WorldWideScience

Sample records for aa student retention

  1. Maslow's Hierarchy and Student Retention.

    Science.gov (United States)

    Brookman, David M.

    1989-01-01

    Abraham Maslow's hierarchy of needs offers perspective on student motivation and a rationale for college retention programing. Student affairs and faculty interventions addressing student safety needs and engaging students' sense of purpose reinforce persistence. A mentor program is a possible cooperative effort between student personnel and…

  2. Designing Online Courses to Promote Student Retention

    Science.gov (United States)

    Dietz-Uhler, Beth; Fisher, Amy; Han, Andrea

    2008-01-01

    Although the issue of student retention is a campus-wide one, it is of special interest in online distance learning courses, where retention rates are reported to be lower than in face-to-face classes. Among the explanations and theories of retention rates in online courses, one that struck us as most useful is a structural one, namely, course…

  3. Emotional Intelligence and Nursing Student Retention

    Science.gov (United States)

    Wilson, Victoria Jane

    2013-01-01

    The study examined the constructs of a Multi-Intelligence Model of Retention with four constructs: cognitive and emotional-social intelligence, student characteristics, and environmental factors. Data were obtained from sophomore students entering two diploma, nine associate, and five baccalaureate nursing programs. One year later, retention and…

  4. Faculty Personality: A Factor of Student Retention

    Science.gov (United States)

    Shaw, Cassandra S.; Wu, Xiaodong; Irwin, Kathleen C.; Patrizi, L. A. Chad

    2016-01-01

    The purpose of this study was to determine the relationship between student retention and faculty personality as it was hypothesized that faculty personality has an effect on student retention. The methodology adopted for this study was quantitative and in two parts 1) using linear regression models to examine the impact or causality of faculty…

  5. Black Student Retention in Higher Education.

    Science.gov (United States)

    Lang, Marvel, Ed.; Ford, Clinita A., Ed.

    This collection focuses on problems in the recruitment, enrollment and retention of Blacks in higher education in America. The following chapters are provided: "The Black Student Retention Problem in Higher Education: Some Introductory Perspectives" (Marvel Lang); "Early Acceptance and Institutional Linkages in a Model Program of Recruitment,…

  6. Positive Youth Development and Undergraduate Student Retention

    Science.gov (United States)

    Demetriou, Cynthia; Powell, Candice

    2014-01-01

    The primary theoretical tradition in the study of college retention has been sociological. A review and synthesis of common themes of development among traditional-age, college students suggests that a developmental perspective on the retention of youth in college may have more to offer than the dominant sociological paradigm. This article argues…

  7. Tribune: Retention Policy for Ethnic Minority Students

    NARCIS (Netherlands)

    Herfs, Paul

    2003-01-01

    The question of the retention of ethnic minority university students in universities in the Netherlands, especially at the University of Utrecht, is examined. In particular, the cases of Surinamese, Antillian, and Aruban students, foreign refugee students, particularly medical doctors, and Turkish

  8. Making Student Retention an Institutional Priority.

    Science.gov (United States)

    Sydow, Debbie L.; Sandel, Robert H.

    1998-01-01

    Describes a study conducted to determine the reasons behind the high rate of student attrition at Mountain Empire Community College in Virginia. Work demands and family conflicts were found to be the primary causes of drop out, conclusions that led to the formation of a task force and a student retention plan to improve persistence. (KC)

  9. Relationship of Personality Traits to Student Retention

    Science.gov (United States)

    Liang, John Paul

    2010-01-01

    Carl Jung's theory of psychological types has been the basis for the development of personality categorization, including tests such as Myers-Briggs Type Indicator (MBTI). This study analyzed the extent of the relationship between MBTI and Tinto (1993) retention factors that influence Oriental medicine students' choice of staying or dropping out…

  10. Healthcare Learning Community and Student Retention

    Science.gov (United States)

    Johnson, Sherryl W.

    2014-01-01

    Teaching, learning, and retention processes have evolved historically to include multifaceted techniques beyond the traditional lecture. This article presents related results of a study using a healthcare learning community in a southwest Georgia university. The value of novel techniques and tools in promoting student learning and retention…

  11. Improving the Retention of First Year Students

    Science.gov (United States)

    Bishop, Graham

    The thesis compares student attrition rates in two UWS Schools for 2004 and 2005. It analyses possible reasons why students discontinue and identifies strategies and approaches to improving the quality of the teaching and learning environment for these students. The thesis focuses on the retention of first year students in the School of Engineering at the University of Western Sydney. Low retention rates are costly to the university, leading to inefficient use of resources, failure to fulfil student aspirations, and intervention between the university and the student. In each chapter, the thesis addresses student retention, satisfaction and performance and the interrelation between them and outlines the measures taken by the School of Engineering to improve these measurements for students commencing in 2006 and proposes many recommendations for further improvements in subsequent years. Each chapter addresses these issues by following the student pathway, commencing with the student leaving High School and entering their chosen university and course of study. At each stage, the relevant issues are addressed which have a direct or indirect impact on student retention, satisfaction and performance. Use is made of reports and papers published by universities and organisations, as outlined in the Literature Review. The research questions provide data through the results obtained from surveys. Typical Retention Rates are 75% for UWS, 81% for the Sector, 76% for the New Generation Universities (NGUs) and 62% for the School of Engineering on which this research is focussed. This thesis confirms the research from many countries that closely links student retention with the quality of teaching and learning. Key issues are: • a sound first year student orientation and welcome by staff; encountering efficient, effective and accurate student. The introduction of a more effective and tailored orientation program in 2007 attracted, at UWS School of Engineering, 92% attendance

  12. Student retention in athletic training education programs.

    Science.gov (United States)

    Dodge, Thomas M; Mitchell, Murray F; Mensch, James M

    2009-01-01

    The success of any academic program, including athletic training, depends upon attracting and keeping quality students. The nature of persistent students versus students who prematurely leave the athletic training major is not known. Understanding the profiles of athletic training students who persist or leave is important. To (1) explore the relationships among the following variables: anticipatory factors, academic integration, clinical integration, social integration, and motivation; (2) determine which of the aforementioned variables discriminate between senior athletic training students and major changers; and (3) identify which variable is the strongest predictor of persistence in athletic training education programs. Descriptive study using a qualitative and quantitative mixed-methods approach. Thirteen athletic training education programs located in District 3 of the National Athletic Trainers' Association. Ninety-four senior-level athletic training students and 31 college students who changed majors from athletic training to another degree option. Data were collected with the Athletic Training Education Program Student Retention Questionnaire (ATEPSRQ). Data from the ATEPSRQ were analyzed via Pearson correlations, multivariate analysis of variance, univariate analysis of variance, and a stepwise discriminant analysis. Open-ended questions were transcribed and analyzed using open, axial, and selective coding procedures. Member checks and peer debriefing techniques ensured trustworthiness of the study. Pearson correlations identified moderate relationships among motivation and clinical integration (r = 0.515, P motivation and academic integration (r = 0.509, P motivation (F(1,121) = 68.887, P motivation was the strongest predictor of persistence in athletic training education, accounting for 37.2% of the variance between groups. The theoretic model accurately classified 95.7% of the seniors and 53.8% of the major changers. A common theme emerging from the

  13. Student Loans, Financial Stress, and College Student Retention

    Science.gov (United States)

    Britt, Sonya L.; Ammerman, David Allen; Barrett, Sarah F.; Jones, Scott

    2017-01-01

    This study examined a sample of 2,475 undergraduate students to determine the influence of financial stress, debt loads, and financial counseling on retention rates. Results indicate, among other findings, that financial stress contributes to an increased likelihood of discontinuing college. Self-reported student loan debt contributes to an…

  14. The drivers of student enrolment and retention: A stakeholder ...

    African Journals Online (AJOL)

    ... in this paper offers a promising resource for the student development strategies of academic institutions. Keywords: student enrolment, student retention, higher education, Q methodology, student development strategy, Unisa, communication, solution meaning, perception analysis, brand perception, university marketing ...

  15. Compassion: A Qualitative Instrumental Case Study on Student Retention

    Science.gov (United States)

    Shedletsky, Nikki

    2017-01-01

    This qualitative case study examined the past and current student retention literature and research in order to fill voids in the literature and knowledge and contribute to increasing retention of more students by understanding Spalding University's culture and how they make it work to serve students. Data was collected from surveys, interviews…

  16. Informing Institutional Management: Institutional Strategies and Student Retention

    Science.gov (United States)

    Hovdhaugen, Elisabeth; Frolich, Nicoline; Aamodt, Per Olaf

    2013-01-01

    European universities are facing demands for better student retention, especially in countries where state funding is no longer based on the number of students, but on the number of graduates. An extensive literature on retention focuses on the characteristics of students who leave higher education without a degree. Much less is known about the…

  17. Improving Student Retention in Higher Education: Improving Teaching and Learning

    Science.gov (United States)

    Crosling, Glenda; Heagney, Margaret; Thomas, Liz

    2009-01-01

    As a key performance indicator in university quality assurance processes, the retention of students in their studies is an issue of concern world-wide. Implicit in the process of quality assurance is quality improvement. In this article, we examine student retention from a teaching and learning perspective, in terms of teaching and learning…

  18. Nursing Student Retention in Associate Degree Nursing Programs Utilizing a Retention Specialist

    Science.gov (United States)

    Schrum, Ronna A.

    2014-01-01

    The purpose of this study was to examine specific variables associated with nursing student retention in Associate Degree Nursing (ADN) Programs. Jeffreys (2004) Nursing Undergraduate Retention and Success (NURS) conceptual model provided the framework for this descriptive correlational study. One hundred sixty eight pre-licensure associate degree…

  19. Determining Factors in Student Retention in Online Courses

    Science.gov (United States)

    Friðriksdóttir, Kolbrún; Arnbjörnsdóttir, Birna

    2017-01-01

    The rapid growth of online education courses, especially Massive Open Online Courses (MOOCs), has called attention to the issue of student retention and low overall completion rates (Gaebel, 2013). The impact of different modes of delivery on retention has also received attention with a blended learning mode being deemed most effective in…

  20. Issues of International Student Retention in American Higher Education

    Science.gov (United States)

    Bista, Krishna; Foster, Charlotte

    2011-01-01

    This paper focused on issues of retention and the individual needs of international students at a southern university through videotaped group interviews with six students from Africa, China, India, Japan, Jordan, and Nepal. Students were asked questions concerning their first experiences at the university, experiences out in the community,…

  1. Building Bridges: Higher Degree Student Retention and Counselling Support

    Science.gov (United States)

    Pearson, Mark

    2012-01-01

    This paper aims to contribute to the discussion on increasing retention rates in higher degree students. It presents evidence from the literature on the value of increasing counselling and mentoring care for higher degree research students. The creation of, and rationale for, a designated higher degree student counsellor-mentor role is described.…

  2. Enrolment Management in Graduate Business Programs: Predicting Student Retention

    Science.gov (United States)

    Eshghi, Abdoloreza; Haughton, Dominique; Li, Mingfei; Senne, Linda; Skaletsky, Maria; Woolford, Sam

    2011-01-01

    The increasing competition for graduate students among business schools has resulted in a greater emphasis on graduate business student retention. In an effort to address this issue, the current article uses survival analysis, decision trees and TreeNet® to identify factors that can be used to identify students who are at risk of dropping out of a…

  3. Overcoming Student Retention Issues in Higher Education Online Programs

    Science.gov (United States)

    Heyman, Errin

    2010-01-01

    Pressure exists to attract and retain students in higher education. Online educational programs have the potential to increase the number of students who can enroll in degree-bearing institutions. Explored in the qualitative study using a modified three-round Delphi technique was the phenomenon of consistently lower student retention rates in…

  4. Managing student retention through the assessment of cost of quality

    African Journals Online (AJOL)

    The primary goal of this article is to introduce a relatively new costing tool that could assist with the formulation of a retention strategy. There is a cost factor linked to the education and training of students: the money spent on a successful student could be perceived as adding value; whilst the costs related to unsuccessful ...

  5. Retention of Displaced Students after Hurricanes Katrina and Rita

    Science.gov (United States)

    Coco, Joshua Christian

    2017-01-01

    The purpose of the study was to investigate the strategies that university leaders implemented to improve retention of displaced students in the aftermaths of Hurricanes Katrina and Rita. The universities that participated in this study admitted displaced students after Hurricanes Katrina and Rita. This study utilized a qualitative…

  6. Improving Student Retention and Performance in Quantitative Courses Using Clickers

    Science.gov (United States)

    Liu, Wallace C.; Stengel, Donald N.

    2011-01-01

    Clickers offer instructors of mathematics-related courses an opportunity to involve students actively in class sessions while diminishing the embarrassment of being wrong. This paper reports on the use of clickers in two university-level courses in quantitative analysis and business statistics. Results for student retention and examination…

  7. Do you hear me? Student voice, academic success and retention

    Directory of Open Access Journals (Sweden)

    Jennifer Allen

    2017-07-01

    Full Text Available The place of student voice, whilst present in the evaluation of the teaching and learning process in higher education institutions, is limited in the planning, provision and ownership of student support services that promote student success and retention. This project seeks to recognise that students have an active role and partnership in constructing their own success and their voice is integral to this partnership. To promote the importance of the student voice at the University of Newcastle (UON, this initiative has established the Office of Student Advocacy (OSA. This is a collaborative enterprise between university staff and student associations, a communication strategy for student-elected representatives on university committees and, a reporting mechanism for student concerns to be communicated to the relevant decision makers at UON. The project repositions students as co-creators of student support to inform student success.

  8. The AAS to BAS Pathway: Heating Up the Educational Aspiration of CTE Students

    Science.gov (United States)

    Kujawa, Tricia A.

    2013-01-01

    The enrollment and transfer behaviors of college students are diverse. As a result, college students travel various pathways to the baccalaureate degree. The purpose of this qualitative study was to better understand the lived experience of students who entered higher education through an associate of applied science (AAS) program and then…

  9. Medication Administration and Knowledge Retention in Baccalaureate Nursing Students

    Directory of Open Access Journals (Sweden)

    Pamela Treister

    2016-12-01

    Full Text Available A quality improvement project was undertaken in order to assist the undergraduate baccalaureate nursing students in knowledge retention for medication administration during their senior semester in nursing school. Two specific changes in curriculum were implemented in order to assist these undergraduate baccalaureate nursing students at a suburban private university in New York. Simulation and the incorporation of competency by rubrics were implemented in the spring semester of junior year, which led to an increased knowledge retention during the fall semester of the senior year. This article discusses the advantages and challenges of using technology, how change occurred in the junior year semester and the effects it had on the senior nursing student's retention of medication administration knowledge.

  10. A Sense of Belonging: Improving Student Retention

    Science.gov (United States)

    O'Keeffe, Patrick

    2013-01-01

    The purpose of this paper is to explore the causes and potential solutions to, student attrition. With student attrition rates reaching between 30 and 50 per cent in the United States, and over 20 per cent in Australia, the inability of higher education institutions to retain their students is a significant issue. This paper cites key risk factors…

  11. Program directors' perceptions of undergraduate athletic training student retention.

    Science.gov (United States)

    Bowman, Thomas G; Hertel, Jay; Mazerolle, Stephanie M; Dodge, Thomas M; Wathington, Heather D

    2015-02-01

    The average retention rate for students enrolled in undergraduate athletic training programs (ATPs) nationwide has been reported to be 81%, and slightly more than half of program directors (PDs) have indicated that retention of athletic training students (ATSs) is a problem. However, why PDs do or do not believe ATS retention is problematic is unknown. To determine why PDs do or do not believe ATS retention is problematic. Qualitative study. Undergraduate ATPs. We obtained responses from 177 of the 343 PDs (51.6%). Using data saturation as a guide, we randomly selected 16 PDs from the survey responses to participate in follow-up telephone interviews; 8 believed retention was a problem and 8 did not. During audio-recorded telephone interviews, we asked PDs why they thought retention was or was not a problem for athletic training education. Following verbatim transcription, we used grounded theory to analyze the interview data and maintained trustworthiness by using intercoder agreement, member checks, and peer review. Program directors believed that retaining ATSs was a problem because students lack information regarding athletic training and the rigor of the ATP. Program directors were consistent in their perception that ATPs do not have a retention challenge because of the use of a secondary admissions process. This finding was likely based on personal use of a secondary admissions process in the ATPs these PDs lead. Program directors who lead ATPs that struggle to retain ATSs should consider using a secondary admissions process. During the preprofessional phase of the ATP, faculty and staff should work to socialize students to the demands of the ATP and the professional lives of athletic trainers.

  12. Recruitment and retention of minority students: diversity in nursing education.

    Science.gov (United States)

    Etowa, Josephine B; Foster, Suzanne; Vukic, Adele R; Wittstock, Lucille; Youden, Susan

    2005-01-01

    A culturally diverse nursing workforce is essential to meet the health needs of an increasingly diverse Canadian population. The recruitment and retention of nursing students representing diverse backgrounds are vital to the building of this diversified work force. Studies have shown that diversity within the student body benefits everyone. For example, students who study and work within a diverse environment are better able to understand and consider multiple perspectives and to appreciate the benefits inherent in diversity. This paper describes one school of nursing's project on the Recruitment and Retention of Black students into their Bachelor of Science Nursing (BScN) Program. The project goals are to increase diversity, foster student learning, and ultimately improve health care for the Black community. Presented in this paper are the project background, implementation process, challenges and outcomes. This may provide learned lessons and future directions for similar initiatives in other institutions.

  13. The Use of University Services and Student Retention: Differential Links for Student Service Members or Veterans and Civilian Students

    Science.gov (United States)

    Southwell, Kenona H.; Whiteman, Shawn D.; MacDermid Wadsworth, Shelley M.; Barry, Adam E.

    2018-01-01

    Grounded in research and theory on college student retention, this study assessed differences in the use of various university services and the influence of key personnel on retention-related outcomes of student service members or veterans (SSM/Vs) compared with civilian students. Participants included 386 students, 199 (154 male, 45 female) of…

  14. Institutionalization: A Model of Retention Through Student Engagement

    Science.gov (United States)

    Davis, E. J.; Campbell, A.; Strand, D.

    2005-12-01

    Bowie State University and NASA Goddard Space Flight Center have, for the past 10 years, worked diligently together to enhance the science, mathematics, engineering and technology (SMET) domain. Efforts made because of a Model Institutions for Excellence (MIE) Award have changed the landscape of the SMET domain by increasing the retention and graduation rates, the number of students entering graduate and professional schools, and the number of students entering SMET related careers. Several initiatives - a Scholarship program, PRISEM Tutoring Center, Safenet Program, Research Emphasis, Focused Mentoring, a Summer Academy for accepted and enrolled incoming students, a Bridge Program for students needing assistance being admitted to the University, the RISE Program and the Bowie State Satellite Operations and Control Center - provides the nurturing and mentoring focus, and opportunities that have resulted in a retention rate of approximately 80%, a 40% increase in the graduation rate, and an 85% increase in the number of students interested/entering graduate school. Successes that have documented by various assessment activities have led to the institutionalization of the retention model of the MIE Initiative. It is anticipated that University-wide application of the retention model will provide the incentives necessary to obtain similar results as has the MIE Initiative.

  15. Effect of differentiated instructional strategies on students' retention ...

    African Journals Online (AJOL)

    The effect of differentiated instructional strategies on students' retention in geometry in senior secondary schools was examined. The study employed experimental research design of pretest, posttest control group. The area of this study is Abuja Municipal Area Council, the Federal Capital Territory. The target population ...

  16. effect of differentiated instructional strategies on students' retention ...

    African Journals Online (AJOL)

    PROF EKWUEME

    The effect of differentiated instructional strategies on students' retention in geometry in senior secondary schools was examined. The study employed experimental research design of pretest, posttest control group. The area of this study is Abuja Municipal Area Council, the Federal Capital. Territory. The target population ...

  17. Medication Administration and Knowledge Retention in Baccalaureate Nursing Students

    OpenAIRE

    Pamela Treister; Donna Darcy

    2016-01-01

    A quality improvement project was undertaken in order to assist the undergraduate baccalaureate nursing students in knowledge retention for medication administration during their senior semester in nursing school. Two specific changes in curriculum were implemented in order to assist these undergraduate baccalaureate nursing students at a suburban private university in New York. Simulation and the incorporation of competency by rubrics were implemented in the spring semester of junior year, w...

  18. Recruitment and retention of scholarship recipient nursing students and staff.

    Science.gov (United States)

    Tucker, Susan K; Sherrod, Roy A

    2011-12-13

    Few problems are more relevant in health care today than nurse recruitment and retention. The purpose of this study was to identify job satisfaction factors for nurse and nursing student education scholarship recipients, as well as examine the relationship of these factors to the intent to complete contractual agreements. Findings revealed that job satisfaction and a positive image of nursing were influential factors in intent to complete contractual agreements. Results may prove valuable information to recruit nursing students and increase job satisfaction.

  19. Emotional intelligence and clinical performance/retention of nursing students

    Directory of Open Access Journals (Sweden)

    Chelsea Marvos

    2015-01-01

    Full Text Available Objective: This exploratory, quantitative, descriptive study was undertaken to explore the relationship between clinical performance and anticipated retention in nursing students. Methods: After approval by the university′s Human Subjects Committee, a sample of 104 nursing students were recruited for this study, which involved testing with a valid and reliable emotional intelligence (EI instrument and a self-report survey of clinical competencies. Results: Statistical analysis revealed that although the group average for total EI score and the 6 score subsets were in the average range, approximately 30% of the individual total EI scores and 30% of two branch scores, identifying emotions correctly and understanding emotions, fell in the less than average range. This data, as well as the analysis of correlation with clinical self-report scores, suggest recommendations applicable to educators of clinical nursing students. Conclusions: Registered nurses make-up the largest segment of the ever-growing healthcare workforce. Yet, retention of new graduates has historically been a challenge for the profession. Given the projected employment growth in nursing, it is important to identify factors which correlate with high levels of performance and job retention among nurses. There is preliminary evidence that EI "a nontraditional intelligence measure" relates positively not only with retention of clinical staff nurses, but with overall clinical performance as well.

  20. Emotional intelligence and clinical performance/retention of nursing students.

    Science.gov (United States)

    Marvos, Chelsea; Hale, Frankie B

    2015-01-01

    This exploratory, quantitative, descriptive study was undertaken to explore the relationship between clinical performance and anticipated retention in nursing students. After approval by the university's Human Subjects Committee, a sample of 104 nursing students were recruited for this study, which involved testing with a valid and reliable emotional intelligence (EI) instrument and a self-report survey of clinical competencies. Statistical analysis revealed that although the group average for total EI score and the 6 score subsets were in the average range, approximately 30% of the individual total EI scores and 30% of two branch scores, identifying emotions correctly and understanding emotions, fell in the less than average range. This data, as well as the analysis of correlation with clinical self-report scores, suggest recommendations applicable to educators of clinical nursing students. Registered nurses make-up the largest segment of the ever-growing healthcare workforce. Yet, retention of new graduates has historically been a challenge for the profession. Given the projected employment growth in nursing, it is important to identify factors which correlate with high levels of performance and job retention among nurses. There is preliminary evidence that EI a nontraditional intelligence measure relates positively not only with retention of clinical staff nurses, but with overall clinical performance as well.

  1. Emotional intelligence and clinical performance/retention of nursing students

    Science.gov (United States)

    Marvos, Chelsea; Hale, Frankie B.

    2015-01-01

    Objective: This exploratory, quantitative, descriptive study was undertaken to explore the relationship between clinical performance and anticipated retention in nursing students. Methods: After approval by the university's Human Subjects Committee, a sample of 104 nursing students were recruited for this study, which involved testing with a valid and reliable emotional intelligence (EI) instrument and a self-report survey of clinical competencies. Results: Statistical analysis revealed that although the group average for total EI score and the 6 score subsets were in the average range, approximately 30% of the individual total EI scores and 30% of two branch scores, identifying emotions correctly and understanding emotions, fell in the less than average range. This data, as well as the analysis of correlation with clinical self-report scores, suggest recommendations applicable to educators of clinical nursing students. Conclusions: Registered nurses make-up the largest segment of the ever-growing healthcare workforce. Yet, retention of new graduates has historically been a challenge for the profession. Given the projected employment growth in nursing, it is important to identify factors which correlate with high levels of performance and job retention among nurses. There is preliminary evidence that EI a nontraditional intelligence measure relates positively not only with retention of clinical staff nurses, but with overall clinical performance as well. PMID:27981096

  2. Approaching the Challenge of Student Retention through the Lens of Quality Control: A Conceptual Model of University Business Student Retention Utilizing Six Sigma

    Science.gov (United States)

    Jenicke, Lawrence O.; Holmes, Monica C.; Pisani, Michael J.

    2013-01-01

    Student retention in higher education is a major issue as academic institutions compete for fewer students and face declining enrollments. A conceptual model of applying the quality improvement methodology of Six Sigma to the problem of undergraduate student retention in a college of business is presented. Improvement techniques such as cause and…

  3. Faculty ratings of retention strategies for minority nursing students.

    Science.gov (United States)

    Baker, Barbara H

    2010-01-01

    The purpose of this study was to investigate a) the types of retention strategies used by undergraduate nursing programs for the purpose of retaining minority students, b) the rated effectiveness of the strategies, as identified by faculty in those programs, and c) whether there is a relationship between strategies rated as effective and the type of nursing program, baccalaureate (BSN) or associate (AD) degree. Administrator-selected faculty from randomly sampled BSN and AD nursing programs within a 16-state area of the southeastern United States were asked to respond to an online survey regarding the use and effectiveness of retention strategies selected from the literature. Descriptive statistics and chi-square tests for association were used to analyze the data. Of the 14 strategies included in this analysis, faculty availability and timely feedback on tests and clinical performances were used by all undergraduate programs. Organized study groups and peer mentoring were the least used strategies. Faculty from both BSN and AD programs reported using many of the strategies and rated their use as effective overall for minority nursing student retention. The highest rated strategies were those that involved direct interaction of nurse faculty and students.

  4. Connecting students to institutions: the relationship between program resources and student retention in respiratory care education programs.

    Science.gov (United States)

    Ari, Arzu

    2009-09-01

    Respiratory care education programs are being held accountable for student retention. Increasing student retention is necessary for the respiratory therapy profession, which suffers from a shortage of qualified therapists needed to meet the increased demand. The present study investigated the relationship between student retention rate and program resources, in order to understand which and to what extent the different components of program resources predict student retention rate. The target population of this study was baccalaureate of science degree respiratory care education programs. After utilizing a survey research method, Pearson correlations and multiple regression analysis were used for data analysis. With a 63% response rate (n = 36), this study found a statistically significant relationship between program resources and student retention rate. Financial and personnel resources had a statistically significant positive relationship with student retention. The mean financial resources per student was responsible for 33% of the variance in student retention, while the mean personnel resources per student accounted for 12% of the variance in student retention. Program financial resources available to students was the single best predictor of program performance on student retention. Respiratory care education programs spending more money per student and utilizing more personnel in the program have higher mean performance in student retention. Therefore, respiratory care education programs must devote sufficient resources to retaining students so that they can produce more respiratory therapists and thereby make the respiratory therapy profession stronger.

  5. Indigenous Students' Voices: Monitoring Indigenous Student Satisfaction and Retention in a Large Australian University

    Science.gov (United States)

    Shah, Mahsood; Widin, Jacquie

    2010-01-01

    Indigenous student satisfaction with the university learning and teaching experience matters. From a student perspective, retention matters as successful completion of tertiary education improves the life chances of students in relation to employment opportunities, being able to support themselves financially and contributing to the society in…

  6. Collaborative learning in engineering: A quest to improve student retention

    Science.gov (United States)

    Marquard, Paul J.

    Colleges of engineering are concerned with retention of their undergraduates. Several studies have determined the reasons students leave engineering to major in other disciplines. The list includes poor teaching, a difficult curriculum, and a lack of belonging. This study alters the traditional lecture format of an engineering dynamics class by using a flipped classroom where scheduled class time emphasizes a collaborative learning pedagogy. Material coverage was facilitated with online lectures. After initiating this change, student attitudes and self-efficacy were measured as well as test performance and study time.

  7. Success of Underrepresented Nursing Students at Selected Southwest Institutions: Impact of a Nursing Retention Program

    Science.gov (United States)

    Khattab, Ibrahim

    2011-01-01

    This study examined retention initiatives and strategies provided to underserved students in the nursing programs at three community colleges in the Southwest region. This research addressed nursing student retention, as well as ways to increase retention among underrepresented populations in the three community colleges, representing a unique…

  8. The Role of Student Characteristics in Predicting Retention in Online Courses

    Science.gov (United States)

    Cochran, Justin D.; Campbell, Stacy M.; Baker, Hope M.; Leeds, Elke M.

    2014-01-01

    Given the continued issue of student retention for online classes, past research has suggested several "retention strategies" focused on engaging students as a way to reduce their withdrawal rate from these classes. However, a recent study testing the effects of these strategies on retention in online undergraduate business courses…

  9. A Study of Retention Trends of International Students at a Southwestern Public University

    Science.gov (United States)

    Wong Davis, Kristina Marie

    2012-01-01

    Literature on factors contributing to the retention of international students remained limited. The purpose of this study was to examine the factors related to retention of international undergraduate degree seeking students through conducting pairwise correlational analysis to test the relationship between retention and age, gender, country of…

  10. The Prediction of College Student Academic Performance and Retention: Application of Expectancy and Goal Setting Theories

    Science.gov (United States)

    Friedman, Barry A.; Mandel, Rhonda G.

    2010-01-01

    Student retention and performance in higher education are important issues for educators, students, and the nation facing critical professional labor shortages. Expectancy and goal setting theories were used to predict academic performance and college student retention. Students' academic expectancy motivation at the start of the college…

  11. Retention of first aid and basic life support skills in undergraduate medical students

    OpenAIRE

    Ruijter, P.A. de; Biersteker, H.A.; Biert, J.; Goor, H. van; Tan, E.C.T.H.

    2014-01-01

    Background: Undergraduate medical students follow a compulsory first aid (FA) and basic life support (BLS) course. Retention of BLS seems poor and only little information is provided on the retention of FA skills. This study aims at evaluating 1- and 2-year retention of FA and BLS training in undergraduate medical students.Methods: One hundred and twenty students were randomly selected from first year (n=349) medical students who successfully followed a compulsory FA and BLS course. From thes...

  12. Facilitating student retention in online graduate nursing education programs: a review of the literature.

    Science.gov (United States)

    Gazza, Elizabeth A; Hunker, Diane F

    2014-07-01

    Online education, a form of distance education, provides students with opportunities to engage in lifelong learning without the restrictions of time and space. However, while this approach meets the needs of employed nursing professionals, it poses some challenges for educators. Student retention is one such challenge. Student retention rates serve as measures of program quality and are reported to accrediting bodies. Therefore, it is imperative that administrators and program faculty implement comprehensive programs to ensure student retention. This review of the literature was designed to identify strategies to improve student retention in online graduate nursing education programs. The review includes 23 articles that address models, research, and best practices supported in nursing and higher education. The findings indicate that student retention in online programs is a multidimensional problem requiring a multifaceted approach. Recommendations for facilitating retention in online nursing programs include ensuring social presence and program and course quality, and attentiveness to individual student characteristics. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. The Ecology of Student Retention: Undergraduate Students and the Great Recession

    Science.gov (United States)

    Mendoza, Pilar; Malcolm, Zaria; Parish, Nancy

    2015-01-01

    This study investigated qualitatively how undergraduate students experienced the Great Recession at a flagship university in the South Eastern of United States and how this experience relates to their retention. Results indicate that the Great Recession has significantly impacted students' engagement and commitments. We argue that student…

  14. Shared Faculty-Student Lifestyle Habits and Their Implications for College Student Retention

    Science.gov (United States)

    Boateng, Kwasi; Plopper, Bruce L.; Keith, David M.

    2016-01-01

    Previous research confirms that first-semester grade-point average (GPA) is related to college student persistence, retention, and graduation. Thus, it is important to identify factors related to enhancing first-semester GPA. In this study, researchers asked faculty and students in the disciplines of journalism, strategic communication or public…

  15. Retention of community college students in online courses

    Science.gov (United States)

    Krajewski, Sarah

    The issue of attrition in online courses at higher learning institutions remains a high priority in the United States. A recent rapid growth of online courses at community colleges has been instigated by student demand, as they meet the time constraints many nontraditional community college students have as a result of the need to work and care for dependents. Failure in an online course can cause students to become frustrated with the college experience, financially burdened, or to even give up and leave college. Attrition could be avoided by proper guidance of who is best suited for online courses. This study examined factors related to retention (i.e., course completion) and success (i.e., receiving a C or better) in an online biology course at a community college in the Midwest by operationalizing student characteristics (age, race, gender), student skills (whether or not the student met the criteria to be placed in an AFP course), and external factors (Pell recipient, full/part time status, first term) from the persistence model developed by Rovai. Internal factors from this model were not included in this study. Both univariate analyses and multivariate logistic regression were used to analyze the variables. Results suggest that race and Pell recipient were both predictive of course completion on univariate analyses. However, multivariate analyses showed that age, race, academic load and first term were predictive of completion and Pell recipient was no longer predictive. The univariate results for the C or better showed that age, race, Pell recipient, academic load, and meeting AFP criteria were predictive of success. Multivariate analyses showed that only age, race, and Pell recipient were significant predictors of success. Both regression models explained very little (<15%) of the variability within the outcome variables of retention and success. Therefore, although significant predictors were identified for course completion and retention, there are still

  16. Student Advising and Retention Application in Cloud Computing Environment

    Directory of Open Access Journals (Sweden)

    Gurdeep S Hura

    2016-11-01

    Full Text Available  This paper proposes a new user-friendly application enhancing and expanding the current advising services of Gradesfirst currently being used for advising and retention by the Athletic department of UMES with a view to implement new performance activities like mentoring, tutoring, scheduling, and study hall hours into existing tools. This application includes various measurements that can be used to monitor and improve the performance of the students in the Athletic Department of UMES by monitoring students’ weekly study hall hours, and tutoring schedules. It also supervises tutors’ login and logout activities in order to monitor their effectiveness, supervises tutor-tutee interaction, and stores and analyzes the overall academic progress of each student. A dedicated server for providing services will be developed at the local site. The paper has been implemented in three steps. The first step involves the creation of an independent cloud computing environment that provides resources such as database creation, query-based statistical data, performance measures activities, and automated support of performance measures such as advising, mentoring, monitoring and tutoring. The second step involves the creation of an application known as Student Advising and Retention (SAR application in a cloud computing environment. This application has been designed to be a comprehensive database management system which contains relevant data regarding student academic development that supports various strategic advising and monitoring of students. The third step involves the creation of a systematic advising chart and frameworks which help advisors. The paper shows ways of creating the most appropriate advising technique based on the student’s academic needs. The proposed application runs in a Windows-based system. As stated above, the proposed application is expected to enhance and expand the current advising service of Gradesfirst tool. A brief

  17. Assessing college students' retention and transfer from calculus to physics

    Science.gov (United States)

    Cui, Lili

    Many introductory calculus-based physics students have difficulties when solving physics problems involving calculus. This study investigates students' retention and transfer from calculus to physics. While retention is the ability to recall your knowledge at a later point in time, transfer of learning is defined as the ability to apply what one has learned in one situation to a different situation. In this dissertation we propose a theoretical framework to assess students' transfer of learning in the context of problem solving. We define two kinds of transfer---horizontal transfer and vertical transfer. Horizontal transfer involves applying previously learned ideas in a problem. Vertical transfer involves constructing new ideas to solve the problem. Students need to employ both horizontal and vertical transfer when they solve any problem. This framework evolves through this research and provides a lens that enables us to examine horizontal and vertical transfer. Additionally, this proposed framework offers researchers a vocabulary to describe and assess transfer of learning in any problem solving context. We use a combination of qualitative and quantitative methods to examine transfer in the context of problem solving. The participants in this study were students enrolled in a second-semester physics course taken by future engineers and physicists, calculus instructors and physics instructors. A total of 416 students' exam sheets were collected and reviewed. Statistical methods were used to analyze the quantitative data. A total of 28 students and nine instructors were interviewed. The video and audio recordings were transcribed and analyzed in light of the aforementioned theoretical framework. A major finding from this study is that a majority of students possess the requisite calculus skills, yet have several difficulties in applying them in the context of physics. These difficulties included: deciding the appropriate variable and limits of integration; not

  18. Academic Libraries and High-Impact Practices for Student Retention: Library Deans' Perspectives

    Science.gov (United States)

    Murray, Adam

    2015-01-01

    Numerous studies on retention have highlighted the role of student engagement in influencing students' withdrawal decisions. This study seeks to address how academic libraries affect student retention by examining the perception of academic library deans or directors on the alignment between library services and resources with ten nationally…

  19. Retention of Differential and Integral Calculus: A Case Study of a University Student in Physical Chemistry

    Science.gov (United States)

    Jukic Matic, Ljerka; Dahl, Bettina

    2014-01-01

    This paper reports a study on retention of differential and integral calculus concepts of a second-year student of physical chemistry at a Danish university. The focus was on what knowledge the student retained 14 months after the course and on what effect beliefs about mathematics had on the retention. We argue that if a student can quickly…

  20. Retention of first aid and basic life support skills in undergraduate medical students

    NARCIS (Netherlands)

    Ruijter, P.A. de; Biersteker, H.A.; Biert, J.; Goor, H. van; Tan, E.C.T.H.

    2014-01-01

    BACKGROUND: Undergraduate medical students follow a compulsory first aid (FA) and basic life support (BLS) course. Retention of BLS seems poor and only little information is provided on the retention of FA skills. This study aims at evaluating 1- and 2-year retention of FA and BLS training in

  1. Factors related to the retention of biology knowledge in non-science college students

    Science.gov (United States)

    Carroll, William Thomas

    The primary purpose of this study was the identification of factors that contribute to the long-term retention of biology knowledge. Long-term retention is defined here as knowledge retained one, two, or three years following the completion of a two-semester college biology course. The factors examined for their influence on retention were primarily learner-centered in that they compared the qualities of the students rather than the nature of the instruction used. The variables examined for their relationship to long-term retention were: the student's learning approach (meaningful or rote), the student's perception of the relevance of the course content to his or her life, the student's interest in biology, the student's biology course grade, and the time between the completion of instruction and the retention measure. This study also examined how the impact of these variables on retention was related to the factual or conceptual nature of the biology content learned. The results of the regression analysis have revealed several interesting interactions among the variables examined. A student's tendency to utilize either a rote or more meaningful approach to learning interacts with his or her perception of course relevance in predicting biology knowledge retention. When the retention of higher-level biology concepts was examined, an interaction was observed between students' approaches to learning and the time between the course and the retention measure. Students with higher performance in the biology course demonstrated greater retention after one or two years but showed the greatest relative loss of retention following a three-year interval. Students' interest in biology, as measured by the frequency of biology related behaviors, showed a small positive correlation to long-term retention.

  2. Postgraduation retention of medical students from Otago and Auckland medical programmes.

    Science.gov (United States)

    Shelker, William; Poole, Phillippa; Bagg, Warwick; Wood, Ian; Glue, Paul

    2014-01-24

    Auckland and Otago medical programmes have different methods for selecting students. This study compared postgraduate retention in New Zealand (NZ) of medical graduates from the two medical programmes, to assess whether different selection methods influenced retention. Other variables assessed included entrance category and age at graduation. Anonymised databases were created of all graduates from the Otago Faculty of Medicine (1999-2011) and the Auckland medical programme (2000-2012). Demographic and entry category data were recorded. Retention was defined as presence on the NZ Medical Register in December 2012. Risk differences (RD) were calculated to compare retention between the two medical programmes using the Mantel-Haenszel method. The influence of medical programme entrance category on retention was also tested. The influence of covariates on retaining graduates on the register was evaluated using a multiple logistic regression model. The postgraduate retention of graduates of the two medical programmes over 13 years was identical (Auckland 74.9%, Otago 73.6%, P=0.48). Retention of graduate and non-graduate entry students from both medical programmes was similar by 6 years after graduation. Age during medical school did not affect retention. University of attendance had no effect on postgraduation retention of students on the NZ Medical Register, suggesting that retention is not influenced by the different student selection methods at each programme. The data presented shows that New Zealand graduates regardless of programme completed show a similar profile in terms of retention.

  3. STRATEGIES TO IMPROVE RETENTION OF POSTGRADUATE BUSINESS STUDENTS IN DISTANCE EDUCATION COURSES: An Australian Case

    Directory of Open Access Journals (Sweden)

    David CARROLL,

    2013-01-01

    Full Text Available In spite of the clear value of postgraduate business students to many providers of distance education courses, the factors affecting the retention of these students have received limited attention in the literature. In addressing this gap, this paper presents the findings of a qualitative study into the factors affecting the retention of postgraduate business students at a major Australian distance education university. The findings of this study suggest that a range of situational, dispositional and attitudinal factors impact upon student retention on this context, both as enablers of and obstacles to ongoing participation. In many cases, these factors differ to those identified in the existing literature on student retention. Based on these findings, we present a range of strategies designed to improve the retention of postgraduate business students by maximising enabling factors and minimising the impact of any identified obstacles. Limitations of the study and suggestions for further research are also presented.

  4. An Interpretivism Perspective of Institutional Practices on Allied Health Program Student Retention at Public Community Colleges in Texas

    Science.gov (United States)

    Gaus, Frances Gayle

    2017-01-01

    Over the past four decades there has been a great amount of research on retention of students in higher education institutions (Tinto, 2006); however, few studies have examined the effect of what institutions provide for student support, regarding retention, specifically allied health program students. Retention of community college students in…

  5. Improving Student Retention in Online College Classes: Qualitative Insights from Faculty

    Science.gov (United States)

    Russo-Gleicher, Rosalie J.

    2014-01-01

    This article provides qualitative insights into addressing the issue of student retention in online classes in higher education. Semi-structured, in-depth interviews were conducted at random with 16 faculty who teach online courses at a large community college in the Northeast about how to improve online student retention. Qualitative analysis…

  6. A Study of Student Retention and Attitudes in a Community College Preparatory Mathematics Course.

    Science.gov (United States)

    Rhodes, Jolene M.

    This study explored the effects of the use of laboratory activities on students' attitudes and retention in a community college preparatory mathematics course. It also examined whether the use of numerical, analytical, and graphical methods of solution in preparatory classes would affect student retention in the succeeding algebra course. The…

  7. Factors Affecting Student Retention in Online Courses: Overcoming This Critical Problem

    Science.gov (United States)

    Gaytan, Jorge

    2013-01-01

    The purpose of this study was to determine what a panel of 15 experts would identify as critical factors affecting student retention in online courses that will serve as implications for educational leaders to guide their student retention strategies, online organizational structures, institutional policies, and online instructional activities. A…

  8. Cooperative Learning and Enhanced Communication: Effects on Student Performance, Retention, and Attitudes in General Chemistry.

    Science.gov (United States)

    Dougherty, R. C.; And Others

    1995-01-01

    Examines the effects of cooperative learning and enhanced communication on student performance, retention, and attitudes in general chemistry. Results indicate that cooperative homework, cooperative quizzes, electronic-mail communication, and open office hours were associated with significantly higher student retention and higher performance on…

  9. Supporting Student Retention and Success: Including Family Areas in an Academic Library

    Science.gov (United States)

    Godfrey, Ian; Rutledge, Lorelei; Mowdood, Alfred; Reed, Jacob; Bigler, Scott; Soehner, Catherine

    2017-01-01

    Many universities and colleges focus on student retention and completion as a measure of their success. Publications such as the "Chronicle of Higher Education" carry an increasing number of articles dealing with student retention, success, and completion. Academic libraries support this goal through a wide variety of services, teaching,…

  10. What Works in Student Retention? Fourth National Survey. Private Four-Year Colleges and Universities Report

    Science.gov (United States)

    ACT, Inc., 2010

    2010-01-01

    This report presents the findings for private four-year colleges that participated in ACT's 2010 What Works in Student Retention survey. The report contains information pertinent to only these institutions. Appended are: (1) Data for Private Four-Year Colleges and Universities; and (2) What Works in Student Retention: Instrument. (Contains 15…

  11. What Works in Student Retention? Fourth National Survey. Public Four-Year Colleges and Universities Report

    Science.gov (United States)

    ACT, Inc., 2010

    2010-01-01

    This report presents the findings for public four-year colleges and universities that participated in ACT's 2010 What Works in Student Retention survey. The report contains information pertinent to only these institutions. Appended are: (1) Data for Public Four-Year Colleges and Universities; and (2) What Works in Student Retention: Instrument.…

  12. Retention of Knowledge following training of students in Basic Trauma Life Support.

    Science.gov (United States)

    Lim, K G; Lum, S K; Burud, I A S

    2016-12-01

    In the course of their undergraduate training at the International Medical University, students receive a Basic Trauma Life Support course. We wanted to test the long-term retention of knowledge (after 16 months) of third year medical students who had received training in Basic Trauma Life Support Method: To assess the retention of knowledge one cohort of students who received the training course were tested again 16 months later using the same 30 question One Best Answer quiz. Seventy-three students who underwent the course sat for the Retention test. The number of students who passed the Retention test was not significantly different from the test taken immediately after the course. The mean scores, 62.5% and 59.5% respectively, were however significantly different. Our study involves a relatively long interval between the course and retention of knowledge test shows encouraging results.

  13. Effects of a retention intervention program for associate degree nursing students.

    Science.gov (United States)

    Fontaine, Karen

    2014-01-01

    To evaluate the effects of a retention intervention program on nursing students' persistence in obtaining an associate's degree. An associate degree nursing program at a large community college used a three-year grant from the US Department of Labor to create a program to improve retention of nursing students. Seven retention interventions (stipends, learning communities, comprehensive orientation, individualized academic planning, counseling, peer tutoring, and community nurse mentoring) were provided to participants. Correlational analyses were conducted between demographic variables and degree completion and between individual intervention program participation and degree completion. The program produced a statistically significant improvement in retention, but no specific intervention or mixture of interventions was significantly correlated with retention. Retention programs must be comprehensive, integrated efforts in order to increase the degree completion rate.

  14. The Student-Initiated Retention Project: Theoretical Contributions and the Role of Self-Empowerment

    Science.gov (United States)

    Maldonado, David Emiliano Zapata; Rhoads, Robert; Buenavista, Tracy Lachica

    2005-01-01

    Despite the many studies of student departure, colleges and universities continue to face difficulties in retaining underrepresented student populations. The authors argue that contemporary social integration and multicultural theories of student retention theory do not adequately address the academic needs of underrepresented students of color.…

  15. Deal or No Deal: using games to improve student learning, retention and decision-making

    Science.gov (United States)

    Chow, Alan F.; Woodford, Kelly C.; Maes, Jeanne

    2011-03-01

    Student understanding and retention can be enhanced and improved by providing alternative learning activities and environments. Education theory recognizes the value of incorporating alternative activities (games, exercises and simulations) to stimulate student interest in the educational environment, enhance transfer of knowledge and improve learned retention with meaningful repetition. In this case study, we investigate using an online version of the television game show, 'Deal or No Deal', to enhance student understanding and retention by playing the game to learn expected value in an introductory statistics course, and to foster development of critical thinking skills necessary to succeed in the modern business environment. Enhancing the thinking process of problem solving using repetitive games should also improve a student's ability to follow non-mathematical problem-solving processes, which should improve the overall ability to process information and make logical decisions. Learning and retention are measured to evaluate the success of the students' performance.

  16. Principal Leadership: How Knowledge, Agency, and Beliefs Influence Grade-Level K-8 Student Retention

    Science.gov (United States)

    Evans, Matthew Thomas

    2012-01-01

    Despite voluminous research on the detrimental effects of grade-level retention, it continues as a regular practice in American public schools as an intervention for struggling students. While research has been done on the roles and influences of teachers on the retention process, little has been done to measure the influence of the school…

  17. The Value of Academic Libraries: Library Services as a Predictor of Student Retention

    Science.gov (United States)

    Murray, Adam; Ireland, Ashley; Hackathorn, Jana

    2016-01-01

    This study examined the predictive relationship between library use by individual students and their retention status in university settings. The methodology builds on a small number of previous studies to examine library use at the individual level to determine if use of specific library services is predictive of retention for freshmen and…

  18. The Relationship between Self-Directed Learning Readiness and Student Retention in Nursing Education

    Science.gov (United States)

    Larmon, Brandy H.

    2015-01-01

    Retention in higher education, especially nursing education, is a concern for nurse educators. Due to the needs of nurse graduates and practicing nurses, the characteristic of self-directed learning in students is often an educational goal of a rigorous nursing curriculum. Program retention is often impacted by such demands. This study, based upon…

  19. The Relationship between Retention and College Counseling for High-risk Students

    Science.gov (United States)

    Bishop, Kyle K.

    2016-01-01

    The author used an archival study to explore the relationship between college counseling and retention. The cohort for this study was a college's 2006 class of full-time, 1st-year students (N = 429). The results of chi-square analyses and regression analyses indicated (a) a significant difference in retention between high-risk and low-risk…

  20. African American College Student Retention and the Ecological Psychology of Historically Black Colleges.

    Science.gov (United States)

    Brown, M. Christopher, II

    1998-01-01

    Discusses the dominant historic, economic, political, and social issues which affect the retention of African American college students through studies on ecological psychology. Considers the behaviors demonstrated by historically Black colleges which translate into effective retention policies or practices for predominantly White institutions.…

  1. Enhancing Minority Student Retention and Academic Performance: What We Can Learn from Program Evaluations

    Science.gov (United States)

    Fleming, Jacqueline

    2012-01-01

    In this important resource, Dr. Fleming (a noted expert in the field of minority retention) draws on educational evaluations she has developed in the course of her distinguished career. This book analyzes the common factors and the role institutional characteristics play in minority student retention to show what really works in increasing…

  2. Pilot Testing for Feasibility in a Study of Student Retention and Attrition in Online Undergraduate Programs

    Science.gov (United States)

    Fraser, Joy; Fahlman, Dorothy; Arscott, Jane; Guillot, Isabelle

    2018-01-01

    Prior to undertaking a descriptive study on attrition and retention of students in two online undergraduate health administration and human service programs, a pilot test was conducted to assess the procedures for participant recruitment, usability of the survey questionnaire, and data collection processes. A retention model provided the…

  3. COLLEGE RETENTION OF THE ADMINISTRATION STUDENTS OF UFS: REASONS AND ACADEMIC MANAGEMENT

    Directory of Open Access Journals (Sweden)

    Rodrigo Teles Dantas de Oliveira

    2016-08-01

    Full Text Available This article discusses the subject of students retention from the Management Program of the Federal University of Sergipe (UFS, regarding the maintenance of the student beyond the regular time. The objectives of this article are to outline the characteristics of UFS’s Management students, to identify the retention reasons, to measure the quality of the course, and to learn the actions to avoid students’ retention, which were developed by the Management Program. Data were collected through documental research and bibliographic references. Google Forms® were used for the retention of the students, as well as interviews were performed with the teachers from the Program who had previously occupied the cargo of Head of the Program/Department. Quantitative data were analyzed using nonparametric statistics through the SPSS® statistical program, using the adapted Likert scale. Qualitative information was analyzed through content analysis. It was concluded that most of the retained students were female, single, aged between 18-30 years old, with 1-3 minimum income wages, within work shifts and/or under internships of 40 or more hours/week, and having more than 75% of the course completed. The reasons identified for the retention were the lack of time of the students, conflict between their professional/academic schedules; strikes; dissatisfaction with faculty members, and reprobation/locking disciplines. Students rated the course as regular. Retention management has been done partially by the Department.

  4. Examining the Retention of Nontraditional Latino(a) Students in a Career-Based Learning Community

    Science.gov (United States)

    Sandoval-Lucero, Elena; Maes, Johanna B.; Chopra, Ritu V.

    2011-01-01

    Learning communities are designed to increase student persistence and academic achievement and are a retention strategy to increase these outcomes for 1st-year college students. This article examines the educational outcomes for a learning community specifically designed for nontraditional Latina(o) students enrolled in a grant-funded program to…

  5. Effects of Academic Mindsets on College Students' Achievement and Retention

    Science.gov (United States)

    Han, Cheon-woo; Farruggia, Susan P.; Moss, Thomas P.

    2017-01-01

    Noncognitive factors, such as academic self-efficacy, motivation, and sense of belonging, predict college students' academic performance and retention. It is unclear if varying profiles of academic mindset are differentially associated with student success. We examined first-year college students' academic mindsets (perceived academic…

  6. Factors Determining Student Retention of Economic Knowledge after Completing the Principles-of-Microeconomics Course.

    Science.gov (United States)

    Kohen, Andrew I.; Kipps, Paul H.

    1979-01-01

    Reports results of a study of economics students to test the effect of time and other factors affecting retention, to develop an instrument to measure the rate of depreciation of the student's stock of economic knowledge, and to explore the implications of findings for the student's academic planning. (Author/KC)

  7. Effects of Quizzing Methodology on Student Outcomes: Reading Compliance, Retention, and Perceptions

    Science.gov (United States)

    Dowling, Carey Bernini

    2017-01-01

    This study set out to replicate and extend research on students' reading compliance and examine the impact of daily quizzing methodology on students' reading compliance and retention. 98 students in two sections of Abnormal Psychology participated (mean age = 21.5, SD = 3.35; 72.4% Caucasian). Using a multiple baseline quasi-experimental design…

  8. Alcohol Consumption and Academic Retention in First-Year College Students

    Science.gov (United States)

    Liguori, Gary; Lonbaken, Barb

    2015-01-01

    Objectives: This study attempted to identify relationships between alcohol consumption and first-to-second-year student retention among college students. Methods: 820 students in general education courses completed an online wellness assessment at four separate time points, including questions related to alcohol consumption. Data were analyzed…

  9. Who Are the Students Who May Qualify for an Alternate Assessment Based on Modified Academic Achievement Standards (AA-MAS)?: Focus Group Results. Synthesis Report 79

    Science.gov (United States)

    Berndt, Sandra; Ebben, Barbara; Kubinski, Eva; Sim, Grant; Liu, Kristin; Lazarus, Sheryl; Thurlow, Martha; Christian, Elizabeth

    2011-01-01

    Beginning in 2007, federal regulations to two major education laws gave state departments of education the option to develop an alternate assessment based on modified achievement standards (AA-MAS) for some students with disabilities. The regulations stated that the AA-MAS was intended for students who were being instructed in the grade-level…

  10. Graduation Policies for Students with Significant Cognitive Disabilities Who Participate in States' AA-AAS. Synthesis Report 97

    Science.gov (United States)

    Thurlow, Martha L.; Albus, Debra A.; Lazarus, Sheryl S.; Vang, Miong

    2014-01-01

    Graduation rates and requirements for earning a regular diploma are topics of increasing interest as states focus on ensuring that their students are college and career ready when they leave school with a diploma. To ensure that states are gauging the rates at which students are graduating in a consistent way, the Elementary and Secondary…

  11. Student Mental Models of the Greenhouse Effect: Retention Months After Interventions

    Science.gov (United States)

    Harris, S. E.; Gold, A. U.

    2013-12-01

    Individual understanding of climate science, and the greenhouse effect in particular, is one factor important for societal decision-making. Ideally, learning opportunities about the greenhouse effect will not only move people toward expert-like ideas but will also have long-lasting effects for those individuals. We assessed university students' mental models of the greenhouse effect before and after specific learning experiences, on a final exam, then again a few months later. Our aim was to measure retention after students had not necessarily been thinking about, nor studying, the greenhouse effect recently. How sticky were the ideas learned? 164 students in an introductory science course participated in a sequence of two learning activities and assessments regarding the greenhouse effect. The first lesson involved the full class, then, for the second lesson, half the students completed a simulation-based activity and the other half completed a data-driven activity. We assessed student thinking through concept sketches, multiple choice and short answer questions. All students generated concept sketches four times, and completed a set of multiple choice (MCQs) and short answer questions twice. Later, 3-4 months after the course ended, 27 students ('retention students') completed an additional concept sketch and answered the questions again, as a retention assessment. These 27 students were nearly evenly split between the two contrasting second lessons in the sequence and included both high and low-achieving students. We then compared student sketches and scores to 'expert' answers. The general pattern over time showed a significant increase in student scores from before the lesson sequence to after, both on concept sketches and MCQs, then an additional increase in concept sketch score on the final exam (MCQs were not asked on the final exam). The scores for the retention students were not significantly different from the full class. Within the retention group

  12. A Review of the Contemporary International Literature on Student Retention in Higher Education

    Directory of Open Access Journals (Sweden)

    Othman Aljohani

    2016-01-01

    Full Text Available One of the major issues that concerns tertiary institutions around the world is the student retention rate. In general, higher rates of completion give more positive image about the academic, administrative and financial statues of these institutions. However, improving the student completion and retention rates can be a challenging task. One way toward this goal is utilising strategies and techniques that are informed by the findings of theoretical models and empirical studies. Therefore, this paper reviews some of the contemporary studies in the student retention literature from different higher educational contexts around the world followed by a list of the variables that are commonly linked to the student retention phenomenon in higher education and a discussion of the factors that are most frequently associated with student attrition as reported by these studies. A summary of the factors associated with the student attrition phenomenon suggested that, the central factors were the quality of students’ institutional experiences and their level of integration into the academic and social systems of their academic institutions. These factors relate to students’ experiences with the administrative system of their academic institution, including the admission, registration and disciplinary rules and policies and the availability and quality of student services and facilities. Keywords: Higher education, student retention, attrition, persistence

  13. Identifying Facilitating Factors and Barriers to Improving Student Retention Rates in Tertiary Teaching Courses: A Systematic Review

    Science.gov (United States)

    Bowles, Terence V.; Brindle, Kimberley A.

    2017-01-01

    Factors which impact student retention in tertiary level teaching courses are complex. This study examined facilitating factors and barriers to student retention for students studying education. Due to a limited number of studies, the search was extended to factors impacting students undertaking tertiary education. A systematic review was…

  14. The Effects of Cooperative Learning Methods on Achievement, Retention and Attitudes of Home Economics Students in North Carolina.

    Science.gov (United States)

    Abu, Rosini B.; Flowers, Jim

    1997-01-01

    A nutrition unit was taught to high school home economics students (91 using cooperative learning and 106 controls). An achievement test immediately after instruction and a retention test three weeks later showed no differences in achievement, retention, or attitudes. (SK)

  15. Using data mining to improve student retention in HE: a case study.

    OpenAIRE

    Zhang, Ying; Oussena, Samia; Clark, Tony; Hyensook, Kim

    2010-01-01

    Data mining combines machine learning, statistics and visualization techniques to discover and extract knowledge. One of the biggest challenges that higher education faces is to improve student retention
 (National Audition Office, 2007).
Student retention has become an indication of academic performance and enrolment management. Our project uses data mining and natural language processing technologies to monitor student, analyze student academic behaviour and provide a basis for efficient in...

  16. Predictive Modeling of Student Performances for Retention and Academic Support in a Diagnostic Medical Sonography Program

    Science.gov (United States)

    Borghese, Peter; Lacey, Sandi

    2014-01-01

    As part of a retention and academic support program, data was collected to develop a predictive model of student performances in core classes in a Diagnostic Medical Sonography (DMS) program. The research goal was to identify students likely to have difficulty with coursework and provide supplemental tutorial support. The focus was on the…

  17. The Effect of Labor Market Conditions and Financial Aid on Doctoral Student Retention

    Science.gov (United States)

    Ampaw, Frimpomaa D.

    2010-01-01

    Forty-three percent of doctoral students never complete their degree. This dropout is the highest among graduate and professional degree programs. Previous cross sectional studies of doctoral students' retention show the importance of financial aid in predicting degree completion. The studies however, do not estimate the labor market's effect on…

  18. The Effects of 3D Computer Simulation on Biology Students' Achievement and Memory Retention

    Science.gov (United States)

    Elangovan, Tavasuria; Ismail, Zurida

    2014-01-01

    A quasi experimental study was conducted for six weeks to determine the effectiveness of two different 3D computer simulation based teaching methods, that is, realistic simulation and non-realistic simulation on Form Four Biology students' achievement and memory retention in Perak, Malaysia. A sample of 136 Form Four Biology students in Perak,…

  19. Modifying the Monte Carlo Quiz to Increase Student Motivation, Participation, and Content Retention

    Science.gov (United States)

    Simonson, Shawn R.

    2017-01-01

    Fernald developed the Monte Carlo Quiz format to enhance retention, encourage students to prepare for class, read with intention, and organize information in psychology classes. This author modified the Monte Carlo Quiz, combined it with the Minute Paper, and applied it to various courses. Students write quiz questions as part of the Minute Paper…

  20. Exploring Student Characteristics of Retention That Lead to Graduation in Higher Education Using Data Mining Models

    Science.gov (United States)

    Raju, Dheeraj; Schumacker, Randall

    2015-01-01

    The study used earliest available student data from a flagship university in the southeast United States to build data mining models like logistic regression with different variable selection methods, decision trees, and neural networks to explore important student characteristics associated with retention leading to graduation. The decision tree…

  1. Continuous Improvement: A Way of Integrating Student Enrollment, Advising, and Retention Systems in a Metropolitan University.

    Science.gov (United States)

    Beeler, Karl J.; Moehl, Pamela J.

    1996-01-01

    The University of Missouri-St. Louis has discovered the value of continuous quality improvement methods in upgrading its core student-related administrative processes. As a result, it is increasing efficiency and personalizing a traditionally bureaucratic system of student service. Concurrent goals are to increase retention and decrease time to…

  2. A Qualitative Exploration of College Student Retention: Personal Experiences of Millennial Freshmen

    Science.gov (United States)

    Barker, Kristen

    2017-01-01

    The purpose of this qualitative investigation was to discover personal reasons Millennial college freshmen, between the ages of 18-20, stated as obstacles to college retention. Fourteen students from a private college in the Midwest were selected to participate in an interview process. These students were asked a series of open-ended questions…

  3. The Impact of Mentor Leadership Styles on First-Year Adult Student Retention

    Science.gov (United States)

    Smith Staley, Charlesetta

    2012-01-01

    This quantitative study explored the leadership styles of mentors for retained first-year adult students to analyze whether the prevalent style had a higher impact on first-year adult student retention. The Multifactor Leadership Questionnaire (MLQ) 5x was used to collect data on the mentors' leadership styles from the perspective of retained…

  4. A Qualitative Investigation of Factors Promoting the Retention and Persistence of Students of Color in STEM

    Science.gov (United States)

    Palmer, Robert T.; Maramba, Dina C.; Dancy, T. Elon, II

    2011-01-01

    The literature on science, technology, engineering, and mathematics (STEM) is abounding with the importance of increasing college access, retention, and persistence among students because of implications for America's global competitiveness. Particular emphasis has been placed on college students of color who remain underrepresented in STEM…

  5. Orientation Programs and Student Retention in Distance Learning: The Case of University of Cape Coast

    Science.gov (United States)

    Arhin, Vera; Wang'eri, Tabitha

    2018-01-01

    This study investigated how orientation programs predict student retention in distance learning at the University of Cape Coast. A correlational research design was employed for the study. The target population was level-200 students in the distance education program at the university. Seven hundred and twenty-seven participants were selected from…

  6. The Role of Work Experience and Self-Efficacy in STEM Student Retention

    Science.gov (United States)

    Raelin, Joseph A.; Bailey, Margaret B.; Hamann, Jerry; Pendleton, Leslie K.; Reisberg, Rachelle; Whitman, David L.

    2015-01-01

    The authors report the results of a three-year longitudinal study of retention among undergraduate engineering students enrolled at four major universities. The study demonstrates that self-efficacy can be a critical factor in student persistence and can be broken down into three components: work, career, and academic self-efficacy. The authors…

  7. Making Sense of Disparities in Mathematics Remediation: What Is the Role of Student Retention?

    Science.gov (United States)

    Bahr, Peter Riley

    2011-01-01

    Recent research on mathematics remediation in community colleges indicates that there are large differences in the rate of successful remediation between students of differing levels of initial math deficiency. One might presume that these "skill gaps" in successful remediation are a result of differing rates of student retention. That…

  8. Relationship between retention and peer tutoring for at-risk students.

    Science.gov (United States)

    Higgins, Bonnie

    2004-07-01

    Although state governing bodies and community agencies have requested increased enrollment in nursing programs, this would be futile without curtailment of the student attrition rate. This article describes the use of a peer-tutoring program to increase retention of students at risk of failing a medical-surgical nursing course.

  9. Exploring the Effects of Hope on GPA and Retention among College Undergraduate Students on Academic Probation

    Directory of Open Access Journals (Sweden)

    Holly Seirup

    2011-01-01

    Full Text Available This study analyzed the impact of hope on the academic achievement and retention of 235 students on academic probation at a private Northeastern university. Probationary students were enrolled in a mandatory online course designed to facilitate academic and nonacademic skills, to improve student GPAs and overall retention. The Hope Scale (Snyder et al. (1991 was administered to identify whether students with greater levels of hope would experience an increase in academic success upon completion of the course. Students were broken down into groups of high, medium, and low hope based on their scores on the instrument. Results showed students who completed the course were more likely to be retained than those who did not complete the course, had a slight increase in GPA by the end of the semester, and high-hope students showed the greatest overall gain in GPAs.

  10. A Look into Students' Retention of Acquired Nature of Science Understandings

    Science.gov (United States)

    Khishfe, Rola

    2015-07-01

    Having the learning and retention of science content and skills as a goal of scientific literacy, it is significant to study the issue of retention as it relates to teaching and learning about nature of science (NOS). Then, the purpose of this study was to investigate the development of NOS understandings of students, and the retention of these understandings four months after being acquired through explicit reflective instruction in relation to two contexts. Participants were 24 tenth-grade students at a private high school in a city in the Middle East. Explicit NOS instruction was addressed within a six-week unit about genetic engineering. Three NOS aspects were integrated and dispersed across the unit. A questionnaire, together with semi-structured interviews, was administered as pre-, post-, and delayed post-test to assess the retention of participants' NOS understandings. The questionnaire had two open-ended scenarios addressing controversial socioscientific issues about genetically modified food and water fluoridation. Results showed that most students improved their naïve understandings of NOS in relation to the two contexts following the six-week unit with the explicit NOS instruction. However, these newly acquired NOS understandings were not retained by all students four months after instruction. Many of the students reverted back to their earlier naïve understandings. Conclusions about the factors facilitating the process of retention as the orientation to meaningful learning and the prolonged exposure to the domain were discussed in relation to practical implications in the classroom.

  11. Retention of first aid and basic life support skills in undergraduate medical students

    Directory of Open Access Journals (Sweden)

    Pim A. de Ruijter

    2014-11-01

    Full Text Available Background: Undergraduate medical students follow a compulsory first aid (FA and basic life support (BLS course. Retention of BLS seems poor and only little information is provided on the retention of FA skills. This study aims at evaluating 1- and 2-year retention of FA and BLS training in undergraduate medical students. Methods: One hundred and twenty students were randomly selected from first year (n=349 medical students who successfully followed a compulsory FA and BLS course. From these 120 students, 94 (78% and 69 (58% participated in retention tests of FA and BLS skills after 1 and 2 years, respectively. The assessment consisted of two FA stations and one BLS station. Results: After 1 year, only 2% passed both FA and BLS stations and 68% failed both FA and BLS stations. After 2 years, 5% passed and 50% failed both FA and BLS stations. Despite the high failure rate at the stations, 90% adequately checked vital signs and started cardiopulmonary resuscitation appropriately. Conclusions: The long-term retention of FA and BLS skills after a compulsory course in the first year is poor. Adequate check of vital signs and commencing cardiopulmonary resuscitation retained longer.

  12. Retention of first aid and basic life support skills in undergraduate medical students.

    Science.gov (United States)

    de Ruijter, Pim A; Biersteker, Heleen A; Biert, Jan; van Goor, Harry; Tan, Edward C

    2014-01-01

    Undergraduate medical students follow a compulsory first aid (FA) and basic life support (BLS) course. Retention of BLS seems poor and only little information is provided on the retention of FA skills. This study aims at evaluating 1- and 2-year retention of FA and BLS training in undergraduate medical students. One hundred and twenty students were randomly selected from first year (n=349) medical students who successfully followed a compulsory FA and BLS course. From these 120 students, 94 (78%) and 69 (58%) participated in retention tests of FA and BLS skills after 1 and 2 years, respectively. The assessment consisted of two FA stations and one BLS station. After 1 year, only 2% passed both FA and BLS stations and 68% failed both FA and BLS stations. After 2 years, 5% passed and 50% failed both FA and BLS stations. Despite the high failure rate at the stations, 90% adequately checked vital signs and started cardiopulmonary resuscitation appropriately. The long-term retention of FA and BLS skills after a compulsory course in the first year is poor. Adequate check of vital signs and commencing cardiopulmonary resuscitation retained longer.

  13. Evaluating knowledge retention of third-year medical students taught with an innovative pharmacology program.

    Science.gov (United States)

    Rodriguez, Rodolfo; Campos-Sepulveda, Efrain; Vidrio, Horacio; Contreras, Eusebio; Valenzuela, Fermin

    2002-06-01

    To explore the degree of retention of pharmacologic knowledge of third-year medical students taught in a new pharmacology teaching program. In 1997, the authors administered a retention test consisting of 100 multiple-choice questions, each with only one correct answer, to 457 third-year medical students at the National University of Mexico. Students were not told in advance about this diagnostic evaluation, which was given eight months after they completed the second-year pharmacology course. As a comparison, the authors also analyzed the results obtained by the same students in the three partial examinations taken during the second-year pharmacology course. The Kolmogorov-Smirnov procedure and Wilcoxon and chi-square tests were used to analyze data. The distribution of scores obtained in the partial exams well approximated a symmetrical bell-shaped curve, and the mean score was 59.9%. In contrast, in the retention test the distribution was negatively skewed, the mean score (69.8%) was significantly higher (p <.001), and the curve was clearly displaced to the right of that corresponding to the partial exams. The percentage of students obtaining at least a passing score (60%) was considerably higher for the retention test (82.5 versus 51.9). These findings, indicating that medical students taught in a new pharmacology program developed adequate basic pharmacologic knowledge, should encourage other medical schools to formally evaluate their teaching programs and continue efforts to improve pharmacologic education of medical students.

  14. Students-as-Customers' Satisfaction, Predictive Retention with Marketing Implications: The Case of Malaysian Higher Education Business Students

    Science.gov (United States)

    Carter, Stephen; Yeo, Amy Chu-May

    2016-01-01

    Purpose: The purpose of this paper is to investigate two areas of interest: first, to determine business student customer satisfiers that could be contributors to students' current and predicted retention in a higher educational institution (HEI) and second, to use these satisfiers to inform HEI marketing planning. Design/Methodology/Approach: The…

  15. An integrative literature review of student retention in programmes of nursing and midwifery education: why do students stay?

    Science.gov (United States)

    Cameron, Joan; Roxburgh, Michelle; Taylor, Julie; Lauder, William

    2011-05-01

    The purpose of the review was to identify student characteristics and strategies in research studies investigating retention (why students stay) as opposed to attrition (why students leave) nursing and midwifery preregistration programmes. Retention in nursing and midwifery programmes is a serious international problem. Many governments are committed to diversifying both the student population and the health care workforce. This has led to higher education institutes in some countries offering places on nursing and midwifery programmes to students with non-traditional entry qualifications. There are suggestions that the policy of widening access has contributed to the challenges of retention in nursing and midwifery programmes. Integrative literature review. Undertaken using electronic databases and specific search terms, 15 articles were identified and reviewed. The critical appraisal tools produced by CASP (2009) were used to evaluate the quality of the data. Findings from the identified research literature were analysed using qualitative content analysis. Two broad themes emerged from the analysis: Programme and Personal. Subthemes were identified in these that give clues as to why students stay: profession, support, student characteristics and family. Personal commitment and good support seem to be essential for students to remain on undergraduate programmes of nursing and midwifery. The term 'support' is rarely explicit and requires to be more clearly defined. Furthermore, studies reviewed fail to indicate clearly how to identify when students are most vulnerable and which interventions are most appropriate in different situations in supporting retaining students on programmes. Nursing and midwifery student retention is a political and professional problem. Collaboration between clinical placement providers, academic institutions, students and their families is required to address the issue. Illumination of factors that help students stay may help us devise

  16. Automated Anxiety Control Promotes Student Retention: A Replication

    Science.gov (United States)

    Driscoll, Richard; Holt, Bruce

    2012-01-01

    This study was undertaken to replicate prior findings in which a test-anxiety control training produced substantial test gains among students on academic probation. Twelve first semester students with marginal achievement were identified, screened for test anxiety, and found to have substantially higher anxiety than other students. Ten of the…

  17. Promoting Diversity: Recruitment, Selection, Orientation, and Retention of International Students

    Science.gov (United States)

    Tas, Murat

    2013-01-01

    The number of international students attending U.S. higher learning institutions has decreased over the past decade (excluding students from China and Saudi Arabia) from 40 percent to 30 percent. These students are an important resource for the U.S. and their native countries in terms of education, culture, and economy. Differences between…

  18. Academic Dishonesty: Behaviors, Sanctions, and Retention of Adjudicated College Students

    Science.gov (United States)

    Olafson, Lori; Schraw, Gregory; Kehrwald, Nicholas

    2014-01-01

    Academic dishonesty, also known as academic misconduct, includes a variety of actions such as plagiarism, cheating on tests using text messaging or concealed notes, exchanging work with other students, buying essays from students or on the Internet, and having other students write examinations (Diekhoff, LaBeff, Shinohara, & Yasukawa, 1999;…

  19. Pre-training evaluation and feedback improved skills retention of basic life support in medical students.

    Science.gov (United States)

    Li, Qi; Zhou, Rong-hua; Liu, Jin; Lin, Jing; Ma, Er-Li; Liang, Peng; Shi, Ting-wei; Fang, Li-qun; Xiao, Hong

    2013-09-01

    Pre-training evaluation and feedback have been shown to improve medical students' skills acquisition of basic life support (BLS) immediately following training. The impact of such training on BLS skills retention is unknown. This study was conducted to investigate effects of pre-training evaluation and feedback on BLS skills retention in medical students. Three hundred and thirty 3rd year medical students were randomized to two groups, the control group (C group) and pre-training evaluation and feedback group (EF group). Each group was subdivided into four subgroups according to the time of retention-test (at 1-, 3-, 6-, 12-month following the initial training). After a 45-min BLS lecture, BLS skills were assessed (pre-training evaluation) in both groups before training. Following this, the C group received 45 min training. 15 min of group feedback corresponding to students' performance in pre-training evaluation was given only in the EF group that was followed by 30 min of BLS training. BLS skills were assessed immediately after training (post-test) and at follow up (retention-test). No skills difference was observed between the two groups in pre-training evaluation. Better skills acquisition was observed in the EF group (85.3 ± 7.3 vs. 68.1 ± 12.2 in C group) at post-test (p<0.001). In all retention-test, better skills retention was observed in each EF subgroup, compared with its paired C subgroup. Pre-training evaluation and feedback improved skills retention in the EF group for 12 months after the initial training, compared with the control group. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  20. Why here and why stay? Students' voices on the retention strategies of a widening participation university.

    Science.gov (United States)

    McKendry, Stephanie; Wright, Marty; Stevenson, Keith

    2014-05-01

    Whilst concern about nursing student retention remains a key priority of governments and educators, much research is focussed on determining the causes and experiences of withdrawal. Further work is required to understand the perspectives of those students who successfully negotiate their programme of study. The study aimed to explore student motivations, experiences and support requirements during their first year to determine the efficacy of institutional retention initiatives. Qualitative data collection through focus groups at two intervals in the year. University class rooms. 46 first year nursing and midwifery students. After collection, the data was subjected to grounded theory-driven coding and thematic analysis. Coding was undertaken independently before mutual verification and theming took place. Students utilise a range of support mechanisms before and during their studies in order to maintain their motivation and to juggle the many demands on their time. These include university staff, fellow students, friends and family and those they currently know within the profession. Expectations play a significant role in student satisfaction, suggesting that institutions should ensure prospective students have a realistic understanding of what a nursing/midwifery programme and career will entail. Nurturing a sense of belonging to both the university and profession appears beneficial in promoting retention. © 2013.

  1. Graduate Counseling Students' Learning, Development, and Retention of Knowledge

    Science.gov (United States)

    Lambie, Glenn W.; Ieva, Kara P.; Mullen, Patrick R.

    2013-01-01

    The present study investigated 52 graduate counseling students' levels of ethical and legal knowledge (Lambie, Hagedorn, & Ieva, 2010) and social-cognitive development (Hy & Loevinger, 1996) at three points: (a) prior to a counseling ethics course, (b) at the completion of the course, and (c) four months later. Students' ethical and legal…

  2. Computer game-based and traditional learning method: a comparison regarding students' knowledge retention.

    Science.gov (United States)

    Rondon, Silmara; Sassi, Fernanda Chiarion; Furquim de Andrade, Claudia Regina

    2013-02-25

    Educational computer games are examples of computer-assisted learning objects, representing an educational strategy of growing interest. Given the changes in the digital world over the last decades, students of the current generation expect technology to be used in advancing their learning requiring a need to change traditional passive learning methodologies to an active multisensory experimental learning methodology. The objective of this study was to compare a computer game-based learning method with a traditional learning method, regarding learning gains and knowledge retention, as means of teaching head and neck Anatomy and Physiology to Speech-Language and Hearing pathology undergraduate students. Students were randomized to participate to one of the learning methods and the data analyst was blinded to which method of learning the students had received. Students' prior knowledge (i.e. before undergoing the learning method), short-term knowledge retention and long-term knowledge retention (i.e. six months after undergoing the learning method) were assessed with a multiple choice questionnaire. Students' performance was compared considering the three moments of assessment for both for the mean total score and for separated mean scores for Anatomy questions and for Physiology questions. Students that received the game-based method performed better in the pos-test assessment only when considering the Anatomy questions section. Students that received the traditional lecture performed better in both post-test and long-term post-test when considering the Anatomy and Physiology questions. The game-based learning method is comparable to the traditional learning method in general and in short-term gains, while the traditional lecture still seems to be more effective to improve students' short and long-term knowledge retention.

  3. Examining the Relations among Student Motivation, Engagement, and Retention in a MOOC: A Structural Equation Modeling Approach

    Directory of Open Access Journals (Sweden)

    Yao Xiong

    2015-09-01

    Full Text Available Students who are enrolled in MOOCs tend to have different motivational patterns than fee-paying college students. A majority of MOOC students demonstrate characteristics akin more to "tourists" than formal learners. As a consequence, MOOC students’ completion rate is usually very low. The current study examines the relations among student motivation, engagement, and retention using structural equation modeling and data from a Penn State University MOOC. Three distinct types of motivation are examined: intrinsic motivation, extrinsic motivation, and social motivation. Two main hypotheses are tested: (a motivation predicts student course engagement; and (b student engagement predicts their retention in the course. The results show that motivation is significantly predictive of student course engagement. Furthermore, engagement is a strong predictor of retention. The findings suggest that promoting student motivation and monitoring individual students’ online activities might improve course retention

  4. Considerations for the Use of the Observation Experience to Aid in Early Socialization and Retention of Athletic Training Students

    Science.gov (United States)

    Mazerolle, Stephanie M.; Dodge, Thomas

    2014-01-01

    Context: Retention of quality students in athletic training programs (ATPs) is important. Many factors contribute to retention of students, including their motivation level, peer support, positive interactions with instructors, clinical integration, and mentorship. Objective: Highlight the use of the observation period for preparatory athletic…

  5. Effectiveness of Computer Animation and Geometrical Instructional Model on Mathematics Achievement and Retention among Junior Secondary School Students

    Science.gov (United States)

    Gambari, A. I.; Falode, C. O.; Adegbenro, D. A.

    2014-01-01

    This study investigated the effectiveness of computer animation and geometry instructional model on mathematics achievement and retention on Junior Secondary School Students in Minna, Nigeria. It also examined the influence of gender on students' achievement and retention. The research was a pre-test post-test experimental and control group…

  6. An Intervention-Based Model of Student Retention in Adult Learners: Factors Predicting Intention to Consider Leaving or Staying

    Science.gov (United States)

    Mooshegian, Stephanie E.

    2010-01-01

    The current study merges theory and research in higher education and organizational psychology in order to investigate student retention in adult learners. Factors that are associated with student retention were examined and points of intervention are recommended. Specifically, this study focuses on the role of campus environment, classroom…

  7. University Students' Retention of Derivative Concepts 14 Months after the Course: Influence of "Met-Befores" and "Met-Afters"

    Science.gov (United States)

    Jukic, Ljerka; Dahl, Bettina

    2012-01-01

    This article reports the concluding part of a larger study on retention of key procedural and conceptual concepts in differential and integral calculus among Croatian and Danish university students in non-mathematics study programmes. The first parts of the study examined the retention of the students' knowledge through a questionnaire testing…

  8. Evaluation of a Community College's Nursing Faculty Advising Program Relative to Students' Satisfaction and Retention

    Science.gov (United States)

    Harrell, Johnna C.; Reglin, Gary

    2018-01-01

    Problem was the community college recognized a decline in student retention rates from 2009 to 2012 in the School of Nursing. Purpose of this program evaluation was to evaluate a faculty advising program (FAP) in the School of Nursing at a community college in regard to students' satisfaction and retention. Evaluation period was from Fall 2012 to…

  9. Do Pre-Entry Interventions Such as "Aimhigher" Impact on Student Retention and Success? A Review of the Literature

    Science.gov (United States)

    Thomas, Liz

    2011-01-01

    This paper reviews the potential impact of pre-entry widening access interventions on student retention and success in higher education. It thus addresses two contemporary policy concerns: What is the impact of pre-entry widening access interventions; and how can we improve student retention and success? A review of academic and practitioner…

  10. The Retention of Mexican American Students in Higher Education with Special Reference to Bicultural and Bilingual Problems.

    Science.gov (United States)

    Guerra, Manuel H.; And Others

    The problem of retaining Mexican American students in institutions of higher education is reviewed in these 5 papers: "The Retention of Mexican American Students in Higher Education with Special Reference to Bicultural and Bilingual Problems" by Manuel H. Guerra; "Mexicanismo vs. Retention: Implications of Retaining Mexican American…

  11. Outlook on Student Retention in Higher Education University Reforms in Morocco

    Directory of Open Access Journals (Sweden)

    Zoulal Mansouri

    2017-04-01

    Full Text Available High student attrition rates at university have become one of the most challenging issues in higher education worldwide in the last five decades. Moroccan universities are no exception. At-risk students drop out of studies for a plethora of reasons, and the attrition rate is increasing despite the efforts made in education reforms carried out since 1999. This article reviews the most important components of the higher education reforms that have been adopted in Moroccan higher education in their endeavor to enhance student retention in university. These components are chronologically reviewed, first in the National Charter of Education and Training (NCET launched in 1999, second in the Emergency Plan conducted in 2009-2012, and finally in the latest Strategic Vision of Reform 2015-2030. It is concluded that more efforts are necessary to strike a balance between quantity and quality in terms of student retention in university education.

  12. Keeping students in by sending them out: Retention and service-learning

    Directory of Open Access Journals (Sweden)

    Iris Mae Yob

    2014-06-01

    Full Text Available This review of recent literature examines the research on the impact of service-learning on student retention.  The theoretical framework of the review draws on both Tinto’s model of student attrition and Knowles’s theory of adult learning, which together suggest that academic and social integration, active participation and engagement in learning, and application and relevancy of the subject-matter under study are key factors in student success. The role of these factors has been confirmed in a growing body of research around learning experiences in general and, as this review shows, particularly in service-learning experiences. Suggestions are made for how future research might expand and critically deepen this evidence and offers some implications for service-learning as a means of improving student retention. DOI: 10.18870/hlrc.v4i2.177

  13. Using data to help increase STEM retention rates for at-risk students; Student expectations and skill building

    Science.gov (United States)

    Reed, D. E.; Jones, G.; Heaney, A.

    2013-12-01

    Retention in the STEM fields is often a focus for higher education due to a shortage of trained workforce members. In particular, much effort has been spent on first year retention rates and introductory level courses under the assumption that students are more likely to drop out of STEM majors early in their higher education degree progress. While the retention rates of women, minorities, and low income students have been a priority by both the National Science Foundation and the private sector, we are interested in at-risk first year students for this study. The University of Wyoming Synergy Program's goal is to promote academic success and retention for underprepared and at-risk students by creating a series of first semester curricula as theme-based college transition skills courses that are paired with English courses. This creates a cohort group of courses for the students with increased communication between instructors at the same time allowing greater development of student social networks. In this study we are highlighting the results of the STEM students as compared with other at-risk participants in the program. The Synergy Program enrolls approximately 144 students each year with pre- and post-course surveys that directly measure which college skills students select as important as well as student expectations of the amount of time required for STEM courses. Follow-up surveys track the same queries for students who persist to their junior and senior year. In addition, instructors complete a summative survey about skills they find important to student success and individual student's challenges and successes with a variety of skills. Our results show a large gap in skills between those identified as important by students and those identified by their instructors. Expectations for the amount of time required to complete work for STEM courses and the reported time spent on course work are not constant when progressing throughout college. This analysis

  14. Learning Analytics and Digital Badges: Potential Impact on Student Retention in Higher Education

    Science.gov (United States)

    Mah, Dana-Kristin

    2016-01-01

    Learning analytics and digital badges are emerging research fields in educational science. They both show promise for enhancing student retention in higher education, where withdrawals prior to degree completion remain at about 30% in Organisation for Economic Cooperation and Development member countries. This integrative review provides an…

  15. Retention Assessment of Core Operations Management Topics for Business Administration Students

    Science.gov (United States)

    Koppel, Nicole B.; Hollister, Kimberly Killmer

    2009-01-01

    To meet the new AACSB International standards regarding retention assessment and adequately determine "if and what students are learning," this research presents a framework within which expected learning outcomes and specific learning are assessed. This paper presents the framework and describes how the process can be implemented with…

  16. Data pre-processing: a case study in predicting student's retention in ...

    African Journals Online (AJOL)

    dataset with features that are ready for data mining task. The study also proposed a process model and suggestions, which can be applied to support more comprehensible tools for educational domain who is the end user. Subsequently, the data pre-processing become more efficient for predicting student's retention in ...

  17. Myth Busting: Using Data Mining to Refute Link between Transfer Students and Retention Risk

    Science.gov (United States)

    McAleer, Brenda; Szakas, Joseph S.

    2010-01-01

    In the past few years, universities have become much more involved in outcomes assessment. Outside of the classroom analysis of learning outcomes, an investigation is performed into the use of current data mining tools to assess the issue of student retention within the Computer Information Systems (CIS) department. Utilizing both a historical…

  18. Student Retention in an Era of Globalization: A Case Study of IGNOU Regional Centre, Mumbai

    Science.gov (United States)

    Rajesh, M.

    2011-01-01

    Student Retention is a function of a number of factors, the most important among them being--the academic response mechanism of an institution, effectiveness in handling administrative queries, counseling at learner support centres, effectiveness in handling practical session and so on. The current paper is an attempt to study the effectiveness of…

  19. Recruitment and Retention Strategies for Latino Students in Tennessee's Private 4-Year Institutions

    Science.gov (United States)

    Abood, Carrie

    2012-01-01

    The purpose of this research study was to identify the perceived effective strategies utilized by colleges and universities to recruit, retain, and graduate Latino students. This study specifically explored the self-reported enrollment and retention strategies and their perceived effectiveness by the 34 member institutions of the Tennessee…

  20. University Executive Team's Collective Leadership and Its Impact on Student Retention on Catholic Campuses

    Science.gov (United States)

    Perez, Michelle

    2016-01-01

    Although individual leadership behaviors, particularly those of a college president have been studied extensively, the possibility of leading at the group level, particularly the relationship of leadership behaviors of the college executive team and its effect on student retention, remains unclear. Based on 68 college executive leader responses,…

  1. Sustainable Student Retention and Gender Issues in Mathematics for ICT Study

    Science.gov (United States)

    Divjak, Blazenka; Ostroski, Mirela; Hains, Violeta Vidacek

    2010-01-01

    This article reports on the research whose specific objective is to improve student retention in mathematics included in the first-year ICT study programme by means of improving teaching methods, with an emphasis on gender issues. Two principal reasons for this research are, first, the fact that first-year mathematics courses are often viewed as…

  2. Generation Y Student-Teachers' Motivational Factors: Retention Implications for K-12 Educational Leaders

    Science.gov (United States)

    Bontempo, Brian

    2010-01-01

    Generation Y represents a growing number of student-teachers who will impact the future of educational practice, yet little research has been conducted for this demographic group. The purpose of this mixed-method study was to identify motivational factors of neophyte teachers and the retention implications these findings had on Kindergarten…

  3. Did the Recession Impact Student Success? Relationships of Finances, Staffing and Institutional Type on Retention

    Science.gov (United States)

    Gansemer-Topf, Ann M.; Downey, Jillian; Thompson, Katherine; Genschel, Ulrike

    2018-01-01

    Economic recessions impact higher education institutions in complex ways. Several analyses have examined the influence of the 2007-2009 recession on tuition, enrollments, revenues, and expenditures, but the connection of these resource allocation patterns to a student success outcome--namely, retention--is limited. This study examined…

  4. Recruitment Combined with Retention Strategies Results in Institutional Effectiveness and Student Satisfaction.

    Science.gov (United States)

    Youngman, Curtis

    In Winter 1994, the Marketing Department at Salt Lake Community College (SLCC) in Utah implemented an educational marketing plan that incorporated a focus on customer service to improve institutional effectiveness and student satisfaction. The plan includes a retention and recruitment program to strengthen the college's relationship with current…

  5. Validating Student Satisfaction Related to Persistence, Academic Performance, Retention and Career Advancement within ODL Perspectives

    Science.gov (United States)

    Sembiring, Maximus Gorky

    2015-01-01

    Student satisfaction associated with persistence, academic performance, retention, and its relations to career advancement were examined. It was aimed at measuring service quality (Servqual) dimensions as a foundation of satisfaction and how, in what comportments, they were interrelated. The study was conducted under explanatory-design. Data was…

  6. Promoting retention, enabling success: Discovering the potential of student support circles.

    Science.gov (United States)

    Bass, Janice; Walters, Caroline; Toohill, Jocelyn; Sidebotham, Mary

    2016-09-01

    Retention of students is critical to education programs and future workforce. A mixed methods study evaluated student engagement within a Bachelor of Midwifery program and connection with career choice through participation in student support circles. Centred on the Five Senses of Success Framework (sense of capability, purpose, identity, resourcefulness and connectedness) and including four stages of engagement (creating space, preparing self, sharing stories, focused conversations), the circles support and develop student and professional identity. Of 80 students 43 (54%) provided responses to a two item survey assessed against a five point Likert scale to determine utility. Using a nominal group technique, student's voices gave rich insight into the personal and professional growth that participation in the student support circles provided. Evaluated as helpful to first year students in orientating to university study and early socialisation into the profession, the circles appear to influence the development of a strong sense of professional identity and personal midwifery philosophy based on the relational nature of the midwife being with woman rather than doing midwifery. This suggests that student support circles positively influence perceptions and expectations, contributing to a shared sense of purpose and discipline connection, for enhancing student retention and future workforce participation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. External and Internal Barriers to Studying Can Affect Student Success and Retention in a Diverse Classroom

    Directory of Open Access Journals (Sweden)

    Laurence Clement

    2016-12-01

    Full Text Available Although a majority of under-represented minority (URM students begin their postsecondary education at community colleges, little is known about barriers to success and retention for transfer-bound science students. This study focuses on some of the barriers that affect these students’ ability to study adequately for a community college “gateway” course. It tests whether instructors’ expectations of study time were realistic for community college students and whether students reported facing external barriers, such as job and family responsibilities, or internal barriers to studying, such as lack of motivational, cognitive, and metacognitive abilities, all of which have been shown to impact academic success and retention. It also tests whether students who faced such barriers were less likely to succeed in and complete the course, as well as whether time spent studying was related to course success. The findings reported here show that community college students do not have enough available time to study and that external and internal barriers are both prevalent among these students. In addition, students who faced such barriers are more likely to fail or drop the class. Results also show that study time is positively correlated with retention, but not performance, as well as with some motivational, cognitive, and metacognitive dimensions of self-regulated learning. These findings lead to new questions, including whether student success in a community college class is associated with the use of cognitive and metacognitive learning strategies for students with no prior degrees, and whether increased course structure may improve success for college students with lower self-regulated abilities.

  8. Retention of underrepresented minority students in dental school: one dental schools story.

    Science.gov (United States)

    Lacy, Ernestine S; Miller, Barbara H; Hornback, Sheryl A; McCann, Ann L; Reuben, Jayne S

    2011-01-01

    There is a large disparity between the proportions of African-Americans, Hispanics, and Native Americans in the general population and in the dental profession. While these underrepresented minorities (URMs) as a group make up almost 30% of the United States population, they constitute only about 6% of the nation's dentists. Eliminating this disparity is important in addressing access to care for underrepresented groups. Texas A&M Health Science Center Baylor College of Dentistry (TAMHSC-BCD) enrolled greater numbers and proportions of URM students than any other non-minority school from 2006-2010. Strategies used to achieve this level of diversity include a Whole File Review process; career awareness activities for elementary, junior high and high school students; and academic enrichment programs for college students and college graduates. Retaining and graduating URM students is just as important as enrolling them. TAMHSC-BCD's retention rate over the last five years is 95.7% for all students and 92.5% for URM students. A wide range of services aids in the retention process. These services are available to all students and include monitoring of students' academic performance followed up with academic advisement as appropriate, peer tutoring, an alternative five-year curriculum, professional psychological counseling, professional learning assessments, social support; and mentoring through student organizations. The retention program at TAMHSC-BCD can serve as a model for other dental and other health professions schools seeking ways to ensure the academic success of their URM students. The more of these students we enroll and graduate, the more the problem of access to dental care is addressed.

  9. Relevant Adult Programs, Resilient Students, and Retention-Driven Administration

    Science.gov (United States)

    Beth Sullivan, Esther; Pagano, Rosanne V.

    2012-01-01

    In ten years, Alaska Pacific University has moved from a totally decentralized administration of its adult online program to a very centralized structure. Drastic changes in funding sources and student needs have compelled the university to take new approaches. As the learning landscape continues to shift for adults, online learners, and Alaska…

  10. College Retention Initiatives Meeting the Needs of Millennial Freshman Students

    Science.gov (United States)

    Turner, Patrick; Thompson, Elizabeth

    2014-01-01

    The qualitative study explored the opinions and perceptions of freshman, sophomores, and freshman students that dropped out of the university to understand the obstacles and enablers that millennial freshmen faced transitioning into a college environment. To understand these factors the study posed the question, how do the participants (i.e.,…

  11. Pre-Semester Workshops and Student Nurse Retention

    Science.gov (United States)

    Jacobs, Steven

    2016-01-01

    The purpose of this study is to determine if student confidence levels change when attending a series of five pre-semester orientation success workshops. This research was conducted at a Canadian Community College whose attrition rates for the Practical Nursing program within the host college average 36%. The workshop sessions occur prior to the…

  12. Why They Stay - Retention Strategies for Students from Diverse Backgrounds in the Geosciences

    Science.gov (United States)

    Haacker, R.

    2014-12-01

    The geosciences have had a chronic problem of underrepresentation of students from diverse ethnic, cultural, and socio-economic backgrounds. While many programs and efforts focus on the recruitment of minorities, a strategic approach to increase retention is equally important for a student's success. Students from diverse backgrounds often face isolation in majority schools, and lack role models and guidance as they navigate through the academic system. Research has shown that continuous and individualized support can greatly strengthen a student's performance and chance of staying in the field. Successful strategies include a strong mentoring system, early involvement in research, cohort building, and creating a welcoming campus climate. At the SOARS Center for Undergraduate Research, we have found that offering students research topics that allow them to give back to society increases engagement and retention significantly. All interventions need to be applied early, often and on a continuous basis in a student's college experience. A long-term mentor assigned to the student beyond a class or a summer research experience can provide follow-up and champion the student's progress. This presentation will share successful approaches of retaining diverse students in the geosciences and discuss how we can support each other in the community to provide such resources.

  13. THE EFFECT OF RECIPROCAL TEACHING LEARNING MODEL INTEGRATED MIND MAP AND PERSISTENCE ON STUDENT RETENTION OF KINGDOM ANIMALIA CONCEPT

    OpenAIRE

    Septiana, Dwi; Miarsyah, Mieke; Komala, Ratna

    2017-01-01

    The low score of students learning outcome on Kingdom  Animalia concept indicate that there must an improvement of students retention. The aim of this study is to know the effect of reciprocal teaching learning model that integrated with mind map and persistence on students retention. The method that used in this research is quasi experiment with 2 x 2 factorial design. The instruments that used in this research are learning outcome test and persistence questionnaire. The subject of this...

  14. Executive Management Team Demography and Minority Student Retention: Does Executive Team Diversity Influence the Retention of Minority Students?

    Science.gov (United States)

    Fincher, Mark; Katsinas, Stephen; Bush, V. Barbara

    2010-01-01

    Many colleges and universities are expected to produce more graduates while responding to an increasing level of racial and ethnic diversity among students. While the importance of diversity within executive management leadership teams may be accepted among nonprofit higher education institutions, the connection between diversity among the…

  15. Negative Impact of Employment on Engineering Student Time Management, Time to Degree, and Retention: Faculty, Administrator, and Staff Perspectives

    Science.gov (United States)

    Tyson, Will

    2012-01-01

    Interviews with faculty, administrators, staff, and students at four engineering programs reveal the role of undergraduate student employment on retention and timely degree completion among engineering students. Dueling narratives reveal how student approaches to earning an engineering degree differ greatly from faculty, administrator, and staff…

  16. Recruitment, advising, and retention programs - Challenges and solutions to the international problem of poor nursing student retention: A narrative literature review.

    Science.gov (United States)

    Mooring, Quanza E

    2016-05-01

    The aim of this literature review was to identify emerging themes in current research to identify challenges to nursing student retention internationally, as well as strategies to improve persistence. A narrative literature review was conducted. Using CINAHL and HealthSource databases, journal articles were reviewed and evaluated for emerging themes related to the causes of high nursing student attrition rates and strategies to overcome this issue. A five-step approach was used to complete the narrative review, beginning with problem identification, followed by the literature search, data analysis, theme emergence and synthesis of the information. The literature review supports the idea that poor retention is related not only to student ability, but also to a lack of necessary intervention by faculty beginning with the admission process and continuing throughout the curriculum. Alterations should be made in the recruitment and student selection process. Aggressive academic advising strategies should be implemented, and retention programs should be interwoven in to the nursing curriculum. Student retention is a multifaceted issue that requires a multi-modal approach. Changes in recruitment, implementation of academic advising, and curriculum integration have the potential to help correct the problem. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. A scholastic appeals process for dental hygiene student remediation and retention.

    Science.gov (United States)

    Freudenthal, Jacqueline; Bowen, Denise M

    2010-03-01

    A scholastic appeals process tailoring individualized remediation for dental hygiene students not meeting academic standards was assessed retrospectively (1999-2008) to evaluate retention and academic failure rates, nature of academic problems, type of remediation, and success of recommendations. Academic records of students (n=55) not meeting academic standards and/or withdrawing were reviewed. Overall retention (92.7 percent) ranged from 86.7 percent to 96.6 percent. Of the fifty-five students whose records were reviewed, six students (10.91 percent) withdrew for medical/personal reasons, and forty-nine (89.1 percent) petitioned for individualized remediation. The number and percentage of students in each category of reasons are as follows: four (7.5 percent) preclinical; thirty-seven (69.8 percent) clinical; eight (15.1 percent) academic/clinical/personal reasons; and four (7.5 percent) academic dishonesty. The options approved were the following: continue in the program with grade below C- (n=3), summer clinical course with individualized contract (n=11), or independent study course during the academic year plus the summer course (n=13), all without delaying graduation; repeating a course with a one-semester delay in graduation (n=7); and auditing/repeating multiple courses with a one-year delay in graduation (n=3). Twelve students were dismissed after denial of a petition requesting remediation or second failure. The scholastic appeals process was successful for 75.5 percent (n=37) of the students who petitioned after failing to meet academic standards, thereby contributing to the 92.7 percent overall retention rate. Student-specific remediation plans based on individual academic appeals are viable options for ensuring success.

  18. Impact of distributed virtual reality on engineering knowledge retention and student engagement

    Science.gov (United States)

    Sulbaran, Tulio Alberto

    Engineering Education is facing many problems, one of which is poor knowledge retention among engineering students. This problem affects the Architecture, Engineering, and Construction (A/E/C) industry, because students are unprepared for many necessary job skills. This problem of poor knowledge retention is caused by many factors, one of which is the mismatch between student learning preferences and the media used to teach engineering. The purpose of this research is to assess the impact of Distributed Virtual Reality (DVR) as an engineering teaching tool. The implementation of DVR addresses the issue of poor knowledge retention by impacting the mismatch between learning and teaching style in the visual versus verbal spectrum. Using as a point of departure three knowledge domain areas (Learning and Instruction, Distributed Virtual Reality and Crane Selection as Part of Crane Lift Planning), a DVR engineering teaching tool is developed, deployed and assessed in engineering classrooms. The statistical analysis of the data indicates that: (1) most engineering students are visual learners; (2) most students would like more classes using DVR; (3) engineering students find DVR more engaging than traditional learning methods; (4) most students find the responsiveness of the DVR environments to be either good or very good; (5) all students are able to interact with DVR and most of the students found it easy or very easy to navigate (without previous formal training in how to use DVR); (6) students' knowledge regarding the subject (crane selection) is higher after the experiment; and, (7) students' using different instructional media do not demonstrate statistical difference in knowledge retained after the experiment. This inter-disciplinary research offers opportunities for direct and immediate application in education, research, and industry, due to the fact that the instructional module developed (on crane selection as part of construction crane lift planning) can be

  19. Methods for Retention of Undergraduate Students in Field-Based Research

    Science.gov (United States)

    Lehnen, J. N.

    2017-12-01

    Undergraduate students often participate in research by following the vision, creativity, and procedures established by their principal investigators. Students at the undergraduate level rarely get a chance to direct the course of their own research and have little experience creatively solving advanced problems and establishing project objectives. This lack of independence and ingenuity results in students missing out on some of the most key aspects of research. For the last two years, the Undergraduate Student Instrument Project (USIP) at the University of Houston has encouraged students to become more independent scientists by completing a research project from start to finish with minimal reliance on faculty mentors. As part of USIP, students were responsible for proposing scientific questions about the upper stratosphere, designing instruments to answer those questions, and launching their experiments into the atmosphere of Fairbanks, Alaska. Everything from formulation of experiment ideas to actual launching of the balloon borne payloads was planned by and performed by students; members of the team even established a student leadership system, handled monetary responsibilities, and coordinated with NASA representatives to complete design review requirements. This session will discuss the pros and cons of student-led research by drawing on USIP as an example, focusing specifically on how the experience impacted student engagement and retention in the program. This session will also discuss how to encourage students to disseminate their knowledge through conferences, collaborations, and educational outreach initiatives by again using USIP students as an example.

  20. Validating Student Satisfaction Related to Persistence, Academic Performance, Retention and Career Advancement within ODL Perspectives

    Directory of Open Access Journals (Sweden)

    Maximus Gorky Sembiring

    2015-11-01

    Full Text Available Student satisfaction associated with persistence, academic performance, retention, and its relations to career advancement were examined. It was aimed at measuring service quality (Servqual dimensions as a foundation of satisfaction and how, in what comportments, they were interrelated. The study was conducted under explanatory-design. Data was collected proportionally and purposively followed by congregating them through unified interviews. Population was 1,814 Universitas Terbuka students domiciled overseas; 350 questionnaires were dispersed, 169 completed. Satisfaction was assessed by examining Servqual dimensions. Importance-performance analysis (IPA and customer-satisfaction index (CSI were applied to measure satisfaction and the level of its importance. Structural equation model (SEM was then employed to examine influencing variables. Nine hypotheses developed were all validated by the analysis. Responsiveness, assurance, tangible, reliability, and empathy were in harmony to satisfaction. Career advancement, retention, academic performance, and persistence were influenced by satisfaction. Qualitative inquiry implemented afterwards was basically coherent with the quantitative findings.

  1. Improved knowledge retention among clinical pharmacy students using an anthropology classroom assessment technique.

    Science.gov (United States)

    Whitley, Heather P; Parton, Jason M

    2014-09-15

    To adapt a classroom assessment technique (CAT) from an anthropology course to a diabetes module in a clinical pharmacy skills laboratory and to determine student knowledge retention from baseline. Diabetes item stems, focused on module objectives, replaced anthropology terms. Answer choices, coded to Bloom's Taxonomy, were expanded to include higher-order thinking. Students completed the online 5-item probe 4 times: prelaboratory lecture, postlaboratory, and at 6 months and 12 months after laboratory. Statistical analyses utilized a single factor, repeated measures design using rank transformations of means with a Mann-Whitney-Wilcoxon test. The CAT revealed a significant increase in knowledge from prelaboratory compared to all postlaboratory measurements (panthropology assessment tool was effectively adapted using Bloom's Taxonomy as a guide and, when used repeatedly, demonstrated knowledge retention. Minimal time was devoted to application of the probe making it an easily adaptable CAT.

  2. MS PHD'S: Effective Strategies for the Retention and Advancement of URM Students in ESS

    Science.gov (United States)

    Escalera, J.; Burgess, A. K.; Pace, L.; Scott, O.; Strickland, J.; Johnson, A.; Williamson Whitney, V.; Ithier-Guzman, W.

    2012-12-01

    The Minorities Striving and Pursuing Higher Degrees of Success (MS PHD'S) Professional Development Program in Earth system science (ESS) is a model initiative for improving the retention of underrepresented minority (URM) students in STEM fields. Entering its ninth cohort, MS PHD'S remains committed to helping URM undergraduate and graduate students achieve outstanding careers in ESS. MS PHD'S facilitates URM student achievement through a three-phase program designed to increase student exposure to the ESS community. By engaging in a series of professional development and skill building exercises, peer-to-peer community building activities, participation in scientific society conferences and workshops, mentoring by URM and other scientists, and a virtual community, URM students gain the confidence and support necessary to achieve their academic goals and enter the ESS workforce. Since its inception, MS PHD'S continues to support 189 participants. Of these 189 participants, 35 have advanced from undergraduate and graduate academic pathways to completion of their PhD and another 60 are currently enrolled in doctoral programs. MS PHD'S maintains close ties with program alumni to further support retention, inclusivity, and broadening participation of URM students and graduates in STEM activities. Its model is built on reengaging alumni to become mentors and leaders for each new cohort as well as facilitating valuable opportunities for alumni to advance in their ESS related academic and professional career pathways.

  3. Track and Connect: Enhancing student retention and success at the University of Sydney. A Practice Report

    Directory of Open Access Journals (Sweden)

    Sophia Barnes

    2015-03-01

    Full Text Available In 2012, staff in Student Support Services at The University of Sydney piloted an early intervention program to increase first year student engagement and retention. Founded in best-practice, evidence-based research, the Track and Connect program was developed in response to a study into first year undergraduate student attrition by the University’s Planning and Information Office, in consultation with Counselling and Psychological Services. Track and Connect provides tailored advice and support to students identified as at risk of withdrawal from a key first-year subject by demographic markers and on-time data. Trained senior peers contact these students and provide information, encouragement and service referrals at key decision points throughout the semester. This report outlines the program’s development, implementation and early outcomes, and identifies areas for refinement and expansion.

  4. University First Year Advisors: A network approach for first year student transition and retention. A Practice Report.

    Directory of Open Access Journals (Sweden)

    Geraldine Box

    2012-03-01

    Full Text Available Focussing expressly on student support and retention, improving the first year experience has been addressed by Murdoch University through the implementation of a School discipline-specific network of professional First Year Advisors (FYAs. FYA initiatives, both broad-based and varied, have been developed in alignment with the changing needs of students as identified throughout the semesters. A combination of outreach telephone campaigns and face-to-face student support enables FYAs to conduct a "just in time" approach to positively increase student engagement, and ultimately, retention. With a bespoke database, FYAs and academic staff have been able to streamline the process of reporting students in need of support, and gather data relating to student retention. The FYA program is yet to be formally evaluated although initial feedback and student consultation is promising. This paper outlines the program's development, current initiatives and expected outcomes.  

  5. Pharmacy Students' Retention of Knowledge and Skills Following Training in Automated External Defibrillator Use

    Science.gov (United States)

    Dopp, Anna Legreid; Dopp, John M.; Vardeny, Orly; Sims, J. Jason

    2010-01-01

    Objectives To assess pharmacy students' retention of knowledge about appropriate automated external defibrillator use and counseling points following didactic training and simulated experience. Design Following a lecture on sudden cardiac arrest and automated external defibrillator use, second-year doctor of pharmacy (PharmD) students were assessed on their ability to perform basic life support and deliver a shock at baseline, 3 weeks, and 4 months. Students completed a questionnaire to evaluate recall of counseling points for laypeople/the public. Assessment Mean time to shock delivery at baseline was 74 ± 25 seconds, which improved significantly at 3 weeks (50 ± 17 seconds, p defibrillator counseling points was diminished after 4 months. Conclusion Pharmacy students can use automated external defibrillators to quickly deliver a shock and are able to retain this ability after 4 months. Refresher training/courses will be required to improve students' retention of automated external defibrillator counseling points to ensure their ability to deliver appropriate patient education. PMID:21045951

  6. Freshmen baccalaureate nursing students' perceptions of their academic and nonacademic experiences: implications for retention.

    Science.gov (United States)

    Sherrod, R A; Harrison, L L; Lowery, B H; Wood, F G; Edwards, R M; Gaskins, S W; Buttram, T

    1992-01-01

    As a component of the evaluation for a program designed to enhance recruitment and retention of disadvantaged nursing students, qualitative interviews were conducted, with a sample of 20 baccalaureate nursing students at the end of their freshman year. Students were asked to describe positive aspects of their academic and nonacademic experiences as well as problems that were experienced, with recommendations for resolving these problems. Positive aspects of the freshman experience that were identified included academic, social, familial, and financial support. Problems cited were related to two categories of factors, external and internal. Problems related to external factors included excessive academic loads, course-specific problems such as with the sciences, large class size, faculty inattentiveness, racial tensions, dorm/roommate problems, and parking or commuting time. Problems related to internal factors included poor study habits, loneliness, homesickness, family conflicts, and difficulties with peer relationships. The findings can be used by nursing faculty to determine the extent to which programs address students' perceived needs and to identify innovative retention strategies that would enhance students' perceptions of their college experience.

  7. Female athletic training students' perceptions of motherhood and retention in athletic training.

    Science.gov (United States)

    Mazerolle, Stephanie M; Gavin, Kerri

    2013-01-01

    Motherhood appears to be a catalyst in job turnover for female athletic trainers, especially those employed at the National Collegiate Athletic Association Division I level. However, most researchers examining this topic have investigated the perspectives of those who are currently employed rather than those who are preparing to enter the profession. To evaluate female athletic training students' perceptions of motherhood and retention. Qualitative study. Athletic training education program. A total of 18 female athletic training students volunteered to participate. They were enrolled in 1 Commission on Accrediting Athletic Training Education-accredited athletic training program and represented 3 levels of academic STUDY. The participants responded to a series of questions related to work-life balance and retention in athletic training. Analysis of the data followed a general inductive process. Credibility was established by interpretive member checks and peer review. The first theme, clinical setting, speaks to the belief that work-life balance and retention in athletic training require an employment setting that fosters a family-friendly atmosphere and a work schedule (including travel) that allows for time at home. The second theme, mentorship, reflects the acknowledgment that a female mentor who is successful in balancing the roles of mother and athletic trainer can serve as a role model. The final theme, work-life balance strategies, illustrates the need to have a plan in place to meet the demands of both home and work life. A female athletic trainer who is successfully balancing her career and family responsibilities may be the most helpful factor in retention, especially for female athletic training students. Young professionals need to be educated on the importance of developing successful work-life balance strategies, which can be helpful in reducing attrition from the profession.

  8. Effectiveness of an Adaptive Quizzing System as an Institutional-Wide Strategy to Improve Student Learning and Retention.

    Science.gov (United States)

    Simon-Campbell, Eʼ Loria; Phelan, Julia

    2016-01-01

    Exploring ways to help students achieve success in nursing programs is critical to increase retention and the number of nurse graduates. This study examined the impact of an adaptive quizzing system implemented as a strategy to support student persistence and performance measured by use, grades, and graduation. Results indicated that use of the system increased course content mastery and predicted final course grades. Retention and program completion rates were also positively influenced.

  9. Modeling Retention at a Large Public University: Can At-Risk Students Be Identified Early Enough to Treat?

    Science.gov (United States)

    Singell, Larry D.; Waddell, Glen R.

    2010-01-01

    We examine the extent to which readily available data at a large public university can be used to a priori identify at-risk students who may benefit from targeted retention efforts. Although it is possible to identify such students, there remains an inevitable tradeoff in any resource allocation between not treating the students who are likely to…

  10. Effects of Information and Communication Technology (ICT) on Students' Academic Achievement and Retention in Chemistry at Secondary Level

    Science.gov (United States)

    Hussain, Ishtiaq; Suleman, Qaiser; ud Din, M. Naseer; Shafique, Farhan

    2017-01-01

    The current paper investigated the effects of information and communication technology on the students' academic achievement and retention in chemistry. Fifty students of 9th grade were selected randomly from Kohsar Public School and College Latamber Karak. The students were grouped into equivalent groups based on pretest score. In order to…

  11. The Interplay of Family Income, Campus Residency, and Student Retention (What Practitioners Should Know about Cultural Mismatch)

    Science.gov (United States)

    Schudde, Lauren

    2016-01-01

    Students from low-income families consistently trail behind their peers in retention and degree attainment. Research on college student experiences suggests that low-income students experience "cultural mismatch" at college--they feel that their backgrounds are at odds with the middle-class values dominant on campus (Armstrong &…

  12. Effect of collaborative testing on learning and retention of course content in nursing students.

    Science.gov (United States)

    Rivaz, Mozhgan; Momennasab, Marzieh; Shokrollahi, Paymaneh

    2015-10-01

    Collaborative testing is a learning strategy that provides students with the opportunity to learn and practice collaboration. This study aimed to determine the effect of collaborative testing on test performance and retention of course content in nursing students of Shiraz University of Medical Sciences, Shiraz, Iran. This quasi-experimental study was carried out on 84 students enrolled in the course of Medical-Surgical 2 in Spring 2013 and Fall 2013 semesters. The control group consisting of 39 students participated in the first mid-term exam in an individual format. The intervention group, on the other hand, consisted of 45 students who took the test in a two-stage process. The first stage included an individual testing, while the second stage was a collaborative one given in groups of five individuals chosen randomly. Four weeks later, in order to investigate retention of the course content, both groups took part in the second mid-term exam held individually. The study findings showed significant difference between the mean scores in the intervention group in the Fall 2013 semester (p=0.001). Besides, a statistically significant difference was found between the two groups regarding the tests mean scores (p=0.001). Moreover, retention of course content improved in the collaborative group (p=0.001). The results indicated an increase in test performance and a long-term learning enhancement in collaborative testing compared with the traditional method. Collaborative testing, as an active learning technique and a valuable assessment method, can help nursing instructors provide the alumni with strong problem-solving and critical thinking abilities at healthcare environments.

  13. Don't go with the 'FLO' - a student mobile texting service to enhance nursing student retention.

    Science.gov (United States)

    Boath, Elizabeth; Jinks, Annette; Thomas, Nigel; Thompson, Roy; Evans, Jayne; O'Connell, Phil; Taylor, Lisa

    2016-10-01

    The review undertaken revealed that there is an abundance of literature concerning retention and the high levels of attrition among undergraduate students and of relevance here, nurse education. The study undertaken evaluated the use of mobile phone automated texts designed to provide information, support and reassurance to help alleviate the stress and anxieties that some undergraduate nursing students experience during the early phase of their studies and which can lead to some students leaving their programme. The objective of the study was to evaluate how use of automated mobile phone texts, using a system known as FLO, could usefully supplement pastoral support, as an intervention to reduce attrition among undergraduate nursing students. A qualitative and quantitative evaluation was conducted using an open-ended questionnaire designed specifically for the study. The sample were two cohorts of undergraduate first year student nurses (n=178). Of these 123 (69%) signed up to FLO and 77 (63%) completed the evaluation form. The evaluation form that was administered in a classroom situation one week after use of FLO had ceased. Data were analysed through use of a descriptive statistics and thematic analysis approaches. A range of key themes emerged from the analysis including that text messages were helpful and supportive, increased a sense of belonging to the University and encouraged retention. There were some unresolved issues concerning the costs incurred by participants when sending reply text messages. It is concluded that FLO or use of similar mobile phone protocols can be a useful addition to approaches to improve undergraduate nursing student retention rates. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Sustainable student retention and gender issues in mathematics for ICT study

    Science.gov (United States)

    Divjak, Blazenka; Ostroski, Mirela; Vidacek Hains, Violeta

    2010-04-01

    This article reports on the research whose specific objective is to improve student retention in mathematics included in the first-year ICT study programme by means of improving teaching methods, with an emphasis on gender issues. Two principal reasons for this research are, first, the fact that first-year mathematics courses are often viewed as an obstacle for retention in studying ICT, and second, the fact that female students are strongly underrepresented in ICT. Furthermore, according to recently introduced research, changes in pedagogy and the content of mathematics have been evaluated. Those changes are directed towards competency-based and student-centred education and are heavily supported by technology-based learning. Although only minor gender differences in different skills have been detected, the pass rate for female students is constantly higher than that for male students. Therefore, the reasons for the better performance of female students have been investigated taking into account both the motivation for study and learning styles. The primary sources of data used in the first year of research comprised questionnaires (n = 130) together with classroom and on-line assessment material for 263 students. In the next year, 160 students of Information Systems participated in the survey, the central topic of which was the motivation for study. Additionally, the research focused on finding out if the motivation factors are gender specific. The research was conducted in Croatia where no research on a similar topic had been previously available. In terms of the specific features of the socio-cultural environment, conducting such a research in Croatia proved to be worthwhile, particularly considering the possibility of comparing the obtained results with those arising from other environments.

  15. High-fidelity simulation effects on CPR knowledge, skills, acquisition, and retention in nursing students.

    Science.gov (United States)

    Aqel, Ahmad A; Ahmad, Muayyad M

    2014-12-01

    There is a gap in the literature regarding learning outcomes linked to the use of high-fidelity simulators compared to that of traditional teaching methods. To examine the effect of using high-fidelity simulators on knowledge and skills acquisition and retention with university students. A randomized two-arm trial using two different educational approaches on 90 nursing students assigned randomly to two groups was used at two points of time. The results showed significant differences in favor of the participants in the high-fidelity simulator group on both the acquisition and retention of knowledge and skills over time. However, a significant loss of cardiopulmonary resuscitation knowledge and skills occurred at 3 months after training in both groups. The findings of this study may assist educators in integrating high-fidelity simulators in education and training. In addition, the findings may help nursing educators to arrange additional cardiopulmonary resuscitation training sessions in order to improve cardiac arrested patients' outcomes. High-fidelity simulation (HFS) provides students with interactive learning experiences in a safe controlled environment. HFS enables teachers to implement critical clinical scenarios, such as cardiac arrest, without risk to patients. Integrating the simulation training into nursing curricula will help to overcome the challenges that face many courses, specifically the shortage of clinical areas for training and the increase in numbers of nursing students. © 2014 Sigma Theta Tau International.

  16. Improving Secondary School Students' Achievement and Retention in Biology Through Video-based Multimedia Instruction

    Directory of Open Access Journals (Sweden)

    Amosa Isiaka Gambari, PhD

    2014-08-01

    Full Text Available The study examined the effects of video-based multimedia instruction on secondary school students' achievement and retention in biology. In Nigeria, 120 students (60 boys and 60 girls were randomly selected from four secondary schools assigned either into one of three experimental groups: Animation + Narration; Animation + On-screen Text; Animation + Narration + On-screen Text or a control group. The pretest, posttest experimental, and control group design was adopted. A 50-item multiple-choice objective test termed Biology Achievement Test (BAT was used for collecting data. The validated BAT was tested for reliability using Kuder Richardson (KR20, which yielded 0.89. T-test, analysis of covariance (ANCOVA, and Scheffe’s post-hoc analysis were used in determining the significant differences among the four groups. The results showed that there was no statistically significant difference among the experimental groups. Generally, students under multimedia instruction performed better than their colleagues in the conventional teaching method. However, students in conventional teaching method had better retention than other groups.

  17. Silent cerebral infarction, income, and grade retention among students with sickle cell anemia

    Science.gov (United States)

    King, Allison A.; Rodeghier, Mark J.; Panepinto, Julie Ann; Strouse, John J.; Casella, James F.; Quinn, Charles T.; Dowling, Michael M.; Sarnaik, Sharada A.; Thompson, Alexis A.; Woods, Gerald M.; Minniti, Caterina P.; Redding-Lallinger, Rupa C.; Kirby-Allen, Melanie; Kirkham, Fenella J.; McKinstry, Robert; Noetzel, Michael J.; White, Desiree A.; Kwiatkowski, Janet K.; Howard, Thomas H.; Kalinyak, Karen A.; Inusa, Baba; Rhodes, Melissa M.; Heiny, Mark E.; Fuh, Ben; Fixler, Jason M.; Gordon, Mae O.; DeBaun, Michael R.

    2014-01-01

    Children with sickle cell anemia have a higher-than-expected prevalence of poor educational attainment. We test two key hypotheses about educational attainment among students with sickle cell anemia, as measured by grade retention and use of special education services: (1) lower household per capita income is associated with lower educational attainment; (2) the presence of a silent cerebral infarct is associated with lower educational attainment. We conducted a multicenter, cross-sectional study of cases from 22 U.S. sites included in the Silent Infarct Transfusion Trial. During screening, parents completed a questionnaire that included sociodemographic information and details of their child’s academic status. Of 835 students, 670 were evaluable; 536 had data on all covariates and were used for analysis. The students’ mean age was 9.4 years (range: 5–15) with 52.2% male; 17.5% of students were retained one grade level and 18.3% received special education services. A multiple variable logistic regression model identified that lower household per capita income (odds ratio [OR] of quartile 1 = 6.36, OR of quartile 2 = 4.7, OR of quartile 3 = 3.87; P = 0.001 for linear trend), age (OR = 1.3; P sickle cell anemia, household per capita income is associated with grade retention, whereas the presence of a silent cerebral infarct is not. Future educational interventions will need to address both the medical and socioeconomic issues that affect students with sickle cell anemia. PMID:25042018

  18. How Money Helps Keep Students in College: The Relationship between Family Finances, Merit-Based Aid, and Retention in Higher Education

    Science.gov (United States)

    Olbrecht, Alexandre M.; Romano, Christopher; Teigen, Jeremy

    2016-01-01

    In this paper, we leverage detailed, individual-level student data to understand the relationships between family finances, merit-based aid, and first-year student retention. With three cohorts of student data that comprise family financial status, institutional merit scholarships, and many of the other known correlates of student retention, we…

  19. BOOSTING STUDENT LIFE SATISFACTION AND ENGAGEMENT TO IMPROVE ONLINE STUDENT RETENTION

    DEFF Research Database (Denmark)

    Slavensky, Henning; Hansen, Hans Jørgen; Knudsen, Mikael Bergholz

    2017-01-01

    ’ decisions to drop out is their full-time job; having a full-time job while studying full time is very time-consuming. Another reason for the student dropout is a feeling of disconnection with their fellow students and the campus environment. Consequently, various strategies to motivate and retain...... to the students what is expected of them. In addition, we have seen a decrease in students with fulltime jobs who, thus, are able to join the teaching synchronously, engaging them much more directly. This, combined with a new strategy of forming mixed teams of online and on-campus students, has boosted...... the student life satisfaction significantly and improved the online students’ interaction with oncampus students. Today, online students take much more responsibility, as they also want the oncampus students to be successful. Conversely, on-campus students now feel more responsible in that they must ensure...

  20. Role Models and Mentors in Mid-Pipeline Retention of Geoscience Students, Newark, NJ

    Science.gov (United States)

    Gates, A. E.; Kalczynski, M. J.

    2012-12-01

    Undergraduate minority students retained enthusiasm for majoring in the geosciences by a combination of working with advanced minority mentors and role models as well as serving as role models for middle and high school students in Geoscience Education programs in Newark, NJ. An academic year program to interest 8-10th grade students from the Newark Public schools in the Geosciences employs minority undergraduate students from Rutgers University and Essex Community College as assistants. There is an academic year program (Geoexplorers) and a science festival (Dinosaur Day) at the Newark Museum that employs Rutgers University students and a summer program that employs Rutgers and Essex Community College students. All students are members of the Garden State LSAMP and receive any needed academic support from that program. The students receive mentoring from minority graduate students, project personnel and participating Newark Public School teachers, many of whom are from minority groups. The main factor in success and retention, however, is their role as authorities and role models for the K-12 students. The assistants are respected and consulted by the K-12 students for their knowledge and authority in the geosciences. This positive feedback shows them that they can be regarded as geoscientists and reinforces their self-image and enthusiasm. It further reinforces their knowledge of Geoscience concepts. It also binds the assistants together into a self-supporting community that even extends to the non-participating minority students in the Rutgers program. Although the drop-out rate among minority Geoscience majors was high (up to 100%) prior to the initiation of the program, it has dropped to 0% over the past 3 years with 2 participants now in PhD programs and 2 others completing MS degrees this year. Current students are seriously considering graduate education. Prior to this program, only one minority graduate from the program continued to graduate school in the

  1. The recruitment and retention of speech and language therapists: what do university students find important?

    Science.gov (United States)

    Whitehouse, Andrew J O; Hird, Kathryn; Cocks, Naomi

    2007-01-01

    Education of health professionals is costly to the general community and more specifically the educational sector. The increasing need for speech and language therapy (SLT) services, coupled with poor employment retention rates, poses serious cost-benefit considerations. The poor job retention rates among speech and language therapists are associated with high levels of job dissatisfaction. One factor known to influence job satisfaction is the congruence between one's career motivation and actual career experience. The current study sought to explore (1) why students choose to embark on an SLT degree, (2) what factors are important to maintain their long-term employment in SLT, and (3) how long they predicted they would remain in the workforce practicing in SLT. Students from two tertiary SLT courses, one in Australia (n=67) and one in the United Kingdom (n=84), completed an online questionnaire targeting these issues. Students' responses were consistent across cohorts, so they were combined into one data set. Three categories of responses emerged, relating to altruism (i.e., helping others), intellectual interest (i.e., interested in disease and disability), and professional issues (e.g., salary, desire for a professional career). There was good agreement in responses to questions focusing on why participants chose to study SLT and what they foresaw as important for their future career. Students who were motivated to enter SLT for professional reasons tended to report that they would remain in the profession for a shorter time than those students who chose the career with a primarily humanistic or intellectual motivation. The implications of these findings for educators and professional bodies are discussed.

  2. Investigating First Year College Student Locus of Control in Relation to Retention: An Explanatory Mixed Methods Study

    Science.gov (United States)

    Estes, Aaron

    2017-01-01

    Institutions of higher education place a high priority on retaining students. With orientation programming, tutoring, learning communities, peer mentoring, and other efforts, institutions dedicate the resources necessary to increase the academic success of their students because academic success has a positive relationship with retention. Through…

  3. Toward a New Predictive Model of Student Retention in Higher Education: An Application of Classical Sociological Theory

    Science.gov (United States)

    Kerby, Molly B.

    2015-01-01

    Theoretical models designed to predict whether students will persist or not have been valuable tools for retention efforts relative to the creation of services in academic and student affairs. Some of the early models attempted to explain and measure factors in the "college dropout process." For example, in his seminal work, Tinto…

  4. Effects of Creative Drama Method on Students' Attitude towards Social Studies, Academic Achievement and Retention in Turkey

    Science.gov (United States)

    Kaf, Ozlem; Yilmaz, Ozge Uygungul

    2017-01-01

    The purpose of this study was to investigate the effect of creative drama as a teaching method on academic achievement and retention in social studies, students' attitude towards social studies of 4th grade. The research is designed according to quasiexperimental model. The research was conducted with 4th year students in a public school in Adana…

  5. Effects of Analogical vs. Schematic Illustrations on Initial Learning and Retention of Technical Material by Eighth-Grade Students.

    Science.gov (United States)

    McAlister, Brian K.

    The effects of analogical and schematic illustrations on the comprehension and retention of expository prose were compared. The population was 191 eighth-grade students at Mahomet Junior High School, Illinois; 134 students' scores were used. Subjects were assigned to two groups through the random distribution of treatment booklets that included a…

  6. The Role of Extracurricular Activity Involvement on Athletic Training Students' Retention and Success: A Qualitative Case Study

    Science.gov (United States)

    Lewis, Melanie Leanor

    2017-01-01

    Higher education research has focused more attention recently on student involvement in extracurricular activities. Student involvement in extracurricular activities has been linked to decreased levels of stress, degree attainment, increased college satisfaction, retention, and positive academic performance. Due to the limited research on the…

  7. Fall 1982 Retention Study.

    Science.gov (United States)

    Peralta Community Coll. District, Oakland, CA. Office of Research, Planning and Development.

    In fall 1982, a study was conducted in the Peralta Community College District (PCCD) using withdrawal and grade distribution data to analyze student retention patterns. Successful retention rates were based on the percentage of students who received a passing grade, while total retention rates were based on the percentage of students who received…

  8. Fall 1984 Retention Study.

    Science.gov (United States)

    Peralta Community Coll. District, Oakland, CA. Office of Research, Planning and Development.

    A study was conducted of the retention patterns of students enrolled in the Peralta Community College District (PCCD) in fall 1984 using college reports on withdrawals and grade distributions. The study focused on successful retention (i.e., all students who received a passing grade) and on total retention (i.e., all students who received any…

  9. Longitudinal retention of anatomical knowledge in second-year medical students.

    Science.gov (United States)

    Doomernik, Denise E; van Goor, Harry; Kooloos, Jan G M; Ten Broek, Richard P

    2017-06-01

    The Radboud University Medical Center has a problem-based, learner-oriented, horizontally, and vertically integrated medical curriculum. Anatomists and clinicians have noticed students' decreasing anatomical knowledge and the disability to apply knowledge in diagnostic reasoning and problem solving. In a longitudinal cohort, the retention of anatomical knowledge gained during the first year of medical school among second-year medical students was assessed. In May 2011, 346 medical students applied for the second-year gastro-intestinal (GI) tract course. The students were asked to participate in a reexamination of a selection of anatomical questions of an examination from October 2009. The examination consisted of a clinical anatomy case scenario and two computed tomography (CT) images of thorax and abdomen in an extended matching format. A total of 165 students were included for analysis. In 2011, students scored significantly lower for the anatomy examination compared to 2009 with a decline in overall examination score of 14.7% (±11.7%). Decrease in knowledge was higher in the radiological questions, compared to the clinical anatomy cases 17.5% (±13.6%) vs. 7.9% (±10.0%), respectively, d = 5.17. In both years, male students scored slightly better compared to female students, and decline of knowledge seems somewhat lower in male students (13.1% (±11.1%) vs. 15.5% (±12.0%), respectively), d = -0.21. Anatomical knowledge in the problem-oriented horizontal and vertical integrated medical curriculum, declined by approximately 15% 1.5 year after the initial anatomy course. The loss of knowledge in the present study is relative small compared to previous studies. Anat Sci Educ 10: 242-248. © 2016 American Association of Anatomists. © 2016 American Association of Anatomists.

  10. Increasing student engagement and retention using immersive interfaces virtual worlds, gaming and simulation

    CERN Document Server

    Wankel, Charles

    2012-01-01

    Increasing Student Engagement and Retention Using Immersive Interfaces: Virtual Worlds, Gaming, and Simulation uses case studies, surveys, and literature reviews to critically examine how gaming, simulation, and virtualization are being used to improve teamwork and leadership skills in students, create engaging communities of practice, and as experiential learning tools to create inter-cultural, multi-perspective, and global experiences. Chapters include how to increase learner engagement using serious games, using game features for classroom engagement, using client-based peer assessment in multi-role, whole-enterprise simulations, using virtual worlds to develop teacher candidate skills, enhancing leadership skills through virtual simulation, using online video simulation for educational leadership, using augmented reality in education, using open source software in education, using educational robotics laboratories to enhance active learning, and utilizing the virtual learning environment to encourage facu...

  11. Enhancing student retention of prerequisite knowledge through pre-class activities and in-class reinforcement.

    Science.gov (United States)

    Taylor, Ann T S; Olofson, Eric L; Novak, Walter R P

    2017-03-04

    To foster the connection between biochemistry and the supporting prerequisite concepts, a collection of activities that explicitly link general and organic chemistry concepts to biochemistry ideas was written and either assigned as pre-class work or as recitation activities. We assessed student learning gains after using these activities alone, or in combination with regularly-integrated clicker and discussion questions. Learning gains were determined from student performance on pre- and post-tests covering key prerequisite concepts, biochemistry course exams, and student self-evaluation. Long-term retention of the material was assessed using a comprehensive exam given to a subset of the students. Our results show that using the pre-class exercises in combination with integrative questions was effective at improving student performance in both the short and long term. Similar results were obtained at both a large research institution with large class enrollments and at a private liberal arts college with moderate enrollments. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(2):97-104, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

  12. Predictive factors of premedical student retention and degree completion within a private undergraduate university

    Science.gov (United States)

    Carter, Frances E.

    Undergraduate retention and eventual graduation is of paramount importance to universities globally. Approximately 58% of students who began their college career at a four-year institution with the intention of receiving a bachelor's degree actually received that degree in a 6-year timeframe, according to the National Center for Education Statistics (NCES) annual report The Condition of Education 2009 (Planty, 2009). In certain subgroups of the undergraduate population, this graduation rate is even lower. This dissertation presents research into the academic integration of students in premedical programs subgroup based on Vincent Tinto's Integrationist Model of Student Departure. Pre-entry factors of interest for this study included incoming high school grade point average (GPA), incoming SAT total test scores, while post-matriculation factors included grade in organic chemistry, and the initial calculus course taken. A sample of 519 students from a private coeducational institution in the southeastern United States was examined. A logistic regression was performed to determine the effect of high school GPA, SAT total scores, organic chemistry grades, and calculus-readiness on graduation. A significant regression equation was found. The findings suggest that of the four predictor variables, high school GPA and organic chemistry grade were the only variables that showed significant predictive ability based on a significance level of p social integration of the student. Additionally, institutional leaders should continue to evaluate the premedical curriculum based on potential changes in medical school requirements.

  13. Physician recruitment and retention in New Brunswick: a medical student perspective

    Directory of Open Access Journals (Sweden)

    Mariah Giberson

    2016-10-01

    Full Text Available Background: Physician recruitment and retention is a priority for many Canadian provinces. Each province is unique in terms of recruitment strategies and packages offered; however, little is known about how medical students evaluate these programs. The purpose of the current study was to determine which factors matter most to New Brunswick (NB medical students when considering their location of future practice. Method: A survey of NB medical students was conducted. Descriptive statistics were produced and a linear regression model was developed to study factors predictive of a student’s expressed willingness to practice in NB. Results:  158 medical students completed the online survey, which is a response rate of 55%. Job availability and spouse’s ability to work in the province were ranked as the top factors in deciding where to practice. In the final regression model, factors predictive of an expressed desire to practice in NB include being female, living in NB prior to medical school, attending medical school at Université de Sherbrooke, participation in the NB Preceptorship program, and a desire to practice family medicine. Conclusions: This study provides insight into what medical students consider when deciding where to practice. This research may be used to inform physician recruitment efforts and guide future research into medical education and policy.

  14. Assessment of medical students' knowledge retention in a diagnostic radiology course: lecture attendees versus absentees.

    Science.gov (United States)

    Chan, Wing Pong

    2009-03-01

    To compare class attendees versus absentees in their ability to retain knowledge during a diagnostic radiology course. This study recruited 146 fourth-year medical students who attended a diagnostic radiology course from February 2004 to June 2004. Eight unit tests were conducted. Questions for each test covered content taught in the prior class. Another examination (which students were not aware of beforehand) was conducted in June, and the questions for this examination included content from all lectures in the course. The class attendance rates were measured separately 6 times during the course. Students who were present on the last of these dates were categorised as attendees (group A students) and those who were absent were categorised as absentees (group B). The average class attendance was 76.8% and the lowest attendance was 56.8%. For the unit tests, the average score of group A students (80.7 +/- 7.3) was significantly higher than that of the group B students (76.2 +/- 8.8) (P = 0.001). However, in the unanticipated examination, there was no significant difference in the scores between group A (68.1 +/- 10.3; range, 36-92) and group B students (65.5 +/- 13.5; range, 28- 88) (P = 0.19). Self-learning time was related to the unit test scores (P = 0.001) but not to the unanticipated examination scores (P = 0.27). Students who frequently attend classes or study for longer can retain their knowledge over a short period of time, but there is no difference in knowledge retention between class attendees and absentees at the end of a 4-month course.

  15. Implementing a Principal Tutor to Increase Student Engagement and Retention within the First Year of a Professional Program

    Directory of Open Access Journals (Sweden)

    Jason Lodge

    2012-03-01

    Full Text Available With ongoing changes to the requirements for professional registration, greater demand for professional services, and targets for increasing participation, universities must adapt quickly to ensure that the quality of accredited professional programs is continually improving. The problem of retaining students is particularly relevant in accredited professional courses where students often have unrealistic expectations about course content and the profession. In order to address issues surrounding student engagement and retention in an accredited psychology course, a Principal Tutor was appointed to a first year cohort. By using a transition pedagogy framework to support student engagement through incorporating administrative and profession-specific advice within and outside the formal curriculum, the program appears to have been successful in increasing student engagement. Indicators of student engagement were higher than national averages and retention rates improved. Implications for possible application of the initiatives included in this program elsewhere are discussed. 

  16. Correlation between active-learning coursework and student retention of core content during advanced pharmacy practice experiences.

    Science.gov (United States)

    Lucas, Kristy H; Testman, Julie A; Hoyland, Marcella N; Kimble, Angel M; Euler, Mary L

    2013-10-14

    To implement an active-learning approach in a pharmacotherapy course sequence in the second year (P2) and third (P3) year of a doctor of pharmacy (PharmD) program and determine whether the pedagogical changes correlated with retention of core content in the fourth year (P4). Class sessions were transitioned from slides-based lectures to discussion-based active-learning pedagogy. A comprehensive examination was created and administered to assess student retention of therapeutic topics taught. Students demonstrated significantly improved overall scores on questions derived from the active-learning pedagogy used in Pharmacotherapy II and III compared to those derived from Pharmacotherapy I in which content was delivered by lecture. The use of active-learning strategies over lecture-based methods in pharmacotherapy courses resulted in higher retention of core content. Students' performance in areas taught using the discussion-based methodology was superior to that which was taught using lecture-based slide presentations.

  17. AA Index

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  18. Student-Retention and Career-Placement Rates Between Bachelor's and Master's Degree Professional Athletic Training Programs.

    Science.gov (United States)

    Bowman, Thomas G; Mazerolle, Stephanie M; Pitney, William A; Dodge, Thomas M; Hertel, Jay

    2015-09-01

    The debate over what the entry-level degree should be for athletic training has heightened. A comparison of retention and career-placement rates between bachelor's and master's degree professional athletic training programs may inform the debate. To compare the retention rates and career-placement rates of students in bachelor's and master's degree professional programs. Cross-sectional study. Web-based survey. A total of 192 program directors (PDs) from bachelor's degree (n = 177) and master's degree (n = 15) professional programs. The PDs completed a Web-based survey. We instructed the PDs to provide a retention rate and career-placement rate for the students in the programs they lead for each of the past 5 years. We also asked the PDs if they thought retention of students was a problem currently facing athletic training education. We used independent t tests to compare the responses between bachelor's and master's degree professional programs. We found a higher retention rate for professional master's degree students (88.70% ± 9.02%, 95% confidence interval [CI] = 83.71, 93.69) than bachelor's degree students (80.98% ± 17.86%, 95% CI = 78.30, 83.66) (t25 = -2.86, P = .008, d = 0.55). Similarly, PDs from professional master's degree programs reported higher career-placement percentages (88.50% ± 10.68%, 95% CI = 82.33, 94.67) than bachelor's degree professional PDs (71.32% ± 18.47%, 95% CI = 68.54, 74.10) (t20 = -5.40, P athletic training (χ(2)1 = 0.720, P = .40, Φ = .061). Professional master's degree education appears to facilitate higher retention rates and greater career-placement rates in athletic training than bachelor's degree education. Professional socialization, program selectivity, and student commitment and motivation levels may help to explain the differences noted.

  19. Chaotic....!! Active and Engaged. Effects of an active learning classroom on student retention and engagement.

    Science.gov (United States)

    Palsole, S.; Serpa, L. F.

    2014-12-01

    Scientific literacy has been defined as the foremost challenge of this decade (AAAS, 2012). The Geological Society of American in its position statement postis that due to the systemic nature of the discipline of earth science, it is the most effective way to engage students in STEM disciplines. Given that the most common place for exposure to earth sciences is at the freshman level for non majors, we decided to transform a freshman introductory geology course to an active, student centered course, using an inquiry based approach. Our focus was to ensure the students saw the earth sciences as broadly applicative field, and not an esoteric science. To achieve this goal, we developed a series of problems that required the students to apply the concepts acquired through their self guided learning into the different topics of the course. This self guided learning took the form of didactic content uploaded into the learning management system (the various elements used to deliver the content were designed video clips, short text based lectures, short formative assessments, discussion boards and other web based discovery exercises) with the class time devoted to problem solving. A comparison of student performance in the active learning classroom vs. a traditional classroom as measured on a geoscience concept inventory (the questions were chosen by a third party who was not teaching either courses) showed that the the students in the active learning classroom scored 10% higher on the average in comparison to the traditional class. In addition to this heightened performance, the students in the active classroom also showed a higher degree of content retention 8 weeks after the semester had ended. This session will share the design process, some exercises and efficacy data collected.

  20. A Correlational Study on Student Retention: Student Identity, Intrinsic, Extrinsic, and Amotivation

    Science.gov (United States)

    Olguin, Javier E.

    2017-01-01

    This study was a quantitative point-biserial correlation analysis on students' motivation to go to college using the AMS-C28 survey instrument. The study implemented Self Determination Theory to explain the characteristics and traits of traditional and non traditional students' motivation to succeed in college after completing the freshmen…

  1. Pathway to Success: Using Students' Insights and Perspectives to Improve Retention and Success for University Students from Low Socioeconomic (LSE) Backgrounds

    Science.gov (United States)

    Sadowski, Christina; Stewart, Margaret; Pediaditis, Mika

    2018-01-01

    In an increasingly complex landscape of diversification and massification, universities are grappling with challenges of student attrition. This paper presents findings from a project investigating how students from low socio-economic backgrounds at a regional Australian university perceive challenges and supports associated with retention and…

  2. An Analysis of Expenditures on Student Affairs/Services and College Student Retention at Four-Year Colleges and Universities in the United States

    Science.gov (United States)

    Umfress, Jason Walter

    2010-01-01

    The purpose of this study was to explore the relationship between expenditures for student affairs / services and college student retention rates. Data reported to the Integrated Postsecondary Education Data Set (IPEDS) for the 2007-2008 academic year were used. Public and private-not-for-profit institutions in the United States that completed the…

  3. Metamorphological awareness and EFL students' memory, retention, and retrieval of English adjectival lexicons.

    Science.gov (United States)

    Zhang, Lawrence Jun

    2002-12-01

    Research has shown that foreign or second language learners' metalinguistic awareness has important effects on their acquisition of the target language. Important among a multitude of the concerns are problems these learners encounter when they have to process the morphological features of individual words, particularly in the acquisition of literacy skills. Nevertheless, for students who learn English as a foreign or second language for academic purposes, one of the biggest challenges in their advanced study is how they can effectively remember, retain, and retrieve the colossal number of newly learnt English vocabulary, including adjectival lexicons, to enhance their academic success. Results from the present report on the effects of metamorphological awareness of 65 adult Chinese EFL learners' memory, retention, and retrieval of adjectival lexicons show that, although the subjects in the two groups did not differ significantly in their performance on a pretest designed to check their lexical knowledge and no sex difference was observed, statistically significant differences were found between the two groups in both conditions (immediate and delayed retrievals) on a posttest. The experimental group and women predominantly performed better in the memory-retention-retrieval tasks assigned to them. Implications for educational research and practices are also discussed.

  4. Development of a transferable student engagement and knowledge retention framework for the earth sciences

    Science.gov (United States)

    Palsole, Sunay Vasant

    active learning course over the traditional course. The data also indicate that the students had greater content retention 8 week after the course had ended in the hybrid course over the traditional course. The study then presents a nascent model for the design of earth science courses.

  5. Retention of laparoscopic and robotic skills among medical students: a randomized controlled trial.

    Science.gov (United States)

    Orlando, Megan S; Thomaier, Lauren; Abernethy, Melinda G; Chen, Chi Chiung Grace

    2017-08-01

    Although simulation training beneficially contributes to traditional surgical training, there are less objective data on simulation skills retention. To investigate the retention of laparoscopic and robotic skills after simulation training. We present the second stage of a randomized single-blinded controlled trial in which 40 simulation-naïve medical students were randomly assigned to practice peg transfer tasks on either laparoscopic (N = 20, Fundamentals of Laparoscopic Surgery, Venture Technologies Inc., Waltham, MA) or robotic (N = 20, dV-Trainer, Mimic, Seattle, WA) platforms. In the first stage, two expert surgeons evaluated participants on both tasks before (Stage 1: Baseline) and immediately after training (Stage 1: Post-training) using a modified validated global rating scale of laparoscopic and robotic operative performance. In Stage 2, participants were evaluated on both tasks 11-20 weeks after training. Of the 40 students who participated in Stage 1, 23 (11 laparoscopic and 12 robotic) underwent repeat evaluation. During Stage 2, there were no significant differences between groups in objective or subjective measures for the laparoscopic task. Laparoscopic-trained participants' performances on the laparoscopic task were improved during Stage 2 compared to baseline measured by time to task completion, but not by the modified global rating scale. During the robotic task, the robotic-trained group demonstrated superior economy of motion (p = .017), Tissue Handling (p = .020), and fewer errors (p = .018) compared to the laparoscopic-trained group. Robotic skills acquisition from baseline with no significant deterioration as measured by modified global rating scale scores was observed among robotic-trained participants during Stage 2. Robotic skills acquired through simulation appear to be better maintained than laparoscopic simulation skills. This study is registered on ClinicalTrials.gov (NCT02370407).

  6. Effect of Cardiac Arrhythmia Simulation on Nursing Students' Knowledge Acquisition and Retention.

    Science.gov (United States)

    Tubaishat, Ahmad; Tawalbeh, Loai I

    2015-09-01

    The realistic and practical environment that simulation provides is an extremely useful part of the teaching process. Simulation is widely used in health and nursing education today. This study aims to evaluate the effect of simulation-based teaching on the acquisition and retention of arrhythmia-related knowledge among nursing students. A randomized controlled design involving a pretest-posttest was used. Nursing students were allocated randomly either to the experimental group (n = 47), who attended simulation scenarios on cardiac arrhythmia, or to the control group (n = 44) who received a traditional lecture on the same topic. A paired t test showed that the mean knowledge score at the posttest was significantly higher than at the pretest for both groups. However, participants in the experimental group demonstrated significantly increased knowledge of cardiac arrhythmia in the first and the second posttest compared with those in the control group. Thus, simulation is superior and significantly improves students' arrhythmia knowledge. © The Author(s) 2014.

  7. Impact of Standardized Simulated Patients on First-Year Pharmacy Students' Knowledge Retention of Insulin Injection Technique and Counseling Skills.

    Science.gov (United States)

    Bowers, Riley; Tunney, Robert; Kelly, Kim; Mills, Beth; Trotta, Katie; Wheeless, C Neil; Drew, Richard

    2017-08-01

    Objective. To compare pre- and post-intervention test scores assessing insulin injection technique and counseling skills among P1 students with (intervention) or without (control) simulated patients, and to compare counseling checklist and knowledge retention test scores between groups. Methods. This study utilized cluster randomization. In addition to traditional instruction, the intervention group counseled a simulated patient on the use of insulin using the teach-back method. Test score changes from baseline were analyzed via two-sample t-test. Results. The intervention group exhibited a significantly greater increase in knowledge test scores from baseline compared to the control group. Similar changes were seen in post-instruction counseling checklist scores and knowledge retention test scores from baseline. Conclusion. Simulated patient interactions, when added to traditional coursework within a P1 skills lab, improve student counseling aptitude and knowledge retention scores.

  8. The relationship between learning communities and student interaction and retention in general biology courses

    Science.gov (United States)

    Wardle, Karen Marie

    The relationship between learning communities and student interaction and retention in community college general biology courses was investigated in this study. The purposes of the study were to discover the students' perceptions of factors influencing their desire to study science, and to examine the use of learning communities as a method of enculturation into the field of science. The learning community in the CCD science courses involved an entry-level science course that was linked with a tutorial enrichment of the underlying principles in scientific research. The coordination between the class and the learning community involved an extensive research project that incorporated important scientific principles. The project goals for student research included an understanding of the scientific method, and an increased engagement in scientific inquiry. Collaboration and communication among students was an additional goal of the leaning communities. A quasi-experiment with pre- and post-measures of student attitudes and perceptions of success in first and second semester biology courses. A premeasure was followed by a quasi experiment in which entry level biology courses were conducted using either learning communities or traditional lecture. Results show the factors students perceived as important to their success in entry-level science courses included their professors and peers. Discriminant results revealed that the factors predicted completion of the courses 75% of the time. Qualitative tests reveal that students in learning communities show a slight increase in community interactions and willingness to explore the content material beyond the material needed for the class, however these results were not significantly higher than the control courses. Future studies include collecting data on the learning communities for longer than a one-year period. The incorporation of the research projects into the courses has lasting value in terms of encouraging new

  9. The Influence of a Career Exploration Course on New First-Time Student Retention at a Public Midwest Community College

    Science.gov (United States)

    French, Brenda F.

    2013-01-01

    The purpose of this study was to examine whether a relationship exists between new first- time students enrolled in a career exploration course and retention during the academic years of 2009 to 2011 at a public Midwest community college. Change of major after the first semester was also investigated. The study utilized quantitative, archival data…

  10. Estimating Student Retention and Degree-Completion Time: Decision Trees and Neural Networks Vis-a-Vis Regression

    Science.gov (United States)

    Herzog, Serge

    2006-01-01

    Focusing on student retention and time to degree completion, this study illustrates how institutional researchers may benefit from the power of predictive analyses associated with data-mining tools. The following are appended: (1) Predictors; and (2) Variable Definitions. (Contains 5 figures.)

  11. The impact of program experiences on the retention of women engineering students in Mexico

    Science.gov (United States)

    Villa, Maria Del Carmen Garcia

    This qualitative study sought to describe and understand the experiences of female students attending engineering colleges in Mexico and the sources of support and strategies that helped them persist in their programs. The participants were 20 women engineering students enrolled in at least their third year in selected colleges of engineering in Mexico, in both public and private universities, and pursuing a variety of engineering majors. Findings focus on the experiences of female students that helped them stay in their programs. Participants described their experiences in college as very challenging and perceived the environment as hostile and uncertain. In addition, patriarchal Mexican cultural values and stereotypes were identified by students as influencing and helping shape the engineering environment. However, in this context, participants were able to find sources of support and use strategies that helped them remain in their majors, such as a strong desire to succeed, a perceived academic self-ability; and support from their families, peers, institutions, and---most importantly---their professors. Furthermore, the fact that participants were able to persist in their programs gave them a sense of pride and satisfaction that was shared by their families, peers, and faculty. In addition, participants experienced contradictory forces and were constantly negotiating between rejecting traditional gender norms and upholding the norms that are so deeply engrained in Mexican society. Finally, as the students advanced in their programs and became "accepted to the club," they tended to reproduce the male-dominated value system present in engineering colleges accepting their professors' expectations of being "top students," accepting the elitist culture of engineering superiority, and embracing the protection given by their male peers. Retention of Mexican female engineering students is important for all engineering colleges, but cultural factors must be taken into

  12. Student Retention: A Description of First-Generation Minority Male Students' Interaction with Faculty

    Science.gov (United States)

    Alford, Keyimani L.

    2017-01-01

    Challenges in retaining minority male students is an on-going issue in higher education in America. In addition, research suggests that the challenge is greater at Predominantly White Institutions. For many years, institutions have adopted principles and strategies suggested by researchers to counterattack this concern. Although a vast wealth of…

  13. Abia, AA

    African Journals Online (AJOL)

    Abia, AA. Vol 4, No 6 (2010) - Articles Studies on the kinetics and intraparticle diffusivities of BOD, colour and TSS reduction from palm oil mill effluent (POME) using boiler fly ash. Abstract PDF. ISSN: 1996-0786. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More ...

  14. Adejumo, AA

    African Journals Online (AJOL)

    Adejumo, AA. Vol 6, No 2 (2014) - Articles Assessment of Tourists Flow and Revenue Generation in Kainji Lake National Park, Nigeria Abstract PDF. ISSN: 2141-1778. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and ...

  15. Adepeju, AA

    African Journals Online (AJOL)

    Adepeju, AA. Vol 19, No 2 (2010) - Articles Assessment of Ethical and Other Professional Standards in Private Medical Laboratories; Osun State Experience. Abstract. ISSN: 1116-1043. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  16. Wornyo, AA

    African Journals Online (AJOL)

    Wornyo, AA. Vol 2, No 1 (2012) - Articles Addressing the Difficulties of Learners in the Reading Class Abstract. ISSN: 2026-6081. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use · Contact AJOL ...

  17. The level of knowledge retention and the attitude of students towards traditional and combined human genetics teaching

    Directory of Open Access Journals (Sweden)

    Petrušić Igor D.

    2016-01-01

    Full Text Available The aim of this research was to compare knowledge retention and course satisfaction among the students who attended a combined teaching course (traditional form and online course and those who attended only the traditional course in human genetics. The study comprised 169 students divided in two groups. The first group included 88 students who attended the combined course, and the second group participated in the traditional course. A knowledge test was given after the end of the courses and six months later.. The results of both groups were compared. Further on, the students in the combined course were divided in three categories according to the levels of online activities: weak, moderate and very active. The categories were compared with each other, and with the results of the students who attended the traditional course. The students who attended the combined course achieved considerably higher results on both tests compared to the students who attended the traditional course. The average number of points on both tests was statistically considerably higher in the group of very active students compared to those moderately active or weak and, of course, better than the students who attended the traditional course The results show that the online course was marked highly, showed higher knowledge retention and that the satisfaction with the combined course was exceptional.

  18. Effects of two retraining strategies on nursing students' acquisition and retention of BLS/AED skills: A cluster randomised trial.

    Science.gov (United States)

    Hernández-Padilla, José Manuel; Suthers, Fiona; Granero-Molina, José; Fernández-Sola, Cayetano

    2015-08-01

    To determine and compare the effects of two different retraining strategies on nursing students' acquisition and retention of BLS/AED skills. Nursing students (N = 177) from two European universities were randomly assigned to either an instructor-directed (IDG) or a student-directed (SDG) 4-h retraining session in BLS/AED. A multiple-choice questionnaire, the Cardiff Test, Laerdal SkillReporter(®) software and a self-efficacy scale were used to assess students' overall competency (knowledge, psychomotor skills and self-efficacy) in BLS/AED at pre-test, post-test and 3-month retention-test. GEE, chi-squared and McNemar tests were performed to examine statistical differences amongst groups across time. There was a significant increase in the proportion of students who achieved competency for all variables measuring knowledge, psychomotor skills and self-efficacy between pre-test and post-test in both groups (all p-valuesretention at 3 months, success rates of students within the IDG deteriorated significantly for all variables except ≥ 70% of chest compressions with correct hand position (p-value = 0.12). Conversely, the proportion of students who achieved competency within the SDG only decreased significantly in 'mean no flow-time ≤ 5s' (p-value = 0.02). Furthermore, differences between groups' success rates at retention-test also proved to be significantly different for all variables measured (all p-values < 0.05). This study demonstrated that using a student-directed strategy to retrain BLS/AED skills has resulted in a higher proportion of nursing students achieving and retaining competency in BLS/AED at three months when compared to an instructor-directed strategy. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  19. Using 3D Printers to Model Earth Surface Topography for Increased Student Understanding and Retention

    Science.gov (United States)

    Thesenga, David; Town, James

    2014-05-01

    In February 2000, the Space Shuttle Endeavour flew a specially modified radar system during an 11-day mission. The purpose of the multinational Shuttle Radar Topography Mission (SRTM) was to "obtain elevation data on a near-global scale to generate the most complete high-resolution digital topographic database of Earth" by using radar interferometry. The data and resulting products are now publicly available for download and give a view of the landscape removed of vegetation, buildings, and other structures. This new view of the Earth's topography allows us to see previously unmapped or poorly mapped regions of the Earth as well as providing a level of detail that was previously unknown using traditional topographic mapping techniques. Understanding and appreciating the geographic terrain is a complex but necessary requirement for middle school aged (11-14yo) students. Abstract in nature, topographic maps and other 2D renderings of the Earth's surface and features do not address the inherent spatial challenges of a concrete-learner and traditional methods of teaching can at times exacerbate the problem. Technological solutions such as 3D-imaging in programs like Google Earth are effective but lack the tactile realness that can make a large difference in learning comprehension and retention for these young students. First developed in the 1980's, 3D printers were not commercial reality until recently and the rapid rise in interest has driven down the cost. With the advent of sub US1500 3D printers, this technology has moved out of the high-end marketplace and into the local office supply store. Schools across the US and elsewhere in the world are adding 3D printers to their technological workspaces and students have begun rapid-prototyping and manufacturing a variety of projects. This project attempted to streamline the process of transforming SRTM data from a GeoTIFF format by way of Python code. The resulting data was then inputted into a CAD-based program for

  20. Short-term, informal, and low-stakes scientific laboratory and field experiences improve STEM student retention and academic success

    Science.gov (United States)

    Hintz, C.; Pride, C. J.; Cox, T.

    2017-12-01

    Formal internship experiences strongly improve student success in the STEM fields. Classical programs like NSF's Research Experiences for Undergraduates are highly successful for traditional and non-traditional students. Moreover when early undergraduate and at-risk (e.g., low income, academically-challenged) students engage in these experiences, their career paths are re-enforced or changed, academic progress and retention improves, and they are encouraged to continue into graduate school. Students build connections to their course-based learning and experience the life of a working scientist. However, NSF formal experiences are relatively expensive to provide (>5000 per student per experience) and are available to fewer than 5% of geoscience majors each year. Although other funded formal internship opportunities exist, they are likely available to no more than 10% of total enrolled geoscience students. These high-quality programs cannot impact enough early undergraduate students to encourage their remaining in science and improve the current overall retention and graduation rates in the US. Savannah State University faculty successfully completed multiple grants funding low-stakes undergraduate field-science experiences. These short-term (semester to year), part-time (5-10h/week) experiences provide similar classroom-to-real-world science connections, offer students direct laboratory and field experiences, build skill sets, and provide a small source of revenue assisting financially-challenged students to stay on campus rather than seeking off-campus employment. For a much lower investment in time and grant resources (500-1500 per student per experience), participant graduation rates exceeded 80%, well above the university 27-34% graduation rate during the same time period. Relatively small infusions of research dollars targeting undergraduate experiences in the field and laboratory could significantly impact long-term student outcomes in STEM disciplines. These

  1. Effect of simulation on knowledge of advanced cardiac life support, knowledge retention, and confidence of nursing students in Jordan.

    Science.gov (United States)

    Tawalbeh, Loai I; Tubaishat, Ahmad

    2014-01-01

    This study examined the effect of simulation on nursing students' knowledge of advanced cardiac life support (ACLS), knowledge retention, and confidence in applying ACLS skills. An experimental, randomized controlled (pretest-posttest) design was used. The experimental group (n = 40) attended an ACLS simulation scenario, a 4-hour PowerPoint presentation, and demonstration on a static manikin, whereas the control group (n = 42) attended the PowerPoint presentation and a demonstration only. A paired t test indicated that posttest mean knowledge of ACLS and confidence was higher in both groups. The experimental group showed higher knowledge of ACLS and higher confidence in applying ACLS, compared with the control group. Traditional training involving PowerPoint presentation and demonstration on a static manikin is an effective teaching strategy; however, simulation is significantly more effective than traditional training in helping to improve nursing students' knowledge acquisition, knowledge retention, and confidence about ACLS. Copyright 2014, SLACK Incorporated.

  2. Individuality in Higher Education: The Use of the Multiple-Mnemonic Method to Enhance ESP Students' Vocabulary Development (Depth and Size) and Retention

    OpenAIRE

    Mohammad Amiryousefi

    2015-01-01

    Vocabulary learning is considered to be the most comprehensive and the most difficult part of language learning for all the students especially for ESP students. These students complain that vocabulary items are too many and are easily forgotten after they are learned. Mnemonic devices, a group of mental strategies, are developed to facilitate vocabulary learning and retention for such students. These students, however, have varied needs and interests and if vocabulary teaching...

  3. Perceptions of male versus female students enrolled in science, technology, engineering and mathematics courses regarding peer tutoring, a component for student retention

    Science.gov (United States)

    Kingsbury, Cheryl D.

    Academic departments in the areas of science, technology, engineering, and mathematics, strive to develop in students the ability to problem solve, analyze, and to critically think about solutions to problems. Academic departments are committed to success, yet retention rates are lower than would be expected for females in science, technology, engineering, and mathematics fields of study, where female students are underrepresented. The purpose of the study was to explore the perceptions of male and female traditional and nontraditional students who participated in a science, technology, engineering or mathematics STEM course during the spring 2010 semester regarding peer tutoring, and to understand why females are underrepresented and not retained at the same level as males in science, technology, engineering and mathematics STEM courses at the University of North Dakota. The participants in this quantitative study were students enrolled at the University of North Dakota who voluntarily completed a peer tutoring usage survey. A total of 231 students enrolled in Concepts of Biology (Biol 111), Introduction to Chemistry (Chem 115), Advanced Applications of CADD (Tech 202), Material Properties and Selection (ME 313), and College Algebra (Math 103), completed a survey about their spring 2010 semester. Five research questions searched for the differences between male and female perceptions regarding peer tutoring, a component of student retention. The independent variable was gender, the dependent variables were the factors regarding peer tutoring: academic preparedness, academic support and cost, and demographics. Two significant differences were found: (a) females viewed themselves as less prepared for science, technology, engineering, and mathematics courses than did male students, and (b) females were more in favor of the costs of peer tutoring than were male students. These findings support Merton's Self-fulfilling Prophecy Theory. Female students perceived

  4. The effects of Embodiment-based TPR approach on student English vocabulary learning achievement, retention and acceptance

    Directory of Open Access Journals (Sweden)

    Fan-Ray Kuo

    2014-01-01

    Full Text Available Research has shown that language learning with the form of human body could promote learner performance on the basis of theory of embodied cognition. Total physical response (TPR has long been used to enhance vocabulary learning. However, TPR has its limitation that teachers are unable to attend to all individual students when the class size is beyond manageable. Thus, to enhance English vocabulary learning, this study proposes an integration of motion-sensing technology and theory of embodied cognition into the total physical response (TPR approach, called Embodiment-based TPR approach. To test the effectiveness of the proposed approach, a total of 50 fifth-grade elementary students participated in this study. Experimental group adopted Embodiment-based TRP learning approach, while control group took conventional TPR learning approach. Cognitive performance and acceptance feedback for the proposed approach were collected in the experiment. Results showed that both the post-test and the delay test concerning English vocabulary learning performance between the two groups had no significant difference. However, the result of learning retention showed a significant regression for the control group while the experimental group’s learning retention retained, which implies the Embodiment-based TPR approach could bring better learning retention than the conventional TPR approach. In addition, experimental group showed a highly positive level of acceptance toward the proposed learning approach.

  5. Science Camps for Introducing Nature of Scientific Inquiry Through Student Inquiries in Nature: Two Applications with Retention Study

    Science.gov (United States)

    Leblebicioglu, G.; Abik, N. M.; Capkinoglu, E.; Metin, D.; Dogan, E. Eroglu; Cetin, P. S.; Schwartz, R.

    2017-08-01

    Scientific inquiry is widely accepted as a method of science teaching. Understanding its characteristics, called Nature of Scientific Inquiry (NOSI), is also necessary for a whole conception of scientific inquiry. In this study NOSI aspects were taught explicitly through student inquiries in nature in two summer science camps. Students conducted four inquiries through their questions about surrounding soil, water, plants, and animals under the guidance of university science educators. At the end of each investigation, students presented their inquiry. NOSI aspects were made explicit by one of the science educators in the context of the investigations. Effectiveness of the science camp program and its retention were determined by applying Views of Scientific Inquiry (VOSI-S) (Schwartz et al. 2008) questionnaire as pre-, post-, and retention test after two months. The patterns in the data were similar. The science camp program was effective in developing three of six NOSI aspects which were questions guide scientific research, multiple methods of research, and difference between data and evidence. Students' learning of these aspects was retained. Discussion about these and the other three aspects is included in the paper. Implications of differences between school and out-of-school science experiences are also discussed.

  6. A gross anatomy flipped classroom effects performance, retention, and higher-level thinking in lower performing students.

    Science.gov (United States)

    Day, Leslie J

    2018-01-22

    A flipped classroom is a growing pedagogy in higher education. Many research studies on the flipped classroom have focused on student outcomes, with the results being positive or inconclusive. A few studies have analyzed confounding variables, such as student's previous achievement, or the impact of a flipped classroom on long-term retention and knowledge transfer. In the present study, students in a Doctor of Physical Therapy program in a traditional style lecture of gross anatomy (n = 105) were compared to similar students in a flipped classroom (n = 112). Overall, students in the flipped anatomy classroom had an increase in semester average grades (P = 0.01) and performance on higher-level analytical questions (P flipped anatomy classroom performing at a higher level in kinesiology (P flipped anatomy class, outperformed their traditional anatomy class counterparts in anatomy semester grades (P flipped classroom may benefit lower performing student's knowledge acquisition and transfer to a greater degree than higher performing students. Future studies should explore the underlying reasons for improvement in lower performing students. Anat Sci Educ. © 2018 American Association of Anatomists. © 2018 American Association of Anatomists.

  7. Examining the Effects of Stress and Campus Climate on the Persistence of Students of Color and White Students: An Application of Bean and Eaton's Psychological Model of Retention

    Science.gov (United States)

    Johnson, Dawn R.; Wasserman, Timothy H.; Yildirim, Nilay; Yonai, Barbara A.

    2014-01-01

    The current study examined the effects of stress and campus climate perceptions on the persistence decisions of students of color and White students using Bean and Eaton's (2000) Psychological Model of College Student Retention. A sample of first-year students (N = 1,491) at a predominantly White research university were survey enduring their…

  8. Age Differences Explain Social Class Differences in Students' Friendship at University: Implications for Transition and Retention

    Science.gov (United States)

    Rubin, Mark; Wright, Chrysalis L.

    2015-01-01

    The present research tested the hypotheses that (a) working-class students have fewer friends at university than middle-class students and (b) this social class difference occurs because working-class students tend to be older than middle-class students. A sample of 376 first-year undergraduate students from an Australian university completed an…

  9. Alienation and First-Year Student Retention. Professional File. Number 116, Spring 2010

    Science.gov (United States)

    Liu, Richard

    2010-01-01

    Since Summerskill's study on college attrition forty years ago, the interest in this topic has never waned. This study was particularly interested in the relationship of race to retention. Various theoretical frames of references have been proposed: Price's organization theory, Durkheim's Suicide, and Marx's Alienation have been used to guide…

  10. "SERPS Up": Support, Engagement and Retention of Postgraduate Students--A Model of Postgraduate Support

    Science.gov (United States)

    Alston, Margaret; Allan, Julaine; Bell, Karen; Brown, Andy; Dowling, Jane; Hamilton, Pat; McKinnon, Jenny; McKinnon, Noela; Mitchell, Rol; Whittenbury, Kerri; Valentine, Bruce; Wicks, Alison; Williams, Rachael

    2005-01-01

    The federal government's 1999 White Paper Knowledge and Innovation: a policy statement on research and research training, notes concerns about retention and completion rates in doctoral studies programs in Australia. This paper outlines a model of higher education support developed at the Centre for Rural Social Research at Charles Sturt…

  11. Colour in Learning: Its Effect on the Retention Rate of Graduate Students

    Science.gov (United States)

    Olurinola, Oluwakemi; Tayo, Omoniyi

    2015-01-01

    Cognitive psychologists have discovered different design principles to enhance memory performance. It has been said that retrieving process depends on many variables and one of them is colour. This paper provides an overview of research on colour and learning. It includes the effect of colour on attention, retention and memory performance, and…

  12. Individualized, Purposeful, and Persistent: Successful Transitions and Retention of Students at Risk

    Science.gov (United States)

    Nix, J. Vincent; Lion, Robert W.; Michalak, Megan; Christensen, Amy

    2015-01-01

    This article provides an overview of GED holders admitted into the Successful Transition and Retention Track (START) two-year pilot-project. An enhanced college-success course, career and mental-health counseling, and English and mathematics tutoring acclimated GED holders to college. Results suggest that postsecondary educational attainment of…

  13. The Effects of Computer-Assisted Instruction on the Achievement, Attitudes and Retention of Fourth Grade Mathematics Students in North Cyprus

    Science.gov (United States)

    Pilli, Olga; Aksu, Meral

    2013-01-01

    The purpose of this study was to examine the effects of the educational software "Frizbi Mathematics 4" on 4th grade student's mathematics achievement, retention, attitudes toward mathematics and attitude toward computer assisted learning. Two groups (experimental and control) of students from the state primary school in Gazimagusa,…

  14. The Effect of Use of Animations on the Academic Achievements of the Students, Retention of the Knowledge Learned, and the Scientific Process Skills

    Science.gov (United States)

    Dasdemir, Ikramettin

    2013-01-01

    This study was conducted to determine the effect of the use of the animation on the academic achievements of the students, retention of this achievement, and the development of scientific process skills in the unit of force and motion of the science and technology course of the 6th grade basic education and to find out the student's views. The…

  15. Relative Effectiveness of Computer-Supported Jigsaw II, STAD and TAI Cooperative Learning Strategies on Performance, Attitude, and Retention of Secondary School Students in Physics

    Science.gov (United States)

    Gambari, Amosa Isiaka; Yusuf, Mudasiru Olalere

    2017-01-01

    This study investigated the relative effectiveness of computer-supported cooperative learning strategies on the performance, attitudes, and retention of secondary school students in physics. A purposive sampling technique was used to select four senior secondary schools from Minna, Nigeria. The students were allocated to one of four groups:…

  16. Learning from Success: How Original Research on Academic Resilience Informs What College Faculty Can Do to Increase the Retention of Low Socioeconomic Status Students

    Science.gov (United States)

    Morales, Erik E.

    2014-01-01

    Utilizing resilience theory and original research conducted on fifty academically resilient low socioeconomic status students of color, this article presents specific objectives and values institutions of higher learning can adopt and emphasize to increase the retention and graduation of their most statistically at-risk students. Major findings…

  17. Do Developmental Mathematics Programs Have a Causal Impact on Student Retention? An Application of Discrete-Time Survival and Regression-Discontinuity Analysis

    Science.gov (United States)

    Lesik, Sally A.

    2007-01-01

    The impact of academic programs--such as developmental mathematics programs--on student retention, has been a controversial topic for administrators, policy makers, and faculty in higher education. Despite deep interest in the effectiveness of these programs in retaining students, scholars have been unable to determine whether such programs have a…

  18. Retention of basic life support knowledge, self-efficacy and chest compression performance in Thai undergraduate nursing students.

    Science.gov (United States)

    Partiprajak, Suphamas; Thongpo, Pichaya

    2016-01-01

    This study explored the retention of basic life support knowledge, self-efficacy, and chest compression performance among Thai nursing students at a university in Thailand. A one-group, pre-test and post-test design time series was used. Participants were 30 nursing students undertaking basic life support training as a care provider. Repeated measure analysis of variance was used to test the retention of knowledge and self-efficacy between pre-test, immediate post-test, and re-test after 3 months. A Wilcoxon signed-rank test was used to compare the difference in chest compression performance two times. Basic life support knowledge was measured using the Basic Life Support Standard Test for Cognitive Knowledge. Self-efficacy was measured using the Basic Life Support Self-Efficacy Questionnaire. Chest compression performance was evaluated using a data printout from Resusci Anne and Laerdal skillmeter within two cycles. The training had an immediate significant effect on the knowledge, self-efficacy, and skill of chest compression; however, the knowledge and self-efficacy significantly declined after post-training for 3 months. Chest compression performance after training for 3 months was positively retaining compared to the first post-test but was not significant. Therefore, a retraining program to maintain knowledge and self-efficacy for a longer period of time should be established after post-training for 3 months. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. The Coppin Academy for Pre-Nursing Success: a model for the recruitment and retention of minority students.

    Science.gov (United States)

    Gordon, Frances C; Copes, Marcella A

    2010-01-01

    There is a clearly documented need for greater minority representation in professional nursing as the nation grows more diversified. Increasing the ranks of minority nurses will assist both in alleviating the nursing shortage and in addressing the health care disparities that plague our healthcare systems. One barrier has been the recruitment and retention of underserved minority nursing students. To address this, the Coppin State University Helene Fuld School of Nursing (HFSON) in Baltimore, Maryland developed and implemented the "Coppin Academy for Pre-Nursing Success" (CAPS), a comprehensive year-round pre-entry baccalaureate preparation program, targeting high school students from disadvantaged backgrounds who are interested in a nursing career. CAPS graduates have met or exceeded goals in retention, passing rate on the nursing licensure exam, and service to the community. As a result, the program is growing, and the School plans to replicate the CAPS model, not only in surrounding communities, but in other vulnerable and under-served urban settings in the nation.

  20. _. AA~ AAA _ _--_ _ _ _

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 3. Horizons of Physics-A Series for Undergraduate Students and Teachers. Avinash Khare. Book Review Volume 2 Issue 3 March 1997 pp 87-88. Fulltext. Click here to view fulltext PDF. Permanent link:

  1. Dreams and disappointments regarding nursing : Student nurses' reasons for attrition and retention. A qualitative study design

    NARCIS (Netherlands)

    ten Hoeve, Yvonne; Castelein, Stynke; Jansen, Gerard; Roodbol, Petrie

    Background: In the Netherlands, hundreds of students register annually for a nursing programme, but not all of these students manage to complete their training. Objective: The main aim of this study was to examine which factors affect student nurses' decision to leave or complete their programme.

  2. Puente Student English Success, Retention, and Persistence at Gavilan Community College.

    Science.gov (United States)

    Willett, Terrence

    This document discusses the Puente program at Gavilan Community College. The Puente program has historically focused on Latino students who intended to transfer to four-year institutions and it is currently focusing in underrepresented students with transfer intent, but is open to all. Puente students are able to enroll in English classes designed…

  3. Overcoming Student Retention Issues in Higher Education Online Programs: A Delphi Study

    Science.gov (United States)

    Heyman, Errin

    2010-01-01

    Pressure exists to attract and retain students in higher education. Online programs educational programs have the potential to increase the number of students who can enroll in degree-bearing institutions. Explored in the qualitative study using a modified three-round Delphi technique was the phenomenon of consistently lower student retention…

  4. Effectiveness of an audience response system on orthodontic knowledge retention of undergraduate dental students – a randomised control trial

    Science.gov (United States)

    Robson, Nicholas; Popat, Hashmat; Richmond, Stephen; Farnell, Damian J. J.

    2015-01-01

    Objective:: To determine the effect of an audience response system (ARS) on knowledge retention of dental students and to gauge student perceptions of using the ARS. Design:: Randomised control study. Setting:: School of Dentistry, Cardiff University. Participants:: Seventy four second-year dental students were stratified by gender and randomised anonymously to one of two groups. Methods:: One group received a lecture on orthodontic terminology and diagnosis in a traditional didactic format and the other received the same lecture integrated with ARS slides. Students completed an assessment of multiple-choice questions (MCQs) scored out of 20, before and immediately after the lecture. Students were also asked to complete a self-reported questionnaire on their perceptions of ARS. Results:: Both groups had statistically significant increases in MCQ scores post-lecture (ARS mean increase 3.6 SD2.0, 95% CI 2.2–3.5 and Didactic mean increase 2.9 SD2.3, 95% CI 2.8–4.3). A mixed-design analysis of variance showed that ARS led to an improved MCQ score (by 0.8 or 25%) compared to the didactic group, although this effect was not significant (P = 0.15). The effect of gender at baseline (P = 0.49), post-lecture (P = 0.73) and increase in MCQ score split by group (P = 0.46) was also not significant. Students reported that the ARS was easy to use, helped them engage with the lecture and encouraged them to work harder. Conclusion:: The ARS did not lead to a significant increase in short-term orthodontic knowledge recall of students compared with didactic teaching. However, the use of ARS within orthodontic teaching could make lectures more interactive and engaging. PMID:26282015

  5. Effectiveness of an audience response system on orthodontic knowledge retention of undergraduate dental students--a randomised control trial.

    Science.gov (United States)

    Robson, Nicholas; Popat, Hashmat; Richmond, Stephen; Farnell, Damian J J

    2015-01-01

    To determine the effect of an audience response system (ARS) on knowledge retention of dental students and to gauge student perceptions of using the ARS. Randomised control study. School of Dentistry, Cardiff University. Seventy four second-year dental students were stratified by gender and randomised anonymously to one of two groups. One group received a lecture on orthodontic terminology and diagnosis in a traditional didactic format and the other received the same lecture integrated with ARS slides. Students completed an assessment of multiple-choice questions (MCQs) scored out of 20, before and immediately after the lecture. Students were also asked to complete a self-reported questionnaire on their perceptions of ARS. Both groups had statistically significant increases in MCQ scores post-lecture (ARS mean increase 3.6 SD2.0, 95% CI 2.2-3.5 and Didactic mean increase 2.9 SD2.3, 95% CI 2.8-4.3). A mixed-design analysis of variance showed that ARS led to an improved MCQ score (by 0.8 or 25%) compared to the didactic group, although this effect was not significant (P = 0.15). The effect of gender at baseline (P = 0.49), post-lecture (P = 0.73) and increase in MCQ score split by group (P = 0.46) was also not significant. Students reported that the ARS was easy to use, helped them engage with the lecture and encouraged them to work harder. The ARS did not lead to a significant increase in short-term orthodontic knowledge recall of students compared with didactic teaching. However, the use of ARS within orthodontic teaching could make lectures more interactive and engaging.

  6. “Academic Coaching” for Enhanced Learning, Higher Levels of Student Responsibility, and Greater Retention

    OpenAIRE

    Barkley, Andrew P.

    2010-01-01

    The relationship between teachers and students has changed. Many writers have put forth hypotheses and ideas about how the current generation of students (Gen‐Y; the “Me Generation”) differs from previous generations. Others focus on teaching methods, course strategies, and technological tools that are effective in the new environment. The objective of this research is to investigate the possibility of “academic coaching” for enhanced student responsibility, higher levels of learning, and gre...

  7. Sustaining Retention of Nontraditional Students in the Geosciences in 2YC; Practices and Ideas

    Science.gov (United States)

    Villalobos, J. I.; Doser, D. I.

    2012-12-01

    As the role of 2YC (two-year colleges/community colleges) changes in the academic pipeline of higher education new practices and ideas to engage and retain students in the geosciences at the 2YC level need to be explored. 2YC typically have a student body composed of non-traditional students ranging from second career students, single parents, students with disabilities, seniors, and minorities. Currently, 2YCs serve 44% of all undergraduate students and 45% of all of all first time freshmen in the US. These statistics show the potential community colleges hold to encourage entering students to the STEM (Science Technology Engineering and Math) fields as a possible career choice. But the reality is the number of STEM degrees awarded at community colleges has not followed the same trends in student enrollment. Over the past four years El Paso Community College (EPCC) in conjunction with The University of Texas at El Paso (UTEP) has implemented several initiatives in our effort to increase the number of Geological Science majors at EPCC and to ensure a successful transition to UTEP. These efforts are aimed to decrease attrition rates of science majors by; articulating degree plans between institutions, introduce field-based research projects to allow hands on experience for students, develop a working relationship between students and university faculty, diversify geology courses offered at EPCC, and strengthening the educational-bridge between the geological science departments of EPCC and UTEP through the aid of federally funded programs. The success of the these efforts have been seen by; the increase in geology majors in our A.S. degree program, the number of degrees conferred at EPCC, the successful transition of students to UTEP, and graduation of students from UTEP with advanced degrees.

  8. A Survival Analysis of Student Mobility and Retention in Indiana Charter Schools

    Directory of Open Access Journals (Sweden)

    Holmes Finch

    2009-10-01

    Full Text Available Research has demonstrated that high rates of student mobility are associated with a range of negative academic outcomes, both for students who leave their schools and those who remain behind. The current study focused on mobility among those enrolled in charter schools in the state of Indiana. A multilevel Cox Proportional Hazards survival analysis model was used to identify significant predictors of student mobility within and from a state charter school system, using factors at both the student and school levels. Results indicated that initial student achievement upon first entering a charter school, student ethnicity, participation in a Title I funded program, and average years of teacher experience at the school were all associated with the decision to leave the charter. Specifically, students with higher initial achievement scores, those eligible for Title 1 services, and non-Caucasian students were more likely to leave charter schools prematurely. In addition, schools with a more experienced faculty had lower early departure rates than did those with less experienced teachers.

  9. A Survival Analysis of Student Mobility and Retention in Indiana Charter Schools

    Science.gov (United States)

    Finch, Holmes; Lapsley, Daniel K.; Baker-Boudissa, Mary

    2009-01-01

    Research has demonstrated that high rates of student mobility are associated with a range of negative academic outcomes, both for students who leave their schools and those who remain behind. The current study focused on mobility among those enrolled in charter schools in the state of Indiana. A multilevel Cox Proportional Hazards survival…

  10. The Effects of a Combined Academic and Personal Counselling Initiative for Post-Secondary Student Retention

    Science.gov (United States)

    Bilodeau, Cynthia; Meissner, John

    2018-01-01

    This study investigated the effectiveness of a combined academic and personal counselling initiative on student performance and emotional well-being outcomes of 289 at-risk students at a Canadian University. Criterion for risk included academic struggles, mental health distress, or both. The program was developed to be tailored to individual…

  11. Outlook on Student Retention in Higher Education University Reforms in Morocco

    Science.gov (United States)

    Mansouri, Zoulal; Moumine, Mohamed El Amine

    2017-01-01

    High student attrition rates at university have become one of the most challenging issues in higher education worldwide in the last five decades. Moroccan universities are no exception. At-risk students drop out of studies for a plethora of reasons, and the attrition rate is increasing despite the efforts made in education reforms carried out…

  12. Supporting Online Student Retention in Community Colleges: What Data Is Most Relevant?

    Science.gov (United States)

    Travers, Steve

    2016-01-01

    Community colleges have traditionally been considered forerunners in their provision of distance education opportunities for higher education students. Recent data from distance education research at several community colleges, however, indicates students taking online courses in the community college setting are often not being supported at…

  13. Comparing Linear and Nonlinear Delivery of Introductory Psychology Lectures: Improving Student Retention

    Science.gov (United States)

    Cramer, Kenneth M.; Sands, Mandy

    2016-01-01

    As in most disciplines, the typical introductory class presents topics to students in a linear fashion, beginning (to use psychology as an example) with the history of the field, research methods, brain and neurons, sensation and perception, and so on. This study examined the impact of topic sequence on student achievement. The same professor…

  14. Communication Skills in Dental Students: New Data Regarding Retention and Generalization of Training Effects.

    Science.gov (United States)

    Broder, Hillary L; Janal, Malvin; Mitnick, Danielle M; Rodriguez, Jasmine Y; Sischo, Lacey

    2015-08-01

    Previous studies have shown that a communications program using patient instructors (PIs) facilitates data-gathering and interpersonal skills of third-year dental students. The aim of this study was to address the question of whether those skills are retained into the students' fourth year and generalized from the classroom to the clinic. In the formative training phase, three cohorts of D3 students (N=1,038) at one dental school received instruction regarding effective patient-doctor communication; interviewed three PIs and received PI feedback; and participated in a reflective seminar with a behavioral science instructor. In the follow-up competency phase, fourth-year students performed two new patient interviews in the clinic that were observed and evaluated by clinical dental faculty members trained in communications. Mean scores on a standardized communications rating scale and data-gathering assessment were compared over training and follow-up sessions and between cohorts with a linear mixed model. The analysis showed that the third-year students' mean communication and data-gathering scores increased with each additional encounter with a PI (pcommunication scores were not only maintained but increased during the fourth-year follow-up competency evaluations (pcommunications curriculum, prior instruction facilitated the students' clinical communication performance at baseline (pCommunications program improved students' data-gathering and interpersonal skills. Those skills were maintained and generalized through completion of the D4 students' summative competency performance in a clinical setting.

  15. Investigating Factors in the Retention of Students in High School Physical Education

    Science.gov (United States)

    Lodewyk, Ken R.; Pybus, Colin M.

    2013-01-01

    Several studies have reported declining student enrolment rates in optional physical education. This study--incorporating constructs from social cognitive, self-determination, and body image theory--investigated factors that might be influential to this trend. Surveys were administered to 227 tenth-grade students from five schools in one school…

  16. Professional Staff Contributions to Student Retention and Success in Higher Education

    Science.gov (United States)

    Roberts, Jenny

    2018-01-01

    Student attrition remains a persistent problem within the Australian higher education sector. Contributing factors include financial, reputational and quality issues, which can pose significant risks for a university's sustainability. Institutional culture is fundamental to decisions student make about withdrawing or remaining in higher education.…

  17. Teaching Introductory Psychology in the Community College Classroom: Enhancing Student Understanding and Retention of Essential Information

    Science.gov (United States)

    Debb, Scott M.; Debb, Sharon M.

    2012-01-01

    Enrolling in an introductory course in psychology is a staple of many community college students' core curriculum. For those students who plan to pursue social science and humanities-related majors in particular, introductory psychology helps provide a solid base upon which future coursework at all academic levels will be built. The goal of any…

  18. Life history approaches to access and retention of nontraditional students in higher education: A cross-European approach

    Directory of Open Access Journals (Sweden)

    John Field

    2012-04-01

    Full Text Available Higher education participation has become an important focus for policy debate as well as for scholarly research. Partly this results from ongoing attempts to expand the higher education system in line with wider policies promoting a 'knowledge economy'; and partly it results from widespread policy concerns for equity and inclusion. In both cases, researchers and policymakers alike have tended to focus on access and entry to the system, with much less attention being paid to the distribution of outcomes from the system. This paper reports on a multi-country study that was aimed at critically understanding the experiences of non-traditional students in higher education, and in particular on the factors that helped promote retention. In doing so, the study straddles the sociology of social reproduction and the psychosociology of learner transformations.

  19. Aa Ah Nak

    Science.gov (United States)

    Tha, Na Gya; Wus, Thay

    2017-01-01

    In this article, Aa Ah Nak, the authors' methodology presents not only various reflections but also diverse contradictions about the Aa Nii language as well as language revitalization. This article explores language foundation and how the Aa Nii language revitalization is inextricably linked to the genocide and resulting historic trauma pervasive…

  20. Backchannelling in the Language Classroom: Improving Student Attention and Retention with Feedback Technologies

    OpenAIRE

    Reinders, Hayo

    2016-01-01

    Backchanneling is a technique for monitoring student engagement and performance in the language classroom. In this article I give the pedagogical rationale for this activity and describe some examples of best practice. The article concludes with a number of practical recommendations on how to get started with the various tools that are available and how to best make use of their affordances with your students.

  1. Dreams and disappointments regarding nursing: Student nurses' reasons for attrition and retention. A qualitative study design.

    Science.gov (United States)

    Ten Hoeve, Yvonne; Castelein, Stynke; Jansen, Gerard; Roodbol, Petrie

    2017-07-01

    In the Netherlands, hundreds of students register annually for a nursing programme, but not all of these students manage to complete their training. The main aim of this study was to examine which factors affect student nurses' decision to leave or complete their programme. The study used an exploratory descriptive design, employing a qualitative phenomenological approach. Student nurses (n=17) at the beginning of their third year of the four-year Bachelor's programme. Data were collected at four Universities of Applied Sciences in the Netherlands, from December 2013 to January 2014. Semi-structured interviews were used to collect the data, using an interview guide. The main reasons for students to become nurses were the caring aspect, personal experiences with healthcare, role models in their immediate environment, and job opportunities. They had both altruistic and professional perceptions of their profession. Reasons for attrition were strongly related to the training programme and to their clinical placements, in particular the perceived lack of support from mentors and team. Feelings of being welcomed and working in a nice team proved to be more important reasons for completing the programme than the specific clinical field. Student nurses started their studies with many dreams, such as caring for people and having the opportunity to deliver excellent nursing care. When their expectations were not met, their dreams became disappointments which caused them to consider stopping and even to leave (attrition). The role of lecturers and mentors seems invaluable in protecting and guiding students through their programme and placements. Optimal cooperation between lecturers and mentors is of paramount importance to retain student nurses in their training programmes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. The Impact of Educational Games-Based iPad Applications on the Development of Social Studies Achievement and Learning Retention among Sixth Grade Students in Jeddah

    Science.gov (United States)

    Najmuldeen, Hanan A.

    2017-01-01

    The present study aims to evaluate the impact of educational games-based iPad applications on the development of social studies achievement and learning retention. Sample consisted of (48) sixth grade primary students in Jeddah. The author adopted Quasi-experimental design of the experimental and control groups. She also provided the teacher a…

  3. Student Retention Indicators Benchmark Report for Four-Year and Two-Year Institutions, 2013. Noel-Levitz Report on Undergraduate Trends in Enrollment Management. Higher Ed Benchmarks

    Science.gov (United States)

    Noel-Levitz, Inc., 2013

    2013-01-01

    This biennial report from Noel-Levitz assists colleges and universities with raising the bar on student retention and degree completion subgoals by benchmarking key predictive indicators such as term-to-term persistence and the ratio of credit hours completed vs. credit hours attempted. The report is based on a Web-based poll of campus officials…

  4. College Student Retention: An Exploration of the Relationship between Self-Efficacy Beliefs and Purpose in Life among College Students

    Science.gov (United States)

    DeWitz, S. Joseph; Woolsey, M. Lynn; Walsh, W. Bruce

    2009-01-01

    We investigated the association between Frankl's (1985, 1988) construct of purpose in life with Bandura's (1977, 1997) theory of self-efficacy as a possible predictor of students who may be at risk for leaving school. For this study, 344 undergraduate college students (233 females, 111 males; 76% White/Caucasian, 10% Asian American/Asian, 7%…

  5. Using a kinesthetic learning strategy to engage nursing student thinking, enhance retention, and improve critical thinking.

    Science.gov (United States)

    Wagner, Elissa A

    2014-06-01

    This article reports the outcomes of a kinesthetic learning strategy used during a cardiac lecture to engage students and to improve the use of classroom-acquired knowledge in today's challenging clinical settings. Nurse educators are constantly faced with finding new ways to engage students, stimulate critical thinking, and improve clinical application in a rapidly changing and complex health care system. Educators who deviate from the traditional pedagogy of didactic, content-driven teaching to a concept-based, student-centered approach using active and kinesthetic learning activities can enhance engagement and improve clinical problem solving, communication skills, and critical thinking to provide graduates with the tools necessary to be successful. The goals of this learning activity were to decrease the well-known classroom-clinical gap by enhancing engagement, providing deeper understanding of cardiac function and disorders, enhancing critical thinking, and improving clinical application. Copyright 2014, SLACK Incorporated.

  6. Outlook on Student Retention in Higher Education University Reforms in Morocco

    OpenAIRE

    Zoulal Mansouri; Mohamed El Amine Moumine

    2017-01-01

    High student attrition rates at university have become one of the most challenging issues in higher education worldwide in the last five decades. Moroccan universities are no exception. At-risk students drop out of studies for a plethora of reasons, and the attrition rate is increasing despite the efforts made in education reforms carried out since 1999. This article reviews the most important components of the higher education reforms that have been adopted in Moroccan higher education in th...

  7. EM&AA: An Algorithm for Predicting the Course Selection by Student in e-Learning Using Data Mining Techniques

    Science.gov (United States)

    Aher, Sunita B.

    2014-01-01

    Recommendation systems have been widely used in internet activities whose aim is to present the important and useful information to the user with little effort. Course Recommendation System is system which recommends to students the best combination of courses in engineering education system e.g. if student is interested in course like system programming then he would like to learn the course entitled compiler construction. The algorithm with combination of two data mining algorithm i.e. combination of Expectation Maximization Clustering and Apriori Association Rule Algorithm have been developed. The result of this developed algorithm is compared with Apriori Association Rule Algorithm which is an existing algorithm in open source data mining tool Weka.

  8. Higher Education Teachers' Experiences with Learning Analytics in Relation to Student Retention

    Science.gov (United States)

    West, Deborah; Huijser, Henk; Heath, David; Lizzio, Alf; Toohey, Danny; Miles, Carol; Searle, Bill; Bronnimann, Jurg

    2016-01-01

    This paper presents findings from a study of Australian and New Zealand academics (n = 276) that teach tertiary education students. The study aimed to explore participants' early experiences of learning analytics in a higher education milieu in which data analytics is gaining increasing prominence. Broadly speaking participants were asked about:…

  9. Increasing First-Semester Student Engagement: A Residential Community Retention Study

    Science.gov (United States)

    Briggs, Ronald

    2012-01-01

    The purpose of this study was to increase first year residential student engagement and participation in residence hall programs during the 2011 fall semester at the Downtown Phoenix Campus of Arizona State University. Six upperclassmen (Taylor Place Leaders) residing in a residence hall (Taylor Place) were matched by academic major with 17 first…

  10. Medical Student Retention of Embryonic Development: Impact of the Dimensions Added by Multimedia Tutorials

    Science.gov (United States)

    Marsh, Karen R.; Giffin, Bruce F.; Lowrie, Donald J., Jr.

    2008-01-01

    The purpose of this project was to develop Web-based learning modules that combine (1) animated 3D graphics; (2) 3D models that a student can manipulate independently; (3) passage of time in embryonic development; and (4) animated 2D graphics, including 2D cross-sections that represent different "slices" of the embryo, and animate in…

  11. Image and Reputation of Higher Education Institutions in Students' Retention Decisions.

    Science.gov (United States)

    Nguyen, Nha; LeBlanc, Gaston

    2001-01-01

    Surveyed business students about the role of institutional image and reputation in the formation of customer loyalty. Found that the degree of loyalty tends to be higher when perceptions of both institutional reputation and image are favorable, and that interaction between the two also influences loyalty. (EV)

  12. The Impact of Digital Games on Student Persistence and Retention in an Online Higher Education Context

    Science.gov (United States)

    Case, Randall E.

    2013-01-01

    Enrollment in online higher education programs has been climbing for the past decade but research suggests that online courses exhibit significantly higher attrition rates than their face-to-face counterparts. Consequently, while significantly more students are enrolling in higher education programs, far too few are graduating. Self-determination…

  13. Exploring Cramming: Student Behaviors, Beliefs, and Learning Retention in the Principles of Marketing Course

    Science.gov (United States)

    McIntyre, Shelby H.; Munson, J. Michael

    2008-01-01

    Cramming for finals is common on college campuses, and many students seem to cram for their final in the Principles of Marketing course. This article addresses the question of defining and measuring a "cramming study strategy." Scales are developed to assess (a) cramming for courses in general and (b) cramming specifically in the Principles of…

  14. Within-Year Retention among Ph.D. Students: The Effect of Debt, Assistantships, and Fellowships

    Science.gov (United States)

    Mendoza, Pilar; Villarreal, Pedro, III; Gunderson, Alee

    2014-01-01

    This study employs the 2007-2008 National Postsecondary Student Aid Study and the National Research Center's survey data, "A Data-Based Assessment of Research-Doctorate Programs in the United States," to investigate the (1) the effects of debt in relation to tuition and fees paid and (2) the effects of teaching assistantships,…

  15. The Use of Deep Learning Strategies in Online Business Courses to Impact Student Retention

    Science.gov (United States)

    DeLotell, Pam Jones; Millam, Loretta A.; Reinhardt, Michelle M.

    2010-01-01

    Interest, application and understanding--these are key elements in successful online classroom experiences and all part of what is commonly referred to as deep learning. Deep learning occurs when students are able to connect with course topics, find value in them and see how to apply them to real-world situations. Asynchronous discussion forums in…

  16. Retention and Application of Information Technology Skills among Nursing and Midwifery Students

    Science.gov (United States)

    Ip, Barry; Jones, Steve; Jacobs, Gabriel

    2007-01-01

    Pre-registration nursing and midwifery students are under considerable pressure to acquire the necessary information technology (IT) skills by the time they embark on a professional nursing career. There is a multitude of research findings detailing the use of computer-based learning materials, IT training initiatives and how such materials are…

  17. Improving Student Preparedness and Retention--Perceptions of Staff at Two Universities

    Science.gov (United States)

    Marr, David; Nicoll, Camilla; von Treuer, Kathryn; Kolar, Christina; Palermo, Josephine

    2013-01-01

    In 2010 the Australian government provided funding under the Higher Education Participation and Partnerships Program (HEPPP) to assist universities to achieve a 20 percent participation rate for students from lower socioeconomic backgrounds. This funding has allowed universities the opportunity to implement projects towards this end. This study…

  18. Student Enrollment in a Supplement Course for Anatomy and Physiology Results in Improved Retention and Success

    Science.gov (United States)

    Hopper, Mari

    2011-01-01

    Anatomy and Physiology I (A&P 1) has one of the highest failure and withdrawal rates on campus. To increase academic success, a course to supplement A&P 1 (Supplement) was developed and taught by anatomy and physiology faculty. Primary goals for the Supplement included (1) early identification of students at risk for failing or withdrawal;…

  19. LAS HABILIDADES SOCIALES EN UNIVERSITARIOS, ADOLESCENTES Y ALCOHÓLICOS EN RECUPERACIÓN DE UN GRUPO DE ALCOHÓLICOS ANÓNIMOS (AA/ SOCIAL ABILITIES IN ADOLESCENTS, UNIVERSITY STUDENTS AND ALCOHOLICS IN RECOVERY IN A GROUP OF ALCOHOLICS ANONYMOUS (AA

    Directory of Open Access Journals (Sweden)

    Carlos Nava Quiroz***

    2010-03-01

    were distributed as follows: 58 adolescents (high school students, 55 members of AA and 44college students. Significant differences were found between some subscales and different reference groups. Most of thesedifferences were found in terms of cutting social cognitive skills. The group of alcoholics AA made the difference, showingthem a higher score on the subscales that indicate «fear» or «concern» in certain social situations. We discuss these findingsand their implications for treatment and prevention of alcoholism.

  20. Support and Retention: Exploring the Role of Mentoring Relationships and Social Capital between College Students and Student Affairs Professionals

    Science.gov (United States)

    Pearl, Domenica Cimarusti

    2013-01-01

    The California State University system recently announced a long-term Graduation Initiative to increase the six-year graduation rate by 8%. As a result, close attention is being focused on ways to retain students at risk of leaving the university prior to graduation. Although it is generally acknowledged that mentoring programs promote college…

  1. States' Flexibility Waiver Plans for Alternate Assessments Based on Alternate Achievement Standards (AA-AAS). Synthesis Report 96

    Science.gov (United States)

    Lazarus, Sheryl S.; Edwards, Lynn M.; Thurlow, Martha L.; Hodgson, Jennifer R.

    2014-01-01

    All states have alternate assessments based on alternate achievement standards (AA-AAS) for students with the most significant cognitive disabilities. For accountability purposes, the Elementary and Secondary Education Act (ESEA) allows up to 1% of students to be counted as proficient with this assessment option. In 2011 the U.S. Department of…

  2. AAS 227: Day 1

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  3. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    tests of GR, and performing predictive GRMHD simulations hydrodynamics simulations that include magnetic fields and full GR treatment. Ozel pointed out that one of the recent theoretical advancements in GRMHD simulations is harnessing the power of GPUs to render images in simulations; check out the tweet below for the awesome video she showed us!Watch C. Chan manipulate black hole simulation with hand motions https://t.co/O5BgaltYAu (more on the code: https://t.co/9GC46ReMGs) #aas227 Sarah Scoles (@ScolesSarah) January 6, 2016Deployment of the full EHT array is planned for early 2017, and theyve already got 10 targets selected black holes that are near enough and large enough that the EHT should be able to image their shadows. I, for one, cant wait to see the first results!Grad School and Postdocs as a Means to a Job (by Meredith Rawls)This morning session was presented by Karen Kelsky of The Professor Is In. She presented a very practical overview of the advice in her book (which this job-searching Astrobiter highly recommends). Her target audience is postdocs and graduate students who are finishing their PhDs and applying for tenure-track jobs. Karens background is in the social sciences, but she has worked with many scientists and her expertise easily transferred. Much of her writing advice also applies for undergraduates who are writing research statements and proposals to apply to graduate school. For example:What not to do, with @ProfessorIsIn #aas227 pic.twitter.com/afGAsSuPwN Meredith Rawls (@merrdiff) January 6, 2016One of Karens main takeaways is that academia is not automatically good preparation for a job search. Writing documents like cover letters, resumes, and research statements will be harder and take more time than you think, and it is important to make them top-notch. Karen was also surprised that the majority of professional astronomers at the AAS meeting carry backpacks, because she typically advises against bringing a backpack to a job interview or

  4. AA under construction

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The AA at an early stage of construction, in the newly built AA-Hall. Cable-trays already outline the shape of the accumulator ring. To the right are huge cable-drums for the pulse-forming-network (PFN) of the injection kicker. Seeing this picture, can one imagine that only 8 months later beams were circulating in the completed accumulator ring ?

  5. Improving physical activity, mental health outcomes, and academic retention in college students with Freshman 5 to Thrive: COPE/Healthy Lifestyles.

    Science.gov (United States)

    Melnyk, Bernadette; Kelly, Stephanie; Jacobson, Diana; Arcoleo, Kimberly; Shaibi, Gabriel

    2014-06-01

    To assess the preliminary effects of a new course entitled Freshman 5 to Thrive/COPE Healthy Lifestyles on the cognitive beliefs, knowledge, mental health outcomes, healthy lifestyle choices, physical activity, and retention of college freshmen. Measures included demographics, nutrition knowledge, healthy lifestyle beliefs, healthy lifestyle perceived difficulty, healthy lifestyle choices, Beck Youth Inventories-II (anxiety, depression, anxiety, and destructive behavior), step count via pedometer, and college retention. The experimental COPE (Creating Opportunities for Personal Empowerment) group had greater intentions to live a healthy lifestyle (p = .02) versus the comparison group. COPE students also significantly increased their physical activity (p = .003) from baseline to postintervention and had a higher college retention rate than students who did not take the course. In addition, there was a significant decrease in depressive and anxiety symptoms in COPE students whose baseline scores were elevated. The Freshman 5 to Thrive Course is a promising intervention that can be used to enhance healthy lifestyle behaviors and improve mental health outcomes in college freshmen. ©2013 The Author(s) ©2013 American Association of Nurse Practitioners.

  6. Assessing the effects of teacher-generated and student-generated motivational and learning strategies on the retention of a science curriculum with at-risk male high school students

    Science.gov (United States)

    Brookins, Harvey D., Sr.

    This study investigated the impact that teacher-generated motivational strategies, student-generated motivational strategies, teacher-generated learning strategies and student-generated learning strategies, acting independently and in combinations, had on the retention rate of at-risk, male, high-school students exposed to a scientific curriculum. In addition to motivational and learning strategies, tests were performed to determine if differences in age, grade level, ability, learning technique, and question type may have caused any final scoring differences. The sample of 85 male students showed remarkable improvement from pre-test to retention tests on multiple-choice assessments. Of special importance was the performance of low achieving students who showed an ability to match the performances of higher achieving students on all aspects of the test. The most improvement resulted from the combination of student-generated motivational and learning strategies. This grouping outperformed all other combinations on the daily tests administered after each lesson. On a student questionnaire completed several days after the lesson sessions, students showed strong support for valuing the strategies, wanting other teachers to incorporate them into other classes, and committing to using them in the future. The students were particularly fond of pictures as a learning strategy but felt that teachers produced better motivational and learning strategies than students. This study supported the idea that motivational and learning strategies are important aspects of retention. This population of at-risk, male, students with a high potential for dropping out of school, it was pointed out, needs an emphasis placed on these strategies.

  7. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    , think-pair-share style clicker questions, and comparing excerpts from scientific articles and the media. Eventually, students discover that the Earths overall temperature is going up, but observations can vary from year to year because heat is moving between the atmosphere and the oceans.Press Conference: Fermis Vision, First Stars, Massive Galaxy Cluster, and Dark Energy (by Susanna Kohler)Todays afternoon press conference was an exciting assortment of results, difficult to categorize under a single umbrella.First up was Marco Ajello (Clemson University), who spoke about 2FHL, the second Fermi-LAT catalog of high-energy sources. LAT stands for Large Area Telescope, an instrument on board the Fermi gamma-ray space observatory that scans the entire sky every three hours. Ajello described the contents of the 2FHL catalog: 360 gamma-ray sources, of which 75% are blazars (distant galactic nuclei with jets pointed toward us), 11% are sources within the galaxy, and the remaining 14% are unknown. With this catalog, Fermi has expanded into higher energies than ever before, providing the first map of the 50 GeV 2 TeV sky. Heres the press release.OMeara: Im a lowly spectroscopist so I dont have fun pictures to show you, just squiggly lines. #aas227 astrobites (@astrobites) January 7, 2016Next to speak, John OMeara (St. Michaels College) told us about the discovery of a gas cloud that may be a remnant from the first population of stars. OMeara showed us the emission spectrum from a distant quasar, which displays abrupt absorption by a cloud of gas located at a redshift of z~3.5. Absorption by gas clouds is not unusual but what is unusual is that this cloud is extremely metal-poor, with only 1/2500th solar metallicity. This is the lowest heavy-element content ever measured, and a sign that the cloud might have been enriched by Population III stars the theoretical first population of stars, which were born when gas in the universe was still pristine. Heres the press release

  8. The effect of using an audience response system on learning, motivation and information retention in the orthodontic teaching of undergraduate dental students: a cross-over trial.

    Science.gov (United States)

    Dhaliwal, Harmeet Kaur; Allen, Mark; Kang, Jing; Bates, Claire; Hodge, Trevor

    2015-06-01

    New methods of teaching and learning are constantly being sought in the adult learning environment. Audience Response Systems (ARS) have been used in many different learning environments, especially in the field of medical education. The objective of this investigation was to ascertain the effect of ARS use in undergraduate teaching in a UK dental school. A cross-over clustered randomized educational trial. Leeds Dental Institute. Year 4 undergraduate dental students in orthodontics. Students at Leeds Dental Institute were taught two different topics within the curriculum to test the use of ARS in a cross-over trial. A questionnaire was delivered to the test (ARS) and control (non-ARS) groups. The response rate to the questionnaires was 89·5% (test group) and 82·9% (control group). The ARS enabled students to perform better as shown by knowledge retention (P = 0·013). Students found the seminar more interesting (P = 0·013), easier to concentrate (P = 0·025) and easier to participate in (P = 0·020) when ARS was used. When ARS was used, students were more able to answer questions (Pteaching and significantly improved knowledge retention. ARS may be useful in facilitating orthodontic teaching in the future.

  9. Immersive and interactive virtual reality to improve learning and retention of neuroanatomy in medical students: a randomized controlled study.

    Science.gov (United States)

    Ekstrand, Chelsea; Jamal, Ali; Nguyen, Ron; Kudryk, Annalise; Mann, Jennifer; Mendez, Ivar

    2018-02-23

    Spatial 3-dimensional understanding of the brain is essential to learning neuroanatomy, and 3-dimensional learning techniques have been proposed as tools to enhance neuroanatomy training. The aim of this study was to examine the impact of immersive virtual-reality neuroanatomy training and compare it to traditional paper-based methods. In this randomized controlled study, participants consisted of first- or second-year medical students from the University of Saskatchewan recruited via email and posters displayed throughout the medical school. Participants were randomly assigned to the virtual-reality group or the paper-based group and studied the spatial relations between neural structures for 12 minutes after performing a neuroanatomy baseline test, with both test and control questions. A postintervention test was administered immediately after the study period and 5-9 days later. Satisfaction measures were obtained. Of the 66 participants randomly assigned to the study groups, 64 were included in the final analysis, 31 in the virtual-reality group and 33 in the paper-based group. The 2 groups performed comparably on the baseline questions and showed significant performance improvement on the test questions following study. There were no significant differences between groups for the control questions, the postintervention test questions or the 7-day postintervention test questions. Satisfaction survey results indicated that neurophobia was decreased. Results from this study provide evidence that training in neuroanatomy in an immersive and interactive virtual-reality environment may be an effective neuroanatomy learning tool that warrants further study. They also suggest that integration of virtual-reality into neuroanatomy training may improve knowledge retention, increase study motivation and decrease neurophobia. Copyright 2018, Joule Inc. or its licensors.

  10. Geomagnetic aa Indices

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  11. Research Synopsis: Spring 1983 Retention.

    Science.gov (United States)

    Peralta Community Coll. District, Oakland, CA. Office of Research, Planning and Development.

    An analysis of spring 1983 retention rates and grade distributions within the Peralta Community College District (PCCD) revealed: (1) College of Alameda had the highest successful retention rate in the PCCD, defined as the total of all students who completed the term with a grade of A, B, C, D, or CR (credit); (2) the PCCD's successful retention…

  12. The St. Jude Cancer Education for Children Program Pilot Study: Determining the Knowledge Acquisition and Retention of 4th-Grade Students.

    Science.gov (United States)

    Ayers, Katherine; Villalobos, Aubrey Van Kirk; Li, Zhenghong; Krasin, Matthew

    2016-03-01

    In 2006, St. Jude Children's Research Hospital began developing a school-based outreach program known as the St. Jude Cancer Education for Children Program (SJCECP). The program aimed to teach children about cancer and healthy habits that can prevent the formation of cancers into adulthood. During the 2010-2011 academic years, we conducted a pilot evaluation of the SJCECP curriculum, with the primary objective of evaluating the impact of the intervention on knowledge acquisition and retention among 4th-grade students participating in the program. Seven local schools and 481 students from the Memphis area participated in the program evaluation. The results of this study show that 4th-grade students are able to acquire gains in knowledge related to cells, cancer, and healthy living after receiving the SJCECP intervention. We conclude that the program can be a useful tool for improving knowledge of cancer concepts at the 4th-grade level.

  13. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  14. Grade Retention and Unobserved Heterogeneity

    OpenAIRE

    Robert J. Gary-Bobo; Marion Gousse; Jean-Marc Robin

    2014-01-01

    We study the treatment effect of grade retention using a panel of French junior high-school students, taking unobserved heterogeneity and the endogeneity of grade repetitions into account. We specify a multistage model of human-capital accumulation with a finite number of types representing unobserved individual characteristics. Class-size and latent student-performance indices are assumed to follow finite mixtures of normal distributions. Grade retention may increase or decrea...

  15. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    and astronomy) who transitioned to being a freelance science writer. Wearing a distinctive bowler hat, Francis talked to a room full of students (and some non-students!) about what its like to be a science writer. Here are some highlights from among his recommendations and comments.A day in the life of a science writer.About the mechanics of freelancing:Some sample numbers: he wrote 73 articles in 2015, for 12 different publications. These vary in length and time invested. He supports himself fully by freelancing.The time between pitching a story and getting it published can vary between a few hours for online news stories to months for feature articles.The answer to the question, What do science writers do all day? (see photo)About transitioning into science writing:If youre interested in a science writing career, start blogging now to build up a portfolio.Use your training! As a researcher, you can read plots, understand scientific articles, and talk to scientists as colleagues. These are great strengths.About writing for the public:Theres a difference in writing for academics and the public: when writing for academics, youre trying to bring them up to your level. When writing for the public, thats probably not the goal.That said, on the subject of dumbing down: If you think your audience is somehow deficient, youve already failed.writing for the web: youll make fundamental spelling/grammar errors, youll find them only when you read the published post. Truth! #aas227 astrobites (@astrobites) January 8, 2016At the end of the session, Francis told us what he considers to be the best part of being a science writer: getting to tell people something that theyve never heard before. Getting it right is communicating a mundane fact to you that is an astounding surprise to your audience.Plenary Talk: News on the Search for Milky Way Satellite Galaxies (by Susanna Kohler)The second-to-last plenary talk of the meeting was given by Keith Bechtol, John Bahcall fellow at

  16. An Analysis of the Rise and Fall of the AA-MAS Policy

    Science.gov (United States)

    Lazarus, Sheryl S.; Thurlow, Martha L.; Ysseldyke, James E.; Edwards, Lynn M.

    2015-01-01

    In 2005, to address concerns about students who might fall in the "gap" between the regular assessment and the alternate assessment based on alternate achievement standards (AA-AAS), the U.S. Department of Education announced that states could develop alternate assessments based on modified achievement standards (AA-MAS). This article…

  17. Risk for Sleep Disorder Measured during Students' First College Semester May Predict Institutional Retention and Grade Point Average over a 3-Year Period, with Indirect Effects through Self-Efficacy

    Science.gov (United States)

    Gaultney, Jane F.

    2016-01-01

    The present study used a validated survey to assess freshmen college students' sleep patterns and risk for sleep disorders and then examined associations with retention and grade point average (GPA) over a 3-year period. Students at risk for a sleep disorder were more likely to leave the institution over the 3-year period, although this…

  18. Examining the Relations among Student Motivation, Engagement, and Retention in a MOOC: A Structural Equation Modeling Approach

    Science.gov (United States)

    Xiong, Yao; Li, Hongli; Kornhaber, Mindy L.; Suen, Hoi K.; Pursel, Barton; Goins, Deborah D.

    2015-01-01

    Students who are enrolled in MOOCs tend to have different motivational patterns than fee-paying college students. A majority of MOOC students demonstrate characteristics akin more to "tourists" than formal learners. As a consequence, MOOC students' completion rate is usually very low. The current study examines the relations among…

  19. Sense of Community in Student Retention at a Tertiary Technical Institution in Bogotá: An Ecological Approach

    Science.gov (United States)

    Mendoza, Pilar; Suarez, Juan Diego; Bustamante, Eileen

    2016-01-01

    Objective: This study probes the reasons for high attrition rates and sense of community among students enrolled at a technical institution serving low-income students in Bogotá, Colombia. Although sense of community on campus is the strongest predictor of a student's thriving, scholars in higher education have studied mainly minority students'…

  20. Assessing institutional support for Hispanic nursing student retention: a study to evaluate the psychometric properties of two self-assessment inventories.

    Science.gov (United States)

    Bond, Mary Lou; Cason, Carolyn L

    2014-01-01

    To assess the content validity and internal consistency reliability of the Healthcare Professions Education Program Self-Assessment (PSA) and the Institutional Self-Assessment for Factors Supporting Hispanic Student Retention (ISA). Health disparities among vulnerable populations are among the top priorities demanding attention in the United States. Efforts to recruit and retain Hispanic nursing students are essential. Based on a sample of provosts, deans/directors, and an author of the Model of Institutional Support, participants commented on the perceived validity and usefulness of each item of the PSA and ISA. Internal consistency reliability was calculated by Cronbach's alpha using responses from nursing schools in states with large Hispanic populations. The ISA and PSA were found to be reliable and valid tools for assessing institutional friendliness. The instruments highlight strengths and identify potential areas of improvement at institutional and program levels.

  1. A comparison of worked-examples and problem-based learning on the achievement and retention of middle school science student teams

    Science.gov (United States)

    Faulkner, David Russell

    This study compared the achievement and retention of scientific inquiry in teams of students either studying the solution to a problem (Worked-examples, or WEGs) or using a problem solving model (Problem-Based Learning, or PBL). Fifty-three students participated in the two-day study: 29 (9 teams) in the WEGs group and 24 (8 teams) in the PBL group. After teams were assigned by abilities (high, medium, and low), a series of pretests was given, and each team received a packet that included instructions to solve an aquarium problem. The WEGs packet contained the solution to the fishtank problem; the PBL packet did not. Posttests and a retention test were given at the end of the second day. A team problem-solving posttest was administered, and individuals and teams were interviewed. The results of the study were inconclusive, except that the PBL teams showed a higher ability to solve a near-transfer problem than did the WEGs group.

  2. Fred-Jaiyesimi, AA

    African Journals Online (AJOL)

    Fred-Jaiyesimi, AA. Vol 12 (2008) - Articles Hypoglycaemic And Alpha-Amylase Inhibitory Activities Of Fermented Seeds Of Parkia Biglobosa (Jacq) Benth Abstract. ISSN: 1118-6267. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  3. Evaluation of the impact of a diabetes education eLearning program for school personnel on diabetes knowledge, knowledge retention and confidence in caring for students with diabetes.

    Science.gov (United States)

    Taha, Nehad A; Rahme, Zahra; Mesbah, Naglaa; Mahmoud, Fatma; AlKandari, Sarah; Othman, Nashwa; Sharaikha, Hanan; Lari, Bashayer S; AlBeloushi, Shaima; Saad, Eglal; Arefanian, Hossein; Sukkar, Faten F

    2018-03-21

    To study the impact of a novel comprehensive eLearning approach in delivering diabetes related education program that includes knowledge and sets of practices to the school personnel in Kuwait to enable them to provide a supportive environment for students with diabetes. The program was designed with three components namely; knowledge, skills and recommendations. The diabetes knowledge was delivered through an interactive eLearning program, the effectiveness of which was assessed using diabetes knowledge questionnaires which were deployed pre- and post-course delivery. Additionally, the participants' knowledge retention and confidence in caring for a student with diabetes were evaluated at 6 or 12 months post-intervention. A total of 124 public schools' personnel participated in the program. Post e-Learning delivery, diabetes knowledge increased significantly from baseline (p < 0.0001) and knowledge was retained over 6 and 12 months. Average of overall confidence scores in caring for students with diabetes was 61.86% in all items of care. Offering eLearning diabetes education for school personnel increases their knowledge which can be retained for up to 12 months and imparts confidence in caring for students with diabetes. This novel approach of delivering diabetes education will help school personnel in managing students with diabetes. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. AL SAHLI, AA; OKOLI, JU

    African Journals Online (AJOL)

    ADOWIE PERE

    bioline.org.br/ja. The Use of Soil Palynomorphs in Forensics. *. 1. ABDULRAHAMAN, AA;. 2. AL SAHLI, AA;. 1. OKOLI, JU. 1Applied Plant Anatomy and Wood Technology Laboratory, Department of Plant Biology, University of Ilorin, Ilorin, Nigeria.

  5. Assessment of the Scientific Validity, Reliability and Normalization of APS, AAS and MAC-R Tests for Spotting Vulnerable Individuals Exposed to Drug Abuse Among the Male High School Students in the City of Tehran

    Directory of Open Access Journals (Sweden)

    Mahmoud Minooee

    2003-08-01

    2. Does the AAS scale aimed at identifying students that suffer from drug abuse enjoy reliability? and indirect observations. The statistical grouping of the research includes the admitted students and eventually 483 female and 53 male students in seven provinces constituted the statistical samples of the study. It was concluded that the separation plan is facing numerous problems at the current juncture. The relevant procedures and the manner of inter-organizational cooperation are not sufficient and the admission process has to undergo changes. Welfare facilities at the centers are not sufficient and keeping the students at the dorms for a long time will bring about many problems for them. Hence, the existence of a strong observation system as well as social workers are among the requisites for keeping up the implementation of the plan. Moreover, attention must be paid to other substitute methods so that the student would be able to study in his normal living environment and in this way reduce possible risks.

  6. The effects of student support services peer tutoring on learning and study strategies, grades, and retention at a rural community college

    Science.gov (United States)

    Mumford, Thomas J.

    The purpose of this study was to investigate the effects of Student Support Services peer tutoring on rural community college students' success in an Anatomy and Physiology class as measured changes in self-reported learning and study strategies, the final grade in Anatomy and Physiology class, and persistence/retention in the following semesters. A secondary goal was to assess the relative merits of two training methods: standard peer tutoring and standard peer tutoring plus introduction to attribution theory. This Anatomy and Physiology class typically has a failure rate of 50%. The federal government annually funds more than 700 Student Support Services (SSS) grants and 162 Health Career Opportunities Programs (HCOP). Nearly 94% of these SSS programs included a tutoring component, and 84% of these programs use peer tutoring. Peer tutors were randomly assigned to one of the treatment conditions and students were randomly assigned to one of the two treatment conditions. There were 31 students in the attribution condition and 28 students in the standard condition. Students were required to have a minimum of 10 hours of tutoring to be included in the analysis. Each tutored student was yoked to a control student who had not sought peer tutoring assistance. Participants were matched for age, marital status, number of adults in the family, number of children in the family and incoming academic skills (CPT Reading Test Results), financial status, and race. The results support peer tutoring as an effective method of increasing student success. The findings support the use of attribution training for tutors as a theoretical base of intervention. Students tutored by attribution trained tutors scored significantly higher on LASSI, had higher Anatomy and Physiology grades, and returned to college at a higher rate than their yoked controls. Standard trained tutors scored significantly higher on the LASSI Test Taking subscale and returned to college at a higher rate than their

  7. Profile in Action: Linking Admission and Retention

    Science.gov (United States)

    Cortes, Carla M.

    2013-01-01

    A profile-oriented retention strategy embraces the admission process as a powerful lever in improving retention and completion rates and recognizes that the student profile can be shaped by changes in admission policies or priorities--even within the current market position of the institution. In addition, the student body can be oriented toward…

  8. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  9. AA, bending magnet, BLG

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The very particular lattice of the AA required 2 types of dipole (bending magnets; BLG, long and narrow; BST, short and wide). The BLG had a steel length of 4.70 m, a good field width of 0.24 m, and a weight of about 70 t. Jean-Claude Brunet inspects the lower half of a BLG. For the BST magnets see 7811105 and 8006036.

  10. Exploring General Education Development Retention

    Science.gov (United States)

    Grover, Sharon D.

    2013-01-01

    According to the instructors and administrators at a local adult education (AE) program in Houston, Texas, retaining and graduating general education development (GED) students has been a constant challenge. Locating GED attendance barriers could enable AE programs to develop techniques that increase student retention and graduation rates. The…

  11. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  12. Fully Integrating Academic Advising with Career Coaching to Increase Student Retention, Graduation Rates and Future Job Satisfaction: An Industry Approach

    Science.gov (United States)

    Tudor, Thomas R.

    2018-01-01

    Higher education institutions in the United States are under increasing pressure to retain and graduate more students. Traditionally, the academic advisor helps students to meet degree graduation requirements and may also do some minor career advising. A new approach is proposed, in which career coaching with industry help becomes just as…

  13. Student Perceptions of the Impact of Participation in Community College Mental Health Counseling on Retention, Graduation, and Transfer

    Science.gov (United States)

    Quin, Matt Jordan

    2017-01-01

    This dissertation examined community college transfer students' perceptions of how mental health concerns interfere with academics, the ability to stay in school, graduate, and transfer to a 4-year university. The study also examined if community college transfer students perceive that mental health counseling improves their ability to stay in…

  14. Assessing the Link between Learning Assistance Programs and the Retention, Probation, and Grade Point Average of Freshman University Students

    Science.gov (United States)

    Ballmer, Noelle C.

    2017-01-01

    As the push towards lowering attrition of university students intensifies, particularly for first-time-in-college freshmen, administrators and campus leaders are increasingly designing and implementing co-curricular programs to support this population in order to positively impact student outcomes, namely, the grade point average, student…

  15. Leadership's Role in Recruitment and Retention of First Generation, Low-Income Latino Students into STEM Majors

    Science.gov (United States)

    Gonzalez, Eliseo A.

    Fostering resiliency and educational success in students that are faced with adversity is not a simple task. The gap in educational success and achievement among low-income, first generation, traditionally marginalized students continues to be significant. California's educational system needs to stop the hemorrhaging from its educational pipeline, also known as the P-20 pipeline, of all students, especially those groups of students with larger gaps in educational attainment. One potential path towards fixing California's educational pipeline for all students is to form and keep partnerships with programs such as Upward Bound, AVID, and Math Engineering Science Achievement (MESA). In 2010-11, the California Department of Education (CDE) reported that over 51% of students enrolled in California's school system and 51% of all California high school seniors were Latino were Latino. Of the 231,231 Latino high school seniors, 79%, graduated. However, of those that graduated, only 26%, met University of California/California State University (UC/CSU) college entrance requirements. Even though 79% of Latinos graduated, 74% did not qualify to apply to a UC or CSU. If the majority of Latino students continue to fall through holes in the educational pipeline, companies will continue to look abroad to fill STEM jobs that remain unfilled by American workers (California Department of Education [CDE], 2012). Alongside the U.S.'s current economic woes, the lack of college preparedness and knowledge by parents and students has led to a decrease in first generation, low-income Latino students' higher education enrollment (Camacho & Lord, 2011). With strong and positive leadership from family, supplemented by the MESA program, these youths can exert their resiliency, face adversity, and overcome extraordinary barriers. Leaders in education such as teachers, coordinators, advisers, administrators, and parents are in the best position to teach students about resilience (Ginsburg, 2007

  16. Helping struggling students in introductory biology: a peer-tutoring approach that improves performance, perception, and retention.

    Science.gov (United States)

    Batz, Zachary; Olsen, Brian J; Dumont, Jonathan; Dastoor, Farahad; Smith, Michelle K

    2015-01-01

    The high attrition rate among science, technology, engineering, and mathematics (STEM) majors has long been an area of concern for institutions and educational researchers. The transition from introductory to advanced courses has been identified as a particularly "leaky" point along the STEM pipeline, and students who struggle early in an introductory STEM course are predominantly at risk. Peer-tutoring programs offered to all students in a course have been widely found to help STEM students during this critical transition, but hiring a sufficient number of tutors may not be an option for some institutions. As an alternative, this study examines the viability of an optional peer-tutoring program offered to students who are struggling in a large-enrollment, introductory biology course. Struggling students who regularly attended peer tutoring increased exam performance, expert-like perceptions of biology, and course persistence relative to their struggling peers who were not attending the peer-tutoring sessions. The results of this study provide information to instructors who want to design targeted academic assistance for students who are struggling in introductory courses. © 2015 Z. Batz et al. CBE—Life Sciences Education © 2015 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  17. Institutionalization of a Retention Model

    Science.gov (United States)

    Davis, E. J.; Campbell, A.

    2006-05-01

    Bowie State University and NASA Goddard Space Flight Center have, for the past 10 years, worked diligently together to enhance the science, mathematics, engineering and technology (SMET) domain. Efforts made, because of a Model Institutions for Excellence (MIE) Award, have changed the landscape of the SMET domain by increasing the retention and graduation rates, the number of students entering graduate and professional schools, and the number of students entering SMET related careers for minorities and women. Several initiatives a Scholarship Program, PRISEM Tutoring Center, Safety-net Program, Research emphasis, Focused Mentoring, a Summer Academy for accepted incoming students, a Bridge Program for students needing assistance being admitted to the University, the RISE Program and the Bowie State Satellite Operations and Control Center (BSOCC) provide the nurturing, mentoring, and opportunities for our students. As a result of efforts made, the retention rate has increase to approximately 80%, the graduation rate has increased 40%, and 85% of the SMET students are now interested or entering graduate and professional schools. Successes that have been documented by various assessment activities have led to the institutionalization of the Retention Model of the MIE Initiative. It is anticipated that University-wide application of the retention model will prove the incentives necessary to obtain similar results as the MIE Initiative.

  18. Factors Influencing Student Performance on the Carpal Bone Test as a Preliminary Evaluation of Anatomical Knowledge Retention

    Science.gov (United States)

    Meyer, Amanda J.; Armson, Anthony; Losco, C. Dominique; Losco, Barrett; Walker, Bruce F.

    2015-01-01

    It has been demonstrated that a positive correlation exists between clinical knowledge and retained concepts in basic sciences. Studies have demonstrated a modest attrition of anatomy knowledge over time, which may be influenced by students' perceived importance of the basic sciences and the learning styles adopted. The aims of this study were to:…

  19. A Logistic Regression Analysis of Student Experience Factors for the Enhancement of Developmental Post-Secondary Retention Initiatives

    Science.gov (United States)

    Shenkle, Michael Thomas

    2017-01-01

    In response to stagnant undergraduate completion rates and growing demands for post-secondary accountability, institutions are actively pursuing effective, broadly applicable methods for promoting student success. One notable scarcity in existing research is found in the tailoring of broad academic interventions to better meet the specific needs…

  20. Anatomical Knowledge Retention in Third-Year Medical Students Prior to Obstetrics and Gynecology and Surgery Rotations

    Science.gov (United States)

    Jurjus, Rosalyn A.; Lee, Juliet; Ahle, Samantha; Brown, Kirsten M.; Butera, Gisela; Goldman, Ellen F.; Krapf, Jill M.

    2014-01-01

    Surgical anatomy is taught early in medical school training. The literature shows that many physicians, especially surgical specialists, think that anatomical knowledge of medical students is inadequate and nesting of anatomical sciences later in the clinical curriculum may be necessary. Quantitative data concerning this perception of an…

  1. Formative Self-Assessment College Classes Improves Self-Regulation and Retention in First/Second Year Community College Students

    Science.gov (United States)

    Mahlberg, Jamie

    2015-01-01

    This research examined the influence formative self-assessment had on first/second year community college student self-regulatory practices. Previous research has shown that the ability to regulate one's learning activities can improve performance in college classes, and it has long been known that the use of formative assessment improves…

  2. Collaborative-Group Testing Improves Learning and Knowledge Retention of Human Physiology Topics in Second-Year Medical Students

    Science.gov (United States)

    Vázquez-García, Mario

    2018-01-01

    The present study examined the relationship between second-year medical students' group performance and individual performance in a collaborative-learning environment. In recent decades, university professors in the scientific and humanistic disciplines have successfully put into practice different modalities of collaborative approaches to…

  3. Evaluation of Retention of Knowledge and Skills Imparted to First-Year Medical Students through Basic Life Support Training

    Science.gov (United States)

    Pande, Sushma; Pande, Santosh; Parate, Vrushali; Pande, Sanket; Sukhsohale, Neelam

    2014-01-01

    Poor awareness among medical graduates about basic life support (BLS) is a matter of great concern. The presence of a trained rescuer is the key determinant of ultimate survival from life-threatening emergencies. To achieve this goal, early exposure to such life-saving skills is the right decision to foster these skills for medical students, which…

  4. Topical versus Chronological Organization of Lifespan Development: Does It Make a Difference in Student Retention and Understanding?

    Science.gov (United States)

    Spangler, Brooke R.; Kiel, Elizabeth J.

    2015-01-01

    This study aimed to determine whether taking a chronological approach (CA) or topical approach (TA) to teaching developmental psychology resulted in different learning outcomes. Across two semesters, in four classes, 354 students participated (M[subscript age] = 19.76, SD[subscript age] = 2.93 years), 66% identifying as female. One instructor…

  5. Effects of an SWH Approach and Self-Evaluation on Sixth Grade Students' Learning and Retention of an Electricity Unit

    Science.gov (United States)

    Memis, Esra Kabatas; Seven, Sabriye

    2015-01-01

    The purpose of this study is to explore the effects of guided, inquiry-based laboratory activities using the Science Writing Heuristic (SWH) approach and self-evaluation on students' science achievement. The study involved three sixth grade classes studying an electricity unit taught by the same primary school teacher. Before the study began, one…

  6. Helping Struggling Students in Introductory Biology: A Peer-Tutoring Approach That Improves Performance, Perception, and Retention

    Science.gov (United States)

    Batz, Zachary; Olsen, Brian J.; Dumont, Jonathan; Dastoor, Farahad; Smith, Michelle K.

    2015-01-01

    The high attrition rate among science, technology, engineering, and mathematics (STEM) majors has long been an area of concern for institutions and educational researchers. The transition from introductory to advanced courses has been identified as a particularly "leaky" point along the STEM pipeline, and students who struggle early in…

  7. A Funny Thing Happened on the Way to the Hippocampus: The Effects of Humor on Student Achievement and Memory Retention

    Science.gov (United States)

    McCartney Matthews, Melissa Lee

    2011-01-01

    Research literature relating to the use of humor as a teaching method or curricula specifically designed to include humor was reviewed to investigate the effects of humor on student learning in various environments from elementary schools to post-secondary classrooms. In this multi-method study, four instruments and a humor treatment were selected…

  8. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  9. A Randomized Comparative Trial of the Knowledge Retention and Usage Conditions in Undergraduate Medical Students Using Podcasts and Blog Posts.

    Science.gov (United States)

    Lien, Kelly; Chin, Alvin; Helman, Anton; Chan, Teresa M

    2018-01-15

    Introduction Podcasts and blog posts have gained popularity in Free Open Access Medical education (FOAM). Previous work suggests that podcasts may be useful for knowledge acquisition in undergraduate medical education. However, there remains a paucity of research comparing the two mediums. This study aims to investigate if there are differences in knowledge acquisition and usage conditions by medical students using podcasts and blog posts. Methods Medical students were randomized to either the podcast or blog post group. They completed an initial online assessment of their baseline knowledge on the subject matter. Participants then received access to learning materials and were given four weeks to complete the follow-up assessment on their own time. Independent t-test, paired samples t-test, and a mixed ANOVA (analysis of variance) were conducted to assess knowledge acquisition. An intention-to-teach analysis was used to impute missing data from students lost to follow-up. Simple descriptive statistical data was used to describe media usage conditions. Results Completion of at least one follow-up assessment was comparable (68% podcasts (n = 21/31), 73% blog posts (n = 22/30)). Both groups showed significant improvements in their test scores, with an average 22% improvement for the podcast group and 29% for the blog post group. There was no significant statistical difference in knowledge acquisition between educational modalities overall. Students in the blog post group that completed both post-intervention quizzes showed a larger improvement than the podcast group in the toxicology topic, with similar improvements in the asthma topic. The podcast group tended to engage in multiple activities while using the learning materials (e.g. at least two to three of the following: driving, eating, chores, taking notes, exercising/walking), while the blog readers tended to do fewer activities (e.g. only one of the following: note taking, eating). Conclusion This study

  10. States' Participation Guidelines for Alternate Assessments Based on Modified Academic Achievement Standards (AA-MAS) in 2010. Synthesis Report 82

    Science.gov (United States)

    Lazarus, Sheryl S.; Hodgson, Jennifer R.; Price, Lynn M.; Thurlow, Martha L.

    2011-01-01

    Federal legislation requires that all students participate in state accountability systems. Most students with disabilities participate in the regular assessment, with or without accommodations. Students with more significant cognitive disabilities participate in the Alternate Assessment based on Alternate Achievement Standards (AA-AAS). A few…

  11. Managing retention.

    Science.gov (United States)

    Carter, Tony

    2007-01-01

    To build this process it is necessary to consult customers for preferences, build familiarity and knowledge to build a relationship and conduct business in a customized fashion. The process takes every opportunity to build customer satisfaction with each customer contact. It is an important process to have, since customers today are more demanding, sophisticated, educated and comfortable speaking to the company as an equal (Belk, 2003). Customers have more customized expectations so they want to be reached as individuals (Raymond and Tanner, 1994). Also, a disproportionate search for new business is costly. The cost to cultivate new customers is more than maintaining existing customers (Cathcart, 1990). Other reasons that customer retention is necessary is because many unhappy customers will never buy again from a company that dissatisfied them and they will communicate their displeasure to other people. These dissatisfied customers may not even convey their displeasure but without saying anything just stop doing business with that company, which may keep them unaware for some time that there is any problem (Cathcart, 1990).

  12. A Comparative Trend Analysis of Institutional Variables and Retention Rates in Publicly Funded Institutions

    Science.gov (United States)

    Lenhardt, Jenna L.

    2017-01-01

    This study focused on student retention trends in institutional spending and student retention rates. The research also investigated the relationship between student retention and the student-to-faculty ratio. The sample was comprised of 14 publicly funded higher education institutions that had an M1Carnegie classification and were located in one…

  13. Beyond Academic and Social Integration: Understanding the Impact of a STEM Enrichment Program on the Retention and Degree Attainment of Underrepresented Students.

    Science.gov (United States)

    Lane, Tonisha B

    2016-01-01

    The current study used a case study methodological approach, including document analysis, semistructured interviews, and participant observations, to investigate how a science, technology, engineering, and mathematics (STEM) enrichment program supported retention and degree attainment of underrepresented students at a large, public, predominantly white institution. From this study, a model emerged that encompassed four components: proactive care, holistic support, community building, and catalysts for STEM identity development. These components encompassed a number of strategies and practices that were instrumental in the outcomes of program participants. This paper concludes with implications for practice, such as using models to inform program planning, assessment, and evaluation. © 2016 T. B. Lane. CBE—Life Sciences Education © 2016 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  14. The Drentsche Aa valley system

    International Nuclear Information System (INIS)

    Gans, W. de.

    1981-01-01

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  15. Effect of using an audience response system on learning environment, motivation and long-term retention, during case-discussions in a large group of undergraduate veterinary clinical pharmacology students.

    Science.gov (United States)

    Doucet, Michèle; Vrins, André; Harvey, Denis

    2009-12-01

    Teaching methods that provide an opportunity for individual engagement and focussed feedback are required to create an active learning environment for case-based teaching in large groups. A prospective observational controlled study was conducted to evaluate whether the use of an audience response system (ARS) would promote an active learning environment during case-based discussions in large groups, have an impact on student motivation and improve long-term retention. Group A (N = 83) participated in large group case discussions where student participation was voluntary, while for group B (N = 86) an ARS was used. Data collection methods included student and teacher surveys, student focus group interviews, independent observations and 1-year post-course testing. Results indicated that the use of an ARS provided an active learning environment during case-based discussions in large groups by favouring engagement, observation and critical reflection and by increasing student and teacher motivation. Although final exam results were significantly improved in group B, long-term retention was not significantly different between groups. It was concluded that ARS use significantly improved the learning experience associated with case-based discussions in a large group of undergraduate students.

  16. Utah Valley University Field Station at Capitol Reef National Park: A Venue for Improved Student Learning and Retention

    Science.gov (United States)

    Nielsen, K.; Schultz, M.; Williams, B.; Gay, J.; Johnson, S.; Dunn, P.

    2015-12-01

    The unique geo-environment offered in Capitol Reef National Park and its surrounding areas has a long-standing history of inspiring geological scientific exploration. The Capitol Reef Field Station was established in 2008 as part of collaboration between the National Park and Utah Valley University in order to support teaching and research of the natural environment found within the park and on the Colorado Plateau. The facility itself situated deep within the park, well off any public road system offers state of the art alternative energy and sustainable construction and makes extensive use of passive heating and cooling, in order to maintain its status of being "off-grid." The field station is a 6200 square foot complex of classrooms and dormitories supporting university level education and field studies of the Colorado Plateau. The complex includes a classroom and dining area, professional kitchen, and two separate dormitories, which can sleep up to 24 overnight visitors, while the daytime usage can accommodate up to 40 visitors. The vision of the facility is to support teaching and research toward responsible, respectful, and sustainable stewardship of the natural world - including Interdisciplinary learning between arts and sciences Student internships and service learning in collaboration with the National Park Service Field-based scientific research (as well as inventorying and assessing Park ecosystems changes) Field training in scientific research Collaboration between National Park Service scientists and local, regional, and national institutions The park is situated at 38°N 249°E at elevations greater than 2000 m in Southern Utah. In contrast to the more famous neighboring sister parks such as Zion and Bryce Canyon National Parks, which are in relatively close proximity to large road systems and cities, Capitol Reef offers what is believed to be the darkest night sky in the US. The culmination of features creates an ideal location for studies of the

  17. Fuel nozzle tube retention

    Energy Technology Data Exchange (ETDEWEB)

    Cihlar, David William; Melton, Patrick Benedict

    2017-02-28

    A system for retaining a fuel nozzle premix tube includes a retention plate and a premix tube which extends downstream from an outlet of a premix passage defined along an aft side of a fuel plenum body. The premix tube includes an inlet end and a spring support feature which is disposed proximate to the inlet end. The premix tube extends through the retention plate. The spring retention feature is disposed between an aft side of the fuel plenum and the retention plate. The system further includes a spring which extends between the spring retention feature and the retention plate.

  18. Retention of Content Utilizing a Flipped Classroom Approach.

    Science.gov (United States)

    Shatto, Bobbi; LʼEcuyer, Kristine; Quinn, Jerod

    The flipped classroom experience promotes retention and accountability for learning. The authors report their evaluation of a flipped classroom for accelerated second-degree nursing students during their primary medical-surgical nursing course. Standardized HESI® scores were compared between a group of students who experienced the flipped classroom and a previous group who had traditional teaching methods. Short- and long-term retention was measured using standardized exams 3 months and 12 months following the course. Results indicated that short-term retention was greater and long- term retention was significantly great in the students who were taught using flipped classroom methodology.

  19. AAS 228: Day 1 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  20. Retention Initiatives Used by Professional Bachelor's Athletic Training Program Directors

    Science.gov (United States)

    Bowman, Thomas G.; Mazerolle, Stephanie M.; Dodge, Thomas M.

    2016-01-01

    Context: Retaining athletic training students has been identified as problematic by approximately half of athletic training program (ATP) directors. It is unknown what ATP directors do to improve athletic training student retention. Objective: To identify initiatives that ATP directors use to improve the retention rates of athletic training…

  1. LAS HABILIDADES SOCIALES EN UNIVERSITARIOS, ADOLESCENTES Y ALCOHÓLICOS EN RECUPERACIÓN DE UN GRUPO DE ALCOHÓLICOS ANÓNIMOS (AA)/ SOCIAL ABILITIES IN ADOLESCENTS, UNIVERSITY STUDENTS AND ALCOHOLICS IN RECOVERY IN A GROUP OF ALCOHOLICS ANONYMOUS (AA)

    OpenAIRE

    Carlos Nava Quiroz***; Cynthia Zaira Vega Valero**; Sandra A. Anguiano Serrano*; Rocío Soria Trujano****

    2010-01-01

    RESUMENEntre los factores de riesgo de inicio al consumo de alcohol se encuentra el déficit en habilidades sociales, que aunqueno es determinante, sí es un factor que de alguna manera influye en la conducta de beber en exceso. En la presenteinvestigación se realizó un análisis de habilidades sociales en tres muestras distintas: universitarios, adolescentes y alcohólicosen recuperación (AA). Se utilizaron los siguientes instrumentos: Escala Multidimensional de Expresión Social – ParteMotora (E...

  2. Retention of selected core materials to zirconia posts.

    Science.gov (United States)

    Edelhoff, D; Sorensen, J A

    2002-01-01

    Due to their favorable optical and mechanical properties, endodontic posts made of partially stabilized zirconia ceramic (ZrO2-Y2O3) are a promising alternative to those made of metal. Zirconia posts can be combined with various tooth-colored core materials to increase the optical properties of a final esthetic restoration. For stability, a reliable bond between core material and the post should be generated. This in vitro study evaluated the retention of selected core materials to zirconia posts dependent on different surface treatments and bonding procedures. Two types of zirconia posts (CeraPost [CEP], Lemgo, Germany) and CosmoPost [COP], Ivoclar Vivadent, Amherst NY 14228, USA) were employed for the study. Ring-shaped cores were fabricated of either heat-pressed, zirconia-containing glass ceramic (IPS Empress Cosmo [EMC], Ivoclar Vivadent), highly-filled hybrid composite (Tetric Ceram [TEC], Ivoclar Vivadent) or an experimental, high-strength glass ceramic (OHSU-RWTH [EX], Ivoclar Vivadent). The core made of material EX was either directly heat pressed (EXP) or adhesively bonded (EXB) onto the post using a flowable composite. Prior to core application, the post surfaces were preconditioned by alumina abrasion (AA) or tribochemical silicoating and silanation (TCS). Specimens (10 per group) were stored in artificial saliva (pH 5.2) for 150 days. Storage time included 5,000 thermocycles (5/55 degrees C per 30 seconds). Defect analysis was conducted visually using a light microscope and a fiber optic transillumination prior to the testing procedure. The loads required to separate post and core were determined by a push-out test. Following testing, the surfaces of the posts and core materials were evaluated in a scanning electron microscope (SEM). There were no statistically significant differences between the separation loads of groups COP/AA/EMC, COP/TCS/TEC, CEP/AA/EMC and COP/AA/EXB. Group COP/AA/EXP showed significantly higher retention, but also the highest

  3. A.A., constructivism, and reflecting teams.

    Science.gov (United States)

    Nevels, B

    1997-12-01

    Numerous studies and clinical anecdotes reveal a relationship between attendance at A.A. meetings and/or degree of involvement in A.A. and maintenance of sobriety. Hypotheses as to how A.A. and/or the A.A. meeting is helpful to its members have ranged from a focus on factors common to all therapy groups, to aspects of A.A. "treatment" which are behavioral in nature. Presented here is another way of understanding A.A.'s effectiveness within the frame of more recent, constructivistic approaches to family therapy. In particular, the A.A. topic meeting is compared to the reflecting team concept of Tom Anderson.

  4. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  5. Football and Freshmen Retention: Examining the Impact of College Football on Institutional Retention Rates

    Science.gov (United States)

    Jones, Willis A.

    2010-01-01

    Student retention has been one of the more researched topics in the study of American higher education over the past 20 years (Braxton, Hirschy, & McClendon, 2004; Pascarella & Terenzini, 2005). Very little of this research, however, has attempted to examine the impact of college athletics on an institution's ability to retain students.…

  6. Laboratory Astrophysics Division of the AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  7. Laboratory Astrophysics Division of The AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-10-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  8. Effect of vitamin C on copper retention in young men

    International Nuclear Information System (INIS)

    Jacob, R.A.; Omaye, S.T.; Skala, J.H.; Taylor, P.C.; Turnlund, J.R.

    1986-01-01

    Previous work suggests that supplemental ascorbic acid (AA) may inhibit intestinal copper absorption by stabilizing the less absorbable cuprous state. The authors studied copper absorption in healthy men (age 19-32) fed a constant diet with different amounts of ascorbic acid supplements. The 6 men were confined to a metabolic unit for the entire 14 week study. The basal diet consisted of a 7 day rotating menu which provided an average of 2.1 mg Cu/d and was adequate in all other nutrients except AA (5 mg/d). The basal diet was supplemented with either zero, 60, or 600 mg of AA daily, added to grape juice and consumed at each meal. All feces were collected. Blood was taken weekly for monitoring AA and copper status. Copper absorption was determined by both balance and 65 Cu stable isotope techniques. As determined by fecal Cu excretion, varying intakes of AA between 0.1 to 10 times the RDA had no significant effect on copper retention. This is consistent with the lack of change in serum ceruloplasmin and serum Cu throughout the study

  9. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  10. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  11. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  12. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  13. A Status Report on the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Fienberg, Richard Tresch; Fraknoi, Andrew; Gurton, Suzanne; Hurst, Anna; Schatz, Dennis L.

    2014-06-01

    The American Astronomical Society, in partnership with the Astronomical Society of the Pacific (ASP), has launched a series of professional-development workshops and a community of practice designed to improve early-career astronomers’ ability to communicate effectively with students and the public. Called AAS Astronomy Ambassadors, the program provides training and mentoring for young astronomers, from advanced undergraduates to beginning faculty; it also provides them access to resources and a network of contacts within the astronomy education and public outreach (EPO) community. Ambassadors are provided with a library of outreach activities and resource materials suitable for a range of venues and audiences. For much of this library we are using resources developed by organizations such as the ASP, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. After a period of evaluation and revision, the program’s “Menu of Outreach Opportunities for Science Education” (MOOSE) is now posted on the AAS website at http://aas.org/outreach/moose-menu-outreach-opportunities-science-education.The first two Astronomy Ambassadors workshops were held at AAS meetings in January 2013 and January 2014; each served 30 young astronomers chosen from about twice that many applicants. Web-based follow-up activities are being provided through a website at the ASP designed to keep cohorts of educators trained in their programs in touch with one another. The AAS is exploring ways to fund additional workshops at future winter meetings; suggestions are most welcome. Meanwhile, the Astronomy Ambassadors trained to date have logged more than 150 outreach events, reaching many thousands of children and adults across the U.S. and Canada.

  14. Point of View: Academic Librarians as STEM Retention Partners

    Science.gov (United States)

    O'Toole, Erin M.

    2017-01-01

    When thinking of collaborating with campus partners on activities to increase the retention of students in science majors, who comes to mind? Usually other academic departments--but are science librarians included? Academic librarians are charged with supporting retention on university and college campuses. However, what exactly can science…

  15. Background or Experience? Using Logistic Regression to Predict College Retention

    Science.gov (United States)

    Synco, Tracee M.

    2012-01-01

    Tinto, Astin and countless others have researched the retention and attrition of students from college for more than thirty years. However, the six year graduation rate for all first-time full-time freshmen for the 2002 cohort was 57%. This study sought to determine the retention variables that predicted continued enrollment of entering freshmen…

  16. Testing to Enhance Retention in Human Anatomy

    Science.gov (United States)

    Logan, Jessica M.; Thompson, Andrew J.; Marshak, David W.

    2011-01-01

    Recent work in cognitive psychology has shown that repeatedly testing one's knowledge is a powerful learning aid and provides substantial benefits for retention of the material. To apply this in a human anatomy course for medical students, 39 fill-in-the-blank quizzes of about 50 questions each, one for each region of the body, and four about the…

  17. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  18. Urinary retention in women.

    Science.gov (United States)

    Juma, Saad

    2014-07-01

    This review is a summary of the most pertinent published studies in the literature in the last 18 months that address cause, diagnosis, and management of urinary retention in women. Symptoms, uroflow, and pressure-flow studies have a low predictive value for and do not correlate with elevated postvoid residual urine (PVR). Anterior and posterior colporrhaphy do not cause de-novo bladder outlet obstruction in the majority of patients with elevated PVR, and the cause of elevated PVR may be other factors such as pain or anxiety causing abnormal relaxation of the pelvic floor and contributing to voiding difficulty. The risk of urinary retention in a future pregnancy after mid-urethral sling (MUS) is small. The risk of urinary tract infection and urinary retention after chemodenervation of the bladder with onabotulinumtoxin-A (100 IU) in patients with non-neurogenic urge incontinence is 33 and 5%, respectively. There is a lack of consensus among experts on the timing of sling takedown in the management of acute urinary retention following MUS procedures. There has been a significant progress in the understanding of the causation of urinary retention. Important areas that need further research (basic and clinical) are post-MUS and pelvic organ prolapse repair urinary retention and obstruction, and urinary retention owing to detrusor underactivity.

  19. Preparation and Characteristics of Corn Straw-Co-AMPS-Co-AA Superabsorbent Hydrogel

    Directory of Open Access Journals (Sweden)

    Wei-Min Cheng

    2015-11-01

    Full Text Available In this study, the corn straw after removing the lignin was grafted with 2-acrylamido-2-methylpropanesulfonic acid (AMPS to prepare sulfonated cellulose. The grafting copolymerization between the sulfonated cellulose and acrylic acid (AA was performed using potassium persulfate and N,N′-methylenebisacrylamide as the initiator and crosslinking agent, respectively, to prepare corn straw-co-AMPS-co-AA hydrogels. The structure and properties of the resulting hydrogels were characterized by Fourier transform infrared spectroscopy, X-ray diffraction, scanning electron microscopy, thermogravimetric analysis, and dynamic rheometry. The effects of initiator, crosslinker, monomer neutralization degree, and temperature on the swelling ratio of the hydrogels were studied. The water retention, salt resistance, and recyclability of the corn straw-co-AMPS-co-AA hydrogels were also investigated. The optimum water absorptivity of the corn straw hydrogels was obtained at a polymerization temperature of 50 °C with 1.2% crosslinker, 1:7 ratio of the pretreated corn straw and AA, 2% initiator, and 50% neutralized AA.

  20. Undergraduate Student Retention in Context: An Examination of First-Year Risk Prediction and Advising Practices within a College of Education

    Science.gov (United States)

    Litchfield, Bradley C.

    2013-01-01

    This study examined the use of an institutionally-specific risk prediction model in the university's College of Education. Set in a large, urban, public university, the risk model predicted incoming students' first-semester GPAs, which, in turn, predicted the students' risk of attrition. Additionally, the study investigated advising practices…

  1. 76 FR 33121 - Record Retention for Regulated Entities and Office of Finance

    Science.gov (United States)

    2011-06-08

    ... outside sources by a regulated entity or the Office of Finance, related to the conduct of the business of... FEDERAL HOUSING FINANCE BOARD 12 CFR Part 914 FEDERAL HOUSING FINANCE AGENCY 12 CFR Part 1235... RIN 2590-AA10 Record Retention for Regulated Entities and Office of Finance AGENCY: Federal Housing...

  2. Marketing and Retention Strategies for Adult Degree Programs

    Science.gov (United States)

    Brown, Joann A.

    2004-01-01

    Four marketing strategies are critical to the success of adult degree programs: integrating marketing, knowing your students (research), shaping programs and services for adults, and staying the course (retention).

  3. [Chronic monstrous urine retention].

    Science.gov (United States)

    Thomsen, Frederik Gustav; Holm, Mette Lind

    2015-01-26

    A 75-year-old male was diagnosed with renal mass at a computed tomography during an examination for extended abdominal girth. A large mesenterical cyst was also detected. The patient had infrequent voiding, which he had trained over many years as a taxi driver. A basic physical examination led to suspect urinary retention. His creatinine level was normal and he had no hydronephrosis. A renography showed equal function, but prolonged bilateral outflow. The volume extracted by urethral catheter passed 15 l. Absence of hydronephrosis and normal S-creatinine level has not been described in chronic urinary retention of this extent. Hydronephrosis is seen, but in much smaller volume of retention. Infrequent voiding is easily diagnosed. Urinary retention should be suspected when finding median cystic processes.

  4. Liquid Effluent Retention Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Liquid Effluent Retention Facility (LERF) is located in the central part of the Hanford Site. LERF is permitted by the State of Washington and has three liquid...

  5. Drug Retention Times

    Energy Technology Data Exchange (ETDEWEB)

    Center for Human Reliability Studies

    2007-05-01

    The purpose of this monograph is to provide information on drug retention times in the human body. The information provided is based on plausible illegal drug use activities that might be engaged in by a recreational drug user.

  6. "Read the Text, as if!"The Reading Retention Strategy

    Science.gov (United States)

    Divoll, Kent; Browning, Sandra

    2013-01-01

    Students do not always read what is expected in college courses (Berry, Cook, Hill, & Stevens, 2010; Phillips & Phillips, 2007; Sikorski et al., 2002) or they read to cram for an exam or quiz (Clump, Bauer, & Bradley, 2004). The Reading Retention Strategy (RRS) is designed to motivate students to read and assist students in…

  7. Applying Cognitive Science Principles to Improve Retention of Science Vocabulary

    Science.gov (United States)

    Shore, Rebecca; Ray, Jenna; Gooklasian, Paula

    2015-01-01

    We investigated whether three student-centred strategies influenced retention of science vocabulary words among 7th grade students. Two of the strategies (drawing pictures and talking about the definition of the terms) were developed to involve the students in more constructive and interactive exercises when compared to the technique that was in…

  8. First-Year Course Requirements and Retention for Community Colleges

    Science.gov (United States)

    Mayo, Teresa

    2013-01-01

    Community colleges educate a diverse group of students. Effective first-year programs should focus on a variety of interventions that improve learning and retention. Students have academic, intellectual, and social challenges during their community college experience. First-year orientation programs should help students adapt. This article…

  9. Learning and retention of quantum concepts with different teaching methods

    Science.gov (United States)

    Deslauriers, Louis; Wieman, Carl

    2011-06-01

    We measured mastery and retention of conceptual understanding of quantum mechanics in a modern physics course. This was studied for two equivalent cohorts of students taught with different pedagogical approaches using the Quantum Mechanics Conceptual Survey. We measured the impact of pedagogical approach both on the original conceptual learning and on long-term retention. The cohort of students who had a very highly rated traditional lecturer scored 19% lower than the equivalent cohort that was taught using interactive engagement methods. However, the amount of retention was very high for both cohorts, showing only a few percent decrease in scores when retested 6 and 18 months after completion of the course and with no exposure to the material in the interim period. This high level of retention is in striking contrast to the retention measured for more factual learning from university courses and argues for the value of emphasizing conceptual learning.

  10. (PCL/AA) hydrogel for controlled drug delivery

    Indian Academy of Sciences (India)

    Administrator

    PCL-g-AA) on the .... Solvent replacement method was used for porosity meas- urement. Weighed dried discs were immersed in .... Regression coefficient (r) values obtained from PCL/AA hydrogels at varying contents of AA and EGDMA are.

  11. Effect of Learning Think-Pair-Share Think through the combined pattern Empowerment Question on Metacognitive Skills, Creative Thinking, Understanding Concepts IPA and retention as well as Social Attitudes Students

    Directory of Open Access Journals (Sweden)

    Maryanti Ekoningtyas

    2014-06-01

    Full Text Available Pengaruh Pembelajaran Think-Pair-Share dipadu Pola Pemberdayaan Berpikir melalui Pertanyaan terhadap Keterampilan Metakognitif, Berpikir Kreatif, Pemahaman Konsep IPA dan Retensinya serta Sikap Sosial Siswa Abstract: cooperative learning is a teaching strategy to raise awareness of student thinking, solve problems together by integrating and applying skills and knowledge, empowering metacognitive learning development, a means to teach social skills students need to live and work together. This study aims to determine the effect pattern combined PBMP TPS learning strategy against metacognitive skills, creative thinking skills, understanding of concepts, understanding of the concept of retention, and social attitudes of students. This study used a quasi-experimental approach (quasi experimental to design non-equivalent pretest-posttest control group design. Analysis of data normality test and homogeneity test, and analysis of covariance (ANCOVA. The study population is class VIII SMPN 1 Pasuruan learning year 2012/2013. Samples were selected at random to determine the experimental class and control class. Results of the study are: (1 no influence on the strategy of metacognitive skills, creative thinking skills, understanding of concepts, and social attitudes among the students who were given a learning strategy with the given TPS PBMP multistrategi learning, (2 there is an influence on the retention of understanding of the concept among students TPS given PBMP learning strategy with a given learning multistrategi. The increase occurred in the class and the class multistrategi PBMP TPS. Key Words: TPS, PBMP, metacognitive skills, creative thinking, understanding of concepts, understanding of the concept of retention, social attitudes Abstrak: Strategi pembelajaran kooperatif merupakan pembelajaran untuk menumbuhkan kesadaran berpikir siswa, menyelesaikan masalah secara bersama dengan mengintegrasikan serta mengaplikasikan kemampuan dan pengetahuan

  12. Development and Implementation of Targeted STEM Retention Strategies at a Hispanic-Serving Institution

    Science.gov (United States)

    Carpi, Anthony; Ronan, Darcy M.; Falconer, Heather M.; Boyd, Heather H.; Lents, Nathan H.

    2013-01-01

    Retention rates of undergraduates at large urban universities serving minority populations have been problematic, especially among students in science and technology fields. John Jay College of Criminal Justice has designed a cohesive collegiate retention program according to the Tinto model of retention. This article details the strategies…

  13. The Effect of Supplemental Instruction on Retention: A Bivariate Probit Model

    Science.gov (United States)

    Bowles, Tyler J.; Jones, Jason

    2004-01-01

    Single equation regression models have been used to test the effect of Supplemental Instruction (SI) on student retention. These models, however, fail to account for the two salient features of SI attendance and retention: (1) both SI attendance and retention are categorical variables, and (2) are jointly determined endogenous variables. Adopting…

  14. Mentors for Undergraduates in Technical Disciplines: A Collaborative Effort by Faculty, Student Development Professionals, and Alumni To Improve Undergraduate Retention and Success in Technical Majors.

    Science.gov (United States)

    Newton, Elizabeth; Wells-Glover, Linda

    1999-01-01

    Describes a program at Fontbonne College (Missouri) by the Department of Mathematics and Computer Science and Office of Multicultural Affairs that identified eight high-risk, first- and second-year students and matched them with four alumni mentors as part of a one-credit career management course. Evaluation showed improved academic performance…

  15. Use of Case-Based or Hands-On Laboratory Exercises with Physiology Lectures Improves Knowledge Retention, but Veterinary Medicine Students Prefer Case-Based Activities

    Science.gov (United States)

    McFee, Renee M.; Cupp, Andrea S.; Wood, Jennifer R.

    2018-01-01

    Didactic lectures are prevalent in physiology courses within veterinary medicine programs, but more active learning methods have also been utilized. Our goal was to identify the most appropriate learning method to augment the lecture component of our physiology course. We hypothesized that case-based learning would be well received by students and…

  16. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  17. AAS 228: Day 3 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  18. Reframing Retention: New Evidence from within the Elementary School Classroom on Post-Retention Performance

    Science.gov (United States)

    Gottfried, Michael A.

    2012-01-01

    This study contributes a novel perspective on grade retention by empirically examining how classroom composition relates to the standardized-testing performance of grade-retained students in their post-retained years. This evaluation employed a sample of entire cohorts of urban elementary school children in the Philadelphia School District over 6…

  19. Magnetic horn of the Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  20. Data on Retention

    NARCIS (Netherlands)

    van Wanrooij, Ward; Pras, Aiko; Schönwälder, Jürgen; Serrat, Joan

    2005-01-01

    Proposed EU regulations on data retention could require every provider to keep accounting logs of its customers Internet usage. Although the technical consequences of these requirements have been investigated by consultancy companies, this paper investigates what this accounting data could be, how

  1. Tritium retention in TFTR

    Energy Technology Data Exchange (ETDEWEB)

    Dylla, H.F.; Wilson, K.L. (eds.)

    1988-04-01

    This report discusses the materials physics related to D-T operation in TFTR. Research activities are described pertaining to basic studies of hydrogenic retention in graphite, hydrogen recycling phenomena, first-wall and limiter conditioning, surface analysis of TFTR first-wall components, and estimates of the tritium inventory.

  2. Information Technology Strategies for Honor Society and Organization Membership Retention in Online Nursing Programs.

    Science.gov (United States)

    Hopkins, Emily E; Wasco, Jennifer J

    Membership retention in an honor society or organization is of utmost importance for sustainability. However, retaining members in organizations that serve online education nursing students can be a challenging task. Understanding the importance of creating a sense of community to promote retention within an honor society chapter, nursing faculty at a small private university implemented different online approaches. This article highlights successful information technology strategies to promote membership retention in organizations for online nursing students.

  3. phosphorus retention data and metadata

    Data.gov (United States)

    U.S. Environmental Protection Agency — phosphorus retention in wetlands data and metadata. This dataset is associated with the following publication: Lane , C., and B. Autrey. Phosphorus retention of...

  4. Retention Measures and Reporting Systems

    National Research Council Canada - National Science Library

    Ropp, Gary

    2003-01-01

    ...) and performed by the Navy Personnel Research and Development Center (NPRDC) to: (1) review current retention measures in use in the Navy, as well as the system used to distribute retention statistics, and (2...

  5. Patient retention at dental school clinics: a marketing perspective.

    Science.gov (United States)

    Makarem, Suzanne C; Coe, Julie M

    2014-11-01

    The purpose of this investigation was to examine the drivers of patient retention at dental school clinics from a services marketing perspective. An analysis of patient characteristics at Virginia Commonwealth University School of Dentistry, screened between August 2010 and July 2011 (N=3604), was performed using descriptive statistics, cross-tabulations, and a binary logistic regression. The main findings were that 42 percent of patients in the study were retained and that no response to communication efforts (36 percent) and financial problems (28 percent) constituted the most common reasons for non-retention. Older age, having insurance, and living within a sixty-mile radius were significant drivers of retention (phigher retention rate (62 percent) than those who did not (42 percent). Finally, some groups of dental students had higher retention rates than others (peducation and to ensuring the sustainability and quality of the school's educational programs.

  6. Successfully Transitioning from the AA-MAS to the General Assessment. NCEO Policy Directions. Number 22

    Science.gov (United States)

    Lazarus, Sheryl; Thurlow, Martha; Christensen, Laurene; Shyyan, Vitaliy

    2014-01-01

    Federal policy initiatives such as the flexibility waivers for accountability are requiring that states transition away from the use of an alternate assessment based on modified achievement standards (AA-MAS). It is expected that those students who had participated in that assessment will instead participate in the state's general assessment (or a…

  7. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    NARCIS (Netherlands)

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg

  8. Peer Mentor Program for the General Chemistry Laboratory Designed to Improve Undergraduate STEM Retention

    Science.gov (United States)

    Damkaci, Fehmi; Braun, Timothy F.; Gublo, Kristin

    2017-01-01

    We describe the design and implementation of an undergraduate peer mentor program that can overlay an existing general chemistry laboratory and is designed to improve STEM student retention. For the first four freshman cohorts going through the program, year-to-year retention improved by a four-year average of 20% for students in peer-mentored…

  9. The Influence of Interactivity and Instructional Strategies on Retention and Satisfaction in Distance Learning Environments

    Science.gov (United States)

    Wise, Teresa Lee

    2012-01-01

    Distance learning classes are on the rise. Some colleges and universities have high retention rates, but others do not. The keys to creating effective online courses are student satisfaction and retention. This quantitative study surveyed 73 students who had completed at least one online course at a small Florida public university that offers…

  10. Soil Water Retention Curve

    Science.gov (United States)

    Johnson, L. E.; Kim, J.; Cifelli, R.; Chandra, C. V.

    2016-12-01

    Potential water retention, S, is one of parameters commonly used in hydrologic modeling for soil moisture accounting. Physically, S indicates total amount of water which can be stored in soil and is expressed in units of depth. S can be represented as a change of soil moisture content and in this context is commonly used to estimate direct runoff, especially in the Soil Conservation Service (SCS) curve number (CN) method. Generally, the lumped and the distributed hydrologic models can easily use the SCS-CN method to estimate direct runoff. Changes in potential water retention have been used in previous SCS-CN studies; however, these studies have focused on long-term hydrologic simulations where S is allowed to vary at the daily time scale. While useful for hydrologic events that span multiple days, the resolution is too coarse for short-term applications such as flash flood events where S may not recover its full potential. In this study, a new method for estimating a time-variable potential water retention at hourly time-scales is presented. The methodology is applied for the Napa River basin, California. The streamflow gage at St Helena, located in the upper reaches of the basin, is used as the control gage site to evaluate the model performance as it is has minimal influences by reservoirs and diversions. Rainfall events from 2011 to 2012 are used for estimating the event-based SCS CN to transfer to S. As a result, we have derived the potential water retention curve and it is classified into three sections depending on the relative change in S. The first is a negative slope section arising from the difference in the rate of moving water through the soil column, the second is a zero change section representing the initial recovery the potential water retention, and the third is a positive change section representing the full recovery of the potential water retention. Also, we found that the soil water moving has traffic jam within 24 hours after finished first

  11. LAA~AA, ______ __ 'VVVVV v

    Indian Academy of Sciences (India)

    L is a lower triangular matrix with non- negative diagonal elements. Of course, a book of such a size as the present one cannot contain everything that we feel the students should know. Two of the important topics that need more explicit attention are minimal polynomials of linear operators and simultaneous diagonalisation.

  12. LAA~AA, ______ __ 'VVVVV v

    Indian Academy of Sciences (India)

    the students should know. Two of the important topics that need more explicit attention are minimal polynomials of linear operators and simultaneous diagonalisation of commuting operators, although these are touched upon in an indirect way in the exercises. We hope that these topics will be included in a future edition.

  13. Leadership, Medication Administration, and Knowledge Retention: A Quality Improvement Project

    Science.gov (United States)

    Treister, Pamela

    2017-01-01

    A leadership and quality improvement project was undertaken in order to assist undergraduate baccalaureate nursing students in knowledge retention for medication administration during their senior semester in nursing school. Specific changes in curriculum were implemented to assist these undergraduate baccalaureate nursing students at a suburban…

  14. Memory Vocabulary Learning Strategies and Long-Term Retention ...

    African Journals Online (AJOL)

    The present study was an attempt to compare the impact of teaching through memory strategies, where students were taught the meaning of new vocabulary items by giving them synonyms, antonyms, definitions and mini-contexts. The results were reflected in the students' short-term and long-term memory retention.

  15. Obesity is a significant susceptibility factor for idiopathic AA amyloidosis.

    Science.gov (United States)

    Blank, Norbert; Hegenbart, Ute; Dietrich, Sascha; Brune, Maik; Beimler, Jörg; Röcken, Christoph; Müller-Tidow, Carsten; Lorenz, Hanns-Martin; Schönland, Stefan O

    2018-01-24

    To investigate obesity as susceptibility factor in patients with idiopathic AA amyloidosis. Clinical, biochemical and genetic data were obtained from 146 patients with AA amyloidosis. Control groups comprised 40 patients with long-standing inflammatory diseases without AA amyloidosis and 56 controls without any inflammatory disease. Patients with AA amyloidosis had either familial Mediterranean fever (FMF) or long-standing rheumatic diseases as underlying inflammatory disease (n = 111, median age 46 years). However, in a significant proportion of patients with AA amyloidosis no primary disease was identified (idiopathic AA; n = 37, median age 60 years). Patients with idiopathic AA amyloidosis were more obese and older than patients with AA amyloidosis secondary to FMF or rheumatic diseases. Serum leptin levels correlated with the body mass index (BMI) in all types of AA amyloidosis. Elevated leptin levels of more than 30 µg/l were detected in 18% of FMF/rheumatic + AA amyloidosis and in 40% of patients with idiopathic AA amyloidosis (p = .018). Finally, the SAA1 polymorphism was confirmed as a susceptibility factor for AA amyloidosis irrespective of the type of the disease. Obesity, age and the SAA1 polymorphism are susceptibility factors for idiopathic AA amyloidosis. Recent advances in treatment of FMF and rheumatic disorders will decrease the incidence of AA amyloidosis due to these diseases. Idiopathic AA, however, might be an emerging problem in the ageing and increasingly obese population.

  16. Enhancing retention of partial dentures using elastomeric retention rings

    Directory of Open Access Journals (Sweden)

    Kakkirala Revathi

    2015-01-01

    Full Text Available This report presents an alternative method for the retention of partial dentures that relies on the engagement of tooth undercuts by a lining material. The lab procedures are also presented. A new maxillary and mandibular acrylic partial dentures were fabricated using elastomeric retention technique for a partially dentate patient. A partially dentate man reported difficulty in retaining his upper removable partial denture (RPD. The maxillary RPD was designed utilizing elastomeric retention technique. During follow-up, it was necessary to replace the retention rings due to wear. The replacement of the retention rings, in this case, was done through a chairside reline technique. Elastomeric retention technique provides exceptionally good retention can be indicated to stabilize, cushion, splint periodontally involved teeth, no enough undercut for clasps, eliminate extractions, single or isolated teeth.

  17. Patient attitudes toward retention and perceptions of treatment success.

    Science.gov (United States)

    Mollov, Nikolay D; Lindauer, Steven J; Best, Al M; Shroff, Bhavna; Tufekci, Eser

    2010-07-01

    To discern patients' opinions regarding responsibility for orthodontic retention and to determine whether patient attitudes toward retention are related to perceptions of treatment success. Questionnaires regarding orthodontic retention were distributed to first-year undergraduate college students (n = 158), first-year dental students (n = 183), and retention patients at orthodontic offices (n = 214). Items included treatment satisfaction, perceived responsibility for retention, type of retainer prescribed, reasons for discontinuing use of retainers, and relapse experienced. Four hundred twenty-eight of 555 participants indicated that they had received orthodontic treatment. Most indicated they were either "satisfied" or "very satisfied" with their teeth, both at the end of treatment (96%) and currently (84%). There was a strong relationship between the perception of stability of tooth position and current satisfaction level (P invisible retainers were significantly more likely to be "very satisfied" currently (50%) compared to those with Hawley (35%) or permanently bonded (36%) retainers (P = .0002). Patients with Hawley retainers were significantly less likely to be wearing them currently as prescribed (45%) than those with invisible (65%) or bonded (68%) retainers (P orthodontic results after treatment is related to patient perceptions of responsibility for retention and perceived stability of tooth position. Patients should play a contributory role in formulating orthodontic retention plans.

  18. Storage Stability Improvement of Copolymer Grafted Polypropylene-AcrylicAcid (PP-AA), by means of Various After Treatment Processes

    International Nuclear Information System (INIS)

    Gitopadmojo, Isminingsih

    2000-01-01

    Polypropylene yams that have been subjected to irradiation induced graftco-polymerization with acrylic acid, have gained its moisture regain and dyeability, that fulfilled the requirement as textile material for garment.However, the copolymer grafted PP-AA has suffered from degradation in thestorage, which was indicated in the previous study that the strengthretention has dropped tremendously by photo-oxidation or photo-degradation.After treatments of PP-AA yams with chemical compound that was able toprevent further photo-oxidation, will be expected to improve the stability ofPP-AA in storage. In this research activity, the polypropylene (PP) yams weresubjected to irradiation induced graft co-polymerization by means ofγ-Ray Co-60 as irradiation source with acrylic acid (AA) as monomer.Various after treatments were subjected to the grafted PP-AA yams such asalkalisation process; dyeing (anionic dyes, cationic dyes and nonionic dyes);as well as processing with optical brightening agent and UV stabilizer,separately. The PP-AA yams (before and after treatment) were subjected tostorage from 1 month up to 42 months, and then being tested for theirmoisture regain, strength retention and elongation at breaks. The samplesbeing stored for 12 months were subjected to radical analysis. It isconcluded from the experiment that after treatment of grafted PP-AA by meansof those various processes were able to improve the stability of copolymergrafted PP-AA in storage. The presence of peroxide radical in the ESR(electron spin resonance) spectrum on PP-AA yams before treatment and theones after treated with alkaline and being stored for 12 months haveindicated the presence of photo oxidation or photo degradation, while thepresence of poly enyl radical in the ESR spectrum of after treated PP-AA withdyes having azo and azine compound as chromophore, as well as with UVstabilizer with carbonyl as chromophore and being stored for 12 months haveproved that its presence have protected such

  19. The AA disappearing under concrete shielding

    CERN Multimedia

    CERN PhotoLab

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  20. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  1. Detection of AA76, a Common Form of Amyloid A Protein, as a Way of Diagnosing AA Amyloidosis.

    Science.gov (United States)

    Sato, Junji; Okuda, Yasuaki; Kuroda, Takeshi; Yamada, Toshiyuki

    2016-01-01

    Reactive amyloid deposits consist of amyloid A (AA) proteins, the degradation products of serum amyloid A (SAA). Since the most common species of AA is the amino terminal portion produced by cleavage between residues 76 and 77 of SAA (AA76), the presence of AA76 in tissues could be a consequence of AA amyloid deposition. This study assessed the diagnostic significance of the detection of AA76 for AA amyloidosis using two different approaches. Biopsy specimens (n=130 from 54 subjects) from gastroduodenal mucosa or abdominal fat (n=9 from 9 subjects) of patients who had already been diagnosed with or were suspected of having AA amyloidosis were used. Fixed mucosal sections were subjected to immunohistochemistry using a newly developed antibody recognizing the carboxyl terminal end of AA76 (anti-AA76). The non-fixed materials from gastroduodenal mucosa or abdominal fat were subjected to immunoblotting for detection of the size of AA76. Among the gastroduodenal specimens (n=115) from already diagnosed patients, the positive rates of Congo red staining, immunohistochemistry using anti-AA76, and immunoblotting were 68.4%, 73.0%, and 92.2%, respectively. The anti-AA76 did not stain the supposed SAA in the blood or leakage, which was stained by anti-SAA antibody. AA76 was not detected either by immunohistochemistry or by immunoblot in the materials from patients in whom AA amyloidosis had been ruled out. In the abdominal fat, the immunoblot detected AA76 in 8 materials from 8 already diagnosed patients and did not in 1 patient whose gastroduodenal mucosa was negative. In conclusion, the detection of AA76 may alter the ability to diagnose AA amyloidosis. In immunohistochemistry for fixed specimens, the new anti-AA76 antibody can improve the specificity. Immunoblot for non-fixed materials, which can considerably improve the sensitivity, should be beneficial for small materials like abdominal fat. © 2016 by the Association of Clinical Scientists, Inc.

  2. Dicty_cDB: FC-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  3. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  4. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  5. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  6. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  7. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  8. Dicty_cDB: FC-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  9. Dicty_cDB: FC-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  10. Dicty_cDB: FC-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  11. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  12. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  13. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  14. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  15. Dicty_cDB: FC-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  16. Dicty_cDB: FC-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  17. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  18. Dicty_cDB: FC-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  19. Teacher professionalisation in relation to retention strategies

    DEFF Research Database (Denmark)

    Mariager-Anderson, Kristina; Wahlgren, Bjarne

    Teacher professionalization in relation to retention strategies Bjarne Wahlgren, professor, director National Centre of Competence Development, University of Aarhus, Denmark The research project ‘New roles for the teacher’ was initiated due to a concern about the increasing number of dropouts...... pedagogical strategies have any impact on retention? The project started in 2010 and includes annual interventions and measurements of the output of these inventions. The intervention includes various teacher training programs e.g. about training in cooperative learning, classroom management, conflict...... management, and training in analyses of the students’ preconditions and experiences. The data collecting methods are comprehensive and include five data sets: • A teacher survey (more than 500 informants) about the teachers’ perception of their own socio-pedagogical competencies and activities • A student...

  20. AA, sandwich line with magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Continuation from 8010293: Finally, the sandwich line with the horn is placed on the ground, for the horn to be inspected and, if needed, exchanged for a new one. The whole procedure was trained with several members of the AA team, for quick and safe handling, and to share the radiation dose amongst them.

  1. Overall view of AA (Bld 193)

    CERN Multimedia

    1980-01-01

    See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  2. Overview of the Antiproton Accumulator (AA)

    CERN Multimedia

    1982-01-01

    See photo 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  3. Overall view of AA in Bld. 193

    CERN Multimedia

    1980-01-01

    See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  4. AA, mating of BST magnet halves

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  5. AA, vacuum tank for stochastic precooling

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  6. Recycling retention functions

    International Nuclear Information System (INIS)

    Skrable, K.W.; Chabot, G.E.; Johnson, M.H.

    1981-01-01

    Beginning with the concept of any number of physiologically meaningful compartments that recycle material with a central extracellular fluid compartment and considering various excretion pathways, we solve the differential equations describing the kinetics by the method of Laplace to obtain concise algebraic expressions for the retentions. These expressions contain both fundamental and eigenvalue rate constants; the eigenvalue rate constants are obtained from the solution of a polynomial incorporating the fundamental rate constants. Mathematically exact expressions that predict the biodistribution resulting from continuous uptakes are used to obtain very simple mathematically exact steady state expressions as well as approximate expressions applicable to any time. These steady state and approximate expressions contain only the fundamental rate constants; also, they include a recycling factor that describes the increase in the biodistributions because of recycling. To obtain the values of the fundamental rate constants, short term kinetics studies along with data on the long term distributions are suggested. Retention functions obtained in this way predict both the short term and long term distributions; they therefore are useful in the interpretation of bioassay data and in the estimation of internal doses

  7. Longitudinal study of experimental induction of AA amyloidosis in mice seeded with homologous and heterologous AA fibrils.

    Science.gov (United States)

    Muhammad, Naeem; Murakami, Tomoaki; Inoshima, Yasuo; Ishiguro, Naotaka

    2016-09-01

    To investigate pathogenesis and kinetics of experimentally induced murine AA amyloidosis seeded with homologous (murine) and heterologous (bovine) AA fibrils. Experimental AA amyloidosis was induced by administration of inflammatory stimulus and preformed AA fibrils to a total of 111 female C57/Black mice. In this longitudinal study, heterologous (bovine) as well as homologous (murine) AA fibrils were injected intraperitoneally to mice in various combinations. Re-stimulation was done at 120 or 300 days post first inoculation. To analyze the intensity of amyloid depositions in mice organs, immunohistochemical techniques and image J software were used. Assessment of cytokines level in sera was done using a Mouse Th1/Th2/Th17 Cytokine CBA Kit. Incidence and severity of AA amyloidosis were quite low in mice inoculated with heterologous bovine AA fibrils than homologous murine one. Homologous AA fibrils administration at first and second inoculation caused maximum amount of amyloid depositions and severe systemic form of amyloidosis. Increase in the level of pro-inflammatory cytokine IL-6 was observed after first inoculation, while second inoculation caused a further increase in the level of anti-inflammatory cytokine IL-10. AA amyloidosis can be induced by heterologous as well as homologous AA fibrils. Severity of AA amyloidosis induced with homologous AA fibrils is higher compared to heterologous AA fibrils.

  8. [Risk control of traditional Chinese medicines containing aristolochis acids (AAs) based on influencing factors of content of AAs].

    Science.gov (United States)

    Tian, Jing-Zhuo; Liang, Ai-Hua; Liu, Jing; Zhang, Bo-Li

    2017-12-01

    Aristolochic acids (AAs) widely exist in such plants as Aristolochia and Asarum. The renal toxicity of AAs as well as its carcinogenicity to urinary system have been widely known. In 2003 and 2004, China prohibited the use of Aristolochiae Radix, Aristolochiae Manshuriensis Caulis and Aristolochiae Fangchi Radix, and required administering other AAs-containing medicines in accordance with the regulations for prescription drugs. In this paper, we retrieved literatures on the content determination of AAs in recent 10 years in China. It suggested that the AAs content is lower in Asarum herb, especially in its roots and rhizomes, and most of which do not show detectable amount of AA-I. Some of traditional Chinese medicines show fairly small amount of detectable AA-I. The AAs content in Aristolochia herb (including Fructus Aristolochiae, kaempfer dutchmanspipe root) is relatively high; however, there are fewer literatures for studying the content determination of AAs in Chinese patent medicines. There were many factors affecting AAs content, including the parts used, origins, processing methods, extraction process. It suggested that we should pay attention to the toxicity of Chinese medicines containing AAs and use these decoction pieces and traditional Chinese medicines cautiously. In addition, basic studies for the origins, processing methods and extraction process of Chinese patent medicines containing AAs, as well as supervision and detection of AAs content in traditional Chinese medicinal materials, decoction pieces and Chinese patent medicines shall be strengthened for reducing medication risk and guaranteeing clinical medication safety. Copyright© by the Chinese Pharmaceutical Association.

  9. Systemic AA amyloidosis: epidemiology, diagnosis, and management.

    Science.gov (United States)

    Real de Asúa, Diego; Costa, Ramón; Galván, Jose María; Filigheddu, María Teresa; Trujillo, Davinia; Cadiñanos, Julen

    2014-01-01

    The term "amyloidosis" encompasses the heterogeneous group of diseases caused by the extracellular deposition of autologous fibrillar proteins. The global incidence of amyloidosis is estimated at five to nine cases per million patient-years. While amyloid light-chain (AL) amyloidosis is more frequent in developed countries, amyloid A (AA) amyloidosis is more common in some European regions and in developing countries. The spectrum of AA amyloidosis has changed in recent decades owing to: an increase in the median age at diagnosis; a percent increase in the frequency of primary AL amyloidosis with respect to the AA type; and a substantial change in the epidemiology of the underlying diseases. Diagnosis of amyloidosis is based on clinical organ involvement and histological evidence of amyloid deposits. Among the many tinctorial characteristics of amyloid deposits, avidity for Congo red and metachromatic birefringence under unidirectional polarized light remain the gold standard. Once the initial diagnosis has been made, the amyloid subtype must be identified and systemic organ involvement evaluated. In this sense, the (123)I-labeled serum amyloid P component scintigraphy is a safe and noninvasive technique that has revolutionized the diagnosis and monitoring of treatment in systemic amyloidosis. It can successfully identify anatomical patterns of amyloid deposition throughout the body and enables not only an initial estimation of prognosis, but also the monitoring of the course of the disease and the response to treatment. Given the etiologic diversity of AA amyloidosis, common therapeutic strategies are scarce. All treatment options should be based upon a greater control of the underlying disease, adequate organ support, and treatment of symptoms. Nevertheless, novel therapeutic strategies targeting the formation of amyloid fibrils and amyloid deposition may generate new expectations for patients with AA amyloidosis.

  10. Factors affecting retention in science-based curriculums at HBCUs

    Energy Technology Data Exchange (ETDEWEB)

    Pelham, J.

    1991-12-31

    A systematic and comprehensive study of the retention of minority students enrolled in college-level engineering was conducted. The majority of prior work in this area focused on institutional retention factors for students in non-specified majors and considered students ``dropouts`` whenever there was a break in enrollment. This study looked only at students whose beginning major was engineering, enrolled primarily at historically black colleges and universities (HBCUs), including a comparison sample from a predominantly white institution (PWI). Science persisters were defined as those students who continuously enrolled in post-secondary institutions full- and part-time -- whether or not they transferred between institutions. The critical factor was their continued enrollment in engineering. Study participants provided four types of information: (1) a measure of academic motivation, (2) an objective measure of science interest, (3) a measure of nine aspects of normal personality functioning, and (4) an assessment of selected demographic variables. 64 refs.

  11. Factors affecting retention in science-based curriculums at HBCUs

    Energy Technology Data Exchange (ETDEWEB)

    Pelham, J.

    1991-01-01

    A systematic and comprehensive study of the retention of minority students enrolled in college-level engineering was conducted. The majority of prior work in this area focused on institutional retention factors for students in non-specified majors and considered students dropouts'' whenever there was a break in enrollment. This study looked only at students whose beginning major was engineering, enrolled primarily at historically black colleges and universities (HBCUs), including a comparison sample from a predominantly white institution (PWI). Science persisters were defined as those students who continuously enrolled in post-secondary institutions full- and part-time -- whether or not they transferred between institutions. The critical factor was their continued enrollment in engineering. Study participants provided four types of information: (1) a measure of academic motivation, (2) an objective measure of science interest, (3) a measure of nine aspects of normal personality functioning, and (4) an assessment of selected demographic variables. 64 refs.

  12. Learning and Retention Using Virtual Reality in a Decontamination Simulation.

    Science.gov (United States)

    Smith, Sherrill J; Farra, Sharon; Ulrich, Deborah L; Hodgson, Eric; Nicely, Stephanie; Matcham, William

    The purpose of this study was to examine the longitudinal effects of virtual reality simulation (VRS) on learning outcomes and retention. Disaster preparation for health care professionals is seriously inadequate. VRS offers an opportunity to practice within a realistic and safe environment, but little is known about learning and retention using this pedagogy. A quasiexperimental design was used to examine the use of VRS with baccalaureate nursing students in two different nursing programs in terms of the skill of decontamination. Results indicate that VRS is at least as good as traditional methods and is superior in some cases for retention of knowledge and performance of skills. VRS may provide a valuable option for promoting skill development and retention. More research is needed to determine how to prepare nurses for skills that may not be required until months or even years after initial introduction.

  13. Effects of Curriculum and Nonacademic Factors on Undergraduate Electronic Engineering Program Retention

    Science.gov (United States)

    Sulaiman, Munir

    Science, technology, engineering, and mathematics (STEM) programs in higher education institutions, particularly engineering programs, face challenges related to recruitment, retention, and graduation rates. The purpose of this study was to determine whether there are significant relationships among students' major preference, academic skills, nonacademic characteristics and perceptions, and retention to year 2 among students in electronic engineering, other STEM, and non STEM majors. The academic skills considered were study habits, intellectual interest, verbal and writing confidence, and academic assistance. The non-academic factors included academic support, family support, financial support, and student social integration into the campus environment. Tinto's theory of retention served as the theoretical framework. The research design was quantitative with a general linear method of analysis using responses to the College Student Inventory (CSI) survey as secondary data to determine the relationships among the independent variables (major and academic and non-academic factors) and dependent variable (retention). Participants were 3,575 first year undergraduate full-time students from three entering classes, 2012 to 2014. Findings suggested that student major and non-academic factors had no effect on student retention, but student study habits and seeking academic assistance were predictors of retention in each of the three groups of majors: engineering, other STEM majors, and nonSTEM majors. Strategies to help increase undergraduate students' study skills and help seeking behaviors may contribute to positive social change at HBCU institutions.

  14. Drug Retention Times

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    2007-05-01

    The purpose of this monograph is to provide information on drug retention times in the human body. The information provided is based on plausible illegal drug use activities that might be engaged in by a recreational drug user. Based on anecdotal evidence, most people “party” during extended time away from the work environment. Therefore, the following scenarios were envisioned: (1) a person uses an illicit drug at a party on Saturday night (infrequent user); (2) a person uses a drug one time on Friday night and once again on Saturday night (infrequent user); and (3) a person uses a drug on Friday night, uses a drug twice on Saturday night, and once again on Sunday (frequent user).

  15. Military Retention. A Comparative Outlook

    Directory of Open Access Journals (Sweden)

    Vasile Sminchise

    2016-06-01

    Full Text Available One of the main goals for human resources management structures and for armed forces leaders is to maintain all necessary personnel, both qualitatively and quantitatively for operational needs or for full required capabilities. The retention of military personnel is essential to keep morale and unit readiness and to reduce the costs for recruiting, training, replacement of manpower. Retention rates depend not only on money or other social measures. The goal for retention is to keep in use the most valuable resource that belongs to an organization: the human beings and their knowledge. The aim pf this paper is to provide a comparative analysis of retention measures in various countries based on Research and Technology Organisation report released in 2007 and, thus, provide more examples of retention measures as far as the Romanian military system is concerned.

  16. Absorption spectra of AA-stacked graphite

    International Nuclear Information System (INIS)

    Chiu, C W; Lee, S H; Chen, S C; Lin, M F; Shyu, F L

    2010-01-01

    AA-stacked graphite shows strong anisotropy in geometric structures and velocity matrix elements. However, the absorption spectra are isotropic for the polarization vector on the graphene plane. The spectra exhibit one prominent plateau at middle energy and one shoulder structure at lower energy. These structures directly reflect the unique geometric and band structures and provide sufficient information for experimental fitting of the intralayer and interlayer atomic interactions. On the other hand, monolayer graphene shows a sharp absorption peak but no shoulder structure; AA-stacked bilayer graphene has two absorption peaks at middle energy and abruptly vanishes at lower energy. Furthermore, the isotropic features are expected to exist in other graphene-related systems. The calculated results and the predicted atomic interactions could be verified by optical measurements.

  17. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  18. AA, assembly of wide bending magnet

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  19. AA, inner conductor of a magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  20. Actual drawing of histological images improves knowledge retention.

    Science.gov (United States)

    Balemans, Monique C M; Kooloos, Jan G M; Donders, A Rogier T; Van der Zee, Catharina E E M

    2016-01-01

    Medical students have to process a large amount of information during the first years of their study, which has to be retained over long periods of nonuse. Therefore, it would be beneficial when knowledge is gained in a way that promotes long-term retention. Paper-and-pencil drawings for the uptake of form-function relationships of basic tissues has been a teaching tool for a long time, but now seems to be redundant with virtual microscopy on computer-screens and printers everywhere. Several studies claimed that, apart from learning from pictures, actual drawing of images significantly improved knowledge retention. However, these studies applied only immediate post-tests. We investigated the effects of actual drawing of histological images, using randomized cross-over design and different retention periods. The first part of the study concerned esophageal and tracheal epithelium, with 384 medical and biomedical sciences students randomly assigned to either the drawing or the nondrawing group. For the second part of the study, concerning heart muscle cells, students from the previous drawing group were now assigned to the nondrawing group and vice versa. One, four, and six weeks after the experimental intervention, the students were given a free recall test and a questionnaire or drawing exercise, to determine the amount of knowledge retention. The data from this study showed that knowledge retention was significantly improved in the drawing groups compared with the nondrawing groups, even after four or six weeks. This suggests that actual drawing of histological images can be used as a tool to improve long-term knowledge retention. © 2015 American Association of Anatomists.

  1. The Relationship between SAT Scores and Retention to the Third Year: 2006 Cohort. Statistical Report

    Science.gov (United States)

    Mattern, Krista D.; Patterson, Brian F.

    2010-01-01

    Results show that SAT performance is related to third year retention rates. Even after controlling for student and institutional characteristics, returners had higher SAT total scores than non-returners, and the performance gap is not due to differences in the demographic makeup of the two groups. Furthermore, while differences in retention can be…

  2. Are Flunkers Social Outcasts? A Multilevel Study of Grade Retention Effects on Same-Grade Friendships

    Science.gov (United States)

    Demanet, Jannick; Van Houtte, Mieke

    2016-01-01

    We examine the association between grade retention and the number of same-grade friendships. Moreover, we investigate the effect of a school's proportion of retained students on these friendships and the moderating effect of this school characteristic on the relationship between retention and the number of same-grade friendships. Multilevel…

  3. Grade-Level Retention in Texas Public Schools, 2015-16

    Science.gov (United States)

    Texas Education Agency, 2017

    2017-01-01

    This annual report provides information for the 2015-16 school year on grade-level retention in the Texas public school system. Data on retention are provided by student characteristics, including grade level; race/ethnicity; gender; degree of English proficiency; and economic, at-risk, immigrant, migrant, and overage statuses. Data also are…

  4. 40 CFR Appendix A to Subpart Aa of... - Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA

    Science.gov (United States)

    2010-07-01

    ... (40 CFR Part 63, Subpart A) to Subpart AA A Appendix A to Subpart AA of Part 63 Protection of... Hazardous Air Pollutants From Phosphoric Acid Manufacturing Plants Pt. 63, Subpt. AA, App. A Appendix A to Subpart AA of Part 63—Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA 40 CFR...

  5. Dicty_cDB: FC-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  6. Dicty_cDB: FC-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA04 (Link to dictyBase) - - - Contig-U15354-1 FC-AA04P (Li...nk to Original site) FC-AA04F 546 FC-AA04Z 484 FC-AA04P 1030 - - Show FC-AA04 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA04Q.Seq.d/ Representative seq. ID FC-AA...04P (Link to Original site) Representative DNA sequence >FC-AA04 (FC-AA04Q) /CSM/FC/FC-AA/FC-AA04Q.Seq.d/ AA...TAATACACATAAAAAATTTATTAAATAAAAATGACTACAACAACAACAAATGAAGTTT ATATAGTTGATTGTATTCGTACACCAATTGGTAGAGGATATAGTAA

  7. Dicty_cDB: FC-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  8. Homesickness at College: Its Impact on Academic Performance and Retention

    Science.gov (United States)

    Sun, Jie; Hagedorn, Linda Serra; Zhang, Yi

    2016-01-01

    For this study we identified factors exerting significant influence on homesickness and explored the impact of the homesick experience on students' academic performance and retention in the first year in college. The findings reveal 2 constructs underlying the homesickness scale: homesick separation and homesick distress. Demographic variables…

  9. Retention in the United States Job Corps: Analysis and Recommendations.

    Science.gov (United States)

    Ginsburg, Kenneth R.; Forke, Christine M.; Kinsman, Sara B.; Fleegler, Eric; Grimes, Eric K.; Rosenbloom, Tamar; Schneider, John S.; Schwarz, Donald F.; Cnaan, Avital; Zhao, Huaqing; Cohen, Brian M.; Gibbs, Kathleen P.

    A project used a mixed quantitative-qualitative approach, drawing from the Job Corps database and site visits at five sites, to generate knowledge that can guide policymakers and program planners as they act to increase retention in the Job Corps or similar programs. Quantitative data on 343,097 students who enrolled in Job Corps between July 1993…

  10. Recruitment and retention strategies and methods in the HEALTHY study

    Science.gov (United States)

    HEALTHY was a 3-year middle school-based primary prevention trial to reduce modifiable risk factors for type 2 diabetes in youth. The study was conducted at seven centers across the country. This paper describes the recruitment and retention activities employed in the study. Schools and students wer...

  11. Developing a More Effective Recruitment and Retention Model.

    Science.gov (United States)

    Janke, Walter; Kelly, Gary

    The purpose of a project was to develop a model for more effective recruitment and retention of people of color in the Associate Degree Interior Design and Diploma Interior Design Assistant Program at Milwaukee Area Technical College (MATC), Wisconsin. During Activity One, individuals in MATC's Student Development and High School Relations…

  12. Minority Recruitment and Retention for Universities: Bilingual Special Education Faculty

    Science.gov (United States)

    Brice, Alejandro E.

    2012-01-01

    Recruitment and retention of minority faculty in bilingual special education is a perilous task. Research has shown that minority faculty/teachers are able to provide emotional support, mentor students, serve as role models, create a positive climate, provide diverse views, increase collaboration among faculty and teachers, and work with…

  13. Best Practices for Access and Retention in Higher Education

    Science.gov (United States)

    Duranczyk, Irene M., Ed.; Higbee, Jeanne L., Ed.; Lundell, Dana Britt, Ed.

    2004-01-01

    This monograph explores best practices for access and retention in higher education in programs that support the most diverse and nontraditional students on their campuses. It focuses on research, theory, and assessment in a variety of national programs. Its 14 chapters provide historic information about successful initiatives, multicultural and…

  14. Accelerated Learning and Retention: Literature Review and Workshop Review

    Science.gov (United States)

    2011-03-01

    has been the dominant way to promote learning and retention. Stereotypic classrooms consist of an instructor, students and typical means of classroom...participants argued that this method of testing may not maximize the learning experience. However, responsibility for developing and administering labour

  15. Job embeddedness and nurse retention.

    Science.gov (United States)

    Reitz, O Ed; Anderson, Mary Ann; Hill, Pamela D

    2010-01-01

    Nurse retention is a different way of conceptualizing the employer-employee relationship when compared with turnover. Job embeddedness (JE), a construct based on retention, represents the sum of reasons why employees remain at their jobs. However, JE has not been investigated in relation to locale (urban or rural) or exclusively with a sample of registered nurses (RNs). The purpose of this study was to determine what factors (JE, age, gender, locale, and income) help predict nurse retention. A cross-sectional mailed survey design was used with RNs in different locales (urban or rural). Job embeddedness was measured by the score on the composite, standardized instrument. Nurse retention was measured by self-report items concerning intent to stay. A response rate of 49.3% was obtained. The typical respondent was female (96.1%), white, non-Hispanic (87.4%), and married (74.9%). Age and JE were predictive of nurse retention and accounted for 26% of the explained variance in intent to stay. Although age was a significant predictor of intent to stay, it accounted for only 1.4% of the variance while JE accounted for 24.6% of the variance of nurse retention (as measured by intent to stay). Older, more "embedded" nurses are more likely to remain employed in their current organization. Based on these findings, JE may form the basis for the development of an effective nurse retention program.

  16. _. AA~ AA, _ _

    Indian Academy of Sciences (India)

    It is probably very difficult to find a person who has not been charmed by the exquisite beauty of soap bubbles. Invariably, our appre- ciation of soap bubbles ends with an admira- tion of their shapes and colours. We do not realise that there is a profound science behind their beauty. The best book to start learning.

  17. Payload retention device

    Science.gov (United States)

    Monford, Leo G., Jr.

    1992-06-01

    A payload retention device for grappling and retaining a payload in docked position on a supporting structure in the cargo bay of a space vehicle is presented. The device comprises a two-fault tolerant electromagnetic grappling system comprising electromagnets for attracting and grappling a grapple strike plate affixed to the payload when in proximity thereto and an electromechanical latching assembly comprising a pair of independent latching subassemblies. Each subassembly comprises a set of latching pawls which are driven into latching and unlatching positions relative to a grappled payload by a pair of gearmotors, each equipped with a ratchet clutch drive mechanism which is two-fault tolerant with respect to latching such that only one gearmotor of the four needs to be operational to effect a latch of the payload but is single fault tolerant with respect to release of a latched payload. Sensors are included for automatically sensing the magnetic grappling of a payload and for automatically de-energizing the gearmotors of the latching subassemblies when a latch condition is achieved.

  18. Lexical Processing Strategy Use,Success, and Word Retention

    OpenAIRE

    小林, 千穂

    2011-01-01

    This study aimed to identify the lexical processing strategies (LPSs ; ignore, consult, infer) used by Japanese university students to cope with unknown words when reading. It also explored how LPS use relates to success in determining word meaning and its retention. Furthermore, it investigated how vocabulary knowledge affects LPS use and its success. The results indicate that the students consulted a large proportion of words and ignored a small proportion. They were generally capable of us...

  19. Data Retention and Anonymity Services

    Science.gov (United States)

    Berthold, Stefan; Böhme, Rainer; Köpsell, Stefan

    The recently introduced legislation on data retention to aid prosecuting cyber-related crime in Europe also affects the achievable security of systems for anonymous communication on the Internet. We argue that data retention requires a review of existing security evaluations against a new class of realistic adversary models. In particular, we present theoretical results and first empirical evidence for intersection attacks by law enforcement authorities. The reference architecture for our study is the anonymity service AN.ON, from which we also collect empirical data. Our adversary model reflects an interpretation of the current implementation of the EC Directive on Data Retention in Germany.

  20. Retention capacity of random surfaces.

    Science.gov (United States)

    Knecht, Craig L; Trump, Walter; Ben-Avraham, Daniel; Ziff, Robert M

    2012-01-27

    We introduce a "water retention" model for liquids captured on a random surface with open boundaries and investigate the model for both continuous and discrete surface heights 0,1,…,n-1 on a square lattice with a square boundary. The model is found to have several intriguing features, including a nonmonotonic dependence of the retention on the number of levels: for many n, the retention is counterintuitively greater than that of an (n+1)-level system. The behavior is explained using percolation theory, by mapping it to a 2-level system with variable probability. Results in one dimension are also found.

  1. Recruitment and Retention.

    Science.gov (United States)

    Combs, Jolene

    1986-01-01

    Suggests ways community college journalism instructors can recruit and retain students in journalism classes (e.g., host a high school press day, fund a journalism scholarship, sponsor events for high school journalism teachers and advisers, serve as counselor for journalism majors, have a yearly journalism convocation, and involve campus…

  2. Transit ridership, reliability, and retention.

    Science.gov (United States)

    2008-10-01

    This project explores two major components that affect transit ridership: travel time reliability and rider : retention. It has been recognized that transit travel time reliability may have a significant impact on : attractiveness of transit to many ...

  3. EA Shuttle Document Retention Effort

    Science.gov (United States)

    Wagner, Howard A.

    2010-01-01

    This slide presentation reviews the effort of code EA at Johnson Space Center (JSC) to identify and acquire databases and documents from the space shuttle program that are adjudged important for retention after the retirement of the space shuttle.

  4. An Update on the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Fienberg, Richard T.; Gurton, S.; Fraknoi, A.; Prather, E. E.; Hurst, A.; Schatz, D. L.

    2013-06-01

    The American Astronomical Society, partnering with organizations active in science education and public outreach (EPO), has launched a series of professional-development workshops and a community of practice designed to help improve early-career astronomers’ ability to effectively communicate with students and the public. Called Astronomy Ambassadors, the program provides mentoring and training experiences for young astronomers, from advanced undergraduates to beginning faculty; it also provides access to resources and a network of contacts within the astronomy EPO community. By learning how to implement effective education and outreach strategies, Astronomy Ambassadors become better teachers, better presenters at meetings, and better representatives of our science to the public and to government. And because young astronomers are a more diverse group than those who currently do the majority of outreach, they help the astronomical community present a more multicultural and gender-balanced face to the public, enabling members of underserved groups to see themselves as scientists. Ambassadors are provided with a large library of outreach activities and materials that are suitable for a range of venues and audiences and that will grow with time. For much of this library we are using resources developed by organizations such as the Astronomical Society of the Pacific, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. The first Astronomy Ambassadors workshop was held at the 221st meeting of the AAS in January 2013 and served 30 young astronomers chosen from more than 75 applicants. Incorporating feedback from workshop participants and lessons learned from the reports they’ve submitted after conducting their own outreach events, we are now planning the second annual workshop to be held 4-5 January 2014 at the 223rd AAS meeting in

  5. phosphorus retention data and metadata

    Science.gov (United States)

    phosphorus retention in wetlands data and metadataThis dataset is associated with the following publication:Lane , C., and B. Autrey. Phosphorus retention of forested and emergent marsh depressional wetlands in differing land uses in Florida, USA. Wetlands Ecology and Management. Springer Science and Business Media B.V;Formerly Kluwer Academic Publishers B.V., GERMANY, 24(1): 45-60, (2016).

  6. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  7. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  8. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  9. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  10. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  11. Dicty_cDB: FC-AA11 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  12. Dicty_cDB: FC-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  13. Dicty_cDB: FC-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  14. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  15. Effectiveness of Computer-Assisted STAD Cooperative Learning Strategy on Physics Problem Solving, Achievement and Retention

    Science.gov (United States)

    Gambari, Amosa Isiaka; Yusuf, Mudasiru Olalere

    2015-01-01

    This study investigated the effectiveness of computer-assisted Students' Team Achievement Division (STAD) cooperative learning strategy on physics problem solving, students' achievement and retention. It also examined if the student performance would vary with gender. Purposive sampling technique was used to select two senior secondary schools…

  16. AA, Inner Conductor of Magnetic Horn

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  17. [Retention and biomechanics of retentive complexes. 3. The Kratochvil school and current retentive complexes].

    Science.gov (United States)

    Enrique Fernández, M; Jacques Grimonster, L

    1989-04-01

    The authors analyse the biomechanical bases of the Kratochvil "retentive complex" and show how they have induced the nowadays north-american propositions (RPI & RPA). They compare them to the european ones (Nally-Martinet).

  18. Experimental immunologically mediated aplastic anemia (AA) in mice: cyclosporin A fails to protect against AA

    International Nuclear Information System (INIS)

    Knospe, W.H.; Steinberg, D.; Gratwohl, A.; Speck, B.

    1984-01-01

    Immunologically mediated aplastic anemia (AA) in mice was induced by the i.v. injection of 10(7) lymph node cells (LNC) from H-2k identical but Mls mismatched CBA/J donor mice into previously irradiated (600 rad total body gamma) C3H/HeJ mice. Cyclosporin A (CsA), 25 mg/kg, was administered subcutaneously from day -1 to day 30. Control mice included C3H/HeJ mice which received 600 rad alone, C3H/HeJ mice which received 600 rad plus CsA as above, and C3H/HeJ mice which received 600 rad total body irradiation followed by 10(7) LNC from CBA/J donors. CsA failed to prevent lethal AA. These results suggest that the pathogenetic mechanisms operating in immunologically mediated AA differ from the mechanisms operating in rodents transplanted with allogeneically mismatched marrow or spleen cells which develop graft-versus-host disease. The results are consistent with a non-T cell-dependent mechanism causing the AA

  19. Simon van der Meer in the AA Control Room

    CERN Multimedia

    CERN PhotoLab

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  20. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    DEFF Research Database (Denmark)

    Hansen, Elo Harald

    1996-01-01

    One of the advantages of the flow injection (FI) concept is that it is compatible with virtually all detection techniques. Being a versatile vehicle for enhancing the performance of the individual detection devices, the most spectacular results have possibly been obtained in conjunction with atomic...... absorption spectrometry (AAS). Initially with flame-AAS (fAAS) procedures, later for hydride generation (HG) techniques, and most recently in combination with electrothermal AAS (ETAAS). The common denominator for all these procedures is the inherently precise and strictly reproducible timing in FI from...

  1. "To be or not to be Retained … That's the Question!" Retention, Self-esteem, Self-concept, Achievement Goals, and Grades.

    Science.gov (United States)

    Peixoto, Francisco; Monteiro, Vera; Mata, Lourdes; Sanches, Cristina; Pipa, Joana; Almeida, Leandro S

    2016-01-01

    Keeping students back in the same grade - retention - has always been a controversial issue in Education, with some defending it as a beneficial remedial practice and others arguing against its detrimental effects. This paper undertakes an analysis of this issue, focusing on the differences in student motivation and self-related variables according to their retention related status, and the interrelationship between retention and these variables. The participants were 695 students selected from two cohorts (5th and 7th graders) of a larger group of students followed over a 3-year project. The students were assigned to four groups according to their retention-related status over time: (1) students with past and recent retention; (2) students with past but no recent retention; (3) students with no past but recent retention; (4) students with no past or recent retention. Measures of achievement goal orientations, self-concept, self-esteem, importance given to school subjects and Grade Point Average (GPA) were collected for all students. Repeated measures MANCOVA analyses were carried out showing group differences in self-esteem, academic self-concept, importance attributed to academic competencies, task and avoidance orientation and academic achievement. To attain a deeper understanding of these results and to identify profiles across variables, a cluster analysis based on achievement goals was conducted and four clusters were identified. Students who were retained at the end of the school year are mainly represented in clusters with less adaptive motivational profiles and almost absent from clusters exhibiting more adaptive ones. Findings highlight that retention leaves a significant mark that remains even when students recover academic achievement and retention is in the distant past. This is reflected in the low academic self-concept as well as in the devaluation of academic competencies and in the avoidance orientation which, taken together, can undermine students

  2. “To be or not to be retained … That’s the question!”Retention,self - esteem,self - concept,achievement goalsand grades

    Directory of Open Access Journals (Sweden)

    Francisco Peixoto

    2016-10-01

    Full Text Available Keeping students back in the same grade – retention – has always been a controversial issue in Education, with some defending it as a beneficial remedial practice and others arguing against its detrimental effects. This paper undertakes an analysis of this issue, focusing on the differences in student motivation and self-related variables according to their retention related status, and the interrelationship between retention and these variables. The participants were 695 students selected from two cohorts (5th and 7th graders of a larger group of students followed over a three-year project. The students were assigned to four groups according to their retention-related status over time: 1 students with past and recent retention; 2 students with past but no recent retention; 3 students with no past but recent retention; 4 students with no past or recent retention. Measures of achievement goal orientations, self-concept, self-esteem, importance given to school subjects and Grade Point Average (GPA were collected for all students.Repeated measures MANCOVA analyses were carried out showing group differences in self-esteem, academic self-concept, importance attributed to academic competencies, task and avoidance orientation and academic achievement. To attain a deeper understanding of these results and to identify profiles across variables, a cluster analysis based on achievement goals was conducted and four clusters were identified. Students who were retained at the end of the school year are mainly represented in clusters with less adaptive motivational profiles and almost absent from clusters exhibiting more adaptive ones.Findings highlight that retention leaves a significant mark that remains even when students recover academic achievement and retention is in the distant past. This is reflected in the low academic self-concept as well as in the devaluation of academic competencies and in the avoidance orientation which, taken together, can

  3. Moessbauer spectrometer MsAa-3

    International Nuclear Information System (INIS)

    Gornicki, R.; Blachowski, A.; Ruebenbauer, K.

    2007-01-01

    The paper is aimed at the description of the newly developed Moessbauer spectrometer MsAa-3. The spectrometer MsAa-3 consists of a high quality γ--ray spectrometer including either a proportional gas detector head or a scintillation detector head, a transducer driving system including the transducer, data storage system, and data communication system based on the TCP/IP protocol. Additionally, the Michelson-Morley interferometer is provided for precise calibration of the transducer velocity. The spectrometer is equipped with an integrated simple temperature controller. All the essential functions are remotely controlled over the TCP/IP link allowing for the spectrometer set-up as the stand-alone unit in the computer network, e.g. on the Internet. External γ-ray detectors or external complete nuclear blocks could be used as well. The spectrometer is equipped with software allowing for setting all the functions, to perform on-line control, and retrieve data. The Moessbauer data processing software MOSGRAF is enclosed as well. The latter software allows for the calculation of the variety of velocity reference functions. (authors)

  4. Conceptual development and retention within the learning cycle

    Science.gov (United States)

    McWhirter, Lisa Jo

    1998-12-01

    This research was designed to achieve two goals: (1) examine concept development and retention within the learning cycle and (2) examine how students' concept development is mediated by classroom discussions and the students' small cooperative learning group. Forty-eight sixth-grade students and one teacher at an urban middle school participated in the study. The research utilized both quantitative and qualitative analyses. Quantitative assessments included a concept mapping technique as well as teacher generated multiple choice tests. Preliminary quantitative analysis found that students' reading levels had an effect on students' pretest scores in both the concept mapping and the multiple-choice assessment. Therefore, a covariant design was implemented for the quantitative analyses. Quantitative analysis techniques were used to examine concept development and retention, it was discovered that the students' concept knowledge increased significantly from the time of the conclusion of the term introduction phase to the conclusion of the expansion phase. These findings would indicate that all three phases of the learning cycle are necessary for conceptual development. However, quantitative analyses of concept maps indicated that this is not true for all students. Individual students showed evidence of concept development and integration at each phase. Therefore, concept development is individualized and all phases of the learning cycle are not necessary for all students. As a result, individual's assimilation, disequilibration, accommodation and organization may not correlate with the phases of the learning cycle. Quantitative analysis also indicated a significant decrease in the retention of concepts over time. Qualitative analyses were used to examine how students' concept development is mediated by classroom discussions and the students' small cooperative learning group. It was discovered that there was a correlation between teacher-student interaction and small

  5. Student Support to WL/ML and WL/AA

    Science.gov (United States)

    1993-01-01

    sample. Samples used for infrared analysis included both 5250-4 resin and it’s powder backbone, l-l’-(Methylenedi -4,1- phenylene ) bismaleimide spread as...8217- (Methylenedi-4,1- phenylene ) bismaleimide powder backbone including; C=O at 1719.2 cm- 1 , CH 2 CH at 2927.1-2972.8cm- 1 , free N-H bending at 1520.7...4 and it’s powder backbone, 1,1’-(Methylenedi-4,1- phenylene ) bismaleimide , allowed for conformation verification as to the basic components of the

  6. Divertor retention for recycling impurities

    International Nuclear Information System (INIS)

    Krieger, K.; Roth, J.; Fussmann, G.

    1992-01-01

    As an important issue for fusion devices with divertor configurations the retention capability for both recycling and non-recycling impurities receives increasing interest. In the case of recycling, gaseous, impurities the retention capability is usually investigated by means of short impurity gas puffs into the plasma vessel and the analysis of the time dependence of the observed line radiation. The detailed understanding of the impurity transport processes related to the retention capability of a certain divertor structure will require modelling of the experimental results with 2D or 3D transport code simulations. However, for the comparison of the global behavior of different configurations a much simpler description of the divertor retention in terms of global time constants may be sufficient. We will give a summary of experimental results from ASDEX for the dependence of the retention capability on parameters like divertor plasma density and temperature and the distance along field lines between main plasma and divertor. In addition we will compare some of these results with similar experiments on DIIID. (author) 8 refs., 2 figs., 2 tabs

  7. Colloid Transport and Retention

    DEFF Research Database (Denmark)

    Yuan, Hao; Shapiro, Alexander

    2012-01-01

    Book Description: Colloidal science and technology is one of the fastest growing research and technology areas. This book explores the cutting edge research in colloidal science and technology that will be usefull in almost every aspect of modern society. This book has a depth of information...... related to historical prospective, synthesis, characterization, theoretical modeling and application of unique class of colloidal materials starting from colloidal gold to coated silica colloid and platinum, titania colloids. This book is unique in its design, content, providing depth of science about...... different colloidal materials and their applications in chemistry, physics, biological, medical sciences and environment. Graduate students, academic and industrial researchers and medical professionals will discover recently developed colloidal materials and their applications in many areas of human...

  8. “To be or not to be Retained … That’s the Question!” Retention, Self-esteem, Self-concept, Achievement Goals, and Grades

    Science.gov (United States)

    Peixoto, Francisco; Monteiro, Vera; Mata, Lourdes; Sanches, Cristina; Pipa, Joana; Almeida, Leandro S.

    2016-01-01

    Keeping students back in the same grade – retention – has always been a controversial issue in Education, with some defending it as a beneficial remedial practice and others arguing against its detrimental effects. This paper undertakes an analysis of this issue, focusing on the differences in student motivation and self-related variables according to their retention related status, and the interrelationship between retention and these variables. The participants were 695 students selected from two cohorts (5th and 7th graders) of a larger group of students followed over a 3-year project. The students were assigned to four groups according to their retention-related status over time: (1) students with past and recent retention; (2) students with past but no recent retention; (3) students with no past but recent retention; (4) students with no past or recent retention. Measures of achievement goal orientations, self-concept, self-esteem, importance given to school subjects and Grade Point Average (GPA) were collected for all students. Repeated measures MANCOVA analyses were carried out showing group differences in self-esteem, academic self-concept, importance attributed to academic competencies, task and avoidance orientation and academic achievement. To attain a deeper understanding of these results and to identify profiles across variables, a cluster analysis based on achievement goals was conducted and four clusters were identified. Students who were retained at the end of the school year are mainly represented in clusters with less adaptive motivational profiles and almost absent from clusters exhibiting more adaptive ones. Findings highlight that retention leaves a significant mark that remains even when students recover academic achievement and retention is in the distant past. This is reflected in the low academic self-concept as well as in the devaluation of academic competencies and in the avoidance orientation which, taken together, can undermine

  9. Avaliação agronômica em híbridos diplóides (AA de bananeira Agronomical evaluation of (AA banana diploid hybrids

    Directory of Open Access Journals (Sweden)

    Lauro Saraiva Lessa

    2009-01-01

    until bunch emission at harvest, greater weight of second hand and fruit length greater than 10 cm. The 0323-03 hybrid presented greater live leaf retention during bunch harvest and also the lowest score for yellow-sigatoka during the harvest. The high variability encountered enables the selection of (AA diploids with potential use in breeding programs of this crop.

  10. Retention of Mohs surgeons in academic dermatology.

    Science.gov (United States)

    Zhang, Shali; Mina, Mary Alice; Brown, Marc D; Zwald, Fiona O

    2015-08-01

    Retention of academic Mohs surgeons is important for the growth of this specialty and teaching of residents and students. To examine factors that influence retention of Mohs surgeons in academics and to better understand reasons for their departure. A survey was electronically distributed to academic Mohs surgeons in the American College of Mohs Surgery, asking them to rate the importance of several variables on their decision to remain in academia. Private practice Mohs surgeons who had left academics were also surveyed. Two hundred thirty-six dermatologic surgeons completed the survey. Twenty-nine percent work full time in academics, and approximately 7% work part time. The top reasons for practicing in the academic setting are intellectual stimulation, teaching opportunities, and collaboration with other university physicians and researchers. Seventy-one percent of respondents reported they would stay in academics, 7% indicated they would not, and 22% were unsure. Unfair compensation, inadequate support staff, poor leadership, increased bureaucracy, and decreased autonomy were top reasons that may compel a Mohs surgeon to leave. Opportunities for intellectual stimulation, collaboration, and teaching remain the main draw for academic Mohs surgeons. A supportive environment, strong leadership, and establishing fair compensation are imperative in ensuring their stay.

  11. A new type of intracellular retention signal identified in a pestivirus structural glycoprotein.

    Science.gov (United States)

    Burrack, Sandra; Aberle, Daniel; Bürck, Jochen; Ulrich, Anne S; Meyers, Gregor

    2012-08-01

    Sorting of membrane proteins into intracellular organelles is crucial for cell function. Viruses exploit intracellular transport and retention systems to concentrate envelope proteins at the site of virus budding. In pestiviruses, a group of important pathogens of pigs and ruminants closely related to human hepatitis C virus, the E(rns) protein translated from the viral RNA is secreted from the infected cells and found in the serum of infected animals. Secretion of the protein is regarded as crucial for its function as a viral virulence factor associated with its RNase activity. However, ∼95% of the E(rns) molecules are retained within the infected cell. Fusion of different E(rns) fragments to the C terminus of CD72 allowed identification of a retention signal within the C-terminal 65 aa of the viral protein. This C-terminal sequence represents its membrane anchor and folds into an amphipathic helix binding in-plane to the membrane surface. Residues L183, I190, and L208 are important for intracellular location of E(rns). Presentation of the retention signal on the cytoplasmic instead of the luminal face of the ER membrane in CD8α fusion proteins still led to retention. Thus, E(rns) contains in its C-terminal amphipathic helix an intracellular retention signal that is active on both faces of the membrane.

  12. Application-Based Crossword Puzzles: Players’ Perception and Vocabulary Retention

    Directory of Open Access Journals (Sweden)

    Dzulfikri Dzulfikri

    2016-09-01

    Full Text Available This study investigates the perceptions of students towards Application-Based Crossword Puzzles and how playing this game can affect the development of vocabulary amongst students. Drawing on Vygostky’s Socio-Cultural Theory which states that the human mind is mediated by cultural artifacts, the nature of this game poses challenges and builds curiosity, allowing players to pay more attention to the words to fill in the boxes which subsequently enhances their retention of vocabulary. This game has very good potential to build positive perceptions and to develop cognition in the linguistic domain of players, i.e. the amount of their vocabulary. In this study, the researcher conducted interviews with eligible or selected student players to find out their perceptions toward this game and administered a vocabulary test to find out how this game had added to the retention in memory of new words acquired by the players from the game. The study findings showed that the participants perceive this game positively and it affects the players’ vocabulary retention positively as indicated by their test results. It is recommended that English teachers consider using Application-Based Crossword Puzzles to help students build their vocabularies especially as part of extracurricular activities.

  13. Idiopathic systemic AA-amyloidosis in a skunk (Mephitis mephitis).

    Science.gov (United States)

    Elhensheri, Mohamed; Linke, Reinhold P; Blankenburg, Anja; Beineke, Andreas

    2012-03-01

    This report describes a case of systemic amyloidosis in a captive striped skunk. At necropsy, bilateral alopecia, as well as reno-, hepato-, and splenomegaly were present. Congo red staining and immunohistochemistry revealed depositions of AA-amyloid in different organs. The lack of a predisposing disease is suggestive of idiopathic systemic AA-amyloidosis.

  14. Partially melted zone cracking in AA6061 welds

    International Nuclear Information System (INIS)

    Prasad Rao, K.; Ramanaiah, N.; Viswanathan, N.

    2008-01-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043

  15. Partially melted zone cracking in AA6061 welds

    Energy Technology Data Exchange (ETDEWEB)

    Prasad Rao, K. [Department of Metallurgical and Materials Engineering, Indian Institute of Technology Madras, Chennai (India)], E-mail: kpr@iitm.ac.in; Ramanaiah, N. [Sri Kalahasteeswara Institute of Technology, Srikalahasti (India); Viswanathan, N. [Defence Research and Development Laboratory, Hyderabad (India)

    2008-07-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043.

  16. The Use of Soil Palynomorphs in Forensics * ABDULRAHAMAN, AA ...

    African Journals Online (AJOL)

    ADOWIE PERE

    The Use of Soil Palynomorphs in Forensics. *. 1. ABDULRAHAMAN, AA;. 2. AL SAHLI, AA;. 1. OKOLI, JU. 1Applied Plant Anatomy and Wood Technology Laboratory, Department of Plant Biology, University of Ilorin, Ilorin, Nigeria. 2Department of Botany and Microbiology, College of Science, King Saud University, Riyadh, ...

  17. Evolution of geomagnetic aa index near sunspot minimum

    Directory of Open Access Journals (Sweden)

    R. P. Kane

    2002-10-01

    Full Text Available The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min occurred earlier than Rz(min, but remained at that low from a few months before Rz(min to a few months after Rz(min. In two cycles, Rz(min and aa(min coincided within a month or two. In nine cycles, aa(min occurred more than three months later than Rz(min. The aa(min coincided with the minima of some solar radio emission indices originating in the solar corona. For sunspot cycles 21, 22, 23, the minimum of solar wind velocity V occurred 0–9 months later than the aa(min. The minimum of solar wind total magnetic field B occurred near Rz(min. The solar wind ion density N had maxima (instead of minima near Rz(min, and again near Rz(max, indicating a  ~5-year periodicity, instead of an 11-year periodicity. The maxima of aa, V and B occurred near Rz(max and/or later in the declining phase of Rz. The aa index was very well correlated with the functions BV and BV 2.Key words. Geomagnetism and paleomagnetism (time variations, diurnal to secular – time variations, secular and long term Interplanetary physics (interplanetary magnetic field

  18. AA, shims and washers on quadrupole ends

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  19. Hot stamping of AA7075 aluminum sheets

    Science.gov (United States)

    Mendiguren, J.; Saenz de Argandona, E.; Galdos, L.

    2016-11-01

    In this work the formability of a high strength aluminium alloy (AA7075-T6) for the stamping of an automotive component has been studied. Due to the low formability of the selected alloy, two different heat assisted forming strategies have been analysed. On the one hand, the W-temper process, where the thermal process is carried out prior to the forming operation. On the other hand, the hot stamping process, where the thermal process is carried out at the same time as the forming. The results showed that both technology were able to form the component avoiding any failure of the material. On the contrary, both processes reduced the final mechanical properties of the material compared to the as received material condition. However, the obtained mechanical properties doubled the strength of commonly used 5xxx and 6xxx aluminium alloys.

  20. Teacher professionalisation in relation to retention strategies

    DEFF Research Database (Denmark)

    Wahlgren, Bjarne

    2014-01-01

    within Danish VET. The main research questions are: Is it possible to train teachers to be able to focus on the students’ completion of the program and not only on the subject matter? Do teachers change their attitudes and actual performance in the classroom after training programs? And do new...... pedagogical strategies have any impact on retention? The project started in 2010 and includes annual interventions and measurements of the output of these inventions. The intervention includes various teacher training programs e.g. about training in cooperative learning, classroom management, conflict...... management, and training in analyses of the students’ preconditions and experiences. The data collecting methods are comprehensive and include five data sets: • A teacher survey (more than 500 informants) about the teachers’ perception of their own socio-pedagogical competencies and activities • A student...