooled blood of normal individuals (pAbs have demonstrated clinical utility for amyloid diseases by in vivo targeting and clearing amyloidogenic proteins and peptides. We now report the following three novel findings on pAb conformer's binding to amyloidogenic aggregates: 1 pAb aggregates have greater activity than monomers (HMW species > dimers > monomers, 2 pAbs interactions with amyloidogenic aggregates at least partially involves unconventional (non-CDR interactions of F(ab regions, and 3 pAb's activity can be easily modulated by trace aggregates generated during sample processing. Specifically, we show that HMW aggregates and dimeric pAbs present in commercial preparations of pAbs, intravenous immunoglobulin (IVIg, had up to ~200- and ~7-fold stronger binding to aggregates of Aβ and transthyretin (TTR than the monomeric antibody. Notably, HMW aggregates were primarily responsible for the enhanced anti-amyloid activities of Aβ- and Cibacron blue-isolated IVIg IgGs. Human pAb conformer's binding to amyloidogenic aggregates was retained in normal human sera, and mimicked by murine pAbs isolated from normal pooled plasmas. An unconventional (non-CDR component to pAb's activity was indicated from control human mAbs, generated against non-amyloid targets, binding to aggregated Aβ and TTR. Similar to pAbs, HMW and dimeric mAb conformers bound stronger than their monomeric forms to amyloidogenic aggregates. However, mAbs had lower maximum binding signals, indicating that pAbs were required to saturate a diverse collection of binding sites. Taken together, our findings strongly support further investigations on the physiological function and clinical utility of the inherent anti-amyloid activities of monomeric but not aggregated IgGs.

  3. Removal of either N-glycan site from the envelope receptor binding domain of Moloney and Friend but not AKV mouse ecotropic gammaretroviruses alters receptor usage

    International Nuclear Information System (INIS)

    Three N-linked glycosylation sites were removed from the envelope glycoproteins of Friend, Moloney, and AKV mouse ecotropic gammaretroviruses: gs1 and gs2, in the receptor binding domain; and gs8, in a region implicated in post-binding cell fusion. Mutants were tested for their ability to infect rodent cells expressing 4 CAT-1 receptor variants. Three mutants (Mo-gs1, Mo-gs2, and Fr-gs1) infect NIH 3T3 and rat XC cells, but are severely restricted in Mus dunni cells and Lec8, a Chinese hamster cell line susceptible to ecotropic virus. This restriction is reproduced in ferret cells expressing M. dunni dCAT-1, but not in cells expressing NIH 3T3 mCAT-1. Virus binding assays, pseudotype assays, and the use of glycosylation inhibitors further suggest that restriction is primarily due to receptor polymorphism and, in M. dunni cells, to glycosylation of cellular proteins. Virus envelope glycan size or type does not affect infectivity. Thus, host range variation due to N-glycan deletion is receptor variant-specific, cell-specific, virus type-specific, and glycan site-specific.

  4. Binding of the Respiratory Chain Inhibitor Antimycin to theMitochondrial bc1 Complex: A New Crystal Structure Reveals an AlteredIntramolecular Hydrogen-Bonding Pattern

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Li-shar; Cobessi, David; Tung, Eric Y.; Berry, Edward A.


    Antimycin A (antimycin), one of the first known and most potent inhibitors of the mitochondrial respiratory chain, binds to the quinone reduction site of the cytochrome bc1 complex.Structure-activity-relationship studies have shown that the N-formylamino-salicyl-amide group is responsible for most of the binding specificity, and suggested that a low pKa for the phenolic OH group and an intramolecular H-bond between that OH and the carbonyl O of the salicylamide linkage are important. Two previous X-ray structures of antimycin bound to vertebrate bc1 complex gave conflicting results. A new structure reported here of the bovine mitochondrial bc1 complex at 2.28Angstrom resolution with antimycin bound, allows us for the first time to reliably describe the binding of antimycin and shows that the intramolecular hydrogen bond described in solution and in the small-molecule structure is replaced by one involving the NH rather than carbonyl O of the amide linkage, with rotation of the amide group relative to the aromatic ring. The phenolic OH and formylamino N form H-bonds with conserved Asp228 of cyt b, and the formylamino O H-bonds via a water molecule to Lys227. A strong density the right size and shape for a diatomic molecule is found between the other side of the dilactone ring and the alpha-A helix.

  5. MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression. (United States)

    Paugh, Steven W; Coss, David R; Bao, Ju; Laudermilk, Lucas T; Grace, Christy R; Ferreira, Antonio M; Waddell, M Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F; Panetta, John C; Wilkinson, Mark R; Pui, Ching-Hon; Naeve, Clayton W; Uberbacher, Edward C; Bonten, Erik J; Evans, William E


    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, ptriplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

  6. MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression.

    Directory of Open Access Journals (Sweden)

    Steven W Paugh


    Full Text Available MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10(-16 for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription.

  7. A functional variant at miR-34a binding site in toll-like receptor 4 gene alters susceptibility to hepatocellular carcinoma in a Chinese Han population. (United States)

    Jiang, Zi-Cheng; Tang, Xian-Mei; Zhao, Ying-Ren; Zheng, Lei


    Toll-like receptor 4 (TLR4) plays a key role in prompting the innate or immediate response. A growing body of evidence suggests that genetic variants of TLR4 gene were associated with the development of cancers. This study aimed to investigate the relationship of a functional variant (rs1057317) at microRNA-34a (miR-34a) binding site in toll-like receptor 4 gene and the risk of hepatocellular carcinoma. A single center-based case-control study was conducted. In this study, the polymerase chain reaction (PCR) and direct sequencing were used to genotype sequence variants of TLR4 in 426 hepatocellular carcinoma cases and 438 controls. The modification of rs1057317 on the binding of hsa-miR-34a to TLR4 messenger RNA (mRNA) was measured by luciferase activity assay. Individuals carrying the AA genotypes for the rs1057317 were associated significantly with increased risk of hepatocellular carcinoma comparing with those carrying wild-type homozygous CC genotypes (adjusted odds ratio [OR] by sex and age, from 1.116 to 2.452, P = 0.013). The activity of the reporter vector was lower in the reporter vector carrying C allele than the reporter vector carrying A allele. Furthermore, the expression of TLR4 was detected in the peripheral blood mononucleated cell of hepatocellular carcinoma (HCC) patients, suggesting that mRNA and protein levels of TLR4 might be associated with SNP rs1057317. Collectively, these results suggested that the risk of hepatocellular carcinoma was associated with a functional variant at miR-34a binding site in toll-like receptor 4 gene. miR-34a/TLR4 axis may play an important role in the development of hepatocellular carcinoma. PMID:25179842

  8. Identification of a 34 kDa protein altered in the LF-1 mutant as the herbicide-binding D1 protein of photosystem II

    International Nuclear Information System (INIS)

    The LF-1 mutant of Scenedesmus has a complete block on the oxidizing side of its PSII reaction center. However, the reaction center as well as the reducing side of PSII is fully functional in this mutant. Compared to the wildtype (WT) the only detected protein difference in the PSII complex of LF-1 is the change in mobility of a 34 kDa protein to 36 kDa. This protein has been implicated to have a major role in Mn-binding and water-oxidation. The authors have recently shown that photoaffinity labeling of thylakoids with azido-[14C]-atrazine tags the 34 kDa protein in WT and the 36 kDa protein in LF-1. It has been shown that the azido-atrazine labeled protein, called D1, functions in herbicide binding and Q/sub A/ to Q/sub B/ electron transfer on the reducing side of PSII. Polyclonal antibodies directed against the D1 protein of Amaranthus hybridus (Ohad, et al., EMBOJ 1985) were found to recognize the Scenedesmus 34 kDa (WT) and 36 kDa (LF-1) proteins. The implied dual function for the D1 protein on the reducing as well as the oxidizing side of PSII reaction center will be discussed

  9. Alterations in benzo(A)pyrene metabolism and in vivo binding to hepatic DNA in rats red diets containing menhaden oil

    Energy Technology Data Exchange (ETDEWEB)

    Wade, A.E.; Dharwadkar, S.


    Polyunsaturated fatty acids of the omega-6 type have been shown to support the mixed function oxidases (MFO) responsible for carcinogen activation and to promote tumorigenesis in laboratory animals. The omega-3 fatty acids contained in menhaden oil (MO) have been shown to enhance MFO activity and increase the binding of Benzo(a)pyrene (B(a)P) metabolites to calf thymus DNA in an in vitro microsomal system. Rats fed two levels of MO (0.5% and 20%) for 11 days received a single i.p. dose of (/sup 3/H)B(a)P (5 m Ci/kg) dissolved in DMSO. At selected time intervals thereafter rats were killed, blood withdrawn, livers removed and DNA extracted. Hepatic microsomes were recovered from control rats on each diet at the time of B(a)P administration to assess MFO activities. Binding of B(a)P to DNA was higher in rats fed the 20% MO diet suggesting an increased rate of B(a)P activation. Blood levels of B(a)P were elevated at 16 and 24 hours post B(a)P, however no differences in urine concentrations were observed. Elevations in concentration of cytochrome P-450, ethoxycoumarin dealkylase, and glutathione S-transferase suggest that omega-3 fatty acids of menhaden fish oil support MFO related reactions not unlike the omega-6 fatty acids.

  10. Analysis of human CD36 gene sequence alterations in the oxidized low-density lipoprotein-binding region using denaturing high-performance liquid chromatography. (United States)

    Rać, Monika Ewa; Suchy, Janina; Kurzawski, Grzegorz; Safranow, Krzysztof; Jakubowska, Katarzyna; Olszewska, Maria; Garanty-Bogacka, Barbara; Rać, Michał; Poncyljusz, Wojciech; Chlubek, Dariusz


    Denaturing high-performance liquid chromatography (DHPLC) has been employed as a prescreening tool to reduce the amount of DNA sequencing. It could be a simple and cost-effective screening method for mutations and polymorphisms in exons 4, 5, and 6 of the CD36 gene, which encode the protein region responsible for the removal of oxidized low-density lipoprotein. Genomic DNA was isolated from 306 Caucasian infants of Polish origin. Six single-nucleotide substitutions were detected by DHPLC and confirmed by direct sequencing. The A591T, G550A, and C572T alterations have not been described so far. Each of two nonsynonymous substitutions (Asp184Asn, Pro191Leu) was found in one subject (0.2% minor allele frequency). The results suggest that nonsynonymous alterations in the analyzed CD36 region are rare in Caucasians. DHPLC is a specific and cost-effective technique that may prove to be particularly useful for the identification of polymorphisms and mutations in the CD36 gene. PMID:20722468

  11. Comparative study of intact A7 MoAb and F(ab')2 fragments for radioimmunoimaging of human colon cancer in nude mice

    International Nuclear Information System (INIS)

    Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab')2 fragments were studied in human colon cancer (LS-174T)-bearing nude mouse. First of all, we examined the yield and the immunoreactivity of F(ab')2 fragments after treatment with ficin as a function of time. The yield of F(ab')2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab')2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab')2 was preferentially taken up by the tumor, was cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. In addition, the tumor image obtained at an early time using 131I-F(ab')2 was much superior in quality to that with intact 131I-A7 MoAb. The use of F(ab')2 fragments may be effective for tumor diagnosis and therapy. (author)

  12. Maximally localized Wannier functions in LaMnO3 within PBE+U, hybrid functionals, and partially self-consistent GW: an efficient route to construct ab-initio tight-binding parameters for e_g perovskites


    Franchini, C.; Kováčik, R; Marsman, M; Sathyanarayana Murthy, S; He, J; Ederer, C.; Kresse, G.


    Using the newly developed VASP2WANNIER90 interface we have constructed maximally localized Wannier functions (MLWFs) for the e_g states of the prototypical Jahn-Teller magnetic perovskite LaMnO3 at different levels of approximation for the exchange-correlation kernel. These include conventional density functional theory (DFT) with and without additional on-site Hubbard U term, hybrid-DFT, and partially self-consistent GW. By suitably mapping the MLWFs onto an effective e_g tight-binding (TB) ...

  13. Effects of altered gravity on the expression of Calcium -binding and matrix proteins in the inner ear of developing fish following ∆g-expositions. (United States)

    Hilbig, Reinhard; Hendrik Anken, Ralf; Weigele, Jochen

    The results of the Foton-M3 mission (OmegaHab) give evidence that the otoliths of the fish form OmegaHab were larger as compared to the ground control. Additionally the shape (raphe) and morphology especially the mode of crystallization of the otoliths were affected during growth in weightlessness. The reason for these changes is assumed to originate from changes in the composition of the otolith matrix and Ca-binding proteins (OMP). The OMPs play an important role in controlling the crystallization process and additionally the morphology of crystals, determining the crystallpolymorph and the strength of the crystals. The matrix of otoliths is a complex functional structure containing several calcium-binding proteins, structural proteins and protease inhibitors. Furthermore it is composed of otolith matrix protein-1, Otolin, Otoconin, SPARC and Neuroserpin, which is a specific expression in the otolth matrix for chichlid fish. During embryonic development of the fish inner ear, these proteins show a spacial and temporal expression pattern. The formation of the inner ear -including otoliths and sensory cells -starting from the otocyst-anlage -can be subdivided in several major developmental stages e.g. the forming of the otic cavity (stage 7/8), the tetha cell or seeding stage (stage 8, 9), the development of the semicircular channels (stage 12), the transition to further daily growth (post stage15) and the development of the third otolith, asteriscus (stage 23). These developmental phases contain different constitutions or involvements of matrix proteins. We investigated the matrixprotein composition of the chichlid fish Oreochromis mossambicus and found that the otolith matrix differentiate between other fishes. In this case some matrix proteins seem to be uniform in fishes, other known matrix proteins are lacking and we have also references to new candidates for matrix proteins chichlids. In this case we investigated the expression of the matrix proteins otolith

  14. Selective translational repression of HIV-1 RNA by Sam68DeltaC occurs by altering PABP1 binding to unspliced viral RNA

    Directory of Open Access Journals (Sweden)

    Soros Vanessa


    Full Text Available Abstract HIV-1 structural proteins are translated from incompletely spliced 9 kb and 4 kb mRNAs, which are transported to the cytoplasm by Crm1. It has been assumed that once in the cytoplasm, translation of incompletely spliced HIV-1 mRNAs occurs in the same manner as host mRNAs. Previous analyses have demonstrated that Sam68 and a mutant thereof, Sam68ΔC, have dramatic effects on HIV gene expression, strongly enhancing and inhibiting viral structural protein synthesis, respectively. While investigating the inhibition of incompletely spliced HIV-1 mRNAs by Sam68ΔC, we determined that the effect was independent of the perinuclear bundling of the viral RNA. Inhibition was dependent upon the nuclear export pathway used, as translation of viral RNA exported via the Tap/CTE export pathway was not blocked by Sam68ΔC. We demonstrate that inhibition of HIV expression by Sam68ΔC is correlated with a loss of PABP1 binding with no attendant change in polyadenosine tail length of the affected RNAs. The capacity of Sam68ΔC to selectively inhibit translation of HIV-1 RNAs exported by Crm1 suggests that it is able to recognize unique characteristics of these viral RNPs, a property that could lead to new therapeutic approaches to controlling HIV-1 replication.

  15. The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves.

    Directory of Open Access Journals (Sweden)

    Rui An

    Full Text Available Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues. We are interested in dissecting these regulatory circuits genetically and report here the isolation of two Arabidopsis dominant mutants, abnormal shoot5-1D (abs5-1D and abs7-1D identified through activation tagging screens. Both abs5-1D and abs7-1D display an intriguing upwardly curly leaf phenotype. Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively. Protoplast transient expression assays confirmed that both ABS5/T5L1 and ABS7/MYB101 are targeted to the nucleus. Interestingly, the expression domains of auxin response reporter DR5::GUS were abnormal in leaves of abs5-1D and ABS5/T5L1 over-expression lines. Moreover, cotyledon venation analysis showed that more areoles and free-ending veins are formed in abs5-1D. We found that the epidermis-specific expressions of ABS5/T5L1 or ABS7/MYB101 driven by the Arabidopsis Meristem Layer 1 promoter (PAtML1 were sufficient to recapitulate the curly leaf phenotype of abs5-1D or abs7-1D. In addition, PAtML1::ABS5 lines exhibited similar changes in DR5::GUS expression patterns as those found in 35S-driven ABS5/T5L1 over-expression lines. Our work demonstrated that enhanced expressions of two transcription factors, ABS5/T5L1 and ABS7/MYB101, are able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis.

  16. The AB Staff Plan

    CERN Document Server

    Boillot, J; Delahaye, J P; Myers, S; CERN. Geneva. AB Department


    The present report summarises the staff plan of the newly created Accelerators and Beams (AB) Division following the restructuring of the Accelerator Sector and covering the period 2003 to 2010. It underlines the refocusing of the staff on priority work, especially the LHC Project and is coherent with the recently adopted CERN Long Term Plan (LTP). It compares the requested and available manpower (both staff and industrial support) for each Project, Programme and Activity (PPA) split in work packages and highlights the missing manpower for each category of personnel.

  17. Integrated multiplex ligation dependent probe amplification (MLPA) assays for the detection of alterations in the HEXB, GM2A and SMARCAL1 genes to support the diagnosis of Morbus Sandhoff, M. Tay-Sachs variant AB and Schimke immuno-osseous dysplasia in humans. (United States)

    Sobek, Anna K U; Evers, Christina; Dekomien, Gabriele


    Multiplex ligation dependent probe amplification (MLPA) assays were designed for the genes HEXB (OMIM: 606873), GM2A (OMIM: 613109) and SMARCAL1 (OMIM: 606622) of humans. Two sets of synthetic MLPA probes for these coding exons were tested. Changes in copy numbers were detected as well as single nucleotide polymorphisms (SNPs) by complementary DNA sequence analyses. The MLPA method was shown to be reliable for mutation detection and identified five published and 12 new mutations. In all cases from a Morbus Sandhoff cohort of patients, exclusively one variation in copy number was observed and linked to a nucleotide alteration called c.1614-14C>A. This deletion comprised exons 1-5. One of these cases is described in detail. Deletions were neither detected in the GM2A nor the SMARCAL1 genes. The MLPA assays complement routine diagnostics for M. Sandhoff (OMIM: 268800), M. Tay-Sachs variant AB (OMIM: 272750) and Schimke immuno-osseous dysplasia (OMIM: 242900). PMID:23010210

  18. Cytokines modulate the sensitivity of human fibroblasts to stimulation with insulin-like growth factor-I (IGF-I) by altering endogenous IGF-binding protein production. (United States)

    Yateman, M E; Claffey, D C; Cwyfan Hughes, S C; Frost, V J; Wass, J A; Holly, J M


    Human dermal fibroblasts produce a number of insulin-like growth factor-binding proteins (IGFBPs) including the main circulating form, IGFBP-3. It has been suggested that the regulation of IGFBP secretion may play a major role in modulating insulin-like growth factor (IGF) bioactivity. We have quantified the effects of two cytokines, transforming growth factor-beta 1 (TGF-beta 1) and tumour necrosis factor-alpha (TNF-alpha) which have opposing actions on fibroblast IGFBP-3 production, and examined their subsequent role in IGF-I mitogenesis. TGF-beta 1 caused a dose-dependent increase in IGFBP-3 in serum-free fibroblast-conditioned media. TGF-beta 1 (1 microgram/l) resulted in immunoreactive IGFBP-3 levels reaching 286.5 +/- 22.4% of control after 20 h, the increase being confirmed by Western ligand blot. TNF-alpha caused a dose-dependent decrease in fibroblast IGFBP-3 secretion, 1 microgram TNF-alpha/l reducing IGFBP-3 levels to 32.1 +/- 11.% of control. This effect was not due to cytotoxicity and was not cell-density-dependent. Fibroblast proliferation was examined using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric cytochemical bioassay. The addition of IGF-I resulted in dose-dependent growth stimulation after 48 h, the effective range being 20-100 micrograms/l. The IGF-I analogue Long-R3-IGF-I which has little affinity for the IGFBPs was approximately 20-fold more potent in this assay, and was unaffected by exogenous IGFBP-3.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7684061

  19. Subchronic treatment with phencyclidine in adolescence leads to impaired exploratory behavior in adult rats without altering social interaction or N-methyl-D-aspartate receptor binding levels. (United States)

    Metaxas, A; Willems, R; Kooijman, E J M; Renjaän, V A; Klein, P J; Windhorst, A D; Donck, L Ver; Leysen, J E; Berckel, B N M van


    Although both the onset of schizophrenia and human phencyclidine (PCP) abuse typically present within the interval from adolescence to early adulthood, the majority of preclinical research employing the PCP model of schizophrenia has been conducted on neonatal or adult animals. The present study was designed to evaluate the behavioral and neurochemical sequelae of subchronic exposure to PCP in adolescence. Male 35-42-day-old Sprague Dawley rats were subcutaneously administered either saline (10 ml · kg(-1) ) or PCP hydrochloride (10 mg · kg(-1) ) once daily for a period of 14 days (n = 6/group). The animals were allowed to withdraw from treatment for 2 weeks, and their social and exploratory behaviors were subsequently assessed in adulthood by using the social interaction test. To examine the effects of adolescent PCP administration on the regulation of N-methyl-D-aspartate receptors (NMDARs), quantitative autoradiography was performed on brain sections of adult, control and PCP-withdrawn rats by using 20 nM (3) H-MK-801. Prior subchronic exposure to PCP in adolescence had no enduring effects on the reciprocal contact and noncontact social behavior of adult rats. Spontaneous rearing in response to the novel testing arena and time spent investigating its walls and floor were reduced in PCP-withdrawn animals compared with control. The long-term behavioral effects of PCP occurred in the absence of persistent deficits in spontaneous locomotion or self-grooming activity and were not mediated by altered NMDAR density. Our results document differential effects of adolescent PCP administration on the social and exploratory behaviors of adult rats, suggesting that distinct neurobiological mechanisms are involved in mediating these behaviors. PMID:24953757

  20. AB Manpower Plan 2007

    CERN Document Server

    Myers, Stephen


    The present exercise is not as such a "manpower plan" but a purely budgetary comparison of known plus requested resources with the known commitments over the period 2007-2012. From a purely budgetary point of view, AB will have the capacity to maintain all those recently hired staff who fulfill the criteria for long term employment at CERN. Following this budgetary exercise, AB proposes to perform a CERN-wide staff work plan so as to compare the manpower available to the quantity of work to be done in the totality of the work-packages. If there is a significant mismatch between these two quantities then we propose the following measures which would create personnel economies and allow us to redress the mismatch by increased recruitment: a new job severance scheme; CERN restructuring; use of the new CERN-ITER agreement; more flexibility in transfers from Materials to Personnel budgets. Failing this a re-examination of possible closure of lower priority facilities may be needed.

  1. Heat Shock Protein 90AB1 and Hyperthermia Rescue Infectivity of HIV with Defective Cores


    Joshi, Pheroze; Sloan, Barbara; Torbett, Bruce E.; Stoddart, Cheryl A.


    We previously showed that reduced infectivity of HIV with incompletely processed capsid-spacer protein 1 (CA-SP1) is rescued by cellular activation or increased expression of HSP90AB1, a member of the cytosolic heat shock protein 90 family. Here we show that HSP90AB1 is present in HIV virions and that HSP90AB1, but not nonfunctional mutated HSP90AB1E42A+D88A, restores infectivity to HIV with mutations in CA that alter core stability. Further, the CA mutants were hypersensitive to pharmacologi...

  2. IFN-gamma and prostaglandin E2 inhibit IL-4-induced expression of Fc epsilon R2/CD23 on B lymphocytes through different mechanisms without altering binding of IL-4 to its receptor

    Energy Technology Data Exchange (ETDEWEB)

    Galizzi, J.P.; Cabrillat, H.; Rousset, F.; Menetrier, C.; de Vries, J.E.; Banchereau, J.


    Human rIL-4 specifically induces the expression of the low affinity receptor for IgE (Fc epsilon R2/CD23) on normal B cells and on the Burkitt lymphoma cell line Jijoye. IL-4 does not induce the generation of the second messenger cAMP in Jijoye cells. PGE2 (at 10(-7) M) was found to inhibit by 50% the IL-4 mediated Fc epsilon R2/CD23 induction on Jijoye cells. The PGE2 half maximum inhibitory concentration (1 nM) was comparable to that inducing a half maximal increase of intracellular cAMP (4nM PGE2). 8-bromo-cAMP (10(-3) M), forskolin (10(-5) M), and cholera toxin (100 ng/ml), which increase intracellular cAMP levels, also inhibited by 40 to 80% the IL-4 induced Fc epsilon R2/CD23 expression on Jijoye cells. PGE2 8-bromo-cAMP, forskolin, and cholera toxin also inhibited the IL-4-induced Fc epsilon R2/CD23 expression on normal B lymphocytes. Taken together these data suggest that PGE2 inhibits the IL-4 induced Fc epsilon R2/CD23 through an increase of intracellular cAMP. In contrast, IFN-gamma, which strongly inhibits IL-4-mediated Fc epsilon R2/CD23 expression on Jijoye cells, did not increase intracellular cAMP levels and thus probably acts through another mechanism. IFN-gamma and PGE2 did not inhibit binding of IL-4 to its receptor. It could be excluded that IFN-gamma and PGE2 were acting via an alteration/desensitization of the IL-4R inasmuch as 24 h pre-incubation of Jijoye cells with these agents affected neither the affinity of 125I-IL-4 for its receptor (Kd = 0.8 to 1.5 x 10(-10) M) nor the maximal number of binding sites per Jijoye cells (Bmax = 390 to 550). Furthermore, IFN-gamma and PGE2 did not affect the internalization and degradation of 125I-IL-4. These data demonstrate that PGE2 and IFN-gamma inhibit the IL-4-mediated induction of Fc epsilon R2/CD23 on B lymphocytes via different mechanisms that do not alter the interaction of IL-4 with its receptor.

  3. Exchanging murine and human immunoglobulin constant chains affects the kinetics and thermodynamics of antigen binding and chimeric antibody autoreactivity.

    Directory of Open Access Journals (Sweden)

    Marcela Torres

    Full Text Available Mouse-human chimeric antibodies composed of murine variable (V and human (C chains are useful therapeutic reagents. Consequently, we investigated whether heterologous C-regions from mice and humans affected specificity and affinity, and determined the contribution of C(H glycosylation to antigen binding. The interaction of a 12-mer peptide mimetic with monoclonal antibody (mAb 18B7 to Cryptococcus neoformans glucuronoxylomannan, and its chimeric (ch and deglycosylated forms were studied by surface plasmon resonance. The equilibrium and rate association constants for the chAb were higher than for mAb 18B7. V region affinity was not affected by C(H region glycosylation whereas heterologous C region of the same isotype altered the Ab binding affinity and the specificity for self-antigens. Structural models displayed local differences that implied changes on the connectivity of residues. These findings suggest that V region conformational changes can be dictated by the C(H domains through an allosteric effect involving networks of highly connected amino acids.

  4. Bruksmakt och maktbruk : Robertsfors AB 1897-1968


    Holmström, Per


    This thesis studies seven strategic decisions made in the family-owned forestry company Robertsfors AB, in Northern Sweden. During the present century Ro­bertsfors AB has developed from a patriarchally concern controlled into a capi­talistic industrial company. This also meant a radical change in the decision­making process. Two factors were decisive in this process: the managing direc­tor's values, and altered power relationships both within the company and exter­nally in relation to e g sta...

  5. ABS 415 ASH Course Tutorial / Tutorialrank




    For more course tutorials visit Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational Techniques ASHFORD ABS 415 Week 3 DQ 2 Leadership in a Cr...

  6. Prediction on Antigenic Epitope Characteristics of Bt Cry2Ab Protein in Transgenic Crops

    Institute of Scientific and Technical Information of China (English)

    Jierong GAO; Ying HE; Zehong ZOU; Ailin TAO; Yuncan AI


    Abstract [Objective] This study aimed to predict the structural characteristics of Bt Cry2Ab protein in transgenic crops with bioinformatic analysis to provide the theoreti- cal clues for design of antibody Cry2Ab. [Method] The amino acid sequence of Cry2Ab protein was searched from NCBI database. The B cell epitopes were pre- dicted with DNAStar. The binding affinity between Cry2Ab protein and MHC-II molecules was analyzed with NetMHCII 2.2 Server to predict the T cell epitopes. [Result] Prediction result suggested the potential B cell epitope of Cry2Ab locating in the region of 208-215. Analysis of the binding affinity between Cry2Ab and MHC-II molecules suggested the regions of 177-185, 299-307 and 255-263 were the po- tential T cell epitopes. Human with HLA-DRB10101 alleles and HLA-DRB10701 al- leles were more sensitive to Cry2Ab protein. [Conclusion] This study facilitates to un- derstand the structural characteristics of Cry2Ab protein and provides a new clue to improve the assessment method for potential allergenicity of genetically modified food.

  7. Ab initio study of neutron drops with chiral Hamiltonians

    Directory of Open Access Journals (Sweden)

    H.D. Potter


    Full Text Available We report ab initio calculations for neutron drops in a 10 MeV external harmonic-oscillator trap using chiral nucleon–nucleon plus three-nucleon interactions. We present total binding energies, internal energies, radii and odd–even energy differences for neutron numbers N=2–18 using the no-core shell model with and without importance truncation. Furthermore, we present total binding energies for N=8,16,20,28,40,50 obtained in a coupled-cluster approach. Comparisons with quantum Monte Carlo results, where available, using Argonne v8′ with three-nucleon interactions reveal important dependences on the chosen Hamiltonian.

  8. Ab initio study of neutron drops with chiral Hamiltonians

    International Nuclear Information System (INIS)

    We report ab initio calculations for neutron drops in a 10 MeV external harmonic-oscillator trap using chiral nucleon–nucleon plus three-nucleon interactions. We present total binding energies, internal energies, radii and odd–even energy differences for neutron numbers N=2–18 using the no-core shell model with and without importance truncation. Furthermore, we present total binding energies for N=8,16,20,28,40,50 obtained in a coupled-cluster approach. Comparisons with quantum Monte Carlo results, where available, using Argonne v8′ with three-nucleon interactions reveal important dependences on the chosen Hamiltonian

  9. Clinical significance of combined detection of multiple serum antibodies (AsAb, EmAb, AcAb, AoAb, ToxAb) in infertile women

    International Nuclear Information System (INIS)

    Objective: To determine the clinical significance of combined detection of multiple serum antibodies in infertile women. Methods; Serum multiple antibodies were examined in 120 infertile women, including 88 failed to get pregnancy and 32 with repeated spontaneous abortion. The antibodies tested were: (1) anti-sperm antibody (AsAb) (2) endometrial antibody (EmAb) (3) anti-cardiophospholipid antibody (AcAb) (4) Anti-ovarian antibody (AoAb) and Toxoplasmosis antibody (ToxAb). Results: In 48 of the infertile women, none of the five antibodies were positive (40% of 120). The rest were: one antibody positive--38/120 or 31.6%; two antibodies positive--31/120 or 25.83%, three and four antibodies positive--4/120 or 3.33%. None of the women were positive with all five antibodies. Conclusion: Immune factor was the chief cause of infertility in women. (authors)

  10. Glycotope sharing between snail hemolymph and larval schistosomes: larval transformation products alter shared glycan patterns of plasma proteins. (United States)

    Yoshino, Timothy P; Wu, Xiao-Jun; Liu, Hongdi; Gonzalez, Laura A; Deelder, André M; Hokke, Cornelis H


    Recent evidence supports the involvement of inducible, highly diverse lectin-like recognition molecules in snail hemocyte-mediated responses to larval Schistosoma mansoni. Because host lectins likely are involved in initial parasite recognition, we sought to identify specific carbohydrate structures (glycans) shared between larval S. mansoni and its host Biomphalaria glabrata to address possible mechanisms of immune avoidance through mimicry of elements associated with the host immunoreactivity. A panel of monoclonal antibodies (mABs) to specific S. mansoni glycans was used to identify the distribution and abundance of shared glycan epitopes (glycotopes) on plasma glycoproteins from B. glabrata strains that differ in their susceptibilities to infection by S. mansoni. In addition, a major aim of this study was to determine if larval transformation products (LTPs) could bind to plasma proteins, and thereby alter the glycotopes exposed on plasma proteins in a snail strain-specific fashion. Plasma fractions ( 100 kDa) from susceptible (NMRI) and resistant (BS-90) snail strains were subjected to SDS-PAGE and immunoblot analyses using mAB to LacdiNAc (LDN), fucosylated LDN variants, Lewis X and trimannosyl core glycans. Results confirmed a high degree of glycan sharing, with NMRI plasma exhibiting a greater distribution/abundance of LDN, F-LDN and F-LDN-F than BS-90 plasma (LTPs significantly altered the reactivity of specific mABs to shared glycotopes on blots, mainly through the binding of LTPs to plasma proteins resulting in either glycotope blocking or increased glycotope attachment to plasma. Many LTP-mediated changes in shared glycans were snail-strain specific, especially those in the 100 kDa fraction. Our data suggest that differential binding of S. mansoni LTPs to plasma proteins of susceptible and resistant B. glabrata strains may significantly impact early anti-larval immune reactivity, and in turn, compatibility, in this parasite-host system. PMID:22448293

  11. Yeast killer toxin-like candidacidal Ab6 antibodies elicited through the manipulation of the idiotypic cascade. (United States)

    Polonelli, Luciano; Beninati, Concetta; Teti, Giuseppe; Felici, Franco; Ciociola, Tecla; Giovati, Laura; Sperindè, Martina; Lo Passo, Carla; Pernice, Ida; Domina, Maria; Arigò, Milena; Papasergi, Salvatore; Mancuso, Giuseppe; Conti, Stefania; Magliani, Walter


    A mouse anti-anti-anti-idiotypic (Id) IgM monoclonal antibody (mAb K20, Ab4), functionally mimicking a Wyckerhamomyces anomalus (Pichia anomala) killer toxin (KT) characterized by fungicidal activity against yeasts presenting specific cell wall receptors (KTR) mainly constituted by β-1,3-glucan, was produced from animals presenting anti-KT Abs (Ab3) following immunization with a rat IgM anti-Id KT-like mAb (mAb K10, Ab2). MAb K10 was produced by immunization with a KT-neutralizing mAb (mAb KT4, Ab1) bearing the internal image of KTR. MAb K20, likewise mAb K10, proved to be fungicidal in vitro against KT-sensitive Candida albicans cells, an activity neutralized by mAb KT4, and was capable of binding to β-1,3-glucan. MAb K20 and mAb K10 competed with each other and with KT for binding to C. albicans KTR. MAb K20 was used to identify peptide mimics of KTR by the selection of phage clones from random peptide phage display libraries. Using this strategy, four peptides (TK 1-4) were selected and used as immunogen in mice in the form of either keyhole limpet hemocyanin (KLH) conjugates or peptide-encoding minigenes. Peptide and DNA immunization could induce serum Abs characterized by candidacidal activity, which was inhibited by laminarin, a soluble β-1,3-glucan, but not by pustulan, a β-1,6-glucan. These findings show that the idiotypic cascade can not only overcome the barrier of animal species but also the nature of immunogens and the type of technology adopted. PMID:25162681

  12. Yeast killer toxin-like candidacidal Ab6 antibodies elicited through the manipulation of the idiotypic cascade.

    Directory of Open Access Journals (Sweden)

    Luciano Polonelli

    Full Text Available A mouse anti-anti-anti-idiotypic (Id IgM monoclonal antibody (mAb K20, Ab4, functionally mimicking a Wyckerhamomyces anomalus (Pichia anomala killer toxin (KT characterized by fungicidal activity against yeasts presenting specific cell wall receptors (KTR mainly constituted by β-1,3-glucan, was produced from animals presenting anti-KT Abs (Ab3 following immunization with a rat IgM anti-Id KT-like mAb (mAb K10, Ab2. MAb K10 was produced by immunization with a KT-neutralizing mAb (mAb KT4, Ab1 bearing the internal image of KTR. MAb K20, likewise mAb K10, proved to be fungicidal in vitro against KT-sensitive Candida albicans cells, an activity neutralized by mAb KT4, and was capable of binding to β-1,3-glucan. MAb K20 and mAb K10 competed with each other and with KT for binding to C. albicans KTR. MAb K20 was used to identify peptide mimics of KTR by the selection of phage clones from random peptide phage display libraries. Using this strategy, four peptides (TK 1-4 were selected and used as immunogen in mice in the form of either keyhole limpet hemocyanin (KLH conjugates or peptide-encoding minigenes. Peptide and DNA immunization could induce serum Abs characterized by candidacidal activity, which was inhibited by laminarin, a soluble β-1,3-glucan, but not by pustulan, a β-1,6-glucan. These findings show that the idiotypic cascade can not only overcome the barrier of animal species but also the nature of immunogens and the type of technology adopted.

  13. Idiotype-anti-idiotype regulation. I. Immunization with a levan-binding myeloma protein leads to the appearance of auto-anti-(anti-idiotype) antibodies and to the activation of silent clones (United States)


    BALB/c mice immunized multiple times with ABPC48 (A48 or Ab1), a BALB/c bacterial levan (BL)-binding myeloma proteins, produce anti-Ab1 antibodies (Ab2). Immunization with only tow doses of AB1 often leads to the production of anti (antiA48) (Ab3) as does immunization with hemocyanin conjugates of Ab2. Finally, immunization with hemocyanin conjugates of Abf3 leads to the production of anti- (anti-[anti-A48]) (Ab4). Normal BALB/c mice immunized with BL produce an anti BL antibody response containing no detectable Ab1 idiotype (Id)-bearing molecules. Mice producing Ab3 express substantial amounts of Ab1 Id in their anti- BL response whereas mice producing Ab2 and Ab4 show a generalized inhibition in their anti BL response. These results indicate that states of immunity within an idiotypic chain may have marked effect on antibody responses to the antigen (i.e., BL) which is the putative initiator of the chain. Strikingly, the chain itself has an interesting feature. That is, Ab3 and Ab1 share a cross-reactive Id in that both are bound by Ab4 and Ab2. We propose a model of Id-anti-Id systems to explain this unexpected result. This is based on the concept of regulatory idiotopes on Ab1 molecules which initiate Ab2 (anti- idiotope) responses. In contrast, Ab2 molecules generally fail to initiate anti-Ab2 Id responses eigher because any individual idiotope is present at very low concentration or because Ab2 molecules tend to lack regulatory idiotopes. Thus, Ab2 molecules immunize syngeneic animals because they interact with cells bearing Ab1 like regulatory idiotopes. Thus, Ab3 will share regulatory idiotopes with Ab1. Ab4 and Ab2 will share the ability to bind the Ab1-like regulatory idiotope. PMID:7252415

  14. Hydrogen adsorption in ZIF-7: A DFT and ab-initio molecular dynamics study (United States)

    Dixit, Mudit; Major, Dan Thomas; Pal, Sourav


    Primary H2 adsorption sites in a zeolitic imidazolate framework, ZIF-7, are identified using ab-initio density functional theory (DFT) based molecular dynamics annealing simulations. The simulations suggest several low energy adsorption sites. The effect of light transition metal decoration on hydrogen storage properties was studied. Our ab-intio DFT calculations illustrate that decorating the ZIF with Sc increases both the number of H2 molecules, as well as the H2 binding energy. The binding energy (∼25 kJ/mol per H2) at 8H2 loading in the pore, suggests that Sc-ZIFs can be potential candidates for hydrogen storage.

  15. Generation of Monoclonal Antibodies against Non-structural Protein 3AB of Foot-and-Mouth Disease Virus

    Institute of Scientific and Technical Information of China (English)

    Tong Lin; Junjun Shao; Huiyun Chang; Shandian Gao; Guozheng Cong; Junzheng Du


    To identify linear epitopes on the non-structural protein 3AB of foot-and-mouth disease virus (FMDV),BABL/c mice were immunized with the 3AB protein and splenocytes of BALB/c mice were fused with myeloma Sp2/0 cells.Two hybridoma monoclonal antibodies (mAbs) cell lines against the 3AB protein of foot-and-mouth disease virus (FMDV) were obtained,named C6 and E7 respectively.The microneutralization titer was 1∶1024 for mAb C6,and 1∶512 for E7.Both mAbs contain kappa light chains,and were of subclass IgG2b.In order to define the mAbs binding epitopes,the reactivity of these mAbs against FMDV were examined by indirect ELISA.The results showed that both mAbs can react with FMDV,but had no cross-reactivity with Swine Vesicular Disease (SVD) antigens.The titers in abdomen liquor were 1∶5×106 for C6 and 1∶2×106 for E7.In conclusion,the mAbs obtained from this study are specific for the detection of FMDV,can be used for etiological and immunological researches on FMDV,and have potential use in diagnosis and future vaccine designs.

  16. Equity valuation : Atlas Copco AB


    Santos, Ricardo Manuel Castro Lopes Alba


    This Dissertation presents a literature review of some of the most appraised theories on equity valuation models. A thoughtful analysis is made, presenting the main advantages and restrictions of each model and setting the path for a discussion about improvements to be made on this field of study. A practical implementation follows, proposing a fair value estimation of Atlas Copco AB shares. Atlas Copco is a Swedish-based capital goods company, operating across four differen...

  17. AB Levitator and Electricity Storage


    Bolonkin, Alexander


    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative...

  18. Thermonuclear Reflect AB-Reactor

    CERN Document Server

    Bolonkin, Alexander


    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  19. AB Levitator and Electricity Storage

    CERN Document Server

    Bolonkin, A


    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative weight ratio of this engine is 0.01 - 0.1 (from thrust). For some types of AB engine (toroidal form) the thrust easily may be changed in any direction without turning of engine. The author computed many projects using different versions of offered AB engine: small device for levitation-flight of a human (including flight from Earth to Outer Space), fly VTOL car (track), big VTOL aircrat, suspended low altitude stationary satellite, powerful Space Shuttle-like booster for travel to the Moon and Mars without spending energ...

  20. The Quantum Nature of Drug-Receptor Interactions: Deuteration Changes Binding Affinities for Histamine Receptor Ligands (United States)

    Repič, Matej; Zakšek, Maja; Kotnik, Kristina; Fijan, Estera; Mavri, Janez


    In this article we report a combined experimental and computational study concerning the effects of deuteration on the binding of histamine and two other histaminergic agonists to 3H-tiotidine-labeled histamine H2 receptor in neonatal rat astrocytes. Binding affinities were measured by displacing radiolabeled tiotidine from H2 receptor binding sites present on cultured neonatal rat astrocytes. Quantum-chemical calculations were performed by employing the empirical quantization of nuclear motion within a cluster model of the receptor binding site extracted from the homology model of the entire H2 receptor. Structure of H2 receptor built by homology modelling is attached in the supporting information (S1 Table) Experiments clearly demonstrate that deuteration affects the binding by increasing the affinity for histamine and reducing it for 2-methylhistamine, while basically leaving it unchanged for 4-methylhistamine. Ab initio quantum-chemical calculations on the cluster system extracted from the homology H2 model along with the implicit quantization of the acidic N–H and O–H bonds demonstrate that these changes in the binding can be rationalized by the altered strength of the hydrogen bonding upon deuteration known as the Ubbelohde effect. Our computational analysis also reveals a new mechanism of histamine binding, which underlines an important role of Tyr250 residue. The present work is, to our best knowledge, the first study of nuclear quantum effects on ligand receptor binding. The ligand H/D substitution is relevant for therapy in the context of perdeuterated and thus more stable drugs that are expected to enter therapeutic practice in the near future. Moreover, presented approach may contribute towards understanding receptor activation, while a distant goal remains in silico discrimination between agonists and antagonists based on the receptor structure. PMID:27159606

  1. High-throughput screening of monoclonal antibodies against plant cell wall glycans by hierarchical clustering of their carbohydrate microarray binding profiles

    DEFF Research Database (Denmark)

    Moller, Isabel; Marcus, Susan E.; Haeger, Ash;


    Antibody-producing hybridoma cell lines were created following immunisation with a crude extract of cell wall polymers from the plant Arabidopsis thaliana. In order to rapidly screen the specificities of individual monoclonal antibodies (mAbs), their binding to microarrays containing 50 cell wall...... investigated using subsequent immunochemical and biochemical analyses and two novel mAbs are described in detail. mAb LM13 binds to an arabinanase-sensitive pectic epitope and mAb LM14, binds to an epitope occurring on arabinogalactan-proteins. Both mAbs display novel patterns of recognition of cell walls in...... plant materials....

  2. Differential screening of phage-ab libraries by oligonucleotide microarray technology.

    Directory of Open Access Journals (Sweden)

    Paolo Monaci

    Full Text Available A novel and efficient tagArray technology was developed that allows rapid identification of antibodies which bind to receptors with a specific expression profile, in the absence of biological information. This method is based on the cloning of a specific, short nucleotide sequence (tag in the phagemid coding for each phage-displayed antibody fragment (phage-Ab present in a library. In order to set up and validate the method we identified about 10,000 different phage-Abs binding to receptors expressed in their native form on the cell surface (10 k Membranome collection and tagged each individual phage-Ab. The frequency of each phage-Ab in a given population can at this point be inferred by measuring the frequency of its associated tag sequence through standard DNA hybridization methods. Using tiny amounts of biological samples we identified phage-Abs binding to receptors preferentially expressed on primary tumor cells rather than on cells obtained from matched normal tissues. These antibodies inhibited cell proliferation in vitro and tumor development in vivo, thus representing therapeutic lead candidates.

  3. Smectite alteration

    International Nuclear Information System (INIS)

    This report contains the proceedings of a second workshop in Washington DC December 8-9, 1983 on the alteration of smectites intended for use as buffer materials in the long-term containment of nuclear wastes. It includes extended summaries of all presentations and a transcript of the detailed scientific discussion. The discussions centered on three main questions: What is the prerequisite for and what is the precise mechanism by which smectite clays may be altered to illite. What are likly sources of potassium with respect to the KBS project. Is it likely that the conversion of smectite to illite will be of importance in the 10 5 to the 10 6 year time frame. The workshop was convened to review considerations and conclusions in connection to these questions and also to broaden the discussion to consider the use of smectite clays as buffer materials for similar applications in different geographical and geological settings. SKBF/KBS technical report 83-03 contains the proceedings from the first workshop on these matters that was held at the State University of New York, Buffalo May 26-27, 1982. (Author)

  4. Heat shock protein 90AB1 and hyperthermia rescue infectivity of HIV with defective cores. (United States)

    Joshi, Pheroze; Sloan, Barbara; Torbett, Bruce E; Stoddart, Cheryl A


    We previously showed that reduced infectivity of HIV with incompletely processed capsid-spacer protein 1 (CA-SP1) is rescued by cellular activation or increased expression of HSP90AB1, a member of the cytosolic heat shock protein 90 family. Here we show that HSP90AB1 is present in HIV virions and that HSP90AB1, but not nonfunctional mutated HSP90AB1(E42A+D88A), restores infectivity to HIV with mutations in CA that alter core stability. Further, the CA mutants were hypersensitive to pharmacological inhibition of HSP90AB1. In agreement with Roesch et al. (2012), we found that culturing HIV at 39.5°C enhanced viral infectivity up to 30-fold in human peripheral blood mononuclear cells (p=0.002) and rescued CA-mutant infectivity in nonactivated cells, concurrent with elevated expression of HSP90AB1 during hyperthermia. In sum, the transdominant effect of HSP90AB1 on CA-mutant HIV infectivity suggests a potential role for this class of cellular chaperones in HIV core stability and uncoating. PMID:23200770

  5. Ab initio study of long-period superstructures in close-packed A3B compounds

    DEFF Research Database (Denmark)

    Rosengaard, N. M.; Skriver, Hans Lomholt


    We have performed ab initio calculations of the stability of one-dimensional long-period superstructures in Cu3Pd, Cu3Al, and Ag3Mg by means of an interface Green's function technique based on the linear-muffin-tin-orbitals method within the tight-binding and atomic-sphere approximations. The...

  6. AP calculus AB/BC

    CERN Document Server

    Schwartz, Stu


    All Access for the AP® Calculus AB & BC Exams Book + Web + Mobile Everything you need to prepare for the Advanced Placement® exam, in a study system built around you! There are many different ways to prepare for an Advanced Placement® exam. What's best for you depends on how much time you have to study and how comfortable you are with the subject matter. To score your highest, you need a system that can be customized to fit you: your schedule, your learning style, and your current level of knowledge. This book, and the free online tools that come with it, will help you personalize your AP® Cal

  7. ABS: Sequence alignment by scanning

    KAUST Repository

    Bonny, Mohamed Talal


    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  8. Binding Procurement (United States)

    Rao, Gopalakrishna M.; Vaidyanathan, Hari


    This viewgraph presentation reviews the use of the binding procurement process in purchasing Aerospace Flight Battery Systems. NASA Engineering and Safety Center (NESC) requested NASA Aerospace Flight Battery Systems Working Group to develop a set of guideline requirements document for Binding Procurement Contracts.

  9. FcRn binding is not sufficient for achieving systemic therapeutic levels of immunoglobulin G after oral delivery of enteric-coated capsules in cynomolgus macaques. (United States)

    Muzammil, Salman; Mabus, John R; Cooper, Philip R; Brezski, Randall J; Bement, Courtney B; Perkinson, Rob; Huebert, Norman D; Thompson, Suzanne; Levine, Dalia; Kliwinski, Connie; Bradley, Dino; Hornby, Pamela J


    Although much speculation has surrounded intestinally expressed FcRn as a means for systemic uptake of orally administered immunoglobulin G (IgG), this has not been validated in translational models beyond neonates or in FcRn-expressing cells in vitro. Recently, IgG1 intestinal infusion acutely in anesthetized cynomolgus resulted in detectable serum monoclonal antibody (mAb) levels. In this study, we show that IgG2 has greater protease resistance to intestinal enzymes in vitro and mice in vivo, due to protease resistance in the hinge region. An IgG2 mAb engineered for FcRn binding, was optimally formulated, lyophilized, and loaded into enteric-coated capsules for oral dosing in cynomolgus. Small intestinal pH 7.5 was selected for enteric delivery based on gastrointestinal pH profiling of cynomolgus by operator-assisted IntelliCap System(®). Milling of the lyophilized IgG2 M428L FcRn-binding variant after formulation in 10 mmol/L histidine, pH 5.7, 8.5% sucrose, 0.04% PS80 did not alter the physicochemical properties nor the molecular integrity compared to the batch released in PBS. Size 3 hard gel capsules (23.2 mg IgG2 M428L ~3 mg/kg) were coated with hydroxypropyl methylcellulose acetate succinate for rapid dissolution at pH 7.5 in small intestine and FcRn binding of encapsulated mAb confirmed. Initial capsule dosing by endoscopic delivery into the small intestine achieved 0.2 + 0.1 ng/mL (n = 5) peak at 24 h. Weekly oral capsule dosing for 6 weeks achieved levels of 0.4 + 0.2 ng/mL and, despite increasing the dose and frequency, remained below 1 ng/mL. In conclusion, lyophilized milled mAb retains FcRn binding and molecular integrity for small intestinal delivery. The low systemic exposure has demonstrated the limitations of intestinal FcRn in non-human primates and the unfeasibility of employing this for therapeutic levels of mAb. Local mAb delivery with limited systemic exposure may be sufficient as a therapeutic for intestinal diseases. PMID

  10. Collagen binding to Staphylococcus aureus

    International Nuclear Information System (INIS)

    Staphylococcus aureus can bind soluble collagen in a specific, saturable manner. We have previously shown that some variability exists in the degree of collagen binding between different strains of heat-killed, formaldehyde-fixed S. aureus which are commercially available as immunologic reagents. The present study demonstrates that live S. aureus of the Cowan 1 strain binds amounts of collagen per organism equivalent to those demonstrated previously in heat-killed, formaldehyde-fixed bacteria but has an affinity over 100 times greater, with Kd values of 9.7 X 10(-11) M and 4.3 X 10(-8) M for live and heat-killed organisms, respectively. Studies were also carried out with S. aureus killed by ionizing radiation, since this method of killing the organism seemed less likely to alter the binding moieties on the surface than did heat killing. Bacteria killed by exposure to gamma radiation bound collagen in a manner essentially indistinguishable from that of live organisms. Binding of collagen to irradiated cells of the Cowan 1 strain was rapid, with equilibrium reached by 30 min at 22 degrees C, and was fully reversible. The binding was not inhibited by fibronectin, fibrinogen, C1q, or immunoglobulin G, suggesting a binding site for collagen distinct from those for these proteins. Collagen binding was virtually eliminated in trypsin-treated organisms, indicating that the binding site has a protein component. Of four strains examined, Cowan 1 and S. aureus ATCC 25923 showed saturable, specific binding, while strains Woods and S4 showed a complete lack of binding. These results suggest that some strains of S. aureus contain high-affinity binding sites for collagen. While the number of binding sites per bacterium varied sixfold in the two collagen-binding strains, the apparent affinity was similar

  11. Skp2B overexpression alters a prohibitin-p53 axis and the transcription of PAPP-A, the protease of insulin-like growth factor binding protein 4.

    Directory of Open Access Journals (Sweden)

    Harish Chander

    Full Text Available BACKGROUND: We previously reported that the degradation of prohibitin by the SCF(Skp2B ubiquitin ligase results in a defect in the activity of p53. We also reported that MMTV-Skp2B transgenic mice develop mammary gland tumors that are characterized by an increased proteolytic cleavage of the insulin-like growth factor binding protein 4 (IGFBP-4, an inhibitor of IGF signaling. However, whether a link exists between a defect in p53 activity and proteolysis of IGFBP-4 was not established. METHODS AND RESULTS: We analyzed the levels of pregnancy-associated plasma protein A (PAPP-A, the protease of IGFBP-4, in MMTV-Skp2B transgenic mice and found that PAPP-A levels are elevated. Further, we found a p53 binding site in intron 1 of the PAPP-A gene and that both wild type and mutant p53 bind to this site. However, binding of wild type p53 results in the transcriptional repression of PAPP-A, while binding of mutant p53 results in the transcriptional activation of PAPP-A. Since MMTV-Skp2B mice express wild type p53 and yet show elevated levels of PAPP-A, at first, these observations appeared contradictory. However, further analysis revealed that the defect in p53 activity in Skp2B overexpressing cells does not only abolish the activity of wild type of p53 but actually mimics that of mutant p53. Our results suggest that in absence of prohibitin, the half-life of p53 is increased and like mutant p53, the conformation of p53 is denatured. CONCLUSIONS: These observations revealed a novel function of prohibitin as a chaperone of p53. Further, they suggest that binding of denatured p53 in intron 1 causes an enhancer effect and increases the transcription of PAPP-A. Therefore, these findings indicate that the defect in p53 function and the increased proteolysis of IGFBP-4, we had observed, represent two components of the same pathway, which contributes to the oncogenic function of Skp2B.

  12. Increased abundance of the adaptor protein containing pleckstrin homology domain, phosphotyrosine binding domain and leucine zipper motif (APPL1) in patients with obesity and type 2 diabetes: evidence for altered adiponectin signalling


    Holmes, R.M.; Yi, Z; De Filippis, E.; Berria, R.; S. Shahani; P. Sathyanarayana; Sherman, V.; K. Fujiwara; Meyer, C.; Christ-Roberts, C.; Hwang, H; Finlayson, J.; Dong, L. Q.; Mandarino, L. J.; Bajaj, M.


    Aims/hypothesis The adiponectin signalling pathway is largely unknown, but recently the adaptor protein containing pleckstrin homology domain, phosphotyrosine binding domain and leucine zipper motif (APPL1), has been shown to interact directly with adiponectin receptor (ADIPOR)1. APPL1 is present in C2C12 myoblasts and mouse skeletal muscle, but its presence in human skeletal muscle has not been investigated. Methods Samples from type 2 diabetic, and lean and non-diabetic obese participants w...

  13. Bacillus thuringiensis delta-endotoxin binding to brush border membrane vesicles of rice stem borers. (United States)

    Alcantara, Edwin P; Aguda, Remedios M; Curtiss, April; Dean, Donald H; Cohen, Michael B


    The receptor binding step in the molecular mode of action of five delta-endotoxins (Cry1Ab, Cry1Ac, Cry1C, Cry2A, and Cry9C) from Bacillus thuringiensis was examined to find toxins with different receptor sites in the midgut of the striped stem borer (SSB) Chilo suppressalis (Walker) and yellow stem borer (YSB) Scirpophaga incertulas (Walker) (Lepidoptera: Pyralidae). Homologous competition assays were used to estimate binding affinities (K(com)) of (125)I-labelled toxins to brush border membrane vesicles (BBMV). The SSB BBMV affinities in decreasing order was: Cry1Ab = Cry1Ac > Cry9C > Cry2A > Cry1C. In YSB, the order of decreasing affinities was: Cry1Ac > Cry1Ab > Cry9C = Cry2A > Cry1C. The number of binding sites (B(max)) estimated by homologous competition binding among the Cry toxins did not affect toxin binding affinity (K(com)) to both insect midgut BBMVs. Results of the heterologous competition binding assays suggest that Cry1Ab and Cry1Ac compete for the same binding sites in SSB and YSB. Other toxins bind with weak (Cry1C, Cry2A) or no affinity (Cry9C) to Cry1Ab and Cry1Ac binding sites in both species. Cry2A had the lowest toxicity to 10-day-old SSB and Cry1Ab and Cry1Ac were the most toxic. Taken together, the results of this study show that Cry1Ab or Cry1Ac could be combined with either Cry1C, Cry2A, or Cry9C for more durable resistance in transgenic rice. Cry1Ab should not be used together with Cry1Ac because a mutation in one receptor site could diminish binding of both toxins. PMID:15027071

  14. A phosphatase activity present in peripheral blood myeloid cells of chronic myelogenous leukemia patients but not normal individuals alters nuclear protein binding to transcriptional enhancers of interferon-inducible genes.


    Seong, D C; Sims, S.; Johnson, E.; Howard, O M; Reiter, B; Hester, J; Talpaz, M; Kantarjian, H; Deisseroth, A


    Cytoplasmic protein from peripheral blood myeloid cells of chronic myelogenous leukemia (CML) patients altered the electrophoretic mobility of complexes formed between nuclear proteins and interferon-inducible transcriptional enhancers. Immature myeloid marrow cells (blasts and promyelocytes) have a higher level of this activity than do mature myeloid marrow cells (bands and polys). This activity, which is not detectable in the peripheral blood cells of normal individuals, is at least 50-fold...

  15. Ab-Initio Molecular Dynamics

    CERN Document Server

    Kühne, Thomas D


    Computer simulations and molecular dynamics in particular, is a very powerful method to provide detailed and essentially exact informations of classical many-body problems. With the advent of \\textit{ab-initio} molecular dynamics, where the forces are computed on-the-fly by accurate electronic structure calculations, the scope of either method has been greatly extended. This new approach, which unifies Newton's and Schr\\"odinger's equations, allows for complex simulations without relying on any adjustable parameter. This review is intended to outline the basic principles as well as a survey of the field. Beginning with the derivation of Born-Oppenheimer molecular dynamics, the Car-Parrinello method as well as novel hybrid scheme that unifies best of either approach are discussed. The predictive power is demonstrated by a series of applications ranging from insulators to semiconductors and even metals in condensed phases.

  16. Novel human anti-claudin 1 mAbs inhibit hepatitis C virus infection and may synergize with anti-SRB1 mAb. (United States)

    Paciello, Rolando; Urbanowicz, Richard A; Riccio, Gennaro; Sasso, Emanuele; McClure, C Patrick; Zambrano, Nicola; Ball, Jonathan K; Cortese, Riccardo; Nicosia, Alfredo; De Lorenzo, Claudia


    Hepatitis C virus (HCV) is a major cause of chronic hepatitis and liver carcinoma and new therapies based on novel targets are needed. The tight junction protein claudin 1 (CLDN-1) is essential for HCV cell entry and spread, and anti-CLDN-1 rat and mouse mAbs are safe and effective in preventing and treating HCV infection in a human liver chimeric mouse model. To accelerate translation of these observations into a novel approach to treat HCV infection and disease in humans, we screened a phage display library of human single-chain antibody fragments by using a panel of CLDN-1-positive and -negative cell lines and identified phage specifically binding to CLDN-1. The 12 clones showing the highest levels of binding were converted into human IgG4. Some of these mAbs displayed low-nanomolar affinity, and inhibited infection of human hepatoma Huh7.5 cells by different HCV isolates in a dose-dependent manner. Cross-competition experiments identified six inhibitory mAbs that recognized distinct epitopes. Combination of the human anti-SRB1 mAb C-1671 with these anti-CLDN-1 mAbs could either increase or reduce inhibition of cell culture-derived HCV infection in vitro. These novel human anti-CLDN-1 mAbs are potentially useful to develop a new strategy for anti-HCV therapy and lend support to the combined use of antibodies targeting the HCV receptors CLDN-1 and SRB1, but indicate that care must be taken in selecting the proper combination. PMID:26519290

  17. Comparative study of intact A7 MoAc and F(ab')2 fragments for radioimmunoimaging of human colon cancer in nude mice

    International Nuclear Information System (INIS)

    Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab)2 fragments were studied in human colon cancer (LS-174T)-bearing nude mice. The authors examined the yield and the immunoreactivity of F(ab)2 fragments after treatment with ficin as a function of time. The yield of F(ab)2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab)2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab')2 was preferentially taken up by the tumor, cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. The tumor image obtained at an early time using 131I-F(ab')2 was much superior in quality to that with intact 131I-A7 MoAb. The use of F(ab')2 fragments may be effective for tumor diagnosis and therapy. (author)

  18. Altered phosphorylation and intracellular distribution of a (CUG)n triplet repeat RNA-binding protein in patients with myotonic dystrophy and in myotonin protein kinase knockout mice


    Roberts, Robert; Timchenko, Nikolaj A.; Miller, Jill W.; Reddy, Sita; Caskey, C. Thomas; Maurice S Swanson; Timchenko, Lubov T.


    Myotonic dystrophy (DM) is associated with expansion of CTG repeats in the 3′-untranslated region of the myotonin protein kinase (DMPK) gene. The molecular mechanism whereby expansion of the (CUG)n repeats in the 3′-untranslated region of DMPK gene induces DM is unknown. We previously isolated a protein with specific binding to CUG repeat sequences (CUG-BP/hNab50) that possibly plays a role in mRNA processing and/or transport. Here we present evidence that the phos...

  19. Impaired synaptic clustering of postsynaptic density proteins and altered signal transmission in hippocampal neurons, and disrupted learning behavior in PDZ1 and PDZ2 ligand binding-deficient PSD-95 knockin mice


    Nagura Hitoshi; Ishikawa Yasuyuki; Kobayashi Katsunori; Takao Keizo; Tanaka Tomo; Nishikawa Kouki; Tamura Hideki; Shiosaka Sadao; Suzuki Hidenori; Miyakawa Tsuyoshi; Fujiyoshi Yoshinori; Doi Tomoko


    Abstract Background Postsynaptic density (PSD)-95-like membrane-associated guanylate kinases (PSD-MAGUKs) are scaffold proteins in PSDs that cluster signaling molecules near NMDA receptors. PSD-MAGUKs share a common domain structure, including three PDZ (PDZ1/2/3) domains in their N-terminus. While multiple domains enable the PSD-MAGUKs to bind various ligands, the contribution of each PDZ domain to synaptic organization and function is not fully understood. Here, we focused on the PDZ1/2 dom...

  20. Theoretical studies of binding of mannose-binding protein to monosaccharides (United States)

    Aida-Hyugaji, Sachiko; Takano, Keiko; Takada, Toshikazu; Hosoya, Haruo; Kojima, Naoya; Mizuochi, Tsuguo; Inoue, Yasushi


    Binding properties of mannose-binding protein (MBP) to monosaccharides are discussed based on ab initio molecular orbital calculations for cluster models constructed. The calculated binding energies indicate that MBP has an affinity for N-acetyl- D-glucosamine, D-mannose, L-fucose, and D-glucose rather than D-galactose and N-acetyl- D-galactosamine, which is consistent with the biochemical experimental results. Electrostatic potential surfaces at the binding site of four monosaccharides having binding properties matched well with that of MBP. A vacant frontier orbital was found to be localized around the binding site of MBP, suggesting that MBP-monosaccharide interaction may occur through electrostatic and orbital interactions.

  1. Ultrasensitive human thyrotropin (h TSH) immunoradiometric assay (IRMA) set up, through identification and minimization of non specific bindings

    International Nuclear Information System (INIS)

    An IRMA of h TSH, based on magnetic solid phase separation, was studied especially for what concerns its non specific bindings. These were identified as a product of the interaction between an altered form of radioiodinated anti-h TSH monoclonal antibody (125 I-m AB) and the uncoupled magnetizable cellulose particle (matrix). Apparently this form of 125 I-m AB is a type of aggregate that can be partly resolved from the main peak on Sephadex G-200 and further minimized via a single pre-incubation with the same matrix. Solid phase saturation with milk proteins, tracer storage at 40 C and serum addition during incubation were also found particularly effective is preventing its formation. These findings were used in order to reproducibly decrease non specific bindings to values 60/BO) up to values of 300-500. This way we obtained h TSH radio assays with functional sensitivities of about 0.05 m IU/L and analytical sensitivities of the order of 0.02 m IU/L, which classify them at least as among the best second generation assays and that are excellent indeed for magnetic IRMA s. A more optimistic sensitivity calculation, based on Rodbard's definition, provided values down to 0.008 m IU/L. Such sensitivities, moreover, were obtained in a very reproducible way and all over the useful tracer life. (author). 83 refs, 13 figs, 25 tabs

  2. GINGA Observations of AB Doradus (United States)

    Vilhu, O.; Tsuru, T.; Collier Cameron, A.

    We report GINGA observations of the pre main sequence star AB Doradus (HD 36705), performed during 8 - 12 January, 1990. Some rotational modulation might be present. four X-ray flares were detected. Three of these events were similar to the EINSTEIN HRI-flare (Vilhu and Linsky, 1987), with decay times around 25 min. The last flare had long rise and decay times (100 min), resembling the EXOSAT flares observed by Collier Cameron (1988). The mean flare spectrum can be fitted by a thermal bremstrahlung with temperature 5.0 keV, or by a power-law model with photon index 2.2. The 3 upper limit of the Iron line equivalent width in the flare spectrum is 1 keV, weaker than predicted by thermal models. This Iron line anomaly was first discussed in the case of UX Ari by Tsuru et. al. (1989). However, normal equivalent widths can be derived from several EXOSAT spectra of active cool stars (Pallavicini and Tagliaferri, 1990). We discuss the possibility that the continuum from non-thermal electrons (producing also the microwave emission) could occasionally lower the apparent equivalent width. The mechanism works for reasonably low magnetic field strengths and electon power-law indexes. However, a large population of non-thermal electrons is needed (comparable to the thermal one). Stronger magnetic fields could explain the radio emission with less electrons, but then the non-thermal X-ray continuum remains small.

  3. A cadherin-like protein influences Bacillus thuringiensis Cry1Ab toxicity in the oriental armyworm, Mythimna separata. (United States)

    Wang, Ling; Jiang, Xingfu; Luo, Lizhi; Stanley, David; Sappington, Thomas W; Zhang, Lei


    Cadherins comprise a family of calcium-dependent cell adhesion proteins that act in cell-cell interactions. Cadherin-like proteins (CADs) in midguts of some insects act as receptors that bind some of the toxins produced by the Bacillus thuringiensis (Bt). We cloned a CAD gene associated with larval midguts prepared from Mythimna separata. The full-length cDNA (MsCAD1, GenBank Accession No. JF951432) is 5642 bp, with an open reading frame encoding a 1757 amino acid and characteristics typical of insect CADs. Expression of MsCAD1 is predominantly in midgut tissue, with highest expression in the 3rd- to 6th-instars and lowest in newly hatched larvae. Knocking-down MsCAD1 decreased Cry1Ab susceptibility, indicated by reduced developmental time, increased larval weight and reduced larval mortality. We expressed MsCAD1 in E. coli and recovered the recombinant protein, rMsCAD1, which binds Cry1Ab toxin. Truncation analysis and binding experiments revealed that a contiguous 209-aa, located in CR11 and CR12, is the minimal Cry1Ab binding region. These results demonstrate that MsCAD1 is associated with Cry1Ab toxicity and is one of the Cry1Ab receptors in this insect. The significance of this work lies in identifying MsCAD1 as a Cry1Ab receptor, which helps understand the mechanism of Cry1Ab toxicity and of potential resistance to Bt in M. separata. PMID:23754724

  4. Alterations of serum concentrations of thyroid hormones and sex hormone-binding globulin, nuclear binding of tri-iodothyronine and thyroid hormone-stimulated cellular uptake of oxygen and glucose in mononuclear blood cells from patients with non-thyroidal illness

    DEFF Research Database (Denmark)

    Kvetny, J; Matzen, L


    Nuclear tri-iodothyronine (T3) binding and thyroid hormone-stimulated oxygen consumption and glucose uptake were examined in mononuclear blood cells from patients with non-thyroidal illness (NTI) in which serum T3 was significantly (P less than 0.05) depressed (0.62 +/- 0.12 (S.D.) nmol/l) compar...

  5. AP calculus AB & BC crash course

    CERN Document Server

    Rosebush, J


    AP Calculus AB & BC Crash Course - Gets You a Higher Advanced Placement Score in Less Time Crash Course is perfect for the time-crunched student, the last-minute studier, or anyone who wants a refresher on the subject. AP Calculus AB & BC Crash Course gives you: Targeted, Focused Review - Study Only What You Need to Know Crash Course is based on an in-depth analysis of the AP Calculus AB & BC course description outline and actual AP test questions. It covers only the information tested on the exams, so you can make the most of your valuable study time. Written by experienced math teachers, our

  6. Ab initio calculations of phosphorus and arsenic clustering parameters for the improvement of process simulation models

    Energy Technology Data Exchange (ETDEWEB)

    Sahli, Beat [Integrated Systems Laboratory, ETH Zurich, Gloriastrasse 35, 8092 Zurich (Switzerland)], E-mail:; Vollenweider, Kilian [Integrated Systems Laboratory, ETH Zurich, Gloriastrasse 35, 8092 Zurich (Switzerland); Zographos, Nikolas; Zechner, Christoph [Synopsys Switzerland LLC, Affolternstrasse 52, 8050 Zurich (Switzerland)


    We present the results of extensive ab initio simulations for phosphorus clusters, arsenic clusters and mixed phosphorus/arsenic clusters in silicon. The specific defects and the parameters that are investigated are selected according to the needs of state-of-the-art diffusion and activation models, taking into account the availability of experimental data, the capabilities of current ab initio methods and the requirements for advanced technology development. The calculated binding energies are used to determine a good starting point for the calibration of a new clustering model implemented in an atomistic process simulator. The defect species V, I, P, PV, PI, As, AsV, AsI and clusters containing up to four dopant atoms and up to one V or I are considered in all relevant charge states. The ab initio results are discussed as well as the challenges arising in the transfer of this information into the process simulation model.

  7. Crystallization of BMP receptor type IA bound to the antibody Fab fragment AbD1556

    International Nuclear Information System (INIS)

    The crystallization of BMP receptor type IA bound to the neutralizing antibody Fab fragment AbD1556 obtained by phage-display selection is reported. An antibody Fab fragment, AbD1556, was selected against the extracellular domain of BMP receptor type IA, which blocks the binding of BMP-2 to BMPR-IA and thereby neutralizes BMP-2 activity. To study the mechanism by which BMPR-IA is recognized and bound by the Fab fragment, the complex of AbD1556 bound to BMPR-IA was prepared and crystallized. Crystals of this binary complex belonged to the monoclinic space group P21, with unit-cell parameters a = 89.32, b = 129.25, c = 100.24 Å, β = 92.27°


    Lifescience Database Archive (English)

    Full Text Available DREDR1ATRD29AB S000152 23-June-2006 (last modified) kehi Related to responsiveness ...dependent in the ABA-responsive expression of the rd29A in Arabidopsis; DRE; drought; water stress; oxidativ

  9. Altered DNA Binding and Amplification of Human Breast Cancer Suppressor Gene BRCA1 Induced by a Novel Antitumor Compound, [Ru(η6-p-phenylethacrynateCl2(pta

    Directory of Open Access Journals (Sweden)

    Adisorn Ratanaphan


    Full Text Available The ruthenium-based complex [Ru(η6-p-phenylethacrynateCl2(pta] (pta = 1,3,5-triaza-7-phosphatricyclo-[]decane, termed ethaRAPTA, is an interesting antitumor compound. The elucidation of the molecular mechanism of drug activity is central to the drug development program. To this end, we have characterized the ethaRAPTA interaction with DNA, including probing the sequence specific modified DNA structural stability and DNA amplification using the breast cancer suppressor gene 1 (BRCA1 of human breast and colon adenocarcinoma cell lines as models. The preference of ethaRAPTA base binding is in the order A > G > T > C. Once modified, the ethaRAPTA-induced BRCA1 structure has higher thermal stability than the modified equivalents of its related compound, RAPTA-C. EthaRAPTA exhibits a higher efficiency than RAPTA-C in inhibiting BRCA1 amplification. With respect to both compounds, the inhibition of BRCA1 amplification is more effective in an isolated system than in cell lines. These data provide evidence that will help to understand the process of elucidating the pathways involved in the response induced by ethaRAPTA.

  10. Alteration in pancreatic immunoreactivity of insulin-like growth factor (IGF)-binding protein (IGFBP)-6 and in intracellular degradation of IGFBP-3 in fibroblasts of IGF-II receptor/IGF-II-deficient mice. (United States)

    Braulke, T; Dittmer, F; Götz, W; von Figura, K


    The Type-2 insulin-like growth factor receptor (IGF2R) mediates the transport of lysosomal hydrolases to lysosomes and the clearance of insulin-like growth factor II (IGF-II). Mutant mice lacking IGF2R usually die perinatally, but are completely rescued from lethality in the absence of IGF-II. IGF2R/IGF-II-deficient mice have elevated levels of circulating IGF binding protein (IGFBP)-3 and show a strong IGFBP-6 immunoreactivity in all pancreatic islet cells and in secretory granules of different size in acinar cells and interlobular connective tissue of exocrine pancreas. Fibroblasts derived from double mutant mice missort the lysosomal protease cathepsin D, and are able to degrade endocytosed (125I)IGFBP-3 intracellularly, however, with lower efficiency than in control cells. These results show that the deficiency of IGF2R and IGF-II affects the expression and metabolism of IGFBPs in a tissue- and cell type-specific manner. PMID:10226807

  11. Ab Initio Studies of Shock-Induced Chemical Reactions of Inter-Metallics (United States)

    Zaharieva, Roussislava; Hanagud, Sathya


    Shock-induced and shock assisted chemical reactions of intermetallic mixtures are studied by many researchers, using both experimental and theoretical techniques. The theoretical studies are primarily at continuum scales. The model frameworks include mixture theories and meso-scale models of grains of porous mixtures. The reaction models vary from equilibrium thermodynamic model to several non-equilibrium thermodynamic models. The shock-effects are primarily studied using appropriate conservation equations and numerical techniques to integrate the equations. All these models require material constants from experiments and estimates of transition states. Thus, the objective of this paper is to present studies based on ab initio techniques. The ab inito studies, to date, use ab inito molecular dynamics. This paper presents a study that uses shock pressures, and associated temperatures as starting variables. Then intermetallic mixtures are modeled as slabs. The required shock stresses are created by straining the lattice. Then, ab initio binding energy calculations are used to examine the stability of the reactions. Binding energies are obtained for different strain components super imposed on uniform compression and finite temperatures. Then, vibrational frequencies and nudge elastic band techniques are used to study reactivity and transition states. Examples include Ni and Al.

  12. Ab initio molecular dynamics with nuclear quantum effects at classical cost: ring polymer contraction for density functional theory

    CERN Document Server

    Marsalek, Ondrej


    Path integral molecular dynamics simulations, combined with an ab initio evaluation of interactions using electronic structure theory, incorporate the quantum mechanical nature of both the electrons and nuclei, which are essential to accurately describe systems containing light nuclei. However, path integral simulations have traditionally required a computational cost around two orders of magnitude greater than treating the nuclei classically, making them prohibitively costly for most applications. Here we show that the cost of path integral simulations can be dramatically reduced by extending our ring polymer contraction approach to ab initio molecular dynamics simulations. By using density functional tight binding as a reference system, we show that our ab initio ring polymer contraction (AI-RPC) scheme gives rapid and systematic convergence to the full path integral density functional theory result. We demonstrate the efficiency of this approach in ab initio simulations of liquid water and the reactive pro...

  13. Ab initio study of antiphase boundaries and stacking faults in L12 and DO22 compounds

    DEFF Research Database (Denmark)

    Rosengaard, N. M.; Skriver, Hans Lomholt


    We have performed ab initio calculations of the energies of antiphase boundaries as well as complex and superlattice intrinsic stacking faults in nine intermetallic compounds observed in the face-centered-cubic L1(2) and DO22 structures. The calculations were performed by means of a Green's funct......'s function technique based on the linear-muffin-tin-orbitals method within the tight-binding and atomic-sphere approximations....

  14. Ab initio theory of galvanomagnetic phenomena in ferromagnetic metals and disordered alloys


    Turek, Ilja; Kudrnovsky, Josef; Drchal, Vaclav


    We present an ab initio theory of transport quantities of metallic ferromagnets developed in the framework of the fully relativistic tight-binding linear muffin-tin orbital method. The approach is based on the Kubo-Streda formula for the conductivity tensor, on the coherent potential approximation for random alloys, and on the concept of interatomic electron transport. The developed formalism is applied to pure 3d transition metals (Fe, Co, Ni) and to random Ni-based ferromagnetic alloys (Ni-...

  15. Pregnane X Receptor Represses HNF4α Gene to Induce Insulin-Like Growth Factor-Binding Protein IGFBP1 that Alters Morphology of and Migrates HepG2 Cells. (United States)

    Kodama, Susumu; Yamazaki, Yuichi; Negishi, Masahiko


    Upon treatment with the pregnane X receptor (PXR) activator rifampicin (RIF), human hepatocellular carcinoma HepG2-derived ShP51 cells that stably express PXR showed epithelial-mesenchymal transition (EMT)-like morphological changes and migration. Our recent DNA microarrays have identified hepatocyte nuclear factor (HNF) 4α and insulin-like growth factor-binding protein (IGFBP) 1 mRNAs to be downregulated and upregulated, respectively, in RIF-treated ShP51 cells, and these regulations were confirmed by the subsequent real-time polymerase chain reaction and Western blot analyses. Using this cell system, we demonstrated here that the PXR-HNF4α-IGFBP1 pathway is an essential signal for PXR-induced morphological changes and migration. First, we characterized the molecular mechanism underlying the PXR-mediated repression of the HNF4α gene. Chromatin conformation capture and chromatin immunoprecipitation (ChIP) assays revealed that PXR activation by RIF disrupted enhancer-promoter communication and prompted deacetylation of histone H3 in the HNF4α P1 promoter. Cell-based reporter and ChIP assays showed that PXR targeted the distal enhancer of the HNF4α P1 promoter and stimulated dissociation of HNF3β from the distal enhancer. Subsequently, small interfering RNA knockdown of HNF4α connected PXR-mediated gene regulation with the PXR-induced cellular responses, showing that the knockdown resulted in the upregulation of IGFBP1 and EMT-like morphological changes without RIF treatment. Moreover, recombinant IGFBP1 augmented migration, whereas an anti-IGFBP1 antibody attenuated both PXR-induced morphological changes and migration in ShP51 cells. PXR indirectly activated the IGFBP1 gene by repressing the HNF4α gene, thus enabling upregulation of IGFBP1 to change the morphology of ShP51 cells and cause migration. These results provide new insights into PXR-mediated cellular responses toward xenobiotics including therapeutics. PMID:26232425

  16. Zooming into the binding groove of HLA molecules : which positions and which substitutions change peptide binding most?

    NARCIS (Netherlands)

    van Deutekom, Hanneke W M; Kesmir, C.


    Human leukocyte antigen (HLA) genes are the most polymorphic genes in the human genome. Almost all polymorphic residues are located in the peptide-binding groove, resulting in different peptide-binding preferences. Whether a single amino acid change can alter the peptide-binding repertoire of an HLA

  17. Regulation of the AcrAB multidrug efflux pump in Salmonella enterica serovar Typhimurium in response to indole and paraquat. (United States)

    Nikaido, Eiji; Shirosaka, Ikue; Yamaguchi, Akihito; Nishino, Kunihiko


    Salmonella enterica serovar Typhimurium has at least nine multidrug efflux pumps. Among these, AcrAB is constitutively expressed and is the most efficient, playing a role in both drug resistance and virulence. The acrAB locus is induced by indole, Escherichia coli-conditioned medium, and bile salts. This induction is dependent on RamA through the binding sequence in the upstream region of acrA that binds RamA. In the present study, we made a detailed investigation of the ramA and acrAB induction mechanisms in Salmonella in response to indole, a biological oxidant for bacteria. We found that acrAB and ramA induction in response to indole is dependent on RamR. However, the cysteine residues of RamR do not play a role in the induction of ramA in response to indole, and the oxidative effect of indole is therefore not related to ramA induction via RamR. Furthermore, we showed that paraquat, a superoxide generator, induces acrAB but not ramA. We further discovered that the mechanism of acrAB induction in response to paraquat is dependent on SoxS. The data indicate that there are at least two independent induction pathways for acrAB in response to extracellular signals such as indole and paraquat. We propose that Salmonella utilizes these regulators for acrAB induction in response to extracellular signals in order to adapt itself to environmental conditions. PMID:21148208

  18. Down regulation of a gene for cadherin, but not alkaline phosphatase, associated with Cry1Ab resistance in the sugarcane borer Diatraea saccharalis.

    Directory of Open Access Journals (Sweden)

    Yunlong Yang

    Full Text Available The sugarcane borer, Diatraea saccharalis, is a major target pest of transgenic corn expressing Bacillus thuringiensis (Bt proteins (i.e., Cry1Ab in South America and the mid-southern region of the United States. Evolution of insecticide resistance in such target pests is a major threat to the durability of transgenic Bt crops. Understanding the pests' resistance mechanisms will facilitate development of effective strategies for delaying or countering resistance. Alterations in expression of cadherin- and alkaline phosphatase (ALP have been associated with Bt resistance in several species of pest insects. In this study, neither the activity nor gene regulation of ALP was associated with Cry1Ab resistance in D. saccharalis. Total ALP enzymatic activity was similar between Cry1Ab-susceptible (Cry1Ab-SS and -resistant (Cry1Ab-RR strains of D. saccharalis. In addition, expression levels of three ALP genes were also similar between Cry1Ab-SS and -RR, and cDNA sequences did not differ between susceptible and resistant larvae. In contrast, altered expression of a midgut cadherin (DsCAD1 was associated with the Cry1Ab resistance. Whereas cDNA sequences of DsCAD1 were identical between the two strains, the transcript abundance of DsCAD1 was significantly lower in Cry1Ab-RR. To verify the involvement of DsCAD1 in susceptibility to Cry1Ab, RNA interference (RNAi was employed to knock-down DsCAD1 expression in the susceptible larvae. Down-regulation of DsCAD1 expression by RNAi was functionally correlated with a decrease in Cry1Ab susceptibility. These results suggest that down-regulation of DsCAD1 is associated with resistance to Cry1Ab in D. saccharalis.

  19. Repeated swim stress alters brain benzodiazepine receptors measured in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Weizman, R.; Weizman, A.; Kook, K.A.; Vocci, F.; Deutsch, S.I.; Paul, S.M.


    The effects of repeated swim stress on brain benzodiazepine receptors were examined in the mouse using both an in vivo and in vitro binding method. Specific in vivo binding of (/sup 3/H)Ro15-1788 to benzodiazepine receptors was decreased in the hippocampus, cerebral cortex, hypothalamus, midbrain and striatum after repeated swim stress (7 consecutive days of daily swim stress) when compared to nonstressed mice. In vivo benzodiazepine receptor binding was unaltered after repeated swim stress in the cerebellum and pons medulla. The stress-induced reduction in in vivo benzodiazepine receptor binding did not appear to be due to altered cerebral blood flow or to an alteration in benzodiazepine metabolism or biodistribution because there was no difference in (14C)iodoantipyrine distribution or whole brain concentrations of clonazepam after repeated swim stress. Saturation binding experiments revealed a change in both apparent maximal binding capacity and affinity after repeated swim stress. Moreover, a reduction in clonazepam's anticonvulsant potency was also observed after repeated swim stress (an increase in the ED50 dose for protection against pentylenetetrazol-induced seizures), although there was no difference in pentylenetetrazol-induced seizure threshold between the two groups. In contrast to the results obtained in vivo, no change in benzodiazepine receptor binding kinetics was observed using the in vitro binding method. These data suggest that environmental stress can alter the binding parameters of the benzodiazepine receptor and that the in vivo and in vitro binding methods can yield substantially different results.

  20. Repeated swim stress alters brain benzodiazepine receptors measured in vivo

    International Nuclear Information System (INIS)

    The effects of repeated swim stress on brain benzodiazepine receptors were examined in the mouse using both an in vivo and in vitro binding method. Specific in vivo binding of [3H]Ro15-1788 to benzodiazepine receptors was decreased in the hippocampus, cerebral cortex, hypothalamus, midbrain and striatum after repeated swim stress (7 consecutive days of daily swim stress) when compared to nonstressed mice. In vivo benzodiazepine receptor binding was unaltered after repeated swim stress in the cerebellum and pons medulla. The stress-induced reduction in in vivo benzodiazepine receptor binding did not appear to be due to altered cerebral blood flow or to an alteration in benzodiazepine metabolism or biodistribution because there was no difference in [14C]iodoantipyrine distribution or whole brain concentrations of clonazepam after repeated swim stress. Saturation binding experiments revealed a change in both apparent maximal binding capacity and affinity after repeated swim stress. Moreover, a reduction in clonazepam's anticonvulsant potency was also observed after repeated swim stress [an increase in the ED50 dose for protection against pentylenetetrazol-induced seizures], although there was no difference in pentylenetetrazol-induced seizure threshold between the two groups. In contrast to the results obtained in vivo, no change in benzodiazepine receptor binding kinetics was observed using the in vitro binding method. These data suggest that environmental stress can alter the binding parameters of the benzodiazepine receptor and that the in vivo and in vitro binding methods can yield substantially different results

  1. GMP-140 binds to a glycoprotein receptor on human neutrophils: Evidence for a lectin-like interaction

    International Nuclear Information System (INIS)

    GMP-140 is a rapidly inducible receptor for neutrophils and monocytes expressed on activated platelets and endothelial cells. It is a member of the selectin family of lectin-like cell surface molecules that mediate leukocyte adhesion. We used a radioligand binding assay to characterize the interaction of purified GMP-140 with human neutrophils. Unstimulated neutrophils rapidly bound [125I]GMP-140 at 4 degrees C, reaching equilibrium in 10-15 min. Binding was Ca2+ dependent, reversible, and saturable at 3-6 nM free GMP-140 with half-maximal binding at approximately 1.5 nM. Receptor density and apparent affinity were not altered when neutrophils were stimulated with 4 beta-phorbol 12-myristate 13-acetate. Treatment of neutrophils with proteases abolished specific binding of [125I]GMP-140. Binding was also diminished when neutrophils were treated with neuraminidase from Vibrio cholerae, which cleaves alpha 2-3-, alpha 2-6-, and alpha 2-8-linked sialic acids, or from Newcastle disease virus, which cleaves only alpha 2-3- and alpha 2-8-linked sialic acids. Binding was not inhibited by an mAb to the abundant myeloid oligosaccharide, Lex (CD15), or by the neoglycoproteins Lex-BSA and sialyl-Lex-BSA. We conclude that neutrophils constitutively express a glycoprotein receptor for GMP-140, which contains sialic acid residues that are essential for function. These findings support the concept that GMP-140 interacts with leukocytes by a lectin-like mechanism

  2. Structural Constraints of Vaccine-Induced Tier-2 Autologous HIV Neutralizing Antibodies Targeting the Receptor-Binding Site

    Directory of Open Access Journals (Sweden)

    Todd Bradley


    Full Text Available Antibodies that neutralize autologous transmitted/founder (TF HIV occur in most HIV-infected individuals and can evolve to neutralization breadth. Autologous neutralizing antibodies (nAbs against neutralization-resistant (Tier-2 viruses are rarely induced by vaccination. Whereas broadly neutralizing antibody (bnAb-HIV-Envelope structures have been defined, the structures of autologous nAbs have not. Here, we show that immunization with TF mutant Envs gp140 oligomers induced high-titer, V5-dependent plasma neutralization for a Tier-2 autologous TF evolved mutant virus. Structural analysis of autologous nAb DH427 revealed binding to V5, demonstrating the source of narrow nAb specificity and explaining the failure to acquire breadth. Thus, oligomeric TF Envs can elicit autologous nAbs to Tier-2 HIVs, but induction of bnAbs will require targeting of precursors of B cell lineages that can mature to heterologous neutralization.

  3. Ab initio valence calculations in chemistry

    CERN Document Server

    Cook, D B


    Ab Initio Valence Calculations in Chemistry describes the theory and practice of ab initio valence calculations in chemistry and applies the ideas to a specific example, linear BeH2. Topics covered include the Schrödinger equation and the orbital approximation to atomic orbitals; molecular orbital and valence bond methods; practical molecular wave functions; and molecular integrals. Open shell systems, molecular symmetry, and localized descriptions of electronic structure are also discussed. This book is comprised of 13 chapters and begins by introducing the reader to the use of the Schrödinge

  4. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    Energy Technology Data Exchange (ETDEWEB)

    Souto, F.J.; Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Kmetyk, L.N. [Sandia National Labs., Albuquerque, NM (United States)


    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS.

  5. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    International Nuclear Information System (INIS)

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS

  6. An efficient magnetic tight-binding method for transition metals and alloys

    DEFF Research Database (Denmark)

    Barreteau, Cyrille; Spanjaard, Daniel; Desjonquères, Marie-Catherine

    An efficient parameterized self-consistent tight-binding model for transition metals using s, p and d valence atomic orbitals as a basis set is presented. The parameters of our tight-binding model for pure elements are determined from a fit to bulk ab-initio calculations. A very simple procedure ...... magneto-crystalline anisotropy. Several examples are discussed....

  7. Improved age constraints for the AB Dor quadruple system - The binary nature of AB Dor B

    CERN Document Server

    Janson, M; Lenzen, R; Close, L; Nielsen, E; Hartung, M; Henning, T; Bouy, H; Janson, Markus; Brandner, Wolfgang; Lenzen, Rainer; Close, Laird; Nielsen, Eric; Hartung, Markus; Henning, Thomas; Bouy, Herve


    We present resolved NACO photometry of the close binary AB Dor B in H- and Ks-band. AB Dor B is itself known to be a wide binary companion to AB Dor A, which in turn has a very low-mass close companion named AB Dor C. These four known components make up the young and dynamically interesting system AB Dor, which will likely become a benchmark system for calibrating theoretical pre-main sequence evolutionary mass tracks for low-mass stars. However, for this purpose the actual age has to be known, and this subject has been a matter of discussion in the recent scientific literature. We compare our resolved photometry of AB Dor Ba and Bb with theoretical and empirical isochrones in order to constrain the age of the system. This leads to an age estimate of about 50 to 100 Myr. We discuss the implications of such an age range for the case of AB Dor C, and compare with other results in the literature.

  8. Anti-interleukin-1 alpha autoantibodies in humans: Characterization, isotype distribution, and receptor-binding inhibition--higher frequency in Schnitzler's syndrome (urticaria and macroglobulinemia)

    International Nuclear Information System (INIS)

    Since autoantibodies (Abs) to cytokines may modify their biologic activities, high-affinity binding factors for interleukin-1 alpha (IL-1 alpha BF) were characterized in human sera. IL-1 alpha BF was identified as IgG (1) by sucrose density-gradient centrifugation followed by immunodiffusion autoradiography, (2) by ligand-blotting method, (3) by ligand binding to affinity-immobilized serum IgG, and (4) by IgG affinity purification followed by sucrose density-gradient centrifugation. IL-1 alpha binding activity resided in the F(ab)2 fragment. The apparent equilibrium constant was in the range of IgG found after immunization with conventional antigens (i.e., 10(-9) to 10(-10) mol/L). Anti-IL-1 alpha IgG auto-Abs represented only an extremely small fraction of total IgG (less than 1/10(-5)). Some sera with IL-1 alpha BF and purified IgG thereof were able to inhibit by 96% to 98% the binding of human recombinant IL-1 alpha to its receptor on murine thymoma EL4-6.1 cells, whereas other sera did not. When 125I-labeled anti-IL-1 alpha IgG complexes were injected into rats, they prolonged the plasma half-life of 125I-labeled IL-1 alpha several fold and altered its tissue distribution. The predominant class was IgG (12/19), mainly IgG4 (9/19), but in five of the sera, anti-IL-1 alpha IgA was also detected. In a screening of 271 sera, IL-1 alpha BF was detected in 17/98 normal subjects and was not more frequent in several control groups of patients, except in patients with Schnitzler's syndrome (fever, chronic urticaria, bone pain, and monoclonal IgM paraprotein) (6/9; p less than 0.005). The pathologic significance of these auto-Abs remains to be determined

  9. Characterization of Asia 1 sdAb from Camels Bactrianus (C. bactrianus) and Conjugation with Quantum Dots for Imaging FMDV in BHK-21 Cells


    Shuanghui Yin; Shunli Yang; Youjun Shang; Shiqi Sun; Guangqing Zhou; Ye Jin; Hong Tian; Jinyan Wu; Xiangtao Liu


    Foot-and-mouth disease (FMD), caused by FMD virus (FMDV), is a highly contagious viral disease affecting cloven-hoofed animals. Camelids have a unique immunoglobulin profile, with the smallest functional heavy-chain antibodies (sdAb or VHH) naturally devoid of light chains with antigen-binding capacity. We screened and characterized five sdAbs against FMDV by immunized library from C. bactrianus with Asia 1 virus-like particles (VLPs). Three of five recombinant sdAbs were stably expressed in ...

  10. Biological activities of binding site specific monoclonal antibodies to prolactin receptors of rabbit mammary gland

    International Nuclear Information System (INIS)

    The biological activity of three monoclonal antibodies (mAbs) against the rabbit mammary prolactin (PRL) receptor (M110, A82, and A917) were investigated using explants of rabbit mammary gland. The three mAbs which were all able to inhibit the binding of 125I-ovine prolactin to its receptor had different biological activities. Two mAbs (M110 and A82) were able to prevent the stimulating effect of PRL on casein synthesis when the molar ratio between the mAb and PRL was 100. One mAb (A917) was able to mimic the action of PRL on both casein and DNA ([3H]thymidine incorporation) synthesis, whereas the other two mAbs were without any stimulatory effect. For this stimulatory effect to be observed, bivalency of the antibody was essential, since monovalent fragments, which were able to inhibit PRL binding, had no agonistic activity. The ability of the mAbs to induce a down-regulation of receptors was also studied. These studies suggest that the binding domain of the receptor might be relatively complex, since only a part of this domain recognized by the antibody with PRL-like activity was able to induce hormonal action. Alternatively, only those antibodies able to microaggregate the receptors may possess PRL-like activity

  11. Ab interno trabeculectomy: A comprehensive review

    Directory of Open Access Journals (Sweden)

    Ting Ting Liu


    Full Text Available PURPOSE To summarize the original literature on ab interno trabeculectomy with the Trabectome system and to review its efficacy and safety in the treatment of glaucoma. METHOD A literature search in PubMed was performed on ab interno trabeculectomy with the Trabectome system, and clinical relevant information was reviewed and summarized. RESULTS Ab interno trabeculectomy with the Trabectome system on average lowered intraocular pressure (IOP to the mid-teens, and decreased the number of required glaucoma medications. Greater preoperative IOP correlated to a greater percent reduction in IOP. The success rates varied among studies, and the definition of success differed by authors. Intraoperative blood reflux was found in nearly all cases. Incidences of early hypotony and IOP spikes were low. No cases of endophthalmitis, wound leak, aqueous misdirection, choroidal hemorrhage or effusions, and irreversible visual acuity decrease (≥2 Snellen lines have been reported. Available studies had a significant amount of data overlap. Only limited data on long-term results was available. There was no randomized controlled trial to date. CONCLUSIONS Ab interno trabeculectomy with the Trabectome system is an effective and safe surgical approach for patients with various types of open angle glaucoma. On average, the procedure at least in the short term lowers IOP to the mid teens regardless of preoperative IOP with or without the aid of topical medications.

  12. Reference: DREDR1ATRD29AB [PLACE

    Lifescience Database Archive (English)

    Full Text Available DREDR1ATRD29AB Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, N... ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590; ...

  13. Preparation of national standard product of Anti-TgAb and Anti-TpoAb in our laboratory

    International Nuclear Information System (INIS)

    Objective: To standardize the China-made quantitative immunoassay kits of Anti-TgAb and Anti-TpoAb with a national standdized product of Anti-TgAb and And-TpoAb developed in our laboratory. Methods and Results: Higher titer Anti - TgAb and Anti-TpoAb serum specimens were pooled and treated with centrifuging and filtering, then freeze-dried and packaged into 2ml anpoules for preparing the national standard candidate. The results of the collaborative study showed that, the immuno-activity of the Anti-TgAb was 3916 IU/Amp in term of the 65/093, and the immuno-activity of the Anti-TpoAb was 434 IU/Amp in term of the 66/387. Conclusion: On the basis of the present study, it is proposed that the candidate standard be established as the National Standard for Anti-TgAb and Anti-TpoAb for immunoassay, the immunoactivity of the Anti-TgAb 4000IU/Amp, and that of Anti - TpoAb is 430IU/Amp. A comparative study on the quality of immunoassay kits of Anti-TgAb and Anti-TpoAb by Axsym System, Immulite 1000, Modular Analytics El70, ADVIA Centaur Assay (the most commonly used types in China) is also presented. (authors)

  14. Lithium Insertion In Silicon Nanowires: An ab Initio Study

    KAUST Repository

    Zhang, Qianfan


    The ultrahigh specific lithium ion storage capacity of Si nanowires (SiNWs) has been demonstrated recently and has opened up exciting opportunities for energy storage. However, a systematic theoretical study on lithium insertion in SiNWs remains a challenge, and as a result, understanding of the fundamental interaction and microscopic dynamics during lithium insertion is still lacking. This paper focuses on the study of single Li atom insertion into SiNWs with different sizes and axis orientations by using full ab initio calculations. We show that the binding energy of interstitial Li increases as the SiNW diameter grows. The binding energies at different insertion sites, which can be classified as surface, intermediate, and core sites, are quite different. We find that surface sites are energetically the most favorable insertion positions and that intermediate sites are the most unfavorable insertion positions. Compared with the other growth directions, the [110] SiNWs with different diameters always present the highest binding energies on various insertion locations, which indicates that [110] SiNWs are more favorable by Li doping. Furthermore, we study Li diffusion inside SiNWs. The results show that the Li surface diffusion has a much higher chance to occur than the surface to core diffusion, which is consistent with the experimental observation that the Li insertion in SiNWs is layer by layer from surface to inner region. After overcoming a large barrier crossing surface-to-intermediate region, the diffusion toward center has a higher possibility to occur than the inverse process. © 2010 American Chemical Society.

  15. Binding characteristics of swine erythrocyte insulin receptors

    International Nuclear Information System (INIS)

    Crossbred gilts had 8.8 +/- 1.1% maximum binding of [125I]insulin to insulin receptors on erythrocytes. The number of insulin-binding sites per cell was 137 +/- 19, with a binding affinity ranging from 7.4 X 10(7)M-1 to 11.2 X 10(7)M-1 and mean of 8.8 X 10(7)M-1. Pregnant sows had a significant increase in maximum binding due to an increase in number of receptor sites per cell. Lactating sows fed a high-fiber diet and a low-fiber diet did not develop a significant difference in maximum binding of insulin. Sows fed the low-fiber diet had a significantly higher number of binding sites and a significantly lower binding affinity than did sows fed a high-fiber diet. Receptor-binding affinity was lower in the low-fiber diet group than in cycling gilts, whereas data from sows fed the high-fiber diet did not differ from data for cycling gilts. Data from this study indicated that insulin receptors of swine erythrocytes have binding characteristics similar to those in other species. Pregnancy and diet will alter insulin receptor binding in swine

  16. Glycotope sharing between snail hemolymph and larval schistosomes: larval transformation products alter shared glycan patterns of plasma proteins.

    Directory of Open Access Journals (Sweden)

    Timothy P Yoshino

    Full Text Available Recent evidence supports the involvement of inducible, highly diverse lectin-like recognition molecules in snail hemocyte-mediated responses to larval Schistosoma mansoni. Because host lectins likely are involved in initial parasite recognition, we sought to identify specific carbohydrate structures (glycans shared between larval S. mansoni and its host Biomphalaria glabrata to address possible mechanisms of immune avoidance through mimicry of elements associated with the host immunoreactivity. A panel of monoclonal antibodies (mABs to specific S. mansoni glycans was used to identify the distribution and abundance of shared glycan epitopes (glycotopes on plasma glycoproteins from B. glabrata strains that differ in their susceptibilities to infection by S. mansoni. In addition, a major aim of this study was to determine if larval transformation products (LTPs could bind to plasma proteins, and thereby alter the glycotopes exposed on plasma proteins in a snail strain-specific fashion. Plasma fractions ( 100 kDa from susceptible (NMRI and resistant (BS-90 snail strains were subjected to SDS-PAGE and immunoblot analyses using mAB to LacdiNAc (LDN, fucosylated LDN variants, Lewis X and trimannosyl core glycans. Results confirmed a high degree of glycan sharing, with NMRI plasma exhibiting a greater distribution/abundance of LDN, F-LDN and F-LDN-F than BS-90 plasma ( 100 kDa fraction. Our data suggest that differential binding of S. mansoni LTPs to plasma proteins of susceptible and resistant B. glabrata strains may significantly impact early anti-larval immune reactivity, and in turn, compatibility, in this parasite-host system.

  17. On the Strain Rate Sensitivity of Abs and Abs Plus Fused Deposition Modeling Parts (United States)

    Vairis, A.; Petousis, M.; Vidakis, N.; Savvakis, K.


    In this work the effect of strain rate on the tensile strength of fused deposition modeling parts built with Acrylonitrile-butadiene-styrene (ABS) and ABS plus material is presented. ASTM D638-02a specimens were built with ABS and ABS plus and they were tested on a Schenck Trebel Co. tensile test machine at three different test speeds, equal, lower, and higher to the test speed required by the ASTM D638-02a standard. The experimental tensile strength results were compared and evaluated. The fracture surfaces of selected specimens were examined with a scanning electron microscope, to determine failure mode of the filament strands. It was found that, as the test speed increases, specimens develop higher tensile strength and have higher elastic modulus. Specimens tested in the highest speed of the experiment had on average about 10% higher elastic modulus and developed on average about 11% higher tensile strength.


    Institute of Scientific and Technical Information of China (English)

    Min-qiang Yu; Zhi-ping Zhou; De-yue Yan


    This work deals with the kinetics of co-condensation polymerization of AB2 and AB monomers, giving expressions of the two-dimensional molecular weight distribution function and the number/weight average molecular weights of the resulting copolymers. The two-dimensional molecular weight distribution depends on two indices, n and l, which are the respective numbers of AB2 and AB units in a copolymer species. The evolution of the two-dimensional weight and z distributions during the co-condensation polymerization has been evaluated systematically. Finally, the two-dimensional distribution was transformed into a one-dimensional molecular weight distribution with only one variable (the molecular weight of the products instead of the degree of polymerization). The calculated results show that the highly branched copolymer has a very broad molecular weight distribution when the co-condensation polymerization approaches completion.

  19. Variability in the cadherin gene in an Ostrinia nubilalis strain selected for Cry1Ab resistance. (United States)

    Bel, Yolanda; Siqueira, Herbert A A; Siegfried, Blair D; Ferré, Juan; Escriche, Baltasar


    Transgenic corn expressing Cry1Ab (a Bacillus thuringiensis toxin) is highly effective in the control of Ostrinia nubilalis. For its toxic action, Cry1Ab has to bind to specific insect midgut proteins. To date, in three Lepidoptera species resistance to a Cry1A toxin has been conferred by mutations in cadherin, a protein of the Lepidoptera midgut membrane. The implication of cadherin in the resistance of an Ostrinia nubilalis colony (Europe-R) selected with Bacillus thuringiensis Cry1Ab protoxin was investigated. Several major mutations in the cadherin (cdh) gene were found, which introduced premature termination codons and/or large deletions (ranging from 1383 to 1701bp). The contribution of these major mutations to the resistance was analyzed in resistant individuals that survived exposure to a high concentration of Cry1Ab protoxin. The results indicated that the presence of major mutations was drastically reduced in individuals that survived exposure. Previous inheritance experiments with the Europe-R strain indicated the involvement of more than one genetic locus and reduced amounts of the cadherin receptor. The results of the present work support a polygenic inheritance of resistance in the Europe-R strain, in which mutations in the cdh gene would contribute to resistance by means of an additive effect. PMID:19114103

  20. Leaching behaviour of the Swedish KBS-glasses ABS 39 and ABS 41

    International Nuclear Information System (INIS)

    The planned Swedish KBS glass corrosion investigation program comprises experiments with inactive glasses containing simulated waste, prolonged in-situ tests, the characterization of corrosion products, immiscibility studies, and corrosion experiments with hot glass. This presentation gives a short description of the entire program. It focuses thereafter on some recent leaching results with the inactive KBS glass qualities ABS 39 and ABS 41, which were leached in a manner similar to the PNL MCC-1 test procedure. 5 figures, 9 tables

  1. Thermomechanical properties of ABS/PA AND ABS/PC blends


    GUINAULT, Alain; Sollogoub, Cyrille


    International audience The significant increase of Waste Electric and Electronic Equipment (WEEE) has led to an important research in upgrading recycled engineering plastics by means of a blending technique. Classical twin-screw extrusion is compared to a new blending technique, where two polymers are combined together and then flow in several static mixers. This technique allows to obtain different morphologies of compatibilized ABS/PA or ABS/PC blends and the aim of this work is to evalu...

  2. AB077. Relationship of TPO-Ab and TSH with in vitro fertilization and embryo transfer


    Wang, Liyun


    Objective Study of thyroid peroxidase antibodies and thyroid stimulating effect on in vitro fertilization embryo transfer ending. Methods From March 2011 to October 2013 in the reproductive center in Qinghai Province People’s Hospital in vitro fertilization embryo transfer a total of 378 cycles were analyzed. (I) Basis for TPO-Ab grouping: research group is thyroid peroxidase antibody positive and thyroid function in patients with normal 69 cycles (TPO-Ab+ group), control group is thyroid per...

  3. Remarkable substrate-specificity of CYP6AB3 in Depressaria pastinacella, a highly specialized caterpillar. (United States)

    Mao, W; Rupasinghe, S; Zangerl, A R; Schuler, M A; Berenbaum, M R


    The parsnip webworm, Depressaria pastinacella, a specialist on two genera in Apiaceae, feeds exclusively on the furanocoumarin-containing reproductive structures of its host plants. This caterpillar relies principally on cytochrome P450-mediated detoxification for coping with the high concentrations of furanocoumarins in its diet. A cDNA encoding the furanocoumarin-inducible P450 CYP6AB3 from this species was coexpressed with house-fly NADPH P450 reductase in baculovirus-infected Sf9 cells and tested for binding and metabolism of the six furanocoumarins typically encountered in host plant tissues. Only imperatorin and bergapten bind in close proximity to the catalytic haem and only imperatorin is metabolized (V(max) and K(m) of 2.412 pmol/min per pmol P450 and 94.28 microm, respectively). Purification of the imperatorin metabolite by normal phase HPLC and characterization of its structure by MS-MS analysis indicate that CYP6AB3 initially epoxidizes the carbon-carbon pi-bond on the isoprenyl side chain on imperatorin. An improved molecular model for the CYP6AB3 protein based on this biochemical characterization and the recently defined mammalian CYP3A4 crystal structure provides insight into the remarkable substrate specificity of this protein. PMID:16640727

  4. Pharmacological activity of metal binding agents that alter copper bioavailability


    Helsel, Marian E.; Franz, Katherine J.


    Iron, copper and zinc are required nutrients for many organisms but also potent toxins if misappropriated. An overload of any of these metals can be cytotoxic and ultimately lead to organ failure, whereas deficiencies can result in anemia, weakened immune system function, and other medical conditions. Cellular metal imbalances have been implicated in neurodegenerative diseases, cancer and infection. It is therefore critical for living organisms to maintain careful control of both the total le...

  5. Glycolipid binding preferences of Shiga toxin variants.

    Directory of Open Access Journals (Sweden)

    Sayali S Karve

    Full Text Available The major virulence factor of Shiga toxin producing E. coli, is Shiga toxin (Stx, an AB5 toxin that consists of a ribosomal RNA-cleaving A-subunit surrounded by a pentamer of receptor-binding B subunits. The two major isoforms, Stx1 and Stx2, and Stx2 variants (Stx2a-h significantly differ in toxicity. The exact reason for this toxicity difference is unknown, however different receptor binding preferences are speculated to play a role. Previous studies used enzyme linked immunosorbent assay (ELISA to study binding of Stx1 and Stx2a toxoids to glycolipid receptors. Here, we studied binding of holotoxin and B-subunits of Stx1, Stx2a, Stx2b, Stx2c and Stx2d to glycolipid receptors globotriaosylceramide (Gb3 and globotetraosylceramide (Gb4 in the presence of cell membrane components such as phosphatidylcholine (PC, cholesterol (Ch and other neutral glycolipids. In the absence of PC and Ch, holotoxins of Stx2 variants bound to mixtures of Gb3 with other glycolipids but not to Gb3 or Gb4 alone. Binding of all Stx holotoxins significantly increased in the presence of PC and Ch. Previously, Stx2a has been shown to form a less stable B-pentamer compared to Stx1. However, its effect on glycolipid receptor binding is unknown. In this study, we showed that even in the absence of the A-subunit, the B-subunits of both Stx1 and Stx2a were able to bind to the glycolipids and the more stable B-pentamer formed by Stx1 bound better than the less stable pentamer of Stx2a. B-subunit mutant of Stx1 L41Q, which shows similar stability as Stx2a B-subunits, lacked glycolipid binding, suggesting that pentamerization is more critical for binding of Stx1 than Stx2a.

  6. Genetics Home Reference: GM2-gangliosidosis, AB variant (United States)

    ... of GM2-gangliosidosis, AB variant: Genetic Testing Registry: Tay-Sachs disease, variant AB These resources from MedlinePlus offer ... AB variant Activator Deficiency/GM2 Gangliosidosis Activator-deficient Tay-Sachs disease GM2 Activator Deficiency Disease GM2 gangliosidosis, type ...

  7. Investigation of high level of AsAb, EmAb in fertility female serum infected by chlamydia trachomatis

    International Nuclear Information System (INIS)

    Objective: To investigate the mechanism of chlamydia trachomatis. AsAb, EmAb in female fertility. Methods: LPS antigen of chlamydia in reproduction tract of fertility female was detected by monoclonal antibody and immunology chromatography; the content of AsAb, EmAb in serum of fertility female was detected by ELISA. Results: Infections rate of chlamydia trachomatis in fertility female was higher than that in the control AsAb, EmAb in serum of the fertility patients who were infected with chlamydia trachomatis showed a significant difference from that in the control group. Conclusion: The level of AsAb, EmAb increases in patients who have been infected with chlamydia trachomatis and these cytokines is involved in the course of female fertility

  8. Emergent properties of nuclei from ab initio coupled-cluster calculations

    CERN Document Server

    Hagen, G; Hjorth-Jensen, M; Papenbrock, T


    Emergent properties such as nuclear saturation and deformation, and the effects on shell structure due to the proximity of the scattering continuum and particle decay channels are fascinating phenomena in atomic nuclei. In recent years, ab initio approaches to nuclei have taken the first steps towards tackling the computational challenge of describing these phenomena from Hamiltonians with microscopic degrees of freedom. This endeavor is now possible due to ideas from effective field theories, novel optimization strategies for nuclear interactions, ab initio methods exhibiting a soft scaling with mass number, and ever-increasing computational power. This paper reviews some of the recent accomplishments. We also present new results. The recently optimized chiral interaction NNLO$_{\\rm sat}$ is shown to provide an accurate description of both charge radii and binding energies in selected light- and medium-mass nuclei up to $^{56}$Ni. We derive an efficient scheme for including continuum effects in coupled-clust...

  9. Ab initio mass tensor molecular dynamics


    Tsuchida, Eiji


    Mass tensor molecular dynamics was first introduced by Bennett [J. Comput. Phys. 19, 267 (1975)] for efficient sampling of phase space through the use of generalized atomic masses. Here, we show how to apply this method to ab initio molecular dynamics simulations with minimal computational overhead. Test calculations on liquid water show a threefold reduction in computational effort without making the fixed geometry approximation. We also present a simple recipe for estimating the optimal ato...

  10. Discovering chemistry with an ab initio nanoreactor


    Wang, Lee-Ping; Titov, Alexey; McGibbon, Robert; Liu, Fang; Pande, Vijay S.; Martínez, Todd J.


    Chemical understanding is driven by the experimental discovery of new compounds and reactivity, and is supported by theory and computation that provides detailed physical insight. While theoretical and computational studies have generally focused on specific processes or mechanistic hypotheses, recent methodological and computational advances harken the advent of their principal role in discovery. Here we report the development and application of the ab initio nanoreactor – a highly accelerat...

  11. Ab initio vel ex eventu. II (United States)

    Thiessen, P. A.; Treder, H.-J.

    Jedes initium wird durch experimenta crucis zum eventus. Jedes theoretisch interpretierbare ex-eventu-Resultat führt auf ein neues Initium. Gerade dies ist die gemeinsame Aussage von Atomistik, Quantenmechanik und Relativitätstheorie.Translated AbstractAb initio vel ex eventu. IIEvery initium becomes an eventus by experimenta crucis. Every theoretically interpretable ex-eventu result leads to a new initium. Right this is the joint assertion of atomism, quantum mechanics, and relativity.

  12. Highly scalable Ab initio genomic motif identification

    KAUST Repository

    Marchand, Benoît


    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  13. Characterization of Asia 1 sdAb from camels bactrianus (C. bactrianus and conjugation with quantum dots for imaging FMDV in BHK-21 cells.

    Directory of Open Access Journals (Sweden)

    Shuanghui Yin

    Full Text Available Foot-and-mouth disease (FMD, caused by FMD virus (FMDV, is a highly contagious viral disease affecting cloven-hoofed animals. Camelids have a unique immunoglobulin profile, with the smallest functional heavy-chain antibodies (sdAb or VHH naturally devoid of light chains with antigen-binding capacity. We screened and characterized five sdAbs against FMDV by immunized library from C. bactrianus with Asia 1 virus-like particles (VLPs. Three of five recombinant sdAbs were stably expressed in E.coli, remained highly soluble, and were serotype-specific for VP1 protein of FMDV Asia 1 by ELISA. These failed to completely neutralize the Asia 1 virus. According to the KD value of binding affinity to three sdAbs, which ranged from 0.44 to 0.71 nm by SPR, sdAb-C6 was selected and conjugated with Zn/CdSe quantum dots (QDs to form a QDs-C6 probe, which was used to trace and image the subcellular location of FMDV in BHK-21 cells. The results show that FMD virions were observed from 3 h.p.i., and most of virions were distributed on one side of the nucleus in the cytoplasm. We demonstrate the utility of sdAbs as functionalized QDs are powerful tools for FMDV research.

  14. Regulation and mechanism of mouse miR-130a/b in metabolism-related inflammation. (United States)

    Zheng, Hailiang; Dong, Xiangkun; Liu, Na; Xia, Wenmin; Zhou, Lulu; Chen, Xiaojun; Yang, Zaiqing; Chen, Xiaodong


    Increasing evidence suggests that microRNAs are involved in regulating immune response and metabolism, which are among the most fundamental requirements for survival. Here we investigate the contribution and mechanism of microRNA-130a/b in controlling metabolism-related inflammation. Our findings indicate that miR-130a/b significantly inhibits TNFα and Sp1 expression by directly binding to their 3'-untranslated regions. Overexpressed miR-130a/b decreases the NF-κB mRNA and protein levels by shortening mRNA half-life. In mice primary hepatocytes, over-expressed miR-130a/b ameliorates the up-regulation of TNFα, Sp1, NF-κB and PPARγ translational levels elicited by LPS or FFAs treatment. Further, C/EBPα attenuates the promoter activity of miR-130a, but enhances that of miR-130b. The progressive deletions and mutations show that the C/EBPα binding motif situated at -1033/-1021bp or -130/-116bp region of miR-130a or b promoter respectively is an essential component required for their promoter activity. Chromatin immunoprecipitation (ChIP) assays reveal that C/EBPα can directly interact with miR-130a/b promoter DNA. Conclusively, these data suggest that miR-130a/b, regulated transcriptionally by C/EBPα, can control metabolism-related inflammatory process through inhibiting Sp1-TLR4-NF-κB/P65-TNFα pathway and regulating translational levels of PPARγ and other key genes involved in lipid metabolism. PMID:26923288

  15. Arsenic at very low concentrations alters glucocorticoid receptor (GR)-mediated gene activation but not GR-mediated gene repression: complex dose-response effects are closely correlated with levels of activated GR and require a functional GR DNA binding domain. (United States)

    Bodwell, Jack E; Kingsley, Lauren A; Hamilton, Joshua W


    Arsenic (As) contamination of drinking water is considered a principal environmental health threat throughout the world. Chronic intake is associated with an increased risk of cancer, diabetes, and cardiovascular disease, and recent studies suggest increased health risks at levels as low as 5-10 ppb. We report here that 0.05-1 microM (6-120 ppb) As showed stimulatory effects on glucocorticoid receptor (GR)-mediated gene activation in rat EDR3 hepatoma cells of both the endogenous tyrosine aminotransferase (TAT) gene and the reporter genes containing TAT glucocorticoid response elements. At slightly higher concentrations (1-3 microM), the effects of As became inhibitory. Thus, over this narrow concentration range, the effects of As changed from a 2- to 4-fold stimulation to a greater than 2-fold suppression in activity. Interestingly, the inhibitory effect of GR on both AP1- and NF-kappa B-mediated gene activation was not affected by As. The magnitude of GR stimulation and inhibition by As was highly dependent on the cellular level of hormone-activated GR. Mutational deletion studies indicated that the central DNA binding domain (DBD) of GR is the minimal region required for the As effect and does not require free sulfhydryls. Point mutations located within the DBD that have known structural consequences significantly altered the GR response to As. In particular, point mutations in the DBD that confer a DNA-bound GR confirmation abolished the low dose As stimulatory effect but enhanced the inhibitory response, further indicating that the DBD is important for mediating these As effects. PMID:15310238

  16. Ab initio study of optical excitations in VO2 (United States)

    Coulter, John; Gali, Adam; Manousakis, Efstratios


    Motivated by recent experimental efforts to fabricate p-n junctions from transition metal oxides (TMOs) and a recent theoretical study claiming TMOs to be good absorbers and promising materials for efficient carrier multiplication, we study the optical properties of a prototypical TMO, the insulator M1 phase of vanadium dioxide (VO2), by ab initio methods. We applied the Bethe-Salpeter equations (BSE) to calculate the optical properties, starting from self-consistent GW quasi-particle energy levels and states. In contrast to expectations, the exciton binding energy obtained by BSE is in good agreement with the experiment. We find that the electron-electron interaction is very strong which makes this material promising for efficient carrier multiplication that might lead to an enhanced efficiency in photo-voltaics applications. To illustrate this more quantitatively, we calculated the impact ionization rate within the independent quasiparticle approximation, and find that the rate is significantly higher than silicon in the region of highest solar intensity, due to the strong multiple carrier excitations.

  17. Undoing Gender Through Legislation and Schooling: the Case of AB 537 and AB 394 IN California, USA (United States)

    Knotts, Greg


    This article investigates California laws AB 537: The Student Safety and Violence Prevention Act of 2000, and the recently enacted AB 394: Safe Place to Learn Act. Both demand that gender identity and sexual orientation be added to the lexicon of anti-harassment protection in public education. However, despite these progressive measures, schools have an unconscious acceptance of heteronormativity and gendered norms, which undermines both the spirit and language of these laws. This paper examines how California schools can both change standard practices and realise the transformative social change that laws like AB 537 and AB 394 can instigate. I assert that the systemic implementation of these laws, through the adoption, enforcement and evaluation of existing AB 537 Task Force Recommendations, is necessary for their success. My second assertion is that AB 537 and AB 394 have the potential to change and reconstitute gender-based and heteronormative standards at school sites.

  18. Ab initio studies of equations of state and chemical reactions of reactive structural materials (United States)

    Zaharieva, Roussislava

    subject of studies of the shock or thermally induced chemical reactions of the two solids comprising these reactive materials, from first principles, is a relatively new field of study. The published literature on ab initio techniques or quantum mechanics based approaches consists of the ab initio or ab initio-molecular dynamics studies in related fields that contain a solid and a gas. One such study in the literature involves a gas and a solid. This is an investigation of the adsorption of gasses such as carbon monoxide (CO) on Tungsten. The motivation for these studies is to synthesize alternate or synthetic fuel technology by Fischer-Tropsch process. In this thesis these studies are first to establish the procedure for solid-solid reaction and then to extend that to consider the effects of mechanical strain and temperature on the binding energy and chemisorptions of CO on tungsten. Then in this thesis, similar studies are also conducted on the effect of mechanical strain and temperature on the binding energies of Titanium and hydrogen. The motivations are again to understand the method and extend the method to such solid-solid reactions. A second motivation is to seek strained conditions that favor hydrogen storage and strain conditions that release hydrogen easily when needed. Following the establishment of ab initio and ab initio studies of chemical reactions between a solid and a gas, the next step of research is to study thermally induced chemical reaction between two solids (Ni+Al). Thus, specific new studies of the thesis are as follows: (1) Ab initio Studies of Binding energies associated with chemisorption of (a) CO on W surfaces (111, and 100) at elevated temperatures and strains and (b) adsorption of hydrogen in titanium base. (2) Equations of state of mixtures of reactive material structures from ab initio methods. (3) Ab initio studies of the reaction initiation, transition states and reaction products of intermetallic mixtures of (Ni+Al) at elevated

  19. 汽车ABS/ASR/ACC集成化系统%Integrated ABS/ASR/ACC System for the Car

    Institute of Scientific and Technical Information of China (English)

    刘昭度; 卢江; 时开斌; 安巍


    叙述了ACC系统和ABS/ASR系统在改善汽车高速行驶主动安全性方面的功用,阐述了ACC系统是ABS/ASR系统功能的延伸、逻辑的发展及它们之间的内在联系,指出了在ABS/ASR的基础上只需增加测距装置和添加巡航控制子程序,就可方便地实现ABS/ASR/ACC集成化系统,并给出了集成化系统的控制框图和控制方法,论述了ABS/ASR/ACC集成化系统比孤立的ABS/ASR和ACC系统的优越性.%The individual functions of ACC and ABS/ASR are described in the improvements of active safety while the road vehicles travel at a high speed. Being a logic extension of and many inherent connections with ABS/BSR, ACC is easily integrated with ABS/ASR to form an integrated system by adding the headway distance*$-detecting device to the existing ABS/ASR system and expanding the ABS/ASR software. The algorithm flowcharts and control methods of the ABS/ASR/ACC are given. The advantages of the ABS/ASR/ACC system compared with those using the stand alone systems ABS, ASR and ACC are mentioned in details.

  20. Shared Binding Sites in Lepidoptera for Bacillus thuringiensis Cry1Ja and Cry1A Toxins


    Herrero, Salvador; González-Cabrera, Joel; Tabashnik, Bruce E; Ferré, Juan


    Bacillus thuringiensis toxins act by binding to specific target sites in the insect midgut epithelial membrane. The best-known mechanism of resistance to B. thuringiensis toxins is reduced binding to target sites. Because alteration of a binding site shared by several toxins may cause resistance to all of them, knowledge of which toxins share binding sites is useful for predicting cross-resistance. Conversely, cross-resistance among toxins suggests that the toxins share a binding site. At lea...

  1. Characterization of the mycobacterial AdnAB DNA motor provides insights into the evolution of bacterial motor-nuclease machines. (United States)

    Unciuleac, Mihaela-Carmen; Shuman, Stewart


    Mycobacterial AdnAB exemplifies a family of heterodimeric motor-nucleases involved in processing DNA double strand breaks (DSBs). The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal RecB-like nuclease module. Here we conducted a biochemical characterization of the AdnAB motor, using a nuclease-inactivated heterodimer. AdnAB is a vigorous single strand DNA (ssDNA)-dependent ATPase (k(cat) 415 s(-1)), and the affinity of the motor for the ssDNA cofactor increases 140-fold as DNA length is extended from 12 to 44 nucleotides. Using a streptavidin displacement assay, we demonstrate that AdnAB is a 3' --> 5' translocase on ssDNA. AdnAB binds stably to DSB ends. In the presence of ATP, the motor unwinds the DNA duplex without requiring an ssDNA loading strand. We integrate these findings into a model of DSB unwinding in which the "leading" AdnB and "lagging" AdnA motor domains track in tandem, 3' to 5', along the same DNA single strand. This contrasts with RecBCD, in which the RecB and RecD motors track in parallel along the two separated DNA single strands. The effects of 5' and 3' terminal obstacles on ssDNA cleavage by wild-type AdnAB suggest that the AdnA nuclease receives and processes the displaced 5' strand, while the AdnB nuclease cleaves the displaced 3' strand. We present evidence that the distinctive "molecular ruler" function of the ATP-dependent single strand DNase, whereby AdnAB measures the distance from the 5'-end to the sites of incision, reflects directional pumping of the ssDNA through the AdnAB motor into the AdnB nuclease. These and other findings suggest a scenario for the descent of the RecBCD- and AddAB-type DSB-processing machines from an ancestral AdnAB-like enzyme. PMID:19920138

  2. Single- and double-wall carbon nanotubes fully covered with tetraphenylporphyrins: Stability and optoelectronic properties from ab-initio calculations


    Orellana, Walter


    The optoelectronic properties of single- and double-wall carbon nanotubes (CNTs) noncovalently functionalized with tetraphenylporphyrins (TPPs) are addressed by dispersion-corrected ab initio calculations. Five CNT species with different chiralities were considered. We find that the most stable configurations are those where the CNTs are fully covered by TPPs, exhibiting binding energy of about 2~eV/TPP. The semiconducting CNT-TPP compounds show optical response characterized by a strong abso...

  3. Germacrene D Cyclization: An Ab Initio Investigation

    Directory of Open Access Journals (Sweden)

    William N. Setzer


    Full Text Available Essential oils that contain large concentrations of germacrene D are typically accompanied by cadinane sesquiterpenoids. The acid-catalyzed cyclization of germacrene D to give cadinane and selinane sesquiterpenes has been computationally investigated using both density functional (B3LYP/6-31G* and post Hartree-Fock (MP2/6-31G** ab initio methods. The calculated energies are in general agreement with experimentally observed product distributions, both from acid-catalyzed cyclizations as well as distribution of the compounds in essential oils.

  4. Ab initio calculations of material strength

    Czech Academy of Sciences Publication Activity Database

    Šob, Mojmír; Friák, Martin; Vitek, V.

    Tokyo : The Japan Society of Mechanical Engineers, 2003, s. 467-475. [International Symposium on Micro-Mechanical Engineering - Heat Transfer, Fluid Dynamics, Reliability and Mechanotronics.. Tsuchiura and Tsukuba (JP), 01.12.2003-03.12.2003] R&D Projects: GA AV ČR IAA1041302; GA ČR GA202/03/1351; GA MŠk OC 523.90 Institutional research plan: CEZ:AV0Z2041904 Keywords : ab initio calculations * electronic structure * theoretical tensile strength Subject RIV: BM - Solid Matter Physics ; Magnetism

  5. Ab Initio Molecular Dynamics: A Virtual Laboratory


    Hobbi Mobarhan, Milad


    In this thesis, we perform ab initio molecular dynamics (MD) simulations at the Hartree-Fock level, where the forces are computed on-the-fly using the Born-Oppenheimer approximation. The theory behind the Hartree-Fock method is discussed in detail and an implementation of this method based on Gaussian basis functions is explained. We also demonstrate how to calculate the analytic energy derivatives needed for obtaining the forces acting on the nuclei. Hartree-Fock calculations on the ground s...

  6. Asiakassuhdehallinnan kehityssuunnitelma : Case: Oy Combi Cool Ab


    Puikkonen, Touko


    Tässä insinöörityössä tutustuttiin Oy Combi Cool Ab:n asiakassuhdehallintaan ja siinä havaittuihin puutteisiin ja kehitystarpeisiin. Työn tarkoituksena oli luoda yritykselle ajan tasalla oleva asiakasrekisteri ja sen pohjalta kehittää asiakassuhdehallintaa etenkin myynnin, oston ja johdon henkilöstön tarpeita ajatellen muovaamalla siitä henkilöstön myynti- ja asiakaspalvelutyöskentelyä tehostava toimiva kokonaisuus. Combi Cool on vuonna 1985 perustettu kylmäalan tukkuliike, joka on vajaan 30 ...

  7. Testing Distributed ABS System with Fault Injection (United States)

    Trawczyński, Dawid; Sosnowski, Janusz; Gawkowski, Piotr

    The paper deals with the problem of adapting software implemented fault injection technique (SWIFI) to evaluate dependability of reactive microcontroller systems. We present an original methodology of disturbing controller operation and analyzing fault effects taking into account reactions of the controlled object and the impact of the system environment. Faults can be injected randomly (in space and time) or targeted at the most sensitive elements of the controller to check it at high stresses. This approach allows identifying rarely encountered problems, usually missed in classical approaches. The developed methodology has been used successfully to verify dependability of ABS system. Experimental results are commented in the paper.

  8. Fragile X mental retardation protein interacts with the RNA-binding protein Caprin1 in neuronal RiboNucleoProtein complexes [corrected].

    Directory of Open Access Journals (Sweden)

    Rachid El Fatimy

    Full Text Available Fragile X syndrome is caused by the absence of the Fragile X Mental Retardation Protein (FMRP, an RNA-binding protein. FMRP is associated with messenger RiboNucleoParticles (mRNPs present in polyribosomes and its absence in neurons leads to alteration in synaptic plasticity as a result of translation regulation defects. The molecular mechanisms by which FMRP plays a role in translation regulation remain elusive. Using immunoprecipitation approaches with monoclonal Ab7G1-1 and a new generation of chicken antibodies, we identified Caprin1 as a novel FMRP-cellular partner. In vivo and in vitro evidence show that Caprin1 interacts with FMRP at the level of the translation machinery as well as in trafficking neuronal granules. As an RNA-binding protein, Caprin1 has in common with FMRP at least two RNA targets that have been identified as CaMKIIα and Map1b mRNAs. In view of the new concept that FMRP species bind to RNA regardless of known structural motifs, we propose that protein interactors might modulate FMRP functions.

  9. Perturbation schedule does not alter retention of a locomotor adaptation across days


    Hussain, Sara J.; Morton, Susanne M.


    Motor adaptation in response to gradual vs. abrupt perturbation schedules may involve different neural mechanisms, potentially leading to different levels of motor memory. However, no study has investigated whether perturbation schedules alter memory of a locomotor adaptation across days. We measured adaptation and retention (memory) of altered interlimb symmetry during walking in two groups of participants over 2 days. On day 1, participants adapted to either a single, large perturbation (ab...

  10. Elastic properties of intermetallic AB2 and AB5 hydrogen-absorbing compounds

    International Nuclear Information System (INIS)

    The elastic properties of AB2 and AB5 hydrogen-absorbing intermetallic compounds are reviewed. The relevance of these properties to hydrogen absorption is discussed briefly. In many cases the temperature dependence of the elastic constants of the AB2 compounds is anomalous in that the moduli do not decrease monotonically with increasing temperature. This unusual behavior appears to be associated with electronic structure effects in a number of cases. The absorption of hydrogen by polycrystalline TaV2 has a profound effect on the aggregate shear modulus, changing both the magnitude and temperature dependence significantly. This effect of hydrogen on the mechanical properties appears to occur via effects on the electronic structure. Few measurements of elastic properties have been reported for hydrogen-absorbing AB5 intermetallic compounds. The LaAlxNi5-x system has been investigated by means of measurements on polycrystals prepared by hot isostatic pressing. The moduli decrease about 8% as x increases from 0 to 1

  11. Characterization of mAbs to chicken anemia virus and epitope mapping on its viral protein, VP1. (United States)

    Trinh, Dai Q; Ogawa, Haruko; Bui, Vuong N; Baatartsogt, Tugsbaatar; Kizito, Mugimba K; Yamaguchi, Shigeo; Imai, Kunitoshi


    Three (MoCAV/F2, MoCAV/F8 and MoCAV/F11) of four mouse mAbs established against the A2/76 strain of chicken anemia virus (CAV) showed neutralization activity. Immunoprecipitation showed a band at ~50 kDa in A2/76-infected cell lysates by neutralizing mAbs, corresponding to the 50 kDa capsid protein (VP1) of CAV, and the mAbs reacted with recombinant VP1 proteins expressed in Cos7 cells. MoCAV/F2 and MoCAV/F8 neutralized the 14 CAV strains tested, whereas MoCAV/F11 did not neutralize five of the strains, indicating distinct antigenic variation amongst the strains. In blocking immunofluorescence tests with the A2/76-infected cells, binding of MoCAV/F11 was not inhibited by the other mAbs. MoCAV/F2 inhibited the binding of MoCAV/F8 to the antigens and vice versa, suggesting that the two mAbs recognized the same epitope. However, mutations were found in different parts of VP1 of the escape mutants of each mAb: EsCAV/F2 (deletion of T89+A90), EsCAV/F8 (I261T) and EsCAV/F11 (E144G). Thus, the epitopes recognized by MoCAV/F2 and MoCAV/F8 seemed to be topographically close in the VP1 structure, suggesting that VP1 has at least two different neutralizing epitopes. However, MoCAV/F8 did not react with EsCAV/F2 or EsCAV/F8, suggesting that binding of MoCAV/F8 to the epitope requires coexistence of the epitope recognized by MoCAV/F2. In addition, MoCAV/F2, with a titre of 1 : 12 800 to the parent strain, neutralized EsCAV/F2 and EsCAV/F8 with low titres of 32 and 152, respectively. The similarity of the reactivity of MoCAV/F2 and MoCAV/F8 to VP1 may also suggest the existence of a single epitope recognized by these mAbs. PMID:25568186

  12. Biosorption of Acid Blue 290 (AB 290) and Acid Blue 324 (AB 324) dyes on Spirogyra rhizopus

    International Nuclear Information System (INIS)

    In this study, the biosorption of Acid Blue 290 and Acid Blue 324 on Spirogyra rhizopus, a green algae growing on fresh water, was studied with respect to initial pH, temperature, initial dye concentration and biosorbent concentration. The optimum initial pH and temperature values for AB 290 and AB 324 biosorption were found to be 2.0, 30 deg. C and 3.0, 25 deg. C, respectively. It was observed that the adsorbed AB 290 and AB 324 amounts increased with increasing the initial dye concentration up to 1500 and 750 mg/L, respectively. The Langmuir, Freundlich, Redlich-Peterson and Koble-Corrigan isotherm models were applied to the experimental equilibrium data and the isotherm constants were determined by using Polymath 4.1 software. The monolayer coverage capacities of S. rhizopus for AB 290 and AB 324 dyes were found as 1356.6 mg/g and 367.0 mg/g, respectively. The intraparticle diffusion model and the pseudo-second order kinetic model were applied to the experimental data in order to describe the removal mechanism of these acidic dyes by S. rhizopus. The pseudo-second order kinetic model described very well the biosorption kinetics of AB 290 and AB 324 dyes. Thermodynamic studies showed that the biosorption of AB 290 and AB 324 on S. rhizopus was exothermic in nature

  13. Ab initio non-relativistic spin dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Feizhi; Goings, Joshua J.; Li, Xiaosong, E-mail: [Department of Chemistry, University of Washington, Seattle, Washington 98195 (United States); Frisch, Michael J. [Gaussian, Inc., 340 Quinnipiac St, Bldg 40, Wallingford, Connecticut 06492 (United States)


    Many magnetic materials do not conform to the (anti-)ferromagnetic paradigm where all electronic spins are aligned to a global magnetization axis. Unfortunately, most electronic structure methods cannot describe such materials with noncollinear electron spin on account of formally requiring spin alignment. To overcome this limitation, it is necessary to generalize electronic structure methods and allow each electron spin to rotate freely. Here, we report the development of an ab initio time-dependent non-relativistic two-component spinor (TDN2C), which is a generalization of the time-dependent Hartree-Fock equations. Propagating the TDN2C equations in the time domain allows for the first-principles description of spin dynamics. A numerical tool based on the Hirshfeld partitioning scheme is developed to analyze the time-dependent spin magnetization. In this work, we also introduce the coupling between electron spin and a homogenous magnetic field into the TDN2C framework to simulate the response of the electronic spin degrees of freedom to an external magnetic field. This is illustrated for several model systems, including the spin-frustrated Li{sub 3} molecule. Exact agreement is found between numerical and analytic results for Larmor precession of hydrogen and lithium atoms. The TDN2C method paves the way for the ab initio description of molecular spin transport and spintronics in the time domain.

  14. Preliminary study of the metal binding site of an anti-DTPA-indium antibody by equilibrium binding immunoassays and immobilized metal ion affinity chromatography. (United States)

    Boden, V; Colin, C; Barbet, J; Le Doussal, J M; Vijayalakshmi, M


    Creating metal coordination sites by modifying an existing enzyme or by eliciting antibodies against metal chelate haptens is of great interest in biotechnology to create enzyme catalysts with novel specificities. Here, we investigate the metal binding potential of a monoclonal antibody raised against a DTPA-In(III) hapten (mAb 734). We study its relative binding efficiency to metals of biological relevance by equilibrium binding immunoassays and immobilized metal ion affinity chromatography, two approaches which can give complementary information regarding composition and/or structure of the metal binding site(s). Fe(III), Fe(II), Cu(II), Mg(II), Ca(II), and Zn(II) binding was compared to In(III). All of them were shown to displace indium, but their affinity for mAb 734 decreased by 100-fold compared to indium. Competitive metal binding immunoassays between Zn(II) and In(III) revealed an unusual behavior by Zn(II) which remains to be explained. Moreover, IMAC allowed us to predict the metal binding amino acids involved in the antibody paratope. The antibody metal binding site was shown to contain at least two histidine residues in a cluster, and the presence of aspartic and glutamic acid as well as cysteine residues could not be excluded. Thus, simple competition studies allows us to obtain some partial information on the metal binding structural features of this anti-metal chelate antibody and to guide our screening of its catalytic potential. PMID:7578356

  15. Registration of immunoglobuline AB/AG reaction with planar polarization interferometer (United States)

    Nabok, Alexei V.; Starodub, Nickolaj F.; Ray, Asim K.; Hassan, Aseel K.


    Immobilization of human immunoglobuline (IgG) (AG) and goat on human IGG antibodies (AB) as well as AB/AG specific reaction were studied with planar polarization interferometry (PPI). In this novel method, polarized laser beam was coupled into the planar waveguide made on silicon wafer and consisted of 20nm Si3N4 layer sandwiched between two 1.5 micrometers SiO2 layers with the sensing window etched in the top SIO2 layer. One of the immune components was deposited by means of polyelectrolyte self- assembly on top of the Si3N3 layer within the sensing window, P-component of the polarized light is sensitive to adsorption, while s-component serves as a reference. Thus the outcoming light intensity depends on the phase shift between s- and p-components. Different sequences of immobilization of the immune components were studied with both surface plasmon resonance (SPR) and PPI methods. It was shown that predeposition of a monolayer of protein A, which is believed to affect the orientation of the immune components, causes an additional increase in the sensitivity. PPI method allowed us to improve substantially the sensitivity towards AB/AG reaction as compared to traditional SPR method. Particularly, of specific binding of 3ng/ml AG was registered.

  16. Ab initio study of the electronic properties of the planar Ga5N5 cluster

    Institute of Scientific and Technical Information of China (English)

    Zheng Hao-Ping; Hao Jing-An


    The first-principles, all electron, ab initio calculations have been performed for an the amazing stable planar structure of Ga5N5 cluster based on the density functional theory. Electronic structure, Electron affinity, ionization potential, and binding energy are obtained. No spin magnetic moment is found. The results show that the planar structure of the Ga5N5 cluster is stable. It is found that for the planar structure of Ga5N5 cluster, three nitrogen atoms in the N3 subunit bind together with large electon transfer although no free N3 can exist. This may be important to the stability of the planar structure of the Ga5N5 cluster which has the lowest ground-state energy.

  17. Ab initio study of beryllium-decorated fullerenes for hydrogen storage (United States)

    Lee, Hoonkyung; Huang, Bing; Duan, Wenhui; Ihm, Jisoon


    We have found that a beryllium (Be) atom on nanostructured materials with H2 molecules generates a Kubas-like dihydrogen complex [Lee, Huang, Duan, and Ihm, Appl. Phys. Lett. 96, 143120 (2010)]. Here, we investigate the feasibility of Be-decorated fullerenes for hydrogen storage using ab initio calculations. We find that the aggregation of Be atoms on pristine fullerenes is energetically preferred, resulting in the dissociation of the dihydrogen. In contrast, for boron (B)-doped fullerenes, Be atoms prefer to be individually attached to B sites of the fullerenes, and a maximum of one H2 molecule binds to each Be atom in a form of dihydrogen with a binding energy of ˜0.3 eV. Our results show that individual dispersed Be-decorated B-doped fullerenes can serve as a room-temperature hydrogen storage medium.

  18. Ab-initio calculations of charge symmetry breaking in the A=4 hypernuclei

    CERN Document Server

    Gazda, Daniel


    We report on ab-initio NCSM calculations of the A=4 mirror Lambda hypernuclei Lambda-4H and Lambda-4He, using the Bonn-Juelich LO chiral EFT YN potentials plus a CSB Lambda0--Sigma0 mixing vertex. In addition to reproducing rather well the 0+ (g.s.) and 1+ (exc.) binding energies, these four-body calculations demonstrate for the first time that the observed CSB splitting of mirror levels, reaching hundreds of keV for 0+ (g.s.), can be reproduced using realistic theoretical interaction models, although with a non-negligible momentum cutoff dependence. Our results are discussed in relation to recent measurements of the Lambda-4H (0+ g.s.) binding energy [MAMI A1 Collaboration, Phys. Rev. Lett. 114, 232501 (2015)] and the Lambda-4He (1+ exc.) excitation energy [J-PARC E13 Collaboration, Phys. Rev. Lett. 115, 222501 (2015)].

  19. Tight-binding parameterization for photonic band gap materials


    Lidorikis, E.; Sigalas, M. M.; Soukoulis, C. M.; Economou, E. N.


    The ideas of the linear combination of atomic orbitals (LCAO) method, well known from the study of electrons, is extended to the classical wave case. The Mie resonances of the isolated scatterer in the classical wave case, are analogous to the localized eigenstates in the electronic case. The matrix elements of the two-dimensional tight-binding (TB) Hamiltonian are obtained by fitting to ab initio results. The transferability of the TB model is tested by reproducing accurately the band struct...

  20. Ab initio no core full configuration approach for light nuclei (United States)

    Kim, Youngman; Shin, Ik Jae; Maris, Pieter; Vary, James P.; Forssén, Christian; Rotureau, Jimmy


    Comprehensive understanding of the structure and reactions of light nuclei poses theoretical and computational challenges. Still, a number of ab initio approaches have been developed to calculate the properties of atomic nuclei using fundamental interactions among nucleons. Among them, we work with the ab initio no core full configuration (NCFC) method and ab initio no core Gamow Shell Model (GSM). We first review these approaches and present some recent results.

  1. Workshop on automated beam steering and shaping (ABS). Proceedings

    International Nuclear Information System (INIS)

    A workshop on Automated Beam Steering and Shaping (ABS) was held at CERN in December 1998. This was the first workshop dedicated to this subject. The workshop had two major goals: to review the present status of ABS algorithms and systems around the world and to create a worldwide ABS community. These proceedings contain summary reports from all sessions, contributions from several presentations held at the workshop, and a complete set of abstracts for all presentations. (orig.)

  2. Ab initio molecular crystal structures, spectra, and phase diagrams. (United States)

    Hirata, So; Gilliard, Kandis; He, Xiao; Li, Jinjin; Sode, Olaseni


    Conspectus Molecular crystals are chemists' solids in the sense that their structures and properties can be understood in terms of those of the constituent molecules merely perturbed by a crystalline environment. They form a large and important class of solids including ices of atmospheric species, drugs, explosives, and even some organic optoelectronic materials and supramolecular assemblies. Recently, surprisingly simple yet extremely efficient, versatile, easily implemented, and systematically accurate electronic structure methods for molecular crystals have been developed. The methods, collectively referred to as the embedded-fragment scheme, divide a crystal into monomers and overlapping dimers and apply modern molecular electronic structure methods and software to these fragments of the crystal that are embedded in a self-consistently determined crystalline electrostatic field. They enable facile applications of accurate but otherwise prohibitively expensive ab initio molecular orbital theories such as Møller-Plesset perturbation and coupled-cluster theories to a broad range of properties of solids such as internal energies, enthalpies, structures, equation of state, phonon dispersion curves and density of states, infrared and Raman spectra (including band intensities and sometimes anharmonic effects), inelastic neutron scattering spectra, heat capacities, Gibbs energies, and phase diagrams, while accounting for many-body electrostatic (namely, induction or polarization) effects as well as two-body exchange and dispersion interactions from first principles. They can fundamentally alter the role of computing in the studies of molecular crystals in the same way ab initio molecular orbital theories have transformed research practices in gas-phase physical chemistry and synthetic chemistry in the last half century. In this Account, after a brief summary of formalisms and algorithms, we discuss applications of these methods performed in our group as compelling

  3. Characterization of engineered actin binding proteins that control filament assembly and structure.

    Directory of Open Access Journals (Sweden)

    Crista M Brawley

    Full Text Available BACKGROUND: Eukaryotic cells strictly regulate the structure and assembly of their actin filament networks in response to various stimuli. The actin binding proteins that control filament assembly are therefore attractive targets for those who wish to reorganize actin filaments and reengineer the cytoskeleton. Unfortunately, the naturally occurring actin binding proteins include only a limited set of pointed-end cappers, or proteins that will block polymerization from the slow-growing end of actin filaments. Of the few that are known, most are part of large multimeric complexes that are challenging to manipulate. METHODOLOGY/PRINCIPAL FINDINGS: We describe here the use of phage display mutagenesis to generate of a new class of binding protein that can be targeted to the pointed-end of actin. These proteins, called synthetic antigen binders (sABs, are based on an antibody-like scaffold where sequence diversity is introduced into the binding loops using a novel "reduced genetic code" phage display library. We describe effective strategies to select and screen for sABs that ensure the generated sABs bind to the pointed-end surface of actin exclusively. CONCLUSIONS/SIGNIFICANCE: From our set of pointed-end binders, we identify three sABs with particularly useful properties to systematically probe actin dynamics: one protein that caps the pointed end, a second that crosslinks actin filaments, and a third that severs actin filaments and promotes disassembly.

  4. Ising and Heisenberg models on ferrimagnetic AB sub 2 chains

    CERN Document Server

    Vitoriano, C; Raposo, E P


    We study the Ising and Heisenberg models on one-dimensional ferrimagnetic bipartite chains with the special AB sub 2 unit-cell topology and experimental motivation in inorganic and organic magnetic polymers. The spin-1/2 AB sub 2 Ising case is exactly solved in the presence of an external magnetic field. We also derive asymptotical low- and high-temperature limits of several thermodynamical quantities of the zero-field classical AB sub 2 Heisenberg model. Further, the quantum spin-1/2 AB sub 2 Heisenberg model in a field is studied using a mean-field approach.

  5. Total iron binding capacity (United States)

    ... page: // Total iron binding capacity To use the sharing features on this page, please enable JavaScript. Total iron binding capacity (TIBC) is a blood test to ...

  6. Coordination modes and bonding of sulfur oxides on transition metal surfaces: combined ab initio and BOC-MP results (United States)

    Seller, Harrell; Shustorovich, Evgeny


    Binding energies for sulfur oxides, SO x, x = 1-3, have been determined for several coordination modes on silver, gold and palladium surfaces employing ab initio quantum chemical methods and the bond order conservation Morse potential (BOC-MP) method. SO 2 coordination was studied in the most detail. In general the agreement between the BOC-MP and ab initio binding energies is good for the (111) surfaces of silver and palladium with both methods predicting that, in the zero coverage limit, di-coordination via S,O and O,O will be more favorable energetically than mono-coordination via S. In the case of chemisorption on the Pd (110) surface the two methods agree well for the cases in which there are formulas for the BOC-MP binding energies. In going from the (111) surfaces to the (110) surfaces of silver and palladium the ab initio calculations predict that the preferred chemisorption site shifts from the bridge site to the hollow site. On the silver surfaces the net charge transferred to the adsorbate as judged from the Mulliken populations correlates roughly with the binding energy. No significant charge transfer was found on the palladium surfaces. Our SO 2 chemisorption calculations indicate that the work functions of the metal surfaces examined should increase upon mono-S adsorption, increase to a lesser extent upon di S,O adsorption and may even decrease upon di O,O adsorption. Ab initio calculations provide evidence of the existence of SO 2 surface dimers. The binding energy predicted by the BOC-MP model for SO 3 in the bridging site agrees well with the ab initio result for SO 3 di-coordinated in the long bridge of the Ag(110) surface. The methods yield similar predictions for the case of SO on silver. Our modeling provides a coherent picture consistent with many aspects of the experimental literature. We present some model predictions, particularly the di O,O coordination mode for SO 2, that require verification experimentally.

  7. Taking the Starch out of Oral Biofilm Formation: Molecular Basis and Functional Significance of Salivary α-Amylase Binding to Oral Streptococci


    Nikitkova, Anna E.; Haase, Elaine M.; Scannapieco, Frank A.


    α-Amylase-binding streptococci (ABS) are a heterogeneous group of commensal oral bacterial species that comprise a significant proportion of dental plaque microfloras. Salivary α-amylase, one of the most abundant proteins in human saliva, binds to the surface of these bacteria via specific surface-exposed α-amylase-binding proteins. The functional significance of α-amylase-binding proteins in oral colonization by streptococci is important for understanding how salivary components influence or...

  8. Role of Streptococcus gordonii Amylase-Binding Protein A in Adhesion to Hydroxyapatite, Starch Metabolism, and Biofilm Formation


    Rogers, Jeffrey D.; Palmer, Robert J.; Kolenbrander, Paul E; Scannapieco, Frank A.


    Interactions between bacteria and salivary components are thought to be important in the establishment and ecology of the oral microflora. α-Amylase, the predominant salivary enzyme in humans, binds to Streptococcus gordonii, a primary colonizer of the tooth. Previous studies have implicated this interaction in adhesion of the bacteria to salivary pellicles, catabolism of dietary starches, and biofilm formation. Amylase binding is mediated at least in part by the amylase-binding protein A (Ab...

  9. Recent progress with large-scale ab initio calculations: the CONQUEST code (United States)

    Bowler, D. R.; Choudhury, R.; Gillan, M. J.; Miyazaki, T.

    While the success of density functional theory (DFT) has led to its use in a wide variety of fields such as physics, chemistry, materials science and biochemistry, it has long been recognised that conventional methods are very inefficient for large complex systems, because the memory requirements scale as N 2 and the cpu requirements as N 3 (where N is the number of atoms). The principles necessary to develop methods with linear scaling of the cpu and memory requirements with system size (O(N ) methods) have been established for more than ten years, but only recently have practical codes showing this scaling for DFT started to appear. We report recent progress in the development of the Conquest code, which performs O(N ) DFT calculations on parallel computers, and has a demonstrated ability to handle systems of over 10000 atoms. The code can be run at different levels of precision, ranging from empirical tight-binding, through ab initio tight-binding, to full ab initio , and techniques for calculating ionic forces in a consistent way at all levels of precision will be presented. Illustrations are given of practical Conquest calculations in the strained Ge/Si(001) system.

  10. Plant Hormone Binding Sites


    Napier, Richard


    • Aims Receptors for plant hormones are becoming identified with increasing rapidity, although a frustrating number remain unknown. There have also been many more hormone‐binding proteins described than receptors. This Botanical Briefing summarizes what has been discovered about hormone binding sites, their discovery and descriptions, and will not dwell on receptor functions or activities except where these are relevant to understand binding.

  11. Guiding ab initio calculations by alchemical derivatives (United States)

    to Baben, M.; Achenbach, J. O.; von Lilienfeld, O. A.


    We assess the concept of alchemical transformations for predicting how a further and not-tested change in composition would change materials properties. This might help to guide ab initio calculations through multidimensional property-composition spaces. Equilibrium volumes, bulk moduli, and relative lattice stability of fcc and bcc 4d transition metals Zr, Nb, Mo, Tc, Ru, Rh, Pd, and Ag are calculated using density functional theory. Alchemical derivatives predict qualitative trends in lattice stability while equilibrium volumes and bulk moduli are predicted with less than 9% and 28% deviation, respectively. Predicted changes in equilibrium volume and bulk moduli for binary and ternary mixtures of Rh-Pd-Ag are in qualitative agreement even for predicted bulk modulus changes as large as +100% or -50%. Based on these results, it is suggested that alchemical transformations could be meaningful for enhanced sampling in the context of virtual high-throughput materials screening projects.

  12. Ab Initio Path to Heavy Nuclei

    CERN Document Server

    Binder, Sven; Calci, Angelo; Roth, Robert


    We present the first ab initio calculations of nuclear ground states up into the domain of heavy nuclei, spanning the range from 16-O to 132-Sn based on two- plus three-nucleon interactions derived within chiral effective field theory. We employ the similarity renormalization group for preparing the Hamiltonian and use coupled-cluster theory to solve the many-body problem for nuclei with closed sub-shells. Through an analysis of theoretical uncertainties resulting from various truncations in this framework, we identify and eliminate the technical hurdles that previously inhibited the step beyond medium-mass nuclei, allowing for reliable validations of nuclear Hamiltonians in the heavy regime. Following this path we show that chiral Hamiltonians qualitatively reproduce the systematics of nuclear ground-state energies up to the neutron-rich Sn isotopes.

  13. Operator evolution for ab initio nuclear theory

    CERN Document Server

    Schuster, Micah D; Johnson, Calvin W; Jurgenson, Eric D; Navratil, Petr


    The past two decades have seen a revolution in ab initio calculations of nuclear properties. One key element has been the development of a rigorous effective interaction theory, applying unitary transformations to soften the nuclear Hamiltonian and hence accelerate the convergence as a function of the model space size. For consistency, however, one ought to apply the same transformation to other operators when calculating transitions and mean values from the eigenstates of the renormalized Hamiltonian. Working in a translationally-invariant harmonic oscillator basis for the two- and three-nucleon systems, we evolve the Hamiltonian, square-radius and total dipole strength operators by the similarity renormalization group (SRG). The inclusion of up to three-body matrix elements in the 4He nucleus all but completely restores the invariance of the expectation values under the transformation. We also consider a Gaussian operator with adjustable range and find at short ranges an increased contribution from such ind...

  14. Discovering chemistry with an ab initio nanoreactor (United States)

    Martinez, Todd

    Traditional approaches for modeling chemical reaction networks such as those involved in combustion have focused on identifying individual reactions and using theoretical approaches to explore the underlying mechanisms. Recent advances involving graphical processing units (GPUs), commodity products developed for the videogaming industry, have made it possible to consider a distinct approach wherein one attempts to discover chemical reactions and mechanisms. We provide a brief summary of these developments and then discuss the concept behind the ``ab initio nanoreactor'' which explores the space of possible chemical reactions and molecular species for a given stoichiometry. The nanoreactor concept is exemplified with an example to the Urey-Miller reaction network which has been previously advanced as a potential model for prebiotic chemistry. We briefly discuss some of the future directions envisioned for the development of this nanoreactor concept.

  15. Ab initio molar volumes and Gaussian radii. (United States)

    Parsons, Drew F; Ninham, Barry W


    Ab initio molar volumes are calculated and used to derive radii for ions and neutral molecules using a spatially diffuse model of the electron distribution with Gaussian spread. The Gaussian radii obtained can be used for computation of nonelectrostatic ion-ion dispersion forces that underlie Hofmeister specific ion effects. Equivalent hard-sphere radii are also derived, and these are in reasonable agreement with crystalline ionic radii. The Born electrostatic self-energy is derived for a Gaussian model of the electronic charge distribution. It is shown that the ionic volumes used in electrostatic calculations of strongly hydrated cosmotropic ions ought best to include the first hydration shell. Ionic volumes for weakly hydrated chaotropic metal cations should exclude electron overlap (in electrostatic calculations). Spherical radii are calculated as well as nonisotropic ellipsoidal radii for nonspherical ions, via their nonisotropic static polarizability tensors. PMID:19140766

  16. Ab initio work function of elemental metals

    DEFF Research Database (Denmark)

    Skriver, Hans Lomholt; Rosengaard, N. M.


    We have used a recently developed self-consistent Green’s-function technique based on tight-binding linear-muffin-tin-orbital theory to calculate the work function for the close-packed surfaces of 37 elemental metals. The results agree with the limited experimental data obtained from single...

  17. Ab initio alpha-alpha scattering. (United States)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G


    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  18. Ab initio alpha-alpha scattering (United States)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.


    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  19. Ablation dynamics in laser sclerotomy ab externo (United States)

    Brinkmann, Ralf; Droege, Gerit; Mohrenstecher, Dirk; Scheu, M.; Birngruber, Reginald


    Laser sclerostomy ab externo with flashlamp excited mid-IR laser systems emitting in the 2-3 micrometer spectral range is in phase II clinical trials. Although acutely high success rates were achieved, the restenosis rate after several months is about 40%. Laser pulses of several hundreds of microseconds, known to induce thermo-mechanical explosive evaporation were used for this procedure. We investigated the ablation dynamics in tissue and the cavitation bubble dynamics in water by means of an Er:YAG laser system to estimate the extent of mechanical damage zones in the sclera and in the anterior chamber, which may contribute to the clinical failure. We found substantial mechanical tissue deformation during the ablation process caused by the cavitation effects. Stress waves up to several bar generated by explosive evaporization were measured. The fast mechanical stretching and collapsing of the scleral tissue induced by cavitation resulted in tissue dissection as could be proved by flash photography and histology. The observed high restenosis might be a result of a subsequent enhanced wound healing process. Early fistula occlusions due to iris adherences, observed in about 20% of the clinical cases may be attributed to intraocular trauma induced by vapor bubble expansion through the anterior chamber after scleral perforation. An automatic feedback system minimizing adverse effects by steering and terminating the laser process during scleral fistulization is demonstrated. Moreover, a new approach in laser sclerostomy ab externo is presented using a cw-IR laser diode system emitting at the 1.94 micrometer mid-IR water absorption peak. This system was used in vitro and showed smaller damage zones compared to the pulsed laser radiation.

  20. Abacavir and the altered peptide repertoire model: clinical implications


    Mallal S; Phillips E.


    Structural and biochemical studies showing that abacavir binds non-covalently to the floor of the peptide binding groove of HLA-B*5701 with exquisite specificity to alter the self-peptides that load on the molecule to be presented to the immune system have recently been published [1–4]. This precise mechanistic explanation of why abacavir binds to HLA-B*5701 and no other allele accounts for the 100% negative predictive value of HLA-B*5701 testing for hypersensitivity which underpins it...

  1. Asymmetrical cross-resistance between Bacillus thuringiensis toxins Cry1Ac and Cry2Ab in pink bollworm. (United States)

    Tabashnik, Bruce E; Unnithan, Gopalan C; Masson, Luke; Crowder, David W; Li, Xianchun; Carrière, Yves


    Transgenic crops producing Bacillus thuringiensis (Bt) toxins kill some key insect pests and can reduce reliance on insecticide sprays. Sustainable use of such crops requires methods for delaying evolution of resistance by pests. To thwart pest resistance, some transgenic crops produce 2 different Bt toxins targeting the same pest. This "pyramid" strategy is expected to work best when selection for resistance to 1 toxin does not cause cross-resistance to the other toxin. The most widely used pyramid is transgenic cotton producing Bt toxins Cry1Ac and Cry2Ab. Cross-resistance between these toxins was presumed unlikely because they bind to different larval midgut target sites. Previous results showed that laboratory selection with Cry1Ac caused little or no cross-resistance to Cry2A toxins in pink bollworm (Pectinophora gossypiella), a major cotton pest. We show here, however, that laboratory selection of pink bollworm with Cry2Ab caused up to 420-fold cross-resistance to Cry1Ac as well as 240-fold resistance to Cry2Ab. Inheritance of resistance to high concentrations of Cry2Ab was recessive. Larvae from a laboratory strain resistant to Cry1Ac and Cry2Ab in diet bioassays survived on cotton bolls producing only Cry1Ac, but not on cotton bolls producing both toxins. Thus, the asymmetrical cross-resistance seen here does not threaten the efficacy of pyramided Bt cotton against pink bollworm. Nonetheless, the results here and previous evidence indicate that cross-resistance occurs between Cry1Ac and Cry2Ab in some key cotton pests. Incorporating the potential effects of such cross-resistance in resistance management plans may help to sustain the efficacy of pyramided Bt crops. PMID:19581574

  2. Attention Alters Perceived Attractiveness. (United States)

    Störmer, Viola S; Alvarez, George A


    Can attention alter the impression of a face? Previous studies showed that attention modulates the appearance of lower-level visual features. For instance, attention can make a simple stimulus appear to have higher contrast than it actually does. We tested whether attention can also alter the perception of a higher-order property-namely, facial attractiveness. We asked participants to judge the relative attractiveness of two faces after summoning their attention to one of the faces using a briefly presented visual cue. Across trials, participants judged the attended face to be more attractive than the same face when it was unattended. This effect was not due to decision or response biases, but rather was due to changes in perceptual processing of the faces. These results show that attention alters perceived facial attractiveness, and broadly demonstrate that attention can influence higher-level perception and may affect people's initial impressions of one another. PMID:26966228

  3. Aqueous Cation-Amide Binding: Free Energies and IR Spectral Signatures by Ab Initio Molecular Dynamics

    Czech Academy of Sciences Publication Activity Database

    Pluhařová, Eva; Baer, M. D.; Mundy, C. J.; Schmidt, B.; Jungwirth, Pavel


    Roč. 5, č. 13 (2014), s. 2235-2240. ISSN 1948-7185 R&D Projects: GA MŠk LH12001 Institutional support: RVO:61388963 Keywords : sodium * calcium * N -methylacetamide * peptide bond * umbrella sampling Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 7.458, year: 2014

  4. Antigen-binding site protection during radiolabeling leads to a higher immunoreactive fraction

    International Nuclear Information System (INIS)

    It is generally accepted that the immunointegrity of an antibody (Ab) depends on the preservation of its antigen-binding sites. Our goal was to radiolabel an antibody at several iodine:antibody molar ratios under conditions protecting its combining site and to compare its immunoreactive fraction (IRF) and electrophoretic mobility with those of the same antibody radiolabeled without protection. The data indicate that an antibody radiolabeled while its antigen-binding site is occupied by its antigen had the same IRF, regardless of the number of iodine atoms per antibody molecule. On the other hand, even at an I:Ab ratio of 1:1, the IRF of the same antibody radiolabeled without protection was lower than that of a protected one and decreased with increasing I:Ab ratios. In addition, the iodination of these Ab changes their electrophoretic mobility; however, when the Ab is labeled in the protected state, the degree of change is less. The binding of an antibody to its antigen prior to radiolabeling, therefore, enhances its immuno-integrity and prevents major conformational changes as reflected by electrophoresis

  5. Dicty_cDB: FCL-AB06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AB06 (Link to dictyBase) - - - Contig-U15603-1 FCL-AB06P ...(Link to Original site) FCL-AB06F 694 FCL-AB06Z 573 FCL-AB06P 1267 - - Show FCL-AB06 Library FCL (Link to library) Clone ID FCL-...3-1 Original site URL Representative seq. ID FCL-AB06P (Link to Original site) Representative DNA sequence >FCL-AB06 (FCL-AB06Q) /CSM/FCL/FCL-...AB/FCL-AB06Q.Seq.d/ CAATTTTATCGGAACCATCAATTCATGCAGGTTCTGTATTTAGTATTAATTTAACCAAAT CTAGACA

  6. Detection of pulmonary embolism with 99mTc-Labeled F(ab)2 fragment of anti-P-selectin monoclonal antibody in dogs

    International Nuclear Information System (INIS)

    Pulmonary embolism is a common and potentially life-threatening condition, and its correct diagnosis is highly desirable before anticoagulant therapy is initiated. However, the safe and accurate diagnosis of acute pulmonary embolism remains a challenge. Single photon emission computed tomography (SPECT) is a highly sensitive scintigraphic imaging technique. Pulmonary embolism can be detected by SPECT with 99mTc-labeled imaging agents that bind to components present predominantly on thromboemboli. P-selectin is an adhesion glycoprotein that is expressed in platelets and endothelial cells. P-selectin on activated platelets is a suitable biomarker of the active thrombus process. The objective of this study was to evaluate 99mTc-labeled F(ab)2 fragment of anti-P-selectin monoclonal antibody SZ51, 99mTc-SZ51-F(ab)2, for imaging pulmonary embolism in beagle canines. SZ51 was digested to F(ab)2 fragment, named SZ51-F(ab)2, and its specific binding to P-selectin on either human or canine platelets was verified by flow cytometry assay. In each dog, an 18-gauge catheter was inserted into left or right pulmonary artery, and a two-stranded spiral stainless-steel coil (20 mm) was inserted through catheter. At 30 min after coil placement, X-ray angiography was performed to document the pulmonary embolism and the locations of the coil. After intravenous injection of 99mTc-SZ51-F(ab)2, experimental thrombi in dogs could be consistently visualized for 2-3 hours by SPECT. Pulmonary embolism showed higher uptake of 99mTc-SZ51-F(ab)2. The present study suggests that 99mTc-SZ51-F(ab)2 may be a promising agent for detecting pulmonary embolism. (author)

  7. Regulation of insulin-like growth factor-I (IGF-I) and IGF-binding proteins by tumor necrosis factor. (United States)

    Fan, J; Char, D; Bagby, G J; Gelato, M C; Lang, C H


    The purpose of the present study was to determine 1) whether exogenous administration of tumor necrosis factor-alpha (TNF-alpha) alters insulin-like growth factor-I (IGF-I) and IGF-binding proteins (BPs) and 2) whether the enhanced endogenous production of TNF mediates the lipopolysaccharide (LPS)-induced changes in the IGF system. The overnight infusion of murine TNF-alpha reduced circulating concentrations of both growth hormone (GH) and IGF-I in fasted rats. Furthermore, TNF-alpha decreased IGF-I content in liver, gastrocnemius muscle, and pituitary. In contrast, TNF-alpha increased IGF-I content in kidney and brain. IGFBP-1 was increased in plasma, liver, and muscle in response to TNF-alpha. In a second study, rats were injected with LPS after treatment with a neutralizing anti-TNF antibody (Ab), and blood and tissues were collected 4 h later. In LPS-treated rats, plasma concentrations of GH and IGF-I were reduced. LPS also decreased the IGF-I content in liver and skeletal muscle and increased plasma, liver, and muscle concentrations of IGFBP-1. Pretreatment with anti-TNF Ab attenuated the LPS-induced reduction in IGF-I and the increased IGFBP-1 in plasma and liver and completely prevented the decrease in IGF-I observed in muscle. In contrast, the LPS-induced decrease in plasma GH and the increased IGFBP-1 observed in muscle were unaltered by the anti-TNF Ab.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7503312

  8. A Case of Laptop Computer-Induced Erythema Ab Igne

    Directory of Open Access Journals (Sweden)

    Nurettin Özgür Doğan


    Full Text Available Erythema ab igne, also known as toasted skin syndrome, is a skin reaction characterized by reticulate erythema, brown pigmentation, and telangiectasia. In some cases, epidermal atrophy and scaling are also identified. The condition is usually caused by prolonged exposure to a source of heat or infrared radiation. Here, we report a case of erythema ab igne associated with laptop computer use.

  9. Kopplung von Dichtefunktional- und ab-initio-Methoden


    Goll, Erich


    Im Rahmen der Doktorarbeit wurde untersucht, inwieweit die Kopplung von Dichtefunktionalmethoden und ab-initio-Korrelationsmethoden der Quantenchemie eine Verbesserung bezüglich beider Grenzmethoden erbringt. Die Kopplung erfolgt durch eine Aufspaltung des interelektronischen Hamiltonoperators (abstoßende Coulombwechselwirkung). Die kurzreichweitige Wechselwirkung wird mit Dichtefunktionaltheorie behandelt, die langreichweitige mit Hilfe von ab-initio-Methoden. Diese Aufteilung soll dazu dien...

  10. Use of monoclonal antibodies for the characterization of novel DNA- binding proteins recognized by human autoimmune sera



    Autoantibodies to a DNA-binding heterodimer consisting of 70,000 and 80,000 dalton subunits were identified in 30-50% of human autoimmune sera from patients with systemic lupus erythematosus (SLE), mixed connective tissue disease (MCTD), and scleroderma. Three murine monoclonal antibodies (mAb) against the heterodimer were produced in BALB/c mice by immunizing with isolated human B cell nuclei. By immunofluorescence, the mAb and autoimmune sera demonstrated both speckled nucleoplasmic stainin...

  11. Antibodies That Efficiently Form Hexamers upon Antigen Binding Can Induce Complement-Dependent Cytotoxicity under Complement-Limiting Conditions (United States)

    Cook, Erika M.; Lindorfer, Margaret A.; van der Horst, Hilma; Oostindie, Simone; Beurskens, Frank J.; Schuurman, Janine; Zent, Clive S.; Burack, Richard; Parren, Paul W. H. I.


    Recently, we demonstrated that IgG Abs can organize into ordered hexamers after binding their cognate Ags expressed on cell surfaces. This process is dependent on Fc:Fc interactions, which promote C1q binding, the first step in classical pathway complement activation. We went on to engineer point mutations that stimulated IgG hexamer formation and complement-dependent cytotoxicity (CDC). The hexamer formation–enhanced (HexaBody) CD20 and CD38 mAbs support faster, more robust CDC than their wild-type counterparts. To further investigate the CDC potential of these mAbs, we used flow cytometry, high-resolution digital imaging, and four-color confocal microscopy to examine their activity against B cell lines and primary chronic lymphocytic leukemia cells in sera depleted of single complement components. We also examined the CDC activity of alemtuzumab (anti-CD52) and mAb W6/32 (anti-HLA), which bind at high density to cells and promote substantial complement activation. Although we observed little CDC for mAb-opsonized cells reacted with sera depleted of early complement components, we were surprised to discover that the Hexabody mAbs, as well as ALM and W6/32, were all quite effective at promoting CDC in sera depleted of individual complement components C6 to C9. However, neutralization studies conducted with an anti-C9 mAb verified that C9 is required for CDC activity against cell lines. These highly effective complement-activating mAbs efficiently focus activated complement components on the cell, including C3b and C9, and promote CDC with a very low threshold of MAC binding, thus providing additional insight into their enhanced efficacy in promoting CDC. PMID:27474078

  12. Positron Emission Tomography Imaging of Tumor Angiogenesis with a 61/64Cu-Labeled F(ab')2 Antibody Fragment


    Hong, Hao; Zhang, Yin; Orbay, Hakan; Valdovinos, Hector F.; Nayak, Tapas R.; Bean, Jero; Theuer, Charles P.; Barnhart, Todd E.; Cai, Weibo


    The objective of this study was to characterize the in vitro and in vivo properties of the F(ab')2 fragment of TRC105, a human/murine chimeric IgG1 monoclonal antibody that binds with high avidity to human and murine CD105 (i.e. endoglin), and investigate its potential for positron emission tomography (PET) imaging of tumor angiogenesis after 61/64Cu-labeling. TRC105-F(ab')2 of high purity was produced by pepsin digestion of TRC105, which was confirmed by SDS-PAGE, HPLC analysis, and mass spe...

  13. Dead cells in melanoma tumors provide abundant antigen for targeted delivery of ionizing radiation by a mAb to melanin


    Dadachova, Ekaterina; Nosanchuk, Joshua D.; Shi, Li; Schweitzer, Andrew D.; Frenkel, Annie; Nosanchuk, Jerome S.; Casadevall, Arturo


    Melanoma is a cancer with a rising incidence, and metastatic disease is almost always lethal. We investigated the feasibility of targeting melanin, an intracellular melanocyte pigment, to deliver cytotoxic radiation to human melanoma cells in vivo by using a melanin-binding mAb (6D2). Nude mice bearing MNT1 pigmented human melanoma tumors were treated with mAb 6D2 labeled with 1.5 mCi (1 Ci = 37 GBq) of the β-emitter 188-Rhenium (188Re) and manifested inhibition of tumor growth and prolonged ...

  14. Metabolism of myristicin by Depressaria pastinacella CYP6AB3v2 and inhibition by its metabolite. (United States)

    Mao, Wenfu; Zangerl, Arthur R; Berenbaum, May R; Schuler, Mary A


    Although methylenedioxyphenyl (MDP) compounds, such as myristicin, are useful in the management of insecticide-resistant insects, the molecular mechanisms for their action in mammals and insects have not been elucidated. In this study, GC-MS analyses of methanol extracts of foliage of wild parsnip (Pastinaca sativa) have identified myristicin as a substrate for CYP6AB3v2, an imperatorin-metabolizing cytochrome P450 monooxygenase from Depressaria pastinacella (parsnip webworm). In contrast with its strong inhibitory effects on many mammalian P450s, myristicin is effectively metabolized by CYP6AB3v2 (V(max) and K(m) of 97.9 pmol/min/pmol P450 and 17.9 microM, respectively) at a rate exceeding that recorded previously for imperatorin, the only other known substrate for this highly specialized enzyme. The myristicin metabolite of CYP6AB3v2 is 1-(3',4'-methylenedioxy-5'-methoxyphenyl)-2,3-epoxypropane. Molecular dockings have indicated that, unlike other epoxide metabolites of furanocoumarins, this epoxide metabolite is likely to remain in the CYP6AB3v2 catalytic site due to its low binding energy (-31.0 kcal/mol). Inhibition assays indicate that myristicin acts as a mixed inhibitor of this insect P450 and suggest that the epoxide metabolite may be an intermediate involved in the formation of P450-methylenedioxyphenyl complexes. PMID:18510976

  15. Effects of Cry1F and Cry34Ab1/35Ab1 on storage pests (United States)

    Two crystalline protoxins from Bacillus thuringiensis (Bt), Cry1Fa1 and Cry34Ab1/Cry35Ab1 (Cry1F, Cry34/35), were evaluated for efficacy against lepidopteran and coleopteran storage pests. Cry1F was tested against the lepidopterans Sitotroga cerealella (Angoumois grain moth) and colonies of the lep...

  16. Protein Dynamics in an RNA Binding Protein (United States)

    Hall, Kathleen


    Using ^15N NMR relaxation measurements, analyzed with the Lipari-Szabo formalism, we have found that the human U1A RNA binding protein has ps-ns motions in those loops that make contact with RNA. Specific mutations can alter the extent and pattern of motions, and those proteins inevitably lose RNA binding affinity. Proteins with enhanced mobility of loops and termini presumably lose affinity due to increased conformational sampling by those parts of the protein that interact directly with RNA. There is an entropic penalty associated with locking down those elements upon RNA binding, in addition to a loss of binding efficiency caused by the increased number of conformations adopted by the protein. However, in addition to local conformational heterogeneity, analysis of molecular dynamics trajectories by Reorientational Eigenmode Dynamics reveals that loops of the wild type protein undergo correlated motions that link distal sites across the binding surface. Mutations that disrupt correlated motions result in weaker RNA binding, implying that there is a network of interactions across the surface of the protein. (KBH was a Postdoctoral Fellow with Al Redfield from 1985-1990). This work was supported by the NIH (to KBH) and NSF (SAS).

  17. Preparation of grafted ABS and compatibilization of r-PET/ABS blends by the grafted ABS%ABS接枝物的制备及其对r-PET/ABS的增容作用

    Institute of Scientific and Technical Information of China (English)

    陈智军; 王益龙; 郑辰


    Two kinds of grafted acrylonitrile-butadiene-styrene copolymer(ABS), i.e. maleic anhydride (MAH) grafted ABS(ABS-g-MAH) and glycidyl methacrylate (GMA) grafted ABS (ABS-g-GMA), were prepared via reactive extrusion and were used as compatibilizer for recycled polyethylene glycol terephthalate (r-PET)/ABS blends. The results show that ABS-g-MAH and ABS-g-GMA can greatly improve the impact strength of the blends. ABS-g-MAH is superior to ABS-g-GMA in compatibilization effect. The optimal compatibilization effect is acquired when the grafting ratio of ABS-g-MAH is 1.35% and the mass content of the copolymer is 5%. Under such conditions, the notched and unnotched *Charpy impact strength of the r-PET/ABS/ABS-g--MAH blends rise by 42% and 23%, respectively, in comparison with those of r-PET/ ABS. The observation by scanning electron microscope(SEM) shows that adding grafted ABS can make ABS be dispersed more homogeneously in the r-PET continuous phase and make particle size more even.%通过反应挤出法制备马来酸酐(MAH)接枝丙烯腈-丁二烯-苯乙烯三元共聚物(ABS)(ABS-g-MAH)和甲基丙烯酸缩水甘油酯(GMA)接枝ABS(ABS-g-GMA),将其用于增容回收聚对苯二甲酸乙二酯(PET)瓶片(r-PET)/ABS共混物,发现能显著提高其混物的冲击强度.ABS-g-MAH的增容效果优于ABS-g-GMA;ABS-g-MAH的接枝率为1.35%,w(ABS-g-MAH)为5%时对r-PET/ABS的增容作用最佳,此时r-PET/ABS/ABS-g-MAH的简支梁缺口冲击强度和无缺口冲击强度比r-PET/ABS分别提高了42%和23%.扫描电子显微镜观察表明,加入ABS接枝物能使ABS在r-PET连续相中的分散更均匀,粒径尺寸更均一.

  18. Large-scale quantitative assessment of binding preferences in protein - nucleic acid complexes

    Czech Academy of Sciences Publication Activity Database

    Jakubec, Dávid; Vondrášek, Jiří


    Roč. 22, č. 1 (2015), s. 12. ISSN 1211-5894. [Discussions in Structural Molecular Biology . Annual Meeting of the Czech Society for Structural Biology /13./. 19.03.2015-21.03.2015, Nové Hrady] Institutional support: RVO:61388963 Keywords : DNA * binding preferences * ab initio calculations Subject RIV: CE - Biochemistry

  19. Oligomerization of mannan-binding lectin dictates binding properties and complement activation

    DEFF Research Database (Denmark)

    Kjaer, Troels R; Jensen, Lisbeth; Hansen, Annette;


    altered self-surfaces. Associated with the collagen-like stems of these PRMs are three mannan-binding lectin (MBL)-associated serine proteases (MASPs) and two MBL-associated proteins (MAps). The most studied of the PRMs, MBL, is present in serum mainly as trimeric and tetrameric oligomers of the...... structural subunit. We hypothesized that oligomerization of MBL may influence both the potential to bind to microorganisms and the interaction with the MASPs and MAps, thus influencing the ability to initiate complement activation. When testing binding at 37°C, we found higher binding of tetrameric MBL to...... Staphylococcus aureus (S. aureus) than trimeric and dimeric MBL. In serum, we found that tetrameric MBL was the main oligomeric form present in complexes with the MASPs and MAp44. Such preference was confirmed using purified forms of recombinant MBL (rMBL) oligomers, where tetrameric rMBL interacted stronger...

  20. Structural and biophysical characterization of Bacillus thuringiensis insecticidal proteins Cry34Ab1 and Cry35Ab1.

    Directory of Open Access Journals (Sweden)

    Matthew S Kelker

    Full Text Available Bacillus thuringiensis strains are well known for the production of insecticidal proteins upon sporulation and these proteins are deposited in parasporal crystalline inclusions. The majority of these insect-specific toxins exhibit three domains in the mature toxin sequence. However, other Cry toxins are structurally and evolutionarily unrelated to this three-domain family and little is known of their three dimensional structures, limiting our understanding of their mechanisms of action and our ability to engineer the proteins to enhance their function. Among the non-three domain Cry toxins, the Cry34Ab1 and Cry35Ab1 proteins from B. thuringiensis strain PS149B1 are required to act together to produce toxicity to the western corn rootworm (WCR Diabrotica virgifera virgifera Le Conte via a pore forming mechanism of action. Cry34Ab1 is a protein of ∼14 kDa with features of the aegerolysin family (Pfam06355 of proteins that have known membrane disrupting activity, while Cry35Ab1 is a ∼44 kDa member of the toxin_10 family (Pfam05431 that includes other insecticidal proteins such as the binary toxin BinA/BinB. The Cry34Ab1/Cry35Ab1 proteins represent an important seed trait technology having been developed as insect resistance traits in commercialized corn hybrids for control of WCR. The structures of Cry34Ab1 and Cry35Ab1 have been elucidated to 2.15 Å and 1.80 Å resolution, respectively. The solution structures of the toxins were further studied by small angle X-ray scattering and native electrospray ion mobility mass spectrometry. We present here the first published structure from the aegerolysin protein domain family and the structural comparisons of Cry34Ab1 and Cry35Ab1 with other pore forming toxins.

  1. Receptor binding studies of the living heart

    International Nuclear Information System (INIS)

    Receptors form a class of intrinsic membrane proteins (or glycoproteins) defined by the high affinity and specificity with which they bind ligands. Many receptors are associated directly or indirectly with membrane ion channels that open or close after a conformational change of the receptor induced by the binding of the neurotransmitter. Changes in number and/or affinity of cardiac neurotransmitter receptors have been associated with myocardial ischemia and infarction, congestive heart failure, and cardiomyopathy as well as diabetes or thyroid-induced heart muscle disease. These alterations of cardiac receptors have been demonstrated in vitro on membrane homogenates from samples collected mainly during surgery or postmortem. The disadvantage of these in vitro binding techniques is that receptors lose their natural environment and their relationships with the other components of the tissue

  2. Ab initio gene identification in metagenomic sequences. (United States)

    Zhu, Wenhan; Lomsadze, Alexandre; Borodovsky, Mark


    We describe an algorithm for gene identification in DNA sequences derived from shotgun sequencing of microbial communities. Accurate ab initio gene prediction in a short nucleotide sequence of anonymous origin is hampered by uncertainty in model parameters. While several machine learning approaches could be proposed to bypass this difficulty, one effective method is to estimate parameters from dependencies, formed in evolution, between frequencies of oligonucleotides in protein-coding regions and genome nucleotide composition. Original version of the method was proposed in 1999 and has been used since for (i) reconstructing codon frequency vector needed for gene finding in viral genomes and (ii) initializing parameters of self-training gene finding algorithms. With advent of new prokaryotic genomes en masse it became possible to enhance the original approach by using direct polynomial and logistic approximations of oligonucleotide frequencies, as well as by separating models for bacteria and archaea. These advances have increased the accuracy of model reconstruction and, subsequently, gene prediction. We describe the refined method and assess its accuracy on known prokaryotic genomes split into short sequences. Also, we show that as a result of application of the new method, several thousands of new genes could be added to existing annotations of several human and mouse gut metagenomes. PMID:20403810

  3. Ab initio two-component Ehrenfest dynamics

    International Nuclear Information System (INIS)

    We present an ab initio two-component Ehrenfest-based mixed quantum/classical molecular dynamics method to describe the effect of nuclear motion on the electron spin dynamics (and vice versa) in molecular systems. The two-component time-dependent non-collinear density functional theory is used for the propagation of spin-polarized electrons while the nuclei are treated classically. We use a three-time-step algorithm for the numerical integration of the coupled equations of motion, namely, the velocity Verlet for nuclear motion, the nuclear-position-dependent midpoint Fock update, and the modified midpoint and unitary transformation method for electronic propagation. As a test case, the method is applied to the dissociation of H2 and O2. In contrast to conventional Ehrenfest dynamics, this two-component approach provides a first principles description of the dynamics of non-collinear (e.g., spin-frustrated) magnetic materials, as well as the proper description of spin-state crossover, spin-rotation, and spin-flip dynamics by relaxing the constraint on spin configuration. This method also holds potential for applications to spin transport in molecular or even nanoscale magnetic devices

  4. Python bindings for libcloudph++


    Jarecka, Dorota; Arabas, Sylwester; Del Vento, Davide


    This technical note introduces the Python bindings for libcloudph++. The libcloudph++ is a C++ library of algorithms for representing atmospheric cloud microphysics in numerical models. The bindings expose the complete functionality of the library to the Python users. The bindings are implemented using the Boost.Python C++ library and use NumPy arrays. This note includes listings with Python scripts exemplifying the use of selected library components. An example solution for using the Python ...

  5. The β-propeller gene Rv1057 of Mycobacterium tuberculosis has a complex promoter directly regulated by both the MprAB and TrcRS two-component systems (United States)

    Pang, Xiuhua; Cao, Guangxiang; Neuenschwander, Pierre F.; Haydel, Shelley E.; Hou, Guihua; Howard, Susan T.


    SUMMARY The β-propeller gene Rv1057 of Mycobacterium tuberculosis is activated by envelope stress and was first characterized as a regulatory target of the TrcRS two-component system (TCS). Rv1057 expression is repressed by TrcRS, and the Rv1057 proximal promoter contains a TrcR binding site. In this study, we determined that Rv1057 is also directly regulated by MprAB, a TCS associated with envelope stress. Multiple potential MprA binding sites (MprA boxes) were identified in the 1 kb intergenic region upstream of Rv1057, and four sites were shown to bind MprA. Although MprA boxes were found in the proximal promoter, analyses suggest that MprA and TrcR do not compete for binding in this region. An MprAB-dependent, detergent-inducible transcriptional start point for Rv1057 was identified downstream of the MprA boxes, and a second TrcR binding site and small ORF of the 13E12 family were discovered in the distal promoter. MprAB was required for activation of Rv1057 during growth in macrophages and under detergent stress, and lacZ promoter constructs suggest the entire intergenic region is utilized during MprAB-dependent activation of Rv1057. These findings indicate that Rv1057 has an extensive and complex promoter, and provide evidence for coordinated regulation of stress response genes by TCSs. PMID:22099420

  6. DNS & Bind Cookbook

    CERN Document Server

    Liu, Cricket


    The DNS & BIND Cookbook presents solutions to the many problems faced by network administrators responsible for a name server. Following O'Reilly's popular problem-and-solution cookbook format, this title is an indispensable companion to DNS & BIND, 4th Edition, the definitive guide to the critical task of name server administration. The cookbook contains dozens of code recipes showing solutions to everyday problems, ranging from simple questions, like, "How do I get BIND?" to more advanced topics like providing name service for IPv6 addresses. It's full of BIND configuration files that yo

  7. Python bindings for libcloudph++

    CERN Document Server

    Jarecka, Dorota; Del Vento, Davide


    This technical note introduces the Python bindings for libcloudph++. The libcloudph++ is a C++ library of algorithms for representing atmospheric cloud microphysics in numerical models. The bindings expose the complete functionality of the library to the Python users. The bindings are implemented using the Boost.Python C++ library and use NumPy arrays. This note includes listings with Python scripts exemplifying the use of selected library components. An example solution for using the Python bindings to access libcloudph++ from Fortran is presented.

  8. Binding affinity and specificity of neuromyelitis optica autoantibodies to aquaporin-4 M1/M23 isoforms and orthogonal arrays. (United States)

    Crane, Jonathan M; Lam, Chiwah; Rossi, Andrea; Gupta, Tripta; Bennett, Jeffrey L; Verkman, A S


    Autoantibodies against astrocyte water channel aquaporin-4 (AQP4) are highly specific for the neuroinflammatory disease neuromyelitis optica (NMO). We measured the binding of NMO autoantibodies to AQP4 in human astrocyte-derived U87MG cells expressing M1 and/or M23 AQP4, or M23 mutants that do not form orthogonal array of particles (OAPs). Binding affinity was quantified by two-color fluorescence ratio imaging of cells stained with NMO serum or a recombinant monoclonal NMO autoantibody (NMO-rAb), together with a C terminus anti-AQP4 antibody. NMO-rAb titrations showed binding with dissociation constants down to 44 ± 7 nm. Different NMO-rAbs and NMO patient sera showed a wide variation in NMO-IgG binding to M1 versus M23 AQP4. Differences in binding affinity rather than stoichiometry accounted for M1 versus M23 binding specificity, with consistently greater affinity of NMO-IgG binding to M23 than M1 AQP4. Binding and OAP measurements in cells expressing different M1:M23 ratios or AQP4 mutants indicated that the differential binding of NMO-IgG to M1 versus M23 was due to OAP assembly rather than to differences in the M1 versus M23 N termini. Purified Fab fragments of NMO-IgG showed similar patterns of AQP4 isoform binding, indicating that structural changes in the AQP4 epitope upon array assembly, and not bivalent cross-linking of whole IgG, result in the greater binding affinity to OAPs. Our study establishes a quantitative assay of NMO-IgG binding to AQP4 and indicates remarkable, OAP-dependent heterogeneity in NMO autoantibody binding specificity. PMID:21454592

  9. On the hierarchical parallelization of ab initio simulations

    CERN Document Server

    Ruiz-Barragan, Sergi; Shiga, Motoyuki


    A hierarchical parallelization has been implemented in a new unified code PIMD-SMASH for ab initio simulation where the replicas and the Born-Oppenheimer forces are parallelized. It is demonstrated that ab initio path integral molecular dynamics simulations can be carried out very efficiently for systems up to a few tens of water molecules. The code was then used to study a Diels-Alder reaction of cyclopentadiene and butenone by ab initio string method. A reduction in the reaction energy barrier is found in the presence of hydrogen-bonded water, in accordance with experiment.

  10. Ab initio and experimental study of the interaction of nitrous oxide with the isolated hydroxyl of silica (United States)

    Garrone, E.; Ugliengo, P.; Ghiotti, G.; Borello, E.; Saunders, V. R.


    High-quality ab initio computational results for the interaction of N 2O with the silanol molecule H 3SiOH, taken as representative of the isolated hydroxyl at the silica surface, are compared with IR data concerning the real system measured at 195 K. Besides a non-specific interaction, features typical of hydrogen bonding are observed: two types of complexes are formed simultaneously, differing in their 2 v1 mode, probably one nitrogen-bonded, the other oxygen-bonded. Ab initio results are in excellent agreement as far as binding energies are concerned: the two complexes show comparable stabilities, once electron correlation has been taken into account; however, SCF-calculated IR features do not allow a definite vibrational assignment of the two complexes.

  11. High adsorption capacity of heavy metals on two-dimensional MXenes: an ab initio study with molecular dynamics simulation. (United States)

    Guo, Xun; Zhang, Xitong; Zhao, Shijun; Huang, Qing; Xue, Jianming


    Density functional theory (DFT) calculation is employed to study the adsorption properties of Pb and Cu on recently synthesized two-dimensional materials MXenes, including Ti3C2, V2C1 and Ti2C1. The influence of surface decoration with functional groups such as H, OH and F have also been investigated. Most of these studied MXenes exhibit excellent capability to adsorb Pb and Cu, especially the adsorption capacity of Pb on Ti2C1 is as high as 2560 mg g(-1). Both the binding energies and the adsorption capacities are sensitive to the functional groups attached to the MXenes' surface. Ab initio molecular dynamics (ab-init MD) simulation confirms that Ti2C1 remains stable at room temperature after adsorbing Pb atoms. Our calculations imply that these newly emerging two-dimensional MXenes are promising candidates for wastewater treatment and ion separation. PMID:26602974

  12. Recombinant norovirus-specific scFv inhibit virus-like particle binding to cellular ligands

    Directory of Open Access Journals (Sweden)

    Hardy Michele E


    Full Text Available Abstract Background Noroviruses cause epidemic outbreaks of gastrointestinal illness in all age-groups. The rapid onset and ease of person-to-person transmission suggest that inhibitors of the initial steps of virus binding to susceptible cells have value in limiting spread and outbreak persistence. We previously generated a monoclonal antibody (mAb 54.6 that blocks binding of recombinant norovirus-like particles (VLP to Caco-2 intestinal cells and inhibits VLP-mediated hemagglutination. In this study, we engineered the antigen binding domains of mAb 54.6 into a single chain variable fragment (scFv and tested whether these scFv could function as cell binding inhibitors, similar to the parent mAb. Results The scFv54.6 construct was engineered to encode the light (VL and heavy (VH variable domains of mAb 54.6 separated by a flexible peptide linker, and this recombinant protein was expressed in Pichia pastoris. Purified scFv54.6 recognized native VLPs by immunoblot, inhibited VLP-mediated hemagglutination, and blocked VLP binding to H carbohydrate antigen expressed on the surface of a CHO cell line stably transfected to express α 1,2-fucosyltransferase. Conclusion scFv54.6 retained the functional properties of the parent mAb with respect to inhibiting norovirus particle interactions with cells. With further engineering into a form deliverable to the gut mucosa, norovirus neutralizing antibodies represent a prophylactic strategy that would be valuable in outbreak settings.

  13. Nuclear binding near a quantum phase transition

    CERN Document Server

    Elhatisari, Serdar; Rokash, Alexander; Alarcón, Jose Manuel; Du, Dechuan; Klein, Nico; Lu, Bing-nan; Meißner, Ulf-G; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Lee, Dean; Rupak, Gautam


    How do protons and neutrons bind to form nuclei? This is the central question of ab initio nuclear structure theory. While the answer may seem as simple as the fact that nuclear forces are attractive, the full story is more complex and interesting. In this work we present numerical evidence from ab initio lattice simulations showing that nature is near a quantum phase transition, a zero-temperature transition driven by quantum fluctuations. Using lattice effective field theory, we perform Monte Carlo simulations for systems with up to twenty nucleons. For even and equal numbers of protons and neutrons, we discover a first-order transition at zero temperature from a Bose-condensed gas of alpha particles (4He nuclei) to a nuclear liquid. Whether one has an alpha-particle gas or nuclear liquid is determined by the strength of the alpha-alpha interactions, and we show that the alpha-alpha interactions depend on the strength and locality of the nucleon-nucleon interactions. The existence of the nearby first-order ...

  14. Risperidone treatment increases CB1 receptor binding in rat brain

    DEFF Research Database (Denmark)

    Secher, Anna; Husum, Henriette; Holst, Birgitte;


    showed that risperidone treatment altered CB(1) receptor binding in the rat brain. Risperidone-induced adiposity and metabolic dysfunction in the clinic may be explained by increased CB(1) receptor density in brain regions involved in appetite and regulation of metabolic function....... positively correlated with visceral fat mass. Risperidone treatment increased CB(1) receptor binding in the arcuate nucleus (40%), hippocampus (25-30%) and amygdala (35%) without concurrent alterations in the CB(1) receptor mRNA. Risperidone treatment increased adiponectin mRNA. CONCLUSION: The present study...

  15. Melanin-binding radiopharmaceuticals

    Energy Technology Data Exchange (ETDEWEB)

    Packer, S; Fairchild, R G; Watts, K P; Greenberg, D; Hannon, S J


    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed. (PSB)

  16. Melanin-binding radiopharmaceuticals

    International Nuclear Information System (INIS)

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed

  17. DNS BIND Server Configuration

    Directory of Open Access Journals (Sweden)

    Radu MARSANU


    Full Text Available After a brief presentation of the DNS and BIND standard for Unix platforms, the paper presents an application which has a principal objective, the configuring of the DNS BIND 9 server. The general objectives of the application are presented, follow by the description of the details of designing the program.

  18. Ab initio molecular dynamics with nuclear quantum effects at classical cost: Ring polymer contraction for density functional theory (United States)

    Marsalek, Ondrej; Markland, Thomas E.


    Path integral molecular dynamics simulations, combined with an ab initio evaluation of interactions using electronic structure theory, incorporate the quantum mechanical nature of both the electrons and nuclei, which are essential to accurately describe systems containing light nuclei. However, path integral simulations have traditionally required a computational cost around two orders of magnitude greater than treating the nuclei classically, making them prohibitively costly for most applications. Here we show that the cost of path integral simulations can be dramatically reduced by extending our ring polymer contraction approach to ab initio molecular dynamics simulations. By using density functional tight binding as a reference system, we show that our ring polymer contraction scheme gives rapid and systematic convergence to the full path integral density functional theory result. We demonstrate the efficiency of this approach in ab initio simulations of liquid water and the reactive protonated and deprotonated water dimer systems. We find that the vast majority of the nuclear quantum effects are accurately captured using contraction to just the ring polymer centroid, which requires the same number of density functional theory calculations as a classical simulation. Combined with a multiple time step scheme using the same reference system, which allows the time step to be increased, this approach is as fast as a typical classical ab initio molecular dynamics simulation and 35× faster than a full path integral calculation, while still exactly including the quantum sampling of nuclei. This development thus offers a route to routinely include nuclear quantum effects in ab initio molecular dynamics simulations at negligible computational cost.

  19. Ab initio molecular dynamics with nuclear quantum effects at classical cost: Ring polymer contraction for density functional theory. (United States)

    Marsalek, Ondrej; Markland, Thomas E


    Path integral molecular dynamics simulations, combined with an ab initio evaluation of interactions using electronic structure theory, incorporate the quantum mechanical nature of both the electrons and nuclei, which are essential to accurately describe systems containing light nuclei. However, path integral simulations have traditionally required a computational cost around two orders of magnitude greater than treating the nuclei classically, making them prohibitively costly for most applications. Here we show that the cost of path integral simulations can be dramatically reduced by extending our ring polymer contraction approach to ab initio molecular dynamics simulations. By using density functional tight binding as a reference system, we show that our ring polymer contraction scheme gives rapid and systematic convergence to the full path integral density functional theory result. We demonstrate the efficiency of this approach in ab initio simulations of liquid water and the reactive protonated and deprotonated water dimer systems. We find that the vast majority of the nuclear quantum effects are accurately captured using contraction to just the ring polymer centroid, which requires the same number of density functional theory calculations as a classical simulation. Combined with a multiple time step scheme using the same reference system, which allows the time step to be increased, this approach is as fast as a typical classical ab initio molecular dynamics simulation and 35× faster than a full path integral calculation, while still exactly including the quantum sampling of nuclei. This development thus offers a route to routinely include nuclear quantum effects in ab initio molecular dynamics simulations at negligible computational cost. PMID:26851913

  20. Ab initio molecular dynamics with nuclear quantum effects at classical cost: Ring polymer contraction for density functional theory

    International Nuclear Information System (INIS)

    Path integral molecular dynamics simulations, combined with an ab initio evaluation of interactions using electronic structure theory, incorporate the quantum mechanical nature of both the electrons and nuclei, which are essential to accurately describe systems containing light nuclei. However, path integral simulations have traditionally required a computational cost around two orders of magnitude greater than treating the nuclei classically, making them prohibitively costly for most applications. Here we show that the cost of path integral simulations can be dramatically reduced by extending our ring polymer contraction approach to ab initio molecular dynamics simulations. By using density functional tight binding as a reference system, we show that our ring polymer contraction scheme gives rapid and systematic convergence to the full path integral density functional theory result. We demonstrate the efficiency of this approach in ab initio simulations of liquid water and the reactive protonated and deprotonated water dimer systems. We find that the vast majority of the nuclear quantum effects are accurately captured using contraction to just the ring polymer centroid, which requires the same number of density functional theory calculations as a classical simulation. Combined with a multiple time step scheme using the same reference system, which allows the time step to be increased, this approach is as fast as a typical classical ab initio molecular dynamics simulation and 35× faster than a full path integral calculation, while still exactly including the quantum sampling of nuclei. This development thus offers a route to routinely include nuclear quantum effects in ab initio molecular dynamics simulations at negligible computational cost

  1. Ab initio molecular dynamics with nuclear quantum effects at classical cost: Ring polymer contraction for density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Marsalek, Ondrej; Markland, Thomas E., E-mail: [Department of Chemistry, Stanford University, Stanford, California 94305 (United States)


    Path integral molecular dynamics simulations, combined with an ab initio evaluation of interactions using electronic structure theory, incorporate the quantum mechanical nature of both the electrons and nuclei, which are essential to accurately describe systems containing light nuclei. However, path integral simulations have traditionally required a computational cost around two orders of magnitude greater than treating the nuclei classically, making them prohibitively costly for most applications. Here we show that the cost of path integral simulations can be dramatically reduced by extending our ring polymer contraction approach to ab initio molecular dynamics simulations. By using density functional tight binding as a reference system, we show that our ring polymer contraction scheme gives rapid and systematic convergence to the full path integral density functional theory result. We demonstrate the efficiency of this approach in ab initio simulations of liquid water and the reactive protonated and deprotonated water dimer systems. We find that the vast majority of the nuclear quantum effects are accurately captured using contraction to just the ring polymer centroid, which requires the same number of density functional theory calculations as a classical simulation. Combined with a multiple time step scheme using the same reference system, which allows the time step to be increased, this approach is as fast as a typical classical ab initio molecular dynamics simulation and 35× faster than a full path integral calculation, while still exactly including the quantum sampling of nuclei. This development thus offers a route to routinely include nuclear quantum effects in ab initio molecular dynamics simulations at negligible computational cost.

  2. Tensile deformation mechanisms of ABS/PMMA/EMA blends (United States)

    Wang, S. H.; Gao, J.; Lin, S. X.; Zhang, P.; Huang, J.; Xu, L. L.


    The tensile deformation mechanisms of acrylonitrile - butadiene - styrene (ABS) / polymethyl methacrylate (PMMA) blends toughened by ethylene methacrylate (EMA) copolymer was investigated by analysing the fracture morphology. ABS/PMMA was blended with EMA copolymer by melt mixing technique using co-rotating twin extruder. Tensile tests show that the elongation at break of ABS/PMMA blends can be efficiently improved with the increase in EMA content. Fracture morphology of ABS/PMMA/EMA blends reveals that the material yield induced by hollowing-out of EMA particles and its propagation into yield zone is the main toughening mechanism. Moreover, the appearance that EMA particles in the central area are given priority to hollowing-out may be related to the skin-core structure of the injection moulded parts caused by the different cooling rate between surface and inside in the process of injection moulding.

  3. Optical tweezers reveal how proteins alter replication (United States)

    Chaurasiya, Kathy

    Single molecule force spectroscopy is a powerful method that explores the DNA interaction properties of proteins involved in a wide range of fundamental biological processes such as DNA replication, transcription, and repair. We use optical tweezers to capture and stretch a single DNA molecule in the presence of proteins that bind DNA and alter its mechanical properties. We quantitatively characterize the DNA binding mechanisms of proteins in order to provide a detailed understanding of their function. In this work, we focus on proteins involved in replication of Escherichia coli (E. coli ), endogenous eukaryotic retrotransposons Ty3 and LINE-1, and human immunodeficiency virus (HIV). DNA polymerases replicate the entire genome of the cell, and bind both double-stranded DNA (dsDNA) and single-stranded DNA (ssDNA) during DNA replication. The replicative DNA polymerase in the widely-studied model system E. coli is the DNA polymerase III subunit alpha (DNA pol III alpha). We use optical tweezers to determine that UmuD, a protein that regulates bacterial mutagenesis through its interactions with DNA polymerases, specifically disrupts alpha binding to ssDNA. This suggests that UmuD removes alpha from its ssDNA template to allow DNA repair proteins access to the damaged DNA, and to facilitate exchange of the replicative polymerase for an error-prone translesion synthesis (TLS) polymerase that inserts nucleotides opposite the lesions, so that bacterial DNA replication may proceed. This work demonstrates a biophysical mechanism by which E. coli cells tolerate DNA damage. Retroviruses and retrotransposons reproduce by copying their RNA genome into the nuclear DNA of their eukaryotic hosts. Retroelements encode proteins called nucleic acid chaperones, which rearrange nucleic acid secondary structure and are therefore required for successful replication. The chaperone activity of these proteins requires strong binding affinity for both single- and double-stranded nucleic

  4. Structural insights and ab initio sequencing within the DING proteins family

    Energy Technology Data Exchange (ETDEWEB)

    Elias, Mikael, E-mail: [Weizmann Institute of Science, Rehovot (Israel); Liebschner, Dorothee [CRM2, Nancy Université (France); Gotthard, Guillaume; Chabriere, Eric [AFMB, Université Aix-Marseille II (France)


    DING proteins constitute a recently discovered protein family that is ubiquitous in eukaryotes. The structural insights and the physiological involvements of these intriguing proteins are hereby deciphered. DING proteins constitute an intriguing family of phosphate-binding proteins that was identified in a wide range of organisms, from prokaryotes and archae to eukaryotes. Despite their seemingly ubiquitous occurrence in eukaryotes, their encoding genes are missing from sequenced genomes. Such a lack has considerably hampered functional studies. In humans, these proteins have been related to several diseases, like atherosclerosis, kidney stones, inflammation processes and HIV inhibition. The human phosphate binding protein is a human representative of the DING family that was serendipitously discovered from human plasma. An original approach was developed to determine ab initio the complete and exact sequence of this 38 kDa protein by utilizing mass spectrometry and X-ray data in tandem. Taking advantage of this first complete eukaryotic DING sequence, a immunohistochemistry study was undertaken to check the presence of DING proteins in various mice tissues, revealing that these proteins are widely expressed. Finally, the structure of a bacterial representative from Pseudomonas fluorescens was solved at sub-angstrom resolution, allowing the molecular mechanism of the phosphate binding in these high-affinity proteins to be elucidated.

  5. Structural insights and ab initio sequencing within the DING proteins family

    International Nuclear Information System (INIS)

    DING proteins constitute a recently discovered protein family that is ubiquitous in eukaryotes. The structural insights and the physiological involvements of these intriguing proteins are hereby deciphered. DING proteins constitute an intriguing family of phosphate-binding proteins that was identified in a wide range of organisms, from prokaryotes and archae to eukaryotes. Despite their seemingly ubiquitous occurrence in eukaryotes, their encoding genes are missing from sequenced genomes. Such a lack has considerably hampered functional studies. In humans, these proteins have been related to several diseases, like atherosclerosis, kidney stones, inflammation processes and HIV inhibition. The human phosphate binding protein is a human representative of the DING family that was serendipitously discovered from human plasma. An original approach was developed to determine ab initio the complete and exact sequence of this 38 kDa protein by utilizing mass spectrometry and X-ray data in tandem. Taking advantage of this first complete eukaryotic DING sequence, a immunohistochemistry study was undertaken to check the presence of DING proteins in various mice tissues, revealing that these proteins are widely expressed. Finally, the structure of a bacterial representative from Pseudomonas fluorescens was solved at sub-angstrom resolution, allowing the molecular mechanism of the phosphate binding in these high-affinity proteins to be elucidated

  6. Ab-initio study of thermoelectricity of layered tellurium compounds


    Ibarra Hernández, Wilfredo


    In this thesis, we explore the electronic, dynamic and thermoelectric properties of different tellurium-based compounds. We perform ab-initio calculations within the Vienna Ab-initio Simulation Package (VASP) that works in the framework of Density Functional Theory (DFT). For the thermoelectric properties, we use the Boltztrap code that solves the Boltzmann Transport Equations (BTE) for electrons within the Constant Relaxation Time Approximation (CRTA). This computational pa...

  7. Evaluation of the Urotest AB antibacterial substance detection test.


    Blondeau, J. M.; Yaschuk, Y; Galenzoski, D; Hrabok, D; Isaacson, M; Lee, L.(Department of Physics, Yale University, New Haven, CT, USA); Link, H; Walshaw, L


    The Urotest AB was used to detect antimicrobial substances in urine samples. Of 1022 urine specimens evaluated, Urotest AB detected inhibitors in 38.9%. Of 159 urine specimens from patients thought to be taking an antibiotic, inhibitors were detected in 80.5%. This test may help to explain culture negative urine samples from symptomatic patients, and could help elucidate treatment failures and the epidemiology of antibiotic resistance.

  8. Toward ab initio density functional theory for nuclei


    Drut, J. E.; Furnstahl, R. J.; Platter, L.


    We survey approaches to nonrelativistic density functional theory (DFT) for nuclei using progress toward ab initio DFT for Coulomb systems as a guide. Ab initio DFT starts with a microscopic Hamiltonian and is naturally formulated using orbital-based functionals, which generalize the conventional local-density-plus-gradients form. The orbitals satisfy single-particle equations with multiplicative (local) potentials. The DFT functionals can be developed starting from internucleon forces using ...

  9. Deriving conservation laws for ABS lattice equations from Lax pairs

    International Nuclear Information System (INIS)

    In this paper we derive infinitely many conservation laws for ABS lattice equations from their Lax pairs. These conservation laws can be algebraically expressed by means of some known polynomials. For each equation, the infinitely many conservation laws are not equivalent and are nontrivial. We also show that the (H1), (H2), (H3), (Q1), (Q2), (Q3) and (A1) equations in the ABS list share a generic discrete Riccati equation. (paper)

  10. Surface binding properties of aged and fresh (recently excreted) Toxoplasma gondii oocysts. (United States)

    Harito, Jemere Bekele; Campbell, Andrew T; Prestrud, Kristin W; Dubey, J P; Robertson, Lucy J


    The surfaces of aged (10 years) and fresh (recently excreted) oocysts of Toxoplasma gondii were investigated using monoclonal antibody (mAb) and lectin-binding assays. Fresh oocysts bound a wall-specific mAb labelled with fluorescein isothiocyanate while aged oocysts did not. In contrast, the walls of aged oocysts bound a lectin (wheat germ agglutinin, WGA), but not the walls of fresh oocysts. Exposure of oocysts to detergent solutions or trypsin did not affect the binding properties of the walls of the oocysts. However, exposure of fresh oocysts to acidified pepsin enabled labelling of the walls with WGA, presumably due to the relevant moieties on the oocyst walls becoming exposed. WGA binding, but not mAb binding, was partially abrogated with periodate exposure. These findings reveal a significant difference in the binding properties of oocyst walls from "aged" and "fresh" oocysts. The results are of relevance when considering technologies for isolating or detecting T. gondii oocysts in environmental samples based on oocyst surface properties, as used for other protozoan parasites. Our results suggest the possibility of developing a WGA-based separation procedure for isolating Toxoplasma oocysts from environmental matrices, in which pepsin pre-treatment would be included to ensure that both fresh and aged oocysts were isolated. PMID:27003461

  11. Rotating wall vessel exposure alters protein secretion and global gene expression in Staphylococcus aureus (United States)

    Rosado, Helena; O'Neill, Alex J.; Blake, Katy L.; Walther, Meik; Long, Paul F.; Hinds, Jason; Taylor, Peter W.


    Staphylococcus aureus is routinely recovered from air and surface samples taken aboard the International Space Station (ISS) and poses a health threat to crew. As bacteria respond to the low shear forces engendered by continuous rotation conditions in a Rotating Wall Vessel (RWV) and the reduced gravitational field of near-Earth flight by altering gene expression, we examined the effect of low-shear RWV growth on protein secretion and gene expression by three S. aureus isolates. When cultured under 1 g, the total amount of protein secreted by these strains varied up to fourfold; under continuous rotation conditions, protein secretion by all three strains was significantly reduced. Concentrations of individual proteins were differentially reduced and no evidence was found for increased lysis. These data suggest that growth under continuous rotation conditions reduces synthesis or secretion of proteins. A limited number of changes in gene expression under continuous rotation conditions were noted: in all isolates vraX, a gene encoding a polypeptide associated with cell wall stress, was down-regulated. A vraX deletion mutant of S. aureus SH1000 was constructed: no differences were found between SH1000 and ΔvraX with respect to colony phenotype, viability, protein export, antibiotic susceptibility, vancomycin kill kinetics, susceptibility to cold or heat and gene modulation. An ab initio protein-ligand docking simulation suggests a major binding site for β-lactam drugs such as imipenem. If such changes to the bacterial phenotype occur during spaceflight, they will compromise the capacity of staphylococci to cause systemic infection and to circumvent antibacterial chemotherapy.

  12. Experimental and theoretical characterization of the high-affinity cation binding site of the purple membrane


    Pardo, Leonardo; Sepulcre Sánchez, Francesc; Cladera Cerdà, Josep Bartomeu; Duñach, Mireia; Labarta, A.; Tejada, J.; Padrós Morell, Esteve


    Binding of Mn2+ or Mg2+ to the high-affinity site of the purple membrane from Halobacterium salinarium has been studied by superconducting quantum interference device magnetometry or by ab initio quantum mechanical calculations, respectively. The binding of Mn2+ cation, in a low-spin state, to the high-affinity site occurs through a major octahedral local symmetry character with a minor rhombic distortion and a coordination number of six. A molecular model of this binding site in the Schiff b...

  13. Radii and Binding Energies in Oxygen Isotopes: A Challenge for Nuclear Forces. (United States)

    Lapoux, V; Somà, V; Barbieri, C; Hergert, H; Holt, J D; Stroberg, S R


    We present a systematic study of both nuclear radii and binding energies in (even) oxygen isotopes from the valley of stability to the neutron drip line. Both charge and matter radii are compared to state-of-the-art ab initio calculations along with binding energy systematics. Experimental matter radii are obtained through a complete evaluation of the available elastic proton scattering data of oxygen isotopes. We show that, in spite of a good reproduction of binding energies, ab initio calculations with conventional nuclear interactions derived within chiral effective field theory fail to provide a realistic description of charge and matter radii. A novel version of two- and three-nucleon forces leads to considerable improvement of the simultaneous description of the three observables for stable isotopes but shows deficiencies for the most neutron-rich systems. Thus, crucial challenges related to the development of nuclear interactions remain. PMID:27517768

  14. Radii and binding energies in oxygen isotopes: a puzzle for nuclear forces

    CERN Document Server

    Lapoux, V; Barbieri, C; Hergert, H; Holt, J D; Stroberg, R


    We present a systematic study of both nuclear radii and binding energies in (even) oxygen isotopes from the valley of stability to the neutron drip line. Both charge and matter radii are compared to state-of-the-art {\\it ab initio} calculations along with binding energy systematics. Experimental matter radii are obtained through a complete evaluation of the available elastic proton scattering data of oxygen isotopes. We show that, in spite of a good reproduction of binding energies, {\\it ab initio} calculations with conventional nuclear interactions derived within chiral effective field theory fail to provide a realistic description of charge and matter radii. A novel version of two- and three-nucleon forces leads to considerable improvement of the simultaneous description of the three observables for stable isotopes, but shows deficiencies for the most neutron-rich systems. Thus, crucial challenges related to the development of nuclear interactions remain.

  15. 基于ABS的ABS/ASR集成液压系统设计%ABS/ASR Integrated Hydraulic System Based on ABS

    Institute of Scientific and Technical Information of China (English)

    马岳峰; 刘昭度; 吴利军; 王国业


    介绍一种基于JETTA GTX轿车ABS液压系统的ABS/ASR集成液压系统改造方案,该ABS/ASR集成液压系统在原有ABS液压系统的基础上增加较少的液压元件实现全部ABS功能和ASR制动干预控制功能,改造后的集成系统工作可靠,不影响原有的常规制动和ABS制动过程.

  16. The R1441C mutation alters the folding properties of the ROC domain of LRRK2


    Li, Yongchao; Dunn, Laura; Greggio, Elisa; Krumm, Brian; Jackson, Graham S.; Cookson, Mark R; Lewis, Patrick A.; Deng, Junpeng


    Abstract LRRK2 is a 250kDa multidomain protein, mutations in which cause familial Parkinson's disease. Previously, we have demonstrated that the R1441C mutation in the ROC domain decreases GTPase activity. Here we show that the R1441C alters the folding properties of the ROC domain, lowering its thermodynamic stability. Similar to small GTPases, binding of different guanosine nucleotides alters the stability of the ROC domain, suggesting that there is an alteration in conformation ...

  17. Ab Initio Computation of Dynamical Properties: Pressure Broadening (United States)

    Wiesenfeld, Laurent; Drouin, Brian


    Rotational spectroscopy of polar molecules is the main observational tool in many areas of astrophysics, for gases of low densities (n ˜ 102 - 108 cm-3). Spectral line shapes in astrophysical media are largely dominated by turbulence-induced Doppler effects and natural line broadening are negligible. However line broadening remains an important tool for denser gases, like planetary high atmospheres. Understanding the excitation schemes of polar molecules requires the knowledge of excitation transfer rate due to collisional excitation, between the polar molecule and the ambient gas, usually H2. Transport properties in ionized media also require a precise knowledge of momentum transfer rates by elastic collisions. In order to assess the theoretically computed cross section and energy/momentum transfer rates, direct absolute experiments are scarce. The best way is to measure not individual scattering events but rather the global effect of the buffer gas, thanks to the pressure broadening cross sections, whose magnitude can be measured without any scaling parameters. At low temperatures, both elastic and inelastic scattering amplitudes are tested. At higher temperature, depending on the interaction strength, only inelastic scattering cross section are shown to play a significant role 1 ,2. Thanks to the advances of computer capabilities, it has become practical to compute spectral line parameters fromab initio quantum chemistry. In particular, the theory of rotational line broadening is readily incorporated into scattering quantum dynamical theory, like close-coupling schemes. The only approximations used in the computation are the isolated collision/isolated line approximations. We compute the non-binding interaction potential with high precision quantum chemistry and fit the resulting ab initio points onto a suitable functional. We have recently computed several such systems, for molecules in H2 buffer gas: H2O,3 H2CO,4 HCO+ .5 Detailed computations taking into

  18. Specific antibody-receptor interactions trigger InlAB-independent uptake of listeria monocytogenes into tumor cell lines

    Directory of Open Access Journals (Sweden)

    Hotz Christian


    Full Text Available Abstract Background Specific cell targeting is an important, yet unsolved problem in bacteria-based therapeutic applications, like tumor or gene therapy. Here, we describe the construction of a novel, internalin A and B (InlAB-deficient Listeria monocytogenes strain (Lm-spa+, which expresses protein A of Staphylococcus aureus (SPA and anchors SPA in the correct orientation on the bacterial cell surface. Results This listerial strain efficiently binds antibodies allowing specific interaction of the bacterium with the target recognized by the antibody. Binding of Trastuzumab (Herceptin® or Cetuximab (Erbitux® to Lm-spa+, two clinically approved monoclonal antibodies directed against HER2/neu and EGFR/HER1, respectively, triggers InlAB-independent internalization into non-phagocytic cancer cell lines overexpressing the respective receptors. Internalization, subsequent escape into the host cell cytosol and intracellular replication of these bacteria are as efficient as of the corresponding InlAB-positive, SPA-negative parental strain. This specific antibody/receptor-mediated internalization of Lm-spa+ is shown in the murine 4T1 tumor cell line, the isogenic 4T1-HER2 cell line as well as the human cancer cell lines SK-BR-3 and SK-OV-3. Importantly, this targeting approach is applicable in a xenograft mouse tumor model after crosslinking the antibody to SPA on the listerial cell surface. Conclusions Binding of receptor-specific antibodies to SPA-expressing L. monocytogenes may represent a promising approach to target L. monocytogenes to host cells expressing specific receptors triggering internalization.

  19. Ab Initio No-Core Shell Model

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, B R; Navratil, P; Vary, J P


    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory ({chi}EFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The

  20. Ab Initio No-Core Shell Model

    International Nuclear Information System (INIS)

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory (χEFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The resulting NN

  1. Emergent properties of nuclei from ab initio coupled-cluster calculations (United States)

    Hagen, G.; Hjorth-Jensen, M.; Jansen, G. R.; Papenbrock, T.


    Emergent properties such as nuclear saturation and deformation, and the effects on shell structure due to the proximity of the scattering continuum and particle decay channels are fascinating phenomena in atomic nuclei. In recent years, ab initio approaches to nuclei have taken the first steps towards tackling the computational challenge of describing these phenomena from Hamiltonians with microscopic degrees of freedom. This endeavor is now possible due to ideas from effective field theories, novel optimization strategies for nuclear interactions, ab initio methods exhibiting a soft scaling with mass number, and ever-increasing computational power. This paper reviews some of the recent accomplishments. We also present new results. The recently optimized chiral interaction NNLO{}{{sat}} is shown to provide an accurate description of both charge radii and binding energies in selected light- and medium-mass nuclei up to 56Ni. We derive an efficient scheme for including continuum effects in coupled-cluster computations of nuclei based on chiral nucleon–nucleon and three-nucleon forces, and present new results for unbound states in the neutron-rich isotopes of oxygen and calcium. The coupling to the continuum impacts the energies of the {J}π =1/{2}-,3/{2}-,7/{2}-,3/{2}+ states in {}{17,23,25}O, and—contrary to naive shell-model expectations—the level ordering of the {J}π =3/{2}+,5/{2}+,9/{2}+ states in {}{53,55,61}Ca. ).

  2. Comparisons of metallic clusters imbedded in the surface oxide of AB2, AB5, and A2B7 alloys

    International Nuclear Information System (INIS)

    Research highlights: Different growth mechanisms have been found on the metallic inclusions imbedded in the surface oxides of AB2, AN5, and A2B7. The high power performance has been correlated to the size and distribution of these inclusions. - Abstract: In order to clarify the relationship between the saturation magnetization of the activated metal hydride material and electrode performance, the specific power measured at both low temperature (-30 oC) and operating temperature (35 oC) of a nickel metal hydride battery were compared with magnetization measurements. It is found specific powers measured at both temperatures correlate well with the saturated magnetic susceptibility, which is proportional to the total amount of metallic nickel clusters distributed within the surface oxide layer after activation. Both the gas phase storage and electrochemical properties of the activated AB2, AB5, and A2B7 alloys were investigated. While the AB2 alloy has the highest storage capacity, it also has the lowest high-rate dischargeability among the three alloys. This suggests a competition between storage capacity and rate capability in these materials. In an alkaline etching experiment, it is established the saturation magnetization increases with etching time in these AB2, AB5, and A2B7 alloys. The saturation magnetization after a 4 h etches track the changes in the high-rate dischargeability. The increase is attributed to the growth in size of the metallic inclusions for the AB2 and Nd-A2B7 samples, and from an increase in the number of metallic inclusion in the case of AB5 and La-A2B7. Transmission electron microscope studies calibrate the size inferred from magnetic susceptibility studies and also the Ni-dominated FCC structure of the metallic clusters.

  3. Study on Exothermic Oxidation of Acrylonitrile-butadiene-styrene (ABS Resin Powder with Application to ABS Processing Safety

    Directory of Open Access Journals (Sweden)

    Jenq-Renn Chen


    Full Text Available Oxidative degradation of commercial grade ABS (Acrylonitrile-butadiene-styrene resin powders was studied by thermal analysis. The instabilities of ABS containing different polybutadiene (PB contents with respect to temperature were studied by Differential Scanning Calorimeter (DSC. Thermograms of isothermal test and dynamic scanning were performed. Three exothermic peaks were observed and related to auto-oxidation, degradation and oxidative decomposition, respectively. Onset temperature of the auto-oxidation was determined to be around 193 °C. However, threshold temperature of oxidation was found to be as low as 140 °C by DSC isothermal testing. Another scan of the powder after degeneration in air showed an onset temperature of 127 °C. Reactive hazards of ABS powders were verified to be the exothermic oxidation of unsaturated PB domains, not the SAN (poly(styrene-acrylonitrile matrix. Heat of oxidation was first determined to be 2,800 ± 40 J per gram of ABS or 4,720 ± 20 J per gram of PB. Thermal hazards of processing ABS powder are assessed by adiabatic temperature rise at process conditions. IR spectroscopy associated with heat of oxidation verified the oxidative mechanism, and these evidences excluded the heat source from the degradation of SAN. A specially prepared powder of ABS without adding anti-oxidant was analyzed by DSC for comparing the exothermic behaviors. Exothermic onset temperatures were determined to be 120 °C and 80 °C by dynamic scanning and isothermal test, respectively. The assessment successfully explained fires and explosions in an ABS powder dryer and an ABS extruder.

  4. Magnetism in zigzag and armchair CuO nanotubes: Ab-initio study (United States)

    Paudel, Samir; Dandeliya, Sushmita; Chaurasiya, Rajneesh; Srivastava, Anurag; Kaphle, Gopi Chandra


    The structural stability, electronic band structure and magnetic properties of zigzag (4≤n≤12) and armchair (3≤n≤8) copper oxide nanotubes have been analyzed by employing a standard Density Functional Theory based ab-intio approach using spin polarized generalized gradient approximation with revised Perdew Burke Ernzerhoff type parameterization. The binding energy of both zigzag as well as armchair CuO nanotubes increases with increasing diameter. Whereas, calculated total magnetic moment decreases with increasing diameter. Among the considered chiralities, (5, 5) armchair (diameter 9.08 Å) and (9, 0) zigzag (diameter 9.47 Å) CuO nanotubes show highest degree of spin polarization, however total magnetic moment is found to be highest for (4, 0) zigzag and (3, 3) armchair CuO nanotubes. The computed electronic properties of considered CuO Nanotube, confirms the metallic nature of these nanotubes.

  5. On the role of hydrogen filled vacancies on the embrittlement of zirconium: An ab initio investigation (United States)

    Olsson, Pär A. T.; Kese, Kwadwo; Alvarez Holston, Anna-Maria


    In this work we report the results of an ab initio study of the influence of hydrogen filled vacancies on the mechanical properties of zirconium. The modelling shows that hydrogen filled vacancies contribute to a lowering of the surface energy and an increase in the unstable stacking fault energy, which implies a reduction in ductility. The increase in unstable stacking fault energy suggests that the defects promote a change in the dislocation glide mechanism from prismatic to basal slip. To investigate the cleavage energetics, we model the decohesion process. For describing the interplanar interaction we adopt an extended version of Rose's universal binding energy relation, which is found to reproduce the behaviour accurately. The results of the modelling imply that the work of fracture and peak stress decrease as a result of the presence of hydrogen filled vacancies.

  6. Ab initio study of pressure induced structural and electronic properties in TmPo

    Energy Technology Data Exchange (ETDEWEB)

    Makode, Chandrabhan, E-mail:; Pataiya, Jagdish; Sanyal, Sankar P. [Department of Physics, Barkatullah University, Bhopal-462026 (India); Panwar, Y. S.; Aynyas, Mahendra [Department of Physics, C.S.A. Govt. P.G. College, Sehore-466001 (India)


    We report an ab initio calculation of pressure induced structural phase transition and electronic properties of Thulium Polonide (TmPo).The total energy as a function of volume is obtained by means of self-consistent tight binding linear muffin-tin-orbital (TB-LMTO) method within the local density approximation (LDA). It is found that TmPo is stable in NaCl-type (B{sub 1}-phase) structure to CsCl-type (B{sub 2}-phase) structure of this compound in the pressure range of 7.0 GPa. We also calculate the lattice parameter (a{sub 0}), bulk modulus (B{sub 0}), band structure and density of states. From energy diagram it is observed that TmPo exhibit metallic behavior. The calculated values of equilibrium lattice parameter and bulk modulus are in general good agreement.

  7. Electron-scattering form factors for 6Li in the ab initio symmetry-guided framework

    CERN Document Server

    Dytrych, T; Launey, K D; Draayer, J P; Maris, P; Vary, J P; Langr, D; Oberhuber, T


    We present an ab initio symmetry-adapted no-core shell-model description for $^{6}$Li. We study the structure of the ground state of $^{6}$Li and the impact of the symmetry-guided space selection on the charge density components for this state in momentum space, including the effect of higher shells. We accomplish this by investigating the electron scattering charge form factor for momentum transfers up to $q \\sim 4$ fm$^{-1}$. We demonstrate that this symmetry-adapted framework can achieve significantly reduced dimensions for equivalent large shell-model spaces while retaining the accuracy of the form factor for any momentum transfer. These new results confirm the previous outcomes for selected spectroscopy observables in light nuclei, such as binding energies, excitation energies, electromagnetic moments, E2 and M1 reduced transition probabilities, as well as point-nucleon matter rms radii.

  8. Functional and structural alterations induced by copper in xanthine oxidase

    Institute of Scientific and Technical Information of China (English)

    Mahnaz Hadizadeh; Ezzatollah Keyhani; Jacqueline Keyhani; Cyrus Khodadadi


    Xanthine oxidase (XO),a key enzyme in purine metab-olism,produces reactive oxygen species causing vascu-lar injuries and chronic heart failure.Here,copper's ability to alter XO activity and structure was investi-gated in vitro after pre-incubation of the enzyme with increasing Cu2+ concentrations for various periods of time.The enzymatic activity was measured by following XO-catalyzed xanthine oxidation to uric acid under steady-state kinetics conditions.Structural alterations were assessed by electronic absorption,fluorescence,and circular dichroism spectroscopy.Results showed that Cu2+ either stimulated or inhibited XO activity,depending on metal concentration and pre-incubation length,the latter also determining the inhibition type.Cu2+-XO complex formation was characterized by modifications in XO electronic absorption bands,intrinsic fluorescence,and α-helical and β-sheet content.Apparent dissociation constant values implied high- and low-affinity Cu2+ binding sites in the vicinity of the enzyme's reactive centers.Data indicated that Cu2+ binding to high-affinity sites caused alterations around XO molybdenum and flavin adenine dinucleo-tide centers,changes in secondary structure,and mod-erate activity inhibition;binding to low affinity sites caused alterations around all XO reactive centers including FeS,changes in tertiary structure as reflected by alterations in spectral properties,and drastic activity inhibition.Stimulation was attributed to transient stabilization of XO optimal conformation.Results also emphasized the potential role of copper in the regu-lation of XO activity stemming from its binding properties.

  9. Molecular basis for the inhibition of β-hydroxyacyl-ACP dehydratase HadAB complex from Mycobacterium tuberculosis by flavonoid inhibitors. (United States)

    Dong, Yu; Qiu, Xiaodi; Shaw, Neil; Xu, Yueyang; Sun, Yuna; Li, Xuemei; Li, Jun; Rao, Zihe


    Dehydration is one of the key steps in the biosynthesis of mycolic acids and is vital to the growth of Mycobacterium tuberculosis (Mtb). Consequently, stalling dehydration cures tuberculosis (TB). Clinically used anti-TB drugs like thiacetazone (TAC) and isoxyl (ISO) as well as flavonoids inhibit the enzyme activity of the β-hydroxyacyl-ACP dehydratase HadAB complex. How this inhibition is exerted, has remained an enigma for years. Here, we describe the first crystal structures of the MtbHadAB complex bound with flavonoid inhibitor butein, 2',4,4'-trihydroxychalcone or fisetin. Despite sharing no sequence identity from Blast, HadA and HadB adopt a very similar hotdog fold. HadA forms a tight dimer with HadB in which the proteins are sitting side-by-side, but are oriented anti-parallel. While HadB contributes the catalytically critical His-Asp dyad, HadA binds the fatty acid substrate in a long channel. The atypical double hotdog fold with a single active site formed by MtbHadAB gives rise to a long, narrow cavity that vertically traverses the fatty acid binding channel. At the base of this cavity lies Cys61, which upon mutation to Ser confers drug-resistance in TB patients. We show that inhibitors bind in this cavity and protrude into the substrate binding channel. Thus, inhibitors of MtbHadAB exert their effect by occluding substrate from the active site. The unveiling of this mechanism of inhibition paves the way for accelerating development of next generation of anti-TB drugs. PMID:26081470

  10. Structural and electronic properties of lead nanowires: Ab-initio study

    International Nuclear Information System (INIS)

    Highlights: → In the present revised manuscript entitled 'Structural and Electronic Properties of Lead Nanowires: Ab-initio study', we have analyzed the stability, electronic properties as well as ground state properties of various atomic configurations of Lead nanowires. → The two-atom zigzag shaped lead nanowire with highest binding energy and lowest total energy has been confirmed as the most stable structure out of the six atomic configurations taken into consideration. → The electronic band structure and density of states have been described in detail with a remarkable observation in case of three-atom triangular lead nanowire having a very small band gap while other atomic configurations are found to be metallic. → The bulk modulus and pressure derivatives for all the stable geometries have also been computed and discussed in the manuscript. The mechanical strength of nanowires has also been discussed in terms of its bulk modulus. → The two-atom ladder shaped nanowire with highest bulk modulus, defends this structure as mechanically stronger than the other tested structure. - Abstract: Ab-initio self-consistent study has been performed to analyze the stability of lead nanowires in its six stable configurations like linear, zigzag, triangular, ladder, square and dumbbell. In the present study, the lowest energy structures have been analyzed under the revised Perdew-Burke-Ernzerhof (revPBE) parameterization of generalized gradient approximation (GGA) potential. The two-atom zigzag shaped atomic configuration with highest binding energy and lowest total energy has been confirmed as the most stable structure out of the six atomic configurations. The electronic band structure and density of states have been discussed in detail with a remarkable observation in case of three-atom triangular lead nanowire having a very small band gap while other configurations are found to be metallic. Bulk modulus, pressure derivatives and lattice parameters for different

  11. Abacavir and the altered peptide repertoire model: clinical implications

    Directory of Open Access Journals (Sweden)

    Mallal S


    Full Text Available Structural and biochemical studies showing that abacavir binds non-covalently to the floor of the peptide binding groove of HLA-B*5701 with exquisite specificity to alter the self-peptides that load on the molecule to be presented to the immune system have recently been published [1–4]. This precise mechanistic explanation of why abacavir binds to HLA-B*5701 and no other allele accounts for the 100% negative predictive value of HLA-B*5701 testing for hypersensitivity which underpins its utility as a screening test. The specificity of the interaction between abacavir, peptide and HLA-B*5701 provides strong evidence that abacavir will not cause any off-target, HLA restricted immune-mediated side effects in HLA-B*5701 negative individuals. The rapid and direct non-covalent binding of abacavir to HLA-B*5701 without the requirement for metabolism of the drug explain the clinical symptoms of hypersensitivity including dose-related escalation of symptoms and rapid offset of symptoms following drug cessation. Importantly, if abacavir were being developed today its propensity to bind HLA-B*5701, alter the peptide repertoire presented, and the functional consequences of this interaction between HLA-B*5701 and abacavir could be determined in vitro and before use in man. This provides an important pre-clinical screening strategy to identify compounds in development that bind HLA and alter peptide presentation which could then be structurally modified to abrogate this property to avert hypersensitivity while retaining on-target effects.

  12. High multiplicity states in disordered carbon systems: Ab initio and semiempirical study

    International Nuclear Information System (INIS)

    Stability of non-zero spin projection states for disordered carbon clusters of low symmetry were examined using semiempirical and ab initio methods. The study proves previous results of V.D. Khavryuchenko, Y.A. Tarasenko, V.V. Strelko, O.V. Khavryuchenko, V.V. Lisnyak, Int. J. Mod. Phys. B 21 (2007) 4507, obtained for the large polyaromatic hydrocarbons clusters and shows that the phenomenon is intrinsic for carbon-rich systems and independent of their symmetries. The electronic properties of the carbon clusters may alter from insulating to semiconducting upon change of C/H ratio and stabilization of non-zero spin projection states. A partial collectivization of the electrons is observed in deeply carbonized carbon clusters in higher Sz states.

  13. SHBG (Sex Hormone Binding Globulin) (United States)

    ... as: Testosterone-estrogen Binding Globulin; TeBG Formal name: Sex Hormone Binding Globulin Related tests: Testosterone , Free Testosterone, ... I should know? How is it used? The sex hormone binding globulin (SHBG) test may be used ...

  14. Dicty_cDB: FC-AB09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available / Representative seq. ID ...FC-AB09F (Link to Original site) Representative DNA sequence >FC-AB09 (FC-AB09Q) /CSM/FC/FC-AB/FC-AB09Q.Seq....QNQKKKKKKKKKKKKKKKKKK Translated Amino Acid sequence (All Frames) Frame A: desashkqlckiynkihyliifinfvlvvdlyp...0.00 m_ : 1.00 72.0 %: nuclear 16.0 %: cytoplasmic 8.0 %: mitochondrial 4.0 %: cytoskeletal >> prediction fo...kkkrkktkpkekkkkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits)

  15. Dicty_cDB: FCL-AB19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AB19 (Link to dictyBase) - - - Contig-U15232-1 FCL-AB19Z ...(Link to Original site) - - FCL-AB19Z 697 - - - - Show FCL-AB19 Library FCL (Link to library) Clone ID FCL-A... Representative seq. ID FCL-...AB19Z (Link to Original site) Representative DNA sequence >FCL-AB19 (FCL-AB19Q) /CSM/FCL/FCL-AB/FCL-...KLINFSIFQ* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value FCL-

  16. Hydrogenation of AB5 and AB2 metal hydride alloys studied by in situ X-ray diffraction

    International Nuclear Information System (INIS)

    Highlights: • Hydrogenation process of an AB5 alloy and two AB2 alloys were studied by quasi in-situ XRD. • In both AB5 and AB2 metal alloy, hydrogen occupation sites on the half-plane were taken first. • In the C14/C15 mixed alloy, C14 phase is the main hydrogen storage phase with a lower equilibrium pressure. • In the C14/C15 mixed alloy, C15 phase is the catalyst hydrogen storage phase with a higher equilibrium pressure. • Small amount of C15 was hydrided first but not completed until C14 phase was fully hydrided. - Abstract: The evolution of lattice constants and abundances of metal (α) and metal hydride (β) phases during the hydrogenation process of an AB5 alloy with a CaCu5 crystal structure, an AB2 alloy with a predominating C14 structure, and a C14/C15-mixed AB2 alloy were reported. The preferred hydrogen insertion sites at different states of charge in both the α and β phases were studied based on the lattice parameter changes during hydrogenation. During the hydrogenation of the AB5 alloy, the ratio between lattice parameters a and c (a/c ratio) in the α phase decreases, stabilizes, and then decreases again while that in the β phase decreases and then stabilizes. The trends in unit cell volume changes are increasing, plateauing, and increasing again in the α phase and increasing followed by plateauing in the β phase as the hydrogenation level increases. In the C14-predominant AB2 alloy, the a/c ratio in the α phase increases at the beginning and then stabilizes while that in the β phase remains about the same and then increases during the addition of hydrogen. Moreover, the unit cell volume in the α phase increases slightly during hydrogenation, comparing to the increasing, decreasing, and then increasing trend in the β phase. In the C14/C15 mixed AB2 alloy, hydrogenation of the C15 phase starts at the beginning and promotes the hydrogenation of the C14 phase. The C14 phase, as the main hydrogen storage phase, completes hydrogenation

  17. Study of the mechanical properties of recycled abs and recovery throught mixing with SEBS


    Peydro, M. A.; Juárez Varón, David; Samuel SANCHEZ-CABALLERO; Pla-Ferrando, R


    Recovery of recycled acrylonitrile butadiene styrene (ABS) through mixing with styrene-ethylene/butylene- styrene (SEBS) has been studied in this paper. To simulate recycled ABS, virgin ABS was processed through 5 cycles, at extreme processing temperatures, 220 oC and 260 oC. The virgin ABS, the virgin SEBS, the recycled ABS and the mixtures were mechanically characterized after the various cycles of reprocessing in order to evaluate their corresponding properties and correlate them with the...

  18. Altered fingerprints: analysis and detection. (United States)

    Yoon, Soweon; Feng, Jianjiang; Jain, Anil K


    The widespread deployment of Automated Fingerprint Identification Systems (AFIS) in law enforcement and border control applications has heightened the need for ensuring that these systems are not compromised. While several issues related to fingerprint system security have been investigated, including the use of fake fingerprints for masquerading identity, the problem of fingerprint alteration or obfuscation has received very little attention. Fingerprint obfuscation refers to the deliberate alteration of the fingerprint pattern by an individual for the purpose of masking his identity. Several cases of fingerprint obfuscation have been reported in the press. Fingerprint image quality assessment software (e.g., NFIQ) cannot always detect altered fingerprints since the implicit image quality due to alteration may not change significantly. The main contributions of this paper are: 1) compiling case studies of incidents where individuals were found to have altered their fingerprints for circumventing AFIS, 2) investigating the impact of fingerprint alteration on the accuracy of a commercial fingerprint matcher, 3) classifying the alterations into three major categories and suggesting possible countermeasures, 4) developing a technique to automatically detect altered fingerprints based on analyzing orientation field and minutiae distribution, and 5) evaluating the proposed technique and the NFIQ algorithm on a large database of altered fingerprints provided by a law enforcement agency. Experimental results show the feasibility of the proposed approach in detecting altered fingerprints and highlight the need to further pursue this problem. PMID:21808092

  19. Ab Initio Studies of Stratospheric Ozone Depletion Chemistry (United States)

    Lee, Timothy J.; Head-Gordon, Martin; Langhoff, Stephen R. (Technical Monitor)


    An overview of the current understanding of ozone depletion chemistry, particularly with regards the formation of the so-called Antarctic ozone hole, will be presented together with an outline as to how ab initio quantum chemistry can be used to further our understanding of stratospheric chemistry. The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of fluorine, chlorine, bromine and nitrogen oxide species will be demonstrated by presentation of some example studies. The ab initio results will be shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the theoretical results are shown to fill in the gaps and to resolve experimental controversies. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of halogen oxide species will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of experimental studies.

  20. Stabilizing a flexible interdomain hinge region harboring the SMB binding site drives uPAR into its closed conformation. (United States)

    Zhao, Baoyu; Gandhi, Sonu; Yuan, Cai; Luo, Zhipu; Li, Rui; Gårdsvoll, Henrik; de Lorenzi, Valentina; Sidenius, Nicolai; Huang, Mingdong; Ploug, Michael


    The urokinase-type plasminogen activator receptor (uPAR) is a multidomain glycolipid-anchored membrane protein, which facilitates extracellular matrix remodeling by focalizing plasminogen activation to cell surfaces via its high-affinity interaction with uPA. The modular assembly of its three LU (Ly6/uPAR-like) domains is inherently flexible and binding of uPA drives uPAR into its closed conformation, which presents the higher-affinity state for vitronectin thus providing an allosteric regulatory mechanism. Using a new class of epitope-mapped anti-uPAR monoclonal antibodies (mAbs), we now demonstrate that the reciprocal stabilization is indeed also possible. By surface plasmon resonance studies, we show that these mAbs and vitronectin have overlapping binding sites on uPAR and that they share Arg91 as hotspot residue in their binding interfaces. The crystal structure solved for one of these uPAR·mAb complexes at 3.0Å clearly shows that this mAb preselects the closed uPAR conformation with an empty but correctly assembled large hydrophobic binding cavity for uPA. Accordingly, these mAbs inhibit the uPAR-dependent lamellipodia formation and migration on vitronectin-coated matrices irrespective of the conformational status of uPAR and its occupancy with uPA. This is the first study to the best of our knowledge, showing that the dynamic assembly of the three LU domains in uPARwt can be driven toward the closed form by an external ligand, which is not engaging the hydrophobic uPA binding cavity. As this binding interface is also exploited by the somatomedin B domain of vitronectin, therefore, this relationship should be taken into consideration when exploring uPAR-dependent cell adhesion and migration in vitronectin-rich environments. PMID:25659907

  1. Alteration of Water Absorption Coefficient of Spruce (Picea abies (L.) Karst.) due to Thermal Modification


    Alexander Pfriem


    The aim of the investigations was to evaluate the infl uence of a thermal modifi cation on the water absorption behaviour of spruce (Picea abies(L.) Karst.). After recording the water uptake of wood samples by partial immersion, a water absorption coefficient of the material could be determined according to EN ISO 15148:2002. The thermal modification results in an alteration of the water absorption behaviour in dependence on the sectional area. In radial and tangential direction the water abs...

  2. Structural Alterations of Segmented Macular Inner Layers in Aquaporin4-Antibody-Positive Optic Neuritis Patients in a Chinese Population.

    Directory of Open Access Journals (Sweden)

    Chunxia Peng

    Full Text Available This study aimed to analyse the structural injury of the peripapillary retinal nerve fibre layer (pRNFL and segmented macular layers in optic neuritis (ON in aquaporin4-antibody (AQP4-Ab seropositivity(AQP4-Ab-positiveON patients and in AQP4-Ab seronegativity (AQP4-Ab-negative ON patients in order to evaluate their correlations with the best-corrected visual acuity (BCVA and the value of the early diagnosis of neuromyelitis optica (NMO.This is a retrospective, cross-sectional and control observational study.In total, 213 ON patients (291 eyes and 50 healthy controls (HC (100 eyes were recruited in this study. According to a serum AQP4-Ab assay, 98 ON patients (132 eyes were grouped as AQP4-Ab-positive ON and 115 ON patients (159 eyes were grouped as AQP4-Ab-negative ON cohorts. All subjects underwent scanning with spectralis optical coherence tomography (OCT and BCVA tests. pRNFL and segmented macular layer measurements were analysed.The pRNFL thickness in AQP4-Ab-positive ON eyes showed a more serious loss during 0-2 months (-27.61μm versus -14.47 μm and ≥6 months (-57.91μm versus -47.19μm when compared with AQP4-Ab-negative ON eyes. AQP4-Ab-positive ON preferentially damaged the nasal lateral pRNFL. The alterations in the macular ganglion cell layer plus the inner plexiform layer (GCIP in AQP4-Ab-positive ON eyes were similar to those in AQP4-Ab-negative ON eyes. AQP4-Ab-positive ON eyes had entirely different injury patterns in the inner nuclear layer (INL compared with AQP4-Ab-negative ON eyes during the first 6 months after the initial ON attack. These differences were as follows: the INL volume of AQP4-Ab-positive ON eyes had a gradual growing trend compared with AQP4-Ab-negative ON eyes, and it increased rapidly during 0-2 months, reached its peak during 2-4 months, and then decreased gradually. The pRNFL and GCIP in AQP4-Ab-positive ON eyes had positive correlations with BCVA. When the pRNFL thickness decreased to 95%CI (50.77

  3. Characterization of 6-mercaptopurine binding to bovine serum albumin and its displacement from the binding sites by quercetin and rutin

    Energy Technology Data Exchange (ETDEWEB)

    Ehteshami, Mehdi [Nutrition Research Center, School of Health and Nutrition, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Rasoulzadeh, Farzaneh [Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Mahboob, Soltanali [Nutrition Research Center, School of Health and Nutrition, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Rashidi, Mohammad-Reza, E-mail: [Research Center for Pharmaceutical Nanotechnology, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of)


    Binding of a drug to the serum albumins as major serum transport proteins can be influenced by other ligands leading to alteration of its pharmacological properties. In the present study, binding characteristics of 6-mercaptopurine (6-MP) with bovine serum albumin (BSA) together with its displacement from its binding site by quercetin and rutin have been investigated by the spectroscopic method. According to the binding parameters, a static quenching component in overall dynamic quenching process is operative in the interaction between 6-MP and BSA. The binding of 6-MP to BSA occurred spontaneously due to entropy-driven hydrophobic interactions. The synchronous fluorescence spectroscopy study revealed that the secondary structure of BSA is changed in the presence of 6-MP and both Tyr and Trp residues participate in the interaction between 6-MP and BSA with the later one being more dominant. The binding constant value of 6-MP-BSA in the presence of quercetin and rutin increased. 6-MP was displaced by ibuprofen indicating that the binding site of 6-MP on albumin is site II. Therefore, the change of the pharmacokinetic and pharmacodynamic properties of 6-MP by quercetin and rutin through alteration of binding capacity of 6-MP to the serum albumin cannot be ruled out. In addition, the displacement study showed that 6-MP is located in site II of BSA. - Highlights: Black-Right-Pointing-Pointer Participation of both Tyr and particularly Trp residues in the interaction between 6-MP and BSA. Black-Right-Pointing-Pointer Involvement of a static quenching component in an overall dynamic quenching process. Black-Right-Pointing-Pointer Ability of quercetin and rutin to change the binding constants of 6-MP-BSA complex. Black-Right-Pointing-Pointer Binding of 6-MP to BSA through entropy-driven hydrophobic interactions.

  4. Characterization of 6-mercaptopurine binding to bovine serum albumin and its displacement from the binding sites by quercetin and rutin

    International Nuclear Information System (INIS)

    Binding of a drug to the serum albumins as major serum transport proteins can be influenced by other ligands leading to alteration of its pharmacological properties. In the present study, binding characteristics of 6-mercaptopurine (6-MP) with bovine serum albumin (BSA) together with its displacement from its binding site by quercetin and rutin have been investigated by the spectroscopic method. According to the binding parameters, a static quenching component in overall dynamic quenching process is operative in the interaction between 6-MP and BSA. The binding of 6-MP to BSA occurred spontaneously due to entropy-driven hydrophobic interactions. The synchronous fluorescence spectroscopy study revealed that the secondary structure of BSA is changed in the presence of 6-MP and both Tyr and Trp residues participate in the interaction between 6-MP and BSA with the later one being more dominant. The binding constant value of 6-MP–BSA in the presence of quercetin and rutin increased. 6-MP was displaced by ibuprofen indicating that the binding site of 6-MP on albumin is site II. Therefore, the change of the pharmacokinetic and pharmacodynamic properties of 6-MP by quercetin and rutin through alteration of binding capacity of 6-MP to the serum albumin cannot be ruled out. In addition, the displacement study showed that 6-MP is located in site II of BSA. - Highlights: ► Participation of both Tyr and particularly Trp residues in the interaction between 6-MP and BSA. ► Involvement of a static quenching component in an overall dynamic quenching process. ► Ability of quercetin and rutin to change the binding constants of 6-MP–BSA complex. ► Binding of 6-MP to BSA through entropy-driven hydrophobic interactions

  5. Novel peptide ligand with high binding capacity for antibody purification

    DEFF Research Database (Denmark)

    Lund, L. N.; Gustavsson, P. E.; Michael, R.;


    commonly used capture step in mAb down stream processing; however, the use of Protein A chromatography is less attractive due to toxic ligand leakage as well as high cost. Whether used as an alternative to the Protein A chromatographic media or as a subsequent polishing step, small synthetic peptide...... the interaction is favorable and entropy-driven with an enthalpy penalty. Our results show that the binding of the Fc fragment of IgG is mediated by hydrophobic interactions and that elution at low pH is most likely due to electrostatic repulsion. Furthermore, we have separated aggregated IgG from non...

  6. Vibronic spectra predictions for open shell molecules - usefulness and limitations of ab initio calculations, assessed on alkali trimers

    International Nuclear Information System (INIS)

    Full text: The usefulness of standard ab initio techniques, such as coupled-cluster or multi-reference approaches, for the prediction of vibronic spectra is discussed using the example of K3 and Rb3 alkali-metal clusters. These exotic molecules, can be formed in their lowest-energy spin state (the doublet) by standard molecular beam methods; their weakly bound quartet state is easily stabilized on the surface of cold (0.4 K) helium nanodroplets. Both spin multiplicities have been characterized spectroscopically, and are good candidates to assess the quality of ab initio methods for electronic-structure calculations. The following characteristics make alkali trimers interesting in this respect: they are multi-electron systems, of moderate size, and include heavy atoms. Correlation energy and relativistic effects thus play an equally essential role for the molecular binding; at the same time, the system remains tractable by computationally expensive high-level methods. The symmetry properties of alkali trimers, in either spin multiplicity, makes them prime examples for the E.e Jahn-Teller effect, where a doubly-degenerate electronic state interacts with the doubly-degenerate vibrational mode of the system. By least-squares-fits of the ab initio points we extract parameters for the analytical description of the potential energy surfaces of several electronic states. We calculate vibronic spectra where the Jahn-Teller distortion as well as spin-orbit coupling are accounted for, which we compare with the available experimental data. (author)

  7. Structural, magnetic and electronic properties of FexCoyIrz (x + y + z = 5, 6) clusters: an ab initio study

    KAUST Repository

    Devi, Assa Aravindh Sasikala


    Investigations on freestanding binary and ternary clusters of Fe (x) Co (y) Ir (z) (x + y + z = 5, 6) are carried out using ab initio density functional theory techniques. The geometry, chemical order, binding energy, magnetic moment and electronic structure of the clusters are analyzed for the entire range of composition. Composition dependent structural transition is observed in the five atom clusters, while octahedral geometry prevailed in clusters with six atoms. Both the clusters show increment in binding energy with the increase in number of heterogeneous bonds. Analysis based on the chemical order parameter indicates that clusters favor mixing rather than segregation. The clusters exhibit ferromagnetic ordering and the inter-dependence of optimal cluster geometry to the magnetic moments and electronic structure is observed.

  8. Quantifying drug-protein binding in vivo

    International Nuclear Information System (INIS)

    Accelerator mass spectrometry (AMS) provides precise quantitation of isotope labeled compounds that are bound to biological macromolecules such as DNA or proteins. The sensitivity is high enough to allow for sub-pharmacological (''micro-'') dosing to determine macromolecular targets without inducing toxicities or altering the system under study, whether it is healthy or diseased. We demonstrated an application of AMS in quantifying the physiologic effects of one dosed chemical compound upon the binding level of another compound in vivo at sub-toxic doses [4].We are using tissues left from this study to develop protocols for quantifying specific binding to isolated and identified proteins. We also developed a new technique to quantify nanogram to milligram amounts of isolated protein at precisions that are comparable to those for quantifying the bound compound by AMS

  9. Music alters visual perception.

    Directory of Open Access Journals (Sweden)

    Jacob Jolij

    Full Text Available BACKGROUND: Visual perception is not a passive process: in order to efficiently process visual input, the brain actively uses previous knowledge (e.g., memory and expectations about what the world should look like. However, perception is not only influenced by previous knowledge. Especially the perception of emotional stimuli is influenced by the emotional state of the observer. In other words, how we perceive the world does not only depend on what we know of the world, but also by how we feel. In this study, we further investigated the relation between mood and perception. METHODS AND FINDINGS: We let observers do a difficult stimulus detection task, in which they had to detect schematic happy and sad faces embedded in noise. Mood was manipulated by means of music. We found that observers were more accurate in detecting faces congruent with their mood, corroborating earlier research. However, in trials in which no actual face was presented, observers made a significant number of false alarms. The content of these false alarms, or illusory percepts, was strongly influenced by the observers' mood. CONCLUSIONS: As illusory percepts are believed to reflect the content of internal representations that are employed by the brain during top-down processing of visual input, we conclude that top-down modulation of visual processing is not purely predictive in nature: mood, in this case manipulated by music, may also directly alter the way we perceive the world.

  10. Genetic Alterations in Glioma

    International Nuclear Information System (INIS)

    Gliomas are the most common type of primary brain tumor and have a dismal prognosis. Understanding the genetic alterations that drive glioma formation and progression may help improve patient prognosis by identification of novel treatment targets. Recently, two major studies have performed in-depth mutation analysis of glioblastomas (the most common and aggressive subtype of glioma). This systematic approach revealed three major pathways that are affected in glioblastomas: The receptor tyrosine kinase signaling pathway, the TP53 pathway and the pRB pathway. Apart from frequent mutations in the IDH1/2 gene, much less is known about the causal genetic changes of grade II and III (anaplastic) gliomas. Exceptions include TP53 mutations and fusion genes involving the BRAF gene in astrocytic and pilocytic glioma subtypes, respectively. In this review, we provide an update on all common events involved in the initiation and/or progression across the different subtypes of glioma and provide future directions for research into the genetic changes

  11. LFA-1 and Mac-1 integrins bind to the serine/threonine-rich domain of thrombomodulin. (United States)

    Kawamoto, Eiji; Okamoto, Takayuki; Takagi, Yoshimi; Honda, Goichi; Suzuki, Koji; Imai, Hiroshi; Shimaoka, Motomu


    LFA-1 (αLβ2) and Mac-1 (αMβ2) integrins regulate leukocyte trafficking in health and disease by binding primarily to IgSF ligand ICAM-1 and ICAM-2 on endothelial cells. Here we have shown that the anti-coagulant molecule thrombomodulin (TM), found on the surface of endothelial cells, functions as a potentially new ligand for leukocyte integrins. We generated a recombinant extracellular domain of human TM and Fc fusion protein (TM-domains 123-Fc), and showed that pheripheral blood mononuclear cells (PBMCs) bind to TM-domains 123-Fc dependent upon integrin activation. We then demonstrated that αL integrin-blocking mAb, αM integrin-blocking mAb, and β2 integrin-blocking mAb inhibited the binding of PBMCs to TM-domains 123-Fc. Furthermore, we show that the serine/threonine-rich domain (domain 3) of TM is required for the interaction with the LFA-1 (αLβ2) and Mac-1 (αMβ2) integrins to occur on PBMCs. These results demonstrate that the LFA-1 and Mac-1 integrins on leukocytes bind to TM, thereby establishing the molecular and structural basis underlying LFA-1 and Mac-1 integrin interaction with TM on endothelial cells. In fact, integrin-TM interactions might be involved in the dynamic regulation of leukocyte adhesion with endothelial cells. PMID:27055590

  12. Ab initio simulation of transport phenomena in rarefied gases. (United States)

    Sharipov, Felix; Strapasson, José L


    Ab initio potentials are implemented into the direct simulation Monte Carlo (DSMC) method. Such an implementation allows us to model transport phenomena in rarefied gases without any fitting parameter of intermolecular collisions usually extracted from experimental data. Applying the method proposed by Sharipov and Strapasson [Phys. Fluids 24, 011703 (2012)], the use of ab initio potentials in the DSMC requires the same computational efforts as the widely used potentials such as hard spheres, variable hard sphere, variable soft spheres, etc. At the same time, the ab initio potentials provide more reliable results than any other one. As an example, the transport coefficients of a binary mixture He-Ar, viz., viscosity, thermal conductivity, and thermal diffusion factor, have been calculated for several values of the mole fraction. PMID:23030889

  13. Epigenetic alterations associated with cholangiocarcinoma (review). (United States)

    Isomoto, Hajime


    Cholangiocarcinoma (CCA) is a highly lethal malignant tumor arising from the biliary tract epithelium. Chronic inflammatory conditions, including primary sclerosing cholangitis, liver fluke infestation, and hepatolithiasis, are considered risk factors, but the cause is still unknown in most cases. Recent advances in molecular pathogenesis have highlighted the importance of epigenetic alterations, including promoter hypermethylation and histone deacetylation, in the process of cholangiocarcinogenesis. More recently, research interest has been focusing on microRNA (mir), a major subtype of non-coding RNA. Mir is highly conserved among species and regulates the expression of specific target genes by binding to the 3'-untranslated regions of messenger RNA. The number of studies on a possible link between mir and various cancers is growing. This review provides a comprehensive overview of the genes currently known to be hypermethylated in CCA and their putative roles in cholangiocarcinogenesis. The epigenetic role of mir in the pathogenesis of CCA is also discussed. PMID:19578760

  14. Surface Modification of AB2. and AB5 Hydrogen Storage Alloy Electrodes by the Hot-Charging Treatment

    Institute of Scientific and Technical Information of China (English)


    The effect of the hot-charging treatment on the performance ofAB2 and AB5 hydrogen storage alloy electrodes was investigated. The result showed that the treatment can markedly improve the voltage plateau ratio (VPR), the high rate discharge ability (HRDA), the diffusion coefficient of hydrogen DH and the discharge capacity of the AB2 hydrogen storage alloy electrode. The SEM analysis showed that the hot-charging treatment brings about a Ni-rich surface due to the dissolution of Zr oxides. It is also very helpful for the improvement of the kinetic properties of AB2 hydrogen storage alloy electrode because the microcracking o.f the surface results in fresh surface. This can be the basic modification treatment for NiMH battery used in electric vehicles (EVs) in the future. But for AB5 type alloys, the treatment has the disadvantage of impairing the comprehensive electrochemical properties, because the surface of the alloy may be corroded during the treatment. The mechanism of the surface modification of the electrode is also proposed.

  15. Stimulation of UvrD helicase by UvrAB. (United States)

    Atkinson, John; Guy, Colin P; Cadman, Chris J; Moolenaar, Geri F; Goosen, Nora; McGlynn, Peter


    Helicases play critical roles in all aspects of nucleic acid metabolism by catalyzing the remodeling of DNA and RNA structures. UvrD is an abundant helicase in Escherichia coli with well characterized functions in mismatch and nucleotide excision repair and a possible role in displacement of proteins such as RecA from single-stranded DNA. The mismatch repair protein MutL is known to stimulate UvrD. Here we show that the nucleotide excision repair proteins UvrA and UvrB can together stimulate UvrD-catalyzed unwinding of a range of DNA substrates containing strand discontinuities, including forked DNA substrates. The stimulation is specific for UvrD, as UvrAB failed to stimulate Rep helicase, a UvrD homologue. Moreover, although UvrAB can promote limited strand displacement, stimulation of UvrD did not require the strand displacement function of UvrAB. We conclude that UvrAB, like MutL, modulate UvrD helicase activity. This stimulation likely plays a role in DNA strand and protein displacement by UvrD in nucleotide excision repair. Promotion of UvrD-catalyzed unwinding of nicked duplexes by UvrAB may also explain the need for UvrAB and UvrD in Okazaki fragment processing in cells lacking DNA polymerase I. More generally, these data support the idea that helicase activity is regulated in vivo, with helicases acting as part of multisubunit complexes rather than in isolation. PMID:19208629

  16. Simplest AB-Thermonuclear Space Propulsion and Electric Generator


    Bolonkin, Alexander


    The author applies, develops and researches mini-sized Micro- AB Thermonuclear Reactors for space propulsion and space power systems. These small engines directly convert the high speed charged particles produced in the thermonuclear reactor into vehicle thrust or vehicle electricity with maximum efficiency. The simplest AB-thermonuclear propulsion offered allows spaceships to reach speeds of 20,000 50,000 km/s (1/6 of light speed) for fuel ratio 0.1 and produces a huge amount of useful elect...

  17. Utveckling av ergoterapitjänster vid Helsingfors ergoterapi Ab


    Sandells, Linn


    Syftet med examensarbetet är att ta fram kvalitativa rekommendationer på ergoterapitjänster för barn i behov av särskilt stöd. Det har gjorts genom en processinriktad metod, rekommendationerna på ergoterapitjänster har tagits fram för Helsingfors ergoterapi Ab. Aktivitetsrättvisa är den teoretiska referensramen i arbetet. Den frågeställning som besvarats är vilka ergoterapitjänster kan rekommenderas till Helsingfors ergoterapi Ab. För att uppnå resultatet har materialinsamling och intervjuer ...

  18. Towards new horizons in ab initio nuclear structure theory

    International Nuclear Information System (INIS)

    We review recent advances in ab initio nuclear structure theory, which have changed the horizons of this field. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to further soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative QCD-based predictions are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (authors)

  19. Use of ab initio quantum chemical methods in battery technology

    Energy Technology Data Exchange (ETDEWEB)

    Deiss, E. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)


    Ab initio quantum chemistry can nowadays predict physical and chemical properties of molecules and solids. An attempt should be made to use this tool more widely for predicting technologically favourable materials. To demonstrate the use of ab initio quantum chemistry in battery technology, the theoretical energy density (energy per volume of active electrode material) and specific energy (energy per mass of active electrode material) of a rechargeable lithium-ion battery consisting of a graphite electrode and a nickel oxide electrode has been calculated with this method. (author) 1 fig., 1 tab., 7 refs.

  20. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    Directory of Open Access Journals (Sweden)

    G. Misra


    Full Text Available Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P, volume (V and temperature (T that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This ab initio method is extended to derive the equation of state for Mercuric Calcogenides. The present equation of state has also been tested for the prediction of End Point. The computed results compare well with Quantum statistical data.

  1. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    International Nuclear Information System (INIS)

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1962. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses (≥ 100 mrem/quarter) is for the whole of AB Atomenergi during this year 74. 2 manrem corresponding to about 50 mrem/year and person or 1 % of the maximum permissible dose. 32500 gamma films and 6200 neutron films have been evaluated. The total number of urine analyses is 2700 and of whole body measurements 10

  2. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    International Nuclear Information System (INIS)

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1963. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses during the year is for AB Atomenergi 64.2 manrem which, distributed over the whole company personnel, corresponds to about 40 mrem per year and person or about 1 % of the maximum permissible dose. 37800 gamma films and 6700 neutron films have been evaluated. The total number of urine analyses is 3603 and of whole body measurements 211

  3. Intern kontroll : - En studie om Schroff Scandinavia ABs interna kontroll


    Huldt, Martin; Björksved, Patrick


    Sammanfattning: ”Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll” Datum:  2014-06-11 Nivå: Kandidatuppsats i företagsekonomi, 15 ECTS Institution: Akademin för Ekonomi, Samhälle och Teknik, EST,                 Mälardalen Högskola Författare: Patrick Björksved, Martin Huldt Titel: Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll Handledare : Magnus Linderström Nyckelord: Intern kontroll, intern revision, intern styrning, COSO-modellen, Lean product...

  4. The optimal placement of up and ab – a comparison


    Dehé, Nicole


    The particle verb construction (PVC), also referred to in the literature as phrasal verb or separable complex verb, occurs in most if not all of the Germanic languages. The work presented here deals with a comparison of the transitive PVC in English and German. In English, the construction occurs in two alternating word orders (They called off the concert vs. They called the concert off ). In German, on the other hand, only one order is possible (Sie sagten das Konzert ab vs. *Sie sagten ab das...

  5. Recent achievements in ab initio modelling of liquid water

    CERN Document Server

    Khaliullin, Rustam Z


    The application of newly developed first-principle modeling techniques to liquid water deepens our understanding of the microscopic origins of its unusual macroscopic properties and behaviour. Here, we review two novel ab initio computational methods: second-generation Car-Parrinello molecular dynamics and decomposition analysis based on absolutely localized molecular orbitals. We show that these two methods in combination not only enable ab initio molecular dynamics simulations on previously inaccessible time and length scales, but also provide unprecedented insights into the nature of hydrogen bonding between water molecules. We discuss recent applications of these methods to water clusters and bulk water.

  6. Ultrasensitive human thyrotropin (h TSH) immunoradiometric assay (IRMA) set up, through identification and minimization of non specific bindings; Ensaio imunoradiometrico ultra-sensivel de tireotrofina humana (hTSH) obtido mediante a identificacao e minimizacao de ligacoes inespecificas

    Energy Technology Data Exchange (ETDEWEB)

    Peroni, C.N.


    An IRMA of h TSH, based on magnetic solid phase separation, was studied especially for what concerns its non specific bindings. These were identified as a product of the interaction between an altered form of radioiodinated anti-h TSH monoclonal antibody ({sup 125} I-m AB) and the uncoupled magnetizable cellulose particle (matrix). Apparently this form of {sup 125} I-m AB is a type of aggregate that can be partly resolved from the main peak on Sephadex G-200 and further minimized via a single pre-incubation with the same matrix. Solid phase saturation with milk proteins, tracer storage at 4{sup 0} C and serum addition during incubation were also found particularly effective is preventing its formation. These findings were used in order to reproducibly decrease non specific bindings to values <0.1% (or <70 cpm), increasing thus the signal-to-noise ratio (B{sub 60}/B{sub O}) up to values of 300-500. This way we obtained h TSH radio assays with functional sensitivities of about 0.05 m IU/L and analytical sensitivities of the order of 0.02 m IU/L, which classify them at least as among the best second generation assays and that are excellent indeed for magnetic IRMA s. A more optimistic sensitivity calculation, based on Rodbard`s definition, provided values down to 0.008 m IU/L. Such sensitivities, moreover, were obtained in a very reproducible way and all over the useful tracer life. (author). 83 refs, 13 figs, 25 tabs.

  7. Mapping of the C3d receptor (CR2)-binding site and a neoantigenic site in the C3d domain of the third component of complement.


    LAMBRIS, J. D.; Ganu, V S; Hirani, S.; Müller-Eberhard, H. J.


    The C3d domain of C3 contains the site that binds to the C3d receptor (CR2) which is expressed on B lymphocytes. It also contains a neoantigenic determinant that is recognized by monoclonal antibody (mAb) 130 and is expressed when C3b is cleaved to iC3b and subsequently to C3dg or C3d. mAb 130 inhibits the binding of C3d to CR2. In this study, the locations of the CR2-binding site and of the neoantigen recognized by mAb 130 within the C3d domain were investigated. Treatment of human C3d with ...

  8. Cloning and characterisation of a nuclear, site specific ssDNA binding protein. (United States)

    Smidt, M P; Russchen, B; Snippe, L; Wijnholds, J; Ab, G


    Estradiol inducible, liver-specific expression of the apoVLDL II gene is mediated through the estrogen receptor and a variety of other DNA-binding proteins. In the present study we report the cloning and characterisation of a single-strand DNA binding protein that interacts with the lower strand of a complex regulatory site, which includes the major estrogen responsive element and a site that resembles the rat albumin site D (apoVLDL II site D). Based on its binding specificity determined with electro-mobility shift assays, the protein is named single-strand D-box binding factor (ssDBF). Analysis of the deduced 302 amino acid sequence revealed that the protein belongs to the heteronuclear ribonucleoprotein A/B family (hnRNP A/B) and resembles other known eukaryotic single-strand DNA binding proteins. Transient transfection experiments in a chicken liver cell-line showed that the protein represses estrogen-induced transcription. A protein with similar binding characteristics is present in liver nuclear extract. The relevance of the occurrence of this protein to the expression of the apoVLDL II gene is discussed. PMID:7630716

  9. Ab initio investigation of the adsorption of atomic and molecular hydrogen on AlN nanotubes

    International Nuclear Information System (INIS)

    Highlights: • The adsorption characteristics of hydrogen inside the zigzag and armchair AlN nanotubes are explored. • The AlN nanotubes can store hydrogen up to 8.89 wt% with the average binding energies of 0.2–0.4 eV/H-2. - Abstract: The adsorption of atomic and molecular hydrogen on zigzag and armchair AlN nanotubes is investigated within the ab initio density functional theory. The adsorption configurations are magnetic when the H atom is adsorbed on the Al atom and the center of a hexagon. The total magnetic moment is 1.00 μB which comes from the H atom and the nearest neighbor N atoms. The barrier height of various adsorption configurations is very low, indicating that the adsorbed H atom can easily transform into other forms. The adsorption energies of hydrogen atoms to the zigzag and armchair AlN nanotubes are calculated at 25%, 50%, 75%, 100%, 133%, and 200% coverages, the most favorable adsorption configurations are 100% hydrogen coverages. The adsorption configuration of hydrogen molecule adsorbed on the Al atom is the most energetically favorable. Each Al atom is capable of binding one hydrogen molecule, corresponding to the hydrogen gravimetric density to 8.89 wt%. Our theoretical study demonstrates that AlN nanotube can be a potential candidate for the hydrogen storage materials

  10. Nonlocal torque operators in ab initio theory of the Gilbert damping in random ferromagnetic alloys (United States)

    Turek, I.; Kudrnovský, J.; Drchal, V.


    We present an ab initio theory of the Gilbert damping in substitutionally disordered ferromagnetic alloys. The theory rests on introduced nonlocal torques which replace traditional local torque operators in the well-known torque-correlation formula and which can be formulated within the atomic-sphere approximation. The formalism is sketched in a simple tight-binding model and worked out in detail in the relativistic tight-binding linear muffin-tin orbital method and the coherent potential approximation (CPA). The resulting nonlocal torques are represented by nonrandom, non-site-diagonal, and spin-independent matrices, which simplifies the configuration averaging. The CPA-vertex corrections play a crucial role for the internal consistency of the theory and for its exact equivalence to other first-principles approaches based on the random local torques. This equivalence is also illustrated by the calculated Gilbert damping parameters for binary NiFe and FeCo random alloys, for pure iron with a model atomic-level disorder, and for stoichiometric FePt alloys with a varying degree of L 10 atomic long-range order.

  11. Ab initio computational studies on molecular conformation of N-methyl-glyphosate (United States)

    Kaliannan, P.; Naseer Ali, M. Mohamed; Venuvanalingam, P.

    Conformational analysis of N-methyl-glyphosate has been carried out using an ab initio molecular orbital (MO) method at the HF/3-21G* levels of theory and the results are compared with the results of a previously studied compound, namely glyphosate. The potential energy surface of the molecule obtained by varying the central torsion angles (Φ, Ψ) was investigated in detail. Fourteen conformers with 5 kcal mol-1 energy cut-off have been selected from the potential energy surface for geometry optimization to locate the true minimum on the conformational space. The minimum has been found to be at (-62°, 110°) for the central torsion angles. This conformation is stabilized by hydrogen bond interactions (O-H···O and C-H···O) and the interactions due to protons nearer to each other. This cationic field leads to the formation of a hydrophobic patch in this structure, as well as in the structures closer to the global minimum. This patch may destabilize the favourable interaction of N-methyl-glyphosate with the surrounding amino acid residues in the binding cavity as they form the cationic field throughout the glyphosate binding region.

  12. Ab initio Calculations of Charge Symmetry Breaking in the A =4 Hypernuclei (United States)

    Gazda, Daniel; Gal, Avraham


    We report on ab initio no-core shell model calculations of the mirror Λ hypernuclei H4Λ and He4Λ , using the Bonn-Jülich leading-order chiral effective field theory hyperon-nucleon potentials plus a charge symmetry breaking Λ -Σ0 mixing vertex. In addition to reproducing rather well the 0g.s . + and 1exc+ binding energies, these four-body calculations demonstrate for the first time that the observed charge symmetry breaking splitting of mirror levels, reaching hundreds of keV for 0g.s . +, can be reproduced using realistic theoretical interaction models, although with a non-negligible momentum cutoff dependence. Our results are discussed in relation to recent measurements of the H4Λ(0g.s . +) binding energy at the Mainz Microtron [A. Esser et al. (A1 Collaboration), Phys. Rev. Lett. 114, 232501 (2015)] and the He4Λ(1exc+) excitation energy [T.O. Yamamoto et al. (J-PARC E13 Collaboration), Phys. Rev. Lett. 115, 222501 (2015)].

  13. Inhibition of selectin binding

    Energy Technology Data Exchange (ETDEWEB)

    Nagy, Jon O. (Rodeo, CA); Spevak, Wayne R. (Albany, CA); Dasgupta, Falguni (New Delhi, IN); Bertozzi, Caroline (Albany, CA)


    This invention provides compositions for inhibiting the binding between two cells, one expressing P- or L-selectin on the surface and the other expressing the corresponding ligand. A covalently crosslinked lipid composition is prepared having saccharides and acidic group on separate lipids. The composition is then interposed between the cells so as to inhibit binding. Inhibition can be achieved at an effective oligosaccharide concentration as low as 10.sup.6 fold below that of the free saccharide. Since selectins are involved in recruiting cells to sites of injury, these composition scan be used to palliate certain inflammatory and immunological conditions.

  14. Inhibition of selectin binding

    Energy Technology Data Exchange (ETDEWEB)

    Nagy, J.O.; Spevak, W.R.; Dasgupta, F.; Bertozzi, C.


    This invention provides a system for inhibiting the binding between two cells, one expressing P- or L-selectin on the surface and the other expressing the corresponding ligand. A covalently crosslinked lipid composition is prepared having saccharides and acidic group on separate lipids. The composition is then interposed between the cells so as to inhibit binding. Inhibition can be achieved at an effective oligosaccharide concentration as low as 10{sup 6} fold below that of the free saccharide. Since selectins are involved in recruiting cells to sites of injury, this system can be used to palliate certain inflammatory and immunological conditions.

  15. Inhibition of selectin binding

    Energy Technology Data Exchange (ETDEWEB)

    Nagy, Jon O. (Rodeo, CA); Spevak, Wayne R. (Albany, CA); Dasgupta, Falguni (New Delhi, IN); Bertozzi, Caroline (Albany, CA)


    This invention provides compositions for inhibiting the binding between two cells, one expressing P- or L-selectin on the surface and the other expressing the corresponding ligand. A covalently crosslinked lipid composition is prepared having saccharides and acidic group on separate lipids. The composition is then interposed between the cells so as to inhibit binding. Inhibition can be achieved at an effective oligosaccharide concentration as low as 10.sup.6 fold below that of the free saccharide. Since selectins are involved in recruiting cells to sites of injury, these composition scan be used to palliate certain inflammatory and immunological conditions.

  16. Inhibition of selectin binding

    Energy Technology Data Exchange (ETDEWEB)

    Nagy, J.O.; Spevak, W.R.; Dasgupta, F.; Bertozzi, C.


    This invention provides compositions for inhibiting the binding between two cells, one expressing P- or L-selectin on the surface and the other expressing the corresponding ligand. A covalently crosslinked lipid composition is prepared having saccharides and acidic group on separate lipids. The composition is then interposed between the cells so as to inhibit binding. Inhibition can be achieved at an effective oligosaccharide concentration as low as 10{sup 6} fold below that of the free saccharide. Since selectins are involved in recruiting cells to sites of injury, these composition scan be used to palliate certain inflammatory and immunological conditions.

  17. Inhibition of selectin binding

    Energy Technology Data Exchange (ETDEWEB)

    Nagy, Jon O. (Rodeo, CA); Spevak, Wayne R. (Albany, CA); Dasgupta, Falguni (New Delhi, IN); Bertozzi, Carolyn (Albany, CA)


    This invention provides a system for inhibiting the binding between two cells, one expressing P- or L-selectin on the surface and the other expressing the corresponding ligand. A covalently crosslinked lipid composition is prepared having saccharides and acidic group on separate lipids. The composition is then interposed between the cells so as to inhibit binding. Inhibition can be achieved at an effective oligosaccharide concentration as low as 10.sup.6 fold below that of the free saccharide. Since selectins are involved in recruiting cells to sites of injury, this system can be used to palliate certain inflammatory and immunological conditions.

  18. Neutralisation and binding of VHS virus by monovalent antibody fragments

    DEFF Research Database (Denmark)

    Cupit, P.M.; Lorenzen, Niels; Strachan, G.; Kemp, G.J.L.; Secombes, C.J.; Cunningham, C.

    single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using the......We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...

  19. The Binding Characterization of Cry Insecticidal Proteins to the Brush Border Membrane Vesicles of Helicoverpa armigera, Spodoptera exigua, Spodoptera litura and Agrotis ipsilon

    Institute of Scientific and Technical Information of China (English)

    LU Qiong; CAO Guang-chun; ZHANG Li-li; LIANG Ge-mei; GAO Xi-wu; ZHANG Yong-jun; GUO Yu-yuan


    Cry toxins produced by Bacillus thuringiensis (Bt) are effective biological insecticides against certain insect species. However, there are potential risks of the evolved resistance of insects to Cry toxin owing to decreased binding of toxins to target sites in the brush border membranes of the larva midgut. The Cry toxins with different binding sites in the larval midgut have been considered to be a good combination to deploy in delaying resistance evolution. Bioassay results demonstrated that the toxicity of different Cry toxins ranked differently for each species. The toxicity ranking was Cry1Ac>Cry1Ab>Cry2Ab for Helicoverpa armigera, Cry1B>Cry1C>Cry2Ab for Spodoptera exigua, and Cry2Ab>Cry1B>Cry1C for S. litura. Only Cry2Ab was toxic to Agrotis ipsilon. Binding experiments were performed with 125I-Cry1Ab, 125I-Cry1Ac, 125I-Cry1B, 125I-Cry1C, 125I-Cry2Ab and the brush border membranes vesicles (BBMV) from H. armigera, S. exigua, S. litura and A. ipsilon. The binding of Cry1Ab and Cry1Ac was shown to be saturable by incubating with increasing concentrations of H. armigera BBMV (Kd=(45.00±2.01) nmol L-1 and (12.80±0.18) nmol L-1, respectively;Bmax=(54.95±1.79) ng and (55.44±0.91) ng, separately). The binding of Cry1B was shown to be saturable by incubating with increasing concentrations of S. exigua BBMV (Kd=(23.26±1.66) nmol L-1;Bmax=(65.37±1.87) ng). The binding of 125I-Cry toxins was shown to be non-saturable by incubating with increasing concentrations of S. litura and A. ipsilon BBMV. In contrast, Cry1B and Cry1C showed some combination with the BBMV of S. litura, and a certain amount of Cry2Ab could bind to the BBMV of A. ipsilon. These observations suggest that a future strategy could be devised for the focused combination of specific cry genes in transgenic crops to control target pests, widen the spectrum of insecticide effectiveness and postpone insect resistance evolution.

  20. GJ 282 AB (WDS 07400-0336 AB = BGH 3 AB) and GICLAS 112-29: A Very Wide System in Process of Dissociation (United States)

    Rica, F. M.; Benavides, R.


    Very wide binaries are interesting objects that shed light on the binary formation process and their dynamical evolution. Poveda et al. (2009) studied the possible physical relation of the near (14.2 pc) and wide (~58") binary star GJ 282 AB and the extremely wide (1.09º; ~55,000 AU) companion, NLTT 18149, and they concluded that this very wide system is in the process of dynamical disintegration. In this work, we confirm the same conclusion but using a different method. We first study dynamically GJ 282 AB, confirmed that it is a bound system and then we determine possible orbital solutions. Later, we calculate the relative velocity of NLTT 18149 with respect to the GJ 282 AB's center mass using their (U, V, W) galactocentric velocity. The relative velocity, Vrel = 1.98 ± 0.16 km s-1, is much larger than the escape velocity (0.25 ± 0.01 km s-1). Therefore, with a significance level of 11s, we also conclude that this very wide system is in a process of dynamical disintegration.

  1. Temperatura e embalagem para abóbora minimamente processada Temperature and packaging of minimally processed pumpkin (Curcubita moschata

    Directory of Open Access Journals (Sweden)

    Ana Veruska Cruzda Silva


    Full Text Available O objetivo deste trabalho foi avaliar temperaturas de armazenamento e embalagens para abóbora minimamente processada. Pedaços de abóbora foram cortados em tamanho de 5 x 10 cm, embalados em bandejas de poliestireno recobertas com filme polivinilcloreto e em embalagem de polietileno de alta densidade a vácuo. O produto foi mantido a 5 e 10 °C por um período de 12 dias. A cada três dias avaliou-se o teor de sólidos solúveis, acidez total titulável, pH, vitamina C e coloração. Os resultados mostraram não haver diferenças significativas entre as duas temperaturas de refrigeração utilizadas na conservação da abóbora. Entretanto, a embalagem com filme PVC permitiu maior conservação dos atributos de qualidade da abóbora até o 9º dia, com exceção da cor, que sofreu menores alterações quando usada embalagem a vácuo.The present work aimed to evaluate the efficiency of different storage temperatures and packing materials for pumpkin fresh cuts. Pumpkin cuts of 5 x 10 cm were packed in polystyrene trays covered with polivynilchloride film or in vacuum high density polyethylene bags. The trays and bags were kept at 5 and 10 °C for 12 days. Soluble solids, total titratable acidity, pH, vitamin C, and color of pumpkin cuts were evaluated every 3 days. The different temperatures did not affect the storage of the pumpkins. However, packaging with PVC film allowed a longer conservation by keeping the pumpkin quality attributes up to the 9th day, except for the color which undergone minor alterations when stored within a vacuum pack.

  2. Positron Emission Tomography Imaging of Tumor Angiogenesis with a 61/64Cu-Labeled F(ab')2 Antibody Fragment (United States)

    Hong, Hao; Zhang, Yin; Orbay, Hakan; Valdovinos, Hector F.; Nayak, Tapas R.; Bean, Jero; Theuer, Charles P.; Barnhart, Todd E.; Cai, Weibo


    The objective of this study was to characterize the in vitro and in vivo properties of the F(ab')2 fragment of TRC105, a human/murine chimeric IgG1 monoclonal antibody that binds with high avidity to human and murine CD105 (i.e. endoglin), and investigate its potential for positron emission tomography (PET) imaging of tumor angiogenesis after 61/64Cu-labeling. TRC105-F(ab')2 of high purity was produced by pepsin digestion of TRC105, which was confirmed by SDS-PAGE, HPLC analysis, and mass spectrometry. 61/64Cu-labeling of NOTA-TRC105-F(ab')2 (NOTA denotes 1,4,7-triazacyclononane-1,4,7-triacetic acid) was achieved with yields of > 75% (specific activity: ~115 GBq/μmol). PET imaging revealed rapid tumor uptake of 64Cu-NOTA TRC105-F(ab')2 in the 4T1 murine breast cancer model (5.8 ± 0.8, 7.6 ± 0.6, 5.6 ± 0.4, 5.0 ± 0.6, and 3.8 ± 0.7 %ID/g at 0.5, 3, 16, 24, and 48 h post-injection respectively; n = 4). Since tumor uptake peaked at 3 h post-injection, 61Cu-NOTA-TRC105-F(ab')2 also gave good tumor contrast at 3 and 8 h post-injection. CD105 specificity of the tracers was confirmed by blocking studies and histopathology. In conclusion, the use of a F(ab')2 fragment led to more rapid tumor uptake (which peaked at 3 h post-injection) than radiolabeled intact antibody (which often peaked after 24 h post-injection), which may allow for same day immunoPET imaging in future clinical studies. PMID:23316869

  3. Positron emission tomography imaging of tumor angiogenesis with a (61/64)Cu-labeled F(ab')(2) antibody fragment. (United States)

    Hong, Hao; Zhang, Yin; Orbay, Hakan; Valdovinos, Hector F; Nayak, Tapas R; Bean, Jero; Theuer, Charles P; Barnhart, Todd E; Cai, Weibo


    The objective of this study was to characterize the in vitro and in vivo properties of the F(ab')(2) fragment of TRC105, a human/murine chimeric IgG1 monoclonal antibody that binds with high avidity to human and murine CD105 (i.e., endoglin), and investigate its potential for positron emission tomography (PET) imaging of tumor angiogenesis after (61/64)Cu-labeling. TRC105-F(ab')(2) of high purity was produced by pepsin digestion of TRC105, which was confirmed by SDS-PAGE, HPLC analysis, and mass spectrometry. (61/64)Cu-labeling of NOTA-TRC105-F(ab')(2) (NOTA denotes 1,4,7-triazacyclononane-1,4,7-triacetic acid) was achieved with yields of >75% (specific activity: ∼115 GBq/μmol). PET imaging revealed rapid tumor uptake of (64)Cu-NOTA-TRC105-F(ab')(2) in the 4T1 murine breast cancer model (5.8 ± 0.8, 7.6 ± 0.6, 5.6 ± 0.4, 5.0 ± 0.6, and 3.8 ± 0.7% ID/g at 0.5, 3, 16, 24, and 48 h postinjection respectively; n = 4). Since tumor uptake peaked at 3 h postinjection, (61)Cu-NOTA-TRC105-F(ab')(2) also gave good tumor contrast at 3 and 8 h postinjection. CD105 specificity of the tracers was confirmed by blocking studies and histopathology. In conclusion, the use of a F(ab')(2) fragment led to more rapid tumor uptake (which peaked at 3 h postinjection) than radiolabeled intact antibody (which often peaked after 24 h postinjection), which may allow for same day immunoPET imaging in future clinical studies. PMID:23316869

  4. Altering petrology through microbial dissimilatory phosphite oxidation (United States)

    Zhu, H.; Figueroa, I.; Coates, J. D.


    Microbial enhanced oil recovery (MEOR) takes advantage of various microbial metabolisms to increase hydrocarbon and energy yield by improving oil flow and flood water sweep in a reservoir during tertiary recovery. Wormholing at the injection well is believed to be the result of the large drop in pressure when water exits the injection well and enters the unconsolidated reservoir matrix. One possible means of prevent this event is to consolidate the rock matrix immediately around the injection well to create a permeable zone of stable petrology. Many microbial processes are known to result in the precipitation of ionic components into their environment creating solid-phase minerals. Such processes could be judiciously applied to bind unconsolidated matrices in order to form a permeable concreted rock matrix, which would minimize wormholing events and thus improve floodwater sweep. However, to date, apart from the application of urea oxidation creating calcium carbonate precipitation, there has been little investigation of the applicability of these precipitated bioconcretions to MEOR strategies and none to control wormholing events. Here we present a novel approach to altering rock petrology to concrete unconsolidated matrices in the near well environment by the biogenesis of authigenic minerals through microbial dissimilatory phosphite oxidation. Desulfotignum phosphitoxidans, strain FiPS-3 is currently the only isolated organism capable of using phosphite (HPO32-) as an electron donor for growth. This process, known as dissimilatory phosphite oxidation (DPO), can be coupled to either sulfate reduction or homoacetogenesis and leads to the accumulation of inorganic phosphate in the medium. The resulting insoluble mineral phases can coat the rock environment resulting in a concretion binding the unconsolidated matrix particles into a single phase. In this study we demonstrate that DPO can effectively produce calcium or magnesium phosphate minerals in packed glass

  5. Cholesterol Corrects Altered Conformation of MHC-II Protein in Leishmania donovani Infected Macrophages: Implication in Therapy (United States)

    Chakrabarti, Saikat; Roy, Syamal


    Background Previously we reported that Kala-azar patients show progressive decrease in serum cholesterol as a function of splenic parasite burden. Splenic macrophages (MΦ) of Leishmania donovani (LD) infected mice show decrease in membrane cholesterol, while LD infected macrophages (I-MΦ) show defective T cell stimulating ability that could be corrected by liposomal delivery of cholesterol. T helper cells recognize peptide antigen in the context of class II MHC molecule. It is known that the conformation of a large number of membrane proteins is dependent on membrane cholesterol. In this investigation we tried to understand the influence of decreased membrane cholesterol in I-MΦ on the conformation of MHC-II protein and peptide-MHC-II stability, and its bearing on the antigen specific T-cell activation. Methodology/Principal Findings MΦ of CBA/j mice were infected with Leishmania donovani (I-MΦ). Two different anti-Aκ mAbs were used to monitor the status of MHC-II protein under parasitized condition. One of them (11.5–2) was conformation specific, whereas the other one (10.2.16) was not. Under parasitized condition, the binding of 11.5–2 decreased significantly with respect to the normal counterpart, whereas that of 10.2.16 remained unaltered. The binding of 11.5–2 was restored to normal upon liposomal delivery of cholesterol in I-MΦ. By molecular dynamics (MD) simulation studies we found that there was considerable conformational fluctuation in the transmembrane domain of the MHC-II protein in the presence of membrane cholesterol than in its absence, which possibly influenced the distal peptide binding groove. This was evident from the faster dissociation of the cognate peptide from peptide-MHC complex under parasitized condition, which could be corrected by liposomal delivery of cholesterol in I-MΦ. Conclusion The decrease in membrane cholesterol in I-MΦ may lead to altered conformation of MHC II, and this may contribute to a faster dissociation of

  6. Comprehensive human transcription factor binding site map for combinatory binding motifs discovery.

    Directory of Open Access Journals (Sweden)

    Arnoldo J Müller-Molina

    Full Text Available To know the map between transcription factors (TFs and their binding sites is essential to reverse engineer the regulation process. Only about 10%-20% of the transcription factor binding motifs (TFBMs have been reported. This lack of data hinders understanding gene regulation. To address this drawback, we propose a computational method that exploits never used TF properties to discover the missing TFBMs and their sites in all human gene promoters. The method starts by predicting a dictionary of regulatory "DNA words." From this dictionary, it distills 4098 novel predictions. To disclose the crosstalk between motifs, an additional algorithm extracts TF combinatorial binding patterns creating a collection of TF regulatory syntactic rules. Using these rules, we narrowed down a list of 504 novel motifs that appear frequently in syntax patterns. We tested the predictions against 509 known motifs confirming that our system can reliably predict ab initio motifs with an accuracy of 81%-far higher than previous approaches. We found that on average, 90% of the discovered combinatorial binding patterns target at least 10 genes, suggesting that to control in an independent manner smaller gene sets, supplementary regulatory mechanisms are required. Additionally, we discovered that the new TFBMs and their combinatorial patterns convey biological meaning, targeting TFs and genes related to developmental functions. Thus, among all the possible available targets in the genome, the TFs tend to regulate other TFs and genes involved in developmental functions. We provide a comprehensive resource for regulation analysis that includes a dictionary of "DNA words," newly predicted motifs and their corresponding combinatorial patterns. Combinatorial patterns are a useful filter to discover TFBMs that play a major role in orchestrating other factors and thus, are likely to lock/unlock cellular functional clusters.

  7. Sequential memory: Binding dynamics (United States)

    Afraimovich, Valentin; Gong, Xue; Rabinovich, Mikhail


    Temporal order memories are critical for everyday animal and human functioning. Experiments and our own experience show that the binding or association of various features of an event together and the maintaining of multimodality events in sequential order are the key components of any sequential memories—episodic, semantic, working, etc. We study a robustness of binding sequential dynamics based on our previously introduced model in the form of generalized Lotka-Volterra equations. In the phase space of the model, there exists a multi-dimensional binding heteroclinic network consisting of saddle equilibrium points and heteroclinic trajectories joining them. We prove here the robustness of the binding sequential dynamics, i.e., the feasibility phenomenon for coupled heteroclinic networks: for each collection of successive heteroclinic trajectories inside the unified networks, there is an open set of initial points such that the trajectory going through each of them follows the prescribed collection staying in a small neighborhood of it. We show also that the symbolic complexity function of the system restricted to this neighborhood is a polynomial of degree L - 1, where L is the number of modalities.

  8. Ab initio calculations of mechanical properties: Methods and applications

    Czech Academy of Sciences Publication Activity Database

    Pokluda, J.; Černý, Miroslav; Šob, Mojmír; Umeno, Y.


    Roč. 73, AUG (2015), s. 127-158. ISSN 0079-6425 R&D Projects: GA ČR(CZ) GAP108/12/0311 Institutional support: RVO:68081723 Keywords : Ab initio methods * Elastic moduli * Intrinsic hardness * Stability analysis * Theoretical strength * Intrinsic brittleness/ductility Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 27.417, year: 2014

  9. Discovery of New Substrates for LuxAB Bacterial Bioluminescence. (United States)

    Jiang, Tianyu; Wang, Weishan; Wu, Xingkang; Wu, Wenxiao; Bai, Haixiu; Ma, Zhao; Shen, Yuemao; Yang, Keqian; Li, Minyong


    In this article, four novel substrates with long halftime have been designed and synthesized successfully for luxAB bacterial bioluminescence. After in vitro and in vivo biological evaluation, these molecules can emit obvious bioluminescence emission with known bacterial luciferase, thus indicating a new promising approach to developing the bacterial bioluminescent system. PMID:26896339

  10. Cyanogen Azide. Ionization Potentials and Ab Initio SCF MO Calculation

    DEFF Research Database (Denmark)

    Bak, Börge; Jansen, Peter; Stafast, Herbert


    The Ne(I) and He(I) photoelectron(PE) spectra of cyanogen azide, NCN3, have been recorded at high resolution. Their interpretation is achieved by comparison with the PE spectrum of HN3 and an ab initio LCGO SCF MO calculation. Deviations from Koopmans' theorem of quite different magnitudes are fo...

  11. Relaxation of Small Molecules: an ab initio Study

    Institute of Scientific and Technical Information of China (English)

    CAO Yi-Gang; JIAO Zheng-Kuan; A. Antons; K. Schroeder; S. Blügel2


    Using an ab initio total energy and force method, we have relaxed several group IV and group V elementalclusters, in detail the arsenic and antimony dimers, silicon, phosphorus, arsenic and antimony tetramers. The obtainedbond lengths and cohesive energies are more accurate than other calculating methods, and in excellent agreement withthe experimental results.

  12. Relaxation of Small Molecules:an ab initio Study

    Institute of Scientific and Technical Information of China (English)

    CAOYi-Gang; A.Antons; 等


    Using an ab inito total energy and force method,we have relaxed several group IV and group V elemental clusters,in detail the arsenic and antimony dimers,silicon,phosphorus,arsenic and antimony tetraners,The obtained bond lengths and cohesive energies are more accurate than other calculating methods,and in excellent agreement with the experimental results.

  13. Ab initio study of phase equilibria in TiCx

    DEFF Research Database (Denmark)

    Korzhavyi, P.A.; Pourovskii, L.V.; Hugosson, H.W.;


    The phase diagram for the vacancy-ordered structures in the substoichiometric TiCx (x = 0.5-1.0) has been established from Monte Carlo simulations with the long-range pair and multisite effective interactions obtained from ab initio calculations. Three ordered superstructures of vacancies (Ti2C, ...

  14. Environmentally friendly process for nickel electroplating of ABS (United States)

    Bazzaoui, M.; Martins, J. I.; Bazzaoui, E. A.; Albourine, A.


    Nickel electroplating of acrylonitrile butadiene styrene (ABS) plastic has been achieved successfully without any chromium or palladium pretreatment. Once the ABS is coated with polypyrrole (PPy), the sample may be electroplated. The process is fast, economic and involves three stages. Firstly, chemical deposition of PPy on ABS, secondly, copper deposition and finally nickel electroplating. A homogenous and adherent PPy has been synthesized chemically on ABS plate by using pyrrole as monomer and iron (III) chloride as oxidant. Copper and nickel were deposited galvanostatically from industrial plating baths. The metallic coatings were homogeneous and the adherence was estimated at 100%. The thickness of copper and nickel depend on the electrolysis time. As the current density increases, the Cu and Ni thickness raises. This result was confirmed from SEM characterization and RX map. The Ni coating is characterized by a globular structure with globules of different sizes. Energy dispersive X-ray spectroscopy (EDS) analysis shows the presence of Ni with some amount of carbon and oxygen due to the nickel oxides and contaminant from the bath solution.

  15. A-B Distinction in a Sample of Prominent Psychotherapists (United States)

    Geller, Jesse D.; Berzins, Juris I.


    A sample of prominent psychotherapists were asked to fill out the A-B therapist "type" scale and comment on their possible differential effectiveness in treating schizoid/schizophrenic versus neurotic patients. The data suggest that B therapists desire and seek more complex and exciting sensory-cognitive inputs during therapy hours than A…

  16. AB 1725 Model Accountability System. California Community Colleges. Revised. (United States)

    California Community Colleges, Sacramento. Board of Governors.

    This report proposes a model accountability system for the California community colleges to comply with the directives of Assembly Bill 1725 (AB 1725). The purpose of the accountability system is to provide colleges and districts, the board of governors, and the California legislature with information that will allow for the continued improvement…

  17. Ultra-Low Voltage Class AB Switched Current Memory Cell

    DEFF Research Database (Denmark)

    Igor, Mucha


    This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with...

  18. An HIV-1 envelope immunogen with W427S mutation in CD4 binding site induced more T follicular helper memory cells and reduced non-specific antibody responses.

    Directory of Open Access Journals (Sweden)

    Hao-Tong Yu

    Full Text Available The CD4 binding site (CD4BS of the HIV-1 envelope glycoprotein (Env contains epitopes for broadly neutralizing antibody (nAb and is the target for the vaccine development. However, the CD4BS core including residues 425-430 overlaps the B cell superantigen site and may be related to B cell exhaustion in HIV-1 infection. Furthermore, production of nAb and high-affinity plasma cells needs germinal center reaction and the help of T follicular helper (Tfh cells. We believe that strengthening the ability of Env CD4BS in inducing Tfh response and decreasing the effects of the superantigen are the strategies for eliciting nAb and development of HIV-1 vaccine. We constructed a gp120 mutant W427S of an HIV-1 primary R5 strain and examined its ability in the elicitation of Ab and the production of Tfh by immunization of BALB/c mice. We found that the trimeric wild-type gp120 can induce more non-specific antibody-secreting plasma cells, higher serum IgG secretion, and more Tfh cells by splenocyte. The modified W427S gp120 elicits higher levels of specific binding antibodies as well as nAbs though it produces less Tfh cells. Furthermore, higher Tfh cell frequency does not correlate to the specific binding Abs or nAbs indicating that the wild-type gp120 induced some non-specific Tfh that did not contribute to the production of specific Abs. This gp120 mutant led to more memory Tfh production, especially, the effector memory Tfh cells. Taken together, W427S gp120 could induce higher level of specific binding and neutralizing Ab production that may be associated with the reduction of non-specific Tfh but strengthening of the memory Tfh.

  19. Plasma Endocannabinoid Alterations in Individuals with Substance Use Disorder are Dependent on the “Mirror Effect” of Schizophrenia


    StephanePotvin; EmmanuelStip; Jean-PierreChiasson; AlexandraFurtos; EdouardKouassi


    Schizophrenia is a complex psychiatric disorder strongly associated with substance use disorders. Theoretically, schizophrenia and SUD may share endocannabinoid alterations in the brain reward system. The main endocannabinoids, anandamide, and 2-arachidonoylglycerol, are lipids which bind cannabinoid receptors. Oleoylethanolamide (OEA), a fatty-acid ethanolamide, binds peroxisome proliferator-activated receptors. The endocannabinoid system has been shown to be impaired in schizophrenia, and r...

  20. Protective mAbs and Cross-Reactive mAbs Raised by Immunization with Engineered Marburg Virus GPs.

    Directory of Open Access Journals (Sweden)

    Marnie L Fusco


    Full Text Available The filoviruses, which include the marburg- and ebolaviruses, have caused multiple outbreaks among humans this decade. Antibodies against the filovirus surface glycoprotein (GP have been shown to provide life-saving therapy in nonhuman primates, but such antibodies are generally virus-specific. Many monoclonal antibodies (mAbs have been described against Ebola virus. In contrast, relatively few have been described against Marburg virus. Here we present ten mAbs elicited by immunization of mice using recombinant mucin-deleted GPs from different Marburg virus (MARV strains. Surprisingly, two of the mAbs raised against MARV GP also cross-react with the mucin-deleted GP cores of all tested ebolaviruses (Ebola, Sudan, Bundibugyo, Reston, but these epitopes are masked differently by the mucin-like domains themselves. The most efficacious mAbs in this panel were found to recognize a novel "wing" feature on the GP2 subunit that is unique to Marburg and does not exist in Ebola. Two of these anti-wing antibodies confer 90 and 100% protection, respectively, one hour post-exposure in mice challenged with MARV.

  1. Preparation, biodistribution, and dosimetry of 188Re-Labeled MoAb ior cea1 and its f(ab')2 fragments by avidin-biotin strategy

    International Nuclear Information System (INIS)

    The biotinylated monoclonal antibody (MoAb) ior cea1 and its F(ab')2 fragments were labeled with Re-188 by combination of avidin-biotin strategy. 188Re-MoAb, 188Re-MoAb-biotin, 188Re-F(ab')2, and 188Re-F(ab')2-biotin preparations were produced for these studies with specific activities of 1.30±0.18 GBq/mg and from instant freeze-dried kit formulations using ethane-1-hydroxy-1,1-diphosphonic acid (EHDP) as a weak competing ligand. There were no significant differences (p>0.05) between the biodistribution in mice of biotinylated and unbiotinylated 188Re-labeled immunoconjugates. When avidin was injected as a chase after injection of 188Re-MoAb-biotin or 188Re-F(ab')2-biotin, the blood radioactivity level decreased approximately 75% (cumulated activity) and the effective dose decreased almost 25% with respect to that of the radioimmunoconjugates in which the chase effect was not used. Our results suggest that 188Re-labeled biotinylated MoAb ior cea1 and its F(ab')2 fragments prepared by this method are stable complexes in vivo

  2. Broad and potent HIV-1 neutralization by a human antibody that binds the gp41-120 interface (United States)

    Huang, Jinghe; Kang, Byong H.; Pancera, Marie; Lee, Jeong Hyun; Tong, Tommy; Feng, Yu; Georgiev, Ivelin S.; Chuang, Gwo-Yu; Druz, Aliaksandr; Doria-Rose, Nicole A.; Laub, Leo; Sliepen, Kwinten; van Gils, Marit J.; de la Peña, Alba Torrents; Derking, Ronald; Klasse, Per-Johan; Migueles, Stephen A.; Bailer, Robert T.; Alam, Munir; Pugach, Pavel; Haynes, Barton F.; Wyatt, Richard T.; Sanders, Rogier W.; Binley, James M.; Ward, Andrew B.; Mascola, John R.; Kwong, Peter D.; Connors, Mark


    The isolation of human monoclonal antibodies (mAbs) is providing important insights regarding the specificities that underlie broad neutralization of HIV-1 (reviewed in1). Here we report a broad and extremely potent HIV-specific mAb, termed 35O22, which binds novel HIV-1 envelope glycoprotein (Env) epitope. 35O22 neutralized 62% of 181 pseudoviruses with an IC50<50 μg/ml. The median IC50 of neutralized viruses was 0.033 μg/ml, among the most potent thus far described. 35O22 did not bind monomeric forms of Env tested, but did bind the trimeric BG505 SOSIP.664. Mutagenesis and a reconstruction by negative-stain electron microscopy of the Fab in complex with trimer revealed it to bind a conserved epitope, which stretched across gp120 and gp41. The specificity of 35O22 represents a novel site of vulnerability on HIV Env, which serum analysis indicates to be commonly elicited by natural infection. Binding to this new site of vulnerability may thus be an important complement to current mAb-based approaches to immunotherapies, prophylaxis, and vaccine design. PMID:25186731

  3. Binding energies and electron affinities of small silicon clusters (n=2--5)

    International Nuclear Information System (INIS)

    The Gaussian-2 (G2) theoretical procedure, based on ab initio molecular orbital theory, is used to calculate the energies of Sin and Si-n (n=1--5) clusters. The G2 energies are used to derive accurate binding energies and electron affinities of these clusters. The calculated electron affinities of Si2--Si4 are in agreement to within 0.1 eV with results from recent photoelectron spectroscopic measurements

  4. ParABS system in chromosome partitioning in the bacterium Myxococcus xanthus.

    Directory of Open Access Journals (Sweden)

    Antonio A Iniesta

    Full Text Available Chromosome segregation is an essential cellular function in eukaryotic and prokaryotic cells. The ParABS system is a fundamental player for a mitosis-like process in chromosome partitioning in many bacterial species. This work shows that the social bacterium Myxococcus xanthus also uses the ParABS system for chromosome segregation. Its large prokaryotic genome of 9.1 Mb contains 22 parS sequences near the origin of replication, and it is shown here that M. xanthus ParB binds preferentially to a consensus parS sequence in vitro. ParB and ParA are essential for cell viability in M. xanthus as in Caulobacter crescentus, but unlike in many other bacteria. Absence of ParB results in anucleate cells, chromosome segregation defects and loss of viability. Analysis of ParA subcellular localization shows that it clusters at the poles in all cells, and in some, in the DNA-free cell division plane between two chromosomal DNA masses. This ParA localization pattern depends on ParB but not on FtsZ. ParB inhibits the nonspecific interaction of ParA with DNA, and ParA colocalizes with chromosomal DNA only when ParB is depleted. The subcellular localization of ParB suggests a single ParB-parS complex localized at the edge of the nucleoid, next to a polar ParA cluster, with a second ParB-parS complex migrating after the replication of parS takes place to the opposite nucleoid edge, next to the other polar ParA cluster.

  5. Large basis ab initio shell model investigation of 9Be and 11Be

    Energy Technology Data Exchange (ETDEWEB)

    Forssen, C; Navratil, P; Ormand, W E; Caurier, E


    We are presenting the first ab initio structure investigation of the loosely bound {sup 11}Be nucleus, together with a study of the lighter isotope {sup 9}Be. The nuclear structure of these isotopes is particularly interesting due to the appearance of a parity-inverted ground state in {sup 11}Be. Our study is performed in the framework of the ab initio no-core shell model. Results obtained using four different, high-precision two-nucleon interactions, in model spaces up to 9{h_bar}{Omega}, are shown. For both nuclei, and all potentials, we reach convergence in the level ordering of positive- and negative-parity spectra separately. Concerning their relative position, the positive-parity states are always too high in excitation energy, but a fast drop with respect to the negative-parity spectrum is observed when the model space is increased. This behavior is most dramatic for {sup 11}Be. In the largest model space we were able to reach, the 1/2{sup +} level has dropped down to become either the first or the second excited state, depending on which interaction we use. We also observe a contrasting behavior in the convergence patterns for different two-nucleon potentials, and argue that a three-nucleon interaction is needed to explain the parity inversion. Furthermore, large-basis calculations of {sup 13}C and {sup 11}B are performed. This allows us to study the systematics of the position of the first unnatural-parity state in the N = 7 isotone and the A = 11 isobar. The {sup 11}B run in the 9{h_bar}{Omega} model space involves a matrix with dimension exceeding 1.1 x 10{sup 9}, and is our largest calculation so far. We present results on binding energies, excitation spectra, level configurations, radii, electromagnetic observables, and {sup 10}Be + n overlap functions.

  6. Epigenetic alterations in gastric carcinogenesis

    Institute of Scientific and Technical Information of China (English)

    In-Seon CHOI; Tsung-Teh WU


    Gastric cancer is believed to result in part from the accumulation of multiple genetic alterations leading to oncogene overexpression and tumor suppressor loss. Epigenetic alterations as a distinct and crucial mechanism to silence a variety of methylated tissue-specific and imprinted genes, have been extensively studied in gastric carcinoma and play important roles in gastric carcinogenesis. This review will briefly discuss the basic aspects of DNA methylation and CpG island methylation, in particular the epigenetic alterations of certain critical genes implicated in gastric carcinogenesis and its relevance of clinical implications.

  7. Veltuzumab, an anti-CD20 mAb for the treatment of non-Hodgkin's lymphoma, chronic lymphocytic leukemia and immune thrombocytopenic purpura. (United States)

    Milani, Cannon; Castillo, Jorge


    Veltuzumab is a humanized, second-generation anti-CD20 mAb currently under development by Immunomedics Inc for the potential treatment of B-cell non-Hodgkin's lymphoma (NHL) and chronic lymphocytic leukemia (CLL). Licensee Nycomed is developing veltuzumab for the potential treatment of rheumatoid arthritis and immune thrombocytopenic purpura (ITP). Veltuzumab contains 90 to 95% human antibody sequences with identical antigen framework regions to epratuzumab (a humanized anti-CD22 mAb) and similar antigen-binding determinants to rituximab (chimeric, anti-CD20 mAb and the first-line treatment of aggressive and indolent NHL). In vitro studies have demonstrated that veltuzumab has enhanced binding avidities and a stronger effect on complement-dependent cytotoxicity compared with rituximab in selected cell lines. In dose-finding phase I/II clinical trials in patients with low-grade NHL, intravenous veltuzumab demonstrated a substantial rate of complete responses in concurrence with shorter and more tolerable infusions compared with rituximab. Currently there has been no evidence of an immune response to repeated administrations, and no serious adverse events related to veltuzumab treatment in patients with NHL. Veltuzumab is undergoing clinical trials using a low-dose subcutaneous formulation in patients with NHL, CLL and ITP. Prospective, randomized clinical trials are needed to clarify the role veltuzumab will play in a market where the therapy of B-cell lymphoproliferative disorders is dominated by rituximab. PMID:19330725

  8. The over-expression of an Arabidopsis B3 transcription factor, ABS2/NGAL1, leads to the loss of flower petals. (United States)

    Shao, Jingxia; Liu, Xiayan; Wang, Rui; Zhang, Gaisheng; Yu, Fei


    Transcriptional regulations are involved in many aspects of plant development and are mainly achieved through the actions of transcription factors (TF). To investigate the mechanisms of plant development, we carried out genetic screens for mutants with abnormal shoot development. Taking an activation tagging approach, we isolated a gain-of-function mutant abs2-1D (abnormal shoot 2-1D). abs2-1D showed pleiotropic growth defects at both the vegetative and reproductive developmental stages. We cloned ABS2 and it encodes a RAV sub-family of plant B3 type of transcriptional factors. Phylogenetic analysis showed that ABS2 was closely related to NGATHA (NGA) genes that are involved in flower development and was previously named NGATHA-Like 1 (NGAL1). NGAL1 was expressed mainly in the root and the filament of the stamen in flower tissues and sub-cellular localization assay revealed that NGAL1 accumulated in the nucleus. Interestingly, over-expression of NGAL1 driven by the constitutive 35S promoter led to transgenic plants with conspicuous flower defects, particularly a loss-of-petal phenotype. A loss-of-function ngal1-1 mutant did not show obvious phenotype, suggesting the existence of redundant activities and also the utility of gain-of-function genetic screens. Our results show that the over-expression of NGAL1 is capable of altering flower petal development, as well as shoot development. PMID:23185464

  9. Realization of prediction of materials properties by ab initio computer simulation

    Indian Academy of Sciences (India)

    Yoshiyuki Kawazoe


    Ab initio treatment is becoming realistic to predict physical, chemical, and even mechanical properties of academically and industrially interesting materials. There is, however, some limitation in size and time of the system up to the order of several hundred atoms and ∼ 1 pico second, even if we use the fastest supercomputer efficiently. Therefore, it is very difficult to simulate realistic materials with grain boundaries and important reactions like diffusion in materials. To improve this situation, two ways have been invented. One way is to upgrade approximations to match the necessary levels according to inhomogeneous electron gas theory beyond the present day standard, i.e. local density approximation (LDA). The reason is simply that the system we are interested in is composed of many particles interacting with Coulomb forces governed by quantum mechanics. (Complete knowledge is available, and only what we should do is to make better approximations to explain the phenomena!). Another is to extract the necessary parameters from the ab initio calculations on systems with limited number of atoms, and apply these results into cluster variation, direct, or any other sophisticated methods based on classical concepts such as statistical mechanics. In this paper, several typical examples recently worked out by our research group are introduced to indicate that these methodologies are actually possible to be successfully used to predict materials properties before experiments based on the present day state-of-art supercomputing systems. It includes scientific visualization of the results of ab initio molecular dynamics simulation on atom insertion process to C60 and to carbon nanotube, tight-binding calculation of single electron conductance properties in nanotube to create nano-scale diode virtually by computer, which will be a base of future nanoscale electric device in nanometer size, Li + H reaction without Born–Oppenheimer approximation, structural phase

  10. Variations in the structures and binding energies of binary complexes with HBO (United States)

    Del Bene, Janet E.; Alkorta, Ibon; Sanchez-Sanz, Goar; Elguero, José


    Ab initio MP2/aug'-cc-pVTZ calculations have been carried out to determine the structures and binding energies of binary complexes formed by HBO with a series of small molecules A. Three different types of structures have been identified, which depend on the nature of A. In one structure A:HBO, HBO acts as a weak proton donor. In the second HBO:A, HBO is a relatively strong base. The third type of complex A||HBO has HBO and A in an approximately parallel arrangement. The dipole moment of A influences both the type of complex formed and its binding energy.

  11. Molecular alteration of a muscarinic acetylcholine receptor system during synaptogenesis

    International Nuclear Information System (INIS)

    Biochemical properties of the muscarinic acetylcholine receptor system of the avian retina were found to change during the period when synapses form in ovo. Comparison of ligand binding to membranes obtained before and after synaptogenesis showed a significant increase in the affinity, but not proportion, of the high affinity agonist-binding state. There was no change in receptor sensitivity to antagonists during this period. Pirenzepine binding, which can discriminate muscarinic receptor subtypes, showed the presence of a single population of low affinity sites (M2) before and after synaptogenesis. The change in agonist binding was not due to the late development of receptor function. However, detergent-solubilization of membranes eliminated differences in agonist binding between receptors from embryos and hatched chicks, suggesting a developmental change in interactions of the receptor with functionally related membrane components. A possible basis for altered interactions was obtained from isoelectric point data showing that the muscarinic receptor population underwent a transition from a predominantly low pI form (4.25) in 13 day embryos to a predominantly high pI form (4.50) in newly hatched chicks. The possibility that biochemical changes in the muscarinic receptor play a role in differentiation of the system by controlling receptor position on the surface of nerve cells is discussed

  12. Photochemical Microscale Electrophoresis Allows Fast Quantification of Biomolecule Binding. (United States)

    Möller, Friederike M; Kieß, Michael; Braun, Dieter


    Intricate spatiotemporal patterns emerge when chemical reactions couple to physical transport. We induce electrophoretic transport by a confined photochemical reaction and use it to infer the binding strength of a second, biomolecular binding reaction under physiological conditions. To this end, we use the photoactive compound 2-nitrobenzaldehyde, which releases a proton upon 375 nm irradiation. The charged photoproducts locally perturb electroneutrality due to differential diffusion, giving rise to an electric potential Φ in the 100 μV range on the micrometer scale. Electrophoresis of biomolecules in this field is counterbalanced by back-diffusion within seconds. The biomolecule concentration is measured by fluorescence and settles proportionally to exp(-μ/D Φ). Typically, binding alters either the diffusion coefficient D or the electrophoretic mobility μ. Hence, the local biomolecule fluorescence directly reflects the binding state. A fit to the law of mass action reveals the dissociation constant of the binding reaction. We apply this approach to quantify the binding of the aptamer TBA15 to its protein target human-α-thrombin and to probe the hybridization of DNA. Dissociation constants in the nanomolar regime were determined and match both results in literature and in control experiments using microscale thermophoresis. As our approach is all-optical, isothermal and requires only nanoliter volumes at nanomolar concentrations, it will allow for the fast screening of biomolecule binding in low volume multiwell formats. PMID:27042755

  13. Pulmonary alterations in Behcet's disease

    International Nuclear Information System (INIS)

    Purpose: This study aims to demonstrate pulmonary alterations (PA) in patients with Behcet's disease by using CT. Materials and methods: CTs of 50 patients with Behcet's disease and 20 others in a control group have been evaluated retrospectively for PA (septal, reticular, nodular, atelectatic opacities). Results: Eight out of 50 patients (16%) with Behcet's disease showed PA. Three out of 20 (15%) in the control group showed PA. No differences were observed between Behcet's disease patients and the control group regarding pulmonary alterations (p = 0.917). No differences were observed in the disease duration, ages and sex in either group in those with and without PA. Conclusion: Pulmonary alterations can be seen in patients with Behcet's disease, but these alterations are not significant.

  14. Solar Powered Vapor Absorption System Using Propane And Alkylated Benzene Ab300 Oil


    Al-Dadah, R.K.; Jackson, G.; Rezk, Ahmed


    Abstract This paper describes experimental work on a solar assisted vapour absorption air conditioning system using Propane (refrigerant) and Alkylated Benzene (AB300?refrigeration lubrication oil, absorbent). Preliminary experiments to assess the miscibility of propane in various lubricating oils namely Shell Clavus oils 32 and 64 and Alkylated Benzene oils AB150 and AB300 indicated that Propane is most miscible in Alkylated Benzene AB300. The vapour absorption system is a single ...

  15. DNA-binding specificity and molecular functions of NAC transcription factors

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Ernst, Heidi Asschenfeldt; Lo Leggio, Leila;


    The family of NAC (NAM/ATAF1,2/CUC2) transcription factors has been implicated in a wide range of plant processes, but knowledge on the DNA-binding properties of the family is limited. Using a reiterative selection procedure on random oligonucleotides, we have identified consensus binding sites for....... Furthermore, NAC protein binding to the CaMV 35S promoter was shown to depend on sequences similar to the consensus of the selected oligonucleotides. Electrophoretic mobility shift assays demonstrated that NAC proteins bind DNA as homo- or heterodimers and that dimerization is necessary for stable DNA binding....... The ability of NAC proteins to dimerize and to bind DNAwas analysed by structure-based mutagenesis. This identified two salt bridge-forming residues essential for NAC protein dimerization. Alteration of basic residues in a loop region containing several highly conserved residues abolished DNA binding...

  16. First-principles Hubbard U approach for small molecule binding in metal-organic frameworks (United States)

    Mann, Gregory W.; Lee, Kyuho; Cococcioni, Matteo; Smit, Berend; Neaton, Jeffrey B.


    We apply first-principles approaches with Hubbard U corrections for calculation of small molecule binding energetics to open-shell transition metal atoms in metal-organic frameworks (MOFs). Using density functional theory with van der Waals dispersion-corrected functionals, we determine Hubbard U values ab initio through an established linear response procedure for M-MOF-74, for a number of different metal centers (M = Ti, V, Cr, Mn, Fe, Co, Ni, and Cu). While our ab initio U values differ from those used in previous work, we show that they result in lattice parameters and electronic contributions to CO2-MOF binding energies that lead to excellent agreement with experiments and previous results, yielding lattice parameters within 3%. In addition, U-dependent calculations for an example system, Co-MOF-74, suggest that the CO2 binding energy grows monotonically with the value of Hubbard U, with the binding energy shifting 4 kJ/mol (or 0.041 eV) over the range of U = 0-5.4 eV. These results provide insight into an approximate but computationally efficient means for calculation of small molecule binding energies to open-shell transition metal atoms in MOFs and suggest that the approach can be predictive with good accuracy, independent of the cations used and the availability of experimental data.

  17. First-principles Hubbard U approach for small molecule binding in metal-organic frameworks. (United States)

    Mann, Gregory W; Lee, Kyuho; Cococcioni, Matteo; Smit, Berend; Neaton, Jeffrey B


    We apply first-principles approaches with Hubbard U corrections for calculation of small molecule binding energetics to open-shell transition metal atoms in metal-organic frameworks (MOFs). Using density functional theory with van der Waals dispersion-corrected functionals, we determine Hubbard U values ab initio through an established linear response procedure for M-MOF-74, for a number of different metal centers (M = Ti, V, Cr, Mn, Fe, Co, Ni, and Cu). While our ab initio U values differ from those used in previous work, we show that they result in lattice parameters and electronic contributions to CO2-MOF binding energies that lead to excellent agreement with experiments and previous results, yielding lattice parameters within 3%. In addition, U-dependent calculations for an example system, Co-MOF-74, suggest that the CO2 binding energy grows monotonically with the value of Hubbard U, with the binding energy shifting 4 kJ/mol (or 0.041 eV) over the range of U = 0-5.4 eV. These results provide insight into an approximate but computationally efficient means for calculation of small molecule binding energies to open-shell transition metal atoms in MOFs and suggest that the approach can be predictive with good accuracy, independent of the cations used and the availability of experimental data. PMID:27155622

  18. Serum and plasma fibronectin binds to complement reacted immune complexes primarily via Clq

    DEFF Research Database (Denmark)

    Baatrup, G; Svehag, S E


    The binding of fibronectin to human Clq, C3b, and complement-reacted immune complexes (IC) was investigated by enzyme-linked immunosorbent assays. Microplates were coated with BSA followed by incubation with rabbit-anti-BSA IgG or F(ab')2 fragments of rabbit anti-BSA. Incubation of the solid phase...... with serum at 37 degrees C caused attachment of Clq and C3b. Addition of EDTA to the serum inhibited the binding of C3b, but not Clq, whereas substitution of the anti-BSA IgG on the solid phase with the F(ab')2 fragments abrogated the Clq, but not the C3b binding. Fibronectin binding was observed after...... incubation of the solid-phase IC with serum or plasma at conditions where Clq was also bound, whereas only minor amounts of fibronectin bound to the solid phase IC via C3b. Purified fibronectin showed a dose-dependent binding to solid-phase IC pretreated with Clq or fibronectin-depleted serum, confirming...

  19. Ab initio van der waals interactions in simulations of water alter structure from mainly tetrahedral to high-density-like

    DEFF Research Database (Denmark)

    Møgelhøj, Andreas; Kelkkanen, Kari André; Wikfeldt, K Thor; Schiøtz, Jakob; Mortensen, Jens Jørgen; Pettersson, Lars G M; Lundqvist, Bengt; Jacobsen, Karsten Wedel; Nilsson, Anders; Nørskov, Jens Kehlet


    , from the much lower and broader first peak in the oxygen-oxygen pair-correlation function (PCF) and loss of structure in the outer hydration shells. Inclusion of vdW interactions is shown to shift the balance of resulting structures from open tetrahedral to more close-packed. The resulting O-O PCF...

  20. Monoclonal antibodies to HLA-E bind epitopes carried by unfolded β2 m-free heavy chains. (United States)

    Tremante, Elisa; Lo Monaco, Elisa; Ingegnere, Tiziano; Sampaoli, Camilla; Fraioli, Rocco; Giacomini, Patrizio


    Since HLA-E heavy chains accumulate free of their light β2 -microglobulin (β2 m) subunit, raising mAbs to folded HLA-E heterodimers has been difficult, and mAb characterization has been controversial. Herein, mAb W6/32 and 5 HLA-E-restricted mAbs (MEM-E/02, MEM-E/07, MEM-E/08, DT9, and 3D12) were tested on denatured, acid-treated, and natively folded (both β2 m-associated and β2 m-free) HLA-E molecules. Four distinct conformations were detected, including unusual, partially folded (and yet β2 m-free) heavy chains reactive with mAb DT9. In contrast with previous studies, epitope mapping and substitution scan on thousands of overlapping peptides printed on microchips revealed that mAbs MEM-E/02, MEM-E/07, and MEM-E/08 bind three distinct α1 and α2 domain epitopes. All three epitopes are linear since they span just 4-6 residues and are "hidden" in folded HLA-E heterodimers. They contain at least one HLA-E-specific residue that cannot be replaced by single substitutions with polymorphic HLA-A, HLA-B, HLA-C, HLA-F, and HLA-G residues. Finally, also the MEM-E/02 and 3D12 epitopes are spatially distinct. In summary, HLA-E-specific residues are dominantly immunogenic, but only when heavy chains are locally unfolded. Consequently, the available mAbs fail to selectively bind conformed HLA-E heterodimers, and HLA-E expression may have been inaccurately assessed in some previous oncology, reproductive immunology, virology, and transplantation studies. PMID:25982269

  1. Liver fatty acid-binding protein binds monoacylglycerol in vitro and in mouse liver cytosol. (United States)

    Lagakos, William S; Guan, Xudong; Ho, Shiu-Ying; Sawicki, Luciana Rodriguez; Corsico, Betina; Kodukula, Sarala; Murota, Kaeko; Stark, Ruth E; Storch, Judith


    Liver fatty acid-binding protein (LFABP; FABP1) is expressed both in liver and intestinal mucosa. Mice null for LFABP were recently shown to have altered metabolism of not only fatty acids but also monoacylglycerol, the two major products of dietary triacylglycerol hydrolysis (Lagakos, W. S., Gajda, A. M., Agellon, L., Binas, B., Choi, V., Mandap, B., Russnak, T., Zhou, Y. X., and Storch, J. (2011) Am. J. Physiol. Gastrointest. Liver Physiol. 300, G803-G814). Nevertheless, the binding and transport of monoacylglycerol (MG) by LFABP are uncertain, with conflicting reports in the literature as to whether this single chain amphiphile is in fact bound by LFABP. In the present studies, gel filtration chromatography of liver cytosol from LFABP(-/-) mice shows the absence of the low molecular weight peak of radiolabeled monoolein present in the fractions that contain LFABP in cytosol from wild type mice, indicating that LFABP binds sn-2 MG in vivo. Furthermore, solution-state NMR spectroscopy demonstrates two molecules of sn-2 monoolein bound in the LFABP binding pocket in positions similar to those found for oleate binding. Equilibrium binding affinities are ∼2-fold lower for MG compared with fatty acid. Finally, kinetic studies examining the transfer of a fluorescent MG analog show that the rate of transfer of MG is 7-fold faster from LFABP to phospholipid membranes than from membranes to membranes and occurs by an aqueous diffusion mechanism. These results provide strong support for monoacylglycerol as a physiological ligand for LFABP and further suggest that LFABP functions in the efficient intracellular transport of MG. PMID:23658011

  2. Liver Fatty Acid-binding Protein Binds Monoacylglycerol in Vitro and in Mouse Liver Cytosol* (United States)

    Lagakos, William S.; Guan, Xudong; Ho, Shiu-Ying; Sawicki, Luciana Rodriguez; Corsico, Betina; Kodukula, Sarala; Murota, Kaeko; Stark, Ruth E.; Storch, Judith


    Liver fatty acid-binding protein (LFABP; FABP1) is expressed both in liver and intestinal mucosa. Mice null for LFABP were recently shown to have altered metabolism of not only fatty acids but also monoacylglycerol, the two major products of dietary triacylglycerol hydrolysis (Lagakos, W. S., Gajda, A. M., Agellon, L., Binas, B., Choi, V., Mandap, B., Russnak, T., Zhou, Y. X., and Storch, J. (2011) Am. J. Physiol. Gastrointest. Liver Physiol. 300, G803–G814). Nevertheless, the binding and transport of monoacylglycerol (MG) by LFABP are uncertain, with conflicting reports in the literature as to whether this single chain amphiphile is in fact bound by LFABP. In the present studies, gel filtration chromatography of liver cytosol from LFABP−/− mice shows the absence of the low molecular weight peak of radiolabeled monoolein present in the fractions that contain LFABP in cytosol from wild type mice, indicating that LFABP binds sn-2 MG in vivo. Furthermore, solution-state NMR spectroscopy demonstrates two molecules of sn-2 monoolein bound in the LFABP binding pocket in positions similar to those found for oleate binding. Equilibrium binding affinities are ∼2-fold lower for MG compared with fatty acid. Finally, kinetic studies examining the transfer of a fluorescent MG analog show that the rate of transfer of MG is 7-fold faster from LFABP to phospholipid membranes than from membranes to membranes and occurs by an aqueous diffusion mechanism. These results provide strong support for monoacylglycerol as a physiological ligand for LFABP and further suggest that LFABP functions in the efficient intracellular transport of MG. PMID:23658011

  3. Mapping the binding site of a cross-reactive Plasmodium falciparum PfEMP1 monoclonal antibody inhibitory of ICAM-1 binding

    DEFF Research Database (Denmark)

    Lennartz, Frank; Bengtsson, Anja; Olsen, Rebecca W;


    The virulence of Plasmodium falciparum is linked to the ability of infected erythrocytes (IE) to adhere to the vascular endothelium, mediated by P. falciparum erythrocyte membrane protein 1 (PfEMP1). In this article, we report the functional characterization of an mAb that recognizes a panel of PfEMP......1s and inhibits ICAM-1 binding. The 24E9 mouse mAb was raised against PFD1235w DBLβ3_D4, a domain from the group A PfEMP1s associated with severe malaria. 24E9 recognizes native PfEMP1 expressed on the IE surface and shows cross-reactivity with and cross-inhibition of the ICAM-1 binding capacity of...... domain cassette 4 PfEMP1s. 24E9 Fab fragments bind DBLβ3_D4 with nanomolar affinity and inhibit ICAM-1 binding of domain cassette 4-expressing IE. The antigenic regions targeted by 24E9 Fab were identified by hydrogen/deuterium exchange mass spectrometry and revealed three discrete peptides that are...

  4. Construction and characterization of an anti-CD20 mAb nanocomb with exceptionally excellent lymphoma-suppressing activity

    Directory of Open Access Journals (Sweden)

    Li H


    Full Text Available Hua-Fei Li,1–3,* Cong Wu,4,* Ting Chen,5,* Ge Zhang,1 He Zhao,1 Chang-Hong Ke,1 Zheng Xu21International Joint Cancer Institute, Translation Medicine Institute, 2Planning Division, Scientific Research Department, 3Tumor Immunology and Gene Therapy Center, Eastern Hepatobiliary Surgery Hospital, 4Department of Laboratory Diagnosis, Changhai Hospital, 5Department of Cardiology, Changhai Hospital, the Second Military Medical University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: The CD20-directed monoclonal antibody rituximab (RTX established a new era in the treatment of non-Hodgkin lymphoma (NHL; however, suboptimal response and/or resistance to RTX still limit its clinical merits. Although four effector mechanisms are validated to participate in CD20-based immunotherapy, including complement-dependent cytotoxicity, antibody-dependent cell-mediated cytotoxicity, caspase-dependent apoptosis, and lysosome-mediated programmed cell death (PCD, they could hardly be synchronously activated by any anti-CD20 mAb or mAb derivative until now. Herein, a novel mAb nanocomb (polyethylenimine polymer–RTX–tositumomab [PPRT nanocomb] was firstly constructed through mass arming two different anti-CD20 mAbs (RTX and tositumomab to one polymer by nanotechnology. Comparing with free mAbs, PPRT nanocomb possesses a comparable binding ability and reduced “off-rate” to surface CD20 of NHL cells. When treated by PPRT nanocomb, the caspase-dependent apoptosis was remarkably enhanced except for concurrently eliciting complement-dependent cytotoxicity, antibody-dependent cell-mediated cytotoxicity, and lysosome-mediated PCD. Besides, “cross-cell link”-assisted homotypic adhesion by PPRT nanocomb further enhanced the susceptibility to PCD of lymphoma cells. Pharmacokinetic assays revealed that PPRT nanocomb experienced a relatively reduced clearance from peripheral blood compared with free antibodies. With

  5. Augmented wave ab initio EFG calculations: some methodological warnings

    Energy Technology Data Exchange (ETDEWEB)

    Errico, Leonardo A. [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Renteria, Mario [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Petrilli, Helena M. [Instituto de Fisica-DFMT, Universidade de Sao Paulo, C.P. 66318, 05315-970 Sao Paulo, SP (Brazil)]. E-mail:


    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO{sub 2}. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects.

  6. Augmented wave ab initio EFG calculations: some methodological warnings

    International Nuclear Information System (INIS)

    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO2. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects

  7. Chemical and Electrochemical Metallic Covering of ABS polymers

    Directory of Open Access Journals (Sweden)

    Florentina Cziple


    Full Text Available The aim of this paper is the deposition of metallic layers on the surface of ABS plastic material, by means of two consecutive procedures, namely: the first is represented by the conductibility through chemical or electro-chemical metallic covering of the polymeric support and the second procedure is the electrodeposition of the metal through galvanization. The chemical mehtod consists in the submission of ABS polymers to some conductibility operations of the plastic material surface through chemical copper plating (chemical roughing, degreasing with ultra-sounds, chemical sensitivation, activation and proper conductibility of the material surface. The electrochemical deposition of nickel was made on the plastic material activated in the mixture solution of graphite with potassium carbonate.

  8. Ab Initio Nuclear Structure Theory: From Few to Many

    International Nuclear Information System (INIS)

    We summarize recent advances in ab initio nuclear structure theory, aiming to connect few- and many-body systems in a coherent theoretical framework. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative predictions connected to QCD via chiral effective field theory are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (author)

  9. Serine Proteases an Ab Initio Molecular Dynamics Study

    CERN Document Server

    De Santis, L


    In serine proteases (SP's), the H-bond between His-57 and Asp-102, and that between Gly-193 and the transition state intermediate play a crucial role for enzymatic function. To shed light on the nature of these interactions, we have carried out ab initio molecular dynamics simulations on complexes representing adducts between the reaction intermediate and elastase (one protein belonging to the SP family). Our calculations indicate the presence of a low--barrier H-bond between His-57 and Asp-102, in complete agreement with NMR experiments on enzyme--transition state analog complexes. Comparison with an ab initio molecular dynamics simulation on a model of the substrate--enzyme adduct indicates that the Gly-193--induced strong stabilization of the intermediate is accomplished by charge/dipole interactions and not by H-bonding as previously suggested. Inclusion of the protein electric field in the calculations does not affect significantly the charge distribution.

  10. Understanding phonon transport in thermoelectric materials using ab initio approaches (United States)

    Broido, David

    Good thermoelectric materials have low phonon thermal conductivity, kph. Accurate theories to describe kph are important components in developing predictive models of thermoelectric efficiency that can help guide synthesis and measurement efforts. We have developed ab initio approaches to calculate kph, in which phonon modes and phonon scattering rates are computed using interatomic force constants determined from density functional theory, and a full solution of the Boltzmann transport equation for phonons is implemented. A recent approach to calculate interatomic force constants using ab initio molecular dynamics has yielded a good description of the thermal properties of Bi2Te3. But, the complexity of new promising candidate thermoelectric materials introduces computational challenges in assessing their thermal properties. An example is germanane, a germanium based hydrogen-terminated layered semiconductor, which we will discuss in this talk.

  11. The density matrix renormalization group for ab initio quantum chemistry

    CERN Document Server

    Wouters, Sebastian


    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. Its underlying wavefunction ansatz, the matrix product state (MPS), is a low-rank decomposition of the full configuration interaction tensor. The virtual dimension of the MPS, the rank of the decomposition, controls the size of the corner of the many-body Hilbert space that can be reached with the ansatz. This parameter can be systematically increased until numerical convergence is reached. The MPS ansatz naturally captures exponentially decaying correlation functions. Therefore DMRG works extremely well for noncritical one-dimensional systems. The active orbital spaces in quantum chemistry are however often far from one-dimensional, and relatively large virtual dimensions are required to use DMRG for ab initio quantum chemistry (QC-DMRG). The QC-DMRG algorithm, its computational cost, and its properties are discussed. Two important aspects to reduce the computational co...

  12. Ab-initio calculations on melting of thorium (United States)

    Mukherjee, D.; Sahoo, B. D.; Joshi, K. D.; Kaushik, T. C.; Gupta, Satish C.


    Ab-initio molecular dynamics study has been performed on face centered cubic structured thorium to determine its melting temperature at room pressure. The ion-electron interaction potential energy calculated as a function of temperature for three volumes (a0)3 and (1.02a0)3 and (1.04a0)3 increases gradually with temperature and undergoes a sharp jump at ~2200 K, ~2100 K and ~1800 K, respectively. Here, a0 = 5.043 Å is the equilibrium lattice parameter at 0 K obtained from ab-initio calculations. These jumps in interaction energy are treated as due to the onset of melting and corresponding temperatures as melting point. The melting point of 2100 K is close to the experimental value of 2023K. Further, the same has been verified by plotting the atomic arrangement evolved at various temperatures and corresponding pair correlation functions.

  13. Kostnadseffektivering av logistikkostnader : Rolls-Royce Oy Ab


    Nordlund, Lucas


    Rolls-Royce Oy Ab som fungerar som uppdragsgivare i detta examensarbete, är ett företag med internationell verksamhet. Företaget hör till det globala Rolls-Royce plc som verkar inom många olika delområden i länder runt om i hela världen. Enheten i Karleby verkar inom Rolls-Royce Marine koncernen och tillverkar vattenjetaggregat. I och med att Rolls-Royce Oy Ab hör till Marine koncernen, medför det att man följer bestämmelser och standarder som följs i hela Marine koncernen. Till dessa gem...

  14. Molexpl: a tool for ab initio data exploration and visualization


    Wang, Xueying; Onofrio, Nicolas,; Strachan, Alejandro


    Density functional theory (DFT) based on ab initio theory, is a powerful method to resolve the electronic structure of atoms, molecules and solids. However, in practical, DFT is limited to few hundreds of atoms. To overcome this limitation, researchers have developed empirical interatomic potentials implemented in molecular dynamics (MD) simulations. MD ignores the movements of electrons and describes bonding and non-bonding interaction as a function of the distance between atoms called force...

  15. Ab initio molecular dynamics simulation of laser melting of silicon


    Silvestrelli, P.-L.; Alavi, A; Parrinello, M.; Frenkel, D


    The method of ab initio molecular dynamics, based on finite temperature density functional theory, is used to simulate laser heating of crystal silicon. We have found that a high concentration of excited electrons dramatically weakens the covalent bond. As a result, the system undergoes a melting transition to a metallic state. In contrast to ordinary liquid silicon, the new liquid is characterized by a high coordination number and a strong reduction of covalent bonding effects.

  16. Towards an ab initio description of magnetism in ionic solids (United States)

    Illas, F.; Casanovas, J.; García-Bach, M. A.; Caballol, R.; Castell, O.


    The physical contributions to the KNiF3 magnetic exchange coupling integral have been obtained from specially designed ab initio cluster model calculations. Three important mechanisms have been identified. These are the delocalization of the magnetic orbitals into the anion ``p'' band, the variational contribution of the second-order interactions, and the many-body terms ``hidden'' in the two-body operator and the Heisenberg Hamiltonian.

  17. Social Media Marketing : CASE: OY SUOMEN LYYRA AB


    Eriksson, Irene


    This bachelor thesis was commissioned by Oy Suomen Lyyra Ab, the largest student online media and student card producer for higher education students in Finland. The the-sis objective was to understanding the current social media situation and activity among the students of higher education in Finland, the social media networks that the case company currently uses as well as understanding how to use these networks for successful marketing activities. The quantitative research was conducted in...

  18. Ab initio simulation of helium inside carbon nanotubes

    International Nuclear Information System (INIS)

    In present work we consider the complex behaviour of quantum liquids like liquid He-4 inside carbon nanotubes. Interactions between helium atoms and carbon atoms of the short-length atomistic model and model with periodical boundary conditions of carbon nanotube were studied via ab initio quantum simulations. Effects of geometrical confinement of the tube on the He behaviour inside CNT (13,0) have been explored. Nanotubes with typical average diameter of 10 angstroms are under consideration.

  19. The density matrix renormalization group for ab initio quantum chemistry


    Wouters, Sebastian


    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. It is used as a numerically exact solver for highly correlated regions in molecules. While the method works extremely well for one-dimensional systems, the correlated regions of interest are often far from one-dimensional. In this introductory talk, I will discuss the DMRG algorithm from a quantum information perspective, how quantum information theory h...

  20. Ab Initio Modeling of Ecosystems with Artificial Life


    Adami, C.


    Artificial Life provides the opportunity to study the emergence and evolution of simple ecosystems in real time. We give an overview of the advantages and limitations of such an approach, as well as its relation to individual-based modeling techniques. The Digital Life system Avida is introduced and prospects for experiments with ab initio evolution (evolution "from scratch"), maintenance, as well as stability of ecosystems are discussed.

  1. P-V Relation for Mercuric Calcogenides: Ab Initio Method


    G. Misra; S. Tenguria; Gautam, M.


    Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P), volume (V) and temperature (T) that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This a...

  2. Erythema Ab Igne in Three Girls with Anorexia Nervosa. (United States)

    Dessinioti, Clio; Katsambas, Andreas; Tzavela, Eleni; Karountzos, Vasileios; Tsitsika, Artemis K


    We present three girls with the eating disorder anorexia nervosa (AN) presenting with erythema ab igne (EAI), a benign, reticular, erythematous dermatosis caused by repeated prolonged skin exposure to mild heat. AN has been associated with abnormal peripheral vascular response to cold, vasoconstriction of the limbs, low hand blood flow, exaggerated response to cold stimuli, subnormal core temperature, and a general feeling of cold that may encourage prolonged heat exposure and induce EAI. PMID:26822102

  3. Structure models: from shell model to ab initio methods

    CERN Document Server

    Bacca, Sonia


    A brief review of models to describe nuclear structure and reactions properties is presented, starting from the historical shell model picture and encompassing modern ab initio approaches. A selection of recent theoretical results on observables for exotic light and medium-mass nuclei is shown. Emphasis is given to the comparison with experiment and to what can be learned about three-body forces and continuum properties.

  4. Ab-initio calculations for dilute magnetic semiconductors


    Belhadji, Brahim


    This thesis focusses on ab-initio calculations for the electronic structure and the magnetic properties of dilute magnetic semiconductors (DMS). In particular we aim at the understanding of the complex exchange interactions in these systems. Our calculations are based on density functional theory, being ideally suited for a description of the material specific properties of the considered DMS. Moreover we use the KKR Green function method in connection with the coherent potential approximatio...

  5. Integrated Design of Antibodies for Systems Biology Using Ab Designer


    Pisitkun, Trairak; Dummer, Patrick; Somparn, Poorichaya; Hirankarn, Nattiya; Kopp, Jeffrey B.; Knepper, Mark A.


    In the current era of large-scale biology, systems biology has evolved as a powerful approach to identify complex interactions within biological systems. In addition to high throughput identification and quantification techniques, methods based on high-quality mono-specific antibodies remain an essential element of the approach. To assist the large-scale design and production of peptide-directed antibodies for systems biology studies, we developed a fully integrated online application, AbDesi...

  6. Innovativeness and innovations utilizations : Oy LM Ericsson Ab


    Saarinen, Vesa


    The aim of this action research was to improve the innovativeness amongst the R&D personnel at LM Ericsson Ab in Finland. The main purpose of this study was to understand the background of innovativeness and to practically compare the research results with the actual company situation. Innovativeness is predominantly a personal, internal matter and it is based on the intrinsic motivation of an individual. Creativity, courage and persistent effort are the key elements of innovativeness...

  7. GAUSSIAN 76: An ab initio Molecular Orbital Program (United States)

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.


    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type Gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  8. GAUSSIAN 76: an ab initio molecular orbital program

    Energy Technology Data Exchange (ETDEWEB)

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.


    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  9. Der halbunendliche Kristall - Elektronische und optische Eigenschaften ab-initio


    Brodersen, Sven


    Es werden die elektronischen und optischen Eigenschaften eines kristallinen Festkörpers unter Berücksichtigung der Oberfläche mit ab-initio Methoden berechnet. Die Behandlung der Oberflächeneffekte in einer Halbraum-Geometrie erzwingt die Darstellung der Wellenfunktionen und der Dielektrischen Funktion (DK) in einer lokalen Basis. Anhand von Volumenkristallen wird die Effizienz von LCAO- Basisfunktionen demonstriert. Die Erweiterung der atomaren Orbitale mit unbesetzten Orbitalen und 'off-sit...

  10. Monoclonal antibodies against rabbit mammary prolactin receptors. Specific antibodies to the hormone binding domain

    International Nuclear Information System (INIS)

    Three monoclonal antibodies (M110, A82, and A917) were obtained by fusing myeloma cells and spleen cells from mice immunized with partially purified rabbit mammary gland prolactin (PRL) receptors. All 3 antibodies were capable of complete inhibition of 125I-ovine prolactin (oPRL) binding to rabbit mammary PRL receptors in either particulate or soluble form. M110 showed slightly greater potency than oPRL in competing for 125I-oPRL binding. These antibodies also inhibited PRL binding to microsomal fractions from rabbit liver, kidney, adrenal, ovary, and pig mammary gland, although A82 showed poor inhibition in pig mammary gland. There was no cross-reaction of any of the 3 monoclonal antibodies (mAbs) for the other species tested: human (T-47D breast cancer cells) and rat (liver, ovary). In order to confirm that these antibodies are specific to the binding domain, antibodies were purified, iodinated, and binding characteristics were investigated. 125I-M110 and 125I-A82 binding was completely inhibited by lactogenic hormones, whereas nonlactogenic hormones did not cross-react. Competition of 125I-M110 by oPRL was comparable to that of 125I-oPRL by unlabeled oPRL, while 125I-A917 binding was only partially competed (30-60%) by lactogenic hormones. Tissue and species specificity of labeled antibody binding paralleled results of binding inhibition experiments using 125I-oPRL. In addition, A82 and A917 completely inhibited 125I-M110 binding. In contrast, 125I-A82 binding was stimulated by A917 and 125I-A917 binding was stimulated by A82

  11. RNA binding specificity of hnRNP proteins: a subset bind to the 3' end of introns.


    Swanson, M S; Dreyfuss, G


    The binding of hnRNP proteins to pre-mRNAs in nuclear extracts, and as isolated proteins, was studied by using monoclonal antibody immunopurification of hnRNP proteins bound to RNase T1-generated fragments. Several major hnRNP proteins, A1, C and D, bind specifically to the 3' end of introns within a region containing the conserved polypyrimidine stretch between the branch site and the 3' splice site. Mutations which alter the conserved 3' splice site dinucleotide AG strongly impair or abolis...

  12. Pressure tracking control of vehicle ABS using piezo valve modulator (United States)

    Jeon, Juncheol; Choi, Seung-Bok


    This paper presents a wheel slip control for the ABS(anti-lock brake system) of a passenger vehicle using a controllable piezo valve modulator. The ABS is designed to optimize for braking effectiveness and good steerability. As a first step, the principal design parameters of the piezo valve and pressure modulator are appropriately determined by considering the braking pressure variation during the ABS operation. The proposed piezo valve consists of a flapper, pneumatic circuit and a piezostack actuator. In order to get wide control range of the pressure, the pressure modulator is desired. The modulator consists of a dual-type cylinder filled with different substances (fluid and gas) and a piston rod moving vertical axis to transmit the force. Subsequently, a quarter car wheel slip model is formulated and integrated with the governing equation of the piezo valve modulator. A sliding mode controller to achieve the desired slip rate is then designed and implemented. Braking control performances such as brake pressure and slip rate are evaluated via computer simulations.

  13. Monte Carlo simulation of AB-copolymers with saturating bonds

    CERN Document Server

    Chertovich, A V; Khokhlov, A R; Bohr, J


    Structural transitions in a single AB-copolymer chain where saturating bonds can be formed between A-and B-units are studied by means of Monte Carlo computer simulations using the bond fluctuation model. Three transitions are found, coil-globule, coil-hairpin and globule-hairpin, depending on the nature of a particular AB-sequence: statistical random sequence, diblock sequence and 'random-complementary' sequence (one-half of such an AB-sequence is random with Bernoulli statistics while the other half is complementary to the first one). The properties of random-complementary sequences are closer to those of diblock sequences than to the properties of random sequences. The model (although quite rough) is expected to represent some basic features of real RNA molecules, i.e. the formation of secondary structure of RNA due to hydrogen bonding of corresponding bases and stacking interactions of the base pairs in helixes. We introduce the notation of RNA-like copolymers and discuss in what sense the sequences studie...

  14. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    International Nuclear Information System (INIS)

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  15. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Draayer, Jerry P. [Louisiana State Univ., Baton Rouge, LA (United States)


    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  16. Studies on the runaway reaction of ABS polymerization process

    Energy Technology Data Exchange (ETDEWEB)

    Hu, K.-H. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China); Kao, C.-S. [Department of Safety, Health and Environmental Engineering, National United University, Taiwan (China); Duh, Y.-S. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China)], E-mail:


    Taiwan has the largest acrylonitrile-butadiene-styrene (ABS) copolymer production in the world. Preventing on unexpected exothermic reactions and related emergency relief hazard is essential in the safety control of ABS emulsion polymerization. A VSP2 (Vent Sizing Package 2) apparatus is capable of studying both normal and abnormal conditions (e.g., cooling failure, mischarge, etc.) of industrial process. In this study, the scenarios were verified from the following abnormal conditions: loss of cooling, double charge of initiator, overcharge of monomer, without charge of solvent, and external fire. An external fire with constant heating will promote higher self-heat rate and this is recommended as the worst case scenario of emulsion polymerization on butadiene. Cooling failure coupled with bulk system of reactant was determined to be the credible worst case in ABS emulsion polymerization. Finally, the emergency vent sizing based on thermokinetics from VSP associated with DIERS methodology were used for evaluating the vent sizing and compared to that of the industrial plants.

  17. Ab initio calculations for industrial materials engineering: successes and challenges

    Energy Technology Data Exchange (ETDEWEB)

    Wimmer, Erich; Freeman, Clive; Christensen, Mikael; Wolf, Walter; Saxe, Paul [Materials Design, Inc., PO Box 2000, Angel Fire, NM 87710 (United States); Najafabadi, Reza; Young Jr, George A; Ballard, Jake D; Angeliu, Thomas M; Vollmer, James [Knolls Atomic Power Laboratory, PO Box 1072, Schenectady, NY 12301-1072 (United States); Chambers, James J; Niimi, Hiroaki; Shaw, Judy B, E-mail: [Advanced CMOS, Texas Instruments Incorporated, Dallas, TX 75243 (United States)


    Computational materials science based on ab initio calculations has become an important partner to experiment. This is demonstrated here for the effect of impurities and alloying elements on the strength of a Zr twist grain boundary, the dissociative adsorption and diffusion of iodine on a zirconium surface, the diffusion of oxygen atoms in a Ni twist grain boundary and in bulk Ni, and the dependence of the work function of a TiN-HfO{sub 2} junction on the replacement of N by O atoms. In all of these cases, computations provide atomic-scale understanding as well as quantitative materials property data of value to industrial research and development. There are two key challenges in applying ab initio calculations, namely a higher accuracy in the electronic energy and the efficient exploration of large parts of the configurational space. While progress in these areas is fueled by advances in computer hardware, innovative theoretical concepts combined with systematic large-scale computations will be needed to realize the full potential of ab initio calculations for industrial applications.

  18. Ab initio calculations for industrial materials engineering: successes and challenges

    International Nuclear Information System (INIS)

    Computational materials science based on ab initio calculations has become an important partner to experiment. This is demonstrated here for the effect of impurities and alloying elements on the strength of a Zr twist grain boundary, the dissociative adsorption and diffusion of iodine on a zirconium surface, the diffusion of oxygen atoms in a Ni twist grain boundary and in bulk Ni, and the dependence of the work function of a TiN-HfO2 junction on the replacement of N by O atoms. In all of these cases, computations provide atomic-scale understanding as well as quantitative materials property data of value to industrial research and development. There are two key challenges in applying ab initio calculations, namely a higher accuracy in the electronic energy and the efficient exploration of large parts of the configurational space. While progress in these areas is fueled by advances in computer hardware, innovative theoretical concepts combined with systematic large-scale computations will be needed to realize the full potential of ab initio calculations for industrial applications.

  19. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    International Nuclear Information System (INIS)

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions

  20. Converting of Matter to Nuclear Energy by AB-Generator

    Directory of Open Access Journals (Sweden)

    Alexander Bolonkin


    Full Text Available Problem statement: Researcher offered a new nuclear generator which allowed to convert any matter to nuclear energy in accordance with Einstein equation E = mc2. The method was based upon tapping the energy potential of a Micro Black Hole (MBH and Hawking radiation created by this MBH. Researcher did not meet the idea and its research in literature to develop the method for getting a cheap energy. Approach: As is well-known, vacuum continuously produced virtual pairs of particles and antiparticles, in particular, photons and anti-photons. MBH event horizon allowed separating them. Anti-photons can be moved to MBH and be annihilated, decreasing mass of MBH, resulting photons leave the MBH neighborhood as Hawking radiation. The offered nuclear generator (named by Researcher as AB-generator utilized Hawking radiation and injected the matter into MBH and kept MBH in a stable state with near-constant mass. Results: AB-generator can be produced gigantic energy outputs and should be cheaper than a conventional electric station by a factor of hundreds of times. One also may be used in aerospace as a photon rocket or as a power source for many vehicles. Conclusion: Many scientists expect Large Hadron Collider at CERN may be produced one MBH every second. A technology to capture them may be developed; than they may be used for the AB-generator.