WorldWideScience

Sample records for aaa aa aaa

  1. _. AA~ AAA _ _--_ _ _ _

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 3. Horizons of Physics-A Series for Undergraduate Students and Teachers. Avinash Khare. Book Review Volume 2 Issue 3 March 1997 pp 87-88. Fulltext. Click here to view fulltext PDF. Permanent link:

  2. NASA Airborne Astronomy Ambassadors (AAA)

    Science.gov (United States)

    Backman, D. E.; Harman, P. K.; Clark, C.

    2016-12-01

    NASA's Airborne Astronomy Ambassadors (AAA) is a three-part professional development (PD) program for high school physics and astronomy teachers. The AAA experience consists of: (1) blended-learning professional development composed of webinars, asynchronous content learning, and a series of hands-on workshops (2) a STEM immersion experience at NASA Armstrong Flight Research Center's B703 science research aircraft facility in Palmdale, California, and (3) ongoing participation in the AAA community of practice (CoP) connecting participants with astrophysics and planetary science Subject Matter Experts (SMEs). The SETI Institute (SI) is partnering with school districts in Santa Clara and Los Angeles Counties during the AAA program's "incubation" period, calendar years 2016 through 2018. AAAs will be selected by the school districts based on criteria developed during spring 2016 focus group meetings led by the program's external evaluator, WestEd.. Teachers with 3+ years teaching experience who are assigned to teach at least 2 sections in any combination of the high school courses Physics (non-AP), Physics of the Universe (California integrated model), Astronomy, or Earth & Space Sciences are eligible. Partner districts will select at least 48 eligible applicants with SI oversight. WestEd will randomly assign selected AAAs to group A or group B. Group A will complete PD in January - June of 2017 and then participate in SOFIA science flights during fall 2017 (SOFIA Cycle 5). Group B will act as a control during the 2017-18 school year. Group B will then complete PD in January - June of 2018 and participate in SOFIA science flights in fall 2018 (Cycle 6). Under the current plan, opportunities for additional districts to seek AAA partnerships with SI will be offered in 2018 or 2019. A nominal two-week AAA curriculum component will be developed by SI for classroom delivery that will be aligned with selected California Draft Science Framework Disciplinary Core Ideas

  3. Africa Agribusiness Academy (AAA) Year Report 2014

    NARCIS (Netherlands)

    Nijhoff, G.H.; Vugt, van S.M.

    2015-01-01

    The Africa Agribusiness Academy (AAA) supports African SME agrifood companies in growing their business. An AAA member companies can enhance knowledge, skills and expertise, and get support in accessing finance and markets. By the end of 2014, AAA had 200 members in five countries: Tanzania, Kenya,

  4. The LHC at the AAAS

    CERN Multimedia

    CERN Bulletin

    2011-01-01

    The American Association for the Advancement of Science held its annual meeting in the Walter E. Washington Convention Center in Washington D.C. last week.   Veteran science writer Tim Radford introduces LHC scientists during a media briefing at the AAAS annual meeting. Left to right: Felicitas Pauss, Tom LeCompte, Yves Schutz and Nick Hadley. As the world’s largest popular science meeting, the AAAS meeting is a major event in the calendar of science journalists.  At this year’s LHC session, CERN’s coordinator for international relations, Felicitas Pauss, opened the discussion, paving the way for Tom LeCompte of ATLAS, Joe Incandela of CMS, Yves Schutz of ALICE and Monica Pepe-Altarelli of LHCb to report on the status of the first year’s analysis from their experiments.    

  5. AAA-ATPases in Protein Degradation

    Directory of Open Access Journals (Sweden)

    Ravikiran S. Yedidi

    2017-06-01

    Full Text Available Proteolytic machineries containing multisubunit protease complexes and AAA-ATPases play a key role in protein quality control and the regulation of protein homeostasis. In these protein degradation machineries, the proteolytically active sites are formed by either threonines or serines which are buried inside interior cavities of cylinder-shaped complexes. In eukaryotic cells, the proteasome is the most prominent protease complex harboring AAA-ATPases. To degrade protein substrates, the gates of the axial entry ports of the protease need to be open. Gate opening is accomplished by AAA-ATPases, which form a hexameric ring flanking the entry ports of the protease. Protein substrates with unstructured domains can loop into the entry ports without the assistance of AAA-ATPases. However, folded proteins require the action of AAA-ATPases to unveil an unstructured terminus or domain. Cycles of ATP binding/hydrolysis fuel the unfolding of protein substrates which are gripped by loops lining up the central pore of the AAA-ATPase ring. The AAA-ATPases pull on the unfolded polypeptide chain for translocation into the proteolytic cavity of the protease. Conformational changes within the AAA-ATPase ring and the adjacent protease chamber create a peristaltic movement for substrate degradation. The review focuses on new technologies toward the understanding of the function and structure of AAA-ATPases to achieve substrate recognition, unfolding and translocation into proteasomes in yeast and mammalian cells and into proteasome-equivalent proteases in bacteria and archaea.

  6. Microstructure and Mechanical Properties of Accumulative Roll-Bonded AA1050A/AA5005 Laminated Metal Composites

    Directory of Open Access Journals (Sweden)

    Frank Kümmel

    2016-03-01

    Full Text Available Laminated metal composites (LMCs with alternating layers of commercial pure aluminum AA1050A and aluminum alloy AA5005 were produced by accumulative roll-bonding (ARB. In order to vary the layer thickness and the number of layer interfaces, different numbers of ARB cycles (4, 8, 10, 12, 14 and 16 were performed. The microstructure and mechanical properties were characterized in detail. Up to 8 ARB cycles, the ultrafine-grained (UFG microstructure of the layers in the LMC evolves almost equally to those in AA1050A and AA5005 mono-material sheets. However, the grain size in the composites tends to have smaller values. Nevertheless, the local mechanical properties of the individual layers in the LMCs are very similar to those of the mono-material sheets, and the macroscopic static mechanical properties of the LMCs can be calculated as the mean value of the mono-material sheets applying a linear rule of mixture. In contrast, for more than 12 ARB cycles, a homogenous microstructure was obtained where the individual layers within the composite cannot be visually separated any longer; thus, the hardness is at one constant and a high level across the whole sheet thickness. This results also in a significant higher strength in tensile testing. It was revealed that, with decreasing layer thickness, the layer interfaces become more and more dominating.

  7. Genetic analysis of abdominal aortic aneurysms (AAA)

    Energy Technology Data Exchange (ETDEWEB)

    St. Jean, P.L.; Hart, B.K.; Zhang, X.C. [Univ. of Pittsburgh, PA (United States)] [and others

    1994-09-01

    The association between AAA and gender, smoking (SM), hypertension (HTN) and inguinal herniation (IH) was examined in 141 AAA probands and 139 of their 1st degree relatives with aortic exam (36 affected, 103 unaffected). There was no significant difference between age at diagnosis of affecteds and age at exam of unaffecteds. Of 181 males, 142 had AAA; of 99 females, 35 had AAA. Using log-linear modeling AAA was significantly associated at the 5% level with gender, SM and HTN but not IH. The association of AAA with SM and HTN held when males and females were analyzed separately. HTN was -1.5 times more common in both affected males and females, while SM was 1.5 and 2 times more common in affected males and females, respectively. Tests of association and linkage analyses were performed with relevant candidate genes: 3 COL3A1 polymorphisms (C/T, ALA/THR, AvaII), 2 ELN polymorphisms (SER/GLY, (CA)n), FBN1(TAAA)n, 2 APOB polymorphisms (Xbal,Ins/Del), CLB4B (CA)n, PI and markers D1S243 (CA)n, HPR (CA)n and MFD23(CA)n. The loci were genotyped in > 100 AAA probands and > 95 normal controls. No statistically significant evidence of association at the 5% level was obtained for any of the loci using chi-square test of association. 28 families with 2 or more affecteds were analyzed using the affected pedigree member method (APM) and lod-score analyses. There was no evidence for linkage with any loci using APM. Lod-score analysis under an autosomal recessive model resulted in excluding linkage (lod score < -2) of all loci to AAA at {theta}=0.0. Under an autosomal dominant model, linkage was excluded at {theta}=0.0 to ELN, APOB, CLG4B, D1S243, HPR and MFD23. The various genes previously proposed in AAA pathogenesis are neither associated nor casually related in our study population.

  8. NASA Airborne Astronomy Ambassadors (AAA) Professional Development and NASA Connections

    Science.gov (United States)

    Backman, D. E.; Clark, C.; Harman, P. K.

    2017-12-01

    NASA's Airborne Astronomy Ambassadors (AAA) program is a three-part professional development (PD) experience for high school physics, astronomy, and earth science teachers. AAA PD consists of: (1) blended learning via webinars, asynchronous content learning, and in-person workshops, (2) a STEM immersion experience at NASA Armstrong's B703 science research aircraft facility in Palmdale, California, and (3) ongoing opportunities for connection with NASA astrophysics and planetary science Subject Matter Experts (SMEs). AAA implementation in 2016-18 involves partnerships between the SETI Institute and seven school districts in northern and southern California. AAAs in the current cohort were selected by the school districts based on criteria developed by AAA program staff working with WestEd evaluation consultants. The selected teachers were then randomly assigned by WestEd to a Group A or B to support controlled testing of student learning. Group A completed their PD during January - August 2017, then participated in NASA SOFIA science flights during fall 2017. Group B will act as a control during the 2017-18 school year, then will complete their professional development and SOFIA flights during 2018. A two-week AAA electromagnetic spectrum and multi-wavelength astronomy curriculum aligned with the Science Framework for California Public Schools and Next Generation Science Standards was developed by program staff for classroom delivery. The curriculum (as well as the AAA's pre-flight PD) capitalizes on NASA content by using "science snapshot" case studies regarding astronomy research conducted by SOFIA. AAAs also interact with NASA SMEs during flight weeks and will translate that interaction into classroom content. The AAA program will make controlled measurements of student gains in standards-based learning plus changes in student attitudes towards STEM, and observe & record the AAAs' implementation of curricular changes. Funded by NASA: NNX16AC51

  9. AAAS joins the Translational Medicine family.

    Science.gov (United States)

    Brander, Christian; Marincola, Francesco M

    2009-05-07

    The AAAS has announced the launch of Science Translational Medicine. This is further and critical recognition of this discipline and we are deeply gratified that translational medicine has risen to the level of recognition by one of the world's most prestigious scientific organizations. We believe that Science Translational Medicine will provide another valuable venue for the rapid and broad dissemination of important articles in the field and contribute to enhancing the effectiveness of translational medicine overall. It has been almost six years since we launched the Journal of Translational Medicine as an open-access journal with Biomed Central. At the beginning, we faced the inevitable skepticism and received several inquires among others also from Science reporters questioning both the significance of translational medicine in today's biomedical world and the need for a new journal dedicated to it.

  10. AAAS Communicating Science Program: Reflections on Evaluation

    Science.gov (United States)

    Braha, J.

    2015-12-01

    The AAAS Center for Public Engagement (Center) with science builds capacity for scientists to engage public audiences by fostering collaboration among natural or physical scientists, communication researchers, and public engagement practitioners. The recently launched Leshner Leadership Institute empowers cohorts of mid-career scientists to lead public engagement by supporting their networks of scientists, researchers, and practitioners. The Center works closely with social scientists whose research addresses science communication and public engagement with science to ensure that the Communicating Science training program builds on empirical evidence to inform best practices. Researchers ( Besley, Dudo, & Storkdieck 2015) have helped Center staff and an external evaluator develop pan instrument that measures progress towards goals that are suggested by the researcher, including internal efficacy (increasing scientists' communication skills and confidence in their ability to engage with the public) and external efficacy (scientists' confidence in engagement methods). Evaluation results from one year of the Communicating Science program suggest that the model of training yields positive results that support scientists in the area that should lead to greater engagement. This talk will explore the model for training, which provides a context for strategic communication, as well as the practical factors, such as time, access to public engagement practitioners, and technical skill, that seems to contribute to increased willingness to engage with public audiences. The evaluation program results suggest willingness by training participants to engage directly or to take preliminary steps towards engagement. In the evaluation results, 38% of trained scientists reported time as a barrier to engagement; 35% reported concern that engagement would distract from their work as a barrier. AAAS works to improve practitioner-researcher-scientist networks to overcome such barriers.

  11. Structural Elements Regulating AAA+ Protein Quality Control Machines

    Directory of Open Access Journals (Sweden)

    Chiung-Wen Chang

    2017-05-01

    Full Text Available Members of the ATPases Associated with various cellular Activities (AAA+ superfamily participate in essential and diverse cellular pathways in all kingdoms of life by harnessing the energy of ATP binding and hydrolysis to drive their biological functions. Although most AAA+ proteins share a ring-shaped architecture, AAA+ proteins have evolved distinct structural elements that are fine-tuned to their specific functions. A central question in the field is how ATP binding and hydrolysis are coupled to substrate translocation through the central channel of ring-forming AAA+ proteins. In this mini-review, we will discuss structural elements present in AAA+ proteins involved in protein quality control, drawing similarities to their known role in substrate interaction by AAA+ proteins involved in DNA translocation. Elements to be discussed include the pore loop-1, the Inter-Subunit Signaling (ISS motif, and the Pre-Sensor I insert (PS-I motif. Lastly, we will summarize our current understanding on the inter-relationship of those structural elements and propose a model how ATP binding and hydrolysis might be coupled to polypeptide translocation in protein quality control machines.

  12. A methodology for developing anisotropic AAA phantoms via additive manufacturing.

    Science.gov (United States)

    Ruiz de Galarreta, Sergio; Antón, Raúl; Cazón, Aitor; Finol, Ender A

    2017-05-24

    An Abdominal Aortic Aneurysm (AAA) is a permanent focal dilatation of the abdominal aorta at least 1.5 times its normal diameter. The criterion of maximum diameter is still used in clinical practice, although numerical studies have demonstrated the importance of biomechanical factors for rupture risk assessment. AAA phantoms could be used for experimental validation of the numerical studies and for pre-intervention testing of endovascular grafts. We have applied multi-material 3D printing technology to manufacture idealized AAA phantoms with anisotropic mechanical behavior. Different composites were fabricated and the phantom specimens were characterized by biaxial tensile tests while using a constitutive model to fit the experimental data. One composite was chosen to manufacture the phantom based on having the same mechanical properties as those reported in the literature for human AAA tissue; the strain energy and anisotropic index were compared to make this choice. The materials for the matrix and fibers of the selected composite are, respectively, the digital materials FLX9940 and FLX9960 developed by Stratasys. The fiber proportion for the composite is equal to 0.15. The differences between the composite behavior and the AAA tissue are small, with a small difference in the strain energy (0.4%) and a maximum difference of 12.4% in the peak Green strain ratio. This work represents a step forward in the application of 3D printing technology for the manufacturing of AAA phantoms with anisotropic mechanical behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Inhibitors of the AAA+ Chaperone p97

    Directory of Open Access Journals (Sweden)

    Eli Chapman

    2015-02-01

    Full Text Available It is remarkable that a pathway as ubiquitous as protein quality control can be targeted to treat cancer. Bortezomib, an inhibitor of the proteasome, was first approved by the US Food and Drug Administration (FDA more than 10 years ago to treat refractory myeloma and later extended to lymphoma. Its use has increased the survival rate of myeloma patients by as much as three years. This success was followed with the recent accelerated approval of the natural product derived proteasome inhibitor carfilzomib (Kyprolis®, which is used to treat patients with bortezomib-resistant multiple myeloma. The success of these two drugs has validated protein quality control as a viable target to fight select cancers, but begs the question why are proteasome inhibitors limited to lymphoma and myeloma? More recently, these limitations have encouraged the search for additional targets within the protein quality control system that might offer heightened cancer cell specificity, enhanced clinical utility, a lower rate of resistance, reduced toxicity, and mitigated side effects. One promising target is p97, an ATPase associated with various cellular activities (AAA+ chaperone. p97 figures prominently in protein quality control as well as serving a variety of other cellular functions associated with cancer. More than a decade ago, it was determined that up-regulation of p97 in many forms of cancer correlates with a poor clinical outcome. Since these initial discoveries, a mechanistic explanation for this observation has been partially illuminated, but details are lacking. Understandably, given this clinical correlation, myriad roles within the cell, and its importance in protein quality control, p97 has emerged as a potential therapeutic target. This review provides an overview of efforts towards the discovery of small molecule inhibitors of p97, offering a synopsis of efforts that parallel the excellent reviews that currently exist on p97 structure, function, and

  14. Coarse-Grained Modeling of Molecular Machines in AAA+ Family

    Science.gov (United States)

    Yoshimoto, Kenji; Brooks, Charles L., III

    2007-03-01

    We present a new coarse-grained model of the large protein complexes which belong to AAA+ (ATPase associated with diverse cellular activities) family. The AAA+ proteins are highly efficient molecular machines driven by the ATP (adenosine triphosphate) binding and hydrolysis and are involved in various cellular events. While a number of groups are developing various coarse-grained models for different AAA+ proteins, the molecular details of ATP binding and hydrolysis are often neglected. In this study, we provide a robust approach to coarse-graining both the AAA+ protein and the ATP (or ADP) molecules. By imposing the distance restraints between the phosphates of the ATP and the neighboring Cα of the proteins, which are used to conserve a typical motif of ATP binding pocket, we are able to predict large conformational changes of the AAA+ proteins, such as replicative hexameric helicases. In the case of the hexameric LTag (large tumor antigen), the backbone RMSD between the predicted ATP-bound structure and the X-ray structure is 1.2 å, and the RMSD between the predicted ADP-bound structure and the X-ray structure is 1.5 å. Using the same approach, we also investigate conformational changes in the hexameric E1 protein, whose X-ray structure was recently solved with ssDNA, and give some insights into the molecular mechanisms of DNA translocation.

  15. The mitochondrial inner membrane AAA metalloprotease family in metazoans.

    Science.gov (United States)

    Juhola, M K; Shah, Z H; Grivell, L A; Jacobs, H T

    2000-09-15

    Three metalloproteases belonging to the AAA superfamily (Yme1p, Afg3p and Rca1p) are involved in protein turnover and respiratory chain complex assembly in the yeast inner mitochondrial membrane. Analysis of the completed genome sequences of Caenorhabditis elegans and Drosophila melanogaster indicates that this gene family typically comprises 3-4 members in metazoans. Phylogenetic analysis reveals three main branches represented, respectively, by Saccharomyces cerevisiae YME1, human SPG7 (paraplegin) and S. cerevisiae AFG3 and RCA1. mt-AAA metalloproteases are weak candidates for several previously studied Drosophila mutants. A full elucidation of the cellular and physiological roles of mt-AAA metalloproteases in metazoans will require the creation of targeted mutations.

  16. The Airborne Astronomy Ambassadors (AAA) Program and NASA Astrophysics Connections

    Science.gov (United States)

    Backman, Dana Edward; Clark, Coral; Harman, Pamela

    2018-01-01

    The NASA Airborne Astronomy Ambassadors (AAA) program is a three-part professional development (PD) experience for high school physics, astronomy, and earth science teachers. AAA PD consists of: (1) blended learning via webinars, asynchronous content delivery, and in-person workshops, (2) a STEM immersion experience at NASA Armstrong’s B703 science research aircraft facility in Palmdale, California, including interactions with NASA astrophysics & planetary science Subject Matter Experts (SMEs) during science flights on SOFIA, and (3) continuing post-flight opportunities for teacher & student connections with SMEs.

  17. Functional Diversity of AAA+ Protease Complexes in Bacillus subtilis

    Science.gov (United States)

    Elsholz, Alexander K. W.; Birk, Marlene S.; Charpentier, Emmanuelle; Turgay, Kürşad

    2017-01-01

    Here, we review the diverse roles and functions of AAA+ protease complexes in protein homeostasis, control of stress response and cellular development pathways by regulatory and general proteolysis in the Gram-positive model organism Bacillus subtilis. We discuss in detail the intricate involvement of AAA+ protein complexes in controlling sporulation, the heat shock response and the role of adaptor proteins in these processes. The investigation of these protein complexes and their adaptor proteins has revealed their relevance for Gram-positive pathogens and their potential as targets for new antibiotics. PMID:28748186

  18. The Adult Asperger Assessment (AAA): A Diagnostic Method

    Science.gov (United States)

    Baron-Cohen, Simon; Wheelwright, Sally; Robinson, Janine; Woodbury-Smith, Marc

    2005-01-01

    At the present time there are a large number of adults who have "suspected" Asperger syndrome (AS). In this paper we describe a new instrument, the Adult Asperger Assessment (AAA), developed in our clinic for adults with AS. The need for a new instrument relevant to the diagnosis of AS in adulthood arises because existing instruments are designed…

  19. Distribution of Wall Stress in Abdominal Aortic Aneurysm (AAA)

    Science.gov (United States)

    Lasheras, Juan

    2005-11-01

    Abdominal aortic aneurysm (AAA) rupture is believed to occur when the mechanical stress acting on the wall exceeds the strength of the wall tissue. Therefore, knowledge of the AAA wall stress distribution could be useful in assessing its risk of rupture. In our research, a finite element analysis was used to determine the wall stresses both in idealized models and in a real clinical model in which the aorta was considered isotropic with nonlinear material properties and was loaded with a given pressure. In the idealized models, both maximum diameter and asymmetry were found to have substantial influence on the distribution of the wall stress. The thrombus inside the AAA was also found to help protecting the walls from high stresses. Using CT scans of the AAA, the actual geometry of the aneurysm was reconstructed and we found that wall tension increases on the flatter surface (typically corresponds to the posterior surface) and at the inflection points of the bulge. In addition to the static analysis, we also performed simulations of the effect of unsteady pressure wave propagation inside the aneurysm.

  20. Increased levels of thioredoxin in patients with abdominal aortic aneurysms (AAAs). A potential link of oxidative stress with AAA evolution

    DEFF Research Database (Denmark)

    Martinez-Pinna, R; Lindholt, Jes Sanddal; Blanco-Colio, L M

    2010-01-01

    Oxidative stress is a main mechanism involved in vascular pathologies. Increased thioredoxin (TRX) levels have been observed in several oxidative stress-associated cardiovascular diseases. We aim to test the potential role of TRX as a biomarker of oxidative stress in abdominal aortic aneurysm (AAA)....

  1. Functional characterization of the mammalian iAAA protease subunit, YME1L

    OpenAIRE

    Majczak, Joanna

    2008-01-01

    The iAAA protease is an ATP-dependent proteolytic complex in the mitochondrial inner membrane and belongs to the highly conserved family of AAA proteins. In the yeast Saccharomyces cerevisiae, the iAAA protease is a homo-oligomeric complex composed of Yme1p subunits which are active in the intermembrane space and mediate protein quality control. Yeast cells lacking Yme1p are characterized by pleiotropic phenotypes including a respiratory deficiency at elevated temperature and an aberrant mito...

  2. Boron toxicity in banana (Musa AAA) plantations of Costa Rica

    International Nuclear Information System (INIS)

    Vargas, Alfonso; Serrano, Edgardo; Arias, Fulvio; Arias M, Oscar

    2007-01-01

    A marginal, irregular and continuous necrosis was observed in the leaves of in banana plants (Musa AAA, cvs. Grande Naine and Valery), This necrosis was developed from an irregular chlorotic area, from the edge towards the internal part of the leaf blade. The central portion of the leaf kept the original green color. Soil and foliar analyses showed that symptoms were caused by high boron concentrations, probably due to excessive soil or foliage applications of the nutriment, or to the effect of very frequent applications of boron during fertigation, combined with a decrease of calcium in the leaf. (author) [es

  3. Inhibition of early AAA formation by aortic intraluminal pentagalloyl glucose (PGG) infusion in a novel porcine AAA model

    DEFF Research Database (Denmark)

    Kloster, Brian O; Lund, Lars; Lindholt, Jes S

    2016-01-01

    and histology. CONCLUSION: In our model, intraluminal delivered PGG is able to penetrate the aortic wall from the inside and impair the early AAA development by stabilizing the elastic lamellae and preserving their integrity. The principle holds a high clinical potential if it can be translated to human...... to physiological values as seen in the control group. In the elastase group, histology revealed more or less complete resolution of the elastic lamellae in the media while they were more abundant, coherent and structurally organized in the PGG group. The control group displayed normal physiological growth...

  4. The oligomeric state of the active Vps4 AAA ATPase

    Science.gov (United States)

    Monroe, Nicole; Han, Han; Gonciarz, Malgorzata D.; Eckert, Debra M.; Karren, Mary Anne; Whitby, Frank G.; Sundquist, Wesley I.; Hill, Christopher P.

    2013-01-01

    The cellular ESCRT pathway drives membrane constriction toward the cytosol and effects membrane fission during cytokinesis, endosomal sorting, and the release of many enveloped viruses, including HIV. A component of this pathway, the AAA ATPase Vps4, provides energy for pathway progression. Although it is established that Vps4 functions as an oligomer, subunit stoichiometry and other fundamental features of the functional enzyme are unclear. Higher-order oligomers have thus far only been characterized for a Walker B mutant of Vps4 in the presence of ATP. Here, we report that although some mutant Vps4 proteins form dodecameric assemblies, active wild-type S. cerevisiae and S. solfataricus Vps4 enzymes can form hexamers in the presence of ATP and ADP, as assayed by size exclusion chromatography and equilibrium analytical ultracentifugation. The Vta1p activator binds hexameric yeast Vps4p without changing the oligomeric state of Vps4p, implying that the active Vta1p:Vps4p complex also contains a single hexameric ring. Additionally, we report crystal structures of two different archaeal Vps4 homologs, whose structures and lattice interactions suggest a conserved mode of oligomerization. Disruption of the proposed hexamerization interface by mutagenesis abolished the ATPase activity of archaeal Vps4 proteins and blocked Vps4p function in S. cerevisiae. These data challenge the prevailing model that active Vps4 is a double ring dodecamer, and argue that, like other type I AAA ATPases, Vps4 functions as a single ring with six subunits. PMID:24161953

  5. Nutritional quality and ruminal degradability of banana (Musa AAA plant.

    Directory of Open Access Journals (Sweden)

    Pablo Chacón-Hernández

    2016-06-01

    Full Text Available The objective of the study was to evaluate the nutritional value of a Musa AAA fodder bank. The study was conducted at the Alfredo Volio Mata Experimental Station of the University of Costa Rica. It took place from May to November 2013 using a complete random block design. Mean values for the whole plant were of 5.67% of dry matter, 6.50% of crude protein, 53.91% of neutral detergent fiber, 35.67% of acid detergent fiber, 7.61% of lignin, 28.07% of cellulose, 18.23% of hemicellulose, 1.95% of ether extract, 19,30% of ash, 4.63% of crude protein attached to the neutral detergent fiber, and 25.32% of non- fibrous carbohydrates. Besides, statistical differences were found (p<0.05 for all bromatological components, according to the sampled plant part. The analysis of ruminal degradability showed values ranging from 18.38% to 47.43% for the soluble fraction, from 33.45% to 45.76% for the degradable fraction, from 1.65%/h to 7.51%/h for the degradation speed, and from 64.14% to 82.86% the potentially degradable percentage, depending on the part of the plant sampled. According to analyzed data, Musa AAA plants could be used for feeding ruminants where available.

  6. Multibands tunneling in AAA-stacked trilayer graphene

    Science.gov (United States)

    Redouani, Ilham; Jellal, Ahmed; Bahaoui, Abdelhadi; Bahlouli, Hocine

    2018-04-01

    We study the electronic transport through np and npn junctions for AAA-stacked trilayer graphene. Two kinds of gates are considered where the first is a single gate and the second is a double gate. After obtaining the solutions for the energy spectrum, we use the transfer matrix method to determine the three transmission probabilities for each individual cone τ = 0 , ± 1 . We show that the quasiparticles in AAA-stacked trilayer graphene are not only chiral but also labeled by an additional cone index τ. The obtained bands are composed of three Dirac cones that depend on the chirality indexes. We show that there is perfect transmission for normal or near normal incidence, which is a manifestation of the Klein tunneling effect. We analyze also the corresponding total conductance, which is defined as the sum of the conductance channels in each individual cone. Our results are numerically discussed and compared with those obtained for ABA- and ABC-stacked trilayer graphene.

  7. AA~AAA __ ------ v VVVV v

    Indian Academy of Sciences (India)

    and Anne-Marie Perrein In Metz, France. He entered the Ecole Polytechnique, Paris, in 1807 but lost a year because of poor health. Among his teachers was Gaspard Monge (1746-1818) who is credited with the invention of descriptive geometry. Poncelet joined the Corps of military engineers in. 1810 and was called upon ...

  8. AA~AAA ______ __ v VVVV v

    Indian Academy of Sciences (India)

    1997-12-05

    Dec 5, 1997 ... also are among the most mysterious, for after centuries of study, the structure of the set of prime numbers is still not well understood. Describing the distribution of primes is at the heart of much mathematics and has many important applications to such areas as cryptography. To study primes, researchers.

  9. Horizons of Physics ______ .AA~AAA

    Indian Academy of Sciences (India)

    out by the Indian Association of Physics. Teachers. The series, addressed to students and teachers, is devoted to physics teaching at the tertiary level. It aims to enhance the knowledge and vision of the teachers and let students know what is happening at the forefront of different areas of physics. These volumes could also ...

  10. Responses of east African highland banana (EAHB-AAA) cultivars to ...

    African Journals Online (AJOL)

    Triploid cooking cultivars of Mpologoma and Kisansa (AAA) versus the considered drought tolerant cultivars of Kayinja (ABB), Sukali ndiizi (AAB) and a low land cultivar Yangambi Km5 (AAA) were grown under a semi-micro environment, with controlled soil evapo-transpiration. Cultivars were grown on three sandy loam soil ...

  11. Triple A syndrome: two novel mutations in the AAAS gene.

    Science.gov (United States)

    Thümmler, Susanne; Huebner, Angela; Baechler-Sadoul, Elisabeth

    2009-01-01

    Triple A syndrome is a rare disease of autosomal recessive inheritance. It was first described in 1978. The typical triad includes adrenocorticotrophic-hormone-resistant glucocorticoid insufficiency, reduced or absent tearing (alacrima) and achalasia. But clinical symptoms can be extremely heterogeneous and of variable clinically expression. This report describes a 7-year-old boy with a 1 year history of fatigue and muscle weakness. Physical examination showed skin and mucosal hyperpigmentation, and hormonal analysis revealed isolated glucocorticoid function. Medical history was marked by megaoesophagus and achalasia. The absence of tears when crying had been noted since birth. In the presence of the classical triad, triple A syndrome was diagnosed. Clinical diagnosis was confirmed by molecular analysis of the AAAS gene on chromosome 12q13. The novel compound heterozygous mutation c.1304delA and c.1292-1294delTTCinsA was found.

  12. Recognition of misfolded proteins by Lon, a AAA(+) protease.

    Science.gov (United States)

    Gur, Eyal; Sauer, Robert T

    2008-08-15

    Proteins unfold constantly in cells, especially under stress conditions. Degradation of denatured polypeptides by Lon and related ATP-dependent AAA(+) proteases helps prevent toxic aggregates formation and other deleterious consequences, but how these destructive enzymatic machines distinguish between damaged and properly folded proteins is poorly understood. Here, we show that Escherichia coli Lon recognizes specific sequences -- rich in aromatic residues -- that are accessible in unfolded polypeptides but hidden in most native structures. Denatured polypeptides lacking such sequences are poor substrates. Lon also unfolds and degrades stably folded proteins with accessible recognition tags. Thus, protein architecture and the positioning of appropriate targeting sequences allow Lon degradation to be dependent or independent of the folding status of a protein. Our results suggest that Lon can recognize multiple signals in unfolded polypeptides synergistically, resulting in nanomolar binding and a mechanism for discriminating irreversibly damaged proteins from transiently unfolded elements of structure.

  13. The AAA+ ATPase p97, a cellular multitool.

    Science.gov (United States)

    Stach, Lasse; Freemont, Paul S

    2017-08-17

    The AAA+ (ATPases associated with diverse cellular activities) ATPase p97 is essential to a wide range of cellular functions, including endoplasmic reticulum-associated degradation, membrane fusion, NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells) activation and chromatin-associated processes, which are regulated by ubiquitination. p97 acts downstream from ubiquitin signaling events and utilizes the energy from ATP hydrolysis to extract its substrate proteins from cellular structures or multiprotein complexes. A multitude of p97 cofactors have evolved which are essential to p97 function. Ubiquitin-interacting domains and p97-binding domains combine to form bi-functional cofactors, whose complexes with p97 enable the enzyme to interact with a wide range of ubiquitinated substrates. A set of mutations in p97 have been shown to cause the multisystem proteinopathy inclusion body myopathy associated with Paget's disease of bone and frontotemporal dementia. In addition, p97 inhibition has been identified as a promising approach to provoke proteotoxic stress in tumors. In this review, we will describe the cellular processes governed by p97, how the cofactors interact with both p97 and its ubiquitinated substrates, p97 enzymology and the current status in developing p97 inhibitors for cancer therapy. © 2017 The Author(s).

  14. Radiation dose assessment of musa acuminata - triploid (AAA)

    International Nuclear Information System (INIS)

    Maravillas, Mart Andrew S.; Locaylocay, Jocelyn R.; Mendoza, Concepcion S.

    2008-01-01

    Bananas are radioactive due to the presence of the radioisotope- 40 K. This imposes a possible health risk to the general public. This study intended to assess the annual equivalent dosages and the annual effective dosage committed by the body. This seeks to benefit the general public, students and researchers, and entrepreneurs. Using atomic absorption spectrophotometry, lakatan banana (Musa acuminata-triploid (AAA), the most purchased variety cultivated in Barangay Adlawon, Cebu City, Philippines, was found to contain 0.53 g of total potassium for every 100 g of its fresh fruit wherein 6.2 x 10 -5 g of which is potassium-40. Based on its 40 K content banana was calculated to have a radioactivity of 16 Bq/100 g. it was found out that the body is exposed to radiation dosages ranging from 2.8 x 10 -3 rem annually by eating 100 g of lakatan bananas everyday. Conversely, it is equivalent to the annual effective dosage of 0.0043 rem; the amount at which the body of an individual is uniformly exposed. However, no or extremely minute health risk was determined by just eating bananas. In fact, to exceed the radiation dose limits set by the International Commission on Radiation Protection, an individual may eat 116 kg of lakatan bananas everyday for a year. Fertilizers may be the major source of the radioisotope - 40 K and assimilated by the plants. (author)

  15. Endovascular abdominal aortic repair for AAA. Anatomical suitability and limitation in Japanese population according to the inclusion criteria of Zenith AAA stent graft

    International Nuclear Information System (INIS)

    Kitagawa, Atsushi; Okita, Yutaka; Okada, Kenji

    2009-01-01

    Since 2007, the EVAR (endovascular abdominal aortic repair) grafts, Zenith, Excluder and Powerlink had been commercially available in Japan. However, a small iliac artery, typical of Japanese population especially in women, was a limiting factor to indicate EVAR. We analyzed the suitability of EVAR in Japanese population according to the inclusion criteria of Zenith AAA stent graft in the current study. From January 2006 to December 2007, 106 AAA (abdominal aortic aneurysm) patients (88 men, 18 women) with a mean age of 73 years were investigated in our institution by multi-slice CT scan in terms of suitability of EVAR, then we measured their abdominal aorta and iliac artery parameters as follows; proximal neck diameter (PND) and length (PNL), common iliac artery diameter (CIAD) and length (CIAL), suprarenal (SNA) and infrarenal neck angulation (INA), external iliac artery diameter (EIAD) and aortic length from the lowest renal artery to the aortic bifurcation (AOL). The inclusion criteria for Zenith AAA stent graft treatment were; PND: 18-28 mm, PNL more than 15 mm, unilateral CIAD less than 20 mm, CIAL at least 10 mm, SNA less than 45 degree and INA less than 60 degree, unilateral EIAD more than 7.5 mm. The indication of EVAR was 25.5% (27/106 patients), and was especially very low in women (5.6%) strictly according to the inclusion criteria of the Zenith AAA stent graft. The main reason of exclusion of EVAR was proximal short neck (40.5%), small iliac artery (30.4%) and infrarenal aortic neck angulation (29.1%). In our analysis, female AAA patients had small PNL and EIAD with angulated neck compared with male AAA ones. Anatomical suitability of EVAR in Japanese population strictly following by the inclusion criteria of Zenith AAA stent graft was low due to their characteristic differences from the European Union (EU) and the United States (US) patients, such as short proximal neck, steep neck angulation and small iliac artery, especially in women. More flexible

  16. AAA application in diagnosis exams in a large public hospital, RS, Brazil; Aplicacao do AAA na realizacao de exames diagnosticos em um hospital publico de grande porte

    Energy Technology Data Exchange (ETDEWEB)

    Bacelar, A.; Ferret, A.A.; Vanni, S.; Galhardi, M.P.; Lykawka, R., E-mail: abacelar@hepa.ufrgs.br, E-mail: allferret@gmail.com, E-mail: svanni@hepa.ufrgs.br, E-mail: mpgalhardi@gmail.com, E-mail: rlykawka@hepa.ufrgs.br [Hospital de Clinicas de Porto Alegre (HCPA), Porto Alegre, RS (Brazil)

    2013-10-01

    Objective: the initiative AAA - Awareness , Appropriateness and Audit , promotes consciousness ( Awareness) , fitness ( Appropriateness ) and Audit ( Audit) . This paper analyzes the application of the concept in the AAA requests and justifications examinations using ionizing radiation within a large public hospital. Materials and methods: we collected and analyzed data between the years 2011 and 2012, concerning the number of exams performed with the use of radiation and their justifications. After, we sought to raise awareness of the clinical team through training on the risks and benefits of the various modalities of the radiology department and the need to justify the use of ionizing radiation on health. After the data were collected again of test requests for verification of the effectiveness of training. Results: the mean requests that need to be appropriate to the AAA in the last quarter of 2011 was 75 % lower than the average demands of the first quarter, matched against the last two months of 2012 increased by up to four times the number requests that require improvements in relation to the excellent results obtained in July 2012. Conclusion: it is shown in this paper the need of implementing this initiative AAA continuously added to the clinical staff awareness about the risk of the use of ionizing radiation, the appropriateness of the requests of these tests , as well as the control of this process in order to optimize use of ionizing radiation on health.

  17. Persistent type II endoleak after EVAR: the predictive value of the AAA thrombus volume.

    Science.gov (United States)

    Gallitto, Enrico; Gargiulo, Mauro; Mascoli, Chiara; Freyrie, Antonio; DE Matteis, Massimo; Serra, Carla; Bianchini Massoni, Claudio; Faggioli, Gianluca; Stella, Andrea

    2018-02-01

    Persistent type II endoleaks (ELIIp, ≥6 months) after an endovascular aneurysm repair (EVAR) can be associated with adverse outcomes. The aims of this study are the evaluation of the incidence of ELIIp, their preoperative morphological predictive features (PMF) and the post-EVAR abdominal aortic aneurysm (AAA) evolution in the presence of ELIIp. Patients underwent EVAR between 2008 and 2010 were prospectively collected. Cases with ELIIp (group A: AG) were identified. A control group without ELIIp (group B: BG), homogeneous for clinical characteristics, follow-up timing and methods (CTA and/or CEUS at 6.12 months and yearly thereafter) was retrospectively selected. The PMF evaluated by computed-tomography-angiography (CTA) were: AAA-diameter, number and diameter of AAA efferent patent vessels (EPV), AAA-total volume (TV), AAA-thrombus volume (THV) and TV/THV rate (%VR). Volumes were calculated by the dedicated vessels analysis software. AG and BG were compared. The primary endpoint was to evaluate the incidence of ELIIp. Secondary endpoints were to analyze the relation between PMF and ELIIp and to assess the post-EVAR AAA-evolution in the presence of ELIIp. Between 2008 and 2010, 200 patients underwent EVAR to treat AAA electively. An ELIIp was detected in 35cases (17.5%) (AG). Twenty-seven patients (13.5%) were included in BG. An overall of 62 patients (GA+GB) were analyzed. The mean pre-operative AAA diameter and EPV were 58±11.6 mm and 5.5±1.8 mm, respectively. The mean TV and THV were 187±111.5 cc and 82±75 cc, respectively. The median %VR was 42.3%. ELIIp was correlated to EPV≥6 (χ2, p=.015) and %VR <40% (logistic regression, P=0.032). The mean follow-up was 22±9 months. Seven (20%) ELIIp spontaneously sealed and 6 (17%) required reinterventions (2 conversions to OR). There were not PMF associated to ELIIp evolution and AAA growth post-EVAR. ELIIp is a not rare complication and it could require re-interventions. Our data suggest that VEP≥6 or %VT<40

  18. Norms for multivariate diagnosis of nutrient imbalance in the East African highland bananas (musa spp.aaa)

    NARCIS (Netherlands)

    Wairegi, L.; Asten, van P.

    2011-01-01

    Despite low yields and soil fertility problems, fertilizer use in the East African Highland banana (AAA-EA) production is absent. High fertilizer costs increase the need for site-specific fertilizer recommendations that address deficiencies. This study aimed to derive and compare norms for AAA-EA

  19. Anonymous Communication Policies for the Internet: Results and Recommendations of the AAAS Conference.

    Science.gov (United States)

    Teich, Al; Frankel, Mark S.; Kling, Rob; Lee, Yaching

    1999-01-01

    Reports the results of a conference on the Internet and anonymous communication organized by the American Association for the Advancement of Science (AAAS). Discusses how anonymous communications can be shaped by the law, education, and public awareness, and highlights the importance of involving all affected interests in policy development.…

  20. Long-Term Outcome of the GORE EXCLUDER AAA Endoprosthesis for Treatment of Infrarenal Aortic Aneurysms

    NARCIS (Netherlands)

    Poublon, Claire G.; Holewijn, Suzanne; van Sterkenburg, Steven M. M.; Tielliu, Ignace F. J.; Zeebregts, Clark J.; Reijnen, Michel M. P. J.

    Purpose: To evaluate long-term outcome of GORE EXCLUDER AAA Endoprosthesis (W.L. Gore & Associates, Inc, Flagstaff, Arizona) for elective treatment of infrarenal aortic aneurysms and to evaluate performance of different generations of the device. Materials and Methods: A retrospective analysis was

  1. Aortocaval fistula (ACF) in patients operated for ruptured aortic aneurysm (rAAA)

    DEFF Research Database (Denmark)

    Warning, Karina; Houlind, Kim Christian; Ravn, Hans

    aneurysms and is typically discovered peroperatively in patients with rAAA. Open surgical treatment is associated with high mortality and morbidity. ACF is a result of spontaneously rupture of large atherosclerotic aneurysms into the inferior vena cava in 80%, 15% arise after trauma and 5% are iatrogenic...

  2. Sexual Dysfunction After Conventional and Endovascular AAA Repair: Results of the DREAM Trial.

    NARCIS (Netherlands)

    Prinssen, M.; Buskens, E.; Nolthenius, R.P.T.; Sterkenburg, S. van; Teijink, J.A.; Blankensteijn, J.D.

    2004-01-01

    Purpose: To assess sexual function in the first postoperative year after elective endovascular aneurysm repair (EVAR) and open repair (OR) of abdominal aortic aneurysm (AAA).Methods: In the Dutch Randomized Endovascular Aneurysm Management (DREAM) trial, 153 patients (141 men; mean age 71 years,

  3. AAA application in diagnosis exams in a large public hospital, RS, Brazil

    International Nuclear Information System (INIS)

    Bacelar, A.; Ferret, A.A.; Vanni, S.; Galhardi, M.P.; Lykawka, R.

    2013-01-01

    Objective: the initiative AAA - Awareness , Appropriateness and Audit , promotes consciousness ( Awareness) , fitness ( Appropriateness ) and Audit ( Audit) . This paper analyzes the application of the concept in the AAA requests and justifications examinations using ionizing radiation within a large public hospital. Materials and methods: we collected and analyzed data between the years 2011 and 2012, concerning the number of exams performed with the use of radiation and their justifications. After, we sought to raise awareness of the clinical team through training on the risks and benefits of the various modalities of the radiology department and the need to justify the use of ionizing radiation on health. After the data were collected again of test requests for verification of the effectiveness of training. Results: the mean requests that need to be appropriate to the AAA in the last quarter of 2011 was 75 % lower than the average demands of the first quarter, matched against the last two months of 2012 increased by up to four times the number requests that require improvements in relation to the excellent results obtained in July 2012. Conclusion: it is shown in this paper the need of implementing this initiative AAA continuously added to the clinical staff awareness about the risk of the use of ionizing radiation, the appropriateness of the requests of these tests , as well as the control of this process in order to optimize use of ionizing radiation on health

  4. Neuromuscular regulation in zebrafish by a large AAA+ ATPase/ubiquitin ligase, mysterin/RNF213

    Science.gov (United States)

    Kotani, Yuri; Morito, Daisuke; Yamazaki, Satoru; Ogino, Kazutoyo; Kawakami, Koichi; Takashima, Seiji; Hirata, Hiromi; Nagata, Kazuhiro

    2015-01-01

    Mysterin (also known as RNF213) is a huge intracellular protein with two AAA+ ATPase modules and a RING finger ubiquitin ligase domain. Mysterin was originally isolated as a significant risk factor for the cryptogenic cerebrovascular disorder moyamoya disease, and was found to be involved in physiological angiogenesis in zebrafish. However, the function and the physiological significance of mysterin in other than blood vessels remain largely unknown, although mysterin is ubiquitously expressed in animal tissues. In this study, we performed antisense-mediated suppression of a mysterin orthologue in zebrafish larvae and revealed that mysterin-deficient larvae showed significant reduction in fast myofibrils and immature projection of primary motoneurons, leading to severe motor deficits. Fast muscle-specific restoration of mysterin expression cancelled these phenotypes, and interestingly both AAA+ ATPase and ubiquitin ligase activities of mysterin were indispensable for proper fast muscle formation, demonstrating an essential role of mysterin and its enzymatic activities in the neuromuscular regulation in zebrafish. PMID:26530008

  5. Intraoperative platelet and plasma improves survival in patients operated for a rAAA: a follow-up evaluation

    DEFF Research Database (Denmark)

    Johansson, Per Ingemar; Swiatek, F.; Jorgensen, L.

    2008-01-01

    mortality in rAAA patients related to a pro-active transfusion therapy is maintained. DESIGN: Single-centre observational study. METHODS: Mortality of patients operated for rAAA 2006-07 was compared to that of patients operated 2004-05 (intervention group; n=50) and 2002-04 (control group, n=82). RESULTS......OBJECTIVES: Continued haemorrhage remains a significant contributor to mortality in massively transfused patients. We found that early administration of platelets and plasma reduced mortality from 54% to 36% in rAAA patients. The aim of the present evaluation was to evaluate whether reduced......: 64 consecutive patients with rAAA received, similar to the intervention group, more platelets (5 and 4 vs. 0 units, P

  6. Characterization of ATPase activity of the AAA ARC from Bifidobacterium longum subsp. infantis.

    Science.gov (United States)

    Guzmán-Rodríguez, Mabel; de la Rosa, Ana Paulina Barba; Santos, Leticia

    2015-01-01

    Bifidobacteria are considered to be probiotics that exist in the large intestine and are helpful to maintain human health. Oral administration of bifidobacteria may be effective in improving the intestinal flora and environment, stimulating the immune response and possibly preventing cancer. However, for consistent and positive results, further well-controlled studies are urgently needed to describe the basic mechanisms of this microorganism. Analysis of the proteasome-lacking Bifidobacterium longum genome reveals that it possesses a gene, IPR003593 AAA ATPase core, which codes a 56 kDa protein containing one AAA ATPase domain. Phylogenetic classification made by CLANS, positioned this sequence into the ARC divergent branch of the AAA ATPase family of proteins. N-terminal analysis of the sequence indicates this protein is closely related to other ATPases such as the Rhodococcus erythropolis ARC, Archaeoglobus fulgidus PAN, Mycobacterium tuberculosis Mpa and the human proteasomal Rpt1 subunit. This gene was cloned, the full-length recombinant protein was overexpressed in Escherichia coli, purified as a high-molecular size complex and named Bl-ARC. Enzymatic characterization showed that Bl-ARC ATPase is active, Mg(+2)-dependent and sensitive to N-ethylmaleimide. Gene organization positions bl-arc in a region flanked by a cluster of genes that includes pup, dop and pafA genes. These findings point to a possible function as a chaperone in the degradation pathway via pupylation.

  7. Structural insights into the unusually strong ATPase activity of the AAA domain of the Caenorhabditis elegans fidgetin-like 1 (FIGL-1) protein.

    Science.gov (United States)

    Peng, Wentao; Lin, Zhijie; Li, Weirong; Lu, Jing; Shen, Yuequan; Wang, Chunguang

    2013-10-11

    The FIGL-1 (fidgetin like-1) protein is a homolog of fidgetin, a protein whose mutation leads to multiple developmental defects. The FIGL-1 protein contains an AAA (ATPase associated with various activities) domain and belongs to the AAA superfamily. However, the biological functions and developmental implications of this protein remain unknown. Here, we show that the AAA domain of the Caenorhabditis elegans FIGL-1 protein (CeFIGL-1-AAA), in clear contrast to homologous AAA domains, has an unusually high ATPase activity and forms a hexamer in solution. By determining the crystal structure of CeFIGL-1-AAA, we found that the loop linking helices α9 and α10 folds into the short helix α9a, which has an acidic surface and interacts with a positively charged surface of the neighboring subunit. Disruption of this charge interaction by mutagenesis diminishes both the ATPase activity and oligomerization capacity of the protein. Interestingly, the acidic residues in helix α9a of CeFIGL-1-AAA are not conserved in other homologous AAA domains that have relatively low ATPase activities. These results demonstrate that the sequence of CeFIGL-1-AAA has adapted to establish an intersubunit charge interaction, which contributes to its strong oligomerization and ATPase activity. These unique properties of CeFIGL-1-AAA distinguish it from other homologous proteins, suggesting that CeFIGL-1 may have a distinct biological function.

  8. BACTERIAL CONTAMINATION CONTROL IN BANANA EXPLANTS (Musa AAA cv. CAIPIRA) CONTROLE DE BACTÉRIAS CONTAMINANTES EM EXPLANTES DE BANANEIRA (Musa AAA cv. CAIPIRA)

    OpenAIRE

    Juliana Domingues Lima; Wilson da Silva Moraes

    2007-01-01

    Esse trabalho teve por objetivo testar métodos de controle de contaminação bacteriana no processo de multiplicação in vitro de bananeira (Musa AAA cv. Caipira), utilizando-se hipoclorito de sódio (NaOCl), antibiótico rifampicina e suas combinações. Não houve oxidação excessiva dos explantes após a imersão em NaOCl ou rifampicina. O melhor tratamento para explantes recém isolados foi imersão em NaOCl a 1% (v/v), dura...

  9. Morphological State as a Predictor for Reintervention and Mortality After EVAR for AAA

    Energy Technology Data Exchange (ETDEWEB)

    Ohrlander, Tomas [Eksjoe County Hospital (Sweden); Dencker, Magnus [Malmoe University Hospital, Department of Clinical Physiology and Nuclear Medicine (Sweden); Acosta, Stefan, E-mail: stefan.acosta@telia.com [Malmoe University Hospital, Vascular Center Malmoe-Lund (Sweden)

    2012-10-15

    Purpose: This study was designed to assess aorto-iliac morphological characteristics in relation to reintervention and all-cause long-term mortality in patients undergoing standard EVAR for infrarenal AAA. Methods: Patients treated with EVAR (Zenith{sup Registered-Sign} Stentgrafts, Cook) between May 1998 and February 2006 were prospectively enrolled in a computerized database where comorbidities and preoperative aneurysm morphology were entered. Reinterventions and mortality were checked until December 1, 2010. Median follow-up time was 68 months. Results: A total of 304 patients were included, of which 86% were men. Median age was 74 years. The reintervention rate was 23.4% (71/304). A greater diameter of the common iliac artery (p = 0.037; hazard ratio (HR) 1.037 [1.002-1.073]) was an independent factor for an increased number of reinterventions. The 30-day mortality rate was 3.0% (9/304). Aneurysm-related deaths due to AAA occurred in 4.9% (15/304). Five patients died due to a concomitant ruptured thoracic aortic aneurysm. The mortality until end of follow-up was 54.3% (165/304). The proportion of deaths caused by vascular diseases was 61.6%. The severity of angulation of the iliac arteries (p = 0.014; HR 1.018 [95% confidence interval (CI) 1.004-1.033]) and anemia (p = 0.044; HR 2.79 [95% CI 1.029-7.556]) remained as independent factors associated with all-cause long-term mortality. The crude reintervention-free survival rate at 1, 3, and 5 years was 84.5%, 64.8%, and 51.6%, respectively. Conclusions: The initial aorto-iliac morphological state in patients scheduled for standard EVAR for AAA seems to be strongly related to the need for reinterventions and long-term mortality.

  10. Structure and Function of the Membrane Deformation AAA ATPase Vps4

    Science.gov (United States)

    Hill, Christopher P.; Babst, Markus

    2011-01-01

    The ATPase Vps4 belongs to the type-I AAA family of proteins. Vps4 functions together with a group of proteins referred to as ESCRTs in membrane deformation and fission events. These cellular functions include vesicle formation at the endosome, cytokinesis and viral budding. The highly dynamic quaternary structure of Vps4 and its interactions with a network of regulators and co-factors have made the analysis of this ATPase challenging. Nevertheless, recent advances in the understanding of the cell biology of Vps4 together with structural information and in vitro studies are guiding mechanistic models of this ATPase. PMID:21925211

  11. TRIP13 is a protein-remodeling AAA+ ATPase that catalyzes MAD2 conformation switching.

    Science.gov (United States)

    Ye, Qiaozhen; Rosenberg, Scott C; Moeller, Arne; Speir, Jeffrey A; Su, Tiffany Y; Corbett, Kevin D

    2015-04-28

    The AAA+ family ATPase TRIP13 is a key regulator of meiotic recombination and the spindle assembly checkpoint, acting on signaling proteins of the conserved HORMA domain family. Here we present the structure of the Caenorhabditis elegans TRIP13 ortholog PCH-2, revealing a new family of AAA+ ATPase protein remodelers. PCH-2 possesses a substrate-recognition domain related to those of the protein remodelers NSF and p97, while its overall hexameric architecture and likely structural mechanism bear close similarities to the bacterial protein unfoldase ClpX. We find that TRIP13, aided by the adapter protein p31(comet), converts the HORMA-family spindle checkpoint protein MAD2 from a signaling-active 'closed' conformer to an inactive 'open' conformer. We propose that TRIP13 and p31(comet) collaborate to inactivate the spindle assembly checkpoint through MAD2 conformational conversion and disassembly of mitotic checkpoint complexes. A parallel HORMA protein disassembly activity likely underlies TRIP13's critical regulatory functions in meiotic chromosome structure and recombination.

  12. TRIP13 is a protein-remodeling AAA+ ATPase that catalyzes MAD2 conformation switching

    Energy Technology Data Exchange (ETDEWEB)

    Ye, Qiaozhen [Ludwig Institute for Cancer Research, San Diego Branch, La Jolla, United States; Rosenberg, Scott C. [Ludwig Institute for Cancer Research, San Diego Branch, La Jolla, United States; Moeller, Arne [National Resource for Automated Molecular Microscopy, Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, United States; Speir, Jeffrey A. [National Resource for Automated Molecular Microscopy, Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, United States; Su, Tiffany Y. [Ludwig Institute for Cancer Research, San Diego Branch, La Jolla, United States; Corbett, Kevin D. [Ludwig Institute for Cancer Research, San Diego Branch, La Jolla, United States; Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, United States

    2015-04-28

    The AAA+ family ATPase TRIP13 is a key regulator of meiotic recombination and the spindle assembly checkpoint, acting on signaling proteins of the conserved HORMA domain family. Here we present the structure of the Caenorhabditis elegans TRIP13 ortholog PCH-2, revealing a new family of AAA+ ATPase protein remodelers. PCH-2 possesses a substrate-recognition domain related to those of the protein remodelers NSF and p97, while its overall hexameric architecture and likely structural mechanism bear close similarities to the bacterial protein unfoldase ClpX. We find that TRIP13, aided by the adapter protein p31(comet), converts the HORMA-family spindle checkpoint protein MAD2 from a signaling-active ‘closed’ conformer to an inactive ‘open’ conformer. We propose that TRIP13 and p31(comet) collaborate to inactivate the spindle assembly checkpoint through MAD2 conformational conversion and disassembly of mitotic checkpoint complexes. A parallel HORMA protein disassembly activity likely underlies TRIP13's critical regulatory functions in meiotic chromosome structure and recombination.

  13. Dissection of Axial-Pore Loop Function during Unfolding and Translocation by a AAA+ Proteolytic Machine

    Directory of Open Access Journals (Sweden)

    Ohad Iosefson

    2015-08-01

    Full Text Available In the axial channels of ClpX and related hexameric AAA+ protein-remodeling rings, the pore-1 loops are thought to play important roles in engaging, mechanically unfolding, and translocating protein substrates. How these loops perform these functions and whether they also prevent substrate dissociation to ensure processive degradation by AAA+ proteases are open questions. Using ClpX pore-1-loop variants, single-molecule force spectroscopy, and ensemble assays, we find that the six pore-1 loops function synchronously to grip and unfold protein substrates during a power stroke but are not important in preventing substrate slipping between power strokes. The importance of grip strength is task dependent. ClpX variants with multiple mutant pore-1 loops translocate substrates as well as the wild-type enzyme against a resisting force but show unfolding defects and a higher frequency of substrate release. These problems are magnified for more mechanically stable target proteins, supporting a threshold model of substrate gripping.

  14. The ATPase of the phi29 DNA packaging motor is a member of the hexameric AAA+ superfamily.

    Science.gov (United States)

    Schwartz, Chad; De Donatis, Gian Marco; Fang, Huaming; Guo, Peixuan

    2013-08-15

    The AAA+ superfamily of proteins is a class of motor ATPases performing a wide range of functions that typically exist as hexamers. The ATPase of phi29 DNA packaging motor has long been a subject of debate in terms of stoichiometry and mechanism of action. Here, we confirmed the stoichiometry of phi29 motor ATPase to be a hexamer and provide data suggesting that the phi29 motor ATPase is a member of the classical hexameric AAA+ superfamily. Native PAGE, EMSA, capillary electrophoresis, ATP titration, and binomial distribution assay show that the ATPase is a hexamer. Mutations in the known Walker motifs of the ATPase validated our previous assumptions that the protein exists as another member of this AAA+ superfamily. Our data also supports the finding that the phi29 DNA packaging motor uses a revolution mechanism without rotation or coiling (Schwartz et al., this issue). Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  15. An atomic model AAA-ATPase/20S core particle sub-complex of the 26S proteasome.

    Science.gov (United States)

    Förster, Friedrich; Lasker, Keren; Beck, Florian; Nickell, Stephan; Sali, Andrej; Baumeister, Wolfgang

    2009-10-16

    The 26S proteasome is the most downstream element of the ubiquitin-proteasome pathway of protein degradation. It is composed of the 20S core particle (CP) and the 19S regulatory particle (RP). The RP consists of 6 AAA-ATPases and at least 13 non-ATPase subunits. Based on a cryo-EM map of the 26S proteasome, structures of homologs, and physical protein-protein interactions we derive an atomic model of the AAA-ATPase-CP sub-complex. The ATPase order in our model (Rpt1/Rpt2/Rpt6/Rpt3/Rpt4/Rpt5) is in excellent agreement with the recently identified base-precursor complexes formed during the assembly of the RP. Furthermore, the atomic CP-AAA-ATPase model suggests that the assembly chaperone Nas6 facilitates CP-RP association by enhancing the shape complementarity between Rpt3 and its binding CP alpha subunits partners.

  16. Analysis of positional candidate genes in the AAA1 susceptibility locus for abdominal aortic aneurysms on chromosome 19

    Directory of Open Access Journals (Sweden)

    Ferrell Robert E

    2011-01-01

    Full Text Available Abstract Background Abdominal aortic aneurysm (AAA is a complex disorder with multiple genetic risk factors. Using affected relative pair linkage analysis, we previously identified an AAA susceptibility locus on chromosome 19q13. This locus has been designated as the AAA1 susceptibility locus in the Online Mendelian Inheritance in Man (OMIM database. Methods Nine candidate genes were selected from the AAA1 locus based on their function, as well as mRNA expression levels in the aorta. A sample of 394 cases and 419 controls was genotyped for 41 SNPs located in or around the selected nine candidate genes using the Illumina GoldenGate platform. Single marker and haplotype analyses were performed. Three genes (CEBPG, PEPD and CD22 were selected for DNA sequencing based on the association study results, and exonic regions were analyzed. Immunohistochemical staining of aortic tissue sections from AAA and control individuals was carried out for the CD22 and PEPD proteins with specific antibodies. Results Several SNPs were nominally associated with AAA (p CEBPG, peptidase D (PEPD, and CD22. Haplotype analysis found a nominally associated 5-SNP haplotype in the CEBPG/PEPD locus, as well as a nominally associated 2-SNP haplotype in the CD22 locus. DNA sequencing of the coding regions revealed no variation in CEBPG. Seven sequence variants were identified in PEPD, including three not present in the NCBI SNP (dbSNP database. Sequencing of all 14 exons of CD22 identified 20 sequence variants, five of which were in the coding region and six were in the 3'-untranslated region. Five variants were not present in dbSNP. Immunohistochemical staining for CD22 revealed protein expression in lymphocytes present in the aneurysmal aortic wall only and no detectable expression in control aorta. PEPD protein was expressed in fibroblasts and myofibroblasts in the media-adventitia border in both aneurysmal and non-aneurysmal tissue samples. Conclusions Association testing

  17. Pareto front analysis of 6 and 15 MV dynamic IMRT for lung cancer using pencil beam, AAA and Monte Carlo

    DEFF Research Database (Denmark)

    Ottosson, R O; Hauer, Anna Karlsson; Behrens, C.F.

    2010-01-01

    of motion on the dose distribution was investigated. Four non-small cell lung cancer cases were selected for this study. Inverse planning was conducted using Varian Eclipse. A total number of 31 dynamic IMRT plans, distributed amongst the four cases, were created ranging from PTV conformity weighted...... distributions when moving the GTV to the edge of the PTV. PBC, however, predicts results contradicting those of AAA and MC. This study shows that PB-based dose calculation algorithms are clinically insufficient for patient geometries involving large density inhomogeneities. AAA is in much better agreement...

  18. Monte Carlo evaluation of the AAA treatment planning algorithm in a heterogeneous multilayer phantom and IMRT clinical treatments for an Elekta SL25 linear accelerator

    International Nuclear Information System (INIS)

    Sterpin, E.; Tomsej, M.; Smedt, B. de; Reynaert, N.; Vynckier, S.

    2007-01-01

    The Anisotropic Analytical Algorithm (AAA) is a new pencil beam convolution/superposition algorithm proposed by Varian for photon dose calculations. The configuration of AAA depends on linear accelerator design and specifications. The purpose of this study was to investigate the accuracy of AAA for an Elekta SL25 linear accelerator for small fields and intensity modulated radiation therapy (IMRT) treatments in inhomogeneous media. The accuracy of AAA was evaluated in two studies. First, AAA was compared both with Monte Carlo (MC) and the measurements in an inhomogeneous phantom simulating lung equivalent tissues and bone ribs. The algorithm was tested under lateral electronic disequilibrium conditions, using small fields (2x2 cm 2 ). Good agreement was generally achieved for depth dose and profiles, with deviations generally below 3% in lung inhomogeneities and below 5% at interfaces. However, the effects of attenuation and scattering close to the bone ribs were not fully taken into account by AAA, and small inhomogeneities may lead to planning errors. Second, AAA and MC were compared for IMRT plans in clinical conditions, i.e., dose calculations in a computed tomography scan of a patient. One ethmoid tumor, one orophaxynx and two lung tumors are presented in this paper. Small differences were found between the dose volume histograms. For instance, a 1.7% difference for the mean planning target volume dose was obtained for the ethmoid case. Since better agreement was achieved for the same plans but in homogeneous conditions, these differences must be attributed to the handling of inhomogeneities by AAA. Therefore, inherent assumptions of the algorithm, principally the assumption of independent depth and lateral directions in the scaling of the kernels, were slightly influencing AAA's validity in inhomogeneities. However, AAA showed a good accuracy overall and a great ability to handle small fields in inhomogeneous media compared to other pencil beam convolution

  19. Inter-ring rotations of AAA ATPase p97 revealed by electron cryomicroscopy.

    Science.gov (United States)

    Yeung, Heidi O; Förster, Andreas; Bebeacua, Cecilia; Niwa, Hajime; Ewens, Caroline; McKeown, Ciarán; Zhang, Xiaodong; Freemont, Paul S

    2014-03-05

    The type II AAA+ protein p97 is involved in numerous cellular activities, including endoplasmic reticulum-associated degradation, transcription activation, membrane fusion and cell-cycle control. These activities are at least in part regulated by the ubiquitin system, in which p97 is thought to target ubiquitylated protein substrates within macromolecular complexes and assist in their extraction or disassembly. Although ATPase activity is essential for p97 function, little is known about how ATP binding or hydrolysis is coupled with p97 conformational changes and substrate remodelling. Here, we have used single-particle electron cryomicroscopy (cryo-EM) to study the effect of nucleotides on p97 conformation. We have identified conformational heterogeneity within the cryo-EM datasets from which we have resolved two major p97 conformations. A comparison of conformations reveals inter-ring rotations upon nucleotide binding and hydrolysis that may be linked to the remodelling of target protein complexes.

  20. [Allgrove syndrome (triple A). Finding of a mutation not described in the AAAS gene].

    Science.gov (United States)

    Capataz Ledesma, M; Méndez Pérez, P; Rodríguez López, R; Galán Gómez, E

    2013-02-01

    Allgrove syndrome (triple A) is a rare autosomal recessive disease. The classic triad includes, congenital adrenal insufficiency due to ACTH resistance, achalasia of the cardia and alacrimia. Neurological abnormalities are associated with autonomic neuropathy, sensory and motor defects, deafness, mental retardation, Parkinsonism and dementia. The gene responsible is the ADRACALIN or AAAS encoding a protein called ALADIN. We report a case of a 19 year-old male, assessed when he was 10 years old in our department due to suspected storage disease. Mild mental and language retardation, hypernasal voice, sensory-motor neuropathy with autonomic involvement and signs of spastic paraparesis, alacrimia. gastroesophageal reflux, and achalasia. Molecular studies showed to mutations, the undescribed p.Tyr 19 Cys, and IVS14 +1 G. Copyright © 2012 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

  1. Toxicidad de boro en plantaciones de banano(Musa AAA en Costa Rica

    Directory of Open Access Journals (Sweden)

    Alfonso Vargas

    2007-01-01

    Full Text Available En las hojas de plantas de banano (Musa AAA, cvs. Grande Naine y Valery, se observó una necrosis marginal irregular y continua, la cual se desarrolló a partir de un área clorótica igualmente irregular, que avanzó del margen hacia el interior de la hoja. La parte central de la lámina foliar retuvo siempre su coloración verde original. Los análisis de suelo y tejido foliar mostraron que los síntomas fueron causados por altas concentraciones de boro, debido ya fuese a aplicaciones excesivas del nutrimento al suelo y al follaje, o por el efecto de aplicaciones muy frecuentes de boro vía fertirriego, combinado con una disminución de la concentración de calcio en la hoja

  2. Mineral fertilizers improve the sensory quality of East African Highland bananas (Musa AAA-EA, cv. Kisansa)

    NARCIS (Netherlands)

    Taulya, G.; Asten, van P.J.A.; Nowakunda, K.; Kaddu-Mukasa, P.

    2010-01-01

    Some farmers in Uganda believe that fertilizers negatively affect the sensory attributes of cooking type bananas. This belief may hamper the adoption of fertilizers. To verify the validity of this belief, bunches (Musa AAA-EA, cv. ‘Kisansa’) from fertilized (i.e. N-P-K-Mg-Zn-S-B-Mo) and

  3. Foot-and-Mouth Disease Virus 2C Is a Hexameric AAA+ Protein with a Coordinated ATP Hydrolysis Mechanism

    DEFF Research Database (Denmark)

    Sweeney, Trevor; Cisnetto, Valentina; Bose, Daniel

    2010-01-01

    Foot-and-mouth disease virus (FMDV), a positive sense, single-stranded RNA virus, causes a highly contagious disease in cloven-hoofed livestock. Like other picornaviruses, FMDV has a conserved 2C protein assigned to the superfamily 3 helicases a group of AAA+ ATPases that has a predicted N-termin...

  4. Mineral fertilizer response and nutrient use efficiencies of East African highland banana (Musa spp., AAA-EAHB, cv. Kisansa)

    NARCIS (Netherlands)

    Nyombi, K.; Asten, van P.J.A.; Corbeels, M.; Taulya, G.; Leffelaar, P.A.; Giller, K.E.

    2010-01-01

    Poor yields of East African highland bananas (Musa spp., AAA-EAHB) on smallholder farms have often been attributed to problems of poor soil fertility. We measured the effects of mineral fertilizers on crop performance at two sites over two to three crop cycles; Kawanda in central Uganda and Ntungamo

  5. Active shape models exploiting slice-to-slice correlation in segmentation of 3D CTA AAA images

    NARCIS (Netherlands)

    Bruijne, M. de; Ginneken, B. van; Niessen, W.J.; Maintz, J.B.A.; Viergever, M.A.

    2001-01-01

    An automated method for the segmentation of thrombus in abdominal aortic aneurysms (AAA) from CTA data is presented. Three segmentation schemes, inspired by Active Shape Model (ASM) segmentation, were investigated. (1) The original ASM scheme as proposed by Cootes and Taylor [1], applied to

  6. Pareto front analysis of 6 and 15 MV dynamic IMRT for lung cancer using pencil beam, AAA and Monte Carlo.

    Science.gov (United States)

    Ottosson, R O; Karlsson, A; Behrens, C F

    2010-08-21

    The pencil beam dose calculation method is frequently used in modern radiation therapy treatment planning regardless of the fact that it is documented inaccurately for cases involving large density variations. The inaccuracies are larger for higher beam energies. As a result, low energy beams are conventionally used for lung treatments. The aim of this study was to analyze the advantages and disadvantages of dynamic IMRT treatment planning for high and low photon energy in order to assess if deviating from the conventional low energy approach could be favorable in some cases. Furthermore, the influence of motion on the dose distribution was investigated. Four non-small cell lung cancer cases were selected for this study. Inverse planning was conducted using Varian Eclipse. A total number of 31 dynamic IMRT plans, distributed amongst the four cases, were created ranging from PTV conformity weighted to normal tissue sparing weighted. All optimized treatment plans were calculated using three different calculation algorithms (PBC, AAA and MC). In order to study the influence of motion, two virtual lung phantoms were created. The idea was to mimic two different situations: one where the GTV is located centrally in the PTV and another where the GTV was close to the edge of the PTV. PBC is in poor agreement with MC and AAA for all cases and treatment plans. AAA overestimates the dose, compared to MC. This effect is more pronounced for 15 than 6 MV. AAA and MC both predict similar perturbations in dose distributions when moving the GTV to the edge of the PTV. PBC, however, predicts results contradicting those of AAA and MC. This study shows that PB-based dose calculation algorithms are clinically insufficient for patient geometries involving large density inhomogeneities. AAA is in much better agreement with MC, but even a small overestimation of the dose level by the algorithm might lead to a large part of the PTV being underdosed. It is advisable to use low energy as a

  7. SU-F-T-622: Comparative Analysis of Pencil Beam and Anisotropic Analytical Algorithm (AAA) for Stereotactic Body Radiation Therapy (SBRT) of Thoracic Spine

    Energy Technology Data Exchange (ETDEWEB)

    Badkul, R; Nicolai, W; Pokhrel, D; Jiang, H; Wang, F; Lominskac, C [University of Kansas Medical Center, Kansas City, KS (United States); Ramanjappa, T [S. K. University, Anantapur, AP (India)

    2016-06-15

    Purpose: To compare the impact of Pencil Beam(PB) and Anisotropic Analytic Algorithm(AAA) dose calculation algorithms on OARs and planning target volume (PTV) in thoracic spine stereotactic body radiation therapy (SBRT). Methods: Ten Spine SBRT patients were planned on Brainlab iPlan system using hybrid plan consisting of 1–2 non-coplanar conformal-dynamic arcs and few IMRT beams treated on NovalisTx with 6MV photon. Dose prescription varied from 20Gy to 30Gy in 5 fractions depending on the situation of the patient. PB plans were retrospectively recalculated using the Varian Eclipse with AAA algorithm using same MUs, MLC pattern and grid size(3mm).Differences in dose volume parameters for PTV, spinal cord, lung, and esophagus were analyzed and compared for PB and AAA algorithms. OAR constrains were followed per RTOG-0631. Results: Since patients were treated using PB calculation, we compared all the AAA DVH values with respect to PB plan values as standard, although AAA predicts the dose more accurately than PB. PTV(min), PTV(Max), PTV(mean), PTV(D99%), PTV(D90%) were overestimated with AAA calculation on average by 3.5%, 1.84%, 0.95%, 3.98% and 1.55% respectively as compared to PB. All lung DVH parameters were underestimated with AAA algorithm mean deviation of lung V20, V10, V5, and 1000cc were 42.81%,19.83%, 18.79%, and 18.35% respectively. AAA overestimated Cord(0.35cc) by mean of 17.3%; cord (0.03cc) by 12.19% and cord(max) by 10.5% as compared to PB. Esophagus max dose were overestimated by 4.4% and 5cc by 3.26% for AAA algorithm as compared to PB. Conclusion: AAA overestimated the PTV dose values by up to 4%.The lung DVH had the greatest underestimation of dose by AAA versus PB. Spinal cord dose was overestimated by AAA versus PB. Given the critical importance of accuracy of OAR and PTV dose calculation for SBRT spine, more accurate algorithms and validation of calculated doses in phantom models are indicated.

  8. Open surgery (OS) versus endovascular aneurysm repair (EVAR) for hemodynamically stable and unstable ruptured abdominal aortic aneurysm (rAAA).

    Science.gov (United States)

    Zhang, Simeng; Feng, Jiaxuan; Li, Haiyan; Zhang, Yongxue; Lu, Qingsheng; Jing, Zaiping

    2016-08-01

    Endovascular aneurysm repair (EVAR) is an alternative treatment for ruptured abdominal aortic aneurysms (rAAA) in hemodynamically (hd) stable patients. Treatment for patients with hd-unstable rAAA remains controversial. The aim of this study was to compare the outcomes of EVAR and open surgery (OS) in hd-stable and hd-unstable rAAA patients using meta-analysis. The first part of this study included 48 articles that reported the treatment outcomes of rAAA managed with EVAR (n = 9610) and OS (n = 93867). The second part, which is the focus of this study, included 5 out of 48 articles, which further reported treatment results in hd-stable (n = 198) and hd-unstable (n = 185) patients. When heterogeneity among the groups was observed, a random-effects model was used to calculate the adjusted odds ratios (OR) or in cases of non-heterogeneity, a fixed-effects model analysis was employed. In the first part of this study, the in-hospital mortality rate was found to be lower in the EVAR group than in the OS group (29.9 vs 40.8 %; OR 0.59; 95 % CI 0.52-0.66; P OS. The total mortality was 147/383 (38.4 %), while the mortality of the EVAR group and the OS group was 25.7 % (39/152) and 46.8 % (108/231), respectively. In the hd-stable group, the in-hospital mortality after EVAR was significantly lower than that after OS [18.9 % (18/95) vs 28.2 % (29/103); OR 0.47; 95 % CI 0.22-0.97; P = 0.04]. For the hd-unstable rAAA patients, the in-hospital mortality after EVAR was significantly lower than that after OS [36.8 % (21/57) vs 61.7 % (79/128); OR 0.40; 95 % CI 0.20-0.79; P OS, EVAR in hd-unstable rAAA patients is associated with improved outcomes. Available publications are currently limited; thus, the best treatment strategy for this subgroup of patients remains unclear. Further clinical studies are needed to provide more detailed data, such as the shock index and long-term results.

  9. SU-E-T-122: Anisotropic Analytical Algorithm (AAA) Vs. Acuros XB (AXB) in Stereotactic Treatment Planning

    International Nuclear Information System (INIS)

    Mynampati, D; Scripes, P Godoy; Kuo, H; Yaparpalvi, R; Tome, W

    2015-01-01

    Purpose: To evaluate dosimetric differences between superposition beam model (AAA) and determinant photon transport solver (AXB) in lung SBRT and Cranial SRS dose computations. Methods: Ten Cranial SRS and ten Lung SBRT plans using Varian, AAA -11.0 were re-planned using Acuros -XB-11.0 with fixed MU. 6MV photon Beam model with HD120-MLC used for dose calculations. Four non-coplanar conformal arcs used to deliver 21Gy or 18Gy to SRS targets (0.4 to 6.2cc). 54Gy (3Fractions) or 50Gy (5Fractions) was planned for SBRT targets (7.3 to 13.9cc) using two VAMT non-coplanar arcs. Plan comparison parameters were dose to 1% PTV volume (D1), dose to 99% PTV volume( D99), Target mean (Dmean), Conformity index (ratio of prescription isodose volume to PTV), Homogeneity Index [ (D2%-D98%)/Dmean] and R50 (ratio of 50% of prescription isodose volume to PTV). OAR parameters were Brain volume receiving 12Gy dose (V12Gy) and maximum dose (D0.03) to Brainstem for SRS. For lung SBRT, maximum dose to Heart and Cord, Mean lung dose (MLD) and volume of lung receiving 20Gy (V20Gy) were computed. PTV parameters compared by percentage difference between AXB and AAA parameters. OAR parameters and HI compared by absolute difference between two calculations. For analysis, paired t-test performed over the parameters. Results: Compared to AAA, AXB SRS plans have on average 3.2% lower D99, 6.5% lower CI and 3cc less Brain-V12. However, AXB SBRT plans have higher D1, R50 and Dmean by 3.15%, 1.63% and 2.5%. For SRS and SBRT, AXB plans have average HI 2 % and 4.4% higher than AAA plans. In both techniques, all other parameters vary within 1% or 1Gy. In both sets only two parameters have P>0.05. Conclusion: Even though t-test results signify difference between AXB and AAA plans, dose differences in dose estimations by both algorithms are clinically insignificant

  10. SU-E-T-122: Anisotropic Analytical Algorithm (AAA) Vs. Acuros XB (AXB) in Stereotactic Treatment Planning

    Energy Technology Data Exchange (ETDEWEB)

    Mynampati, D; Scripes, P Godoy [Montefiore Medical Center, Bronx, NY (United States); Kuo, H; Yaparpalvi, R; Tome, W [Montefiore Medical Center, Bronx, NY (United States); Albert Einstein College of Medicine, Bronx, NY (United States)

    2015-06-15

    Purpose: To evaluate dosimetric differences between superposition beam model (AAA) and determinant photon transport solver (AXB) in lung SBRT and Cranial SRS dose computations. Methods: Ten Cranial SRS and ten Lung SBRT plans using Varian, AAA -11.0 were re-planned using Acuros -XB-11.0 with fixed MU. 6MV photon Beam model with HD120-MLC used for dose calculations. Four non-coplanar conformal arcs used to deliver 21Gy or 18Gy to SRS targets (0.4 to 6.2cc). 54Gy (3Fractions) or 50Gy (5Fractions) was planned for SBRT targets (7.3 to 13.9cc) using two VAMT non-coplanar arcs. Plan comparison parameters were dose to 1% PTV volume (D1), dose to 99% PTV volume( D99), Target mean (Dmean), Conformity index (ratio of prescription isodose volume to PTV), Homogeneity Index [ (D2%-D98%)/Dmean] and R50 (ratio of 50% of prescription isodose volume to PTV). OAR parameters were Brain volume receiving 12Gy dose (V12Gy) and maximum dose (D0.03) to Brainstem for SRS. For lung SBRT, maximum dose to Heart and Cord, Mean lung dose (MLD) and volume of lung receiving 20Gy (V20Gy) were computed. PTV parameters compared by percentage difference between AXB and AAA parameters. OAR parameters and HI compared by absolute difference between two calculations. For analysis, paired t-test performed over the parameters. Results: Compared to AAA, AXB SRS plans have on average 3.2% lower D99, 6.5% lower CI and 3cc less Brain-V12. However, AXB SBRT plans have higher D1, R50 and Dmean by 3.15%, 1.63% and 2.5%. For SRS and SBRT, AXB plans have average HI 2 % and 4.4% higher than AAA plans. In both techniques, all other parameters vary within 1% or 1Gy. In both sets only two parameters have P>0.05. Conclusion: Even though t-test results signify difference between AXB and AAA plans, dose differences in dose estimations by both algorithms are clinically insignificant.

  11. The Protective Effects of Diabetes Mellitus on Post-EVAR AAA Growth and Reinterventions.

    Science.gov (United States)

    Png, Chien Yi M; Tadros, Rami O; Kang, Ming; Beckerman, William E; Tardiff, Melissa L; Vouyouka, Ageliki G; Marin, Michael L; Faries, Peter L

    2017-08-01

    This study aims to investigate the effect of diabetes on post-endovascular aneurysm repairs (EVARs) of abdominal aortic aneurysms (AAAs). A total of 1,479 consecutive patients who underwent AAA EVAR were reviewed. The cohorts were divided based on their diabetes status and compared. Preoperative demographic and comorbidity data were analyzed using the t-test and chi-squared test, whereas post-EVAR outcomes were analyzed using Probit multivariate model, followed by Kaplan-Meier survival curve and Cox regression. Of our 1,479 patients, 993 met inclusion criteria. One hundred eighty-three were diabetics (18.4%) compared with 810 nondiabetics (81.6%). Coronary artery disease (CAD; diabetics: 70.49%, nondiabetics: 60.76%, P = 0.014) and hypertension (HTN; diabetics: 90.16%, nondiabetics: 79.46%, P = 0.0008) were the only comorbidities analyzed, including follow-up length, which had any significant differences between the diabetic and nondiabetic groups. Probit multivariate analysis using a combined cohort follow-up mean of 51 months showed a significant decrease in aneurysm sac enlargement in diabetic patients (diabetics: 13.11%, nondiabetics: 19.43%, model estimate: 0.3058; 95% confidence interval [CI]: 0.0486-0.5629, Pr > ChiSq = 0.0198) and trended toward significantly fewer reinterventions (diabetics: 23.50%, nondiabetics: 28.41%, model estimate: 0.1990; 95% CI: -0.0262 to 0.4243, Pr > ChiSq = 0.0833). In the Cox regressions, diabetes had a significant protective factor on reinterventions (hazard ratio [HR]: 0.697, Pr > ChiSq = 0.0151), and was trending toward significance for aneurysm sac enlargement (HR: 0.750, Pr > ChiSq = 0.1961). There was no significant difference across diabetic status in any other outcomes, including mortality and endoleak occurrence. Although a higher proportion of diabetic patients present with HTN and CAD, they have decreased long-term rates of aneurysm sac enlargement after EVAR. As a result, this cohort trends

  12. AAAS Mass Media Science and Engineering Fellowship Program: Building Communication Skills in Young Scientists

    Science.gov (United States)

    Pasco, S.

    2006-12-01

    The AAAS Mass Media Science &Engineering Fellowship program has succeeded in training scientists to become more effective communicators for more than 30 years. The program places advanced science, engineering and mathematics students at media sites to work as science reporters for ten weeks each summer. AAAS places between 15 to 20 students a year at newspapers, magazines and radio stations. Our goal is to create better science communicators who understand their role in fostering the public's understanding of science. Fellows leave the program with a greater awareness of how to communicate complex issues by making the connection as to why people should be interested in certain developments, and more specifically, how they will impact their communities. 2004 AGU Fellow Rei Ueyama put her lessons learned to good use during her Fellowship at the Sacramento Bee. "In a regional paper like The Bee, a (story) also had to have a local touch. I needed to show why people in Sacramento (or California) should bother to read the story. One example is the story I wrote about seeding the ocean with iron particles to fight global warming. Since ocean fertilization is a global issue, I had to clearly specify the reason why The Bee and not The New York Times was running the story. The local angle I chose was to point out that the core group of scientists involved in this study was from Monterey Bay, Calif." Many alumni tell us the program has been an integral force in shaping the course of their career. Similarly, sites often report that having a scientist on staff is an invaluable resource that allows them to cover additional science stories as well as report some technical stories in more depth. The American Geophysical Union has sponsored a Mass Media Fellow since 1997. Sponsorship allows affiliate program partners to establish connections with young professionals in their field. They are then also able to take advantage of the communication skills resident in their alumni base

  13. Structures of Asymmetric ClpX Hexamers Reveal Nucleotide-Dependent Motions in a AAA+ Protein-Unfolding Machine

    Energy Technology Data Exchange (ETDEWEB)

    Glynn, Steven E.; Martin, Andreas; Nager, Andrew R.; Baker, Tania A.; Sauer, Robert T.; MIT

    2010-02-02

    ClpX is a AAA+ machine that uses the energy of ATP binding and hydrolysis to unfold native proteins and translocate unfolded polypeptides into the ClpP peptidase. The crystal structures presented here reveal striking asymmetry in ring hexamers of nucleotide-free and nucleotide-bound ClpX. Asymmetry arises from large changes in rotation between the large and small AAA+ domains of individual subunits. These differences prevent nucleotide binding to two subunits, generate a staggered arrangement of ClpX subunits and pore loops around the hexameric ring, and provide a mechanism for coupling conformational changes caused by ATP binding or hydrolysis in one subunit to flexing motions of the entire ring. Our structures explain numerous solution studies of ClpX function, predict mechanisms for pore elasticity during translocation of irregular polypeptides, and suggest how repetitive conformational changes might be coupled to mechanical work during the ATPase cycle of ClpX and related molecular machines.

  14. The AAA+ ATPase TRIP13 remodels HORMA domains through N-terminal engagement and unfolding

    Energy Technology Data Exchange (ETDEWEB)

    Ye, Qiaozhen; Kim, Dong Hyun; Dereli, Ihsan; Rosenberg, Scott C.; Hagemann, Goetz; Herzog, Franz; Tóth, Attila; Cleveland, Don W.; Corbett, Kevin D.

    2017-06-28

    Proteins of the conserved HORMA domain family, including the spindle assembly checkpoint protein MAD2 and the meiotic HORMADs, assemble into signaling complexes by binding short peptides termed “closure motifs”. The AAA+ ATPase TRIP13 regulates both MAD2 and meiotic HORMADs by disassembling these HORMA domain–closure motif complexes, but its mechanisms of substrate recognition and remodeling are unknown. Here, we combine X-ray crystallography and crosslinking mass spectrometry to outline how TRIP13 recognizes MAD2 with the help of the adapter protein p31comet. We show that p31comet binding to the TRIP13 N-terminal domain positions the disordered MAD2 N-terminus for engagement by the TRIP13 “pore loops”, which then unfold MAD2 in the presence of ATP. N-terminal truncation of MAD2 renders it refractory to TRIP13 action in vitro, and in cells causes spindle assembly checkpoint defects consistent with loss of TRIP13 function. Similar truncation of HORMAD1 in mouse spermatocytes compromises its TRIP13-mediated removal from meiotic chromosomes, highlighting a conserved mechanism for recognition and disassembly of HORMA domain–closure motif complexes by TRIP13.

  15. AAA-ATPase FIDGETIN-LIKE 1 and Helicase FANCM Antagonize Meiotic Crossovers by Distinct Mechanisms.

    Directory of Open Access Journals (Sweden)

    Chloe Girard

    2015-07-01

    Full Text Available Meiotic crossovers (COs generate genetic diversity and are critical for the correct completion of meiosis in most species. Their occurrence is tightly constrained but the mechanisms underlying this limitation remain poorly understood. Here we identified the conserved AAA-ATPase FIDGETIN-LIKE-1 (FIGL1 as a negative regulator of meiotic CO formation. We show that Arabidopsis FIGL1 limits CO formation genome-wide, that FIGL1 controls dynamics of the two conserved recombinases DMC1 and RAD51 and that FIGL1 hinders the interaction between homologous chromosomes, suggesting that FIGL1 counteracts DMC1/RAD51-mediated inter-homologue strand invasion to limit CO formation. Further, depleting both FIGL1 and the previously identified anti-CO helicase FANCM synergistically increases crossover frequency. Additionally, we showed that the effect of mutating FANCM on recombination is much lower in F1 hybrids contrasting from the phenotype of inbred lines, while figl1 mutation equally increases crossovers in both contexts. This shows that the modes of action of FIGL1 and FANCM are differently affected by genomic contexts. We propose that FIGL1 and FANCM represent two successive barriers to CO formation, one limiting strand invasion, the other disassembling D-loops to promote SDSA, which when both lifted, leads to a large increase of crossovers, without impairing meiotic progression.

  16. Long-Term Outcome of the GORE EXCLUDER AAA Endoprosthesis for Treatment of Infrarenal Aortic Aneurysms.

    Science.gov (United States)

    Poublon, Claire G; Holewijn, Suzanne; van Sterkenburg, Steven M M; Tielliu, Ignace F J; Zeebregts, Clark J; Reijnen, Michel M P J

    2017-05-01

    To evaluate long-term outcome of GORE EXCLUDER AAA Endoprosthesis (W.L. Gore & Associates, Inc, Flagstaff, Arizona) for elective treatment of infrarenal aortic aneurysms and to evaluate performance of different generations of the device. A retrospective analysis was performed of 248 patients undergoing elective endovascular aneurysm repair with the GORE EXCLUDER between January 2000 and December 2015 in 2 hospitals. Primary endpoint was reintervention-free survival. Secondary endpoints were technical success, overall survival, rupture-free survival, endoleaks, sac diameter change (> 5 mm), limb occlusion, and migration (> 5 mm). Median follow-up time was 26 months (range, 1-190 months). Assisted primary technical success was 96.8%. Reintervention-free survival for 5 and 10 years was 85.2% and 75.6%, respectively. Independent risk factors for reintervention were technical success (P GORE EXCLUDER compared with the low permeability GORE EXCLUDER (P = .001) and in the presence of type I, II, and V endoleaks (P GORE EXCLUDER is effective with acceptable reintervention rates in the long-term and few device-related adverse events or ruptures up to 10 years. Observed late adverse events and new-onset endoleaks emphasize the need for long-term surveillance. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.

  17. Effect of fertilizer insertion in the harvested mother banana plant pseudostem (Musa AAA Simmonds

    Directory of Open Access Journals (Sweden)

    Felipe Galvis R

    2013-04-01

    Full Text Available The need for more efficient nutrient use in adverse conditions, such as droughts, facilitated the development of new alternatives for fertilizer application, such as direct insertion into the vascular system of the pseudostem of harvested banana plants (Musa AAA Simmonds, considering the plant interconnection between the mother plant and the sucker in succession. The objective of this study was to evaluate the effect of fertilizer insertion into the pseudostem of banana plants compared to the conventional soil fertilization system. The study was conducted at two locations (north and center of Urabá region, setting different rates of fertilizer treatments (75, 100 and 125% of the commercial rate inserted at different heights (0.6 m and 0.9 m with a soil application of fertilizers as a control treatment. Biometric (height, pseudostem diameter, number of leaves, physiological (specific leaf area and specific leaf weight, and production variables were evaluated in the plants. According to the results, it was evident that the 0.9 m insertion height of the fertilizer was better than 0.6 m and the soil application. Although no significant differences were found between doses of fertilizer, we observed a trend of better performance for plants in treatments of 75% and 100% fertilizer dose inserted at 0.9 m

  18. Agrobacterium tumefaciens-mediated genetic transformation of embryogenesis cell suspensions of banana cultivar Grande naine (AAA

    Directory of Open Access Journals (Sweden)

    Idalmis Bermúdez-Caraballoso

    2004-01-01

    Full Text Available The black Sigatoka (Mycosphaerella fijiensis Morelet has become in the last years, the most destructive disease that affects the production of banana and plantains world-wide. The present work was made with the objective to obtain transgenic plants of banana cultivar Grand naine (AAA resistant to this disease with the use of genetic transformation. Embryogenenic cell suspensions obtained from somatic embryos formed from immature male flowers, were used for the transformation by Agrobacterium tumefaciens. The bacterial strain EHA-105 was used with the binary plasmids pHCA-58, pHCG-59 and pHGA-91, which contain different combinations of genes that encode for the antifungal chitinase, glucanase enzymes and the AP-24 osmotin. The commercial herbicide BASTA® was used as selective agent. One hundred ten putative transformed lines of the three constructions were obtained, after three selection months in the culture medium. The transgenic events were verified by means of Polymerase Chain Reaction analysis. Key words: AP-24, chitinase, glucanase, Musa, Mycosphaerella fijiensis

  19. Zinc and ATP Binding of the Hexameric AAA-ATPase PilF from Thermus thermophilus

    Science.gov (United States)

    Salzer, Ralf; Herzberg, Martin; Nies, Dietrich H.; Joos, Friederike; Rathmann, Barbara; Thielmann, Yvonne; Averhoff, Beate

    2014-01-01

    The traffic AAA-ATPase PilF is essential for pilus biogenesis and natural transformation of Thermus thermophilus HB27. Recently, we showed that PilF forms hexameric complexes containing six zinc atoms coordinated by conserved tetracysteine motifs. Here we report that zinc binding is essential for complex stability. However, zinc binding is neither required for pilus biogenesis nor natural transformation. A number of the mutants did not exhibit any pili during growth at 64 °C but still were transformable. This leads to the conclusion that type 4 pili and the DNA translocator are distinct systems. At lower growth temperatures (55 °C) the zinc-depleted multiple cysteine mutants were hyperpiliated but defective in pilus-mediated twitching motility. This provides evidence that zinc binding is essential for the role of PilF in pilus dynamics. Moreover, we found that zinc binding is essential for complex stability but dispensable for ATPase activity. In contrast to many polymerization ATPases from mesophilic bacteria, ATP binding is not required for PilF complex formation; however, it significantly increases complex stability. These data suggest that zinc and ATP binding increase complex stability that is important for functionality of PilF under extreme environmental conditions. PMID:25202014

  20. Effect of microgravity simulation using 3D clinostat on cavendish banana (Musa acuminata AAA Group) ripening process

    Science.gov (United States)

    Dwivany, Fenny Martha; Esyanti, Rizkita R.; Prapaisie, Adeline; Puspa Kirana, Listya; Latief, Chunaeni; Ginaldi, Ari

    2016-11-01

    The objective of the research was to determine the effect of microgravity simulation by 3D clinostat on Cavendish banana (Musa acuminata AAA group) ripening process. In this study, physical, physiological changes as well as genes expression were analysed. The result showed that in microgravity simulation condition ripening process in banana was delayed and the MaACOl, MaACSl and MaACS5 gene expression were affected.

  1. EFECTO DE DOS TIPOS DE FUNDAS SOBRE EL FRUTO DE BANANO (Musa AAA

    Directory of Open Access Journals (Sweden)

    Alfonso Vargas-Calvo

    2011-01-01

    Full Text Available El objetivo de este estudio fue determinar el efecto de dos fundas en la protección del racimo de banano (Musa AAA . En dos épocas climáticas (adversa y favorable bajo condiciones del Ca ribe de Costa Ri ca se evaluaron dos fundas: 1- azul Sa nta Lucía (bifentrina 0,1%, polie tileno de 12,7 ¿ de grosor, con perforaciones de 4 mm y 86,4 cm de ancho y 2- transparente con aditivos para filtrar la luz ultravioleta e infrarroja (bifentrina 0,1%, 20,3 ¿ de grosor, con perforaciones de 4 mm y 88,9 cm de ancho. El peso del racimo así como el grosor y la longitud del fruto central de la fila externa en la segunda, cuarta y sexta mano no difirieron (P> 0,0556 entre ambas fundas. Tampoco hubo diferencias entre estas en la apa rie ncia del racimo (P>0,4699 ni en la firmeza de la cáscara en grado 1 de maduración (P= 0,6268. En las varia bles de medición del color del fruto solamente L* presentó un valor (56,48 más alto (P=0,0109 con la funda transparente fotosensible, mie ntras que las otras dos varia bles relacionadas (a* y b* no fueron diferentes (P>0,1011 entre las fundas. El incremento adicional de 7,6 ¿ en el grosor del polie tileno de la funda transparente con respecto a la azul Sa nta Lucía, no ocasionó un incremento productivo ni una mejor apa rie ncia del racimo de banano y sus frutos.

  2. AAA+ proteases and their role in distinct stages along the Vibrio cholerae lifecycle.

    Science.gov (United States)

    Pressler, Katharina; Vorkapic, Dina; Lichtenegger, Sabine; Malli, Gerald; Barilich, Benjamin P; Cakar, Fatih; Zingl, Franz G; Reidl, Joachim; Schild, Stefan

    2016-09-01

    The facultative human pathogen Vibrio cholerae has to adapt to different environmental conditions along its lifecycle by means of transcriptional, translational and post-translational regulation. This study provides a first comprehensive analysis regarding the contribution of the cytoplasmic AAA+ proteases Lon, ClpP and HslV to distinct features of V. cholerae behaviour, including biofilm formation, motility, cholera toxin expression and colonization fitness in the mouse model. While absence of HslV did not yield to any altered phenotype compared to wildtype, absence of Lon or ClpP resulted in significantly reduced colonization in vivo. In addition, a Δlon deletion mutant showed altered biofilm formation and increased motility, which could be correlated with higher expression of V. cholerae flagella gene class IV. Concordantly, we could show by immunoblot analysis, that Lon is the main protease responsible for proteolytic control of FliA, which is required for class IV flagella gene transcription, but also downregulates virulence gene expression. FliA becomes highly sensitive to proteolytic degradation in absence of its anti-sigma factor FlgM, a scenario reported to occur during mucosal penetration due to FlgM secretion through the broken flagellum. Our results confirm that the high stability of FliA in the absence of Lon results in less cholera toxin and toxin corgulated pilus production under virulence gene inducing conditions and in the presence of a damaged flagellum. Thus, the data presented herein provide a molecular explanation on how V. cholerae can achieve full expression of virulence genes during early stages of colonization, despite FliA getting liberated from the anti-sigma factor FlgM. Copyright © 2016 Elsevier GmbH. All rights reserved.

  3. Catalytic Turnover Triggers Exchange of Subunits of the Magnesium Chelatase AAA+ Motor Unit*

    Science.gov (United States)

    Lundqvist, Joakim; Braumann, Ilka; Kurowska, Marzena; Müller, André H.; Hansson, Mats

    2013-01-01

    The ATP-dependent insertion of Mg2+ into protoporphyrin IX is the first committed step in the chlorophyll biosynthetic pathway. The reaction is catalyzed by magnesium chelatase, which consists of three gene products: BchI, BchD, and BchH. The BchI and BchD subunits belong to the family of AAA+ proteins (ATPases associated with various cellular activities) and form a two-ring complex with six BchI subunits in one layer and six BchD subunits in the other layer. This BchID complex is a two-layered trimer of dimers with the ATP binding site located at the interface between two neighboring BchI subunits. ATP hydrolysis by the BchID motor unit fuels the insertion of Mg2+ into the porphyrin by the BchH subunit. In the present study, we explored mutations that were originally identified in semidominant barley (Hordeum vulgare L.) mutants. The resulting recombinant BchI proteins have marginal ATPase activity and cannot contribute to magnesium chelatase activity although they apparently form structurally correct complexes with BchD. Mixing experiments with modified and wild-type BchI in various combinations showed that an exchange of BchI subunits in magnesium chelatase occurs during the catalytic cycle, which indicates that dissociation of the complex may be part of the reaction mechanism related to product release. Mixing experiments also showed that more than three functional interfaces in the BchI ring structure are required for magnesium chelatase activity. PMID:23836887

  4. The Rice AAA-ATPase OsFIGNL1 Is Essential for Male Meiosis

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-09-01

    Full Text Available Meiosis is crucial in reproduction of plants and ensuring genetic diversity. Although several genes involved in homologous recombination and DNA repair have been reported, their functions in rice (Oryza sativa male meiosis remain poorly understood. Here, we isolated and characterized the rice OsFIGNL1 (OsFidgetin-like 1 gene, encoding a conserved AAA-ATPase, and explored its function and importance in male meiosis and pollen formation. The rice Osfignl1 mutant exhibited normal vegetative growth, but failed to produce seeds and displayed pollen abortion phenotype. Phenotypic comparisons between the wild-type and Osfignl1 mutant demonstrated that OsFIGNL1 is required for anther development, and that the recessive mutation of this gene causes male sterility in rice. Complementation and CRISPR/Cas9 experiments demonstrated that wild-type OsFIGNL1 is responsible for the male sterility phenotype. Subcellular localization showed that OsFIGNL1-green fluorescent protein was exclusively localized in the nucleus of rice protoplasts. Male meiosis in the Osfignl1 mutant exhibited abnormal chromosome behavior, including chromosome bridges and multivalent chromosomes at diakinesis, lagging chromosomes, and chromosome fragments during meiosis. Yeast two-hybrid assays demonstrated OsFIGNL1 could interact with RAD51A1, RAD51A2, DMC1A, DMC1B, and these physical interactions were further confirmed by BiFC assay. Taken together, our results suggest that OsFIGNL1 plays an important role in regulation of male meiosis and anther development.

  5. Design of experiments in medical physics: Application to the AAA beam model validation.

    Science.gov (United States)

    Dufreneix, S; Legrand, C; Di Bartolo, C; Bremaud, M; Mesgouez, J; Tiplica, T; Autret, D

    2017-09-01

    The purpose of this study is to evaluate the usefulness of the design of experiments in the analysis of multiparametric problems related to the quality assurance in radiotherapy. The main motivation is to use this statistical method to optimize the quality assurance processes in the validation of beam models. Considering the Varian Eclipse system, eight parameters with several levels were selected: energy, MLC, depth, X, Y 1 and Y 2 jaw dimensions, wedge and wedge jaw. A Taguchi table was used to define 72 validation tests. Measurements were conducted in water using a CC04 on a TrueBeam STx, a TrueBeam Tx, a Trilogy and a 2300IX accelerator matched by the vendor. Dose was computed using the AAA algorithm. The same raw data was used for all accelerators during the beam modelling. The mean difference between computed and measured doses was 0.1±0.5% for all beams and all accelerators with a maximum difference of 2.4% (under the 3% tolerance level). For all beams, the measured doses were within 0.6% for all accelerators. The energy was found to be an influencing parameter but the deviations observed were smaller than 1% and not considered clinically significant. Designs of experiment can help define the optimal measurement set to validate a beam model. The proposed method can be used to identify the prognostic factors of dose accuracy. The beam models were validated for the 4 accelerators which were found dosimetrically equivalent even though the accelerator characteristics differ. Copyright © 2017 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  6. Study of AAA Algorithm on the pelvic region with the VMAT technical using a dummy anthropomorphic; Estudio del algoritmo AAA en la region pelvica con la tecnica VMAT usando un maniqui antropomorfico

    Energy Technology Data Exchange (ETDEWEB)

    Puchades Puchades, V.; Serna Berna, A.; Mata Colodro, F.; Ramos Amores, D.; Casal Zamorano, E.

    2013-07-01

    Knowledge of real dosimetry in patients in new techniques of irradiation is very important to know the degree of accuracy of the dose calculations provided by the planners and however it is sometimes difficult to achieve. One way to evaluate this dosimetry without resorting to a patient, is the use of anthropomorphic Dummies. One of the algorithms employed is called AAA (Analytical Anisotropic Algorithm), which is an analytical algorithm of overlap-convolution, which improves the calculation of doses in the heterogeneities that the patient presents in your body (FAT, muscle, bone, lung) in comparison with other ancestor algorithms. (Author)

  7. A dosimetric evaluation of the Eclipse AAA algorithm and Millennium 120 MLC for cranial intensity-modulated radiosurgery.

    Science.gov (United States)

    Calvo Ortega, Juan Francisco; Moragues, Sandra; Pozo, Miquel; José, Sol San; Puertas, Enrique; Fernández, Jaime; Casals, Joan

    2014-01-01

    The aim of this study is to assess the accuracy of a convolution-based algorithm (anisotropic analytical algorithm [AAA]) implemented in the Eclipse planning system for intensity-modulated radiosurgery (IMRS) planning of small cranial targets by using a 5-mm leaf-width multileaf collimator (MLC). Overall, 24 patient-based IMRS plans for cranial lesions of variable size (0.3 to 15.1cc) were planned (Eclipse, AAA, version 10.0.28) using fixed field-based IMRS produced by a Varian linear accelerator equipped with a 120 MLC (5-mm width on central leaves). Plan accuracy was evaluated according to phantom-based measurements performed with radiochromic film (EBT2, ISP, Wayne, NJ). Film 2D dose distributions were performed with the FilmQA Pro software (version 2011, Ashland, OH) by using the triple-channel dosimetry method. Comparison between computed and measured 2D dose distributions was performed using the gamma method (3%/1mm). Performance of the MLC was checked by inspection of the DynaLog files created by the linear accelerator during the delivery of each dynamic field. The absolute difference between the calculated and measured isocenter doses for all the IMRS plans was 2.5% ± 2.1%. The gamma evaluation method resulted in high average passing rates of 98.9% ± 1.4% (red channel) and 98.9% ± 1.5% (blue and green channels). DynaLog file analysis revealed a maximum root mean square error of 0.46mm. According to our results, we conclude that the Eclipse/AAA algorithm provides accurate cranial IMRS dose distributions that may be accurately delivered by a Varian linac equipped with a Millennium 120 MLC. © 2013 American Association of Medical Dosimetrists Published by American Association of Medical Dosimetrists All rights reserved.

  8. Developmental Localization and Methylesterification of Pectin Epitopes during Somatic Embryogenesis of Banana (Musa spp. AAA)

    Science.gov (United States)

    Xu, Chunxiang; Zhao, Lu; Pan, Xiao; Šamaj, Jozef

    2011-01-01

    Background The plant cell walls play an important role in somatic embryogenesis and plant development. Pectins are major chemical components of primary cell walls while homogalacturonan (HG) is the most abundant pectin polysaccharide. Developmental regulation of HG methyl-esterification degree is important for cell adhesion, division and expansion, and in general for proper organ and plant development. Methodology/Principal Findings Developmental localization of pectic homogalacturonan (HG) epitopes and the (1→4)-β-D-galactan epitope of rhamnogalacturonan I (RG-I) and degree of pectin methyl-esterification (DM) were studied during somatic embryogenesis of banana (Musa spp. AAA). Histological analysis documented all major developmental stages including embryogenic cells (ECs), pre-globular, globular, pear-shaped and cotyledonary somatic embryos. Histochemical staining of extracellularly secreted pectins with ruthenium red showed the most intense staining at the surface of pre-globular, globular and pear-shaped somatic embryos. Biochemical analysis revealed developmental regulation of galacturonic acid content and DM in diverse embryogenic stages. Immunodots and immunolabeling on tissue sections revealed developmental regulation of highly methyl-esterified HG epitopes recognized by JIM7 and LM20 antibodies during somatic embryogenesis. Cell walls of pre-globular/globular and late-stage embryos contained both low methyl-esterified HG epitopes as well as partially and highly methyl-esterified ones. Extracellular matrix which covered surface of early developing embryos contained pectin epitopes recognized by 2F4, LM18, JIM5, JIM7 and LM5 antibodies. De-esterification of cell wall pectins by NaOH caused a decrease or an elimination of immunolabeling in the case of highly methyl-esterified HG epitopes. However, immunolabeling of some low methyl-esterified epitopes appeared stronger after this base treatment. Conclusions/Significance These data suggest that both low

  9. The AAA ATPase Vps4 Plays Important Roles in Candida albicans Hyphal Formation and is Inhibited by DBeQ.

    Science.gov (United States)

    Zhang, Yahui; Li, Wanjie; Chu, Mi; Chen, Hengye; Yu, Haoyuan; Fang, Chaoguang; Sun, Ningze; Wang, Qiming; Luo, Tian; Luo, Kaiju; She, Xueping; Zhang, Mengqian; Yang, Dong

    2016-06-01

    Candida albicans is an opportunistic human pathogen, and its pathogenicity is associated with hyphal formation. Previous studies have shown that at neutral-to-alkaline pH, hyphal growth is dependent on the Rim101 pathway whose activation requires Snf7, a member of the ESCRT system. In this work, we described the purification and characterization of the C. albicans Vps4, an AAA ATPase required for recycling of the ESCRTs. Its role on hyphal growth has been investigated. Our data suggest deletion of Vps4 decreases overall hyphal growth at pH 7 and increases the growth of multiple hyphae induced by serum, which indicates that the ESCRTs may make a Rim101-independent contribution to hyphal growth. Furthermore, DBeQ, an inhibitor of the AAA ATPase p97, was shown to inhibit the ATPase activity of Vps4 with an IC50 of about 11.5 μM. To a less degree, it also inhibits hyphal growth. Our work may provide a new strategy to control C. albicans infection.

  10. The AAA+ proteins Pontin and Reptin enter adult age: from understanding their basic biology to the identification of selective inhibitors.

    Science.gov (United States)

    Matias, Pedro M; Baek, Sung Hee; Bandeiras, Tiago M; Dutta, Anindya; Houry, Walid A; Llorca, Oscar; Rosenbaum, Jean

    2015-01-01

    Pontin and Reptin are related partner proteins belonging to the AAA+ (ATPases Associated with various cellular Activities) family. They are implicated in multiple and seemingly unrelated processes encompassing the regulation of gene transcription, the remodeling of chromatin, DNA damage sensing and repair, and the assembly of protein and ribonucleoprotein complexes, among others. The 2nd International Workshop on Pontin and Reptin took place at the Instituto de Tecnologia Química e Biológica António Xavier in Oeiras, Portugal on October 10-12, 2014, and reported significant new advances on the mechanisms of action of these two AAA+ ATPases. The major points under discussion were related to the mechanisms through which these proteins regulate gene transcription, their roles as co-chaperones, and their involvement in pathophysiology, especially in cancer and ciliary biology and disease. Finally, they may become anticancer drug targets since small chemical inhibitors were shown to produce anti-tumor effects in animal models.

  11. HTTP as a Data Access Protocol: Trials with XrootD in CMS’s AAA Project

    Science.gov (United States)

    Balcas, J.; Bockelman, B. P.; Kcira, D.; Newman, H.; Vlimant, J.; Hendricks, T. W.; CMS Collaboration

    2017-10-01

    The main goal of the project to demonstrate the ability of using HTTP data federations in a manner analogous to the existing AAA infrastructure of the CMS experiment. An initial testbed at Caltech has been built and changes in the CMS software (CMSSW) are being implemented in order to improve HTTP support. The testbed consists of a set of machines at the Caltech Tier2 that improve the support infrastructure for data federations at CMS. As a first step, we are building systems that produce and ingest network data transfers up to 80 Gbps. In collaboration with AAA, HTTP support is enabled at the US redirector and the Caltech testbed. A plugin for CMSSW is being developed for HTTP access based on the DaviX software. It will replace the present fork/exec or curl for HTTP access. In addition, extensions to the XRootD HTTP implementation are being developed to add functionality to it, such as client-based monitoring identifiers. In the future, patches will be developed to better integrate HTTP-over-XRootD with the Open Science Grid (OSG) distribution. First results of the transfer tests using HTTP are presented in this paper together with details about the initial setup.

  12. Unfolding the mechanism of the AAA+ unfoldase VAT by a combined cryo-EM, solution NMR study.

    Science.gov (United States)

    Huang, Rui; Ripstein, Zev A; Augustyniak, Rafal; Lazniewski, Michal; Ginalski, Krzysztof; Kay, Lewis E; Rubinstein, John L

    2016-07-19

    The AAA+ (ATPases associated with a variety of cellular activities) enzymes play critical roles in a variety of homeostatic processes in all kingdoms of life. Valosin-containing protein-like ATPase of Thermoplasma acidophilum (VAT), the archaeal homolog of the ubiquitous AAA+ protein Cdc48/p97, functions in concert with the 20S proteasome by unfolding substrates and passing them on for degradation. Here, we present electron cryomicroscopy (cryo-EM) maps showing that VAT undergoes large conformational rearrangements during its ATP hydrolysis cycle that differ dramatically from the conformational states observed for Cdc48/p97. We validate key features of the model with biochemical and solution methyl-transverse relaxation optimized spectroscopY (TROSY) NMR experiments and suggest a mechanism for coupling the energy of nucleotide hydrolysis to substrate unfolding. These findings illustrate the unique complementarity between cryo-EM and solution NMR for studies of molecular machines, showing that the structural properties of VAT, as well as the population distributions of conformers, are similar in the frozen specimens used for cryo-EM and in the solution phase where NMR spectra are recorded.

  13. Preferences of AAA/AAG codon recognition by modified nucleosides, τm5s2U34 and t6A37 present in tRNALys.

    Science.gov (United States)

    Sonawane, Kailas D; Kamble, Asmita S; Fandilolu, Prayagraj M

    2017-12-27

    Deficiency of 5-taurinomethyl-2-thiouridine, τm 5 s 2 U at the 34th 'wobble' position in tRNA Lys causes MERRF (Myoclonic Epilepsy with Ragged Red Fibers), a neuromuscular disease. This modified nucleoside of mt tRNA Lys , recognizes AAA/AAG codons during protein biosynthesis process. Its preference to identify cognate codons has not been studied at the atomic level. Hence, multiple MD simulations of various molecular models of anticodon stem loop (ASL) of mt tRNA Lys in presence and absence of τm 5 s 2 U 34 and N 6 -threonylcarbamoyl adenosine (t 6 A 37 ) along with AAA and AAG codons have been accomplished. Additional four MD simulations of multiple ASL mt tRNA Lys models in the context of ribosomal A-site residues have also been performed to investigate the role of A-site in recognition of AAA/AAG codons. MD simulation results show that, ASL models in presence of τm 5 s 2 U 34 and t 6 A 37 with codons AAA/AAG are more stable than the ASL lacking these modified bases. MD trajectories suggest that τm 5 s 2 U recognizes the codons initially by 'wobble' hydrogen bonding interactions, and then tRNA Lys might leave the explicit codon by a novel 'single' hydrogen bonding interaction in order to run the protein biosynthesis process smoothly. We propose this model as the 'Foot-Step Model' for codon recognition, in which the single hydrogen bond plays a crucial role. MD simulation results suggest that, tRNA Lys with τm 5 s 2 U and t 6 A recognizes AAA codon more preferably than AAG. Thus, these results reveal the consequences of τm 5 s 2 U and t 6 A in recognition of AAA/AAG codons in mitochondrial disease, MERRF.

  14. Architecture and characterization of a thermostable MoxR family AAA(+) ATPase from Thermococcus kodakarensis KOD1.

    Science.gov (United States)

    Pham, Bang Phuong; Lee, Sangmin; Jia, Baolei; Kwak, Jae Myeong; Cheong, Gang-Won

    2014-05-01

    AAA(+) ATPases are ubiquitous enzymes that can function as molecular chaperones, employing the energy obtained from ATP hydrolysis to remodel macromolecules. In this report, the MoxR enzyme from Thermococcus kodakarensis KOD1 (TkMoxR) was shown to have two native forms: a two-stack hexameric ring and a hexameric structure, under physiological conditions and cold stress, respectively. TkMoxR was altered to a microtubule-like form in the presence of ATP and tightly interacted with dsDNA molecules of various lengths. In addition, the two-stack hexameric protein catalyzed dsDNA decomposition to form and then release ssDNA, whereas the hexamer TkMoxR structure interacted with but did not release dsDNA. These results suggest that TkMoxR has DNA helicase activity involved in gene expression control.

  15. A novel two-step mechanism for removal of a mitochondrial signal sequence involves the mAAA complex and the putative rhomboid protease Pcp1.

    Science.gov (United States)

    Esser, Karlheinz; Tursun, Baris; Ingenhoven, Martin; Michaelis, Georg; Pratje, Elke

    2002-11-08

    The yeast protein cytochrome c peroxidase (Ccp1) is nuclearly encoded and imported into the mitochondrial intermembrane space, where it is involved in degradation of reactive oxygen species. It is known, that Ccp1 is synthesised as a precursor with a N-terminal pre-sequence, that is proteolytically removed during transport of the protein. Here we present evidence for a new processing pathway, involving novel signal peptidase activities. The mAAA protease subunits Yta10 (Afg3) and Yta12 (Rca1) were identified both to be essential for the first processing step. In addition, the Pcp1 (Ygr101w) gene product was found to be required for the second processing step, yielding the mature Ccp1 protein. The newly identified Pcp1 protein belongs to the rhomboid-GlpG superfamily of putative intramembrane peptidases. Inactivation of the protease motifs in mAAA and Pcp1 blocks the respective steps of proteolysis. A model of coupled Ccp1 transport and N-terminal processing by the mAAA complex and Pcp1 is discussed. Similar processing mechanisms may exist, because the mAAA subunits and the newly identified Pcp1 protein belong to ubiquitous protein families.

  16. AAA-ATPase NVL2 acts on MTR4-exosome complex to dissociate the nucleolar protein WDR74

    Energy Technology Data Exchange (ETDEWEB)

    Hiraishi, Nobuhiro; Ishida, Yo-ichi; Nagahama, Masami, E-mail: nagahama@my-pharm.ac.jp

    2015-11-20

    Nuclear VCP-like 2 (NVL2) is a chaperone-like nucleolar ATPase of the AAA (ATPase associated with diverse cellular activities) family, which exhibits a high level of amino acid sequence similarity with the cytosolic AAA-ATPase VCP/p97. These proteins generally act on macromolecular complexes to stimulate energy-dependent release of their constituents. We previously showed that NVL2 interacts with RNA processing/degradation machinery containing an RNA helicase MTR4/DOB1 and an exonuclease complex, nuclear exosome, and involved in the biogenesis of 60S ribosomal subunits. These observations implicate NVL2 as a remodeling factor for the MTR4-exosome complex during the maturation of pre-ribosomal particles. Here, we used a proteomic screen and identified a WD repeat-containing protein 74 (WDR74) as a factor that specifically dissociates from this complex depending on the ATPase activity of NVL2. WDR74 shows weak amino acid sequence similarity with the yeast ribosome biogenesis protein Nsa1 and is co-localized with NVL2 in the nucleolus. Knockdown of WDR74 decreases 60S ribosome levels. Taken together, our results suggest that WDR74 is a novel regulatory protein of the MTR4-exsosome complex whose interaction is regulated by NVL2 and is involved in ribosome biogenesis. - Highlights: • WDR74 accumulates in MTR4-exosome complex upon expression of dominant-negative NVL2. • WDR74 is co-localized with NVL2 in the nucleolus. • WDR74, along with NVL2, is involved in the synthesis of 60S ribosomal subunits.

  17. AAA-ATPase NVL2 acts on MTR4-exosome complex to dissociate the nucleolar protein WDR74

    International Nuclear Information System (INIS)

    Hiraishi, Nobuhiro; Ishida, Yo-ichi; Nagahama, Masami

    2015-01-01

    Nuclear VCP-like 2 (NVL2) is a chaperone-like nucleolar ATPase of the AAA (ATPase associated with diverse cellular activities) family, which exhibits a high level of amino acid sequence similarity with the cytosolic AAA-ATPase VCP/p97. These proteins generally act on macromolecular complexes to stimulate energy-dependent release of their constituents. We previously showed that NVL2 interacts with RNA processing/degradation machinery containing an RNA helicase MTR4/DOB1 and an exonuclease complex, nuclear exosome, and involved in the biogenesis of 60S ribosomal subunits. These observations implicate NVL2 as a remodeling factor for the MTR4-exosome complex during the maturation of pre-ribosomal particles. Here, we used a proteomic screen and identified a WD repeat-containing protein 74 (WDR74) as a factor that specifically dissociates from this complex depending on the ATPase activity of NVL2. WDR74 shows weak amino acid sequence similarity with the yeast ribosome biogenesis protein Nsa1 and is co-localized with NVL2 in the nucleolus. Knockdown of WDR74 decreases 60S ribosome levels. Taken together, our results suggest that WDR74 is a novel regulatory protein of the MTR4-exsosome complex whose interaction is regulated by NVL2 and is involved in ribosome biogenesis. - Highlights: • WDR74 accumulates in MTR4-exosome complex upon expression of dominant-negative NVL2. • WDR74 is co-localized with NVL2 in the nucleolus. • WDR74, along with NVL2, is involved in the synthesis of 60S ribosomal subunits.

  18. SU-F-T-600: Influence of Acuros XB and AAA Dose Calculation Algorithms On Plan Quality Metrics and Normal Lung Doses in Lung SBRT

    Energy Technology Data Exchange (ETDEWEB)

    Yaparpalvi, R; Mynampati, D; Kuo, H; Garg, M; Tome, W; Kalnicki, S [Montefiore Medical Center, Bronx, NY (United States)

    2016-06-15

    Purpose: To study the influence of superposition-beam model (AAA) and determinant-photon transport-solver (Acuros XB) dose calculation algorithms on the treatment plan quality metrics and on normal lung dose in Lung SBRT. Methods: Treatment plans of 10 Lung SBRT patients were randomly selected. Patients were prescribed to a total dose of 50-54Gy in 3–5 fractions (10?5 or 18?3). Doses were optimized accomplished with 6-MV using 2-arcs (VMAT). Doses were calculated using AAA algorithm with heterogeneity correction. For each plan, plan quality metrics in the categories- coverage, homogeneity, conformity and gradient were quantified. Repeat dosimetry for these AAA treatment plans was performed using AXB algorithm with heterogeneity correction for same beam and MU parameters. Plan quality metrics were again evaluated and compared with AAA plan metrics. For normal lung dose, V{sub 20} and V{sub 5} to (Total lung- GTV) were evaluated. Results: The results are summarized in Supplemental Table 1. PTV volume was mean 11.4 (±3.3) cm{sup 3}. Comparing RTOG 0813 protocol criteria for conformality, AXB plans yielded on average, similar PITV ratio (individual PITV ratio differences varied from −9 to +15%), reduced target coverage (−1.6%) and increased R50% (+2.6%). Comparing normal lung doses, the lung V{sub 20} (+3.1%) and V{sub 5} (+1.5%) were slightly higher for AXB plans compared to AAA plans. High-dose spillage ((V105%PD - PTV)/ PTV) was slightly lower for AXB plans but the % low dose spillage (D2cm) was similar between the two calculation algorithms. Conclusion: AAA algorithm overestimates lung target dose. Routinely adapting to AXB for dose calculations in Lung SBRT planning may improve dose calculation accuracy, as AXB based calculations have been shown to be closer to Monte Carlo based dose predictions in accuracy and with relatively faster computational time. For clinical practice, revisiting dose-fractionation in Lung SBRT to correct for dose overestimates

  19. Random amplified polymorphic DNA (RAPD) detection of dwarf off-types in micropropagated Cavendish (Musa spp. AAA) bananas.

    Science.gov (United States)

    Damasco, O P; Graham, G C; Henry, R J; Adkins, S W; Smiths, M K; Godwin, I D

    1996-11-01

    A RAPD marker specific to the dwarf off-type (hereafter known as dwarf) from micropropagation of Cavendish banana (Musa spp. AAA) cultivars New Guinea Cavendish and Williams was identified following an analysis of 57 normal (true-to-type) and 59 dwarf plants generated from several different micropropagation events. Sixty-six random decamer primers were used in the initial screen, of which 19 (28.8%) revealed polymorphisms between normal and dwarf plants. Primer OPJ-04 (5'-CCGAACACGG-3') was found to amplify an approx. 1.5 kb band which was consistently present in all normal but absent in all dwarf plants of both cultivars. Reliable detection of dwarf plants was achieved using this marker, providing the only available means ofin vitro detection of dwarfs. The use of this marker could facilitate early detection and elimination of dwarfs from batches of micropropagated bananas, and may be a useful tool in determining what factors in the tissue culture process lead to this off type production.Other micropropagation-induced RAPD polymorphisms were observed but were not associated with the dwarf trait.

  20. Ultrastructural changes and the distribution of arabinogalactan proteins during somatic embryogenesis of banana (Musa spp. AAA cv. 'Yueyoukang 1').

    Science.gov (United States)

    Pan, Xiao; Yang, Xiao; Lin, Guimei; Zou, Ru; Chen, Houbin; Samaj, Jozef; Xu, Chunxiang

    2011-08-01

    A better understanding of somatic embryogenesis in banana (Musa spp.) may provide a practical way to improve regeneration of banana plants. In this study, we applied scanning electron microscopy (SEM) and transmission electron microscopy (TEM) to visualize the ultrastructural changes during somatic embryogenesis of banana (Musa AAA cv. 'Yueyoukang 1'). We also used histological and immunohistochemical techniques with 16 monoclonal antibodies to study the spatial distribution and cellular/subcellular localization of different arabinogalactan protein (AGP) components of the cell wall during somatic embryogenesis. Histological study with periodic acid-Schiff staining documented diverse embryogenic stages from embryogenic cells (ECs) to the late embryos. SEM revealed a mesh-like structure on the surface of proembryos which represented an early structural marker of somatic embryogenesis. TEM showed that ECs were rich in juvenile mitochondria, endoplasmic reticulum and Golgi stacks. Cells in proembryos and early globular embryos resembled ECs, but they were more vacuolated, showed more regular nuclei and slightly more developed organelles. Immunocytochemical study revealed that the signal of most AGP epitopes was stronger in starch-rich cells when compared with typical ECs. The main AGP component in the extracellular matrix surface network of banana proembryos was the MAC204 epitope. Later, AGP immunolabelling patterns varied with the developmental stages of the embryos. These results about developmental regulation of AGP epitopes along with developmental changes in the ultrastructure of cells are providing new insights into the somatic embryogenesis of banana. Copyright © Physiologia Plantarum 2011.

  1. In vivo assessment of blood flow patterns in abdominal aorta of mice with MRI: implications for AAA localization

    Science.gov (United States)

    Long, Robert C.; Consolini, Michelle A.; Suo, Jin; Willett, Nick J.; Fielden, Sam W.; Giddens, Don P.; Taylor, W. Robert; Oshinski, John N.

    2009-01-01

    Abdominal aortic aneurysms (AAA) localize in the infrarenal aorta in humans, while they are found in the suprarenal aorta in mouse models. It has been shown previously that humans experience a reversal of flow during early diastole in the infrarenal aorta during each cardiac cycle. This flow reversal causes oscillatory wall shear stress (OWSS) to be present in the infrarenal aorta of humans. OWSS has been linked to a variety of proatherogenic and proinflammatory factors. The presence of reverse flow in the mouse aorta is unknown. In this study we investigated blood flow in mice, using phase-contrast magnetic resonance (PCMR) imaging. We measured blood flow in the suprarenal and infrarenal abdominal aorta of 18 wild-type C57BL/6J mice and 15 apolipoprotein E (apoE)−/− mice. Although OWSS was not directly evaluated, results indicate that, unlike humans, there is no reversal of flow in the infrarenal aorta of wild-type or apoE−/− mice. Distensibility of the mouse aortic wall in both the suprarenal and infrarenal segments is higher than reported values for the human aorta. We conclude that normal mice do not experience the reverse flow in the infrarenal aorta that is observed in humans. PMID:19684182

  2. Crystal structure of Mycobacterium tuberculosis ClpP1P2 suggests a model for peptidase activation by AAA+ partner binding and substrate delivery.

    Science.gov (United States)

    Schmitz, Karl R; Carney, Daniel W; Sello, Jason K; Sauer, Robert T

    2014-10-28

    Caseinolytic peptidase P (ClpP), a double-ring peptidase with 14 subunits, collaborates with ATPases associated with diverse activities (AAA+) partners to execute ATP-dependent protein degradation. Although many ClpP enzymes self-assemble into catalytically active homo-tetradecamers able to cleave small peptides, the Mycobacterium tuberculosis enzyme consists of discrete ClpP1 and ClpP2 heptamers that require a AAA+ partner and protein-substrate delivery or a peptide agonist to stabilize assembly of the active tetradecamer. Here, we show that cyclic acyldepsipeptides (ADEPs) and agonist peptides synergistically activate ClpP1P2 by mimicking AAA+ partners and substrates, respectively, and determine the structure of the activated complex. Our studies establish the basis of heteromeric ClpP1P2 assembly and function, reveal tight coupling between the conformations of each ring, show that ADEPs bind only to one ring but appear to open the axial pores of both rings, provide a foundation for rational drug development, and suggest strategies for studying the roles of individual ClpP1 and ClpP2 rings in Clp-family proteolysis.

  3. Elements in nucleotide sensing and hydrolysis of the AAA+ disaggregation machine ClpB: a structure-based mechanistic dissection of a molecular motor

    Energy Technology Data Exchange (ETDEWEB)

    Zeymer, Cathleen, E-mail: cathleen.zeymer@mpimf-heidelberg.mpg.de; Barends, Thomas R. M.; Werbeck, Nicolas D.; Schlichting, Ilme; Reinstein, Jochen, E-mail: cathleen.zeymer@mpimf-heidelberg.mpg.de [Max Planck Institute for Medical Research, Jahnstrasse 29, 69120 Heidelberg (Germany)

    2014-02-01

    High-resolution crystal structures together with mutational analysis and transient kinetics experiments were utilized to understand nucleotide sensing and the regulation of the ATPase cycle in an AAA+ molecular motor. ATPases of the AAA+ superfamily are large oligomeric molecular machines that remodel their substrates by converting the energy from ATP hydrolysis into mechanical force. This study focuses on the molecular chaperone ClpB, the bacterial homologue of Hsp104, which reactivates aggregated proteins under cellular stress conditions. Based on high-resolution crystal structures in different nucleotide states, mutational analysis and nucleotide-binding kinetics experiments, the ATPase cycle of the C-terminal nucleotide-binding domain (NBD2), one of the motor subunits of this AAA+ disaggregation machine, is dissected mechanistically. The results provide insights into nucleotide sensing, explaining how the conserved sensor 2 motif contributes to the discrimination between ADP and ATP binding. Furthermore, the role of a conserved active-site arginine (Arg621), which controls binding of the essential Mg{sup 2+} ion, is described. Finally, a hypothesis is presented as to how the ATPase activity is regulated by a conformational switch that involves the essential Walker A lysine. In the proposed model, an unusual side-chain conformation of this highly conserved residue stabilizes a catalytically inactive state, thereby avoiding unnecessary ATP hydrolysis.

  4. Genomic organization and mapping of the mouse P26s4 ATPase gene: A member of the remarkably conserved AAA gene family

    Energy Technology Data Exchange (ETDEWEB)

    Hoyle, J.; Fisher, E.M.C. [Imperial College, London (United Kingdom)

    1996-01-01

    The eukaryotic genome contains a large family of ATPases in which each member has at least one highly conserved domain of approximately 200 amino acids with an ATP binding motif (the {open_quotes}AAA{close_quotes} domain). AAA ATPases play diverse roles in the cell and are of considerable interest to researchers investigating a number of different phenomena, including control of the cell cycle. We have characterized the mouse P26s4 AAA ATPase gene that encodes a subunit of the 26S protease, a multimeric complex that is responsible for the ubiquitin- and ATP-dependent degradation of specific proteins. The normal functioning of eukaryotic cells depends on this pathway to remove regulatory proteins such as cyclins or signal transduction molecules from the intracellular environment, with the appropriate timing to allow normal cell division and development. We have isolated mouse P26s4 cDNAs and mapped the P26s4 gene to chromosome 12. We have analyzed the intron-exon structure of the P26s4 genomic locus and have determined that the gene contains at least 10 introns, the first of which separates the start methionine from the rest of the coding sequence. 18 refs., 2 figs.

  5. Molecular cloning and expression of five glutathione S-transferase (GST) genes from Banana (Musa acuminata L. AAA group, cv. Cavendish).

    Science.gov (United States)

    Wang, Zhuo; Huang, Suzhen; Jia, Caihong; Liu, Juhua; Zhang, Jianbin; Xu, Biyu; Jin, Zhiqiang

    2013-09-01

    Three tau class MaGSTs responded to abiotic stress, MaGSTF1 and MaGSTL1 responded to signaling molecules, they may play an important role in the growth of banana plantlet. Glutathione S-transferases (GST) are multifunctional detoxification enzymes that participate in a variety of cellular processes, including stress responses. In this study, we report the molecular characteristics of five GST genes (MaGSTU1, MaGSTU2, MaGSTU3, MaGSTF1 and MaGSTL1) cloned from banana (Musa acuminate L. AAA group, cv. Cavendish) using a RACE-PCR-based strategy. The predicted molecular masses of these GSTs range from 23.4 to 27.7 kDa and their pIs are acidic. At the amino acid level, they share high sequence similarity with GSTs in the banana DH-Pahang (AA group) genome. Phylogenetic analysis showed that the deduced amino acid sequences of MaGSTs also have high similarity to GSTs of other plant species. Expression analysis by semi-quantitative RT-PCR revealed that these genes are differentially expressed in various tissues. In addition, their expression is regulated by various stress conditions, including exposure to signaling molecules, cold, salinity, drought and Fusarium oxysporum f specialis(f. Sp) cubense Tropical Race 4 (Foc TR4) infection. The expression of the tau class MaGSTs (MaGSTU1, MaGSTU2 and MaGSTU3) mainly responded to cold, salinity and drought while MaGSTF1 and MaGSTL1 expressions were upregulated by signaling molecules. Our findings suggest that MaGSTs play a key role in both development and abiotic stress responses.

  6. Evaluation of the Analytical Anisotropic Algorithm (AAA) in dose calculation for fields with non-uniform fluences considering heterogeneity correction; Avaliacao do Algoritmo Analitico Anisotropico (AAA) no calculo de dose para campos com fluencia nao uniforme considerando correcao de heterogeneidade

    Energy Technology Data Exchange (ETDEWEB)

    Bornatto, P.; Funchal, M.; Bruning, F.; Toledo, H.; Lyra, J.; Fernandes, T.; Toledo, F.; Marciao, C., E-mail: pricila_bornatto@yahoo.com.br [Hospital Erasto Gaertner (LPCC), Curitiba, PR (Brazil). Departamento de Radioterapia

    2014-08-15

    The purpose of this study is to evaluate the calculation of dose distribution AAA (Varian Medical Systems) for fields with non-uniform fluences considering heterogeneity correction. Five different phantoms were used with different density materials. These phantoms were scanned in the CT BrightSpeed (©GE Healthcare) upon the array of detectors MAPCHECK2 TM (Sun Nuclear Corporation) and irradiated in a linear accelerator 600 CD (Varian Medical Systems) 6MV and rate dose 400MU/min with isocentric setup. The fluences used were exported from IMRT plans, calculated by ECLIPSE™ planning system (Varian Medical Systems), and a 10x10 cm{sup 2} field to assess the heterogeneity correction for uniform fluence. The measured dose distribution was compared to the calculated by Gamma analysis with approval criteria of 3% / 3 mm and 10% threshold. The evaluation was performed using the software SNCPatient (Sun Nuclear Corporation) and considering absolute dose normalized at maximum. The phantoms best performers were those with low density materials, with an average of 99.2% approval. Already phantoms with plates of higher density material presented various fluences below 95% of the points approved. The average value reached 94.3%. It was observed a dependency between fluency and approved percentage points, whereas for the same fluency, 100% of the points have been approved in all phantoms. The approval criteria for IMRT plans recommended in most centers is 3% / 3mm with at least 95% of points approved, it can be concluded that, under these conditions, the IMRT plans with heterogeneity correction can be performed , however the quality control must be careful because the difficulty of the system to accurately predict the dose distribution in certain situations. (author)

  7. Verification of Rapid Arc™ planning with AAA algorithm using an inhomogeneous 3D phantom; Verificacao de planejamentos de RapidArc™ com algoritmo AAA usando um fantoma heterogeneo 3D

    Energy Technology Data Exchange (ETDEWEB)

    Trindade, Cassia; Silva, Leonardo P.; Souza, Roberto S.; Batista, Delano V.L.; Martins, Lais P.; Santos, Maira R.; Garcia, Paulo L., E-mail: cassiatr@gmail.com [Instituto Nacional do Cancer (INCa), Rio de Janeiro, RJ (Brazil)

    2013-12-15

    New technologies have been developed to improve the quality assurance of the planning with modulated beams. One way to deal with the high costs of the dosimetry equipment was to develop a 3D phantom, using TLDs and radiochromic film, designed by the Radiotherapy Quality Program of INCa. The calculus was done using the AAA algorithm with heterogeneity correction, making the phantom rather heterogeneous. Five measurements related to the Rapid Arc™ planning were taken, once there was the phantom CT for optimization. The purpose of this work is a 3D verification of the dose distribution in the heterogeneous phantom. The mean deviation in planning target volumes was lower than ±5%. On the other side, the results dispersion for the others heterogeneities was higher, the maximum mean deviation obtained, for example, for the heterogeneity related to the bladder, was 7.41%. The maximum standard deviation found for both cases was around 9% for the target heterogeneity and 11% for the other heterogeneities. The phantom might be an interesting tool in order to verify the Rapid Arc™ planning, however, more statistical data is necessary as to achieve better results for the analysis of dose distribution. (author)heterogeneous phantom. The mean deviation in planning target volumes was lower than ±5%. On the other side, the results dispersion for the others heterogeneities was higher, the maximum mean deviation obtained, for example, for the heterogeneity related to the bladder, was 7.41%. The maximum standard deviation found for both cases was around 9% for the target heterogeneity and 11% for the other heterogeneities. The phantom might be an interesting tool in order to verify the Rapid Arc™ planning, however, more statistical data is necessary as to achieve better results for the analysis of dose distribution. (author)

  8. The ATP Sites of AAA+ Clamp Loaders Work Together as a Switch to Assemble Clamps on DNA*

    Science.gov (United States)

    Marzahn, Melissa R.; Hayner, Jaclyn N.; Finkelstein, Jeff; O'Donnell, Mike; Bloom, Linda B.

    2014-01-01

    Clamp loaders belong to a family of proteins known as ATPases associated with various cellular activities (AAA+). These proteins utilize the energy from ATP binding and hydrolysis to perform cellular functions. The clamp loader is required to load the clamp onto DNA for use by DNA polymerases to increase processivity. ATP binding and hydrolysis are coordinated by several key residues, including a conserved Lys located within the Walker A motif (or P-loop). This residue is required for each subunit to bind ATP. The specific function of each ATP molecule bound to the Saccharomyces cerevisiae clamp loader is unknown. A series of point mutants, each lacking a single Walker A Lys residue, was generated to study the effects of abolishing ATP binding in individual clamp loader subunits. A variety of biochemical assays were used to analyze the function of ATP binding during discrete steps of the clamp loading reaction. All mutants reduced clamp binding/opening to different degrees. Decreased clamp binding activity was generally correlated with decreases in the population of open clamps, suggesting that differences in the binding affinities of Walker A mutants stem from differences in stabilization of proliferating cell nuclear antigen in an open conformation. Walker A mutations had a smaller effect on DNA binding than clamp binding/opening. Our data do not support a model in which each ATP site functions independently to regulate a different step in the clamp loading cycle to coordinate these steps. Instead, the ATP sites work in unison to promote conformational changes in the clamp loader that drive clamp loading. PMID:24436332

  9. The ATP sites of AAA+ clamp loaders work together as a switch to assemble clamps on DNA.

    Science.gov (United States)

    Marzahn, Melissa R; Hayner, Jaclyn N; Finkelstein, Jeff; O'Donnell, Mike; Bloom, Linda B

    2014-02-28

    Clamp loaders belong to a family of proteins known as ATPases associated with various cellular activities (AAA+). These proteins utilize the energy from ATP binding and hydrolysis to perform cellular functions. The clamp loader is required to load the clamp onto DNA for use by DNA polymerases to increase processivity. ATP binding and hydrolysis are coordinated by several key residues, including a conserved Lys located within the Walker A motif (or P-loop). This residue is required for each subunit to bind ATP. The specific function of each ATP molecule bound to the Saccharomyces cerevisiae clamp loader is unknown. A series of point mutants, each lacking a single Walker A Lys residue, was generated to study the effects of abolishing ATP binding in individual clamp loader subunits. A variety of biochemical assays were used to analyze the function of ATP binding during discrete steps of the clamp loading reaction. All mutants reduced clamp binding/opening to different degrees. Decreased clamp binding activity was generally correlated with decreases in the population of open clamps, suggesting that differences in the binding affinities of Walker A mutants stem from differences in stabilization of proliferating cell nuclear antigen in an open conformation. Walker A mutations had a smaller effect on DNA binding than clamp binding/opening. Our data do not support a model in which each ATP site functions independently to regulate a different step in the clamp loading cycle to coordinate these steps. Instead, the ATP sites work in unison to promote conformational changes in the clamp loader that drive clamp loading.

  10. LAA~AAA

    Indian Academy of Sciences (India)

    interactions between the ions in the formed crystal. The Born-. Lande equation involves calculation of the electrostatic energy of a 'reference ion' resulting from electrostatic interactions with an infinite number of ions surrounding it in the crystal lattice and the Madelung constant plays a vital role in incorporating this infinite ...

  11. New AAAS committee

    CERN Multimedia

    1971-01-01

    Dr Glen Seaborg, chairman of the US Atomic Energy Commission, has been made president elect of the American Association for the Advancement of science. He defeated two other candidates despite fears of some members that his connection with the AEC could lead to a conflict of interests (2 paragraphs).

  12. LAAnAAA

    Indian Academy of Sciences (India)

    04 Glial Cens: The Other Cells of the Nervous System. aCIIIICl. Introduction. 94. An Introduction to Glial Cells. V Rajaraman. Wireless Telegraphic. Communication. Guglielmo Marconi. 53 at Marconi point on Cape Cod, USA. Medha S Raiadhyaksha and Yasmin Khan. GENERAL ARTICLES. 11 Splitting of Comets.

  13. The Multivesicular Bodies (MVBs-Localized AAA ATPase LRD6-6 Inhibits Immunity and Cell Death Likely through Regulating MVBs-Mediated Vesicular Trafficking in Rice.

    Directory of Open Access Journals (Sweden)

    Xiaobo Zhu

    2016-09-01

    Full Text Available Previous studies have shown that multivesicular bodies (MVBs/endosomes-mediated vesicular trafficking may play key roles in plant immunity and cell death. However, the molecular regulation is poorly understood in rice. Here we report the identification and characterization of a MVBs-localized AAA ATPase LRD6-6 in rice. Disruption of LRD6-6 leads to enhanced immunity and cell death in rice. The ATPase activity and homo-dimerization of LRD6-6 is essential for its regulation on plant immunity and cell death. An ATPase inactive mutation (LRD6-6E315Q leads to dominant-negative inhibition in plants. The LRD6-6 protein co-localizes with the MVBs marker protein RabF1/ARA6 and interacts with ESCRT-III components OsSNF7 and OsVPS2. Further analysis reveals that LRD6-6 is required for MVBs-mediated vesicular trafficking and inhibits the biosynthesis of antimicrobial compounds. Collectively, our study shows that the AAA ATPase LRD6-6 inhibits plant immunity and cell death most likely through modulating MVBs-mediated vesicular trafficking in rice.

  14. Chronic contained rupture of abdominal aortic aneurysm (CCR-AAA) with massive vertebral bone erosion: computed tomography (CT), magnetic resonance imaging (MRI) and fluorine-18-fluorodeoxyglucose positron emission tomography (FDG-PET) findings.

    Science.gov (United States)

    Nakano, Sachiko; Okauchi, Kenzo; Tsushima, Yoshito

    2014-02-01

    A 62-year-old male presented with sudden onset of low back and right leg pain. Contrast-enhanced computed tomography demonstrated an abdominal aortic aneurysm (AAA), along with a large mass lesion causing vertebral body erosion. Magnetic resonance imaging (MRI) suggested that the mass lesion consisted of a chronic hematoma. Fluorine-18-fluorodeoxyglucose positron emission tomography (FDG-PET) demonstrated increased uptake around the mass lesion, but not around the AAA. Surgical intervention was performed, and the subsequent histological diagnosis was chronic contained rupture of AAA. The mass lesion consisted of chronic hematoma and necrosis with inflammatory cell infiltration and hemosiderin deposition. This condition mimics some neoplastic diseases, but MRI and FDG-PET findings may help establish the correct diagnosis.

  15. Caracterização do grânulo de amido de bananas (Musa AAA-Nanicão e Musa AAB-Terra Characterization of starch granules from bananas Musa AAA-Nanicão and Musa AAB-Terra

    Directory of Open Access Journals (Sweden)

    M.C.J. Freitas

    2005-06-01

    Full Text Available O amido de bananas tem sido pesquisado na área de nutrição a partir da introdução do conceito de Amido Resistente. O amido de Musa AAA-Nanicão e Musa AAB-Terra foram caracterizados quanto as suas respostas fisiológicas [12]. Em continuidade, o presente trabalho estudou características físicas e morfológicas dos grânulos de amido de ambas as espécies de banana comparando-as com amido nativo de milho comercial. O amido de bananas foi extraído segundo CHIANG, CHU & CHU [3]. A morfologia dos grânulos foi realizada após tratamento enzimático in vitro a 37°C/24h com alfa-amilase pancreática. Foram efetuados os respectivos amilogramas e difractogramas de raios-X. Os grânulos de amido da Musa Tipo AAA-Nanicão apresentaram comprimento entre 30-40µm. Em Musa AAB-Terra, os grânulos, também ovais e alongados, eram um pouco menores, 20-30µm. A corrosão enzimática in vitro iniciava-se sobre a superfície anteriormente lisa e formavam estrias superficiais e apicais. A Microscopia Eletrônica de Varredura (MEV mostrou que a hidrólise in vitro por 24 horas foi pequena e ocorria sobretudo nas camadas amorfas dos grânulos de ambas as espécies. O padrão de corrosão demonstrou-se distinto daquele ocorrido no amido de milho. As suspensões de amido de bananas ao viscosímetro demonstraram forte capacidade de hidratação e menor capacidade de retrogradação em relação ao milho, sobretudo do amido de Musa Tipo AAA-Nanicão; o amido de Musa Tipo AAB-Terra apresentou maior estabilidade de pasta. Na análise de difração de raios-X, os grânulos de bananas apresentaram padrão tipo B e C para Musa Tipo AAA-Nanicão e Musa Tipo AAB-Terra, respectivamente. Conclui-se que os amidos de Musa AAA-Nanicão e Musa AAB-Terra são estruturalmente distintos, justificando as respostas fisiológicas distintas encontradas posteriormente pelos mesmos autores. As distinções das propriedades físicas e bioquímicas obtidas para os grânulos, embora

  16. Comparison of doses and NTCP to risk organs with enhanced inspiration gating and free breathing for left-sided breast cancer radiotherapy using the AAA algorithm.

    Science.gov (United States)

    Edvardsson, Anneli; Nilsson, Martin P; Amptoulach, Sousana; Ceberg, Sofie

    2015-04-10

    The purpose of this study was to investigate the potential dose reduction to the heart, left anterior descending (LAD) coronary artery and the ipsilateral lung for patients treated with tangential and locoregional radiotherapy for left-sided breast cancer with enhanced inspiration gating (EIG) compared to free breathing (FB) using the AAA algorithm. The radiobiological implication of such dose sparing was also investigated. Thirty-two patients, who received tangential or locoregional adjuvant radiotherapy with EIG for left-sided breast cancer, were retrospectively enrolled in this study. Each patient was CT-scanned during FB and EIG. Similar treatment plans, with comparable target coverage, were created in the two CT-sets using the AAA algorithm. Further, the probability of radiation induced cardiac mortality and pneumonitis were calculated using NTCP models. For tangential treatment, the median V25Gy for the heart and LAD was decreased for EIG from 2.2% to 0.2% and 40.2% to 0.1% (p < 0.001), respectively, whereas there was no significant difference in V20Gy for the ipsilateral lung (p = 0.109). For locoregional treatment, the median V25Gy for the heart and LAD was decreased for EIG from 3.3% to 0.2% and 51.4% to 5.1% (p < 0.001), respectively, and the median ipsilateral lung V20Gy decreased from 27.0% for FB to 21.5% (p = 0.020) for EIG. The median excess cardiac mortality probability decreased from 0.49% for FB to 0.02% for EIG (p < 0.001) for tangential treatment and from 0.75% to 0.02% (p < 0.001) for locoregional treatment. There was no significant difference in risk of radiation pneumonitis for tangential treatment (p = 0.179) whereas it decreased for locoregional treatment from 6.82% for FB to 3.17% for EIG (p = 0.004). In this study the AAA algorithm was used for dose calculation to the heart, LAD and left lung when comparing the EIG and FB techniques for tangential and locoregional radiotherapy of breast cancer patients. The results support the dose and

  17. Geometrical determinations of IMRT photon pencil-beam path in radiotherapy wedges and limit divergence angle with the Anisotropic Analytic Algorithm (AAA

    Directory of Open Access Journals (Sweden)

    Francisco Casesnoves

    2014-08-01

    Full Text Available Purpose: Static wedge filters (WF are commonly used in radiation therapy, forward and/or inverse planning. We calculated the exact 2D/3D geometrical pathway of the photon-beam through the usual alloy WF, in order to get a better dose related to the beam intensity attenuation factor(s, after the beam has passed through the WF. The objective was to provide general formulation into the Anisotropic Analytical Algorithm (AAA model coordinates system (depending on collimator/wedge angles that also can be applied to other models. Additionally, second purpose of this study was to develop integral formulation for 3D wedge exponential factor with statistical approximations, with introduction for the limit angle/conformal wedge.Methods: The radiotherapy model used to develop this mathematical task is the classical superposition-convolution algorithm, AAA (developed by Ulmer and Harder. We worked with optimal geometrical approximations to make the computational IMRT calculations quicker/reduce the planning-system time. Analytic geometry/computational-techniques to carry out simulations (for standard wedges are detailed/developed sharply. Integral developments/integral-statistical approximations are explained. Beam-divergence limit Angle for optimal wedge filtration formulas is calculated/sketched, with geometrical approximations. Fundamental trigonometry is used for this purpose.Results: Extent simulation tables for WF of 15º, 30º, 45º, and 60º are shown with errors. As a result, it is possible to determine the best individual treatment dose distribution for each patient. We presented these basic simulations/numerical examples for standard manufacturing WF of straight sloping surface, to check the accuracy/errors of the calculations. Simulations results give low RMS/Relative Error values (formulated for WF of 15º, 30º, 45º, and 60º.Conclusion: We obtained a series of formulas of analytic geometry for WF that can be applied for any particular dose

  18. Synthesis of orthogonally protected (2S)-2-amino-adipic acid (α-AAA) and (2S,4R)-2-amino-4-hydroxyadipic acid (Ahad).

    Science.gov (United States)

    Yadav, Saroj; Taylor, Carol M

    2013-06-07

    (2S,4R)-2-amino-4-hydroxyadipic acid (Ahad) building block 45 was synthesized in 11 steps and 6.5% overall yield from commercially available materials. Key steps in stereocontrol were an asymmetric conjugate addition employing a proline-based catalyst and a syn-selective intramolecular-conjugate addition of an oxygen nucleophile to an α,β-unsaturated ester. To enable incorporation of α-amino-adipic acid (α-AAA) and Ahad into peptides, a truly orthogonal protecting group scheme was developed, encompassing an allyloxycarbonyl (Alloc) carbamate for Nα, a tert-butyl ester for the δ-COOH, an acetol ester for the α-COOH, and a tert-butyldimethylsilyl ether for the γ-hydroxy group of Ahad.

  19. Caracterização do grânulo de amido de bananas (Musa AAA-Nanicão e Musa AAB-Terra)

    OpenAIRE

    Freitas,M.C.J.; Tavares,D.de Q.

    2005-01-01

    O amido de bananas tem sido pesquisado na área de nutrição a partir da introdução do conceito de Amido Resistente. O amido de Musa AAA-Nanicão e Musa AAB-Terra foram caracterizados quanto as suas respostas fisiológicas [12]. Em continuidade, o presente trabalho estudou características físicas e morfológicas dos grânulos de amido de ambas as espécies de banana comparando-as com amido nativo de milho comercial. O amido de bananas foi extraído segundo CHIANG, CHU & CHU [3]. A morfologia dos ...

  20. TU-C-BRE-05: Clinical Implications of AAA Commissioning Errors and Ability of Common Commissioning ' Credentialing Procedures to Detect Them

    Energy Technology Data Exchange (ETDEWEB)

    McVicker, A; Oldham, M; Yin, F; Adamson, J [Duke University Medical Center, Durham, NC (United States)

    2014-06-15

    Purpose: To test the ability of the TG-119 commissioning process and RPC credentialing to detect errors in the commissioning process for a commercial Treatment Planning System (TPS). Methods: We introduced commissioning errors into the commissioning process for the Anisotropic Analytical Algorithm (AAA) within the Eclipse TPS. We included errors in Dosimetric Leaf Gap (DLG), electron contamination, flattening filter material, and beam profile measurement with an inappropriately large farmer chamber (simulated using sliding window smoothing of profiles). We then evaluated the clinical impact of these errors on clinical intensity modulated radiation therapy (IMRT) plans (head and neck, low and intermediate risk prostate, mesothelioma, and scalp) by looking at PTV D99, and mean and max OAR dose. Finally, for errors with substantial clinical impact we determined sensitivity of the RPC IMRT film analysis at the midpoint between PTV and OAR using a 4mm distance to agreement metric, and of a 7% TLD dose comparison. We also determined sensitivity of the 3 dose planes of the TG-119 C-shape IMRT phantom using gamma criteria of 3% 3mm. Results: The largest clinical impact came from large changes in the DLG with a change of 1mm resulting in up to a 5% change in the primary PTV D99. This resulted in a discrepancy in the RPC TLDs in the PTVs and OARs of 7.1% and 13.6% respectively, which would have resulted in detection. While use of incorrect flattening filter caused only subtle errors (<1%) in clinical plans, the effect was most pronounced for the RPC TLDs in the OARs (>6%). Conclusion: The AAA commissioning process within the Eclipse TPS is surprisingly robust to user error. When errors do occur, the RPC and TG-119 commissioning credentialing criteria are effective at detecting them; however OAR TLDs are the most sensitive despite the RPC currently excluding them from analysis.

  1. Whole-exome sequencing identifies homozygous AFG3L2 mutations in a spastic ataxia-neuropathy syndrome linked to mitochondrial m-AAA proteases.

    Directory of Open Access Journals (Sweden)

    Tyler Mark Pierson

    2011-10-01

    Full Text Available We report an early onset spastic ataxia-neuropathy syndrome in two brothers of a consanguineous family characterized clinically by lower extremity spasticity, peripheral neuropathy, ptosis, oculomotor apraxia, dystonia, cerebellar atrophy, and progressive myoclonic epilepsy. Whole-exome sequencing identified a homozygous missense mutation (c.1847G>A; p.Y616C in AFG3L2, encoding a subunit of an m-AAA protease. m-AAA proteases reside in the mitochondrial inner membrane and are responsible for removal of damaged or misfolded proteins and proteolytic activation of essential mitochondrial proteins. AFG3L2 forms either a homo-oligomeric isoenzyme or a hetero-oligomeric complex with paraplegin, a homologous protein mutated in hereditary spastic paraplegia type 7 (SPG7. Heterozygous loss-of-function mutations in AFG3L2 cause autosomal-dominant spinocerebellar ataxia type 28 (SCA28, a disorder whose phenotype is strikingly different from that of our patients. As defined in yeast complementation assays, the AFG3L2(Y616C gene product is a hypomorphic variant that exhibited oligomerization defects in yeast as well as in patient fibroblasts. Specifically, the formation of AFG3L2(Y616C complexes was impaired, both with itself and to a greater extent with paraplegin. This produced an early-onset clinical syndrome that combines the severe phenotypes of SPG7 and SCA28, in additional to other "mitochondrial" features such as oculomotor apraxia, extrapyramidal dysfunction, and myoclonic epilepsy. These findings expand the phenotype associated with AFG3L2 mutations and suggest that AFG3L2-related disease should be considered in the differential diagnosis of spastic ataxias.

  2. NVL2, a nucleolar AAA-ATPase, is associated with the nuclear exosome and is involved in pre-rRNA processing.

    Science.gov (United States)

    Yoshikatsu, Yuki; Ishida, Yo-ichi; Sudo, Haruka; Yuasa, Keizo; Tsuji, Akihiko; Nagahama, Masami

    2015-08-28

    Nuclear VCP-like 2 (NVL2) is a member of the chaperone-like AAA-ATPase family and is involved in the biosynthesis of 60S ribosomal subunits in mammalian cells. We previously showed the interaction of NVL2 with a DExD/H-box RNA helicase MTR4/DOB1, which is a known cofactor for an exoribonuclease complex, the exosome. This finding implicated NVL2 in RNA metabolic processes during ribosome biogenesis. In the present study, we found that a series of mutations within the ATPase domain of NVL2 causes a defect in pre-rRNA processing into mature 28S and 5.8S rRNAs. Co-immunoprecipitation analysis showed that NVL2 was associated with the nuclear exosome complex, which includes RRP6 as a nucleus-specific catalytic subunit. This interaction was prevented by depleting either MTR4 or RRP6, indicating their essential role in mediating this interaction with NVL2. Additionally, knockdown of MPP6, another cofactor for the nuclear exosome, also prevented the interaction by causing MTR4 to dissociate from the nuclear exosome. These results suggest that NVL2 is involved in pre-rRNA processing by associating with the nuclear exosome complex and that MPP6 is required for maintaining the integrity of this rRNA processing complex. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. A Fragment-Based Ligand Screen Against Part of a Large Protein Machine: The ND1 Domains of the AAA+ ATPase p97/VCP.

    Science.gov (United States)

    Chimenti, Michael S; Bulfer, Stacie L; Neitz, R Jeffrey; Renslo, Adam R; Jacobson, Matthew P; James, Thomas L; Arkin, Michelle R; Kelly, Mark J S

    2015-07-01

    The ubiquitous AAA+ ATPase p97 functions as a dynamic molecular machine driving several cellular processes. It is essential in regulating protein homeostasis, and it represents a potential drug target for cancer, particularly when there is a greater reliance on the endoplasmic reticulum-associated protein degradation pathway and ubiquitin-proteasome pathway to degrade an overabundance of secreted proteins. Here, we report a case study for using fragment-based ligand design approaches against this large and dynamic hexamer, which has multiple potential binding sites for small molecules. A screen of a fragment library was conducted by surface plasmon resonance (SPR) and followed up by nuclear magnetic resonance (NMR), two complementary biophysical techniques. Virtual screening was also carried out to examine possible binding sites for the experimental hits and evaluate the potential utility of fragment docking for this target. Out of this effort, 13 fragments were discovered that showed reversible binding with affinities between 140 µM and 1 mM, binding stoichiometries of 1:1 or 2:1, and good ligand efficiencies. Structural data for fragment-protein interactions were obtained with residue-specific [U-(2)H] (13)CH3-methyl-labeling NMR strategies, and these data were compared to poses from docking. The combination of virtual screening, SPR, and NMR enabled us to find and validate a number of interesting fragment hits and allowed us to gain an understanding of the structural nature of fragment binding. © 2015 Society for Laboratory Automation and Screening.

  4. Early evaluation and on field conditions of resistance to Mycosphaerella fijiensis Morelet of plants from Grande naine (AAA cultivar, obtained through out tissue culture and mutations induction

    Directory of Open Access Journals (Sweden)

    Lourdes R. García

    2003-04-01

    Full Text Available The present work was carried out in the Plants Biotechnology Institute of the Central University of Las Villas. The plant material from the cv. Grande Naine (AAA was treated with physical mutagenic agents(gamma radiation 60Co source to induce genetic variability. The behaviour of the population to the black Sigatoka was evaluated. A somaclone was selected by its disease resistance and was in vitro multiplied and the plants were acclimatized to evaluate its behaviour facing the disease on greenhouse conditions and in a second cycle of multiplication in the field. The results showed that in the majority of the plants were not found differences respect cv Grande Naine, just one presented similar reaction to cv. ‘FHIA 18’ (AAAB (partially resistant as for the variable evaluated, being obtained a frequency of 0.018% for this character. This plant was named IBP 446. After 60 days of application of the mycelial homogenized of M. fijiensis in micropropagated plants of this somaclone, differences in the respect affectation states were found at susceptible witness in greenhouse conditions. When plants of the IBP 446 were evaluated in a second cycle of multiplication differences were found with the susceptible control only at flowering, while they behaved similar at susceptible control in the crop. Key words: early detection, breeding, mutation, Black Sigatoka

  5. Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

    Directory of Open Access Journals (Sweden)

    Resnanti Utami Handayani

    2014-07-01

    Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

  6. Zinc and ATP binding of the hexameric AAA-ATPase PilF from Thermus thermophilus: role in complex stability, piliation, adhesion, twitching motility, and natural transformation.

    Science.gov (United States)

    Salzer, Ralf; Herzberg, Martin; Nies, Dietrich H; Joos, Friederike; Rathmann, Barbara; Thielmann, Yvonne; Averhoff, Beate

    2014-10-31

    The traffic AAA-ATPase PilF is essential for pilus biogenesis and natural transformation of Thermus thermophilus HB27. Recently, we showed that PilF forms hexameric complexes containing six zinc atoms coordinated by conserved tetracysteine motifs. Here we report that zinc binding is essential for complex stability. However, zinc binding is neither required for pilus biogenesis nor natural transformation. A number of the mutants did not exhibit any pili during growth at 64 °C but still were transformable. This leads to the conclusion that type 4 pili and the DNA translocator are distinct systems. At lower growth temperatures (55 °C) the zinc-depleted multiple cysteine mutants were hyperpiliated but defective in pilus-mediated twitching motility. This provides evidence that zinc binding is essential for the role of PilF in pilus dynamics. Moreover, we found that zinc binding is essential for complex stability but dispensable for ATPase activity. In contrast to many polymerization ATPases from mesophilic bacteria, ATP binding is not required for PilF complex formation; however, it significantly increases complex stability. These data suggest that zinc and ATP binding increase complex stability that is important for functionality of PilF under extreme environmental conditions. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. EFECTO DE LA MICORRIZACIÓN Y LA FERTILIZACIÓN EN LA ACUMULACIÓN DE BIOMASA EN PLANTAS DE BANANO (Musa AAA cv. Gran Enano (Musaceae MICORRHIZATION AND FERTILIZATION EFFECT ON BIOMASS ACCUMULATION IN BANANA PLANTS (Musa AAA cv. Gran Enano (Musaceae

    Directory of Open Access Journals (Sweden)

    Carmen Elena Usuga Osorio

    2008-06-01

    Full Text Available Bajo condiciones de invernadero (ubicado en el municipio de Bello - Antioquia (Colombia se evaluó el efecto independiente y combinado de los factores: tipo de inóculo de Hongos Micorriza Arbuscular (HMA, fertilización y aplicación de materia orgánica sobre el porcentaje de asociación de HMA en plantas de banano (Musa AAA cv. Gran Enano, así como en la acumulación de materia seca foliar y radical. Dentro del factor tipo de inóculo, se evaluaron inóculos nativos, de agroecosistemas bananeros y ecosistemas naturales del Urabá (Antioquia-Colombia, uno comercial y la especie Acaulospora morrowiae; con respecto a la fertilización se probó la mitad, completa y dos veces la dosis de la fertilización recomendada de acuerdo al análisis de suelo y a los requerimientos de la planta, y cada uno de estos factores con y sin la aplicación de materia orgánica; como testigos se usaron, la no aplicación del respectivo factor. Se usó como material vegetal plantas de banano micropropagadas del grupo Cavendish cv. Gran Enano (AAA. El sustrato utilizado para el crecimiento de las plantas de banano se compuso de suelo y arena en relación 70/30 v/v. El suelo se obtuvo de la granja experimental de Augura, ubicado en el municipio de Carepa en la región de Urabá. Los resultados encontrados, muestran que los factores que más incidieron en la asociación así como en la acumulación de biomasa en toda la planta son la micorrización y la adición de materia orgánica. Los resultados, también muestran un comportamiento positivo respecto al uso de inóculos nativos de agroecosistemas bananeros, con bajas aplicaciones de fertilizantes.The effects of independent an combined factors such as inoculum type, fertilization and organic matter application on the percentage of association of ‘H.M.A’ in banana plants (Musa AAA cv. ‘Gran Enano’, and on the accumulation of leaves and rrots material, were evaluated under greenhouse conditions. Natives samples

  8. NVL2, a nucleolar AAA-ATPase, is associated with the nuclear exosome and is involved in pre-rRNA processing

    Energy Technology Data Exchange (ETDEWEB)

    Yoshikatsu, Yuki [Department of Life Systems, Institute of Technology and Science, The University of Tokushima Graduate School, Tokushima 770-8506 (Japan); Ishida, Yo-ichi; Sudo, Haruka [Department of Molecular and Cellular Biochemistry, Meiji Pharmaceutical University, Kiyose, Tokyo 204-8588 (Japan); Yuasa, Keizo; Tsuji, Akihiko [Department of Life Systems, Institute of Technology and Science, The University of Tokushima Graduate School, Tokushima 770-8506 (Japan); Nagahama, Masami, E-mail: nagahama@my-pharm.ac.jp [Department of Molecular and Cellular Biochemistry, Meiji Pharmaceutical University, Kiyose, Tokyo 204-8588 (Japan)

    2015-08-28

    Nuclear VCP-like 2 (NVL2) is a member of the chaperone-like AAA-ATPase family and is involved in the biosynthesis of 60S ribosomal subunits in mammalian cells. We previously showed the interaction of NVL2 with a DExD/H-box RNA helicase MTR4/DOB1, which is a known cofactor for an exoribonuclease complex, the exosome. This finding implicated NVL2 in RNA metabolic processes during ribosome biogenesis. In the present study, we found that a series of mutations within the ATPase domain of NVL2 causes a defect in pre-rRNA processing into mature 28S and 5.8S rRNAs. Co-immunoprecipitation analysis showed that NVL2 was associated with the nuclear exosome complex, which includes RRP6 as a nucleus-specific catalytic subunit. This interaction was prevented by depleting either MTR4 or RRP6, indicating their essential role in mediating this interaction with NVL2. Additionally, knockdown of MPP6, another cofactor for the nuclear exosome, also prevented the interaction by causing MTR4 to dissociate from the nuclear exosome. These results suggest that NVL2 is involved in pre-rRNA processing by associating with the nuclear exosome complex and that MPP6 is required for maintaining the integrity of this rRNA processing complex. - Highlights: • ATPase-deficient mutants of NVL2 have decreased pre-rRNA processing. • NVL2 associates with the nuclear exosome through interactions with MTR4 and RRP6. • MPP6 stabilizes MTR4-RRP6 interaction and allows NVL2 to interact with the complex.

  9. Utilización del método de superficie de respuesta para formular una base de banano (Musa AAA para batidos

    Directory of Open Access Journals (Sweden)

    Marta Gamboa White

    2010-07-01

    Full Text Available El Método de Superficie de Respuesta se utiliza para optimizar o reformular productos. Se usa principalmente para economizar dinero y reducir el tiempo de pruebas, al disminuir el número de ensayos. Se presenta la aplicación del Método de Superficie de Respuesta para desarrollar una base a partir de bananos (Musa AAA var. Cavendish cv. Gran Enano de rechazo de exportación a manera de caso para estudiar su uso. Por medio de una encuesta se identificó que el dulzor, espumosidad y sabor fueron los atributos que los consumidores consideraron más importantes en un batido. Con base en estos atributos y con los ingredientes: pulpa de banano, goma guar y azúcar, se elaboraron y seleccionaron varias mezclas base, que fueron degustadas, en forma de batidos en leche, por un grupo de 90 consumidores. Por medio del diseño de superficie de respuesta se determinó que el batido con la mayor aceptación estuvo constituido por un 77,0 % de leche y un 23,0 % de mezcla base, compuesta esta última por 0,12 % de goma guar, 80,50 % de pulpa de banano y un 19,50 % de azúcar. Un Análisis de Componentes Principales permitió determinar que el contenido de sacarosa, que define el grado de dulzor, fue el atributo más importante para la aceptación del batido y se demostró que la combinación del Método de Superficie de Respuesta con el Análisis de Componentes Principales constituyó una herramienta útil en la formulación y optimización de productos, sobre todo para entender la interrelación de las variables.

  10. Identification and expression analysis of four 14-3-3 genes during fruit ripening in banana (Musa acuminata L. AAA group, cv. Brazilian).

    Science.gov (United States)

    Li, Mei-Ying; Xu, Bi-Yu; Liu, Ju-Hua; Yang, Xiao-Liang; Zhang, Jian-Bin; Jia, Cai-Hong; Ren, Li-Cheng; Jin, Zhi-Qiang

    2012-02-01

    To investigate the regulation of 14-3-3 proteins in banana (Musa acuminata L. AAA group, cv. Brazilian) fruit postharvest ripening, four cDNAs encoding 14-3-3 proteins were isolated from banana and designated as Ma-14-3-3a, Ma-14-3-3c, Ma-14-3-3e, and Ma-14-3-3i, respectively. Amino acid sequence alignment showed that the four 14-3-3 proteins shared a highly conserved core structure and variable C-terminal as well as N-terminal regions with 14-3-3 proteins from other plant species. Phylogenetic analysis revealed that the four 14-3-3 genes belong to the non-ε groups. They were differentially and specifically expressed in various tissues. Real-time RT-PCR analysis indicated that these four genes function differentially during banana fruit postharvest ripening. Three genes, Ma-14-3-3a, Ma-14-3-3c, and Ma-14-3-3e, were significantly induced by exogenous ethylene treatment. However, gene function differed in naturally ripened fruits. Ethylene could induce Ma-14-3-3c expression during postharvest ripening, but expression patterns of Ma-14-3-3a and Ma-14-3-3e suggest that these two genes appear to be involved in regulating ethylene biosynthesis during fruit ripening. No obvious relationship emerged between Ma-14-3-3i expression in naturally ripened and 1-MCP (1-methylcyclopropene)-treated fruit groups during fruit ripening. These results indicate that the 14-3-3 proteins might be involved in various regulatory processes of banana fruit ripening. Further studies will mainly focus on revealing the detailed biological mechanisms of these four 14-3-3 genes in regulating banana fruit postharvest ripening.

  11. Activation of salicylic acid metabolism and signal transduction can enhance resistance to Fusarium wilt in banana (Musa acuminata L. AAA group, cv. Cavendish).

    Science.gov (United States)

    Wang, Zhuo; Jia, Caihong; Li, Jingyang; Huang, Suzhen; Xu, Biyu; Jin, Zhiqiang

    2015-01-01

    Fusarium wilt caused by the fungus Fusarium oxysporum f. sp. cubens (Foc) is the most serious disease that attacks banana plants. Salicylic acid (SA) can play a key role in plant-microbe interactions. Our study is the first to examine the role of SA in conferring resistance to Foc TR4 in banana (Musa acuminata L. AAA group, cv. Cavendish), which is the greatest commercial importance cultivar in Musa. We used quantitative real-time reverse polymerase chain reaction (qRT-PCR) to analyze the expression profiles of 45 genes related to SA biosynthesis and downstream signaling pathways in a susceptible banana cultivar (cv. Cavendish) and a resistant banana cultivar (cv. Nongke No. 1) inoculated with Foc TR4. The expression of genes involved in SA biosynthesis and downstream signaling pathways was suppressed in a susceptible cultivar and activated in a resistant cultivar. The SA levels in each treatment arm were measured using high-performance liquid chromatography. SA levels were decreased in the susceptible cultivar and increased in the resistant cultivar. Finally, we examined the contribution of exogenous SA to Foc TR4 resistance in susceptible banana plants. The expression of genes involved in SA biosynthesis and signal transduction pathways as well as SA levels were significantly increased. The results suggest that one reason for banana susceptibility to Foc TR4 is that expression of genes involved in SA biosynthesis and SA levels are suppressed and that the induced resistance observed in banana against Foc TR4 might be a case of salicylic acid-dependent systemic acquired resistance.

  12. Utilización del método de superficie de respuesta para formular una base de banano (Musa AAA para batidos

    Directory of Open Access Journals (Sweden)

    Marta Gamboa White

    2010-06-01

    Full Text Available El Método de Superficie de Respuesta se utiliza para optimizar o reformular productos. Se usa principalmente para economizar dinero y reducir el tiempo de pruebas, al disminuir el número de ensayos. Se presenta la aplicación del Método de Superficie de Respuesta para desarrollar una base a partir de bananos (Musa AAA var. Cavendish cv. Gran Enano de rechazo de exportación a manera de caso para estudiar su uso. Por medio de una encuesta se identificó que el dulzor, espumosidad y sabor fueron los atributos que los consumidores consideraron más importantes en un batido. Con base en estos atributos y con los ingredientes: pulpa de banano, goma guar y azúcar, se elaboraron y seleccionaron varias mezclas base, que fueron degustadas, en forma de batidos en leche, por un grupo de 90 consumidores. Por medio del diseño de superficie de respuesta se determinó que el batido con la mayor aceptación estuvo constituido por un 77,0 % de leche y un 23,0 % de mezcla base, compuesta esta última por 0,12 % de goma guar, 80,50 % de pulpa de banano y un 19,50 % de azúcar. Un Análisis de Componentes Principales permitió determinar que el contenido de sacarosa, que define el grado de dulzor, fue el atributo más importante para la aceptación del batido y se demostró que la combinación del Método de Superficie de Respuesta con el Análisis de Componentes Principales constituyó una herramienta útil en la formulación y optimización de productos, sobre todo para entender la interrelación de las variables.

  13. EFEITO DO PERÍODO DE ARMAZENAMENTO SOBRE A BROTAÇÃO DE MUDAS DE BANANEIRA DO CULTIVAR NANICÃO (Musa acuminata AAA EFFECT OF STORAGE TIME IN THE BUDDING OF BANANA ROOTSTOCK CULTIVAR NANICÃO (Musa acuminata AAA

    Directory of Open Access Journals (Sweden)

    Ronaldo Veloso Naves

    2007-09-01

    Full Text Available

    A grande procura atual de mudas de bananeiras do cultivar Nanicão (Musa acuminata AAA em Goiás, principalmente na região do Mato Grosso Goiano, tem forçado o transporte de mudas a grandes distâncias. A maioria destas mudas são transportadas sob a forma de pedaços de rizoma com aproximadamente 1 Kg. Tem-se observado uma falha acima do previsto quando se utiliza este tipo de muda. O presente trabalho foi realizado para determinar o efeito do período de armazenamento sobre a brotação deste cultivar. Com base nos resultados concluiu-se que no período de armazenamento estudado (45 dias praticamente não houve diferença na brotação das mudas. Somente aquelas armazenadas por 5 (cinco semanas apresentaram inexplicavelmente um índice baixo de pegamento.

    Because of the tremendous current demand for Nanicão (Musa acuminata AAA banana shoots in the state of Goiás, notably in the “Mato Grosso Goiano” area, shoots have had to be imported from far away. The greater part of these shoots are transported in rootstalk form. Each rootstalk weighs approximately 1 Kg. A larger portion of these shoots than been anticipated, are defective. The present study was made to determine the effect of storage time on the budding of this particular banana rootstalk. The results of the experiment show that during the period of storage, forty-two (42 days, that was studied, there was almost no difference in budding among the rootstalks. Only those which were stored for five (5 weeks showed, unexplainably, a low budding index.

  14. AAA Foundation for Traffic Safety

    Science.gov (United States)

    ... or save the crowd? Scientists wonder how driverless cars will ‘choose’ -- The Washington Post Top distraction for teen drivers in crashes may surprise you - CBS News Vision Zero conference ...

  15. Efecto de la micorrización y la fertilización en la acumulación de biomasa en plantas de banano (musa aaa cv. gran enano)(musaceae).

    OpenAIRE

    Usuga Osorio, Carmen Elena; Castañeda Sánchez, Darío Antonio; Franco Molano, Ana Esperanza; Gómez Velásquez, Felipe Andrés; Lopera Agudelo, Carlos Adrián

    2011-01-01

    Bajo condiciones de invernadero (ubicado en el municipio de Bello – Antioquia (Colombia) se evaluó el efecto independiente y combinado de los factores: tipo de inóculo de Hongos Micorriza Arbuscular (HMA), fertilización y aplicación de materia orgánica sobre el porcentaje de asociación de HMA en plantas de banano (Musa AAA cv. Gran Enano), así como en la acumulación de materia seca foliar y radical. Dentro del factor tipo de inóculo, se evaluaron inóculos nativos, de agroecosistemas bananeros...

  16. Descripción morfoagronómica de materiales de plátano (Musa AAB, ABB y banano (Musa AAA cultivados en San Andrés Isla Morpho-agronomic Description of Plantain (Musa AAB, ABB and Banana (Musa AAA Materials Grown in San Andres Island

    Directory of Open Access Journals (Sweden)

    Oscar Javier Parra Pachón

    2009-10-01

    Full Text Available Durante el primer semestre de 2005 se estudiaron los cultivares de plátano y banano en fincas y parcelas de 15 agricultores típicos participantes en programas conjuntos de la Secretaría de Agricultura y Pesca de San Andrés Isla y de la Universidad Nacional de Colombia sede Caribe. A partir de descriptores de INIBAP, IPGRI y CIRAD y revisiones bibliográficas.se describen morfológicamente los materiales de Musa cultivados en la Isla, así como las prácticas de los productores isleños, Se identificaron cuatro clones del subgrupo plátano (Musa AAB: un Hartón (‘Horse’ y tres Dominico-Hartón (‘Tallo Negro’, ‘Tallo Blanco’ y ‘Cincuenta’ del subgrupo ABB se hallaron un material de Bluggoe (‘Boscó’ y un Felipita. El subgrupo banano AAA presentó dos materiales Gros Michel (denominados Común y Chino y uno de banano (Rojo. El plátano tiene gran importancia para los agricultores de la Isla, siendo el Boscó el clon más aceptado entre consumidores por su adaptación a las condiciones edafológicas y climáticas. El banano es menos cultivado; ya que los suelos, el clima y las enfermedades como sigatoka negra, condicionaron el desarrollo de clones. El trabajo sugiere prácticas de fácil implementación que podrían aumentar la producción en los sistemas de huerto mixto tropical que predominan en la Isla.During the first semester, 2005 we studied the plantain and banana cultivars in small farms of 15 volunteer regular producers, who were participating in joint programs of the Agriculture and Fisheries Secretariat of San Andres Island and the Colombian National University Caribbean Headquarters. We described morphologically the Musa cultivars identified in the island, as well as agricultural practices of the island producers, using the INIBAP, IPGRI and CIRAD (1996 descriptors and bibliographical reviews. We identified four clones within the plantain sub-group Musa AAB: a Horn type and three French-Horn; and within the ABB

  17. Efeito da interação entre carvão ativado e N6-benzilaminopurina na propagação in vitro de bananeira, cv. Grand Naine (AAA)

    OpenAIRE

    Costa,Frederico Henrique da Silva; Pereira,Jonny Everson Scherwinski; Pereira,Maria Aparecida Alves; Oliveira,Janiffe Peres de

    2006-01-01

    O carvão ativado possui a propriedade de adsorver os compostos fenólicos liberados pela oxidação dos tecidos lesionados durante o cultivo in vitro. O objetivo deste trabalho foi avaliar os efeitos da interação entre o carvão ativado e diferentes concentrações de N6-benzilaminopurina (BAP) na multiplicação in vitro da bananeira, cv. Grande Naine (AAA). O meio de cultura utilizado foi o MS, solidificado com 5 g.L-1 de ágar. O cultivo foi mantido em sala de crescimento a 25±2ºC, fotoperío...

  18. MULTIPLICACIÓN DE HONGOS MICORRIZA ARBUSCULAR (H.M.A Y EFECTO DE LA MICORRIZACIÓN EN PLANTAS MICROPROPAGADAS DE BANANO (Musa AAA cv. Gran Enano (Musaceae MULTIPLICATION OF ARBUSCULAR MYCORRHIZAE FUNGI (AMF AND MYCORRHIZATION EFFECT IN MICROPROPAGATED PLANTS OF BANANA (Musa AAA cv. ‘Gran Enano’ (Musaceae

    Directory of Open Access Journals (Sweden)

    Carmen Elena Usuga Osorio

    2008-06-01

    Full Text Available Se evaluó el proceso de multiplicación de hongos que forman micorriza arbuscular (HMA, para lo cual se usaron diferentes tipos de inóculos entre ellos nativos de agroecosistemas bananeros del Urabá (Antioquia-Colombia, en sustrato sólido, con diferentes plantas hospedadoras y la infectividad y efectividad sobre plantas de banano (Musa AAA cv. Gran Enano. La colonización micorrizal promedio general de los HMA a las plantas trampa fue de 37,76 ± 21,86 %, con respecto a este porcentaje, las plantas B (Brachiaria decumbens y S (Sorgum vulgare fueron las que más favorecieron la simbiosis. Teniendo en cuenta el sustrato, el S2 (Arena 50 - suelo 50 y el S6 (Vermiculita 50-suelo 50 permitieron expresiones significativamente mayores respecto a los demás. El Sorgum vulgare y Pueraria phaseoloides y en el sustrato S1 (Arena 30 - suelo 70, se encontró un mayor número de esporas. La combinación planta-sustrato que más favoreció la asociación fue la planta trampa B en los sustratos S2 y S4 (cascarilla de arroz 50-suelo50 y la producción de esporas fueron las plantas K y S en el sustrato S1. La asociación micorrícica general en plantas de banano provenientes de cultivo de tejidos fue de 48,74 ± 30,44. No se encontraron diferencias significativas (P > 0,05 entre plantas de cero días con plantas de 30 de aclimatadas. Los inóculos que significativamente favorecieron la asociación fueron los provenientes de agroecosistemas bananeros al compararse con el inóculo comercial y el proveniente de ecosistemas naturales del Urabá. El mayor peso seco foliar y radical se encontró en plántulas de banano inoculadas con I5 (Inóculo proveniente de agroecosistema bananeros de la zona de estudio. Para las variables de crecimiento no se encontraron diferencias.The process of multiplication of arbuscular mycorrhizae fungi (AMF from indigenous banana agro-environments from Urabá (Antioquia - Colombia was evaluated, using solid substrate, with different

  19. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  20. ORF Alignment: Ca19AnnotatedDec2004aaSeq [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available Ca19AnnotatedDec2004aaSeq orf19.2937; >1u02A 1 220 11 247 4e-27 ... gb|EAL02637.1| hy....10454 [Candida ... albicans SC5314] gb|AAA34356.1| phosphomannomutase ... [Candida albicans] ...sp|P31353|PMM_CANAL ... Phosphomannomutase (PMM) ... Length = 237 ...

  1. Descripción morfoagronómica de materiales de plátano (Musa AAB, ABB y banano (Musa AAA cultivados en San Andrés Isla

    Directory of Open Access Journals (Sweden)

    Oscar Javier Parra Pachón

    2009-10-01

    Full Text Available Durante el primer semestre de 2005 se estudiaron los cultivares de plátano y banano en fincas y parcelas de 15 agricultores típicos participantes en programas conjuntos de la Secretaría de Agricultura y Pesca de San Andrés Isla y de la Universidad Nacional de Colombia sede Caribe. A partir de descriptores de INIBAP, IPGRI y CIRAD y revisiones bibliográficas.se describen morfológicamente los materiales de Musa cultivados en la Isla, así como las prácticas de los productores isleños, Se identificaron cuatro clones del subgrupo plátano (Musa AAB: un Hartón (‘Horse’ y tres Dominico-Hartón (‘Tallo Negro’, ‘Tallo Blanco’ y ‘Cincuenta’ del subgrupo ABB se hallaron un material de Bluggoe (‘Boscó’ y un Felipita. El subgrupo banano AAA presentó dos materiales Gros Michel (denominados Común y Chino y uno de banano (Rojo. El plátano tiene gran importancia para los agricultores de la Isla, siendo el Boscó el clon más aceptado entre consumidores por su adaptación a las condiciones edafológicas y climáticas. El banano es menos cultivado; ya que los suelos, el clima y las enfermedades como sigatoka negra, condicionaron el desarrollo de clones. El trabajo sugiere prácticas de fácil implementación que podrían aumentar la producción en los sistemas de huerto mixto tropical que predominan en la Isla.

  2. Descripción morfoagronómica de materiales de plátano (Musa AAB, ABB y banano (Musa AAA cultivados en San Andrés Isla

    Directory of Open Access Journals (Sweden)

    Parra Pachón Oscar Javier

    2009-12-01

    Full Text Available Durante el primer semestre de 2005 se estudiaron los cultivares de plátano y banano en fincas y parcelas de 15 agricultores típicos participantes en programas conjuntos de la Secretaría de Agricultura y Pesca de San Andrés Isla y de la Universidad Nacional de Colombia sede Caribe. A partir de descriptores de INIBAP, IPGRI y CIRAD y revisiones bibliográficas.se describen morfológicamente los materiales de Musa cultivados en la Isla, así como las prácticas de los productores isleños, Se identificaron cuatro clones del subgrupo plátano (Musa AAB: un Hartón (‘Horse’ y tres Dominico-Hartón (‘Tallo Negro’, ‘Tallo Blanco’ y ‘Cincuenta’ del subgrupo ABB se hallaron un material de Bluggoe (‘Boscó’ y un Felipita. El subgrupo banano AAA presentó dos materiales Gros Michel (denominados Común y Chino y uno de banano (Rojo. El plátano tiene gran importancia para los agricultores de la Isla, siendo el Boscó el clon más aceptado entre consumidores por su adaptación a las condiciones edafológicas y climáticas. El banano es menos cultivado; ya que los suelos, el clima y las enfermedades como sigatoka negra, condicionaron el desarrollo de clones. El trabajo sugiere prácticas de fácil implementación que podrían aumentar la producción en los sistemas de huerto mixto tropical que predominan en la Isla.

  3. Calidad física y sensorial de Coffea arábica L. variedad Colombia, perfil Nespresso AAA, en la Unión Nariño

    Directory of Open Access Journals (Sweden)

    Lady Johanna Ramos V.

    2017-12-01

    Full Text Available En respuesta a la necesidad de generar alternativas que permitan asegurar la calidad y diferenciación del café de Nariño, se realizó esta investigación con el objetivo de evaluar la calidad física y sensorial del café variedad Colombia, fruto rojo, sembrado a plena exposición solar por caficultores del programa Nespresso AAA 2015, en diferentes altitudes y variaciones en el beneficio, en el Municipio de la Unión, Nariño. En cada finca se cosecharon diez kilos de café maduro con color rojo intenso, se procesaron con beneficio húmedo en la misma finca, se secaron con diferentes tiempos de exposición solar y se llevaron al laboratorio de Almacafé para evaluar sus características físicas y organolépticas como: aroma, fragancia, acidez, cuerpo, sabor, sabor residual, balance, taza limpia, dulzor y puntaje del catador. Igualmente se analizaron las relaciones de los factores climáticos y agronómicos de cada finca con la calidad de taza. Toda la información se analizó mediante análisis multivariado de componentes principales (ACP y análisis de correspondencias múltiples (ACM. Se concluyó que las condiciones de altitud, no están asociadas particularmente con los parámetros de calidad de la bebida del café; menores contenidos de fósforo en el suelo, menor tiempo de fermentación (16 - 17h y secado (20 - 25h de sol, se asociaron a mayores puntajes de calidad. La compleja interacción de todas las variables asociadas a la producción del café, es la que define al final, la calidad de taza.

  4. Spirit and Reason Reunite at the AAAS.

    Science.gov (United States)

    Simonelli, Richard

    2003-01-01

    A historic session on Native science at the 2003 conference of the American Association for the Advancement of Science included discussions about the Indigenous approach to science, the Tribal Environmental and Natural Resources Management program at Northwest Indian College, the need to connect the spiritual element in Indigenous knowledge with…

  5. NCBI nr-aa BLAST: CBRC-MMUS-04-0013 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-04-0013 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  6. NCBI nr-aa BLAST: CBRC-PTRO-07-0067 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-07-0067 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  7. NCBI nr-aa BLAST: CBRC-RMAC-04-0050 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-04-0050 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  8. NCBI nr-aa BLAST: CBRC-CFAM-12-0016 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-12-0016 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  9. NCBI nr-aa BLAST: CBRC-ACAR-01-0845 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0845 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  10. NCBI nr-aa BLAST: CBRC-FRUB-02-0074 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0074 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  11. NCBI nr-aa BLAST: CBRC-TBEL-01-1883 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-1883 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  12. NCBI nr-aa BLAST: CBRC-LAFR-01-1734 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-LAFR-01-1734 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  13. NCBI nr-aa BLAST: CBRC-TNIG-10-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-10-0006 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  14. NCBI nr-aa BLAST: CBRC-OCUN-01-1522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OCUN-01-1522 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  15. NCBI nr-aa BLAST: CBRC-FCAT-01-1020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-1020 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  16. NCBI nr-aa BLAST: CBRC-GACU-18-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-18-0022 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  17. NCBI nr-aa BLAST: CBRC-CJAC-01-1332 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CJAC-01-1332 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  18. NCBI nr-aa BLAST: CBRC-TNIG-14-0023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-14-0023 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) gb|AAD34624.1|AF153345_1 CB1 cann...abinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannabinoid receptor gb|AAA91176.1| neuronal cann...abinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal can...nabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  19. NCBI nr-aa BLAST: CBRC-PCAP-01-1368 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-1368 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor gb|AAD34624.1|AF153345_1 CB1 cannabinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannab...inoid receptor [Mus musculus] gb|AAA91176.1| neuronal cannabinoid receptor [Mus m...usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto

  20. NCBI nr-aa BLAST: CBRC-PHAM-01-1594 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-1594 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor gb|AAD34624.1|AF153345_1 CB1 cannabinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannab...inoid receptor [Mus musculus] gb|AAA91176.1| neuronal cannabinoid receptor [Mus m...usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto

  1. NCBI nr-aa BLAST: CBRC-MLUC-01-1112 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-1112 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor gb|AAD34624.1|AF153345_1 CB1 cannabinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannab...inoid receptor [Mus musculus] gb|AAA91176.1| neuronal cannabinoid receptor [Mus m...usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto

  2. NCBI nr-aa BLAST: CBRC-OPRI-01-0982 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-0982 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor gb|AAD34624.1|AF153345_1 CB1 cannabinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannab...inoid receptor [Mus musculus] gb|AAA91176.1| neuronal cannabinoid receptor [Mus m...usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto

  3. NCBI nr-aa BLAST: CBRC-VPAC-01-1554 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1554 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor gb|AAD34624.1|AF153345_1 CB1 cannabinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannab...inoid receptor [Mus musculus] gb|AAA91176.1| neuronal cannabinoid receptor [Mus m...usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto

  4. NCBI nr-aa BLAST: CBRC-MMUR-01-1494 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1494 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor gb|AAD34624.1|AF153345_1 CB1 cannabinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannab...inoid receptor [Mus musculus] gb|AAA91176.1| neuronal cannabinoid receptor [Mus m...usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto

  5. NCBI nr-aa BLAST: CBRC-TTRU-01-0117 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-0117 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor gb|AAD34624.1|AF153345_1 CB1 cannabinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannab...inoid receptor [Mus musculus] gb|AAA91176.1| neuronal cannabinoid receptor [Mus m...usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto

  6. NCBI nr-aa BLAST: CBRC-GGOR-01-1297 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGOR-01-1297 ref|NP_031752.1| cannabinoid receptor 1 (brain) [Mus musculus] sp...|P47746|CNR1_MOUSE RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor gb|AAD34624.1|AF153345_1 CB1 cannabinoid receptor [Mus musculus] gb|AAA64413.1| CB1 cannab...inoid receptor [Mus musculus] gb|AAA91176.1| neuronal cannabinoid receptor [Mus m...usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto

  7. NCBI nr-aa BLAST: CBRC-TSYR-01-0231 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TSYR-01-0231 ref|NP_000814.2| growth hormone releasing hormone receptor isofor...m a precursor [Homo sapiens] sp|Q02643|GHRHR_HUMAN RecName: Full=Growth hormone-releasing hormone receptor; ...Short=GHRH receptor; AltName: Full=GRF receptor; Short=GRFR; Flags: Precursor gb|AAA58619.1| growth hormone-...releasing gormone receptor [Homo sapiens] gb|AAC23789.1| growth hormone-releasing hormone... receptor [Homo sapiens] dbj|BAC05924.1| seven transmembrane helix receptor [Homo sapiens] gb|AAS59864.1| growth hormone

  8. NCBI nr-aa BLAST: CBRC-PCAP-01-0323 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-0323 ref|NP_000814.2| growth hormone releasing hormone receptor isofor...m a precursor [Homo sapiens] sp|Q02643|GHRHR_HUMAN RecName: Full=Growth hormone-releasing hormone receptor; ...Short=GHRH receptor; AltName: Full=GRF receptor; Short=GRFR; Flags: Precursor gb|AAA58619.1| growth hormone-...releasing gormone receptor [Homo sapiens] gb|AAC23789.1| growth hormone-releasing hormone... receptor [Homo sapiens] dbj|BAC05924.1| seven transmembrane helix receptor [Homo sapiens] gb|AAS59864.1| growth hormone

  9. NCBI nr-aa BLAST: CBRC-GGOR-01-0759 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGOR-01-0759 ref|NP_000814.2| growth hormone releasing hormone receptor isofor...m a precursor [Homo sapiens] sp|Q02643|GHRHR_HUMAN RecName: Full=Growth hormone-releasing hormone receptor; ...Short=GHRH receptor; AltName: Full=GRF receptor; Short=GRFR; Flags: Precursor gb|AAA58619.1| growth hormone-...releasing gormone receptor [Homo sapiens] gb|AAC23789.1| growth hormone-releasing hormone... receptor [Homo sapiens] dbj|BAC05924.1| seven transmembrane helix receptor [Homo sapiens] gb|AAS59864.1| growth hormone

  10. NCBI nr-aa BLAST: CBRC-PVAM-01-1440 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-1440 ref|NP_000814.2| growth hormone releasing hormone receptor isofor...m a precursor [Homo sapiens] sp|Q02643|GHRHR_HUMAN RecName: Full=Growth hormone-releasing hormone receptor; ...Short=GHRH receptor; AltName: Full=GRF receptor; Short=GRFR; Flags: Precursor gb|AAA58619.1| growth hormone-...releasing gormone receptor [Homo sapiens] gb|AAC23789.1| growth hormone-releasing hormone... receptor [Homo sapiens] dbj|BAC05924.1| seven transmembrane helix receptor [Homo sapiens] gb|AAS59864.1| growth hormone

  11. NCBI nr-aa BLAST: CBRC-ACAR-01-0732 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0732 sp|P21109|CXCR1_RABIT High affinity interleukin-8 receptor A (IL-...8R A) (CXCR-1) (CD181 antigen) gb|AAA31375.1| interleukin 8 receptor gb|AAA31376.1| interleukin 8 receptor P21109 1e-113 64% ...

  12. NCBI nr-aa BLAST: CBRC-TBEL-01-0817 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-0817 sp|P21109|CXCR1_RABIT High affinity interleukin-8 receptor A (IL-...8R A) (CXCR-1) (CD181 antigen) gb|AAA31375.1| interleukin 8 receptor gb|AAA31376.1| interleukin 8 receptor P21109 1e-134 68% ...

  13. NCBI nr-aa BLAST: CBRC-EEUR-01-0272 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-EEUR-01-0272 sp|P21109|CXCR1_RABIT High affinity interleukin-8 receptor A (IL-...8R A) (CXCR-1) (CD181 antigen) gb|AAA31375.1| interleukin 8 receptor gb|AAA31376.1| interleukin 8 receptor P21109 1e-141 72% ...

  14. NCBI nr-aa BLAST: CBRC-CPOR-01-0033 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CPOR-01-0033 sp|P21109|CXCR1_RABIT High affinity interleukin-8 receptor A (IL-...8R A) (CXCR-1) (CD181 antigen) gb|AAA31375.1| interleukin 8 receptor gb|AAA31376.1| interleukin 8 receptor P21109 9e-64 80% ...

  15. NCBI nr-aa BLAST: CBRC-OANA-01-0052 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-0052 sp|P21109|CXCR1_RABIT High affinity interleukin-8 receptor A (IL-...8R A) (CXCR-1) (CD181 antigen) gb|AAA31375.1| interleukin 8 receptor gb|AAA31376.1| interleukin 8 receptor P21109 1e-114 63% ...

  16. NCBI nr-aa BLAST: CBRC-OCUN-01-0050 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OCUN-01-0050 sp|P21109|CXCR1_RABIT High affinity interleukin-8 receptor A (IL-...8R A) (CXCR-1) (CD181 antigen) gb|AAA31375.1| interleukin 8 receptor gb|AAA31376.1| interleukin 8 receptor P21109 1e-164 81% ...

  17. NCBI nr-aa BLAST: CBRC-CFAM-37-0005 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-37-0005 sp|P21109|CXCR1_RABIT High affinity interleukin-8 receptor A (IL-...8R A) (CXCR-1) (CD181 antigen) gb|AAA31375.1| interleukin 8 receptor gb|AAA31376.1| interleukin 8 receptor P21109 1e-152 76% ...

  18. NCBI nr-aa BLAST: CBRC-OANA-01-1436 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-1436 sp|P21109|CXCR1_RABIT High affinity interleukin-8 receptor A (IL-...8R A) (CXCR-1) (CD181 antigen) gb|AAA31375.1| interleukin 8 receptor gb|AAA31376.1| interleukin 8 receptor P21109 1e-115 59% ...

  19. NCBI nr-aa BLAST: CBRC-RNOR-09-0076 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-09-0076 sp|P21109|CXCR1_RABIT High affinity interleukin-8 receptor A (IL-...8R A) (CXCR-1) (CD181 antigen) gb|AAA31375.1| interleukin 8 receptor gb|AAA31376.1| interleukin 8 receptor P21109 1e-127 69% ...

  20. NCBI nr-aa BLAST: CBRC-MMUS-01-0026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-01-0026 sp|P21109|CXCR1_RABIT High affinity interleukin-8 receptor A (IL-...8R A) (CXCR-1) (CD181 antigen) gb|AAA31375.1| interleukin 8 receptor gb|AAA31376.1| interleukin 8 receptor P21109 1e-127 70% ...

  1. NCBI nr-aa BLAST: CBRC-BTAU-01-2915 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-2915 sp|P21109|CXCR1_RABIT High affinity interleukin-8 receptor A (IL-...8R A) (CXCR-1) (CD181 antigen) gb|AAA31375.1| interleukin 8 receptor gb|AAA31376.1| interleukin 8 receptor P21109 1e-137 72% ...

  2. Noninvasive evaluation of the effectiveness of endovascular AAA exclusion.

    NARCIS (Netherlands)

    Laan, M.J. van der; Teutelink, A.; Wixon, C.L.; Blankensteijn, J.D.

    2003-01-01

    PURPOSE: To evaluate the relationship between aneurysm sac pressure and endograft wall motion in vitro and in vivo and to compare this to sac volume changes after endovascular aneurysm repair. METHODS: In a flow model of an aneurysm with a stent-graft in situ, sac pressure was incrementally

  3. Dimensions of Usability: Cougaar, Aglets and Adaptive Agent Architecture (AAA)

    Energy Technology Data Exchange (ETDEWEB)

    Haack, Jereme N.; Cowell, Andrew J.; Gorton, Ian

    2004-06-20

    Research and development organizations are constantly evaluating new technologies in order to implement the next generation of advanced applications. At Pacific Northwest National Laboratory, agent technologies are perceived as an approach that can provide a competitive advantage in the construction of highly sophisticated software systems in a range of application areas. An important factor in selecting a successful agent architecture is the level of support it provides the developer in respect to developer support, examples of use, integration into current workflow and community support. Without such assistance, the developer must invest more effort into learning instead of applying the technology. Like many other applied research organizations, our staff are not dedicated to a single project and must acquire new skills as required, underlining the importance of being able to quickly become proficient. A project was instigated to evaluate three candidate agent toolkits across the dimensions of support they provide. This paper reports on the outcomes of this evaluation and provides insights into the agent technologies evaluated.

  4. Achieving the AAAs of Ambulatory Care: Aptitude, Appeal, and Appreciation

    Science.gov (United States)

    Rybolt, Ann H.; Staton, Lisa J.; Panda, Mukta; Jones, Roger C.

    2009-01-01

    Background In the current health care environment more patient care has moved from in-hospital care to the ambulatory primary care settings; however, fewer internal medicine residents are pursuing primary care careers. Barriers to residents developing a sense of competency and enjoyment in ambulatory medicine include the complexity of practice-based systems, patients with multiple chronic diseases, and the limited time that residents spend in the outpatient setting. Objective In an effort to accelerate residents' ambulatory care competence and enhance their satisfaction with ambulatory practice, we sought to change the learning environment. Interns were provided a series of intensive, focused, ambulatory training sessions prior to beginning their own continuity clinic sessions. The sessions were designed to enable them to work confidently and effectively in their continuity clinic from the beginning of the internship year, and it was hoped this would have a positive impact on their perception of the desirability of ambulatory practice. Methods Improvement needs assessment after a performance, so we developed a structured, competency-based, multidisciplinary curriculum for initiation into ambulatory practice. The curriculum focused on systems-based practice, patient safety, quality improvement, and collaborative work while emphasizing the importance of continuity of care and long-term doctor-patient relationships. Direct observation of patient encounters was done by an attending physician to evaluate communication and physical examination skills. Systems of care commonly used in the clinic were demonstrated. Resources for practice-based learning were used. Conclusion The immersion of interns in an intensive, hands-on experience using a structured ambulatory care orientation curriculum early in training may prepare the intern to be a successful provider and learner in the primary care ambulatory setting. PMID:21975724

  5. The 40th AAAS Gordon Conference on nuclear chemistry

    International Nuclear Information System (INIS)

    Seaborg, G.T.

    1991-01-01

    I am pleased to speak at the Fortieth Gordon Conference on Nuclear Chemistry. I served as Chairman of the first Gordon Conference on Nuclear Chemistry held June 23--27, 1952, at New Hampton, New Hampshire. In my remarks, during which I shall quote from my journal, I shall describe some of the background leading up to the first Gordon Conference on Nuclear Chemistry and my attendance at the first seven Gordon Conferences during the period 1952 through 1958. I shall also quote my description of my appearance as the featured speaker at the Silver Anniversary of the Gordon Research Conferences on December 27, 1956 held at the Commodore Hotel in New York City. I shall begin with reference to my participation in the predecessor to the Gordon Conferences, the Gibson Island Research Conferences 45 years ago, on Thursday, June 20, 1946, as a speaker. This was 15 years after the start of these conferences in 1931. Neil Gordon played a leading role in these conferences, which were named (in 1948) in his honor -- the Gordon Research Conferences -- soon after they were moved to Colby Junior College, New London, New Hampshire in 1947. W. George Parks became Director in 1947, Alexander Cruickshank became Assistant Director in 1947 and Director in 1968

  6. Nuclear Forensics: Report of the AAAS/APS Working Group

    Science.gov (United States)

    Tannenbaum, Benn

    2008-04-01

    This report was produced by a Working Group of the American Physical Society's Program on Public Affairs in conjunction with the American Association for the Advancement of Science Center for Science, Technology and Security Policy. The primary purpose of this report is to provide the Congress, U.S. government agencies and other institutions involved in nuclear forensics with a clear unclassified statement of the state of the art of nuclear forensics; an assessment of its potential for preventing and identifying unattributed nuclear attacks; and identification of the policies, resources and human talent to fulfill that potential. In the course of its work, the Working Group observed that nuclear forensics was an essential part of the overall nuclear attribution process, which aims at identifying the origin of unidentified nuclear weapon material and, in the event, an unidentified nuclear explosion. A credible nuclear attribution capability and in particular nuclear forensics capability could deter essential participants in the chain of actors needed to smuggle nuclear weapon material or carry out a nuclear terrorist act and could also encourage states to better secure such materials and weapons. The Working Group also noted that nuclear forensics result would take some time to obtain and that neither internal coordination, nor international arrangements, nor the state of qualified personnel and needed equipment were currently enough to minimize the time needed to reach reliable results in an emergency such as would be caused by a nuclear detonation or the intercept of a weapon-size quantity of material. The Working Group assesses international cooperation to be crucial for forensics to work, since the material would likely come from inadequately documented foreign sources. In addition, international participation, if properly managed, could enhance the credibility of the deterrent effect of attribution. Finally the Working Group notes that the U.S. forensics capability involved a number of agencies and other groups that would have to cooperate rapidly in an emergency and that suitable exercises to ensure such cooperation were needed.

  7. The 40th AAAS Gordon Conference on nuclear chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Seaborg, G.T.

    1991-06-27

    I am pleased to speak at the Fortieth Gordon Conference on Nuclear Chemistry. I served as Chairman of the first Gordon Conference on Nuclear Chemistry held June 23--27, 1952, at New Hampton, New Hampshire. In my remarks, during which I shall quote from my journal, I shall describe some of the background leading up to the first Gordon Conference on Nuclear Chemistry and my attendance at the first seven Gordon Conferences during the period 1952 through 1958. I shall also quote my description of my appearance as the featured speaker at the Silver Anniversary of the Gordon Research Conferences on December 27, 1956 held at the Commodore Hotel in New York City. I shall begin with reference to my participation in the predecessor to the Gordon Conferences, the Gibson Island Research Conferences 45 years ago, on Thursday, June 20, 1946, as a speaker. This was 15 years after the start of these conferences in 1931. Neil Gordon played a leading role in these conferences, which were named (in 1948) in his honor -- the Gordon Research Conferences -- soon after they were moved to Colby Junior College, New London, New Hampshire in 1947. W. George Parks became Director in 1947, Alexander Cruickshank became Assistant Director in 1947 and Director in 1968.

  8. NCBI nr-aa BLAST: CBRC-OGAR-01-0927 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OGAR-01-0927 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  9. NCBI nr-aa BLAST: CBRC-FCAT-01-0104 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-0104 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  10. NCBI nr-aa BLAST: CBRC-RNOR-08-0291 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-08-0291 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  11. NCBI nr-aa BLAST: CBRC-ACAR-01-0724 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0724 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  12. NCBI nr-aa BLAST: CBRC-GACU-18-0028 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-18-0028 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  13. NCBI nr-aa BLAST: CBRC-TNIG-14-0037 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-14-0037 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  14. NCBI nr-aa BLAST: CBRC-HSAP-06-0071 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-06-0071 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  15. NCBI nr-aa BLAST: CBRC-OCUN-01-1054 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OCUN-01-1054 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  16. NCBI nr-aa BLAST: CBRC-PTRO-07-0063 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-07-0063 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  17. NCBI nr-aa BLAST: CBRC-TGUT-05-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-05-0034 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  18. NCBI nr-aa BLAST: CBRC-GGAL-03-0036 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-03-0036 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  19. NCBI nr-aa BLAST: CBRC-XTRO-01-3060 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-3060 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  20. NCBI nr-aa BLAST: CBRC-GACU-15-0003 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-15-0003 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  1. NCBI nr-aa BLAST: CBRC-CBRE-01-0003 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CBRE-01-0003 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  2. NCBI nr-aa BLAST: CBRC-RMAC-04-0048 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-04-0048 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  3. NCBI nr-aa BLAST: CBRC-DNOV-01-2922 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DNOV-01-2922 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

  4. NCBI nr-aa BLAST: CBRC-MMUS-18-0028 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ong interspersed element-1) (L1) [Includes: Reverse transcriptase ; Endonuclease] gb|AAA66024.1| 2855 is the position of the first start codon in ORF 2; putative P11369 2e-49 84% ...

  5. NCBI nr-aa BLAST: CBRC-MMUS-08-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ong interspersed element-1) (L1) [Includes: Reverse transcriptase ; Endonuclease] gb|AAA66024.1| 2855 is the position of the first start codon in ORF 2; putative P11369 0.0 82% ...

  6. On a question of A. Balog

    OpenAIRE

    Shkredov, Ilya D.

    2015-01-01

    We give a partial answer to a conjecture of A. Balog, concerning the size of AA+A, where A is a finite subset of real numbers. Also, we prove several new results on the cardinality of A:A+A, AA+AA and A:A + A:A.

  7. NCBI nr-aa BLAST: CBRC-PCAP-01-0328 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-0328 ref|NP_742088.1| glucagon receptor isoform 2 [Rattus norvegicus] ref|NP_742089.1| glucag...ceptor; Short=GL-R; Flags: Precursor gb|AAA02992.1| glucagon receptor [Rattus norvegicus] gb|AAA16439.1| glucag...on receptor [Rattus norvegicus] emb|CAA48651.1| glucagon hepatic receptor rela...ted to the receptor for the glucagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucagon rece...ptor [synthetic construct] gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon rece

  8. NCBI nr-aa BLAST: CBRC-HSAP-26-0013 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-26-0013 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  9. NCBI nr-aa BLAST: CBRC-CINT-01-0113 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CINT-01-0113 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  10. NCBI nr-aa BLAST: CBRC-BTAU-01-2375 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-2375 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  11. NCBI nr-aa BLAST: CBRC-PHAM-01-1151 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-1151 ref|NP_742088.1| glucagon receptor isoform 2 [Rattus norvegicus] ref|NP_742089.1| glucag...ceptor; Short=GL-R; Flags: Precursor gb|AAA02992.1| glucagon receptor [Rattus norvegicus] gb|AAA16439.1| glucag...on receptor [Rattus norvegicus] emb|CAA48651.1| glucagon hepatic receptor rela...ted to the receptor for the glucagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucagon rece...ptor [synthetic construct] gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon rece

  12. NCBI nr-aa BLAST: CBRC-CJAC-01-1596 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CJAC-01-1596 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  13. NCBI nr-aa BLAST: CBRC-GGAL-18-0009 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-18-0009 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  14. NCBI nr-aa BLAST: CBRC-TGUT-21-0005 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-21-0005 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  15. NCBI nr-aa BLAST: CBRC-GGOR-01-0630 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGOR-01-0630 ref|NP_742088.1| glucagon receptor isoform 2 [Rattus norvegicus] ref|NP_742089.1| glucag...ceptor; Short=GL-R; Flags: Precursor gb|AAA02992.1| glucagon receptor [Rattus norvegicus] gb|AAA16439.1| glucag...on receptor [Rattus norvegicus] emb|CAA48651.1| glucagon hepatic receptor rela...ted to the receptor for the glucagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucagon rece...ptor [synthetic construct] gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon rece

  16. NCBI nr-aa BLAST: CBRC-DRER-15-0091 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-15-0091 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  17. NCBI nr-aa BLAST: CBRC-ACAR-01-1133 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-1133 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  18. NCBI nr-aa BLAST: CBRC-GACU-05-0037 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-05-0037 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  19. NCBI nr-aa BLAST: CBRC-TNIG-02-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-02-0006 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  20. NCBI nr-aa BLAST: CBRC-PVAM-01-0495 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-0495 ref|NP_742088.1| glucagon receptor isoform 2 [Rattus norvegicus] ref|NP_742089.1| glucag...ceptor; Short=GL-R; Flags: Precursor gb|AAA02992.1| glucagon receptor [Rattus norvegicus] gb|AAA16439.1| glucag...on receptor [Rattus norvegicus] emb|CAA48651.1| glucagon hepatic receptor rela...ted to the receptor for the glucagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucagon rece...ptor [synthetic construct] gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon rece

  1. NCBI nr-aa BLAST: CBRC-FRUB-02-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0022 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  2. NCBI nr-aa BLAST: CBRC-XTRO-01-3227 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-3227 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  3. NCBI nr-aa BLAST: CBRC-TGUT-17-0002 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-17-0002 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  4. NCBI nr-aa BLAST: CBRC-RMAC-16-0040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-16-0040 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  5. NCBI nr-aa BLAST: CBRC-XTRO-01-3481 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-3481 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  6. NCBI nr-aa BLAST: CBRC-ACAR-01-0228 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0228 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  7. NCBI nr-aa BLAST: CBRC-ETEL-01-0178 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ETEL-01-0178 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  8. NCBI nr-aa BLAST: CBRC-FRUB-02-0410 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0410 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  9. NCBI nr-aa BLAST: CBRC-MMUS-11-0145 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-11-0145 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  10. NCBI nr-aa BLAST: CBRC-OLAT-19-0005 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-19-0005 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  11. NCBI nr-aa BLAST: CBRC-OANA-01-0157 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-0157 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  12. NCBI nr-aa BLAST: CBRC-GACU-11-0015 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-11-0015 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  13. NCBI nr-aa BLAST: CBRC-PABE-18-0044 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PABE-18-0044 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  14. NCBI nr-aa BLAST: CBRC-CINT-01-0112 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CINT-01-0112 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  15. NCBI nr-aa BLAST: CBRC-RNOR-10-0254 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-10-0254 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  16. NCBI nr-aa BLAST: CBRC-MDOM-02-0174 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-02-0174 ref|NP_742088.1| glucagon receptor isoform 2 [Rattus norvegicus] ref|NP_742089.1| glucag...ceptor; Short=GL-R; Flags: Precursor gb|AAA02992.1| glucagon receptor [Rattus norvegicus] gb|AAA16439.1| glucag...on receptor [Rattus norvegicus] emb|CAA48651.1| glucagon hepatic receptor rela...ted to the receptor for the glucagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucagon rece...ptor [synthetic construct] gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon rece

  17. NCBI nr-aa BLAST: CBRC-MEUG-01-2032 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-2032 ref|NP_742088.1| glucagon receptor isoform 2 [Rattus norvegicus] ref|NP_742089.1| glucag...ceptor; Short=GL-R; Flags: Precursor gb|AAA02992.1| glucagon receptor [Rattus norvegicus] gb|AAA16439.1| glucag...on receptor [Rattus norvegicus] emb|CAA48651.1| glucagon hepatic receptor rela...ted to the receptor for the glucagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucagon rece...ptor [synthetic construct] gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon rece

  18. NCBI nr-aa BLAST: CBRC-FCAT-01-0389 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-0389 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  19. NCBI nr-aa BLAST: CBRC-TTRU-01-1039 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-1039 ref|NP_742088.1| glucagon receptor isoform 2 [Rattus norvegicus] ref|NP_742089.1| glucag...ceptor; Short=GL-R; Flags: Precursor gb|AAA02992.1| glucagon receptor [Rattus norvegicus] gb|AAA16439.1| glucag...on receptor [Rattus norvegicus] emb|CAA48651.1| glucagon hepatic receptor rela...ted to the receptor for the glucagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucagon rece...ptor [synthetic construct] gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon rece

  20. NCBI nr-aa BLAST: CBRC-PTRO-18-0063 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-18-0063 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  1. NCBI nr-aa BLAST: CBRC-CFAM-09-0002 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-09-0002 ref|NP_742088.1| glucagon receptor [Rattus norvegicus] ref|NP_742089.1| glucag...on receptor [Rattus norvegicus] sp|P30082|GLR_RAT Glucagon receptor precursor (GL-R) gb|AAA02992.1| glucag...on receptor gb|AAA16439.1| glucagon receptor emb|CAA48651.1| glucagon hepatic receptor related to the receptor for the glu...cagon-like peptide 1 (GLP-1) [Rattus norvegicus] gb|AAA67262.1| glucag...on receptor gb|AAB16800.1| glucagon receptor [Rattus norvegicus] gb|EDM06848.1| glucagon recep

  2. Structure and function of the AAA+ ATPase p97/Cdc48p.

    Science.gov (United States)

    Xia, Di; Tang, Wai Kwan; Ye, Yihong

    2016-05-25

    p97 (also known as valosin-containing protein (VCP) in mammals or Cdc48p in Saccharomyces cerevisiae) is an evolutionarily conserved ATPase present in all eukaryotes and archaebacteria. In conjunction with a collection of cofactors and adaptors, p97/Cdc48p performs an array of biological functions mostly through modulating the stability of 'client' proteins. Using energy from ATP hydrolysis, p97/Cdc48p segregates these molecules from immobile cellular structures such as protein assemblies, membrane organelles, and chromatin. Consequently, the released polypeptides can be efficiently degraded by the ubiquitin proteasome system or recycled. This review summarizes our current understanding of the structure and function of this essential cellular chaperoning system. Published by Elsevier B.V.

  3. Endovascular AAA exclusion: will stents with hooks and barbs prevent stent-graft migration?

    Science.gov (United States)

    Malina, M; Lindblad, B; Ivancev, K; Lindh, M; Malina, J; Brunkwall, J

    1998-11-01

    To investigate if stents with hooks and barbs will improve stent-graft fixation in the abdominal aorta. Sixteen- to 24-mm-diameter Dacron grafts were deployed inside cadaveric aortas. The grafts were anchored by stents as in endovascular abdominal aortic aneurysm repair. One hundred thirty-seven stent-graft deployments were carried out with modified self-expanding Z-stents with (A) no hooks and barbs (n = 75), (B) 4 5-mm-long hooks and barbs (n = 39), (C) 8 10-mm-long, strengthened hooks and barbs (n = 19), or (D) hooks only (n = 4). Increasing longitudinal traction was applied to determine the displacement force needed to extract the stent-grafts. The radial force of the stents was measured and correlated to the displacement force. The median (interquartile range) displacement force needed to extract grafts anchored by stent A was 2.5 N (2.0 to 3.4), stent B 7.8 N (7.4 to 10.8), and stent C 22.5 N (17.1 to 27.9), p barbs added anchoring strength. During traction, the weaker barbs were distorted or caused intimal tears. The stronger barbs engaged the entire aortic wall. The radial force of the stents had no impact on fixation, while aortic calcification and graft oversizing had marginal effects. Stent barbs and hooks increased the fixation of stent-grafts tenfold, while the radial force of stents had no impact. These data may prove important in future endograft development to prevent stent-graft migration after aneurysm exclusion.

  4. The Hopelessly Compromised: Independent Games as a Movement against Mainstream AAA Video Games

    DEFF Research Database (Denmark)

    Juul, Jesper

    2016-01-01

    The last 10-15 years have seen the rise of a loosely defined independent games movement, often promoted as a more authentic type of video game than mainstream big budget video games (Juul 2014). For example, developer Dan Cook claims that “Indie games let me be a fan who is cheering on someone...... of the design and values of mainstream video games. As such, mainstream video games play the role of the morally and aesthetically compromised other, an other from which video games must be saved; an other that independent games are assumed to be rebelling against. In this paper I will analyze independent games...... as a number of specific (and sometimes contradictory) rejections of particular aspects of mainstream video game design. I am examining the game design of selected high-profile independent games, as well as game reviews and developer statement about their games. Here I am presenting general results...

  5. The Ethnology of Traditional and Complex Societies. Test Edition. AAAS Study Guides on Contemporary Problems.

    Science.gov (United States)

    Simic, Andrei

    This is one of several study guides on contemporary problems produced by the American Association for the Advancement of Science with support of the National Science Foundation. This guide focuses on the ethnology of traditional and complex societies. Part I, Simple and Complex Societies, includes three sections: (1) Introduction: Anthropologists…

  6. The AAA(+) ATPase RUVBL2 is a critical mediator of MLL-AF9 oncogenesis

    NARCIS (Netherlands)

    Osaki, H.; Walf-Vorderwuebecke, V.; Mangolini, M.; Zhao, L.; Horton, S. J.; Morrone, G.; Schuringa, J. J.; de Boer, J.; Williams, O.

    The most frequent chromosomal translocations in pediatric acute myeloid leukemia affect the 11q23 locus and give rise to mixed lineage leukemia (MLL) fusion genes, MLL-AF9 being the most prevalent. The MLL-AF9 fusion gene has been shown to induce leukemia in both mouse and human models. In this

  7. Chemical and microbiological interactions between soils and roots in commercial banana plantations (Musa AAA, cv. Cavendish)

    NARCIS (Netherlands)

    Segura Mena, R.; Serrano, E.; Pocasangre, L.; Acuna, O.; Bertsch, F.; Stoorvogel, J.J.; Sandoval, J.A.

    2015-01-01

    A study was performed to determine the relationships between soil chemical and microbiological con-ditions and how they impact soil production. The study was carried out on six Costa Rican commercialbanana farms with high, medium and low productivity. In each of the farms sector with relatively

  8. Study of banana (Musa aaa Cavendish cv Nanica trigger ripening for small scale process

    Directory of Open Access Journals (Sweden)

    Fábio Donato Soares Larotonda

    2008-10-01

    Full Text Available The present work focuse on the impact of O2, CO2 and ethylene concentrations on ripening rate control of bananas as a contribution for the development of domestic equipments that could allow the user to drive the fruit shelf live. It represented the adjustment of metabolic activity rates in order to manage the maturity process. Ripening variables such as ethylene and CO2 concentrations and temperature were adjusted to accelerate or slow down the process, while the maturity degree was monitored through the physical and chemical parameters and sensorial analysis. Therefore, the objective of this work was to evaluate the influence of these parameters to manage the banana ripening. The optimum temperature was at 25 ºC of storage. The presence of oxygen, CO2 withdraws and ethylene injection were relevant for the ripening process. The "ready-to-eat" quality was achieved in 6 days in confined system. The use of ethylene as trigger was adequate to accelerate the ripening process with advantages in fruit color.O presente trabalho foca no impacto da concentração de O2, CO2 e etileno no controle da taxa de amadurecimento de bananas, como contribuição para o desenvolvimento de equipamentos domésticos que permitam o controle pelo próprio usuário da vida de prateleira de frutas. Isto representa o ajuste das atividades metabólicas para garantir o controle do amadurecimento. Variáveis como concentração de etileno e CO2 e temperatura foram ajustadas para acelerar ou reduzir o processo, enquanto que o grau de maturação foi monitorado através de parâmetros físico-químicos e sensoriais. Desta forma, o objetivo deste trabalho foi avaliar a influência destes parâmetros para controlar o amadurecimento de banana. A temperatura ótima de amadurecimento foi 25ºC. A presença de O2, a retirada de CO2 e a injeção de etileno foram relevantes no processo. A qualidade "pronto-para-consumo" foi obtida em 6 dias em sistema confinado. O uso de etileno como gatilho é adequado para acelerar o amadurecimento, com vantagens para a cor do produto.

  9. An Instructors Guide to Water Pollution. Test Edition. AAAS Study Guides on Contemporary Problems, No. 5.

    Science.gov (United States)

    Kidd, David E.

    This is one of several study guides on contemporary problems produced by the American Association for the Advancement of Science with support of the National Science Foundation. This study guide on water pollution includes the following units: (1) Overview of World Pollution; (2) History, Definition, Criteria; (3) Ecosystem Theory; (4) Biological…

  10. AAA Rated: Unscrambling the Bond Market. RUSA Occasional Papers, Number 22.

    Science.gov (United States)

    LaFaro, Lydia E., Ed.

    Many people are investing these days, but many librarians, especially non-business librarians, are uncomfortable helping patrons with questions on the subject. This reference guide gives librarians the knowledge and confidence to assist patrons in identifying the correct information in a critical but little understood investment area--the bond…

  11. Effects of gamma radiation on banana 'nanica' (Musa sp., group AAA) irradiated in pre climacteric phase

    International Nuclear Information System (INIS)

    Silva, Simone Faria; Dionisio, Ana Paula; Walder, Julio Marcos Melges

    2007-01-01

    The present work verified the effect of gamma radiation on physical and chemical parameters of banana 'nanica', analyzing possible alterations on the period of conservation and the possibility of commercial irradiation aiming the exportation. The results had demonstrated that the radiations had not produced effect on pH and total acidity. However, the bananas of the 'control group' and those that had received 0,75 kGy, had presented greater maturation degree and, radiated with 0,30 kGy, had presented greater firmness. In accordance with the results of the organoleptic analysis, can be perceived that the bananas most mature, especially of the 'control group', had had greater acceptance. The bananas of treatments 0,30 and 0,60 kGy had had minors notes for presenting minor maturation stadium. Knowing that the irradiation in adequate dose and fruits of good quality brings benefits to the storage and the process of exportation, we conclude that the dose most appropriate for the control of the maturation of the 'nanica' banana is 0,30 kGy. (author)

  12. Use of Banana (Musa acuminata Colla AAA) Peel Extract as an Antioxidant Source in Orange Juices.

    Science.gov (United States)

    Ortiz, Lucía; Dorta, Eva; Gloria Lobo, M; González-Mendoza, L Antonio; Díaz, Carlos; González, Mónica

    2017-03-01

    Using banana peel extract as an antioxidant in freshly squeezed orange juices and juices from concentrate was evaluated. Free radical scavenging capacity increased by adding banana peel extracts to both types of orange juice. In addition, remarkable increases in antioxidant capacity using 2,2'-azino-bis-(3-ethylbenzothiazoline)-6-sulfonic acid (ABTS) radical were observed when equal or greater than 5 mg of banana peel extract per ml of freshly squeezed juice was added. No clear effects were observed in the capacity to inhibit lipid peroxidation. Adding 5 mg banana peel extract per ml of orange juice did not substantially modify the physicochemical and sensory characteristics of either type of juice. However, undesirable changes in the sensory characteristics (in-mouth sensations and colour) were detected when equal or greater than 10 mg banana peel extract per ml of orange juice was added. These results confirm that banana peel is a promising natural additive that increases the capacity to scavenge free radicals of orange juice with acceptable sensory and physicochemical characteristics for the consumer.

  13. Improved tolerance toward fungal diseases in transgenic Cavendish banana (Musa spp. AAA group) cv. Grand Nain.

    Science.gov (United States)

    Vishnevetsky, Jane; White, Thomas L; Palmateer, Aaron J; Flaishman, Moshe; Cohen, Yuval; Elad, Yigal; Velcheva, Margarita; Hanania, Uri; Sahar, Nachman; Dgani, Oded; Perl, Avihai

    2011-02-01

    The most devastating disease currently threatening to destroy the banana industry worldwide is undoubtedly Sigatoka Leaf spot disease caused by Mycosphaerella fijiensis. In this study, we developed a transformation system for banana and expressed the endochitinase gene ThEn-42 from Trichoderma harzianum together with the grape stilbene synthase (StSy) gene in transgenic banana plants under the control of the 35S promoter and the inducible PR-10 promoter, respectively. The superoxide dismutase gene Cu,Zn-SOD from tomato, under control of the ubiquitin promoter, was added to this cassette to improve scavenging of free radicals generated during fungal attack. A 4-year field trial demonstrated several transgenic banana lines with improved tolerance to Sigatoka. As the genes conferring Sigatoka tolerance may have a wide range of anti-fungal activities we also inoculated the regenerated banana plants with Botrytis cinerea. The best transgenic lines exhibiting Sigatoka tolerance were also found to have tolerance to B. cinerea in laboratory assays.

  14. Tobacco arabinogalactan protein NtEPc can promote banana (Musa AAA) somatic embryogenesis.

    Science.gov (United States)

    Shu, H; Xu, L; Li, Z; Li, J; Jin, Z; Chang, S

    2014-12-01

    Banana is an important tropical fruit worldwide. Parthenocarpy and female sterility made it impossible to improve banana varieties through common hybridization. Genetic transformation for banana improvement is imperative. But the low rate that banana embryogenic callus was induced made the transformation cannot be performed in many laboratories. Finding ways to promote banana somatic embryogenesis is critical for banana genetic transformation. After tobacco arabinogalactan protein gene NtEPc was transformed into Escherichia coli (DE3), the recombinant protein was purified and filter-sterilized. A series of the sterilized protein was added into tissue culture medium. It was found that the number of banana immature male flowers developing embryogenic calli increased significantly in the presence of NtEPc protein compared with the effect of the control medium. Among the treatments, explants cultured on medium containing 10 mg/l of NtEPc protein had the highest chance to develop embryogenic calli. The percentage of lines that developed embryogenic calli on this medium was about 12.5 %. These demonstrated that NtEPc protein can be used to promote banana embryogenesis. This is the first paper that reported that foreign arabinogalactan protein (AGP) could be used to improve banana somatic embryogenesis.

  15. Responses of east African highland banana (EAHB-AAA) cultivars to ...

    African Journals Online (AJOL)

    ACSS

    50% among cooking cultivars, and less than 40% to dessert cultivars. Leaf orientation was significant to folding with cooking variety type opening leaves widely (up to 100o), and enhancing excessive leaf plant dehydration, even during stressful conditions. Soil evapo-transpiration showed that cvs. Kisansa and Mpologoma ...

  16. Diagnosis and perioperative management of ruptured AAA mimicking symptomatic groin hernia

    Directory of Open Access Journals (Sweden)

    Holger Jan Klein

    2016-01-01

    Conclusion: Computed Tomography Angiography (CTA remains the recommended diagnostic tool—for both safe diagnosis of the ruptured aneurysm and precise preoperative planning. Endovascular aortic repair of the RAAA—if feasible—is the treatment of choice. This rare form of RAAA manifestation should call physicians attention—especially in patients with known abdominal aortic aneurysms in their preceding medical history.

  17. Formulation and evaluation of semisolid jelly produced by Musa acuminata Colla (AAA Group peels

    Directory of Open Access Journals (Sweden)

    Noor Azwani Mohd Rasidek

    2016-01-01

    Conclusions: TPC can be used as an indicator in assessing the antioxidant activity of fruits and vegetables. The present investigation reveals that TPC is mainly responsible for DPPH free radical scavenging capacity.

  18. Impaired folding of the mitochondrial small TIM chaperones induces clearance by the i-AAA protease.

    Science.gov (United States)

    Baker, Michael J; Mooga, Ved P; Guiard, Bernard; Langer, Thomas; Ryan, Michael T; Stojanovski, Diana

    2012-12-14

    The intermembrane space of mitochondria contains a dedicated chaperone network-the small translocase of the inner membrane (TIM) family-for the sorting of hydrophobic precursors. All small TIMs are defined by the presence of a twin CX(3)C motif and the monomeric proteins are stabilized by two intramolecular disulfide bonds formed between the cysteines of these motifs. The conserved cysteine residues within small TIM members have also been shown to participate in early biogenesis events, with the most N-terminal cysteine residue important for import and retention within the intermembrane space via the receptor and disulfide oxidase, Mia40. In this study, we have analyzed the in vivo consequences of improper folding of small TIM chaperones by generating site-specific cysteine mutants and assessed the fate of the incompletely oxidized proteins within mitochondria. We show that no individual cysteine residue is required for the function of Tim9 or Tim10 in yeast and that defective assembly of the small TIMs induces their proteolytic clearance from mitochondria. We delineate a clearance mechanism for the mutant proteins and their unassembled wild-type partner protein by the mitochondrial ATP-dependent protease, Yme1 (yeast mitochondrial escape 1). Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. A Study Guide on Holography (Draft). Test Edition. AAAS Study Guides on Contemporary Problems.

    Science.gov (United States)

    Jeong, Tung H.

    This is one of several study guides on contemporary problems produced by the American Association for the Advancement of Science with support of the National Science Foundation. The primary purpose of this guide is to provide a student with sufficient practical and technical information to begin independently practicing holography, with occasional…

  20. NCBI nr-aa BLAST: CBRC-FRUB-02-0858 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0858 sp|P41755|DHE2_ACHKL NAD-specific glutamate dehydrogenase (NAD-GDH) pir||A53164 glutamate... dehydrogenase (EC 1.4.1.2) - Achlya klebsiana gb|AAA17563.1| NAD-specific glutamate dehydrogenase P41755 3e-45 35% ...

  1. NCBI nr-aa BLAST: CBRC-OLAT-08-0000 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-08-0000 sp|P41755|DHE2_ACHKL NAD-specific glutamate dehydrogenase (NAD-GDH) pir||A53164 glutamate... dehydrogenase (EC 1.4.1.2) - Achlya klebsiana gb|AAA17563.1| NAD-specific glutamate dehydrogenase P41755 2e-83 36% ...

  2. NCBI nr-aa BLAST: CBRC-RMAC-03-0036 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-03-0036 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 1e-138 72% ...

  3. NCBI nr-aa BLAST: CBRC-DRER-12-0072 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-12-0072 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 1e-119 57% ...

  4. NCBI nr-aa BLAST: CBRC-HSAP-07-0017 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-07-0017 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 0.0 86% ...

  5. NCBI nr-aa BLAST: CBRC-ACAR-01-0764 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0764 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 1e-141 56% ...

  6. NCBI nr-aa BLAST: CBRC-TGUT-04-0018 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-04-0018 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 1e-147 60% ...

  7. NCBI nr-aa BLAST: CBRC-MLUC-01-0263 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0263 ref|NP_036982.1| growth hormone releasing hormone receptor [Rattu...s norvegicus] gb|AAA41221.1| growth hormone-releasing hormone receptor [Rattus norvegicus] NP_036982.1 1e-119 53% ...

  8. NCBI nr-aa BLAST: CBRC-BTAU-01-2615 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-2615 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 0.0 82% ...

  9. NCBI nr-aa BLAST: CBRC-OLAT-04-0021 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-04-0021 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 1e-110 52% ...

  10. NCBI nr-aa BLAST: CBRC-OCUN-01-0178 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OCUN-01-0178 ref|NP_036982.1| growth hormone releasing hormone receptor [Rattu...s norvegicus] gb|AAA41221.1| growth hormone-releasing hormone receptor NP_036982.1 7e-66 48% ...

  11. NCBI nr-aa BLAST: CBRC-DNOV-01-2844 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DNOV-01-2844 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 1e-126 58% ...

  12. NCBI nr-aa BLAST: CBRC-EEUR-01-0660 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-EEUR-01-0660 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 1e-129 83% ...

  13. NCBI nr-aa BLAST: CBRC-CPOR-01-2037 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CPOR-01-2037 ref|NP_036982.1| growth hormone releasing hormone receptor [Rattu...s norvegicus] gb|AAA41221.1| growth hormone-releasing hormone receptor NP_036982.1 1e-110 72% ...

  14. NCBI nr-aa BLAST: CBRC-CPOR-01-2037 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CPOR-01-2037 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 1e-110 73% ...

  15. NCBI nr-aa BLAST: CBRC-GGAL-02-0000 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-02-0000 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 1e-148 58% ...

  16. NCBI nr-aa BLAST: CBRC-FRUB-02-0138 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0138 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 1e-120 54% ...

  17. NCBI nr-aa BLAST: CBRC-PABE-08-0029 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PABE-08-0029 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 0.0 80% ...

  18. NCBI nr-aa BLAST: CBRC-RMAC-03-0036 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-03-0036 ref|NP_036982.1| growth hormone releasing hormone receptor [Rattu...s norvegicus] gb|AAA41221.1| growth hormone-releasing hormone receptor NP_036982.1 1e-131 67% ...

  19. NCBI nr-aa BLAST: CBRC-MMUS-06-0057 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-06-0057 ref|NP_036982.1| growth hormone releasing hormone receptor [Rattu...s norvegicus] gb|AAA41221.1| growth hormone-releasing hormone receptor NP_036982.1 0.0 94% ...

  20. NCBI nr-aa BLAST: CBRC-RNOR-04-0139 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-04-0139 ref|NP_036982.1| growth hormone releasing hormone receptor [Rattu...s norvegicus] gb|AAA41221.1| growth hormone-releasing hormone receptor NP_036982.1 0.0 91% ...

  1. NCBI nr-aa BLAST: CBRC-DNOV-01-2844 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DNOV-01-2844 ref|NP_036982.1| growth hormone releasing hormone receptor [Rattu...s norvegicus] gb|AAA41221.1| growth hormone-releasing hormone receptor NP_036982.1 1e-116 53% ...

  2. NCBI nr-aa BLAST: CBRC-LAFR-01-0274 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-LAFR-01-0274 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 1e-106 84% ...

  3. NCBI nr-aa BLAST: CBRC-CJAC-01-1513 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CJAC-01-1513 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 0.0 80% ...

  4. NCBI nr-aa BLAST: CBRC-FCAT-01-0862 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-0862 ref|NP_999200.1| growth hormone releasing hormone receptor [Sus s...crofa] sp|P34999|GHRHR_PIG Growth hormone-releasing hormone receptor precursor (GHRH receptor) (GRF receptor...) (GRFR) gb|AAA93391.1| growth hormone-releasing hormone receptor NP_999200.1 1e-179 79% ...

  5. NCBI nr-aa BLAST: CBRC-PCAP-01-0323 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-0323 ref|NP_036982.1| growth hormone releasing hormone receptor [Rattu...s norvegicus] gb|AAA41221.1| growth hormone-releasing hormone receptor [Rattus norvegicus] NP_036982.1 1e-159 65% ...

  6. NCBI nr-aa BLAST: CBRC-OLAT-26-0221 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-26-0221 ref|NP_504494.2| Prion-like-(Q/N-rich)-domain-bearing protein fam...ily member (pqn-13) [Caenorhabditis elegans] gb|AAA96110.3| Prion-like-(q/n-rich)-domain-bearing protein protein 13 [Caenorhabditis elegans] NP_504494.2 3e-23 25% ...

  7. NCBI nr-aa BLAST: CBRC-BTAU-01-2227 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-2227 ref|NP_504494.2| Prion-like-(Q/N-rich)-domain-bearing protein fam...ily member (pqn-13) [Caenorhabditis elegans] gb|AAA96110.3| Prion-like-(q/n-rich)-domain-bearing protein protein 13 [Caenorhabditis elegans] NP_504494.2 2e-08 25% ...

  8. NCBI nr-aa BLAST: CBRC-DNOV-01-2816 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DNOV-01-2816 ref|NP_056542.1| tachykinin receptor 1 isoform short [Homo sapien...s] gb|AAA36644.1| substance P receptor (short form) gb|EAW99595.1| tachykinin receptor 1, isoform CRA_a [Homo sapiens] NP_056542.1 4e-68 96% ...

  9. NCBI nr-aa BLAST: CBRC-XTRO-01-1664 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-1664 ref|NP_056542.1| tachykinin receptor 1 isoform short [Homo sapien...s] gb|AAA36644.1| substance P receptor (short form) gb|EAW99595.1| tachykinin receptor 1, isoform CRA_a [Homo sapiens] NP_056542.1 1e-132 76% ...

  10. NCBI nr-aa BLAST: CBRC-DNOV-01-0327 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DNOV-01-0327 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 79% ...

  11. NCBI nr-aa BLAST: CBRC-RMAC-05-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-05-0004 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 84% ...

  12. NCBI nr-aa BLAST: CBRC-OLAT-05-0023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-05-0023 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-169 70% ...

  13. NCBI nr-aa BLAST: CBRC-FRUB-02-0554 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0554 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-124 64% ...

  14. NCBI nr-aa BLAST: CBRC-ACAR-01-0406 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0406 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-138 63% ...

  15. NCBI nr-aa BLAST: CBRC-HSAP-02-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-02-0034 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 78% ...

  16. NCBI nr-aa BLAST: CBRC-TGUT-06-0017 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-06-0017 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-179 70% ...

  17. NCBI nr-aa BLAST: CBRC-PTRO-05-0012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-05-0012 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 83% ...

  18. NCBI nr-aa BLAST: CBRC-CFAM-03-0024 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-03-0024 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 83% ...

  19. NCBI nr-aa BLAST: CBRC-PABE-05-0009 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PABE-05-0009 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 83% ...

  20. NCBI nr-aa BLAST: CBRC-OCUN-01-0165 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OCUN-01-0165 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-156 79% ...

  1. NCBI nr-aa BLAST: CBRC-HSAP-01-0064 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-01-0064 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 79% ...

  2. NCBI nr-aa BLAST: CBRC-ETEL-01-0092 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ETEL-01-0092 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-129 74% ...

  3. NCBI nr-aa BLAST: CBRC-CJAC-01-0720 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CJAC-01-0720 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 82% ...

  4. NCBI nr-aa BLAST: CBRC-GACU-17-0020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-17-0020 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-167 69% ...

  5. NCBI nr-aa BLAST: CBRC-OANA-01-1403 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-1403 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-104 53% ...

  6. NCBI nr-aa BLAST: CBRC-FCAT-01-1119 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-1119 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 85% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0200 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0200 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 3e-47 59% ...

  8. NCBI nr-aa BLAST: CBRC-GGAL-04-0039 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-04-0039 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 70% ...

  9. NCBI nr-aa BLAST: CBRC-FRUB-02-0376 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0376 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-164 68% ...

  10. NCBI nr-aa BLAST: CBRC-PTRO-02-0027 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-02-0027 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 79% ...

  11. NCBI nr-aa BLAST: CBRC-MMUS-05-0015 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-05-0015 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 95% ...

  12. NCBI nr-aa BLAST: CBRC-RNOR-14-0117 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-14-0117 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 99% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0834 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0834 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 3e-47 59% ...

  14. NCBI nr-aa BLAST: CBRC-TBEL-01-1190 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-1190 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-138 80% ...

  15. NCBI nr-aa BLAST: CBRC-XTRO-01-1729 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-1729 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-176 72% ...

  16. NCBI nr-aa BLAST: CBRC-OGAR-01-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OGAR-01-0008 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-169 75% ...

  17. NCBI nr-aa BLAST: CBRC-BTAU-01-0632 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-0632 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 81% ...

  18. NCBI nr-aa BLAST: CBRC-HSAP-04-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-04-0022 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 0.0 82% ...

  19. NCBI nr-aa BLAST: CBRC-TGUT-09-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-09-0008 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-128 55% ...

  20. NCBI nr-aa BLAST: CBRC-CPOR-01-0124 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CPOR-01-0124 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 1e-108 80% ...

  1. NCBI nr-aa BLAST: CBRC-LAFR-01-3848 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-LAFR-01-3848 ref|NP_002053.2| glucagon-like peptide 1 receptor [Homo sapiens] gb|AAC50050.1| glucag...on-like peptide-1 receptor gb|AAA62471.1| glucagon-like peptide-1 receptor NP_002053.2 1e-52 75% ...

  2. NCBI nr-aa BLAST: CBRC-BTAU-01-1581 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-1581 ref|NP_002053.2| glucagon-like peptide 1 receptor [Homo sapiens] gb|AAC50050.1| glucag...on-like peptide-1 receptor gb|AAA62471.1| glucagon-like peptide-1 receptor NP_002053.2 0.0 88% ...

  3. NCBI nr-aa BLAST: CBRC-RMAC-16-0040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-16-0040 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 0.0 78% ...

  4. NCBI nr-aa BLAST: CBRC-FRUB-02-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0022 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 1e-115 48% ...

  5. NCBI nr-aa BLAST: CBRC-GGAL-18-0009 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-18-0009 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 1e-47 66% ...

  6. NCBI nr-aa BLAST: CBRC-XTRO-01-3481 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-3481 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 1e-119 55% ...

  7. NCBI nr-aa BLAST: CBRC-MMUS-11-0145 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-11-0145 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 0.0 99% ...

  8. NCBI nr-aa BLAST: CBRC-PTRO-07-0048 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-07-0048 ref|NP_002053.2| glucagon-like peptide 1 receptor [Homo sapiens] gb|AAC50050.1| glucag...on-like peptide-1 receptor gb|AAA62471.1| glucagon-like peptide-1 receptor NP_002053.2 0.0 97% ...

  9. NCBI nr-aa BLAST: CBRC-FCAT-01-0519 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-0519 ref|NP_002053.2| glucagon-like peptide 1 receptor [Homo sapiens] gb|AAC50050.1| glucag...on-like peptide-1 receptor gb|AAA62471.1| glucagon-like peptide-1 receptor NP_002053.2 1e-55 82% ...

  10. NCBI nr-aa BLAST: CBRC-CJAC-01-1596 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CJAC-01-1596 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 0.0 73% ...

  11. NCBI nr-aa BLAST: CBRC-FCAT-01-0389 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-0389 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 0.0 71% ...

  12. NCBI nr-aa BLAST: CBRC-HSAP-26-0013 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-26-0013 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 0.0 73% ...

  13. NCBI nr-aa BLAST: CBRC-PABE-18-0044 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PABE-18-0044 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 0.0 76% ...

  14. NCBI nr-aa BLAST: CBRC-CINT-01-0112 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CINT-01-0112 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 4e-80 36% ...

  15. NCBI nr-aa BLAST: CBRC-HSAP-06-0055 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-06-0055 ref|NP_002053.2| glucagon-like peptide 1 receptor [Homo sapiens] gb|AAC50050.1| glucag...on-like peptide-1 receptor gb|AAA62471.1| glucagon-like peptide-1 receptor NP_002053.2 0.0 97% ...

  16. NCBI nr-aa BLAST: CBRC-OGAR-01-0624 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OGAR-01-0624 ref|NP_002053.2| glucagon-like peptide 1 receptor [Homo sapiens] gb|AAC50050.1| glucag...on-like peptide-1 receptor gb|AAA62471.1| glucagon-like peptide-1 receptor NP_002053.2 1e-164 87% ...

  17. NCBI nr-aa BLAST: CBRC-BTAU-01-2375 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-2375 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 0.0 80% ...

  18. NCBI nr-aa BLAST: CBRC-RNOR-10-0254 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-10-0254 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 0.0 93% ...

  19. NCBI nr-aa BLAST: CBRC-OANA-01-2134 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-2134 ref|NP_002053.2| glucagon-like peptide 1 receptor [Homo sapiens] gb|AAC50050.1| glucag...on-like peptide-1 receptor gb|AAA62471.1| glucagon-like peptide-1 receptor NP_002053.2 0.0 72% ...

  20. NCBI nr-aa BLAST: CBRC-MMUS-17-0107 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-17-0107 ref|NP_002053.2| glucagon-like peptide 1 receptor [Homo sapiens] gb|AAC50050.1| glucag...on-like peptide-1 receptor gb|AAA62471.1| glucagon-like peptide-1 receptor NP_002053.2 0.0 92% ...

  1. NCBI nr-aa BLAST: CBRC-PABE-07-0043 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PABE-07-0043 ref|NP_002053.2| glucagon-like peptide 1 receptor [Homo sapiens] gb|AAC50050.1| glucag...on-like peptide-1 receptor gb|AAA62471.1| glucagon-like peptide-1 receptor NP_002053.2 0.0 98% ...

  2. NCBI nr-aa BLAST: CBRC-CFAM-09-0002 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-09-0002 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 0.0 85% ...

  3. NCBI nr-aa BLAST: CBRC-CINT-01-0113 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CINT-01-0113 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 7e-77 36% ...

  4. NCBI nr-aa BLAST: CBRC-PTRO-18-0063 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-18-0063 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 0.0 79% ...

  5. NCBI nr-aa BLAST: CBRC-ETEL-01-0178 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ETEL-01-0178 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 0.0 77% ...

  6. NCBI nr-aa BLAST: CBRC-RMAC-04-0036 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-04-0036 ref|NP_002053.2| glucagon-like peptide 1 receptor [Homo sapiens] gb|AAC50050.1| glucag...on-like peptide-1 receptor gb|AAA62471.1| glucagon-like peptide-1 receptor NP_002053.2 0.0 85% ...

  7. NCBI nr-aa BLAST: CBRC-TGUT-17-0002 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-17-0002 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 8e-56 46% ...

  8. NCBI nr-aa BLAST: CBRC-CJAC-01-1434 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CJAC-01-1434 ref|NP_002053.2| glucagon-like peptide 1 receptor [Homo sapiens] gb|AAC50050.1| glucag...on-like peptide-1 receptor gb|AAA62471.1| glucagon-like peptide-1 receptor NP_002053.2 0.0 93% ...

  9. NCBI nr-aa BLAST: CBRC-ACAR-01-0228 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0228 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 1e-117 54% ...

  10. NCBI nr-aa BLAST: CBRC-LAFR-01-0177 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-LAFR-01-0177 ref|NP_032127.1| glucagon receptor [Mus musculus] sp|Q61606|GLR_M...OUSE Glucagon receptor precursor (GL-R) gb|AAA88244.1| glucagon receptor gb|AAF44749.1| glucagon receptor [Mus musculus] NP_032127.1 4e-54 51% ...

  11. NCBI nr-aa BLAST: CBRC-XTRO-01-3896 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-3896 sp|P48766|NAC1_CAVPO Sodium/calcium exchanger 1 precursor (Na(+)/Ca(2+)-exchange... protein 1) gb|AAA73904.1| sodium-calcium exchanger prf||2108269A Na/Ca exchanger P48766 0.0 86% ...

  12. NCBI nr-aa BLAST: CBRC-GACU-09-0056 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-09-0056 sp|P48766|NAC1_CAVPO Sodium/calcium exchanger 1 precursor (Na(+)/Ca(2+)-exchange... protein 1) gb|AAA73904.1| sodium-calcium exchanger prf||2108269A Na/Ca exchanger P48766 0.0 68% ...

  13. NCBI nr-aa BLAST: CBRC-CELE-04-0066 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CELE-04-0066 ref|NP_001021268.1| UNCoordinated family member (unc-44) [Caenorh...abditis elegans] gb|AAA93447.2| Uncoordinated protein 44, isoform f [Caenorhabditis elegans] NP_001021268.1 0.0 100% ...

  14. NCBI nr-aa BLAST: CBRC-CREM-01-0864 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CREM-01-0864 ref|NP_001021268.1| UNCoordinated family member (unc-44) [Caenorh...abditis elegans] gb|AAA93447.2| Uncoordinated protein 44, isoform f [Caenorhabditis elegans] NP_001021268.1 0.0 53% ...

  15. New Insights into Effects of Aromatic Amino Acids on Hydroxyapatite.

    Science.gov (United States)

    Guo, Y R; Yang, X; Feng, X W; Sa, Y; Wang, M; Li, P; Jiang, T

    2018-04-01

    Biomimetics inspired by superstructures and extraordinary properties of teeth have resulted in tooth repair and the generation of novel materials. However, little attention has been paid to tooth color, whose origin remains unknown. Based on recent studies, fluorophores-mainly aromatic amino acids (AAAs) in proteins-might be responsible for tooth color. We synthesized carbonated hydroxyapatite (HA; the mineral phase of teeth) in the presence of different amino acids (AAs; the basic units of protein matrix of teeth) as a simplified model of teeth to explore the color source at the AA level. After measuring the fluorescence and color characteristics of HA-AAs before and after bleaching treatment, we found that only HA, synthesized in the presence of AAAs, exhibited remarkable fluorescence and color property. Furthermore, linearly increased fluorescence intensity and deeper color were observed with an increase in AAA content in HA-AAAs. Similarly, significantly decreased absorbance of HA-AAAs between 250 and 300 nm in ultraviolet spectra, declined fluorescence intensity, and decolored performance of HA-AAAs were observed after bleaching treatment. The results showed that AAAs contributed to the fluorescence and color properties of HA and that hydrogen peroxide might whiten HA-AAAs by oxidizing the benzene ring in AAAs. These findings are of great significance in promoting the synthesis of advanced tooth-colored materials and furthering our understanding of the possible mechanisms of hydrogen peroxide. Moreover, our study shed light on the importance of AAAs and might provide new ideas for investigations of biomineralization and biomimetics.

  16. AA Index

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  17. NCBI nr-aa BLAST: CBRC-TBEL-01-0817 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-0817 ref|NP_000625.1| interleukin 8 receptor alpha [Homo sapiens] sp|P...25024|CXCR1_HUMAN High affinity interleukin-8 receptor A (IL-8R A) (IL-8 receptor type 1) (CXCR-1) (CD181 an...tigen) (CDw128a) emb|CAA46688.1| High affinity interleukin-8 receptor [Homo sapiens] gb|AAA64378.1| interleukin...-8 receptor type A gb|AAB59436.1| interleukin 8 receptor alpha gb|AAA59160.1| interleukin... 8 receptor alpha gb|AAT46689.1| interleukin 8 receptor, alpha [Homo sapiens] emb|CAG46791.1| IL8

  18. NCBI nr-aa BLAST: CBRC-OCUN-01-0050 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OCUN-01-0050 ref|NP_000625.1| interleukin 8 receptor alpha [Homo sapiens] sp|P...25024|CXCR1_HUMAN High affinity interleukin-8 receptor A (IL-8R A) (IL-8 receptor type 1) (CXCR-1) (CD181 an...tigen) (CDw128a) emb|CAA46688.1| High affinity interleukin-8 receptor [Homo sapiens] gb|AAA64378.1| interleukin...-8 receptor type A gb|AAB59436.1| interleukin 8 receptor alpha gb|AAA59160.1| interleukin... 8 receptor alpha gb|AAT46689.1| interleukin 8 receptor, alpha [Homo sapiens] emb|CAG46791.1| IL8

  19. NCBI nr-aa BLAST: CBRC-RNOR-05-0198 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-05-0198 ref|NP_003180.1| T-cell acute lymphocytic leukemia 1 [Homo sapien...s] sp|P17542|TAL1_HUMAN T-cell acute lymphocytic leukemia-1 protein (TAL-1 protein) (Stem cell protein) (T-cell leukemia.../lymphoma-5 protein) gb|AAA36599.1| stem cell leukemia gene product gb|AAA36600.1| stem cell leukemia... gene product emb|CAB72103.1| T-cell acute lymphocytic leukemia 1 [Homo sapi...ens] gb|EAX06875.1| T-cell acute lymphocytic leukemia 1, isoform CRA_a [Homo sapiens] gb|EAX06876.1| T-cell acute lymphocytic leukemi

  20. NCBI nr-aa BLAST: CBRC-MMUS-14-0025 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-14-0025 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  1. NCBI nr-aa BLAST: CBRC-GACU-06-0016 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-06-0016 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  2. NCBI nr-aa BLAST: CBRC-PABE-11-0023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PABE-11-0023 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  3. NCBI nr-aa BLAST: CBRC-FRUB-02-0312 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0312 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  4. NCBI nr-aa BLAST: CBRC-LAFR-01-0317 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-LAFR-01-0317 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  5. NCBI nr-aa BLAST: CBRC-PTRO-11-0025 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-11-0025 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  6. NCBI nr-aa BLAST: CBRC-OANA-01-0467 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-0467 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  7. NCBI nr-aa BLAST: CBRC-RMAC-09-0017 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-09-0017 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  8. NCBI nr-aa BLAST: CBRC-FCAT-01-1060 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-1060 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  9. NCBI nr-aa BLAST: CBRC-RNOR-16-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-16-0010 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  10. NCBI nr-aa BLAST: CBRC-CFAM-04-0005 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-04-0005 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  11. NCBI nr-aa BLAST: CBRC-CJAC-01-0071 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CJAC-01-0071 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  12. NCBI nr-aa BLAST: CBRC-BTAU-01-1987 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-1987 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  13. NCBI nr-aa BLAST: CBRC-DRER-13-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-13-0034 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  14. NCBI nr-aa BLAST: CBRC-HSAP-10-0029 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-10-0029 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  15. NCBI nr-aa BLAST: CBRC-OCUN-01-0801 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OCUN-01-0801 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  16. NCBI nr-aa BLAST: CBRC-TGUT-09-0005 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-09-0005 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  17. NCBI nr-aa BLAST: CBRC-OGAR-01-1103 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OGAR-01-1103 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  18. NCBI nr-aa BLAST: CBRC-CJAC-01-0706 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CJAC-01-0706 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  19. NCBI nr-aa BLAST: CBRC-TBEL-01-2532 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-2532 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  20. NCBI nr-aa BLAST: CBRC-OLAT-15-0014 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-15-0014 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  1. NCBI nr-aa BLAST: CBRC-ACAR-01-1006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-1006 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  2. NCBI nr-aa BLAST: CBRC-GGAL-06-0001 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-06-0001 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor gb|AAB92384.1| RPE-retinal G protein coupled receptor [Homo sapiens] gb|EAW80358.1| retina

  3. NCBI nr-aa BLAST: CBRC-BTAU-01-2837 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-2837 ref|NP_776992.1| opsin 1 (cone pigments), short-wave-sensitive (c...olor blindness, tritan) [Bos taurus] sp|P51490|OPSB_BOVIN Blue-sensitive opsin (BOP) (Blue cone photoreceptor pigment...) gb|AAA93189.1| visual pigment gb|AAB50158.1| blue cone pigment protein [Bos taurus] NP_776992.1 0.0 100% ...

  4. NCBI nr-aa BLAST: CBRC-CFAM-14-0051 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-14-0051 ref|NP_776992.1| opsin 1 (cone pigments), short-wave-sensitive (c...olor blindness, tritan) [Bos taurus] sp|P51490|OPSB_BOVIN Blue-sensitive opsin (BOP) (Blue cone photoreceptor pigment...) gb|AAA93189.1| visual pigment gb|AAB50158.1| blue cone pigment protein [Bos taurus] NP_776992.1 0.0 91% ...

  5. NCBI nr-aa BLAST: CBRC-FCAT-01-1178 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-1178 ref|NP_776992.1| opsin 1 (cone pigments), short-wave-sensitive (c...olor blindness, tritan) [Bos taurus] sp|P51490|OPSB_BOVIN Blue-sensitive opsin (BOP) (Blue cone photoreceptor pigment...) gb|AAA93189.1| visual pigment gb|AAB50158.1| blue cone pigment protein [Bos taurus] NP_776992.1 0.0 89% ...

  6. NCBI nr-aa BLAST: CBRC-LAFR-01-3136 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-LAFR-01-3136 ref|NP_776992.1| opsin 1 (cone pigments), short-wave-sensitive (c...olor blindness, tritan) [Bos taurus] sp|P51490|OPSB_BOVIN Blue-sensitive opsin (BOP) (Blue cone photoreceptor pigment...) gb|AAA93189.1| visual pigment gb|AAB50158.1| blue cone pigment protein [Bos taurus] NP_776992.1 1e-153 84% ...

  7. NCBI nr-aa BLAST: CBRC-OGAR-01-1096 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OGAR-01-1096 ref|NP_776992.1| opsin 1 (cone pigments), short-wave-sensitive (c...olor blindness, tritan) [Bos taurus] sp|P51490|OPSB_BOVIN Blue-sensitive opsin (BOP) (Blue cone photoreceptor pigment...) gb|AAA93189.1| visual pigment gb|AAB50158.1| blue cone pigment protein [Bos taurus] NP_776992.1 1e-104 63% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1750 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1750 ref|NP_776992.1| opsin 1 (cone pigments), short-wave-sensitive (c...olor blindness, tritan) [Bos taurus] sp|P51490|OPSB_BOVIN Blue-sensitive opsin (BOP) (Blue cone photoreceptor pigment...) gb|AAA93189.1| visual pigment gb|AAB50158.1| blue cone pigment protein [Bos taurus] NP_776992.1 0.0 88% ...

  9. NCBI nr-aa BLAST: CBRC-TBEL-01-1714 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-1714 ref|NP_776992.1| opsin 1 (cone pigments), short-wave-sensitive (c...olor blindness, tritan) [Bos taurus] sp|P51490|OPSB_BOVIN Blue-sensitive opsin (BOP) (Blue cone photoreceptor pigment...) gb|AAA93189.1| visual pigment gb|AAB50158.1| blue cone pigment protein [Bos taurus] NP_776992.1 1e-147 73% ...

  10. NCBI nr-aa BLAST: CBRC-OANA-01-0265 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-0265 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [Gall...us gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 1e-152 84% ...

  11. NCBI nr-aa BLAST: CBRC-TGUT-30-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-30-0010 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [Gall...us gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 97% ...

  12. NCBI nr-aa BLAST: CBRC-ACAR-01-0746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0746 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [Gall...us gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 90% ...

  13. NCBI nr-aa BLAST: CBRC-TNIG-02-0001 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-02-0001 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [Gall...us gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 83% ...

  14. NCBI nr-aa BLAST: CBRC-DRER-03-0035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-03-0035 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [Gall...us gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 88% ...

  15. NCBI nr-aa BLAST: CBRC-FCAT-01-1136 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-1136 sp|P34998|CRFR1_HUMAN Corticotropin-releasing factor receptor 1 p...recursor (CRF-R) (CRF1) (Corticotropin-releasing hormone receptor 1) (CRH-R 1) gb|AAA35719.1| corticotropin releasing... factor receptor gb|AAC69993.1| corticotropin-releasing factor type 1 receptor [Homo sapiens] P34998 3e-51 45% ...

  16. NCBI nr-aa BLAST: CBRC-CFAM-09-0011 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-09-0011 sp|P34998|CRFR1_HUMAN Corticotropin-releasing factor receptor 1 p...recursor (CRF-R) (CRF1) (Corticotropin-releasing hormone receptor 1) (CRH-R 1) gb|AAA35719.1| corticotropin releasing... factor receptor gb|AAC69993.1| corticotropin-releasing factor type 1 receptor [Homo sapiens] P34998 0.0 91% ...

  17. NCBI nr-aa BLAST: CBRC-CJAC-01-0121 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CJAC-01-0121 sp|P34998|CRFR1_HUMAN Corticotropin-releasing factor receptor 1 p...recursor (CRF-R) (CRF1) (Corticotropin-releasing hormone receptor 1) (CRH-R 1) gb|AAA35719.1| corticotropin releasing... factor receptor gb|AAC69993.1| corticotropin-releasing factor type 1 receptor [Homo sapiens] P34998 0.0 90% ...

  18. NCBI nr-aa BLAST: CBRC-XTRO-01-0916 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-0916 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [Gall...us gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 84% ...

  19. NCBI nr-aa BLAST: CBRC-GACU-05-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-05-0008 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [Gall...us gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 79% ...

  20. NCBI nr-aa BLAST: CBRC-GGAL-27-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-27-0004 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [Gall...us gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 99% ...

  1. Dynamics of Growth and Development of Banana (Musa AAA Simmonds cvs. Gran Enano and Valery Dinámica del Crecimiento y Desarrollo del Banano (Musa AAA Simmonds cvs. Gran Enano y Valery

    Directory of Open Access Journals (Sweden)

    Ana María Martínez Acosta

    2011-12-01

    Full Text Available This research was conducted in the banana zone on Urabá (Colombia, whith cvs. Gran Enano and Valery. Since planting, each three to four leaves sprouted, three plants per variety were sampled, each corresponding to a repetition. These were separated into its different organs and the total dry matter was estimated. Each cv. was analyzed on a growth curve. The dry matter accumulation on both cvs. is adjusted to the typical sigmoid curve of the plant growth. In the exponential phase, the corm was the main source of assimilates for the development; while in the lineal and senescence phase, the pseudo-stem and leaves were the reservoir organs; when the bunch is formed, such reserves were sent to this drain. In general, while the development progressed, the vegetative organs did not show any dry matter lost, only reduction in the assimilates accumulation rate; unlike the bunch that from its emission kept a high rate, leading the fruit to represent, in the harvest season, almost 50% of the total dry matter of the plant.El estudio se realizó en la zona bananera de Urabá (Colombia; con los cvs. Gran Enano y Valery. A partir de la siembra, cada tres a cuatro hojas emitidas, se muestrearon tres plantas por cv., cada una correspondiente a una repetición. Estas se separaron en sus diferentes órganos y se estimó la materia seca total. Se analizó cada cv. a partir de curvas de crecimiento. La acumulación de materia seca en ambos cvs. se ajustó al modelo típico de la curva sigmoidea del crecimiento vegetal. En la fase exponencial, el cormo fue la principal fuente de asimilados para el desarrollo;mientras que en la fase lineal y de senescencia,el pseudotallo y hojas fueron órganos reservorio; al formarse el racimo, tales reservas fueron enviadas a ese sumidero. En general, a medida que avanzaba el desarrollo, los órganos vegetativos no presentaron pérdidas de materia seca, solo disminución en la tasa de acumulación de asimilados;a diferencia del racimo que desde su emisión mantuvo una tasa elevada, llevando a que al momento de la cosecha el fruto, representara cerca del 50% de la materia seca total de la planta.

  2. Effects of gamma radiation on banana 'nanica' (Musa sp., group AAA) irradiated in pre climacteric phase; Efeitos da radicao gama em banana 'nanica' (Musa sp., grupo AAA) irradiada na fase pre-climaterica

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Simone Faria [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Agroindutria de Alimentos e Nutricao; Dionisio, Ana Paula [Universidade Estadual de Campinas (FEA/UNICAMP), SP (Brazil). Faculdade de Engenharia de Alimentos. Dept. de Ciencia de Alimentos; Walder, Julio Marcos Melges [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil). Lab. de Radioentomologia e Irradiacao de Alimentos

    2007-07-15

    The present work verified the effect of gamma radiation on physical and chemical parameters of banana 'nanica', analyzing possible alterations on the period of conservation and the possibility of commercial irradiation aiming the exportation. The results had demonstrated that the radiations had not produced effect on pH and total acidity. However, the bananas of the 'control group' and those that had received 0,75 kGy, had presented greater maturation degree and, radiated with 0,30 kGy, had presented greater firmness. In accordance with the results of the organoleptic analysis, can be perceived that the bananas most mature, especially of the 'control group', had had greater acceptance. The bananas of treatments 0,30 and 0,60 kGy had had minors notes for presenting minor maturation stadium. Knowing that the irradiation in adequate dose and fruits of good quality brings benefits to the storage and the process of exportation, we conclude that the dose most appropriate for the control of the maturation of the 'nanica' banana is 0,30 kGy. (author)

  3. Thalassemia intermedia as a result of heterozygosis for ß0-thalassemia and aaaanti-3.7/aa genotype in a Brazilian patient

    Directory of Open Access Journals (Sweden)

    Kimura E.M.

    2003-01-01

    Full Text Available We report a case in which the interaction of heterozygosis for both the ß0-IVS-II-1 (G->A mutation and the aaaanti-3.7 allele was the probable cause for the clinical occurrence of thalassemia intermedia. The propositus, a 6-year-old Caucasian Brazilian boy of Portuguese descent, showed a moderately severe chronic anemia in spite of having the ß-thalassemia trait. Investigation of the alpha-globin gene status revealed heterozygosis for alpha-gene triplication (aaa/aa. The patient's father, also presenting mild microcytic and hypochromic anemia, had the same alpha and ß genotypes as his son, while the mother, not related to the father and hematologically normal, was also a carrier of the aaaanti-3.7 allele. The present case emphasizes the need for considering the possibility of alpha-gene triplication in ß-thalassemia heterozygotes who display an unexpected severe phenotype. The ß-thalassemia mutation found here is being described for the first time in Brazil.

  4. Abia, AA

    African Journals Online (AJOL)

    Abia, AA. Vol 4, No 6 (2010) - Articles Studies on the kinetics and intraparticle diffusivities of BOD, colour and TSS reduction from palm oil mill effluent (POME) using boiler fly ash. Abstract PDF. ISSN: 1996-0786. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More ...

  5. Adejumo, AA

    African Journals Online (AJOL)

    Adejumo, AA. Vol 6, No 2 (2014) - Articles Assessment of Tourists Flow and Revenue Generation in Kainji Lake National Park, Nigeria Abstract PDF. ISSN: 2141-1778. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and ...

  6. Adepeju, AA

    African Journals Online (AJOL)

    Adepeju, AA. Vol 19, No 2 (2010) - Articles Assessment of Ethical and Other Professional Standards in Private Medical Laboratories; Osun State Experience. Abstract. ISSN: 1116-1043. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  7. Wornyo, AA

    African Journals Online (AJOL)

    Wornyo, AA. Vol 2, No 1 (2012) - Articles Addressing the Difficulties of Learners in the Reading Class Abstract. ISSN: 2026-6081. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use · Contact AJOL ...

  8. The role of the N-domain in the ATPase activity of the mammalian AAA ATPase p97/VCP.

    Science.gov (United States)

    Niwa, Hajime; Ewens, Caroline A; Tsang, Chun; Yeung, Heidi O; Zhang, Xiaodong; Freemont, Paul S

    2012-03-09

    p97/valosin-containing protein (VCP) is a type II ATPase associated with various cellular activities that forms a homohexamer with each protomer containing an N-terminal domain (N-domain); two ATPase domains, D1 and D2; and a disordered C-terminal region. Little is known about the role of the N-domain or the C-terminal region in the p97 ATPase cycle. In the p97-associated human disease inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia, the majority of missense mutations are located at the N-domain D1 interface. Structure-based predictions suggest that such mutations affect the interaction of the N-domain with D1. Here we have tested ten major inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia-linked mutants for ATPase activity and found that all have increased activity over the wild type, with one mutant, p97(A232E), having three times higher activity. Further mutagenesis of p97(A232E) shows that the increase in ATPase activity is mediated through D2 and requires both the N-domain and a flexible ND1 linker. A disulfide mutation that locks the N-domain to D1 in a coplanar position reversibly abrogates ATPase activity. A cryo-EM reconstruction of p97(A232E) suggests that the N-domains are flexible. Removal of the C-terminal region also reduces ATPase activity. Taken together, our data suggest that the conformation of the N-domain in relation to the D1-D2 hexamer is directly linked to ATP hydrolysis and that the C-terminal region is required for hexamer stability. This leads us to propose a model where the N-domain adopts either of two conformations: a flexible conformation compatible with ATP hydrolysis or a coplanar conformation that is inactive.

  9. Pareto front analysis of 6 and 15 MV dynamic IMRT for lung cancer using pencil beam, AAA and Monte Carlo

    DEFF Research Database (Denmark)

    Ottosson, R O; Hauer, Anna Karlsson; Behrens, C.F.

    2010-01-01

    The pencil beam dose calculation method is frequently used in modern radiation therapy treatment planning regardless of the fact that it is documented inaccurately for cases involving large density variations. The inaccuracies are larger for higher beam energies. As a result, low energy beams are...

  10. Human Origins: Problems in the Interpretation of New Evidence. Third Edition. AAAS Study Guides on Contemporary Problems.

    Science.gov (United States)

    Almquist, Alan J.; Cronin, John E.

    This Chautauqua-type short course in human evolution is divided into two parts: The Biochemical Evidence for Human Evolution, and the Fossil Evidence for Human Evolution. The first part covers the comparison of macromolecular differences between species. This includes comparison of DNA base-ratios and amino acid substitution in enzymes and other…

  11. The hetero-hexameric nature of a chloroplast AAA+ FtsH protease contributes to its thermodynamic stability.

    Directory of Open Access Journals (Sweden)

    Ofer Moldavski

    Full Text Available FtsH is an evolutionary conserved membrane-bound metalloprotease complex. While in most prokaryotes FtsH is encoded by a single gene, multiple FtsH genes are found in eukaryotes. Genetic and biochemical data suggest that the Arabidopsis chloroplast FtsH is a hetero-hexamer. This raises the question why photosynthetic organisms require a heteromeric complex, whereas in most bacteria a homomeric one is sufficient. To gain structural information of the possible complexes, the Arabidopsis FtsH2 (type B and FtsH5 (type A were modeled. An in silico study with mixed models of FtsH2/5 suggests that heteromeric hexamer structure with ratio of 4:2 is more likely to exists. Specifically, calculation of the buried surface area at the interfaces between neighboring subunits revealed that a hetero-complex should be thermodynamically more stable than a homo-hexamer, due to the presence of additional hydrophobic and hydrophilic interactions. To biochemically assess this model, we generated Arabidopsis transgenic plants, expressing epitope-tagged FtsH2 and immuno-purified the protein. Mass-spectrometry analysis showed that FtsH2 is associated with FtsH1, FtsH5 and FtsH8. Interestingly, we found that 'type B' subunits (FtsH2 and FtsH8 were 2-3 fold more abundant than 'type A' (FtsH1 and FtsH5. The biochemical data corroborate the in silico model and suggest that the thylakoid FtsH hexamer is composed of two 'type A' and four 'type B' subunits.

  12. Efecto biofungicida del gel de Aloe vera sobre Mycosphaerella fijiensis, agente causal de la Sigatoka negra en Musa (AAA

    Directory of Open Access Journals (Sweden)

    Edwin Jaramillo Aguilar

    2017-01-01

    Full Text Available El objetivo de este trabajo fue evaluar a nivel in vitro la actividad antifúngica del gel de Aloe vera sobre el crecimiento micelial de Mycosphaerella fijiensis. Se utilizó la técnica de envenenamiento en el medio de cultivo PDA para determinar la actividad antifúngica del gel. El diseño utilizado fue completamente al azar, con siete tratamientos y tres repeticiones. En los tratamientos se utilizó un fungicida químico comercial (propiconazol, a 250 ppm y 500 ppm; un biofungicida comercial (Trichoderma sp. a 500 ppm y 1000 ppm; ambos productos se usaron como testigo químico y biológico, respectivamente; el gel de Aloe vera a 500 ppm y 1000 ppm; y un testigo absoluto. Se determinó diferencias significativas entre los tratamientos (ANOVA, El test de Tukey demostró que todos los tratamientos registraron diferencia significativa (p ≤ 0,05 con respecto al testigo absoluto. El propiconazol presentó el mayor porcentaje de inhibición del micelio (73,10%; el test de Tukey y el porcentaje de inhibición del micelio presentaron valores similares en el control del crecimiento del hongo a los 30 días de inoculación, en los tratamientos gel de Aloe vera y el T6 de Trichoderma sp. Los resultados sugieren que el Aloe vera podría ser un adecuado biofungicida para el control de Mycosphaerella fijiensis, agente causal de la Sigatoka negra.

  13. Genome-wide identification and characterization of the superoxide dismutase gene family in Musa acuminata cv. Tianbaojiao (AAA group).

    Science.gov (United States)

    Feng, Xin; Lai, Zhongxiong; Lin, Yuling; Lai, Gongti; Lian, Conglong

    2015-10-20

    Superoxide dismutase (SOD) is an essential enzyme of the plant antioxidant system that responds to oxidative stresses caused by adverse conditions. Banana is an important staple and economic crop in tropical and subtropical regions. However, its growth and yield are constantly affected by various abiotic stresses. To analyze the roles of distinct SOD genes under various stresses, a detailed characterization and analysis of the SOD gene family in Cavendish banana is indispensable. The presence and structure of the SOD family genes were experimentally verified using 5'/3' RACE-PCR, reverse transcription PCR and PCR. Then, their syntenic relationships, conserved motifs and phylogenetic relationships were analyzed using software. Cis-elements present in the promoters were predicted via PlantCARE. And the expression levels under abiotic and hormonal stresses were determined using real-time quantitative polymerase chain reaction. In total, 25 'Tianbaojiao' SOD cDNAs (MaSODs), which encoded six Cu/ZnSODs, four MnSODs and two FeSODs, were cloned. The 12 MaSOD genes were divided into four groups based on their conserved motifs, which corroborated their classifications based on gene-structure patterns and subcellular localizations. Eleven MaSOD promoters were isolated and found to contain many cis-acting elements involved in stress responses. Gene expression analysis showed that 11 out of the 12 MaSODs were expressed in all tested tissues (leaf, pseudostem and root), whereas MaCSD2B was expressed only in leaves and roots. Specific MaSOD members exhibited different expression patterns under abiotic and hormonal treatments. Among the 12 MaSOD genes, MaCSD1D was the only one that responded to all eight treatments, suggesting that this gene plays a predominant role in reactive oxygen species scavenging caused by various stresses in banana. A genome-wide analysis showed that the 'Tianbaojiao' banana harbored an expanded SOD gene family. Whole genome duplication, segmental duplication and complex transcriptional regulation contributed to the gene expansion and mRNA diversity of the MaSODs. The expression patterns of distinct MaSOD genes showed that they are important responses to different abiotic and hormonal stresses in banana.

  14. A Greenhouse Bioassay for the Fusarium oxysporum f. sp. cubense x ‘Grand Naine’ (Musa, AAA, Cavendish Subgroup) Interaction

    NARCIS (Netherlands)

    Dita Rodriguez, M.A.; Waalwijk, C.; Paiva, L.V.; Souza, M.T.; Kema, G.H.J.

    2011-01-01

    Several disease resistance screening protocols for Fusarium wilt of banana (causal agent Fusarium oxysporum f. sp. cubense - Foc) under greenhouse conditions have been reported. Here, we report a standardised rapid and reliable greenhouse bioassay for this pathosystem. This is indispensable for

  15. A Greenhouse Bioassay for the Fusarium oxysporum f. sp. cubense x ‘Grand Naine’ (Musa, AAA, Cavendish Subgroup) Interaction

    OpenAIRE

    Dita Rodriguez, M.A.; Waalwijk, C.; Paiva, L.V.; Souza, M.T.; Kema, G.H.J.

    2011-01-01

    Several disease resistance screening protocols for Fusarium wilt of banana (causal agent Fusarium oxysporum f. sp. cubense - Foc) under greenhouse conditions have been reported. Here, we report a standardised rapid and reliable greenhouse bioassay for this pathosystem. This is indispensable for banana phenotyping, particularly since the occurrence of tropical race 4 (TR4), which is a significant threat for the global Cavendish-based banana export industry. Using a double-pot system, hardened ...

  16. Wound-induced pectin methylesterases enhance banana (Musa spp. AAA) susceptibility to Fusarium oxysporum f. sp. cubense.

    Science.gov (United States)

    Ma, Li; Jiang, Shuang; Lin, Guimei; Cai, Jianghua; Ye, Xiaoxi; Chen, Houbin; Li, Minhui; Li, Huaping; Takác, Tomás; Samaj, Jozef; Xu, Chunxiang

    2013-05-01

    Recent studies suggest that plant pectin methylesterases (PMEs) are directly involved in plant defence besides their roles in plant development. However, the molecular mechanisms of PME action on pectins are not well understood. In order to understand how PMEs modify pectins during banana (Musa spp.)-Fusarium interaction, the expression and enzyme activities of PMEs in two banana cultivars, highly resistant or susceptible to Fusarium, were compared with each other. Furthermore, the spatial distribution of PMEs and their effect on pectin methylesterification of 10 individual homogalacturonan (HG) epitopes with different degrees of methylesterification (DMs) were also examined. The results showed that, before pathogen treatment, the resistant cultivar displayed higher PME activity than the susceptible cultivar, corresponding well to the lower level of pectin DM. A significant increase in PME expression and activity and a decrease in pectin DM were observed in the susceptible cultivar but not in the resistant cultivar when plants were wounded, which was necessary for successful infection. With the increase of PME in the wounded susceptible cultivar, the JIM5 antigen (low methyestrified HGs) increased. Forty-eight hours after pathogen infection, the PME activity and expression in the susceptible cultivar were higher than those in the resistant cultivar, while the DM was lower. In conclusion, the resistant and the susceptible cultivars differ significantly in their response to wounding. Increased PMEs and thereafter decreased DMs acompanied by increased low methylesterified HGs in the root vascular cylinder appear to play a key role in determination of banana susceptibility to Fusarium.

  17. Transcripts and MicroRNAs Responding to Salt Stress in Musa acuminata Colla (AAA Group cv. Berangan Roots.

    Directory of Open Access Journals (Sweden)

    Wan Sin Lee

    Full Text Available Physiological responses to stress are controlled by expression of a large number of genes, many of which are regulated by microRNAs. Since most banana cultivars are salt-sensitive, improved understanding of genetic regulation of salt induced stress responses in banana can support future crop management and improvement in the face of increasing soil salinity related to irrigation and climate change. In this study we focused on determining miRNA and their targets that respond to NaCl exposure and used transcriptome sequencing of RNA and small RNA from control and NaCl-treated banana roots to assemble a cultivar-specific reference transcriptome and identify orthologous and Musa-specific miRNA responding to salinity. We observed that, banana roots responded to salinity stress with changes in expression for a large number of genes (9.5% of 31,390 expressed unigenes and reduction in levels of many miRNA, including several novel miRNA and banana-specific miRNA-target pairs. Banana roots expressed a unique set of orthologous and Musa-specific miRNAs of which 59 respond to salt stress in a dose-dependent manner. Gene expression patterns of miRNA compared with those of their predicted mRNA targets indicated that a majority of the differentially expressed miRNAs were down-regulated in response to increased salinity, allowing increased expression of targets involved in diverse biological processes including stress signaling, stress defence, transport, cellular homeostasis, metabolism and other stress-related functions. This study may contribute to the understanding of gene regulation and abiotic stress response of roots and the high-throughput sequencing data sets generated may serve as important resources related to salt tolerance traits for functional genomic studies and genetic improvement in banana.

  18. Comparative biochemical analysis after steam pretreatment of lignocellulosic agricultural waste biomass from Williams Cavendish banana plant (Triploid Musa AAA group).

    Science.gov (United States)

    Kamdem, Irénée; Jacquet, Nicolas; Tiappi, Florian Mathias; Hiligsmann, Serge; Vanderghem, Caroline; Richel, Aurore; Jacques, Philippe; Thonart, Philippe

    2015-11-01

    The accessibility of fermentable substrates to enzymes is a limiting factor for the efficient bioconversion of agricultural wastes in the context of sustainable development. This paper presents the results of a biochemical analysis performed on six combined morphological parts of Williams Cavendish Lignocellulosic Biomass (WCLB) after steam cracking (SC) and steam explosion (SE) pretreatments. Solid (S) and liquid (L) fractions (Fs) obtained from SC pretreatment performed at 180°C (SLFSC180) and 210°C (SLFSC210) generated, after diluted acid hydrolysis, the highest proportions of neutral sugar (NS) contents, specifically 52.82 ± 3.51 and 49.78 ± 1.39%w/w WCLB dry matter (DM), respectively. The highest proportions of glucose were found in SFSC210 (53.56 ± 1.33%w/w DM) and SFSC180 (44.47 ± 0.00%w/w DM), while the lowest was found in unpretreated WCLB (22.70 ± 0.71%w/w DM). Total NS content assessed in each LF immediately after SC and SE pretreatments was less than 2%w/w of the LF DM, thus revealing minor acid autohydrolysis consequently leading to minor NS production during the steam pretreatment. WCLB subjected to SC at 210 °C (SC210) generated up to 2.7-fold bioaccessible glucan and xylan. SC and SE pretreatments showed potential for the deconstruction of WCLB (delignification, depolymerization, decrystallization and deacetylation), enhancing its enzymatic hydrolysis. The concentrations of enzymatic inhibitors, such as 2-furfuraldehyde and 5-(hydroxymethyl)furfural from LFSC210, were the highest (41 and 21 µg ml(-1), respectively). This study shows that steam pretreatments in general and SC210 in particular are required for efficient bioconversion of WCLB. Yet, biotransformation through biochemical processes (e.g., anaerobic digestion) must be performed to assess the efficiency of these pretreatments. © The Author(s) 2015.

  19. Revolution rather than rotation of AAA+ hexameric phi29 nanomotor for viral dsDNA packaging without coiling☆

    Science.gov (United States)

    Schwartz, Chad; De Donatis, Gian Marco; Zhang, Hui; Fang, Huaming; Guo, Peixuan

    2013-01-01

    It has long been believed that the DNA-packaging motor of dsDNA viruses utilizes a rotation mechanism. Here we report a revolution rather than rotation mechanism for the bacteriophage phi29 DNA packaging motor. The phi29 motor contains six copies of the ATPase (Schwartz et al., this issue); ATP binding to one ATPase subunit stimulates the ATPase to adopt a conformation with a high affinity for dsDNA. ATP hydrolysis induces a new conformation with a lower affinity, thus transferring the dsDNA to an adjacent subunit by a power stroke. DNA revolves unidirectionally along the hexameric channel wall of the ATPase, but neither the dsDNA nor the ATPase itself rotates along its own axis. One ATP is hydrolyzed in each transitional step, and six ATPs are consumed for one helical turn of 360°. Transition of the same dsDNA chain along the channel wall, but at a location 60° different from the last contact, urges dsDNA to move forward 1.75 base pairs each step (10.5 bp per turn/6ATP=1.75 bp per ATP). Each connector subunit tilts with a left-handed orientation at a 30° angle in relation to its vertical axis that runs anti-parallel to the right-handed dsDNA helix, facilitating the one-way traffic of dsDNA. The connector channel has been shown to cause four steps of transition due to four positively charged lysine rings that make direct contact with the negatively charged DNA phosphate backbone. Translocation of dsDNA into the procapsid by revolution avoids the difficulties during rotation that are associated with DNA supercoiling. Since the revolution mechanism can apply to any stoichiometry, this motor mechanism might reconcile the stoichiometry discrepancy in many phage systems where the ATPase has been found as a tetramer, hexamer, or nonamer. PMID:23763768

  20. Revolution rather than rotation of AAA+ hexameric phi29 nanomotor for viral dsDNA packaging without coiling.

    Science.gov (United States)

    Schwartz, Chad; De Donatis, Gian Marco; Zhang, Hui; Fang, Huaming; Guo, Peixuan

    2013-08-15

    It has long been believed that the DNA-packaging motor of dsDNA viruses utilizes a rotation mechanism. Here we report a revolution rather than rotation mechanism for the bacteriophage phi29 DNA packaging motor. The phi29 motor contains six copies of the ATPase (Schwartz et al., this issue); ATP binding to one ATPase subunit stimulates the ATPase to adopt a conformation with a high affinity for dsDNA. ATP hydrolysis induces a new conformation with a lower affinity, thus transferring the dsDNA to an adjacent subunit by a power stroke. DNA revolves unidirectionally along the hexameric channel wall of the ATPase, but neither the dsDNA nor the ATPase itself rotates along its own axis. One ATP is hydrolyzed in each transitional step, and six ATPs are consumed for one helical turn of 360°. Transition of the same dsDNA chain along the channel wall, but at a location 60° different from the last contact, urges dsDNA to move forward 1.75 base pairs each step (10.5bp per turn/6ATP=1.75bp per ATP). Each connector subunit tilts with a left-handed orientation at a 30° angle in relation to its vertical axis that runs anti-parallel to the right-handed dsDNA helix, facilitating the one-way traffic of dsDNA. The connector channel has been shown to cause four steps of transition due to four positively charged lysine rings that make direct contact with the negatively charged DNA phosphate backbone. Translocation of dsDNA into the procapsid by revolution avoids the difficulties during rotation that are associated with DNA supercoiling. Since the revolution mechanism can apply to any stoichiometry, this motor mechanism might reconcile the stoichiometry discrepancy in many phage systems where the ATPase has been found as a tetramer, hexamer, or nonamer. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Caracterización de harina y almidón de frutos de banano Gros Michel (Musa acuminata AAA

    Directory of Open Access Journals (Sweden)

    Jairo Montoya-López

    2015-01-01

    Full Text Available En el estudio se determinaron las características fisicoquímicas, térmicas y reológicas de la harina y el almidón de frutos de banano Gros Michel (Musa acuminata cosechado en fincas del departamento del Quindío, Colombia. En el análisis proximal, la harina presentó un contenido de fibra de 18.82% y el almidón presentó contenidos de proteína de 1.92%, grasa de 5.3% y fibra de 2.76%. La harina presentó la temperatura más alta de absorción de calor (68.88 °C y su entalpía de gelatinización fue de 2.17 J/g; mientras que para el almidón estos valores fueron de 48.36 °C y 44.62 J/g, respectivamente. El análisis termogravimétrico (TGA de la harina o temperaturas en las cuales se registra la descomposición de carbohidratos (componentes de bajo peso molecular y polisacáridos (componentes de alto peso molecular fueron, respectivamente, de 284.51 °C y 470.42 °C; y para el almidón fueron de 307.51 °C y 500.46 °C. Los gránulos de almidón de banano tienen forma elipsoidal con un tamaño longitudinal promedio de 39.39 µm y tamaño transversal promedio de 29.47 µm. Los difractogramas de rayos X mostraron patrones de difracción tipo B. Los viscoamilogramas mostraron que para la harina la temperatura de inicio de gelatinización (Tg es de 76.3 °C, la viscosidad máxima de 1120 cP, y para el almidón la Tg fue de 70.75 °C y la viscosidad máxima de 2087 cP.

  2. Molecular characterization of CONSTANS-Like (COL) genes in banana (Musa acuminata L. AAA Group, cv. Grand Nain).

    Science.gov (United States)

    Chaurasia, Akhilesh Kumar; Patil, Hemant Bhagwan; Azeez, Abdul; Subramaniam, Vadakanthara Ramakrishnan; Krishna, Bal; Sane, Aniruddha Prafullachandra; Sane, Prafullachandra Vishnu

    2016-01-01

    The CONSTANS (CO) family is an important regulator of flowering in photoperiod sensitive plants. But information regarding their role in day neutral plants is limited. We report identification of nine Group I type CONSTANS-like (COL) genes of banana and their characterization for their age dependent, diurnal and tissue-specific expression. Our studies show that the Group I genes are conserved in structure to members in other plants. Expression of these genes shows a distinct circadian regulation with a peak during light period. Developmental stage specific expression reveals high level transcript accumulation of two genes, MaCOL3a and MaCOL3b, well before flowering and until the initiation of flowering. A decrease in their transcript levels after initiation of flowering is followed by an increase in transcription of other members that coincides with the continued development of the inflorescence and fruiting. CO binding cis-elements are observed in at least three FT -like genes in banana suggesting possible CO-FT interactions that might regulate flowering. Distinct tissue specific expression patterns are observed for different family members in mature leaves, apical inflorescence, bracts, fruit skin and fruit pulp suggesting possible roles other than flowering. This is the first exhaustive study of the COL genes belonging to Group I of banana.

  3. S&P: meie kohus oli USA riigireitingut alandada / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2011-01-01

    Standard & Poor´s langetas USA reitingut tasemelt AAA tasemeni AA+. Agentuuri esindaja sõnul oli reitingu alandamine nende kohustus, sest nende arvates oli USA senine reiting liiga kõrge. Hiina nõuab, et USA hakkaks oma võlaprobleemiga tegelema. AAA reiting on nüüd vaid 15 riigil või territooriumil maailmas

  4. NCBI nr-aa BLAST: CBRC-TNIG-14-0023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-14-0023 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 74% ...

  5. NCBI nr-aa BLAST: CBRC-MDOM-02-0334 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-02-0334 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor emb|CAA39332.1| CB1 cannabinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cann...abinoid receptor [Rattus norvegicus] gb|EDL98589.1| cannabinoid receptor 1 (bra...in) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 94% ...

  6. NCBI nr-aa BLAST: CBRC-GGOR-01-1297 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGOR-01-1297 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor emb|CAA39332.1| CB1 cannabinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cann...abinoid receptor [Rattus norvegicus] gb|EDL98589.1| cannabinoid receptor 1 (bra...in) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  7. NCBI nr-aa BLAST: CBRC-PHAM-01-1594 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-1594 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor emb|CAA39332.1| CB1 cannabinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cann...abinoid receptor [Rattus norvegicus] gb|EDL98589.1| cannabinoid receptor 1 (bra...in) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  8. NCBI nr-aa BLAST: CBRC-OANA-01-2200 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-2200 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 93% ...

  9. NCBI nr-aa BLAST: CBRC-FRUB-02-0074 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0074 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 1e-159 61% ...

  10. NCBI nr-aa BLAST: CBRC-RNOR-05-0081 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-05-0081 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 100% ...

  11. NCBI nr-aa BLAST: CBRC-OPRI-01-0982 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-0982 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor emb|CAA39332.1| CB1 cannabinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cann...abinoid receptor [Rattus norvegicus] gb|EDL98589.1| cannabinoid receptor 1 (bra...in) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  12. NCBI nr-aa BLAST: CBRC-MMUR-01-1494 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1494 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor emb|CAA39332.1| CB1 cannabinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cann...abinoid receptor [Rattus norvegicus] gb|EDL98589.1| cannabinoid receptor 1 (bra...in) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  13. NCBI nr-aa BLAST: CBRC-TGUT-05-0032 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-05-0032 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 92% ...

  14. NCBI nr-aa BLAST: CBRC-DNOV-01-3023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DNOV-01-3023 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  15. NCBI nr-aa BLAST: CBRC-TSYR-01-1316 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TSYR-01-1316 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor emb|CAA39332.1| CB1 cannabinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cann...abinoid receptor [Rattus norvegicus] gb|EDL98589.1| cannabinoid receptor 1 (bra...in) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 81% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0195 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  17. NCBI nr-aa BLAST: CBRC-MEUG-01-1939 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-1939 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor emb|CAA39332.1| CB1 cannabinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cann...abinoid receptor [Rattus norvegicus] gb|EDL98589.1| cannabinoid receptor 1 (bra...in) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 94% ...

  18. NCBI nr-aa BLAST: CBRC-HSAP-06-0074 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-06-0074 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  19. NCBI nr-aa BLAST: CBRC-STRI-01-2565 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2565 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor emb|CAA39332.1| CB1 cannabinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cann...abinoid receptor [Rattus norvegicus] gb|EDL98589.1| cannabinoid receptor 1 (bra...in) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 2e-82 91% ...

  20. NCBI nr-aa BLAST: CBRC-CFAM-12-0016 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-12-0016 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 98% ...

  1. NCBI nr-aa BLAST: CBRC-TBEL-01-1883 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-1883 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 98% ...

  2. NCBI nr-aa BLAST: CBRC-ACAR-01-0845 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0845 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 86% ...

  3. NCBI nr-aa BLAST: CBRC-GGAL-03-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-03-0034 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 93% ...

  4. NCBI nr-aa BLAST: CBRC-OCUN-01-1522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OCUN-01-1522 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 1e-28 94% ...

  5. NCBI nr-aa BLAST: CBRC-RMAC-04-0050 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-04-0050 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  6. NCBI nr-aa BLAST: CBRC-CJAC-01-1332 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CJAC-01-1332 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  7. NCBI nr-aa BLAST: CBRC-EEUR-01-1648 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-EEUR-01-1648 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  8. NCBI nr-aa BLAST: CBRC-ETEL-01-1516 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ETEL-01-1516 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  9. NCBI nr-aa BLAST: CBRC-MMUS-04-0013 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-04-0013 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 99% ...

  10. NCBI nr-aa BLAST: CBRC-PTRO-07-0067 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-07-0067 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  11. NCBI nr-aa BLAST: CBRC-VPAC-01-1554 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1554 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor emb|CAA39332.1| CB1 cannabinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cann...abinoid receptor [Rattus norvegicus] gb|EDL98589.1| cannabinoid receptor 1 (bra...in) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 94% ...

  12. NCBI nr-aa BLAST: CBRC-PABE-07-0058 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PABE-07-0058 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  13. NCBI nr-aa BLAST: CBRC-FCAT-01-1020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-1020 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 98% ...

  14. NCBI nr-aa BLAST: CBRC-LAFR-01-1734 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-LAFR-01-1734 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cann...abinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cann...abinoid receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 91% ...

  15. NCBI nr-aa BLAST: CBRC-PCAP-01-1368 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-1368 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT RecName: Full=Cannabinoid receptor 1; Short=CB1; Short=CB-R; AltName: Full=Brain-type cann...abinoid receptor emb|CAA39332.1| CB1 cannabinoid receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cann...abinoid receptor [Rattus norvegicus] gb|EDL98589.1| cannabinoid receptor 1 (bra...in) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  16. NCBI nr-aa BLAST: CBRC-TTRU-01-1088 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-1088 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RecName: Full=RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor [Homo sapiens] gb|AAB92384.1| RPE-retinal G protein coupled recep...tor [Homo sapiens] gb|EAW80358.1| retinal G protein coupled receptor, isoform CRA_e [Homo sapiens] NP_001012738.1 1e-101 85% ...

  17. NCBI nr-aa BLAST: CBRC-PVAM-01-1271 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-1271 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RecName: Full=RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor [Homo sapiens] gb|AAB92384.1| RPE-retinal G protein coupled recep...tor [Homo sapiens] gb|EAW80358.1| retinal G protein coupled receptor, isoform CRA_e [Homo sapiens] NP_001012738.1 1e-138 82% ...

  18. NCBI nr-aa BLAST: CBRC-MMUR-01-1282 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1282 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RecName: Full=RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor [Homo sapiens] gb|AAB92384.1| RPE-retinal G protein coupled recep...tor [Homo sapiens] gb|EAW80358.1| retinal G protein coupled receptor, isoform CRA_e [Homo sapiens] NP_001012738.1 1e-117 73% ...

  19. NCBI nr-aa BLAST: CBRC-PCAP-01-0832 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-0832 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RecName: Full=RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor [Homo sapiens] gb|AAB92384.1| RPE-retinal G protein coupled recep...tor [Homo sapiens] gb|EAW80358.1| retinal G protein coupled receptor, isoform CRA_e [Homo sapiens] NP_001012738.1 1e-131 79% ...

  20. NCBI nr-aa BLAST: CBRC-STRI-01-2561 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2561 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RecName: Full=RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor [Homo sapiens] gb|AAB92384.1| RPE-retinal G protein coupled recep...tor [Homo sapiens] gb|EAW80358.1| retinal G protein coupled receptor, isoform CRA_e [Homo sapiens] NP_001012738.1 1e-107 87% ...

  1. NCBI nr-aa BLAST: CBRC-OPRI-01-0735 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-0735 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RecName: Full=RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor [Homo sapiens] gb|AAB92384.1| RPE-retinal G protein coupled recep...tor [Homo sapiens] gb|EAW80358.1| retinal G protein coupled receptor, isoform CRA_e [Homo sapiens] NP_001012738.1 1e-137 82% ...

  2. NCBI nr-aa BLAST: CBRC-MLUC-01-0650 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0650 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RecName: Full=RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor [Homo sapiens] gb|AAB92384.1| RPE-retinal G protein coupled recep...tor [Homo sapiens] gb|EAW80358.1| retinal G protein coupled receptor, isoform CRA_e [Homo sapiens] NP_001012738.1 1e-100 67% ...

  3. NCBI nr-aa BLAST: CBRC-TSYR-01-0651 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TSYR-01-0651 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RecName: Full=RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor [Homo sapiens] gb|AAB92384.1| RPE-retinal G protein coupled recep...tor [Homo sapiens] gb|EAW80358.1| retinal G protein coupled receptor, isoform CRA_e [Homo sapiens] NP_001012738.1 1e-100 72% ...

  4. NCBI nr-aa BLAST: CBRC-PHAM-01-1583 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-1583 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RecName: Full=RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor [Homo sapiens] gb|AAB92384.1| RPE-retinal G protein coupled recep...tor [Homo sapiens] gb|EAW80358.1| retinal G protein coupled receptor, isoform CRA_e [Homo sapiens] NP_001012738.1 1e-127 81% ...

  5. NCBI nr-aa BLAST: CBRC-GGOR-01-1361 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGOR-01-1361 ref|NP_001012738.1| retinal G-protein coupled receptor isoform 2 ...[Homo sapiens] sp|P47804|RGR_HUMAN RecName: Full=RPE-retinal G protein-coupled receptor gb|AAA56748.1| putative RPE-retina...l G protein-coupled receptor [Homo sapiens] gb|AAB92384.1| RPE-retinal G protein coupled recep...tor [Homo sapiens] gb|EAW80358.1| retinal G protein coupled receptor, isoform CRA_e [Homo sapiens] NP_001012738.1 1e-162 95% ...

  6. NCBI nr-aa BLAST: CBRC-TNIG-22-0079 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-22-0079 ref|NP_000862.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo... sapiens] sp|P50406|5HT6R_HUMAN 5-hydroxytryptamine 6 receptor (5-HT-6) (Serotonin receptor 6) gb|AAA92622.1| 5-HT6 serotonin... receptor gb|AAR07900.1| 5-hydroxytryptamine/serotonin receptor 6 [Homo sapiens] gb|AAH7499...6.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo sapiens] gb|AAH74995.1| 5-hydroxytryptamine (seroton...in) receptor 6 [Homo sapiens] emb|CAI19020.1| 5-hydroxytryptamine (serotonin) recep

  7. NCBI nr-aa BLAST: CBRC-TGUT-37-0212 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-37-0212 ref|NP_000862.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo... sapiens] sp|P50406|5HT6R_HUMAN 5-hydroxytryptamine 6 receptor (5-HT-6) (Serotonin receptor 6) gb|AAA92622.1| 5-HT6 serotonin... receptor gb|AAR07900.1| 5-hydroxytryptamine/serotonin receptor 6 [Homo sapiens] gb|AAH7499...6.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo sapiens] gb|AAH74995.1| 5-hydroxytryptamine (seroton...in) receptor 6 [Homo sapiens] emb|CAI19020.1| 5-hydroxytryptamine (serotonin) recep

  8. NCBI nr-aa BLAST: CBRC-TBEL-01-0493 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-0493 ref|NP_000862.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo... sapiens] sp|P50406|5HT6R_HUMAN 5-hydroxytryptamine 6 receptor (5-HT-6) (Serotonin receptor 6) gb|AAA92622.1| 5-HT6 serotonin... receptor gb|AAR07900.1| 5-hydroxytryptamine/serotonin receptor 6 [Homo sapiens] gb|AAH7499...6.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo sapiens] gb|AAH74995.1| 5-hydroxytryptamine (seroton...in) receptor 6 [Homo sapiens] emb|CAI19020.1| 5-hydroxytryptamine (serotonin) recep

  9. NCBI nr-aa BLAST: CBRC-OANA-01-1821 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-1821 ref|NP_000862.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo... sapiens] sp|P50406|5HT6R_HUMAN 5-hydroxytryptamine 6 receptor (5-HT-6) (Serotonin receptor 6) gb|AAA92622.1| 5-HT6 serotonin... receptor gb|AAR07900.1| 5-hydroxytryptamine/serotonin receptor 6 [Homo sapiens] gb|AAH7499...6.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo sapiens] gb|AAH74995.1| 5-hydroxytryptamine (seroton...in) receptor 6 [Homo sapiens] emb|CAI19020.1| 5-hydroxytryptamine (serotonin) recep

  10. NCBI nr-aa BLAST: CBRC-DRER-23-0046 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-23-0046 ref|NP_000862.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo... sapiens] sp|P50406|5HT6R_HUMAN 5-hydroxytryptamine 6 receptor (5-HT-6) (Serotonin receptor 6) gb|AAA92622.1| 5-HT6 serotonin... receptor gb|AAR07900.1| 5-hydroxytryptamine/serotonin receptor 6 [Homo sapiens] gb|AAH7499...6.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo sapiens] gb|AAH74995.1| 5-hydroxytryptamine (seroton...in) receptor 6 [Homo sapiens] emb|CAI19020.1| 5-hydroxytryptamine (serotonin) recep

  11. NCBI nr-aa BLAST: CBRC-MMUS-04-0078 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-04-0078 ref|NP_000862.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo... sapiens] sp|P50406|5HT6R_HUMAN 5-hydroxytryptamine 6 receptor (5-HT-6) (Serotonin receptor 6) gb|AAA92622.1| 5-HT6 serotonin... receptor gb|AAR07900.1| 5-hydroxytryptamine/serotonin receptor 6 [Homo sapiens] gb|AAH7499...6.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo sapiens] gb|AAH74995.1| 5-hydroxytryptamine (seroton...in) receptor 6 [Homo sapiens] emb|CAI19020.1| 5-hydroxytryptamine (serotonin) recep

  12. NCBI nr-aa BLAST: CBRC-OLAT-07-0000 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-07-0000 ref|NP_000862.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo... sapiens] sp|P50406|5HT6R_HUMAN 5-hydroxytryptamine 6 receptor (5-HT-6) (Serotonin receptor 6) gb|AAA92622.1| 5-HT6 serotonin... receptor gb|AAR07900.1| 5-hydroxytryptamine/serotonin receptor 6 [Homo sapiens] gb|AAH7499...6.1| 5-hydroxytryptamine (serotonin) receptor 6 [Homo sapiens] gb|AAH74995.1| 5-hydroxytryptamine (seroton...in) receptor 6 [Homo sapiens] emb|CAI19020.1| 5-hydroxytryptamine (serotonin) recep

  13. NCBI nr-aa BLAST: CBRC-VPAC-01-1432 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1432 ref|NP_776992.1| opsin 1 (cone pigments), short-wave-sensitive [B...os taurus] sp|P51490|OPSB_BOVIN RecName: Full=Blue-sensitive opsin; Short=BOP; AltName: Full=Blue cone photoreceptor pigment... gb|AAA93189.1| visual pigment [Bos taurus] gb|AAB50158.1| blue cone pigment protein [Bos taurus] NP_776992.1 0.0 92% ...

  14. NCBI nr-aa BLAST: CBRC-TTRU-01-0695 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-0695 ref|NP_776992.1| opsin 1 (cone pigments), short-wave-sensitive [B...os taurus] sp|P51490|OPSB_BOVIN RecName: Full=Blue-sensitive opsin; Short=BOP; AltName: Full=Blue cone photoreceptor pigment... gb|AAA93189.1| visual pigment [Bos taurus] gb|AAB50158.1| blue cone pigment protein [Bos taurus] NP_776992.1 1e-155 88% ...

  15. NCBI nr-aa BLAST: CBRC-PVAM-01-1068 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-1068 ref|NP_776992.1| opsin 1 (cone pigments), short-wave-sensitive [B...os taurus] sp|P51490|OPSB_BOVIN RecName: Full=Blue-sensitive opsin; Short=BOP; AltName: Full=Blue cone photoreceptor pigment... gb|AAA93189.1| visual pigment [Bos taurus] gb|AAB50158.1| blue cone pigment protein [Bos taurus] NP_776992.1 0.0 92% ...

  16. NCBI nr-aa BLAST: CBRC-OPRI-01-1437 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-1437 ref|NP_776992.1| opsin 1 (cone pigments), short-wave-sensitive [B...os taurus] sp|P51490|OPSB_BOVIN RecName: Full=Blue-sensitive opsin; Short=BOP; AltName: Full=Blue cone photoreceptor pigment... gb|AAA93189.1| visual pigment [Bos taurus] gb|AAB50158.1| blue cone pigment protein [Bos taurus] NP_776992.1 1e-162 80% ...

  17. NCBI nr-aa BLAST: CBRC-STRI-01-2355 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2355 ref|NP_004373.2| corticotropin releasing hormone receptor 1 isofo...rm 2 [Homo sapiens] gb|AAA35718.1| corticotropin releasing factor receptor [Homo sapiens] emb|CAA51052.1| corticotrophin releasing... factor receptor [Homo sapiens] gb|AAR19768.1| corticotropin releasing hormone recepto...r 1 [Homo sapiens] gb|AAH96836.1| Corticotropin releasing hormone receptor 1 [Hom...o sapiens] dbj|BAG70280.1| corticotropin releasing hormone receptor 1 [Homo sapiens] NP_004373.2 1e-165 80% ...

  18. NCBI nr-aa BLAST: CBRC-RNOR-10-0233 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-10-0233 ref|NP_112261.1| corticotropin releasing hormone receptor 1 [Ratt...us norvegicus] sp|P35353|CRFR1_RAT Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA16441.1| corticotropin-releasing factor receptor gb|A...AC53519.1| corticotropin releasing factor receptor [Rattus norvegicus] gb|EDM06294.1| corticotropin releas...ing hormone receptor 1 [Rattus norvegicus] NP_112261.1 0.0 99% ...

  19. NCBI nr-aa BLAST: CBRC-GGOR-01-1460 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGOR-01-1460 ref|NP_004373.2| corticotropin releasing hormone receptor 1 isofo...rm 2 [Homo sapiens] gb|AAA35718.1| corticotropin releasing factor receptor [Homo sapiens] emb|CAA51052.1| corticotrophin releasing... factor receptor [Homo sapiens] gb|AAR19768.1| corticotropin releasing hormone recepto...r 1 [Homo sapiens] gb|AAH96836.1| Corticotropin releasing hormone receptor 1 [Hom...o sapiens] dbj|BAG70280.1| corticotropin releasing hormone receptor 1 [Homo sapiens] NP_004373.2 0.0 82% ...

  20. NCBI nr-aa BLAST: CBRC-MLUC-01-0880 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0880 ref|NP_004373.2| corticotropin releasing hormone receptor 1 isofo...rm 2 [Homo sapiens] gb|AAA35718.1| corticotropin releasing factor receptor [Homo sapiens] emb|CAA51052.1| corticotrophin releasing... factor receptor [Homo sapiens] gb|AAR19768.1| corticotropin releasing hormone recepto...r 1 [Homo sapiens] gb|AAH96836.1| Corticotropin releasing hormone receptor 1 [Hom...o sapiens] dbj|BAG70280.1| corticotropin releasing hormone receptor 1 [Homo sapiens] NP_004373.2 0.0 91% ...

  1. NCBI nr-aa BLAST: CBRC-MMUS-11-0131 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-11-0131 ref|NP_112261.1| corticotropin releasing hormone receptor 1 [Ratt...us norvegicus] sp|P35353|CRFR1_RAT Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA16441.1| corticotropin-releasing factor receptor gb|A...AC53519.1| corticotropin releasing factor receptor [Rattus norvegicus] gb|EDM06294.1| corticotropin releas...ing hormone receptor 1 [Rattus norvegicus] NP_112261.1 0.0 98% ...

  2. NCBI nr-aa BLAST: CBRC-PVAM-01-1208 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-1208 ref|NP_004373.2| corticotropin releasing hormone receptor 1 isofo...rm 2 [Homo sapiens] gb|AAA35718.1| corticotropin releasing factor receptor [Homo sapiens] emb|CAA51052.1| corticotrophin releasing... factor receptor [Homo sapiens] gb|AAR19768.1| corticotropin releasing hormone recepto...r 1 [Homo sapiens] gb|AAH96836.1| Corticotropin releasing hormone receptor 1 [Hom...o sapiens] dbj|BAG70280.1| corticotropin releasing hormone receptor 1 [Homo sapiens] NP_004373.2 0.0 96% ...

  3. NCBI nr-aa BLAST: CBRC-VPAC-01-0911 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-0911 ref|NP_004373.2| corticotropin releasing hormone receptor 1 isofo...rm 2 [Homo sapiens] gb|AAA35718.1| corticotropin releasing factor receptor [Homo sapiens] emb|CAA51052.1| corticotrophin releasing... factor receptor [Homo sapiens] gb|AAR19768.1| corticotropin releasing hormone recepto...r 1 [Homo sapiens] gb|AAH96836.1| Corticotropin releasing hormone receptor 1 [Hom...o sapiens] dbj|BAG70280.1| corticotropin releasing hormone receptor 1 [Homo sapiens] NP_004373.2 5e-71 57% ...

  4. NCBI nr-aa BLAST: CBRC-PCAP-01-1661 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-1661 ref|NP_004373.2| corticotropin releasing hormone receptor 1 isofo...rm 2 [Homo sapiens] gb|AAA35718.1| corticotropin releasing factor receptor [Homo sapiens] emb|CAA51052.1| corticotrophin releasing... factor receptor [Homo sapiens] gb|AAR19768.1| corticotropin releasing hormone recepto...r 1 [Homo sapiens] gb|AAH96836.1| Corticotropin releasing hormone receptor 1 [Hom...o sapiens] dbj|BAG70280.1| corticotropin releasing hormone receptor 1 [Homo sapiens] NP_004373.2 1e-125 71% ...

  5. NCBI nr-aa BLAST: CBRC-PHAM-01-1677 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-1677 ref|NP_004373.2| corticotropin releasing hormone receptor 1 isofo...rm 2 [Homo sapiens] gb|AAA35718.1| corticotropin releasing factor receptor [Homo sapiens] emb|CAA51052.1| corticotrophin releasing... factor receptor [Homo sapiens] gb|AAR19768.1| corticotropin releasing hormone recepto...r 1 [Homo sapiens] gb|AAH96836.1| Corticotropin releasing hormone receptor 1 [Hom...o sapiens] dbj|BAG70280.1| corticotropin releasing hormone receptor 1 [Homo sapiens] NP_004373.2 0.0 93% ...

  6. NCBI nr-aa BLAST: CBRC-MDOM-02-0161 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-02-0161 ref|NP_004373.2| corticotropin releasing hormone receptor 1 isofo...rm 2 [Homo sapiens] gb|AAA35718.1| corticotropin releasing factor receptor [Homo sapiens] emb|CAA51052.1| corticotrophin releasing... factor receptor [Homo sapiens] gb|AAR19768.1| corticotropin releasing hormone recepto...r 1 [Homo sapiens] gb|AAH96836.1| Corticotropin releasing hormone receptor 1 [Hom...o sapiens] dbj|BAG70280.1| corticotropin releasing hormone receptor 1 [Homo sapiens] NP_004373.2 0.0 92% ...

  7. NCBI nr-aa BLAST: CBRC-MMUR-01-1392 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1392 ref|NP_004373.2| corticotropin releasing hormone receptor 1 isofo...rm 2 [Homo sapiens] gb|AAA35718.1| corticotropin releasing factor receptor [Homo sapiens] emb|CAA51052.1| corticotrophin releasing... factor receptor [Homo sapiens] gb|AAR19768.1| corticotropin releasing hormone recepto...r 1 [Homo sapiens] gb|AAH96836.1| Corticotropin releasing hormone receptor 1 [Hom...o sapiens] dbj|BAG70280.1| corticotropin releasing hormone receptor 1 [Homo sapiens] NP_004373.2 0.0 97% ...

  8. 75 FR 1302 - Hazardous Materials: Transportation of Lithium Batteries

    Science.gov (United States)

    2010-01-11

    ... in medical devices, computer memory and as replaceable batteries (AA and AAA size) suitable for... materials is sound and can be used to effectively mitigate the risk posed by lithium batteries in air...

  9. Prevalence of gastrointestinal pathogenic bacteria in patients with ...

    African Journals Online (AJOL)

    AAA GAA GCT ACT AAG GGT ACA AA. 65 55*. C. difficile tpi gene. 230. 3. TpiR. CAT AAT ATT GGG TCT ATT CCT AC. TcdAF. AGA TTC CTA TAT TTA CAT GAC AAT AT. 65 55*. C. difficile tcdA gene. 369/110†. 3. TcdAR. GTA TCA GGC ATA AAG TAA TAT ACT TT. TcdBF. GGA AAA GAG AAT GGT TTT ATT AA. 65 55*.

  10. Aa Ah Nak

    Science.gov (United States)

    Tha, Na Gya; Wus, Thay

    2017-01-01

    In this article, Aa Ah Nak, the authors' methodology presents not only various reflections but also diverse contradictions about the Aa Nii language as well as language revitalization. This article explores language foundation and how the Aa Nii language revitalization is inextricably linked to the genocide and resulting historic trauma pervasive…

  11. AA under construction

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The AA at an early stage of construction, in the newly built AA-Hall. Cable-trays already outline the shape of the accumulator ring. To the right are huge cable-drums for the pulse-forming-network (PFN) of the injection kicker. Seeing this picture, can one imagine that only 8 months later beams were circulating in the completed accumulator ring ?

  12. Gerald L. Epstein, PhD: director, center for science, technology, and security policy, American Association for the Advancement of Science (AAAS). Interview by Madeline Drexler.

    Science.gov (United States)

    Epstein, Gerald L

    2009-12-01

    Over his entire career, Gerald Epstein has toiled at the nexus of science, technology, and security. From 2003 to 2009, he was Senior Fellow for Science and Security at the Center for Strategic and International Studies Homeland Security Program, where he worked on reducing biological weapons threats, improving national preparedness, and easing potential tensions between the scientific research and national security communities. Epstein came to CSIS from the Institute for Defense Analyses. From 1996 to 2001, he served in the White House Office of Science and Technology Policy. And from 1983 to 1989, and again from 1991 until its demise in 1995, Epstein worked at the Congressional Office of Technology Assessment, where he directed a study on the proliferation of weapons of mass destruction, alongside research on other global security topics. A recognized expert in biological risk reduction, Epstein was actually trained as a physicist, having received SB degrees in physics and electrical engineering from MIT, and a PhD in physics from the University of California at Berkeley. How, then, did he come to study the evolving threat from bioterrorism? "What compelled me about bioterrorism was that it was a stellar example of a topic that would lead to a train wreck between the scientific community and the security community unless they figured out how to work together," he said. "The distance between a laboratory and a very large consequence event is a lot shorter in biology than in any other field. I got into bioterrorism to help make sure that the security community doesn't get so scared of the science that it shuts it down, and that the science community isn't so oblivious of security concerns that it pays no attention to them." Epstein spoke on November 6, 2009, with contributing writer Madeline Drexler, author of Emerging Epidemics: The Menace of New Infections (Penguin, 2009), an updated version of an earlier volume. Drexler holds a visiting appointment at the Harvard School of Public Health and is a senior fellow at Brandeis University's Schuster Institute for Investigative Journalism.

  13. Influencia de la pérdida foliar sobre la cosecha en el cv. Gruesa, Musa acuminata Colla (AAA, cultivado bajo invernadero en las Islas Canarias

    Directory of Open Access Journals (Sweden)

    Juan Cabrera Cabrera

    2010-12-01

    Full Text Available El cultivo de la variedad de platanera Gruesa, selección local de Dwarf Cavendish, ha experimentado un importante aumento en los últimos años en las Islas Canarias, tanto al aire libre como bajo invernadero. La eliminación de hojas, tras la floración, es una práctica habitual en los cultivos bajo invernadero. Asimismo es frecuente la pérdida de hojas por el efecto de los vientos en los cultivos al aire libre. El objetivo de este trabajo es evaluar, mediante simulación de pérdida foliar por daños mecánicos, la influencia que tiene la disminución de superficie foliar sobre el llenado y cosecha de la fruta en dicho cultivar. Para ello, cuatro meses antes de la cosecha se efectuaron cinco niveles de defoliación: 0%, 25%, 50%, 75% y 100%. Se valoran dos métodos diferentes de defoliación, eliminación de limbo foliar y tronchado de hojas con posterior corte de éstas. Se analizan y presentan datos morfológicos, fenológicos y productivos, así como valoración de la metodología empleada en este trabajo para la simulación de daños. A partir de un 25% de defoliado, equivalente a 7.5 hojas funcionales por planta, se detectaron diferencias significativas con las plantas testigos.

  14. Efecto de la sigatoka negra (Mycosphaerella fijiensis sobre la fotosíntesis y transpiración foliar del banano (Musa sp. AAA, cv. Valery

    Directory of Open Access Journals (Sweden)

    Martín Hidalgo

    2006-01-01

    Full Text Available Con el propósito de relacionar el ataque de la Sigatoka negra (Mycosphaerella fijiensis con las tasas fotosintética y de transpiración foliares, se sembraron rebrotes del tercer ciclo de producción de una plantación del cv. Valery en potes plásticos de 4 litros. Las plantas se mantuvieron dentro de un invernadero a humedad relativa y temperatura del 90% y 27°C, respectivamente. Al emitir 6 hojas, las 4 más jóvenes fueron inoculadas con conidios de M. fijiensis a partir de cultivos monospóricos de aislamientos silvestres. Dos riegos diarios por aspersión mantuvieron una película de agua sobre las hojas. Se aplicó una suspensión de 150000 conidios ml-1 sobre el envés de las hojas utilizando un aerógrafo, en 2 fechas con un intervalo de 30 días entre ellas, para obtener diferentes grados de severidad y estadios de la enfermedad en hojas de diferentes edades. Tanto la determinación visual del porcentaje de severidad como la del estadio de desarrollo de la enfermedad, fueron llevadas a cabo en los 6,25 cm2 del área foliar cubierta por la cubeta del medidor infrarrojo de gases, utilizado para determinar las tasas fotosintéticas y transpiratorias foliares. La tasa fotosintética neta foliar (Fn; μmoles de CO2 reducidos por m2 s-1 decayó con el incremento del porcentaje de severidad (Fn=-0,1517 x+6,845; R2=0,72 y el estadio de la enfermedad (Fn=-1,62 x+8,36; R2=0,60. El impacto del patógeno sobre la tasa transpiratoria foliar (E; mmoles de agua m-2 s-1 fue relativamente menor, como lo mostró la regresión de E contra el porcentaje de severidad (E=-0,0122 x+2,429; R2=0,11

  15. Comparison of tissue deterioration of ripening banana fruit (Musa spp., AAA group, Cavendish sub-group) under chilling and non-chilling temperatures.

    Science.gov (United States)

    Ramírez-Sánchez, Maricruz; Huber, Donald J; Vallejos, C Eduardo

    2018-03-08

    In fleshy fruits, induced-PCD has been observed in heat-treated tomato, and ethylene-treated and low temperature exposure in immature cucumber. No other fleshy fruit has been evaluated for CI-induced PCD, especially mature fruit with full ripening capacity. The purpose of this research was to identify and evaluate the presence of PCD processes during the development of low temperature-induced physiopathy of banana fruit. Exposure of fruit to 5 °C for 4 days induced degradative processes similar to those occurring during ripening and over-ripening of non-chilled fruit. Nuclease from banana peel showed activity in both DNA- and RNA-substrates. No exclusive low-temperature induced proteases and nucleases were observed. DNA of chilled peel showed earlier signs of degradation and higher levels of DNA tailing during over-ripening. This study shows that exposure to low temperatures did not induce a pattern of degradative processes that differed from that occurring during ripening and over-ripening of non-chilled fruit. DNA showed earlier signs of degradation and higher levels of DNA tailing. Nuclease activity analysis showed bifunctionality in both chilled and non-chilled tissue and no chilling exclusive protease and nuclease. Fleshy fruit might use their available resources on degradative processes and adjust them depending on environmental conditions. This article is protected by copyright. All rights reserved.

  16. Inflorescence proliferation for somatic embryogenesis induction and suspension-derived plant regeneration from banana (Musa AAA, cv. 'Dwarf Cavendish') male flowers.

    Science.gov (United States)

    Pérez-Hernández, Juan Bernardo; Rosell-García, Purificación

    2008-06-01

    Availability of explants with adequate embryogenic competence is one of the most important limitations for the development of regenerable cell suspensions in banana. To increase the number and ease of accessibility to potentially embryogenic explants, a novel methodology is described by which young male flower clusters isolated from adult plants are induced to form new flower buds and proliferate in vitro. Different concentrations of the plant growth regulator thidiazuron (TDZ) induced inflorescence proliferation, which could be maintained over time as a continuous source of young flower buds. Intensity of proliferation was evaluated during successive subcultures. At the third cycle of proliferation, the highest multiplication rate (2.89) was obtained on the medium containing 5 microM TDZ. Newly generated floral tissues were assessed for embryogenic competence, resulting in an average embryogenic frequency of 12.5%. The observed embryogenic capacity, together with the recurrent availability of immature flowers, allowed for the direct initiation of cell suspensions from bulked explant cultures. Regular observation and regeneration tests during the development of suspended cell cultures confirmed their embryogenic condition. Produced embryos successfully matured and germinated to regenerate hundreds of somatic in vitro plants.

  17. Pengaruh Beberapa Perlakuan Pasca Panen Dan Suhu Penyimpanan Terhadap Kualitas Dan Daya Simpan Buah Pisang Cavendish (Musa (Grup Aaa, Subgrup Cavendish))

    OpenAIRE

    Purwoko, Bambang S; Juniarti, Diah

    1998-01-01

    The objective of this research was to determine the effect of prestorage infiltration of CaCl2, infiltration of spermidine, plastic wrapping and waxing on the maintenance of banana shelflife and qualities at different storage temperatures. Prestorage infiltration of Cavendish banana (Musa Cavendishii) with CaCl2 inhibited fruit softening, the increase of sugar content in peel color index. Plastic wrapping could inhibit the increase of weight loss, pulp peel ratio, peel color index, and the de...

  18. Dietary intervention with green dwarf banana flour (Musa sp AAA) prevents intestinal inflammation in a trinitrobenzenesulfonic acid model of rat colitis

    OpenAIRE

    Scarminio, Viviane [UNESP; Fruet, Andrea C. [UNESP; Witaicenis, Aline [UNESP; Rall, Vera L. M. [UNESP; Di Stasi, Luiz C. [UNESP

    2012-01-01

    Dietary products are among the therapeutic approaches used to modify intestinal microflora and to promote protective effects during the intestinal inflammatory process. Because the banana plant is rich in resistant starch, which is used by colonic microbiota for the anaerobic production of the short-chain fatty acids that serve as a major fuel source for colonocytes: first, green dwarf banana flour produces protective effects on the intestinal inflammation acting as a prebiotic and, second, c...

  19. Influencia del seudotallo de la planta madre cosechada sobre el crecimiento y producción del hijo de sucesión en banano (Musa AAA Simmonds

    Directory of Open Access Journals (Sweden)

    Rodríguez Carolina

    2006-12-01

    Full Text Available

    Se estudió el efecto de la altura de corte del seudotallo de la planta recién cosechada sobre el crecimiento y producción del siguiente ciclo de producción en plantas de banano cultivar Gran enano. El experimento se realizó en la región de Urabá (Antioquia, Colombia, en dos fincas comerciales de banano y durante dos épocas del año, con un mismo promedio de precipitación. Los tratamientos comprendieron tres alturas de corte desde la superficie del suelo (2, 1,2 y 0 m al momento de la cosecha de la planta madre. Las alturas de corte de 2 y 1,2 m aumentaron la altura y el diámetro del seudotallo del hijo de sucesión y disminuyeron el tiempo hasta la floración, en comparación con los hijos de sucesión de las plantas madres a las que se les eliminó la totalidad del seudotallo. En las dos fincas, los hijos de sucesión de la altura de corte de 2 m incrementaron significativamente el peso del racimo, comparados con los hijos de sucesión sin seudotallo  de la planta madre. La longitud y el calibre de los dedos no fueron afectados por los tratamientos. Los resultados indican que existe una influencia del seudotallo de la planta madre cosechada sobre el hijo de sucesión. Esto favorece el crecimiento temprano del hijo de sucesión, debido al suministro de reservas y agua por parte de esta estructura, lo que se refleja en el incremento del rendimiento. 

  20. The role of topolins in micropropagation and somaclonal variation of banana cultivars ´Williams´ and ´Grand Naine´ (Musa spp. AAA)

    Czech Academy of Sciences Publication Activity Database

    Bairu, M. W.; Stirk, W.A.; Doležal, Karel; van Staden, J.

    2008-01-01

    Roč. 95, č. 3 (2008), s. 373-379 ISSN 0167-6857 R&D Projects: GA ČR GA522/06/0108 Institutional research plan: CEZ:AV0Z50380511 Keywords : Abnormality index * Banana * Micropropagation Subject RIV: ED - Physiology Impact factor: 1.017, year: 2008