WorldWideScience

Sample records for aa light smokers

  1. Comparison of native light daily smokers and light daily smokers who were former heavy smokers.

    Science.gov (United States)

    Fish, Laura J; Pollak, Kathryn I; Scheuermann, Taneisha S; Cox, Lisa Sanderson; Mathur, Charu; Ahluwalia, Jasjit S

    2015-05-01

    An increasing proportion of daily smokers are light smokers (≤10 cigarettes per day). Some light smokers have never smoked more than 10 cigarettes per day (native light smokers) and others smoked at higher levels but have cut down (converted light smokers). It is important that we expand our understanding of these distinct subgroups of light smokers in order to develop effective interventions. Data for this report come from a larger sample of smokers who completed a cross-sectional survey administered through an online panel survey service. The sample of 522 light smokers included 256 native light smokers and 266 as converted light smokers. The goal of the analysis was to examine demographic, smoking, and psychosocial factors that differentiate between native and converted light smokers. Multivariable logistic regression results showed 4 variables that differentiated between native and converted light smokers. Native light smokers were more likely to be Black than White, smoke fewer cigarettes per day, smoked fewer total years, and had higher perceived risk of heart disease than converted light smokers. Native and converted light smokers are similar in many ways and also differ on some important characteristics. Further exploration of group difference is needed and could help to inform for cessation strategies for daily light smokers. © The Author 2014. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Altered arterial stiffness and subendocardial viability ratio in young healthy light smokers after acute exercise.

    Directory of Open Access Journals (Sweden)

    Robert J Doonan

    Full Text Available Studies showed that long-standing smokers have stiffer arteries at rest. However, the effect of smoking on the ability of the vascular system to respond to increased demands (physical stress has not been studied. The purpose of this study was to estimate the effect of smoking on arterial stiffness and subendocardial viability ratio, at rest and after acute exercise in young healthy individuals.Healthy light smokers (n = 24, pack-years = 2.9 and non-smokers (n = 53 underwent pulse wave analysis and carotid-femoral pulse wave velocity measurements at rest, and 2, 5, 10, and 15 minutes following an exercise test to exhaustion. Smokers were tested, 1 after 12h abstinence from smoking (chronic condition and 2 immediately after smoking one cigarette (acute condition. At rest, chronic smokers had higher augmentation index and lower aortic pulse pressure than non-smokers, while subendocardial viability ratio was not significantly different. Acute smoking increased resting augmentation index and decreased subendocardial viability ratio compared with non-smokers, and decreased subendocardial viability ratio compared with the chronic condition. After exercise, subendocardial viability ratio was lower, and augmentation index and aortic pulse pressure were higher in non-smokers than smokers in the chronic and acute conditions. cfPWV rate of recovery of was greater in non-smokers than chronic smokers after exercise. Non-smokers were also able to achieve higher workloads than smokers in both conditions.Chronic and acute smoking appears to diminish the vascular response to physical stress. This can be seen as an impaired 'vascular reserve' or a blunted ability of the blood vessels to accommodate the changes required to achieve higher workloads. These changes were noted before changes in arterial stiffness or subendocardial viability ratio occurred at rest. Even light smoking in young healthy individuals appears to have harmful effects on vascular

  3. Project Impact: a pharmacotherapy pilot trial investigating the abstinence and treatment adherence of Latino light smokers.

    Science.gov (United States)

    de Dios, Marcel A; Anderson, Bradley J; Stanton, Cassandra; Audet, Daniel A; Stein, Michael

    2012-10-01

    Light smoking is particularly prevalent among Latino smokers. Nicotine replacement (NRT) and varenicline are effective medications for smoking cessation for moderate-heavy smokers but have not been tested in light smokers, and thus, there are no treatment guidelines for use with light smokers. This pilot trial tested the efficacy of NRT and varenicline in increasing smoking abstinence among Latino light smokers. A 3-group (NRT, varenicline, and varenicline-placebo) randomized design was used, and Latino light smokers (≤10 cigarettes per day) received 12 weeks of treatment, which included a culturally informed behavioral health session and ongoing medication management visits. At follow-up, there were no abstinent participants in the placebo and NRT groups. However, 30% of participants in the varenicline group were abstinent at the 3-, 4-, and 6-month follow-up. This study represents the only investigation that specifically targets Latino light smokers using these treatments and characterizing their treatment adherence. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Awareness of FDA-mandated cigarette packaging changes among smokers of 'light' cigarettes.

    Science.gov (United States)

    Falcone, M; Bansal-Travers, M; Sanborn, P M; Tang, K Z; Strasser, A A

    2015-02-01

    Previous research has clearly demonstrated that smokers associate cigarette descriptors such as 'light', 'ultra-light' and 'low tar' with reduced health risks, despite evidence showing that cigarettes with these descriptor terms do not present lower health risk. In June 2010, regulations implemented by the US Food and Drug Administration went into effect to ban the use of 'light', 'mild' and 'low' on cigarette packaging. We surveyed smokers participating in human laboratory studies at our Center in Philadelphia, PA, USA shortly after the ban went into effect to determine the extent of awareness of recent cigarette packaging changes among smokers of light cigarettes. In our sample of 266 smokers, 76 reported smoking light cigarettes, but fewer than half of these smokers reported noticing changes to their cigarette packaging. Simple removal of a few misleading terms may be too subtle of a change to register with consumers of so-called 'low tar' cigarettes; more comprehensive regulation of cigarette packaging design may be necessary to gain smokers' attention and minimize misperceptions associated with tobacco pack design characteristics and color. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  5. Smoker reactions to a "radio message" that Light cigarettes are as dangerous as Regular cigarettes.

    Science.gov (United States)

    Kozlowski, L T; Goldberg, M E; Sweeney, C T; Palmer, R F; Pillitteri, J L; Yost, B A; White, E L; Stine, M M

    1999-03-01

    The purpose of this study was to examine in a systematic, controlled fashion the reactions of smokers to scientifically correct information about the risks of smoking Light cigarettes (about 6-15 mg tar by the FTC method). Random-digit dialing, computer-assisted telephone interviews were used to locate daily smokers of Light cigarettes. In an experimental design, smokers were randomly assigned to listen (n = 293) or not (n = 275) to a persuasive simulated radio message on the risks of Light cigarettes; 108 of those who did not listen to the message in the first part of the interview were played the message in the second part, to evaluate some repeated-measures effects. Those who heard the message were more likely to report that one Light cigarette could give a smoker the same amount of tar as one Regular cigarette and that Light cigarettes were more dangerous: 55% said the message made them think more about quitting and 46% said the message increased the amount they wanted to quit; 42% said that after hearing the message they thought Light cigarettes were more dangerous. Using the Theory of Planned Behavior, structural equation modeling analysis indicated that the message acted to increase intention to quit smoking by increasing the desire to quit smoking. Seventy-three per cent of the smokers agreed that it was important to play such messages widely on the radio; 77% agreed that there should be a warning on packs that vent blocking increases tar; 61% agreed that the location of filter vents should be marked. The majority of smokers of Light cigarettes seem to value being informed that Light cigarettes are as dangerous for them as Regular cigarettes, and this information increases their intentions to quit smoking.

  6. Awareness of FDA-Mandated Cigarette Packaging Changes among Smokers of "Light" Cigarettes

    Science.gov (United States)

    Falcone, M.; Bansal-Travers, M.; Sanborn, P. M.; Tang, K. Z.; Strasser, A. A.

    2015-01-01

    Previous research has clearly demonstrated that smokers associate cigarette descriptors such as "light", "ultra-light" and "low tar" with reduced health risks, despite evidence showing that cigarettes with these descriptor terms do not present lower health risk. In June 2010, regulations implemented by the US Food and…

  7. Smokers' sensory beliefs mediate the relation between smoking a light/low tar cigarette and perceptions of harm.

    Science.gov (United States)

    Elton-Marshall, Tara; Fong, Geoffrey T; Yong, Hua-Hie; Borland, Ron; Xu, Steve Shaowei; Quah, Anne C K; Feng, Guoze; Jiang, Yuan

    2015-11-01

    The sensory belief that 'light/low tar' cigarettes are smoother can also influence the belief that 'light/low tar' cigarettes are less harmful. However, the 'light' concept is one of several factors influencing beliefs. No studies have examined the impact of the sensory belief about one's own brand of cigarettes on perceptions of harm. The current study examines whether a smoker's sensory belief that their brand is smoother is associated with the belief that their brand is less harmful and whether sensory beliefs mediate the relation between smoking a 'light/low tar' cigarette and relative perceptions of harm among smokers in China. Data are from 5209 smokers who were recruited using a stratified multistage sampling design and participated in Wave 3 of the International Tobacco Control (ITC) China Survey, a face-to-face survey of adult smokers and non-smokers in seven cities. Smokers who agreed that their brand of cigarettes was smoother were significantly more likely to say that their brand of cigarettes was less harmful (pimportance of implementing tobacco control policies that address the impact that cigarette design and marketing can have in capitalising on the smoker's natural associations between smoother sensations and lowered perceptions of harm. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  8. What Astronomers and the AAS Need to be Doing to Curb Light Pollution

    Science.gov (United States)

    Green, D. W. E.

    2001-12-01

    Astronomers and especially the AAS are doing apalling little in the war on light pollution. This is quite surprising, considering that optical groundbased astronomy may become nearly extinct in the 21st century if we don't get more serious about the loss of our night skies to artificial lighting. Part of the blame must be placed on astronomers throughout the 20th century (particularly before 1980), as very few of them seem to have set an example by starting an early crusade against bad outdoor night lighting (save for a handful of important individuals near large U.S. observatories, and a few connected with smaller observatories); this apathy of earlier generations of astronomers fueled the current general apathy within the AAS and aided the opening of the floodgates in terms of the disastrous lighting situation now upon us in terms of drowning out the night sky. There are possible solutions, and they need to be discussed and acted upon quickly. For example, the AAS should require that all members include a useful amount (say, \\$30) in annual membership fees to be directly transmitted to the International Dark Sky Association, and the AAS should make constant visible strides to educate the public and government officials of the absolute need to reduce outdoor lighting levels and to fully shield all outdoor lighting. There are many other areas of research into outdoor lighting that the AAS should fund or officially/strongly support, so that the astronomical community can better be educated (and can better educate the public) on the evils of bad and thoughtless outdoor-lighting practices; such research includes developing a comprehensive database of national statistics on numbers and types of different outdoor lamps, as a function of time (thus, historical), and also a comprehensive database including all local, state, and federal lighting laws and ordinances together with legal court cases (and their outcomes) involving outdoor night lighting. And professional

  9. Utility and relationships of biomarkers of smoking in African-American light smokers.

    Science.gov (United States)

    Ho, Man Ki; Faseru, Babalola; Choi, Won S; Nollen, Nicole L; Mayo, Matthew S; Thomas, Janet L; Okuyemi, Kolawole S; Ahluwalia, Jasjit S; Benowitz, Neal L; Tyndale, Rachel F

    2009-12-01

    Although expired carbon monoxide (CO) and plasma cotinine (COT) have been validated as biomarkers of self-reported cigarettes per day (CPD) in heavy smoking Caucasians, their utility in light smokers is unknown. Further, variability in CYP2A6, the enzyme that mediates formation of COT from nicotine and its metabolism to trans-3'-hydroxycotinine (3HC), may limit the usefulness of COT. We assessed whether CO and COT are correlated with CPD in African-American light smokers (smoking mentholated cigarettes, or rate of CYP2A6 activity, by genotype and phenotype measures (3HC/COT), influence these relationships. At baseline, many participants (42%) exhaled CO of smoking, whereas few (3.1%) had COT below the cutoff of smoking status in this population. CPD was weakly correlated with CO and COT (r = 0.32-0.39, P smoking mentholated cigarettes, or age, although it appeared stronger in females (r = 0.38 versus 0.21, P relationships are not substantially improved when variables previously reported to influence these biomarkers are considered.

  10. Design, baseline characteristics, and retention of African American light smokers into a randomized trial involving biological data

    Directory of Open Access Journals (Sweden)

    Okuyemi Kolawole S

    2011-01-01

    Full Text Available Abstract Background African Americans experience significant tobacco-related health disparities despite the fact that over half of African American smokers are light smokers (use ≤10 cigarettes per day. African Americans have been under-represented in smoking cessation research, and few studies have evaluated treatment for light smokers. This paper describes the study design, measures, and baseline characteristics from Kick It at Swope III (KIS-III, the first treatment study of bupropion for African American light smokers. Methods Five hundred forty African American light smokers were randomly assigned to receive bupropion (150mg bid (n = 270 or placebo (n = 270 for 7 weeks. All participants received written materials and health education counseling. Participants responded to survey items and provided blood samples for evaluation of phenotype and genotype of CYP2A6 and CYP2B6 enzymes involved in nicotine and bupropion metabolism. Primary outcome was cotinine-verified 7-day point prevalence smoking abstinence at Week 26 follow-up. Results Of 2,628 individuals screened, 540 were eligible, consented, and randomized to treatment. Participants had a mean age of 46.5 years and 66.1% were women. Participants smoked an average of 8.0 cigarettes per day, had a mean exhaled carbon monoxide of 16.4ppm (range 1-55 and a mean serum cotinine of 275.8ng/ml. The mean Fagerström Test for Nicotine Dependence was 3.2, and 72.2% of participants smoked within 30 minutes of waking. The average number of quit attempts in the past year was 3.7 and 24.2% reported using pharmacotherapy in their most recent quit attempt. Motivation and confidence to quit were high. Conclusion KIS-III is the first study designed to examine both nicotine and bupropion metabolism, evaluating CYP2A6 and CYP2B6 phenotype and genotype in conjunction with psychosocial factors, in the context of treatment of African American light smokers. Of 1629 smokers screened for study participation, only

  11. Design, baseline characteristics, and retention of African American light smokers into a randomized trial involving biological data.

    Science.gov (United States)

    Cox, Lisa Sanderson; Faseru, Babalola; Mayo, Matthew S; Krebill, Ron; Snow, Tricia S; Bronars, Carrie A; Nollen, Nicole L; Choi, Won S; Okuyemi, Kolawole S; Salzman, Gary A; Benowitz, Neal L; Tyndale, Rachel F; Ahluwalia, Jasjit S

    2011-01-25

    African Americans experience significant tobacco-related health disparities despite the fact that over half of African American smokers are light smokers (use ≤ 10 cigarettes per day). African Americans have been under-represented in smoking cessation research, and few studies have evaluated treatment for light smokers. This paper describes the study design, measures, and baseline characteristics from Kick It at Swope III (KIS-III), the first treatment study of bupropion for African American light smokers. Five hundred forty African American light smokers were randomly assigned to receive bupropion (150 mg bid) (n = 270) or placebo (n = 270) for 7 weeks. All participants received written materials and health education counseling. Participants responded to survey items and provided blood samples for evaluation of phenotype and genotype of CYP2A6 and CYP2B6 enzymes involved in nicotine and bupropion metabolism. Primary outcome was cotinine-verified 7-day point prevalence smoking abstinence at Week 26 follow-up. Of 2,628 individuals screened, 540 were eligible, consented, and randomized to treatment. Participants had a mean age of 46.5 years and 66.1% were women. Participants smoked an average of 8.0 cigarettes per day, had a mean exhaled carbon monoxide of 16.4 ppm (range 1-55) and a mean serum cotinine of 275.8 ng/ml. The mean Fagerström Test for Nicotine Dependence was 3.2, and 72.2% of participants smoked within 30 minutes of waking. The average number of quit attempts in the past year was 3.7 and 24.2% reported using pharmacotherapy in their most recent quit attempt. Motivation and confidence to quit were high. KIS-III is the first study designed to examine both nicotine and bupropion metabolism, evaluating CYP2A6 and CYP2B6 phenotype and genotype in conjunction with psychosocial factors, in the context of treatment of African American light smokers. Of 1629 smokers screened for study participation, only 18 (1.1%) were ineligible to participate in the study

  12. Exposure to welding fumes increases lung cancer risk among light smokers but not among heavy smokers: evidence from two case–control studies in Montreal

    Science.gov (United States)

    Vallières, Eric; Pintos, Javier; Lavoué, Jérôme; Parent, Marie-Élise; Rachet, Bernard; Siemiatycki, Jack

    2012-01-01

    We investigated relationships between occupational exposure to gas and arc welding fumes and the risk of lung cancer among workers exposed to these agents throughout the spectrum of industries. Two population-based case–control studies were conducted in Montreal. Study I (1979–1986) included 857 cases and 1066 controls, and Study II (1996–2001) comprised 736 cases and 894 controls. Detailed job histories were obtained by interview and evaluated by an expert team of chemist–hygienists to estimate degree of exposure to approximately 300 substances for each job. Gas and arc welding fumes were among the agents evaluated. We estimated odds ratios (ORs) and 95% confidence intervals (CIs) of lung cancer using logistic regression, adjusting for smoking history and other covariates. The two studies provided similar results, so a pooled analysis was conducted. Among all subjects, no significant association was found between lung cancer and gas welding fumes (OR = 1.1; 95% CI = 0.9–1.4) or arc welding fumes (OR = 1.0; 95% CI = 0.8–1.2). However, when restricting attention to light smokers, there was an increased risk of lung cancer in relation to gas welding fumes (OR = 2.9; 95% CI = 1.7–4.8) and arc welding fumes (OR = 2.3; 95% CI = 1.3–3.8), with even higher OR estimates among workers with the highest cumulative exposures. In conclusion, there was no detectable excess risk of lung cancer due to welding fumes among moderate to heavy smokers; but among light smokers we found an excess risk related to both types of welding fumes. PMID:23342253

  13. Exposure to welding fumes increases lung cancer risk among light smokers but not among heavy smokers: evidence from two case-control studies in Montreal.

    Science.gov (United States)

    Vallières, Eric; Pintos, Javier; Lavoué, Jérôme; Parent, Marie-Élise; Rachet, Bernard; Siemiatycki, Jack

    2012-08-01

    We investigated relationships between occupational exposure to gas and arc welding fumes and the risk of lung cancer among workers exposed to these agents throughout the spectrum of industries. Two population-based case-control studies were conducted in Montreal. Study I (1979-1986) included 857 cases and 1066 controls, and Study II (1996-2001) comprised 736 cases and 894 controls. Detailed job histories were obtained by interview and evaluated by an expert team of chemist-hygienists to estimate degree of exposure to approximately 300 substances for each job. Gas and arc welding fumes were among the agents evaluated. We estimated odds ratios (ORs) and 95% confidence intervals (CIs) of lung cancer using logistic regression, adjusting for smoking history and other covariates. The two studies provided similar results, so a pooled analysis was conducted. Among all subjects, no significant association was found between lung cancer and gas welding fumes (OR = 1.1; 95% CI = 0.9-1.4) or arc welding fumes (OR = 1.0; 95% CI = 0.8-1.2). However, when restricting attention to light smokers, there was an increased risk of lung cancer in relation to gas welding fumes (OR = 2.9; 95% CI = 1.7-4.8) and arc welding fumes (OR = 2.3; 95% CI = 1.3-3.8), with even higher OR estimates among workers with the highest cumulative exposures. In conclusion, there was no detectable excess risk of lung cancer due to welding fumes among moderate to heavy smokers; but among light smokers we found an excess risk related to both types of welding fumes.

  14. Conceptual obstacles to making use of four smoking-cessation strategies: What reasons do light smokers give for rejecting strategies?

    Science.gov (United States)

    Ryan, Michael P; Hinojosa, Jennifer J

    2015-07-01

    Some smokers have safety and cost concerns about nicotine replacement therapy which discourage its use. We recruited 56 young adult light smokers to read detailed descriptions of a hybrid nicotine replacement therapy, a prescription drug treatment, scheduled reduced smoking, and a menu of self-help tactics. Participants listed five reasons smokers might reject each strategy. An emergent-category content analysis classified each response with a high degree of inter-rater reliability. Only one-third of 32 concerns were strategy-specific; the majority focused on the general difficulty of quitting. Most prevalent were "continued cravings," "addiction too strong," "takes too long," and "won't work." These and other concerns reflect conceptual obstacles to be surmounted in smoking-cessation interventions.

  15. Light versus heavy smoking among African American men and women.

    Science.gov (United States)

    Businelle, Michael S; Kendzor, Darla E; Costello, Tracy J; Cofta-Woerpel, Ludmila; Li, Yisheng; Mazas, Carlos A; Vidrine, Jennifer Irvin; Reitzel, Lorraine R; Cinciripini, Paul M; Ahluwalia, Jasjit S; Wetter, David W

    2009-02-01

    The majority of smoking cessation research has focused on heavy smokers. African Americans (AA) are less likely than the general population to be heavy smokers. Thus, little is known about the smoking and psychosocial characteristics of lighter AA smokers. The present study compared the baseline demographic, smoking, and psychosocial characteristics of light (5-10 cigarettes per day; n=86) and moderate to heavy (>10 cigarettes per day; n=286) AA smokers enrolled in a smoking cessation clinical trial. Results indicated no differences between groups on demographic variables. However, light smokers (LS) were less dependent on smoking, reported more previous quit attempts, and had higher self-efficacy to quit than moderate to heavy smokers (MHS). On a measure of withdrawal, LS reported less pre-quit craving and less difficulty concentrating than MHS. In addition, LS reported lower perceived stress, fewer symptoms of depression, and greater positive affect than AA MHS. These findings highlight important similarities and differences between AA LS and MHS, and have implications for the treatment of AA smokers.

  16. Reasons for smoking among tri-ethnic daily and nondaily smokers.

    Science.gov (United States)

    Pulvers, Kim; Scheuermann, Taneisha S; Emami, Ashley S; Basora, Brittany; Luo, Xianghua; Khariwala, Samir S; Ahluwalia, Jasjit S

    2014-12-01

    Nondaily smokers experience adverse effects from tobacco use, yet they have been understudied compared to daily smokers. Understanding how reasons for smoking (RS) differ by smoking level, gender, and race/ethnicity could inform tailored interventions. A cross-sectional survey was administered through an online panel survey service to 2,376 current smokers who were at least 25 years of age. The sample was stratified to obtain equal numbers of 3 racial/ethnic groups (African American [AA], Latino, and White) across smoking level (native nondaily, converted nondaily, daily light, and daily moderate/heavy). A 7-factor structure of a 20-item Modified Reasons for Smoking Scale (MRSS) was confirmed (each subscale alpha > 0.80). Each factor of the MRSS varied by smoking level, with nondaily smokers endorsing all RS less frequently than daily smokers (p smoker subgroups incrementally differed from one another (p smokers. Males reported stronger RS on 5 out of 7 reasons (p Whites and AAs on all reasons (p .05). AAs and Whites were comparable on all RS (p > .05). The present study highlights considerable variability across smoking level, gender, and race/ethnicity in strength of RS. Addressing subgroup differences in RS may contribute to more sensitive and effective prevention and treatment efforts. © The Author 2014. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. VR light curves of AA Tau in 2007-2013 (Bouvier+, 2013) [Dataset

    NARCIS (Netherlands)

    Bouvier, J.; Grankin, K.; Ellerbroek, L.; Bouy, H.; Barrado, D.

    2013-01-01

    Optical observations of AA Tau were obtained at the Crimean Astrophysical Observatory (CrAO) from October 2007 to February 2013. Additional BVRcIc photometry was obtained on December 23, 2011 using the Cafos focal reducer in direct imaging mode with CCD SITE1d 15 on the 2.2m Calar Alto Telescope.

  18. A Qualitative Study of Smoker Identity Among College Student Smokers.

    Science.gov (United States)

    Rosa, Juliana D; Aloise-Young, Patricia

    2015-01-01

    This research was motivated by findings that college students who smoke cigarettes often self-categorize as nonsmokers, that is, they reject the social identity of "smoker." The goal of the present study was to shed light on college students' smoker identities beyond the smoker/nonsmoker dichotomy. Focus groups were conducted to investigate how college students categorize their own smoking patterns and to identify what behaviors and attitudes are associated with these different categories of smoker identities. Forty-one students from a western university participated in this study in November 2011. The focus group results indicated that there were five distinct smoker identities on campus. Light and regular smokers were the daily smoker identities present, while stress, social, and drunk smokers were the occasional smoker identities. Moreover, each of these smoker identities was defined by a unique pattern of smoking behavior, attitudes, and motives. These findings support the notion that there are different types of smokers, both daily and occasional, in the college population. We suggest that researchers, healthcare providers, and prevention/intervention programs may all benefit from distinguishing between these different types of smokers.

  19. Risk perception and intention to quit among a tri-ethnic sample of nondaily, light daily, and moderate/heavy daily smokers.

    Science.gov (United States)

    Savoy, Elaine; Reitzel, Lorraine R; Scheuermann, Taneisha S; Agarwal, Mohit; Mathur, Charu; Choi, Won S; Ahluwalia, Jasjit S

    2014-10-01

    Although the relationship between risk perceptions and quit intentions has been established, few studies explore the potential impact of smoking level on these associations, and none have done so among diversely-aged samples of multiple ethnicities. Participants, ranging in age from 25 to 81, were 1133 nondaily smokers (smoked ≥1 cigarette on 4 to 24days in the past 30days), 556 light daily smokers (≤10 cigarettes per day), and 585 moderate to heavy daily smokers (>10 cigarettes per day). Each smoking level comprised approximately equal numbers of African Americans, Latinos, and Whites. A logistic regression analysis, adjusted for sociodemographics, self-rated health, time to the first cigarette of the day and smoking level, was used to examine the association between risk perception (perceived risk of acquiring lung cancer, lung disease, and heart disease) and intention to quit (≤6months versus >6months/never). A second adjusted model tested moderation by smoking level with an interaction term. Greater risk perception was associated with a higher odds of planning to quit within 6months (AOR=1.34, CI.95=1.24, 1.45). Smoking level did not moderate this association (p=.85). Results suggest that educating all smokers, irrespective of their smoking level, about increased risk of developing smoking-related diseases might be a helpful strategy to enhance their intention to make a smoking quit attempt. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Michelson interferometer design for Linac Coherent Light Source (LCLS) applications in the 15-1.5 Aa wavelength range

    International Nuclear Information System (INIS)

    Tatchyn, Roman

    2000-01-01

    In recent years the continuing development of linac-driven X-Ray Free Electron Laser (XRFEL) designs has significantly expanded the parameter space associated with 3rd and earlier-generation synchrotron radiation sources. In particular, in contrast to the >100 ps pulse durations typical of storage rings, temporal lengths extending down to the <100 fs regime will become available. For example, for the SLAC Linac Coherent Light Source (LCLS) a pulse duration of ∼200-300 fs with finer temporal features extending down to ∼1 fs is anticipated. The characterization of the phase space distributions of such pulses poses a significant challenge for instrumentation design both with regard to the brevity of the pulse structure as well as the X-ray (15-1.5 Aa) wavelength range of the FEL line. In this paper we assess a Michelson interferometer design aimed at characterizing the coherence length of the SLAC LCLS and discuss considerations related to its operation

  1. AA Index

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  2. Abia, AA

    African Journals Online (AJOL)

    Abia, AA. Vol 4, No 6 (2010) - Articles Studies on the kinetics and intraparticle diffusivities of BOD, colour and TSS reduction from palm oil mill effluent (POME) using boiler fly ash. Abstract PDF. ISSN: 1996-0786. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More ...

  3. Adejumo, AA

    African Journals Online (AJOL)

    Adejumo, AA. Vol 6, No 2 (2014) - Articles Assessment of Tourists Flow and Revenue Generation in Kainji Lake National Park, Nigeria Abstract PDF. ISSN: 2141-1778. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and ...

  4. Adepeju, AA

    African Journals Online (AJOL)

    Adepeju, AA. Vol 19, No 2 (2010) - Articles Assessment of Ethical and Other Professional Standards in Private Medical Laboratories; Osun State Experience. Abstract. ISSN: 1116-1043. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  5. Wornyo, AA

    African Journals Online (AJOL)

    Wornyo, AA. Vol 2, No 1 (2012) - Articles Addressing the Difficulties of Learners in the Reading Class Abstract. ISSN: 2026-6081. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use · Contact AJOL ...

  6. Smokers at Risk.

    Science.gov (United States)

    Wilner, Susan

    1984-01-01

    Discusses current information on the health consequences of smoking and two types of risks: those associated with all smokers and the higher risks associated with other characteristics, such as to pregnant women, teenagers, heavy smokers, those with cardiovascular disease, users of alcohol, and smokers in certain occupations. (SK)

  7. Adult Cigarette Smokers at Highest Risk for Concurrent Alternative Tobacco Product Use Among a Racially/Ethnically and Socioeconomically Diverse Sample.

    Science.gov (United States)

    Nollen, Nicole L; Ahluwalia, Jasjit S; Lei, Yang; Yu, Qing; Scheuermann, Taneisha S; Mayo, Matthew S

    2016-04-01

    Rates of alternative tobacco product use (ATPs; eg, cigars, cigarillos, pipes) among cigarette smokers are on the rise but little is known about the subgroups at highest risk. This study explored interactions between demographic, tobacco, and psychosocial factors to identify cigarette smokers at highest risk for ATP use from a racially/ethnically and socioeconomically diverse sample of adult smokers across the full smoking spectrum (nondaily, daily light, daily heavy). Two-thousand three-hundred seventy-six adult cigarette smokers participated in an online cross-sectional survey. Quotas ensured equal recruitment of African American (AA), white (W), Hispanic/Latino (H) as well as daily and nondaily smokers. Classification and Regression Tree modeling was used to identify subgroups of cigarette smokers at highest risk for ATP use. 51.3% were Cig+ATP smokers. Alcohol for men and age, race/ethnicity, and discrimination for women increased the probability of ATP use. Strikingly, 73.5% of men screening positive for moderate to heavy drinking and 62.2% of younger (≤45 years) African American/Hispanic/Latino women who experienced regular discrimination were Cig+ATP smokers. Screening for concurrent ATP use is necessary for the continued success of tobacco cessation efforts especially among male alcohol users and racial/ethnic minority women who are at greatest risk for ATP use. © The Author 2015. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. COPD in Never Smokers

    Science.gov (United States)

    McBurnie, Mary Ann; Vollmer, William M.; Gudmundsson, Gunnar; Welte, Tobias; Nizankowska-Mogilnicka, Ewa; Studnicka, Michael; Bateman, Eric; Anto, Josep M.; Burney, Peter; Mannino, David M.; Buist, Sonia A.

    2011-01-01

    Background: Never smokers comprise a substantial proportion of patients with COPD. Their characteristics and possible risk factors in this population are not yet well defined. Methods: We analyzed data from 14 countries that participated in the international, population-based Burden of Obstructive Lung Disease (BOLD) study. Participants were aged ≥ 40 years and completed postbronchodilator spirometry testing plus questionnaires about respiratory symptoms, health status, and exposure to COPD risk factors. A diagnosis of COPD was based on the postbronchodilator FEV1/FVC ratio, according to current GOLD (Global Initiative for Obstructive Lung Disease) guidelines. In addition to this, the lower limit of normal (LLN) was evaluated as an alternative threshold for the FEV1/FVC ratio. Results: Among 4,291 never smokers, 6.6% met criteria for mild (GOLD stage I) COPD, and 5.6% met criteria for moderate to very severe (GOLD stage II+) COPD. Although never smokers were less likely to have COPD and had less severe COPD than ever smokers, never smokers nonetheless comprised 23.3% (240/1,031) of those classified with GOLD stage II+ COPD. This proportion was similar, 20.5% (171/832), even when the LLN was used as a threshold for the FEV1/FVC ratio. Predictors of COPD in never smokers include age, education, occupational exposure, childhood respiratory diseases, and BMI alterations. Conclusion: This multicenter international study confirms previous evidence that never smokers comprise a substantial proportion of individuals with COPD. Our data suggest that, in addition to increased age, a prior diagnosis of asthma and, among women, lower education levels are associated with an increased risk for COPD among never smokers. PMID:20884729

  9. Diverging effects of nicotine on motor learning performance: Improvement in deprived smokers and attenuation in non-smokers.

    Science.gov (United States)

    Grundey, J; Amu, R; Batsikadze, G; Paulus, W; Nitsche, M A

    2017-11-01

    Nicotine modulates cognition and neuroplasticity in smokers and non-smokers. A possible mechanism for its effect on learning and memory performance is its impact on long-term potentiation (LTP) and long-term depression (LTD). As neuroplasticity is closely connected to learning processes, we aimed to explore the effect of nicotine in healthy, young smokers and non-smokers on performance of the serial reaction time task (SRTT), a sequential motor learning paradigm. 20 nicotine-deprived smokers and 20 non-smokers participated in the study and were exposed to nicotine or placebo medication. Deprived smokers under placebo medication displayed reduced performance in terms of reaction time and error rates compared to the non-smoking group. After application of nicotine, performance in smokers improved while it deteriorated in non-smokers. These results indicate a restituting effect of nicotine in smokers in terms of cognitive parameters. This sheds further light on the proposed mechanism of nicotine on learning processes, which might be linked to the addictive component of nicotine, the probability of relapse and thus needs also be addressed in cessation treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Classifying a smoker scale in adult daily and nondaily smokers.

    Science.gov (United States)

    Pulvers, Kim; Scheuermann, Taneisha S; Romero, Devan R; Basora, Brittany; Luo, Xianghua; Ahluwalia, Jasjit S

    2014-05-01

    Smoker identity, or the strength of beliefs about oneself as a smoker, is a robust marker of smoking behavior. However, many nondaily smokers do not identify as smokers, underestimating their risk for tobacco-related disease and resulting in missed intervention opportunities. Assessing underlying beliefs about characteristics used to classify smokers may help explain the discrepancy between smoking behavior and smoker identity. This study examines the factor structure, reliability, and validity of the Classifying a Smoker scale among a racially diverse sample of adult smokers. A cross-sectional survey was administered through an online panel survey service to 2,376 current smokers who were at least 25 years of age. The sample was stratified to obtain equal numbers of 3 racial/ethnic groups (African American, Latino, and White) across smoking level (nondaily and daily smoking). The Classifying a Smoker scale displayed a single factor structure and excellent internal consistency (α = .91). Classifying a Smoker scores significantly increased at each level of smoking, F(3,2375) = 23.68, p smoker identity, stronger dependence on cigarettes, greater health risk perceptions, more smoking friends, and were more likely to carry cigarettes. Classifying a Smoker scores explained unique variance in smoking variables above and beyond that explained by smoker identity. The present study supports the use of the Classifying a Smoker scale among diverse, experienced smokers. Stronger endorsement of characteristics used to classify a smoker (i.e., stricter criteria) was positively associated with heavier smoking and related characteristics. Prospective studies are needed to inform prevention and treatment efforts.

  11. Aa Ah Nak

    Science.gov (United States)

    Tha, Na Gya; Wus, Thay

    2017-01-01

    In this article, Aa Ah Nak, the authors' methodology presents not only various reflections but also diverse contradictions about the Aa Nii language as well as language revitalization. This article explores language foundation and how the Aa Nii language revitalization is inextricably linked to the genocide and resulting historic trauma pervasive…

  12. AA under construction

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The AA at an early stage of construction, in the newly built AA-Hall. Cable-trays already outline the shape of the accumulator ring. To the right are huge cable-drums for the pulse-forming-network (PFN) of the injection kicker. Seeing this picture, can one imagine that only 8 months later beams were circulating in the completed accumulator ring ?

  13. Screening of oral premalignant lesions in smokers using toluidine blue

    Directory of Open Access Journals (Sweden)

    Yanti Leosari

    2009-06-01

    Full Text Available Background: A smoker is associated with the risk of developing oral premalignant lesions due to the cacinogenic contents in cigarette. Toluidine blue is a basic chromatic dye used in screening the presence of premalignant lesions due to its ability to detect acidic components in cells and tissues. Purpose: This study was purposed to observe the outcomes of toluidine blue staining on oral mucosa of smokers and non smokers and to find out whether quantity and duration of smoking affect the final results of toluidine blue staining. Methods: Forty male subjects, aged 20-60 years old were involved in this study, consisted of 10 heavy smokers, 10 moderate smokers, 10 light smokers and 10 non smokers. Subjects were instructed to rinse their mouths with mineral water for 20 seconds followed by acetic acid 1% for another 20 seconds. Toluidine blue stain was applied in excess and left on site for 1 minute. Subjects were instructed to rinse with acetic acid 1% and sufficient water consecutively for 20 seconds each. The areas of oral mucosa that stained blue were captured with intraoral camera and transferred to the computer unit. The staining procedure was repeated after 14 days. Results: Chi-square test showed that toluidine blue positive staining dominates the smokers group. Regression and correlation test indicate that Toluidine blue staining is more obvious in subjects who consume more cigarettes. Conclusion: It was concluded that oral mucosa of smokers absorbed more toluidine blue than that of non smokers and retention of toluidine blue is affected by quantity and duration of smoking.

  14. Lighting

    Data.gov (United States)

    Federal Laboratory Consortium — Lighting Systems Test Facilities aid research that improves the energy efficiency of lighting systems. • Gonio-Photometer: Measures illuminance from each portion of...

  15. Low Cotinine Glucuronidation Results in Higher Serum and Saliva Cotinine in African American Compared to White Smokers.

    Science.gov (United States)

    Murphy, Sharon E; Sipe, Christopher J; Choi, Kwangsoo; Raddatz, Leah M; Koopmeiners, Joseph S; Donny, Eric C; Hatsukami, Dorothy K

    2017-07-01

    Background: Tobacco exposure is often quantified by serum or saliva concentrations of the primary nicotine metabolite, cotinine. However, average cotinine concentrations are higher in African Americans (AA) compared with Whites with similar smoking levels. Cotinine is metabolized by UGT2B10 and CYP2A6, and low UGT2B10 activity is common in AA, due to the prevalence of a UGT2B10 splice variant. Methods: UGT2B10 activity was phenotyped in 1,446 smokers (34% AA) by measuring the percentage of cotinine excreted as a glucuronide. Urinary total nicotine equivalents (TNE), the sum of nicotine and 6 metabolites, were determined to quantify smoking dose, and cotinine and 3'-hydroxycotinine were quantified in saliva (study 1) or serum (study 2). Results: Ninety-seven smokers (78% AA) were null for UGT2B10 activity, and the saliva and serum cotinine levels, after adjustment for TNE and cigarettes per day (CPD), were 68% and 48% higher in these smokers compared with nonnull smokers ( P White smokers, but with additional adjustment for UGT2B10 activity, there were no significant differences in saliva and serum cotinine concentrations between these two groups. Conclusions: UGT2B10 activity significantly influences plasma cotinine levels, and higher cotinine concentrations in AA versus White smokers (after adjustment for smoking dose) result from lower levels of UGT2B10-catalyzed cotinine glucuronidation by AA. Impact: UGT2B10 activity or genotype should be considered when using cotinine as a tobacco exposure biomarker, particularly in populations such as AA with high frequencies of UGT2B10 nonfunctional variants. Cancer Epidemiol Biomarkers Prev; 26(7); 1093-9. ©2017 AACR . ©2017 American Association for Cancer Research.

  16. Light

    DEFF Research Database (Denmark)

    Prescott, N.B.; Kristensen, Helle Halkjær; Wathes, C.M.

    2004-01-01

    This chapter presents the effect of artificial light environments (light levels, colour, photoperiod and flicker) on the welfare of broilers in terms of vision, behaviour, lameness and mortality......This chapter presents the effect of artificial light environments (light levels, colour, photoperiod and flicker) on the welfare of broilers in terms of vision, behaviour, lameness and mortality...

  17. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  18. Delay and probability discounting of multiple commodities in smokers and never-smokers using multiple-choice tasks.

    Science.gov (United States)

    Poltavski, Dmitri V; Weatherly, Jeffrey N

    2013-12-01

    The purpose of the present study was to investigate temporal and probabilistic discounting in smokers and never-smokers, across a number of commodities, using a multiple-choice method. One hundred and eighty-two undergraduate university students, of whom 90 had never smoked, 73 were self-reported light smokers (commodities and administered in a multiple-choice format. In addition to cigarettes, monetary rewards, and health outcomes, the tasks included novel commodities such as ideal dating partner and retirement income. The results showed that heavy smokers probability discounted commodities at a significantly shallower rate than never-smokers, suggesting greater risk-taking. No effect of smoking status was observed for delay discounting questions. The only commodity that was probability discounted significantly less than others was 'finding an ideal dating partner'. The results suggest that probability discounting tasks using the multiple-choice format can discriminate between non-abstaining smokers and never-smokers and could be further explored in the context of behavioral and drug addictions.

  19. COPD: recognizing the susceptible smoker

    NARCIS (Netherlands)

    Hoonhorst, Susan

    2014-01-01

    Smoking is the main cause of COPD, a chronic non-curable lung disease. Not all smokers develop COPD and it is still unclear why COPD is only manifested in a small subset of smokers (15-20%). Probably their genetic background makes the difference. We investigated whether young individuals (18-40

  20. Geomagnetic aa Indices

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  1. Intent to quit, quit attempts, and perceived health risk reduction among African American, Latino, and White nondaily and daily smokers in the United States.

    Science.gov (United States)

    Scheuermann, Taneisha S; Nollen, Nicole L; Luo, Xianghua; Cox, Lisa Sanderson; Ahluwalia, Jasjit S

    2017-10-16

    Ethnic and racial differences in smoking patterns and behaviors have been well documented and most African American and Latino smokers are nondaily or light smokers. However, differences within smoking levels are understudied. Our primary aim was to determine whether there are racial and ethnic differences among African American, Latino, and White nondaily, light daily, and moderate to heavy daily smokers on (1) perceived health risk reduction, (2) intentions to quit, and (3) past year quit attempts. Smokers were recruited through an online research panel for a cross-sectional survey (n = 2376). Sampling quotas were used to obtain equal numbers of African American, Latino, and White nondaily and daily smokers. African American (59.6%) and Latino (54%) nondaily smokers were more likely than White nondaily smokers (45%) to currently limit their cigarettes per day (cpd) as a perceived health risk reduction strategy (p smokers were more likely than Latino and White nondaily smokers (p smokers (15%) were more likely than either Latinos (7.8%) or Whites (8.5%) to intend to quit in the next 30 days (p smokers were more likely than Whites (49%) to have made a quit attempt in the past year (p smokers. Racial and ethnic group differences were more pronounced among nondaily smokers compared to light daily smoker and moderate to heavy daily smokers. Smoking level is an important consideration in understanding racial and ethnic variation in perceived health risk reduction and cessation-related behaviors.

  2. The influence of smokers' degree of dependence on the effectiveness of message framing for capturing smokers for a Quitline.

    Science.gov (United States)

    Szklo, André Salem; Coutinho, Evandro Silva Freire

    2010-06-01

    Smoking is a worldwide public health problem, and various communication strategies aimed at its cessation have been used. The objective of this paper was to explore differences over time of two communication strategies (gain-framed versus loss-framed) in encouraging calls to a Quitline, according to smoker's degree of dependence. A study was conducted for four weeks among passengers of two selected subway stations in the city of Rio de Janeiro-Brazil (N(average) = 12,500 passengers a day per station). The interventions - large posters with images and text based on central theme "shortness-of-breath" - also contained the Quitline number. Call rate differences between the strategies, overall and specific per study week, were calculated. Light smokers exposed to the positive-content message called on average 2.2 times more often than those exposed to the negative-content message (p < 0.001). The absolute difference in call rates decreased after the first week of the study (p for the additive interaction between intervention and study week, 0.02). For heavy smokers, no differences between the two stations were observed. Additive interaction was found between type of smoker - light or heavy - and intervention (p = 0.02). The results suggest that short-term positive-content campaigns based on issues pertaining to individuals' daily routine could be effective in capturing light smokers. These results may have considerable public health impact, as the prevalence of less dependent smokers is much higher than that of heavier smokers. Copyright 2010 Elsevier Ltd. All rights reserved.

  3. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    University of Wisconsin-Madison. Bechtol spoke about the recent discovery of new satellite galaxies of the Milky Way. Dwarf galaxies orbiting the Milky Way are often hard to spot because they are so faint while globular clusters have mass-to-light ratios of around 1, the ultra-faint satellites around the Milky Way can have mass-to-light ratios of hundreds or thousands! A combination of better facilities and improved analysis techniques has been lengthening the list of known Milky Way satellites, however: SDSS took us from ~10 to ~30 in the last ten years, and facilities like the Dark Energy Survey Camera (DES), Pan-STARRS 1, SkyMapper, and Hyper Suprime-Cam pushed that number to ~50 in 2015.Bechtol plenary on the discovery of new MW satellites #aas227 pic.twitter.com/3GH0Sd2J8c Matthias Steinmetz (@GalacticRAVE) January 8, 2016The new candidates discovered with DES are all less luminous and more distant than previous satellites found. One interesting aspect of this sample is that 15/17 of the candidates fall in the southern half of the DES footprint, and are located near the Large and Small Magellanic Clouds. This anisotropy is not thought to be a selection effect so is it coincidence, or could they possibly be satellites of satellites? Were not sure yet!Why do we care about finding Milky Way satellites? There are lots of reasons, but one of the biggest is that they may help us to unravel some of the mysteries of dark matter. These faint-but-massive galaxies were probably born in the Milky Ways dark-matter halo, and they could be great places to indirectly detect dark matter. In addition, theres the missing satellite problem the phenomenon wherein the cold-dark-matter model predicts there should be hundreds of satellites around the Milky Way, yet weve only found a few dozen. Finding more of these galaxies would help clear up whether its the theory or the observations that are wrong.One more time, it shouldnt be called the Missing Satellite Problem. The theorists have a

  4. Periodontal tissue damage in smokers

    Directory of Open Access Journals (Sweden)

    Hutojo Djajakusuma

    2006-09-01

    Full Text Available Dental plaque is the primary etiological factor in periodontal diseases. However, there are many factors that can modify how an individual periodontal tissue will respond to the accumulation of dental plaque. Among such risk factors, there is increasing evidence that smoking tobacco products alters the expression and rate of progression of periodontal diseases. The aim of this study was to find out the loss of periodontal tissue adhesion in smokers by measuring pocket depth using probe, and by measuring alveolar bone damage using Bone Loss Score (BLS radiographic methods on teeth 12, 11, 21, 22, 32, 31, 41, 42. Based on T Test statistical analysis, there were significant differences in pocket depth damage of alveolar bone in smokers and non smokers. In conclusion there were increasing pocket depth and alveolar bone damage in smokers.

  5. Light

    CERN Document Server

    Robertson, William C

    2003-01-01

    Why is left right and right left in the mirror? Baffled by the basics of reflection and refraction? Wondering just how the eye works? If you have trouble teaching concepts about light that you don t fully grasp yourself, get help from a book that s both scientifically accurate and entertaining with Light. By combining clear explanations, clever drawings, and activities that use easy-to-find materials, this book covers what science teachers and parents need to know to teach about light with confidence. It uses ray, wave, and particle models of light to explain the basics of reflection and refraction, optical instruments, polarization of light, and interference and diffraction. There s also an entire chapter on how the eye works. Each chapter ends with a Summary and Applications section that reinforces concepts with everyday examples. Whether you need a deeper understanding of how light bends or a good explanation of why the sky is blue, you ll find Light more illuminating and accessible than a college textbook...

  6. Fred-Jaiyesimi, AA

    African Journals Online (AJOL)

    Fred-Jaiyesimi, AA. Vol 12 (2008) - Articles Hypoglycaemic And Alpha-Amylase Inhibitory Activities Of Fermented Seeds Of Parkia Biglobosa (Jacq) Benth Abstract. ISSN: 1118-6267. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  7. Light

    CERN Document Server

    Rivera, Andrea

    2017-01-01

    Light is all around us. Learn how it is used in art, technology, and engineering. Five easy-to-read chapters explain the science behind light, as well as its real-world applications. Vibrant, full-color photos, bolded glossary words, and a key stats section let readers zoom in even deeper. Aligned to Common Core Standards and correlated to state standards. Abdo Zoom is a division of ABDO.

  8. AL SAHLI, AA; OKOLI, JU

    African Journals Online (AJOL)

    ADOWIE PERE

    bioline.org.br/ja. The Use of Soil Palynomorphs in Forensics. *. 1. ABDULRAHAMAN, AA;. 2. AL SAHLI, AA;. 1. OKOLI, JU. 1Applied Plant Anatomy and Wood Technology Laboratory, Department of Plant Biology, University of Ilorin, Ilorin, Nigeria.

  9. Oral candidal species among smokers and non-smokers

    International Nuclear Information System (INIS)

    Rasool, S.; Siar, C.H.; Ng, K.P.

    2005-01-01

    Objective: To determine the various oral Candidal species among healthy Malaysian adults. Design: Case-control study. Place and Duration of Study: This study was collaborated between the Department of Medical Microbiology, Faculty of Medicine and Department of Oral Pathology, Oral Medicine and Periodontology, Faculty of Dentistry, University of Malaysia, Kuala Lumpur, Malaysia, between September 2002 till January 2004. Patients and Methods: One hundred adults (50 smokers and 50 non-smokers), aged between 40 and 70 years were studied. Swabs and carbohydrate assimilation (Saboraud Dextrose Agar, Corn Meal Agar, API 20C AUX System) were performed. Specimens were collected from dorsum of the tongue, buccal mucosa and commissures (right and left each). Colony forms were established by positive colony forming units, on SDA medium (24-48 hours). Germ tube test for (true/pseudohyphae) growth was done on Corn Meal Agar Medium, candida biotypes were evaluated by API 20C AUX system, which had a numerical 7 digit profile, added to evaluate a definite candida species. Results: Thirty-five percent of Malaysian adults harbored Candida intraorally. Candida species identified among 100 subjects had C. albicans (27) 77%, C. glabrata (3) 8%, C. famata, C. tropicalis, C. krusei, C. lusitaniae and C. guillermondii (1) 3% each. Thirty-three positive cases comprised of 35 species i.e. two cases had two species each. Fifty-seven percent of these were smokers and 43% non-smokers. These included 40% Chinese, 36% Malays and 24% Indians. Species were, however, not specified according to intra-oral sites i.e. buccal, commissural mucosa and sorsum of tongue. Conclusion: On this series C. albicans is the most common specie found in the oral cavity of Malaysian adults. It is equally frequent in smokers and non-smokers, but showed a prediliection for the ethnic Chinese group. (author)

  10. Social Smoking among Intermittent Smokers

    Science.gov (United States)

    Shiffman, Saul; Li, Xiaoxue; Dunbar, Michael S.; Ferguson, Stuart G.; Tindle, Hilary A.; Scholl, Sarah M.

    2015-01-01

    Background “Social smoking” - smoking mostly or even only with others – may be an important pattern that implies smoking motivated extrinsically by social influences. Non-daily smokers (intermittent smokers; ITS) are often assumed to be social smokers, with some authors even assuming that all ITS are social smokers (SS+). We sought to identify and characterize social smokers in a sample of ITS. Methods 204 adult ITS (smoking 4–27 days/month) recorded the circumstances of smoking in their natural settings using Ecological Momentary Assessment, while also recording their circumstances in nonsmoking moments. SS+ were defined as ITS who were with others when they smoked most of their cigarettes, and who were ≥ 50% more likely to be with others when smoking than when not. Results Only 13% of ITS were SS+. Although defined solely on the basis of presence of others, SS+ showed a distinct pattern of smoking across multiple dimensions: Compared to other ITS (who were significantly less likely to smoke when with others), SS+ smoking was more associated with socializing, being with friends and acquaintances, drinking alcohol, weekends, evening or nighttime, being in other people’s homes, but not their own home. SS+ smoking was low in the morning and increased in the evening. SS+ smoked fewer days/week and were less dependent, but did not differ demographically. Conclusions Social smoking does constitute a highly distinct smoking pattern, but is not common among adult ITS. PMID:26205313

  11. Light

    CERN Document Server

    Ditchburn, R W

    1963-01-01

    This classic study, available for the first time in paperback, clearly demonstrates how quantum theory is a natural development of wave theory, and how these two theories, once thought to be irreconcilable, together comprise a single valid theory of light. Aimed at students with an intermediate-level knowledge of physics, the book first offers a historical introduction to the subject, then covers topics such as wave theory, interference, diffraction, Huygens' Principle, Fermat's Principle, and the accuracy of optical measurements. Additional topics include the velocity of light, relativistic o

  12. Systemic AA amyloidosis: epidemiology, diagnosis, and management.

    Science.gov (United States)

    Real de Asúa, Diego; Costa, Ramón; Galván, Jose María; Filigheddu, María Teresa; Trujillo, Davinia; Cadiñanos, Julen

    2014-01-01

    The term "amyloidosis" encompasses the heterogeneous group of diseases caused by the extracellular deposition of autologous fibrillar proteins. The global incidence of amyloidosis is estimated at five to nine cases per million patient-years. While amyloid light-chain (AL) amyloidosis is more frequent in developed countries, amyloid A (AA) amyloidosis is more common in some European regions and in developing countries. The spectrum of AA amyloidosis has changed in recent decades owing to: an increase in the median age at diagnosis; a percent increase in the frequency of primary AL amyloidosis with respect to the AA type; and a substantial change in the epidemiology of the underlying diseases. Diagnosis of amyloidosis is based on clinical organ involvement and histological evidence of amyloid deposits. Among the many tinctorial characteristics of amyloid deposits, avidity for Congo red and metachromatic birefringence under unidirectional polarized light remain the gold standard. Once the initial diagnosis has been made, the amyloid subtype must be identified and systemic organ involvement evaluated. In this sense, the (123)I-labeled serum amyloid P component scintigraphy is a safe and noninvasive technique that has revolutionized the diagnosis and monitoring of treatment in systemic amyloidosis. It can successfully identify anatomical patterns of amyloid deposition throughout the body and enables not only an initial estimation of prognosis, but also the monitoring of the course of the disease and the response to treatment. Given the etiologic diversity of AA amyloidosis, common therapeutic strategies are scarce. All treatment options should be based upon a greater control of the underlying disease, adequate organ support, and treatment of symptoms. Nevertheless, novel therapeutic strategies targeting the formation of amyloid fibrils and amyloid deposition may generate new expectations for patients with AA amyloidosis.

  13. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  14. AA, bending magnet, BLG

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The very particular lattice of the AA required 2 types of dipole (bending magnets; BLG, long and narrow; BST, short and wide). The BLG had a steel length of 4.70 m, a good field width of 0.24 m, and a weight of about 70 t. Jean-Claude Brunet inspects the lower half of a BLG. For the BST magnets see 7811105 and 8006036.

  15. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  16. Health care institutions should not exclude smokers from employment.

    Science.gov (United States)

    Huddle, Thomas S; Kertesz, Stefan G; Nash, Ryan R

    2014-06-01

    Some health care institutions, including academic health centers, have adopted policies excluding smokers from employment. Claims advanced on behalf of these policies include financial savings from reduced health costs and absenteeism as well as advantages consonant with their message of healthy living. The authors suggest that the institutional savings from these policies are speculative and unproven. Also, in settings where large medical schools operate, it is likely to be the poor, including members of minority groups, who, under an employee smoker ban, will lose the opportunity to work for an employer that offers health insurance and other benefits. In response to the incentives created by such bans, some will quit smoking, but most will not. Thus, at the community level, employee smoker bans are more likely to be harmful than beneficial.Although private businesses may rightly choose not to hire smokers in the 19 states where such policies are legal, health care institutions, including academic health centers, should consider hiring choices in light of the values they profess. The traditional values of medicine include service to all persons in need, even when illness results from addiction or unsafe behavior. Secular academic communities require a shared dedication to discovery without requiring strict conformity of private behavior or belief. The authors conclude that for health care institutions, policies of hiring smokers and helping them to quit are both prudent and expressive of the norms of medical care, such as inclusion, compassion, and fellowship, that academic health professionals seek to honor.

  17. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    ?).Peebles: expect surprises and think outside the box yes! #aas228 Kevin Schawinski (@kevinschawinski) June 15, 2016His comparison of local vs. high-redshift cosmology in terms of scales of problems was outstanding, and he encouraged the audience and the community to keep an open mind. After all, in Sean Carrolls words, we do live in a preposterous universe, and the time is almost right to explain it all.This The Limits of Scientific Cosmology series at #aas228 has been absolutely fantastic. @AAS_Office please put videos on youtube! Kevin Schawinski (@kevinschawinski) June 15, 2016Press Conference Black Holes and Gamma-Ray Bursts (by Susanna Kohler)The final press conference of the meeting covered three topics from the categories of black holes and gamma-ray bursts.Fred Rasio (CIERA/Northwestern University) opened the conference with a discussion of how the systems that LIGO detected might have formed. There are two primary models for how these black-hole binaries are created. In the first, they start out as binary systems of two massive stars. If the binary survives the process of both stars collapsing into black holes, then a binary black hole system results.Rasio focused on the second theory, in which that black holes are formed in dense stellar clusters. These black holes then sink (via dynamical friction) to the centers of the clusters like dust particles settling on the floor of a room, where they form binaries in a black hole mosh pit eventually getting kicked out of the cluster by dynamical interactions. You can read more about their research in the press release here.Rasio presents a pretty awesome animation of this black hole mosh pit. https://t.co/AkewctI7uK#aas228 astrobites (@astrobites) June 15, 2016The effects of a spinning black hole on the spacetime around it. [J.P. Eekels J.M. Overduin]Next up was Richard Henry (Johns Hopkins University), who spoke about the internal structure of spinning black holes (known as Kerr black holes). Because no light can escape from

  18. Smoker Identity Development among Adolescents who Smoke

    Science.gov (United States)

    Hertel, Andrew W.; Mermelstein, Robin J.

    2016-01-01

    Adolescents who smoke are more likely to escalate their smoking frequency if they believe smoking is self-defining. Knowing factors that are associated with development of a smoker identity among adolescents who smoke may help to identify who will become a regular smoker. We investigated whether smoker identity development is associated with internal and external motives for smoking. For comparison, we also investigated whether social smoker identity development is associated with internal and external motives for smoking. Adolescents who smoke (n = 292) completed measures of smoker and social smoker identity, internal motives for smoking (negative affect coping, positive affect enhancement), and external motives for smoking (social fit) at baseline, 6-, 15-, and 24-month assessments of an ongoing longitudinal study of smoking patterns. We examined whether change in smoker and social smoker identity from 6 to 24 months was associated with change in motives at earlier assessment waves. We also explored whether gender moderated these relationships. Increases in negative affect coping motives were associated with smoker identity development among both males and females. Increases in social motives were associated with smoker identity development among males, and increases in negative affect coping motives were associated with social smoker identity development among females. Smoker and social smoker identities are signaled by negative affect coping as well as social motives for smoking. PMID:27136374

  19. Secondhand smoke exposure and serum cotinine levels among current smokers in the USA.

    Science.gov (United States)

    Lindsay, Ryan P; Tsoh, Janice Y; Sung, Hai-Yen; Max, Wendy

    2016-03-01

    Secondhand smoke (SHS) likely provides additional exposure to nicotine and toxins for smokers, but has been understudied. Our objective was to determine whether SHS exposure among smokers yields detectable differences in cotinine levels compared with unexposed smokers at the population level. Using the US National Health and Nutrition Examination Survey (NHANES) for the years 1999-2012, we compared serum cotinine levels of 4547 current adult cigarette smokers stratified by self-reported SHS exposure sources (home and/or work) and smoking intensity. A weighted multivariable linear regression model determined the association between SHS exposure and cotinine levels among smokers. Smokers with SHS exposure at home (43.8%) had higher cotinine levels (β=0.483, p≤0.001) compared with those with no SHS exposure at home after controlling for the number of cigarettes smoked per day and number of days smoked in the previous 5 days, survey year, age, gender and education. Smokers with SHS exposure at work (20.0%) did not have significantly higher cotinine levels after adjustment. The adjusted geometric mean cotinine levels of light smokers (1-9 cigarettes per day) with no SHS exposure, exposure at work only, home only, and both home and work were 52.0, 62.7, 67.2, 74.4 ng/mL, respectively, compared with 219.4, 220.9, 255.2, 250.5 ng/mL among moderate/heavy smokers (≥10 cigarettes per day). Smokers living in residences where others smoke inside the home had significantly higher cotinine levels than smokers reporting no SHS exposure, regardless of individual smoking intensity. Future research should target the role that SHS exposure may have in nicotine dependence, cessation outcomes and other health impacts among smokers. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  20. Identity change among smokers and ex-smokers: Findings from the ITC Netherlands Survey.

    Science.gov (United States)

    Meijer, Eline; van Laar, Colette; Gebhardt, Winifred A; Fokkema, Marjolein; van den Putte, Bas; Dijkstra, Arie; Fong, Geoffrey T; Willemsen, Marc C

    2017-06-01

    Successful smoking cessation appears to be facilitated by identity change, that is, when quitting or nonsmoking becomes part of smokers' and ex-smokers' self-concepts. The current longitudinal study is the first to examine how identity changes over time among smokers and ex-smokers and whether this can be predicted by socioeconomic status (SES) and psychosocial factors (i.e., attitude, perceived health damage, social norms, stigma, acceptance, self-evaluative emotions, health worries, expected social support). We examined identification with smoking (i.e., smoker self-identity) and quitting (i.e., quitter self-identity) among a large sample of smokers (n = 742) and ex-smokers (n = 201) in a cohort study with yearly measurements between 2009 and 2014. Latent growth curve modeling was used as an advanced statistical technique. As hypothesized, smokers perceived themselves more as smokers and less as quitters than do ex-smokers, and identification with smoking increased over time among smokers and decreased among ex-smokers. Furthermore, psychosocial factors predicted baseline identity and identity development. Socioeconomic status (SES) was particularly important. Specifically, lower SES smokers and lower SES ex-smokers identified more strongly with smoking, and smoker and quitter identities were more resistant to change among lower SES groups. Moreover, stronger proquitting social norms were associated with increasing quitter identities over time among smokers and ex-smokers and with decreasing smoker identities among ex-smokers. Predictors of identity differed between smokers and ex-smokers. Results suggest that SES and proquitting social norms should be taken into account when developing ways to facilitate identity change and, thereby, successful smoking cessation. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  1. Recruiting Diverse Smokers: Enrollment Yields and Cost

    Directory of Open Access Journals (Sweden)

    Kaitlyn E. Brodar

    2016-12-01

    Full Text Available To help tobacco control research better include vulnerable populations, we sought to identify effective ways to recruit diverse smokers. In 2014–2015, we recruited 2149 adult cigarette smokers in California and North Carolina, United States, to participate in a randomized trial of pictorial cigarette pack warnings. The most effective means of recruiting smokers were the classified advertising website Craigslist (28% of participants, word of mouth (23%, Facebook (16%, and flyers or postcards (14%. Low-income and African American smokers were more likely to respond to interpersonal contact (including staff in-person recruitment and word of mouth than were high-income and non-African American smokers (all p < 0.05. Hispanic and gay, lesbian, and bisexual smokers were more likely to be recruited by Craigslist than non-Hispanic and straight smokers (both p < 0.05. Of the recruitment methods requiring cost, the cheapest was Craigslist ($3–7 per smoker. The most expensive methods were newspaper ads in California ($375 per smoker and staff in-person recruiting in North Carolina ($180 per smoker. Successfully recruiting diverse smokers requires using multiple methods including interpersonal, online, and other media. Craigslist and word of mouth are especially useful and low-cost ways to recruit diverse smokers.

  2. Recruiting Diverse Smokers: Enrollment Yields and Cost.

    Science.gov (United States)

    Brodar, Kaitlyn E; Hall, Marissa G; Butler, Eboneé N; Parada, Humberto; Stein-Seroussi, Al; Hanley, Sean; Brewer, Noel T

    2016-12-16

    To help tobacco control research better include vulnerable populations, we sought to identify effective ways to recruit diverse smokers. In 2014-2015, we recruited 2149 adult cigarette smokers in California and North Carolina, United States, to participate in a randomized trial of pictorial cigarette pack warnings. The most effective means of recruiting smokers were the classified advertising website Craigslist (28% of participants), word of mouth (23%), Facebook (16%), and flyers or postcards (14%). Low-income and African American smokers were more likely to respond to interpersonal contact (including staff in-person recruitment and word of mouth) than were high-income and non-African American smokers (all p < 0.05). Hispanic and gay, lesbian, and bisexual smokers were more likely to be recruited by Craigslist than non-Hispanic and straight smokers (both p < 0.05). Of the recruitment methods requiring cost, the cheapest was Craigslist ($3-7 per smoker). The most expensive methods were newspaper ads in California ($375 per smoker) and staff in-person recruiting in North Carolina ($180 per smoker). Successfully recruiting diverse smokers requires using multiple methods including interpersonal, online, and other media. Craigslist and word of mouth are especially useful and low-cost ways to recruit diverse smokers.

  3. Behavior of Lung Health Parameters among Smokers and Secondhand Smokers

    Directory of Open Access Journals (Sweden)

    Esther Ghanem

    2018-01-01

    Full Text Available A cross-sectional study on a pool of undergraduate smokers and nonsmokers (n=200 was randomly selected from Notre Dame University, Lebanon. The study design is based on a questionnaire about the students’ smoking record exposure, cotinine saliva levels, and ventilatory lung function parameters. Despite the nonsmoking policies that have been recently established by universities, diffused smoking stations in proximity to classes and offices still exist, at least in the MENA region. Such an environment still imposes a remarkable effect on certain lung health parameters of nonsmokers exhibiting similar exhaled air per second (FEV1 to smokers with a P value = 0.558 and normal flow of air (TV with a P value = 0.153. However, the maximum amount of air held in the lungs remained different with respect to sex and smoking status. These results imply a poor performance of nonsmokers mimicking partially the lung health parameters of smokers. It remains a pressing issue to increase awareness concerning the debilitating effects of secondhand smoking.

  4. Differences in happiness between smokers, ex-smokers and never smokers: cross-sectional findings from a national household survey.

    Science.gov (United States)

    Shahab, Lion; West, Robert

    2012-02-01

    Happiness has become established as an important psychological dimension and not merely the obverse of depression and anxiety. Ex-smokers report that they are happier than when they were smoking but this could reflect biased recall. To date, no studies have examined happiness as a function of smoking status in ex-smokers of varying length of abstinence compared with current and never smokers. A cross-sectional household study of a nationally representative sample of adults examined the association between smoking status (never smoker, smoker, ex-smokerhappiness adjusting for sociodemographic characteristics (N=6923). After adjusting for age, gender and social grade, ex-smokers of ≥ 1 year reported higher levels of happiness than smokers (phappiness among current smokers. Ex-smokers who have stopped for a year or more are happier than current smokers and similar to never smokers. Whilst these results are cross-sectional and have to be interpreted with caution, this adds to the evidence that smoking may decrease happiness and stopping may increase it. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  5. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Society, which was the culmination of several years of supportive interaction. This new relationship is described further in the press release just issued by AAS.First plenary: The Ocean World Enceladus (by Chris Faesi)Enceladus takes its place in the lineup of potential life-bearing solar system bodies.In the first plenary session of the AAS 228th meeting, Christopher Glein of the University of Toronto took the audience on an exciting tour of the ocean world Enceladus. This small, icy moon of Saturn had been thought rather unremarkable for most of the 2+ centuries since its discovery in 1789, but theCassini spacecrafts extended visit over the last decade has revealed it to be a surprisingly dynamic and unique little world. From Cassinis 23 flybys, we now know that Enceladus is composed of roughly equal parts rock and ice, and, with analbedo of 99%, is the most reflective body in the solar system.The moons surface is not entirely cratered, as are most solar system objects such as our own Moon, but has a southern hemisphere with long fissures that look like tiger stripes on an otherwise smooth surface. Follow-up with the satellites highly sensitive instruments revealed that these stripes were heated up to 200 K much hotter than Enceladuss typical 75 K surface temperature. There seems to be an energy shortage: the heating expected from Saturns tidal influence on the moon is a factor of about ten smaller than what would be required to heat the surface this much. Unraveling this discrepancy is still an area of active study today.Learning about the chemistry of Enceladuss plumes. It always amazes me how much we can learn from light! #aas228 pic.twitter.com/yklpClPjRD astrobites (@astrobites) June 13, 2016Enceladus also spews powerful jets of salty water and water ice far into space viacryovolcanism, making it the smallest geologically active body in the solar system. Perhaps most intriguingly, this 500 km-diameter moon may be a promising target in the search for

  6. Hidden truth of circulating neutrophils (polymorphonuclear neutrophil function in periodontally healthy smoker subjects

    Directory of Open Access Journals (Sweden)

    Chitra Agarwal

    2016-01-01

    Full Text Available Context: Tobacco smoking is considered to be a major risk factor associated with periodontal disease. Smoking exerts a major effect on the protective elements of the immune response, resulting in an increase in the extent and severity of periodontal destruction. Aims: The aim of the present study was to assess viability and phagocytic function of neutrophils in circulating blood of the smokers and nonsmokers who are periodontally healthy. Settings and Design: Two hundred subjects in the mean range of 20–30 years of age were included in the study population. It was a retrospective study carried out for 6 months. Materials and Methods: Two hundred subjects were divided into four groups: 50 nonsmokers, 50 light smokers (15 cigarettes/day. Full mouth plaque index, sulcus bleeding index, and probing depths were measured. Percentage viability of circulating neutrophils and average number of phagocytosed Candida albicans were recorded. Statistical Analysis Used: Means and standard deviations were calculated from data obtained within the groups. Comparison between the smokers and nonsmokers was performed by Kruskal–Wallis ANOVA analysis. Comparison between smoker groups was performed using Mann–Whitney–Wilcoxon test. Results: Percentage viability of neutrophils was significantly less in heavy smokers (66.9 ± 4.0, moderate (76.6 ± 4.2, light smokers (83.1 ± 2.5 as compared to nonsmokers (92.3 ± 2.6 (P < 0.01. The ability of neutrophils to phagocytose, i.e., mean particle number was significantly less in light smokers (3.5 ± 0.5, moderate smokers (2.3 ± 0.5, and heavy smokers (1.4 ± 0.5 compared to nonsmokers (4.9 ± 0.7 (P < 0.01 with evidence of dose-response effect. Conclusions: Smoking significantly affects neutrophils viability and phagocytic function in periodontally healthy population.

  7. AAS 227: Day 1

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  8. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  9. Sex-effects on smoking cue perception in non-smokers, smokers, and ex-smokers: a pilot study.

    Directory of Open Access Journals (Sweden)

    Davide Zanchi

    2016-11-01

    Full Text Available IntroductionRecent neuroimaging research suggests sex-related brain differences in smoking addiction. In the present pilot study, we assessed gender-related differences in brain activation in response to cigarette-related video cues, investigating non-smokers, smokers and ex-smokers. MethodsFirst, we compared 29 females (28.6±5.3 versus 23 males (31.5±6.4 regardless of current smoking status to assess global gender-related effects. Second, we performed a post-hoc analysis of non-smokers (9 F, 8M, smokers (10F, 8M and ex-smokers (10F, 7M. Participants performed a block-design functional magnetic resonance imaging (fMRI paradigm contrasting smoking with control cue video exposures. Data analyses included task-related general linear model, voxel-based morphometry (VBM of gray matter, and tract-based spatial statistics (TBSS of white matter. ResultsFirst, the global effect regardless of current smoking status revealed higher activation in the bilateral superior frontal gyrus and anterior cingulate cortex for females compared to males. Second, the analysis according to current smoking status demonstrated higher activation in female vs. male smokers vs. non-smokers in the superior frontal gyrus, anterior and posterior cingulate cortex, and precuneus, and higher activation in female vs. male ex-smokers vs. non-smokers in the right precentral gyrus, in the right insula and anterior cingulate cortex. No structural differences were found in grey or white matter.ConclusionThe current study identifies gender-related brain functional differences in smokers and ex-smokers compared to non-smokers. The current work can be considered as a starting point for future investigations into gender differences in brain responses to cigarette-related cues.

  10. Sex Effects on Smoking Cue Perception in Non-Smokers, Smokers, and Ex-Smokers: A Pilot Study.

    Science.gov (United States)

    Zanchi, Davide; Brody, Arthur; Borgwardt, Stefan; Haller, Sven

    2016-01-01

    Recent neuroimaging research suggests sex-related brain differences in smoking addiction. In the present pilot study, we assessed gender-related differences in brain activation in response to cigarette-related video cues, investigating non-smokers, smokers, and ex-smokers. First, we compared 29 females (28.6 ± 5.3) vs. 23 males (31.5 ± 6.4), regardless of current smoking status to assess global gender-related effects. Second, we performed a post hoc analysis of non-smokers (9 females and 8 males), smokers (10 females and 8 males), and ex-smokers (10 females and 7 males). Participants performed a block-design functional magnetic resonance imaging paradigm contrasting smoking with control cue video exposures. Data analyses included task-related general linear model, voxel-based morphometry of gray matter (GM), and tract-based spatial statistics of white matter (WM). First, the global effect regardless of current smoking status revealed higher activation in the bilateral superior frontal gyrus and anterior cingulate cortex (ACC) for females compared to males. Second, the analysis according to current smoking status demonstrated higher activation in female vs. male smokers vs. non-smokers in the superior frontal gyrus, anterior and posterior cingulate cortex, and precuneus, and higher activation in female vs. male ex-smokers vs. non-smokers in the right precentral gyrus, in the right insula and ACC. No structural differences were found in GM or WM. The current study identifies gender-related brain functional differences in smokers and ex-smokers compared to non-smokers. The current work can be considered as a starting point for future investigations into gender differences in brain responses to cigarette-related cues.

  11. Localization of aristolochic acid in mouse kidney tissues by immunohistochemistry using an anti-AA-I and AA-II monoclonal antibody.

    Science.gov (United States)

    Li, Xiao-Wei; Yokota, Sadaki; Wang, Dan; Wang, Xuan; Shoyama, Yukihiro; Cai, Shao-Qing

    2014-01-01

    Aristolochic acids (AAs) are found in herbal medicines of Aristolochiaceae plants, including Aristolochia and Asarum species. AAs are associated with a rapidly progressive interstitial nephritis, which is called aristolochic acid nephropathy (AAN). However, the in-situ localization of AAs in the target organ, the kidney, has not been investigated yet. In the present study, the accumulation of aristolochic acid I (AA-I) in mouse kidney was revealed by immunoperoxidase light microscopy as well as colloidal gold immunoelectron microscopy (IEM) based on an anti-AA-I and AA-II monoclonal antibody (mAb). Male BALB/c mice were treated with 1.25 or 2.50 mg kg(-1) of AA-I per day for 5 days. Paraffin sections and ultra-thin sections of kidney tissue were respectively prepared. Under light microscopy, the apical surface of proximal tubules was strongly stained for AA-I, whereas no obvious immunostaining was found in the distal tubules and glomerulus, which remained relatively intact. Under electron microscopy, epithelial cells of the proximal tubules, distal tubules and collecting tubules were broken to various degrees. Gold labeling in the proximal and distal tubules was stronger than that in the collecting tubules. In renal tubules, immunogold signals of AA-I tended to accumulate in the mitochondria and peroxisomes, though the signals could be observed all over the cell. Gold signals were also found in the erythrocytes of glomeruli. The MAb against AA-I and AA-II provides a clue for the identification of proteins or factors which might interact with AA-I and thus induce targeted damage of kidney.

  12. Core-corona PSt/P(BA-AA) composite particles by two-stage emulsion polymerization

    Science.gov (United States)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya; Liao, Shijun

    2016-03-01

    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA-AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA-AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core-corona composite particles, P(St/P(BA-AA)), could be regulated and controlled by varying the concentrations of P(BA-AA) or the mass ratio of BA:AA in P(BA-AA). The experimental results indicate that 3.0-6.0 wt% of P(BA-AA) is required to obtain stable composite emulsions, and P(BA-AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core-corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA-A). The regular morphology of the colloidal film is expected to facilitate potential application of core-corona particles in the field of light scattering. Furthermore, the diversity of core-corona particles can be expanded by replacing P(BA-AA) corona particles with other amphiphilic particles.

  13. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  14. Comparison of peak expiratory flow rate and lipid profile in asymptomatic smokers and non-smokers

    International Nuclear Information System (INIS)

    Fatima, F.; Abbasi, M.A.; Jadoon, J.; Sohail, M.; Shah, J.; Afridi, U.; Noor, M.M.

    2015-01-01

    Tobacco is the major risk factor for chronic obstructive airway disease (COAD), other pulmonary diseases, cancer, cardiovascular and cerebrovascular diseases. The objective of study was to determine the mean Peak Expiratory Flow Rate (PEFR) and serum lipid profile in apparently healthy male smokers and non-smokers. Methods: This cross-sectional study was conducted in Ayub Teaching Hospital, Abbottabad from 15th December, 2009 to 15th June, 2010. Apparently healthy smokers and non-smokers from population coming to Hospital as attendants of the patients or as employees of the hospital were inducted in the study. PEFR and lipid profile of all the subjects was accessed. Results: There were total of 300 male subjects, 150 smokers and 150 non-smokers. The mean age of study subjects was 26.60 ± 5.5 years. The mean PEFR of smokers was 450.62l/min and that of non-smokers was 494.81 L/min, the difference being statistically significant (p-value <0.05).The mean total cholesterol of smokers is 5.30 ± 0.86 mmol/l and it was 3.84 ± 0.54 mmol/l in non-smokers. Mean serum Triacyl Glycerols (TAGs) and Low Density Lipoproteins (LDL) cholesterol of smokers was 2.04 ± 0.38 and 3.5 ± 0.83 mmol/l whereas it was 1.44 ± 0.52 and 2.02 ± 0.66 mmol/l in non-smokers. Mean High Density Lipo-protein (HDL) of smokers was 0.86 ± 0.30 mmol/l and of non-smokers is 1.20 ± 0.41 mmo/l. There was statistically significant difference between serum lipid profile of smokers and non-smokers (p<0.05). the mean serum Total Cholesterol (TC), TAGs and LDL were significantly higher in smokers as compared to non-smokers. However HDL was significantly lower in smokers in comparison to non-smokers. Conclusion: There was statistically significant difference between PEFR of smokers and non-smokers. Higher and significant mean values of TC, TAG and LDL-C was observed in smokers as compared to non-smokers. (author)

  15. The case against a smoker's license.

    Directory of Open Access Journals (Sweden)

    Jeff Collin

    Full Text Available Tobacco continues to kill millions of people around the world each year and its use is increasing in some countries, which makes the need for new, creative, and radical efforts to achieve the tobacco control endgame vitally important. One such effort is discussed in this PLOS Medicine Debate, where Simon Chapman presents his proposal for a "smoker's license" and Jeff Collin argues against. Chapman sets out a case for introducing a smart card license for smokers designed to limit access to tobacco products and encourage cessation. Key elements of the smoker's license include smokers setting daily limits, financial incentives for permanent license surrender, and a test of health risk knowledge for commencing smokers. Collin argues against the proposal, saying that it would shift focus away from the real vector of the epidemic--the tobacco industry--and that by focusing on individuals it would censure victims, increase stigmatization of smokers, and marginalize the poor.

  16. The case for a smoker's license.

    Directory of Open Access Journals (Sweden)

    Simon Chapman

    Full Text Available BACKGROUND TO THE DEBATE: Tobacco continues to kill millions of people around the world each year and its use is increasing in some countries, which makes the need for new, creative, and radical efforts to achieve the tobacco control endgame vitally important. One such effort is discussed in this PLOS Medicine Debate, where Simon Chapman presents his proposal for a "smoker's license" and Jeff Collin argues against. Chapman sets out a case for introducing a smart card license for smokers designed to limit access to tobacco products and encourage cessation. Key elements of the smoker's license include smokers setting daily limits, financial incentives for permanent license surrender, and a test of health risk knowledge for commencing smokers. Collin argues against the proposal, saying that it would shift focus away from the real vector of the epidemic--the tobacco industry--and that by focusing on individuals it would censure victims, increase stigmatization of smokers, and marginalize the poor.

  17. The case for a smoker's license.

    Science.gov (United States)

    Chapman, Simon

    2012-01-01

    Tobacco continues to kill millions of people around the world each year and its use is increasing in some countries, which makes the need for new, creative, and radical efforts to achieve the tobacco control endgame vitally important. One such effort is discussed in this PLOS Medicine Debate, where Simon Chapman presents his proposal for a "smoker's license" and Jeff Collin argues against. Chapman sets out a case for introducing a smart card license for smokers designed to limit access to tobacco products and encourage cessation. Key elements of the smoker's license include smokers setting daily limits, financial incentives for permanent license surrender, and a test of health risk knowledge for commencing smokers. Collin argues against the proposal, saying that it would shift focus away from the real vector of the epidemic--the tobacco industry--and that by focusing on individuals it would censure victims, increase stigmatization of smokers, and marginalize the poor.

  18. The case against a smoker's license.

    Science.gov (United States)

    Collin, Jeff

    2012-01-01

    Tobacco continues to kill millions of people around the world each year and its use is increasing in some countries, which makes the need for new, creative, and radical efforts to achieve the tobacco control endgame vitally important. One such effort is discussed in this PLOS Medicine Debate, where Simon Chapman presents his proposal for a "smoker's license" and Jeff Collin argues against. Chapman sets out a case for introducing a smart card license for smokers designed to limit access to tobacco products and encourage cessation. Key elements of the smoker's license include smokers setting daily limits, financial incentives for permanent license surrender, and a test of health risk knowledge for commencing smokers. Collin argues against the proposal, saying that it would shift focus away from the real vector of the epidemic--the tobacco industry--and that by focusing on individuals it would censure victims, increase stigmatization of smokers, and marginalize the poor.

  19. Eating pathology among Black and White smokers.

    Science.gov (United States)

    Sánchez-Johnsen, Lisa A P; Fitzgibbon, Marian L; Ahluwalia, Jasjit S; Spring, Bonnie J

    2005-02-01

    Among White smokers, many females use smoking as a weight control strategy. Little is known about the relationship between eating pathology and smoking among Black females, and whether smokers who enroll in treatment differ in eating pathology from smokers who decline treatment. We examined eating pathology among Black and White smokers who enrolled in a smoking cessation treatment and those who declined treatment. Participants were 100 Black and 100 White female smokers (ages 18-65) who completed three measures of eating pathology. After controlling for BMI, Whites reported greater levels of overall eating pathology than Blacks [F(1,195)=4.1; pWhite than Black smokers. However, once females seek smoking cessation treatment, these ethnic differences are not apparent.

  20. Immunodetection of rasP21 and c-myc oncogenes in oral mucosal swab preparation from clove cigarette smokers

    Directory of Open Access Journals (Sweden)

    Silvi Kintawati

    2008-12-01

    Full Text Available Background: Smoking is the biggest factor for oral cavity malignancy. Some carcinogens found in cigar will stimulate epithel cell in oral cavity and cause mechanism disturbance on tissue resistance and produce abnormal genes (oncogenes. Oncogenes ras and myc are found on malignant tumor in oral cavity which are associated with smoking. Purpose: This research is to find the expression of oncogenes rasP21 and c-myc in oral mucosa epithelial of smoker with immunocytochemistry reaction. Methods: An oral mucosal swab was performed to 30 smokers categorized as light, moderate, and chain, and 10 non smokers which was followed by immunocytochemistry reaction using antibody towards oncogene rasP21 and c-myc is reacted to identify the influence of smoking towards malignant tumor in oral cavity. The result is statistically analyzed using Kruskal-Wallis test. Result: Based on the observation result of oncogene rasP21reaction, it shows that there is significant difference between non smoker group and light smoker, compared to moderate and chain smoker group (p < 0.01. On the other side, the observation result of oncogene c-myc indicates that there is no significant difference between the group of non smokers and the group of light, moderate, and chain smokers (p > 0.05. Conclusion: The higher the possibility of oral cavity malignancy and that the antibody for rasP21 oncogene can be used as a marker for early detection of oral cavity malignancy caused by smoking.

  1. The Drentsche Aa valley system

    International Nuclear Information System (INIS)

    Gans, W. de.

    1981-01-01

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  2. Evaluation of clinical periodontal conditions in smokers and non-smokers

    Directory of Open Access Journals (Sweden)

    Lucinara Ignez Tavares Luzzi

    2007-12-01

    Full Text Available Given that tobacco smoking habit is a risk factor for periodontal diseases, the aim of this study was to compare clinical periodontal aspects between smokers and non-smokers. The clinical status were assessed in 55 patients, 29 smokers and 26 non-smokers, aged 30 to 50 years, with mean age of 40. The clinical parameters used were: probing depth (PD, plaque index (PI, gingival index (GI, clinical attachment level (CAL, gingival recession (GR and gingival bleeding index (GBI for arches (upper and lower and teeth (anterior and posterior. Tooth loss was also evaluated in both groups. Multiple regression analysis showed: tendency of greater probing depth and clinical attachment level means for smokers; greater amount of plaque in smokers in all regions; greater gingival index means for non-smokers with clinical significance (p<0.05 in all regions. Although, without statistical significance, the analysis showed greater gingival bleeding index means almost always for non-smokers; similar gingival recession means in both groups and tendency of upper tooth loss in smokers and lower tooth loss in non-smokers. The findings of this study showed that clinical periodontal parameters may be different in smokers when compared to non-smokers and that masking of some periodontal signs can be a result of nicotine's vasoconstrictor effect.

  3. Cigarette Fires Involving Upholstered Furniture in Residences: The Role that Smokers, Smoker Behavior, and Fire Standard Compliant Cigarettes Play.

    Science.gov (United States)

    Butry, David T; Thomas, Douglas S

    2017-05-01

    Residential structure fires pose a significant risk to life and property. A major source of these fires is the ignition of upholstered furniture by cigarettes. It has long been established that cigarettes and other lighted tobacco products could ignite upholstered furniture and were a leading cause of fire deaths in residences. In recent years, states have adopted fire standard compliant cigarettes ('FSC cigarettes') that are made with a wrapping paper that contains regularly spaced bands, which increases the likelihood of self-extinguishment. This paper measures the effectiveness of FSC cigarettes on the number of residential fires involving upholstered furniture, and the resulting fatalities, injuries, and extent of flame spread, while accounting for the under-reporting of fire incidents. In total, four models were estimated using fire department data from 2002 to 2011. The results provide evidence that FSC cigarettes, on average, reduced the number of residential fires by 45 %, reduced fatalities by 23 %, and extent of flame spread by 27 % in 2011. No effect on injuries was found. Within each state, effectiveness is moderated by the number of smokers and their consumption patterns. In general, FSC cigarettes are more effective in places with a large smoking population who engage in heavier smoking. There is a very limited effect on the lightest of smokers, suggesting behavioral differences between heavy and light smokers that influence fire risk.

  4. Core–corona PSt/P(BA–AA) composite particles by two-stage emulsion polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya, E-mail: cexyzh@scut.edu.cn; Liao, Shijun [South China University of Technology, School of Chemistry and Chemical Engineering (China)

    2016-03-15

    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA–AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA–AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core–corona composite particles, P(St/P(BA–AA)), could be regulated and controlled by varying the concentrations of P(BA–AA) or the mass ratio of BA:AA in P(BA–AA). The experimental results indicate that 3.0–6.0 wt% of P(BA–AA) is required to obtain stable composite emulsions, and P(BA–AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core–corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA–A). The regular morphology of the colloidal film is expected to facilitate potential application of core–corona particles in the field of light scattering. Furthermore, the diversity of core–corona particles can be expanded by replacing P(BA–AA) corona particles with other amphiphilic particles.

  5. Core–corona PSt/P(BA–AA) composite particles by two-stage emulsion polymerization

    International Nuclear Information System (INIS)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya; Liao, Shijun

    2016-01-01

    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA–AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA–AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core–corona composite particles, P(St/P(BA–AA)), could be regulated and controlled by varying the concentrations of P(BA–AA) or the mass ratio of BA:AA in P(BA–AA). The experimental results indicate that 3.0–6.0 wt% of P(BA–AA) is required to obtain stable composite emulsions, and P(BA–AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core–corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA–A). The regular morphology of the colloidal film is expected to facilitate potential application of core–corona particles in the field of light scattering. Furthermore, the diversity of core–corona particles can be expanded by replacing P(BA–AA) corona particles with other amphiphilic particles.

  6. Adolescents' perceptions about smokers in Karnataka, India

    Directory of Open Access Journals (Sweden)

    N Devadasan

    2011-07-01

    Full Text Available Abstract Background Prevalence of tobacco use among adolescents in India is very high. Despite many epidemiological studies exploring tobacco use among youth, there is no published data on adolescents' perceptions about smokers in Indian society and its implications on tobacco control. Methods A cross-sectional study was conducted using a stratified random sampling with probability proportional to school-type (government or private owned. Data was collected using a pretested, self-administered, anonymous questionnaire with a mix of close and open-ended questions from a sample of 1087 students. Chi-square test was used to measure associations. Qualitative data was analysed through inductive coding. Results The response rate for the study was 82.5% and the sample population had a mean age of 16.9 years (SD = 1.9 with 57.8% male students. Majority of respondents (84.6% reported negative perceptions about smokers while 20.4% of respondents reported positive perceptions. Female students reported significantly higher disapproval rate (negative perceptions for smoking compared to male students (89.7% Vs 71.6% in case of male smoker; 81.2% Vs 67.3% in case of female smoker. Dominant themes defining perceptions about smokers included 'hatred/hostility/Intolerance', 'against family values/norms', 'not aware of tobacco harms' and 'under stress/emotional trauma'. Themes like 'culture', 'character' and 'power' specifically described negative social image of female smoker but projected a neutral or sometimes even a positive image of male smoker. There was a significant association between adolescents' positive perceptions of smokers and tobacco use by themselves as well as their close associates. Conclusions Adolescents' stereotypes of smokers, especially female smokers are largely negative. We suggest that tobacco control interventions targeting adolescents should be gender specific, should also involve their peers, family and school personnel, and should go

  7. AAS 228: Day 3 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  8. Electronic cigarette use behaviors and motivations among smokers and non-smokers.

    Science.gov (United States)

    Sussan, Thomas E; Shahzad, Fatima G; Tabassum, Eefa; Cohen, Joanna E; Wise, Robert A; Blaha, Michael J; Holbrook, Janet T; Biswal, Shyam

    2017-09-08

    The use of electronic cigarettes (EC) has risen exponentially over the past decade, including among never smokers, and ECs are now the most popular tobacco product among teenagers in the US. While, EC manufacturers utilize numerous marketing strategies to target both smokers and non-smokers, it is unclear how perceptions and behaviors differ between these two groups. We conducted a survey of 320 adults either via online surveys or in Baltimore vape shops to determine demographics, behaviors, perceptions, and motivations underlying use of ECs. Our survey respondents were predominantly young, Caucasian males, 74% of whom identified themselves as former smokers, while 20% identified as current smokers and 6% were never smokers. Former smokers reported a longer history of EC use and higher nicotine concentrations than current smokers. For former and current smokers, the primary motivation for EC use was assistance to quit smoking, and nearly half indicated that they plan to reduce their nicotine concentration and eventually quit using ECs. Among former smokers, self-reports on use and measures of dependence were consistent with nicotine replacement as their primary motivation. The majority of former and current smokers also reported that their respiratory health had improved as a result of EC use, although this effect was stronger for former smokers. Never smokers reported less frequent EC use and dependence compared to former and current smokers. Their motivations for use were more commonly for enjoyment and popularity, and they displayed a reduced desire to eventually quit using ECs. These responses provide insight into the underlying thoughts and behaviors of smoking and non-smoking EC users and also suggest that never smoking EC users are an emerging demographic with different motivations and perceptions than those of current and former smokers.

  9. Electronic cigarette use behaviors and motivations among smokers and non-smokers

    Directory of Open Access Journals (Sweden)

    Thomas E. Sussan

    2017-09-01

    Full Text Available Abstract Background The use of electronic cigarettes (EC has risen exponentially over the past decade, including among never smokers, and ECs are now the most popular tobacco product among teenagers in the US. While, EC manufacturers utilize numerous marketing strategies to target both smokers and non-smokers, it is unclear how perceptions and behaviors differ between these two groups. Methods We conducted a survey of 320 adults either via online surveys or in Baltimore vape shops to determine demographics, behaviors, perceptions, and motivations underlying use of ECs. Results Our survey respondents were predominantly young, Caucasian males, 74% of whom identified themselves as former smokers, while 20% identified as current smokers and 6% were never smokers. Former smokers reported a longer history of EC use and higher nicotine concentrations than current smokers. For former and current smokers, the primary motivation for EC use was assistance to quit smoking, and nearly half indicated that they plan to reduce their nicotine concentration and eventually quit using ECs. Among former smokers, self-reports on use and measures of dependence were consistent with nicotine replacement as their primary motivation. The majority of former and current smokers also reported that their respiratory health had improved as a result of EC use, although this effect was stronger for former smokers. Never smokers reported less frequent EC use and dependence compared to former and current smokers. Their motivations for use were more commonly for enjoyment and popularity, and they displayed a reduced desire to eventually quit using ECs. Conclusions These responses provide insight into the underlying thoughts and behaviors of smoking and non-smoking EC users and also suggest that never smoking EC users are an emerging demographic with different motivations and perceptions than those of current and former smokers.

  10. Medicaid expenditures for children living with smokers

    Directory of Open Access Journals (Sweden)

    Levy Douglas E

    2011-05-01

    Full Text Available Abstract Background Children's exposure to secondhand smoke is associated with increased morbidity. We estimated Medicaid expenditures for children living with smokers compared to those living with no smokers in the United States. Methods Data were overall and service-specific (i.e., inpatient, ambulatory, emergency department, prescription drug, and dental annual Medicaid expenditures for children 0-11 years old from the 2000-2007 Medical Expenditures Panel Surveys. Smokers' presence in households was determined by adult respondents' self reports. There were 25,835 person-years of observation. We used multivariate analyses to adjust for child, parent, and geographic characteristics. Results Children with Medicaid expenditures were nearly twice as likely to live with a smoker as other children in the U.S. population. Adjusted analyses revealed no detectable differences in children's overall Medicaid expenditures by presence of smokers in the household. Medicaid children who lived with smokers on average had $10 (95% CI $3, $18 higher emergency department expenditures per year than those living with no smokers. Conclusions Living with at least one smoker (a proxy for secondhand smoke exposure is unrelated to children's overall short-term Medicaid expenditures, but has a modest impact on emergency department expenditures. Additional research is necessary to understand the relationship between secondhand smoke exposure and long-term health and economic outcomes.

  11. Exfoliative cytology of oral mucosa among smokers, opium addicts and non-smokers: a cytomorphometric study.

    Science.gov (United States)

    Hashemipour, Maryam Alsadat; Aghababaie, Mahbobeh; Mirshekari, Toraj Reza; Asadi-Shekaari, Majid; Tahmasbi-Arashlow, Mehrnaz; Tahmasbi-Arashlow, Farzad; Gandjalikhan Nassab, Sayed Amir Hossein

    2013-12-01

    The present study was conducted to evaluate keratinization as well as nuclear and cytoplasmic changes of oral epithelial cells among smokers, opium addicts and non-smokers through exfoliative cytology technique. Smears of buccal mucosa and mouth floor were collected from 300 males (100 smokers, 100 opium addicts and 100 non-smokers). The nucleus and cytoplasm sizes were determined using image analysis software. Data was analyzed with Mann-Whitney test and Student's t-test on SPSS version 13 statistical software. Statistical significance was defined as P opium addicts and non-smokers in different age groups. The mean size of the nucleus compared to that of cytoplasm was significantly higher in smokers and opium addicts compared to non-smokers after correction for age. The results of this study indicate different rates of epithelial cell keratinization in oral cavity among smokers, opium addicts and non-smokers. Also, our results suggest a possible relationship between the number of cigarettes per day, daily opium consumption and an increase in the rate of cellular proliferation of oral mucosal cells. The present study indicated a decrease in cellular diameter as well as an increase in nuclear diameter and nuclear/cytoplasmic ratio in smears taken from both smokers and opium addicts compared to non-smokers.

  12. Health education pamphlets about smoking-their benefit to smokers and non-smokers

    DEFF Research Database (Denmark)

    Meillier, Lucette Kirsten; Osler, M; Sabroe, Svend

    1999-01-01

    in 1994. Of these 71% also participated in a telephone interview enquiring about the use of health education material, smoking status and socio-demographic variables, 39% of readers of household-delivered anti-smoking pamphlets reported having gained information from them and 22% reported having made...... health education materials from other places. Non-smokers received (3 49%) and read pamphlets about smoking as frequently as did smokers who did not intend to quit. In conclusion, written health education material was well received by readers, but, when distributed in a more open setting it needs...... to be targeted towards smokers who are considering stopping smoking. In general practice, smokers not thinking of stopping were open to health education, and pamphlets used in this setting should also target this group. Non-smokers contribute indirectly to smokers quitting by providing support to smokers...

  13. Happiness as a Buffer of the Association Between Dependence and Acute Tobacco Abstinence Effects in African American Smokers.

    Science.gov (United States)

    Liautaud, Madalyn M; Leventhal, Adam M; Pang, Raina D

    2017-09-27

    African-American (AA) smokers are at disproportionate risk of tobacco dependence, utilizing smoking to regulate stress, and poor cessation outcomes. Positive emotional traits may function as coping factors that buffer the extent to which dependence increases vulnerability to adverse responses to acute tobacco abstinence (i.e., tobacco withdrawal). This laboratory study examined subjective happiness (SH; dispositional orientation towards frequent and intense positive affect [PA] and life satisfaction) as a moderator of the relation between tobacco dependence and subjective and behavioral abstinence effects among AA smokers. AA smokers (N=420, 39.0% female) completed self-report measures of tobacco dependence and SH followed by two counterbalanced experimental sessions (non-abstinent vs. 16-hr abstinent) involving self-report measures of composite withdrawal, urge to smoke, and mood, and a behavioral smoking task in which participants could: (a) earn money to delay smoking reinstatement, and (b) subsequently purchase cigarettes to smoke. Tobacco dependence was positively associated with increased abstinence effects in composite withdrawal, urge to smoke, PA, and latency to smoking reinstatement (pspsychological construct within tobacco research-subjective happiness-that may suppress the extent to which more severe tobacco dependence increases risk for subjective withdrawal-related distress during acute smoking abstinence in African American smokers. In doing so, the study provides a primer for future targeting of subjective happiness and other positive emotional traits as means to understand and treat acute tobacco abstinence effects among dependent African American smokers. © The Author 2017. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Sex Effects on Smoking Cue Perception in Non-Smokers, Smokers, and Ex-Smokers: A Pilot Study

    OpenAIRE

    Zanchi, Davide; Brody, Arthur; Borgwardt, Stefan; Haller, Sven

    2016-01-01

    Introduction Recent neuroimaging research suggests sex-related brain differences in smoking addiction. In the present pilot study, we assessed gender-related differences in brain activation in response to cigarette-related video cues, investigating non-smokers, smokers, and ex-smokers. Methods First, we compared 29 females (28.6 ± 5.3) vs. 23 males (31.5 ± 6.4), regardless of current smoking status to assess global gender-related effects. Second, we performed a post hoc analysis of...

  15. Unplanned quitting in a triethnic sample of U.S. smokers.

    Science.gov (United States)

    Resnicow, Ken; Zhou, Yan; Scheuermann, Taneisha S; Nollen, Nicole L; Ahluwalia, Jasjit S

    2014-06-01

    Smokers who report quitting without prior planning have been shown to report longer abstinence compared with those who planned. Little is known about unplanned quitting (UQ) among U.S. smokers, minorities, or nondaily and light smokers. Using an online panel, we recruited equal numbers of Black, White, and Latino nondaily, light daily, and moderate/heavy daily smokers. Of the 1,127 who reported a past-year quit attempt, we queried whether it was planned and the maximum number of days abstinent. Overall, 38% reported that their last quit attempt was unplanned. The impact of planned versus unplanned quitting interacted with smoking level and race. Among White moderate/heavy smokers, mean days abstinent was 99 for those who reported an unplanned quit attempt compared with 60 days for those who reported a planned attempt (p = .02). Among Black moderate/heavy smokers, the mean days abstinent was higher among those whose last attempt was planned, 92 days, compared with 56 days among those whose last attempt was unplanned (p = .09). The pattern among Latinos resembled Whites but was not significant. Results remained after adjusting for confounds such as age, gender, education, income, time to first cigarette, and menthol use. There were no significant differences in abstinence by quit type for light or nondaily smokers. Future studies are needed to elucidate why UQ appears to have differential effectiveness across racial/ethnic groups and different levels of cigarette use. Research examining the impact of UQ on long-term quitting, which is not addressed here, is needed.

  16. A Japanese cross-sectional multicentre study of biomarkers associated with cardiovascular disease in smokers and non-smokers

    OpenAIRE

    L?dicke, Frank; Magnette, John; Baker, Gizelle; Weitkunat, Rolf

    2015-01-01

    Abstract We performed a cross-sectional, multicentre study in Japan to detect the differences in biomarkers of exposure and cardiovascular biomarkers between smokers and non-smokers. Several clinically relevant cardiovascular biomarkers differed significantly between smokers and non-smokers, including lipid metabolism (high-density lipoprotein cholesterol concentrations ? lower in smokers), inflammation (fibrinogen and white blood cell count ? both higher in smokers), oxidative stress (8-epi-...

  17. Relationship between Personality Traits and Nicotine Dependence in Male and Female Smokers of African-American and European-American Samples

    Directory of Open Access Journals (Sweden)

    Jung-Seok Choi

    2017-07-01

    Full Text Available AimsPersonality characteristics are linked to nicotine dependence (ND. It remains unclear whether these factors differ across African-American (AA and European-American (EA male and female smokers. This study was aimed to determine the relationship between personality traits and smoking status, as well as the degree of ND, in AA and EA male and female samples.MethodsA total of 5,040 participants (AA: N = 3,737, female = 54.31%; EA: N = 1,313, female = 64.51% were included in this study, with 2,474 smokers and 2,566 non-smokers. The measures used in this study included five dimensions of personality by the NEO-personality inventory-revised (neuroticism, extraversion, agreeableness, openness to experience, and conscientiousness, Fagerström test for ND, and drive subscale of the ND Syndrome Scale (NDSS.ResultsIn the AA sample, neuroticism was significantly associated with a higher risk of smoking [odds ratio (OR = 1.057; 95% confidence interval (CI 1.032, 1.083; p < 0.0001], and conscientiousness was significantly associated with decreased risk of smoking (OR = 0.936; 95% CI 0.912, 0.961; p < 0.0001. In the EA sample, higher neuroticism was associated with increased risk of being a current smoker (OR = 1.058; 95% CI 1.013, 1.104; p = 0.0105. Furthermore, we found that a lower level of neuroticism and higher level of conscientiousness were associated with the severity of ND in both the AA and EA samples and a broader range of personality factors were involved in predicting the severity of ND in the AA samples. However, no differential association was detected between male and female smokers of both AA and EA samples.ConclusionThere exist differential relationships between personality traits and the severity of ND in the AA and EA samples.

  18. Social Representations of Smokers among Smoking Youth

    OpenAIRE

    O V Maslova; V S Tarkhova

    2014-01-01

    The article presents the results of the empirical research of social representations of smoking abuse among smoking young people. The authors reveal gender differences in the representations of smokers and show the role of psychological factors in smoking abuse.

  19. The Case against a Smoker's License

    OpenAIRE

    Chapman, Simon

    2012-01-01

    BACKGROUND TO THE DEBATE: Tobacco continues to kill millions of people around the world each year and its use is increasing in some countries, which makes the need for new, creative, and radical efforts to achieve the tobacco control endgame vitally important. One such effort is discussed in this PLOS Medicine Debate, where Simon Chapman presents his proposal for a "smoker's license" and Jeff Collin argues against. Chapman sets out a case for introducing a smart card license for smokers desig...

  20. The Case against a Smoker's License

    OpenAIRE

    Collin, J.

    2012-01-01

    Background to the debate: Tobacco continues to kill millions of people around the world each year and its use is increasing in some countries, which makes the need for new, creative, and radical efforts to achieve the tobacco control endgame vitally important. One such effort is discussed in this PLOS Medicine Debate, where Simon Chapman presents his proposal for a "smoker's license" and Jeff Collin argues against. Chapman sets out a case for introducing a smart card license for smokers desig...

  1. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    expansion as it reached the red giant branch. Finally, Paula Szkody explained the exotic light curves of cataclysmic variables found with K2. These detailed observations allow us to understand previously unseen bumps and wiggles in the light curves due to the complex physics driving these systems.The Limits of Scientific Cosmology: Historical and Cosmological Context (by Gourav Koullar)Karl Popper was everywhere today, being invoked by both Matt Stanley and Sean Carroll.The second session of this forum constituted a series of talks aimed at setting the premise for our current understanding of the universe, and the very story of how cosmology came to be a science. Matt Stanley gave us an extraordinary tour of the last 150 years of scientific tendencies to create models of the universe. John Tyndall, James Clark Maxwell, Ernst Mach all joined the party, as we moved towards the Friedman-Lemaitre-Robertson-Walker model and Einsteins tweaks to his field equations in General Relativity. Stanley gave due credit to the Steady State Cosmology movement, since it was using Popperian falsifiability that Hermann Bondi and Fred Hoyle established the rules of how a theory of the universe should look like. Even today, as we wage an internal battle between Adaptive Optimism and Pessimistic Induction as scientists, our willingness understand the cosmos stays strong.Virginia Trimble: old skool ( slightly off the wall) #aas228 pic.twitter.com/W31PtbC0in chrislintott (@chrislintott) June 14, 2016Richard Dawid followed this up with a new philosophical theory of science, putting an emphasis on non-empirical confirmation of theories, and tracking evolution of credence (e.g. in a Bayesian manner) instead of definitive true or false answers to fundamental questions. Virginia Trimble brought the afternoon discussion to a conclusion by discussing a very unique empirical observation: whenever a community has come at a juncture where the choice has been between one or many, finite or infinite (in a non

  2. Smokers Show Lower Levels of Psychological Well-Being and Mindfulness than Non-Smokers.

    Directory of Open Access Journals (Sweden)

    Víviam Vargas Barros

    Full Text Available Mindfulness is defined as "paying attention in a particular way, on purpose, in the present moment, and nonjudgmentally". Mindfulness is associated with positive affect, life satisfaction, self-esteem, lower negative affect and rumination. Conversely, evidence suggests a relationship between nicotine dependence and psychiatric disorders. This study aimed to compare the levels of Mindfulness and Subjective Well-Being (SWB between smokers and non-smokers. Ninety seven smokers and eighty four non-smokers participated in the study (n = 181. The Five Facet Mindfulness Questionnaire (FFMQ-BR and the Subjective Well-Being Scale (SWBS were used. In all the factors of SWBS, the total scores in the FFMQ-BR and in the facets of Observing and Non-Reactivity, the non-smokers scored higher than the smokers. This study suggests that smokers present lower levels of Mindfulness and SWB than non-smokers. Consequently, we propose that Mindfulness-Based Interventions (MBI may help smokers deal with treatment and abstinence by increasing their level of SWB.

  3. Smokers Show Lower Levels of Psychological Well-Being and Mindfulness than Non-Smokers.

    Science.gov (United States)

    Barros, Víviam Vargas; Kozasa, Elisa Harumi; Formagini, Taynara Dutra Batista; Pereira, Laís Helena; Ronzani, Telmo Mota

    2015-01-01

    Mindfulness is defined as "paying attention in a particular way, on purpose, in the present moment, and nonjudgmentally". Mindfulness is associated with positive affect, life satisfaction, self-esteem, lower negative affect and rumination. Conversely, evidence suggests a relationship between nicotine dependence and psychiatric disorders. This study aimed to compare the levels of Mindfulness and Subjective Well-Being (SWB) between smokers and non-smokers. Ninety seven smokers and eighty four non-smokers participated in the study (n = 181). The Five Facet Mindfulness Questionnaire (FFMQ-BR) and the Subjective Well-Being Scale (SWBS) were used. In all the factors of SWBS, the total scores in the FFMQ-BR and in the facets of Observing and Non-Reactivity, the non-smokers scored higher than the smokers. This study suggests that smokers present lower levels of Mindfulness and SWB than non-smokers. Consequently, we propose that Mindfulness-Based Interventions (MBI) may help smokers deal with treatment and abstinence by increasing their level of SWB.

  4. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  5. Peak Expiratory Flow Rate In Cigarette Smokers | Ukoli | Highland ...

    African Journals Online (AJOL)

    Objective: To compare lung function between smokers and non-smokers using Peak Expiratory Flow Rate (PEFR). Methods: This study examines the peak expiratory flow rate (PEFR) of three hundred and forty cigarette smokers, age and sex-matched with PEFR of equal number of non-smokers. Results: The mean PEFR of ...

  6. Examining of Thallium in Cigarette Smokers.

    Science.gov (United States)

    Ghaderi, Amir; NasehGhafoori, Payam; Rasouli-Azad, Morad; Sehat, Mojtaba; Mehrzad, Fateme; Nekuei, Mina; Aaseth, Jan; Banafshe, Hamid Reza; Mehrpour, Omid

    2018-04-01

    Smoking is one of the sources of thallium which is considered as a toxic heavy metal. The aim of this study was to determine urinary thallium levels and related variables in smokers, compared to a control group. The study was conducted on 56 participants who had smoked continuously during the year before they were referred to Kashan Smoking Cessation Clinic. Fifty-three nonsmokers who were family members or friends of the smokers were selected as the control group. Urinary thallium was measured in both groups (n = 109) using atomic absorption spectrophotometry. The mean value (with SD) for urinary thallium in the smokers (10.16 ± 1.82 μg/L) was significantly higher than in the control group (2.39 ± 0.63 μg/L). There was a significant relationship between smoking duration and urinary thallium levels (P = 0.003). In a subgroup of smokers who was addicted to opium and opium residues (n = 9), the mean level of thallium (37.5 ± 13.09 μg/L) was significantly higher than in the other smokers (4.93 ± 4.45; P = 0.001). Multiple regression analysis showed opioid abuse, insomnia, and chronic obstructive pulmonary disease (COPD), together were strong predictors of urinary thallium levels in smokers. There was no significant difference in thallium level in hookah smokers (P = 0.299) or in those with COPD compared to other smokers (P = 0.375). Urinary thallium levels of smokers with clinical signs of depression, sleep disorders, memory loss, and sweating were higher than those of smokers without these signs. Since thallium, as other toxic metals is accumulated in the body, and cigarette smoking also involves carcinogenic exposures and health hazards for passively exposed people, the need for cigarette control policies is emphasized.

  7. Tobacco Withdrawal Amongst African American, Hispanic, and White Smokers.

    Science.gov (United States)

    Bello, Mariel S; Pang, Raina D; Cropsey, Karen L; Zvolensky, Michael J; Reitzel, Lorraine R; Huh, Jimi; Leventhal, Adam M

    2016-06-01

    Persistent tobacco use among racial and ethnic minority populations in the United States is a critical public health concern. Yet, potential sources of racial/ethnic disparities in tobacco use remain unclear. The present study examined racial/ethnic differences in tobacco withdrawal-a clinically-relevant underpinning of tobacco use that has received sparse attention in the disparities literature-utilizing a controlled laboratory design. Daily smokers (non-Hispanic African American [n = 178], non-Hispanic white [n = 118], and Hispanic [n = 28]) attended two counterbalanced sessions (non-abstinent vs. 16-hour abstinent). At both sessions, self-report measures of urge, nicotine withdrawal, and affect were administered and performance on an objective behavioral task that assessed motivation to reinstate smoking was recorded. Abstinence-induced changes (abstinent scores vs. non-abstinent scores) were analyzed as a function of race/ethnicity. Non-Hispanic African American smokers reported greater abstinence-induced declines in several positive affect states in comparison to other racial/ethnic groups. Relative to Hispanic smokers, non-Hispanic African American and non-Hispanic white smokers displayed larger abstinence-provoked increases in urges to smoke. No racial/ethnic differences were detected for a composite measure of nicotine withdrawal symptomatology, negative affect states, and motivation to reinstate smoking behavior. These results suggest qualitative differences in the expression of some components of tobacco withdrawal across three racial/ethnic groups. This research helps shed light on bio-behavioral sources of tobacco-related health disparities, informs the application of smoking cessation interventions across racial/ethnic groups, and may ultimately aid the overall effort towards reducing the public health burden of tobacco addiction in minority populations. The current study provides some initial evidence that there may be qualitative differences in the

  8. Reference values of fractional excretion of exhaled nitric oxide among non-smokers and current smokers.

    Science.gov (United States)

    Torén, Kjell; Murgia, Nicola; Schiöler, Linus; Bake, Björn; Olin, Anna-Carin

    2017-08-25

    Fractional exhaled nitric oxide (FE NO ) is used to assess of airway inflammation; diagnose asthma and monitor adherence to advised therapy. Reliable and accurate reference values for FE NO are needed for both non-smoking and current smoking adults in the clinical setting. The present study was performed to establish reference adult FE NO values among never-smokers, former smokers and current smokers. FE NO was measured in 5265 subjects aged 25-75 years in a general-population study, using a chemiluminescence (Niox ™) analyser according to the guidelines of the American Thoracic Society and the European Respiratory Society. Atopy was based on the presence of immunoglobulin E (IgE) antibodies to common inhalant allergens (measured using Phadiatop® test). Spirometry without bronchodilation was performed and forced vital capacity (FVC), forced expired volume in 1 s (FEV 1 ) and the ratio of FEV 1 to FVC values were obtained. After excluding subjects with asthma, chronic bronchitis, spirometric airway obstruction and current cold, 3378 subjects remained. Equations for predictions of FE NO values were modelled using nonparametric regression models. FE NO levels were similar in never-smokers and former smokers, and these two groups were therefore merged into a group termed "non-smokers". Reference equations, including the 5th and 95th percentiles, were generated for female and male non-smokers, based on age, height and atopy. Regression models for current smokers were unstable. Hence, the proposed reference values for current smokers are based on the univariate distribution of FE NO and fixed cut-off limits. Reference values for FE NO among respiratory healthy non-smokers should be outlined stratified for gender using individual reference values. For current smokers separate cut-off limits are proposed.

  9. Stressful Life Events and Psychosomatic Symptoms among Students Smokers and Non-smokers

    Science.gov (United States)

    Dodaj, Arta; Simic, Natasa

    2012-01-01

    The objective of this study is to analyze the rate of stressful life events and psychosomatic symptoms among students smokers and non-smokers and examine the predictive contribution of stress and smoking to subjective health status. Methods were conducted on a convenience sample of 200 students from the University of Mostar, with a median age of…

  10. Identity change among smokers and ex-smokers: Findings from the ITC Netherlands survey

    NARCIS (Netherlands)

    Meijer, E.; van Laar, C.; Gebhardt, W.A.; Fokkema, M.; van den Putte, B.; Dijkstra, A.; Fong, G.T.; Willemsen, M.C.

    2017-01-01

    Successful smoking cessation appears to be facilitated by identity change, that is, when quitting or nonsmoking becomes part of smokers’ and ex-smokers’ self-concepts. The current longitudinal study is the first to examine how identity changes over time among smokers and ex-smokers and whether this

  11. The role of impulse oscillometry in assessment of airway obstruction in smokers and ex-smokers

    Directory of Open Access Journals (Sweden)

    Taher El-Naggar

    2012-10-01

    Conclusion: IOS is an effective, easy to perform, and a non invasive method for the assessment of airway obstruction in obstructive pulmonary disorders. Although, there is no significant difference between impulse oscillometry and spirometry parameters in early detection of airway obstruction in smokers and ex-smokers groups.

  12. Plain packaging increases visual attention to health warnings on cigarette packs in non-smokers and weekly smokers but not daily smokers.

    Science.gov (United States)

    Munafò, Marcus R; Roberts, Nicole; Bauld, Linda; Leonards, Ute

    2011-08-01

    To assess the impact of plain packaging on visual attention towards health warning information on cigarette packs. Mixed-model experimental design, comprising smoking status as a between-subjects factor, and package type (branded versus plain) as a within-subjects factor. University laboratory. Convenience sample of young adults, comprising non-smokers (n = 15), weekly smokers (n = 14) and daily smokers (n = 14). Number of saccades (eye movements) towards health warnings on cigarette packs, to directly index visual attention. Analysis of variance indicated more eye movements (i.e. greater visual attention) towards health warnings compared to brand information on plain packs versus branded packs. This effect was observed among non-smokers and weekly smokers, but not daily smokers. Among non-smokers and non-daily cigarette smokers, plain packaging appears to increase visual attention towards health warning information and away from brand information. © 2011 The Authors, Addiction © 2011 Society for the Study of Addiction.

  13. Comparison of salivary calcium level in smokers and non-smokers with chronic periodontitis, aggressive periodontitis, and healthy controls

    OpenAIRE

    Kambalyal, Preeti; Kambalyal, Prabhuraj; Hungund, Shital

    2015-01-01

    Objective: The purpose of this study was to compare salivary calcium (Ca) level in smokers and non-smokers with chronic periodontitis, aggressive periodontitis, and healthy controls. Materials and Methods: 56 subjects were included in the study and were grouped as follows: 12 subjects who were periodontally healthy (Group I), 12 subjects having chronic periodontitis who were non-smokers (Group II), 12 non-smokers having aggressive periodontitis (Group III), 12 smokers with chronic periodontit...

  14. A.A., constructivism, and reflecting teams.

    Science.gov (United States)

    Nevels, B

    1997-12-01

    Numerous studies and clinical anecdotes reveal a relationship between attendance at A.A. meetings and/or degree of involvement in A.A. and maintenance of sobriety. Hypotheses as to how A.A. and/or the A.A. meeting is helpful to its members have ranged from a focus on factors common to all therapy groups, to aspects of A.A. "treatment" which are behavioral in nature. Presented here is another way of understanding A.A.'s effectiveness within the frame of more recent, constructivistic approaches to family therapy. In particular, the A.A. topic meeting is compared to the reflecting team concept of Tom Anderson.

  15. Enhanced prolactin levels in opium smokers.

    Science.gov (United States)

    Moshtaghi-Kashanian, Ghollam-Reza; Esmaeeli, Farzaneh; Dabiri, Shahriar

    2005-12-01

    In Iran, opium is smoked for pleasure or as a medication by some people. It is a complex mixture of 40 different alkaloids, including morphine and codeine along with many impurities. Although it is well established that opioids or tobacco affect many physiological functions in humans, to our knowledge there has been no specific study looking at these effects in opium smokers. To assess that, we investigated the circulating levels of prolactin, TSH, LH, FSH and testosterone in male opium smokers who also smoke cigarettes (n=23, aged 28.4+/- 4.1 years), and comparing this with the corresponding values for nicotine abusers (n=12, 15-25 cigarettes/day) or a healthy control group (n=20) of the same age. Our results showed that 86.96% of the opium-dependent and 41.67 % of the nicotine-dependent group displayed high prolactin values (popium and the plasma prolactin level of opium dependents (p=0.748, popium smokers and 50% of the cigarette smokers (popium smokers was also lower than that of the other two groups (popium and cigarette smoking may synergistically influence pituitary hormone production through the effects on neuropeptides produced either locally or systemic.

  16. [Smoker teenagers in colleges of Zaghouan].

    Science.gov (United States)

    Abdelkafi Koubaa, Afifa; Chibani, Moncef; Bel Abed, Najet; Dahmen, Hayet; Ouerfelli, Nabil; Taher Maabouj, Mohamed; Hasni, Khadija; Askri, Moncef; Sellami, Lotfi

    2009-09-01

    The aim of this study is to evaluate the rate of smoker adolescents in Zaghouan, to seek for the smoking reasons, the used arguments, recording to them, to stop, and show their knowledge about prevention. A prospective study included 266 teenagers scolarised: 194 boys and 72 girls (aged from 12 to 16 years) from 3 colleges located in Zaghouan during 2006. A questionnaire was drawn up on these adolescents. It contains three parts: tabagic habits of smoking teenagers, the reasons of smoking and information about prevention. Twenty six percents of students are smokers, this percentage increases with the scholar level. They have parents' authorization in 18% of cases and have at least one smoker in their environment in 74% of cases. From whose who have tried tobacco, 65% became smokers. The most invoked causes are calming character of cigarettes and the pleasure to smoke. The first cigarette is smoked just for curiosity. The middle age of smoking initiation is 12 years. Twenty three percents of smoking students have tried to stop. The reasons are the dangerous character for health and the cost of tobacco. Adolescents prefer to use shocking pictures to self-sensitize (66%). Some pupils suggest calling smoker persons who are victims of tobacco to talk about their experiences. Adolescents' smoking is a Public Health priority in Tunisia. The rate of smoking, its cost and its bad health risks encourage us to make preventions, especially the education and information for children and help adolescents to stop smoking.

  17. Lower hypoxic ventilatory response in smokers compared to non-smokers during abstinence from cigarettes.

    Science.gov (United States)

    Hildebrandt, Wulf; Sauer, Roland; Koehler, Ulrich; Bärtsch, Peter; Kinscherf, Ralf

    2016-11-24

    Carotid body O 2 -chemosensitivity determines the hypoxic ventilatory response (HVR) as part of crucial regulatory reflex within oxygen homeostasis. Nicotine has been suggested to attenuate HVR in neonates of smoking mothers. However, whether smoking affects HVR in adulthood has remained unclear and probably blurred by acute ventilatory stimulation through cigarette smoke. We hypothesized that HVR is substantially reduced in smokers when studied after an overnight abstinence from cigarettes i.e. after nicotine elimination. We therefore determined the isocapnic HVR of 23 healthy male smokers (age 33.9 ± 2.0 years, BMI 24.2 ± 0.5 kg m -2 , mean ± SEM) with a smoking history of >8 years after 12 h of abstinence and compared it to that of 23 healthy male non-smokers matched for age and BMI. Smokers and non-smokers were comparable with regard to factors known to affect isocapnic HVR such as plasma levels of glucose and thiols as well as intracellular levels of glutathione in blood mononuclear cells. As a new finding, abstinent smokers had a significantly lower isocapnic HVR (0.024 ± 0.002 vs. 0.037 ± 0.003 l min -1 % -1 BMI -1 , P = 0.002) compared to non-smokers. However, upon re-exposure to cigarettes the smokers' HVR increased immediately to the non-smokers' level. This is the first report of a substantial HVR reduction in abstinent adult smokers which appears to be masked by daily smoking routine and may therefore have been previously overlooked. A low HVR may be suggested as a novel link between smoking and aggravated hypoxemia during sleep especially in relevant clinical conditions such as COPD.

  18. AA/12-lipoxygenase signaling contributes to inhibitory learning in Hermissenda Type B photoreceptors

    Directory of Open Access Journals (Sweden)

    Tony L Walker

    2010-08-01

    Full Text Available Conditioned inhibition (CI is a major category of associative learning that occurs when an organism learns that one stimulus predicts the absence of another. In addition to being important in its own right, CI is interesting because its occurrence implies that the organism has formed an association between stimuli that are non-coincident. In contrast to other categories of associative learning that are dependent upon temporal contiguity (pairings of stimuli, the neurobiology of CI is virtually unexplored. We have previously described a simple form of CI learning in Hermissenda, whereby animals’ phototactic behavior is increased by repeated exposures to explicitly unpaired (EU presentations of light and rotation. EU conditioning also produces characteristic reductions in the excitability and light response, and increases several somatic K+ currents in Type B photoreceptors. Type B photoreceptors are a major site of plasticity for classical conditioning in Hermissenda. Because arachidonic acid (AA and/or its metabolites open diverse K+ channels in many cell types, we examined the potential contribution of AA to CI. Our results indicate that AA contributes to one of the major effects of EU-conditioning on Type B photoreceptors: decreases in light-evoked spike activity. We find that AA increases the transient (IA somatic K+ current in Type B photoreceptors, further mimicking CI training. In addition, our results indicate that metabolism of AA by a 12-lipoxygenase enzyme is critical for these effects of AA, and further that 12-lipoxygenase metabolites are apparently generated during CI training.

  19. Achieving high rates of consent for genetic testing among African American smokers.

    Science.gov (United States)

    Cox, Lisa Sanderson; Bronars, Carrie A; Thomas, Janet L; Okuyemi, Kolawole S; King, Gary; Mayo, Matthew S; Ahluwalia, Jasjit S

    2007-06-01

    Genetic factors play an important role in smoking behavior. Although African Americans are at disproportionately increased risk for tobacco-related morbidity and mortality, limited attention has been given to genetic investigation of tobacco use in this population. The present study examined consent for genetic testing among African American smokers enrolled in a smoking cessation clinical trial. African American light smokers (genetic analysis related to smoking. Participants completed assessment of demographic, psychosocial, and tobacco-related variables. Of 755 clinical trial participants, 745 (99%) responded to the genetic consent form. Of participants who responded, 620 (83%) provided consent for blood collection for genetic analysis. No significant differences were identified between individuals who consented to genetic analysis and those who denied consent. This study demonstrated the feasibility of obtaining consent for genetic analysis for smoking-related investigation among African American smokers. Findings support the inclusion of African Americans within genetic investigation of tobacco use and treatment.

  20. Cigarette smokers' classification of tobacco products.

    Science.gov (United States)

    Casseus, M; Garmon, J; Hrywna, M; Delnevo, C D

    2016-11-01

    Cigarette consumption has declined in the USA. However, cigar consumption has increased. This may be due in part to some cigarette smokers switching to filtered cigars as a less expensive substitute for cigarettes. Additionally, some cigarette smokers may perceive and consume little filtered cigars as cigarettes. The purpose of this study was to determine how cigarette smokers classify tobacco products when presented with photographs of those products. An online survey was conducted with a sample of 344 self-identified cigarette smokers. Respondents were presented with pictures of various types of tobacco products, both with and without packaging, and then asked to categorise them as either a cigarette, little cigar, cigarillo, cigar or machine-injected roll-your-own cigarette (RYO). Respondents were also asked about their tobacco use and purchasing behaviour. Overall, respondents had difficulty distinguishing between cigarettes, little cigars, cigarillos and RYO. When presented with images of the products without packaging, 93% of respondents identified RYO as a cigarette, while 42% identified a little cigar as a cigarette. Additionally, respondents stated that they would consider purchasing little cigars as substitutes for cigarettes because of the price advantage. The results of this survey suggest that when presented with photographs of tobacco products, large proportions of current smokers were unable to differentiate between cigarettes, little cigars, cigarillos, RYO and cigars. Findings have implications for existing public health efforts targeting cigarette smokers, and underscore the need to review current definitions of tobacco products and federal excise taxes on such products. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  1. Do symptoms predict COPD in smokers?

    Science.gov (United States)

    Ohar, Jill A; Sadeghnejad, Alireza; Meyers, Deborah A; Donohue, James F; Bleecker, Eugene R

    2010-06-01

    The US Preventive Services Task Force recommends against spirometry in the absence of symptoms. However, as much as 50% of COPD cases in the United States remain undiagnosed. Report of symptoms, smoking history, and spirometric data were collected from subjects screened for a work-related medical evaluation (N = 3,955). Prevalence of airflow obstruction and respiratory symptoms were assessed. Sensitivity, specificity, positive and negative predictive values, and relative risks of predicting symptoms and smoking history for COPD were calculated. Forty-four percent of smokers in our sample had airways obstruction (AO). Of these, 36% reported a diagnosis of or treatment for COPD. Odds ratio (95% CI) for AO with smoking (> or = 20 pack-years) was 3.73 (3.12- 4.45), 1.98 (1.73-2.27) for cough, 1.79 (1.55-2.08) for dyspnea, 1.95 (1.70-2.34) for sputum, and 2.59 (2.26-2.97) for wheeze. Respiratory symptoms were reported by 92% of smokers with AO, 86% smokers with restriction, 76% smokers with normal spirometry, and 73% of nonsmokers. Sensitivity (92% vs 90%), specificity (19% vs 22%), positive (47% vs 40%) and negative (75% vs 80%) predictive values for the presence of one or more symptoms were similar between smokers and all subjects. COPD is underdiagnosed in the United States. Symptoms are frequent in subjects with AO and increase their risk for COPD, but add little beyond age and smoking history to the predictive value of spirometry. In view of the high prevalence of symptoms and their poor predictive value, a simpler and more effective approach would be to screen older smokers.

  2. Genome-wide association study of a nicotine metabolism biomarker in African American smokers: impact of chromosome 19 genetic influences.

    Science.gov (United States)

    Chenoweth, Meghan J; Ware, Jennifer J; Zhu, Andy Z X; Cole, Christopher B; Cox, Lisa Sanderson; Nollen, Nikki; Ahluwalia, Jasjit S; Benowitz, Neal L; Schnoll, Robert A; Hawk, Larry W; Cinciripini, Paul M; George, Tony P; Lerman, Caryn; Knight, Joanne; Tyndale, Rachel F

    2018-03-01

    The activity of CYP2A6, the major nicotine-inactivating enzyme, is measurable in smokers using the nicotine metabolite ratio (NMR; 3'hydroxycotinine/cotinine). Due to its role in nicotine clearance, the NMR is associated with smoking behaviours and response to pharmacotherapies. The NMR is highly heritable (~80%), and on average lower in African Americans (AA) versus whites. We previously identified several reduce and loss-of-function CYP2A6 variants common in individuals of African descent. Our current aim was to identify novel genetic influences on the NMR in AA smokers using genome-wide approaches. Genome-wide association study (GWAS). Multiple sites within Canada and the United States. AA smokers from two clinical trials: Pharmacogenetics of Nicotine Addiction Treatment (PNAT)-2 (NCT01314001; n = 504) and Kick-it-at-Swope (KIS)-3 (NCT00666978; n = 450). Genome-wide SNP genotyping, the NMR (phenotype) and population substructure and NMR covariates. Meta-analysis revealed three independent chromosome 19 signals (rs12459249, rs111645190 and rs185430475) associated with the NMR. The top overall hit, rs12459249 (P = 1.47e-39; beta = 0.59 per C (versus T) allele, SE = 0.045), located ~9.5 kb 3' of CYP2A6, remained genome-wide significant after controlling for the common (~10% in AA) non-functional CYP2A6*17 allele. In contrast, rs111645190 and rs185430475 were not genome-wide significant when controlling for CYP2A6*17. In total, 96 signals associated with the NMR were identified; many were not found in prior NMR GWASs in individuals of European descent. The top hits were also associated with the NMR in a third cohort of AA (KIS2; n = 480). None of the hits were in UGT or OCT2 genes. Three independent chromosome 19 signals account for ~20% of the variability in the nicotine metabolite ratio in African American smokers. The hits identified may contribute to inter-ethnic variability in nicotine metabolism, smoking behaviours and tobacco-related disease risk

  3. Laboratory Astrophysics Division of the AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  4. Laboratory Astrophysics Division of The AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-10-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  5. Comparison of Puff Volume With Cigarettes per Day in Predicting Nicotine Uptake Among Daily Smokers

    Science.gov (United States)

    Krebs, Nicolle M.; Chen, Allshine; Zhu, Junjia; Sun, Dongxiao; Liao, Jason; Stennett, Andrea L.; Muscat, Joshua E.

    2016-01-01

    Abstract The role of inhalation behaviors as predictors of nicotine uptake was examined in the Pennsylvania Adult Smoking Study (2012–2014), a study of 332 adults whose cigarette smoking was measured in a naturalistic environment (e.g., at home) with portable handheld topography devices. Piecewise regression analyses showed that levels of salivary cotinine, trans-3′-hydroxycotinine, and total salivary nicotine metabolites (cotinine + trans-3′-hydroxycotinine) increased linearly up to a level of about 1 pack per day (20 cigarettes per day (CPD)) (P < 0.01). Total daily puff volume (TDPV; in mL) (P < 0.05) and total daily number of puffs (P < 0.05), but not other topographical measures, increased linearly with CPD up to a level of about 1 pack per day. The mean level of cotinine per cigarette did not change above 20 CPD and was 36% lower in heavy smokers (≥20 CPD) than in lighter smokers (<20 CPD) (15.6 ng/mL vs. 24.5 ng/mL, respectively; P < 0.01). Mediation models showed that TDPV accounted for 43%–63% of the association between CPD and nicotine metabolites for smokers of <20 CPD. TDPV was the best predictor of nicotine metabolite levels in light-to-moderate smokers (1–19 CPD). In contrast, neither CPD, total daily number of puffs, nor TDPV predicted nicotine metabolite levels above 20 CPD (up to 40 CPD). Finally, although light smokers are traditionally considered less dependent on nicotine, these findings suggest that they are exposed to more nicotine per cigarette than are heavy smokers due to more frequent, intensive puffing. PMID:27313218

  6. Long-term prognosis of AL and AA renal amyloidosis: a Japanese single-center experience.

    Science.gov (United States)

    Ozawa, Masatoyo; Komatsuda, Atsushi; Ohtani, Hiroshi; Nara, Mizuho; Sato, Ryuta; Togashi, Masaru; Takahashi, Naoto; Wakui, Hideki

    2017-04-01

    Few studies have been conducted on the long-term prognosis of patients with amyloid light chain (AL) and amyloid A (AA) renal amyloidosis in the same cohort. We retrospectively examined 68 patients with biopsy-proven renal amyloidosis (38 AL and 30 AA). Clinicopathological findings at the diagnosis and follow-up data were evaluated in each patient. We analyzed the relationship between clinicopathological parameters and survival data. Significant differences were observed in several clinicopathological features, such as proteinuria levels, between the AL and AA groups. Among all patients, 84.2 % of the AL group and 93.3 % of the AA group received treatments for the underlying diseases of amyloidosis. During the follow-up period (median 18 months in AL and 61 months in AA), 36.8 % of the AL group and 36.7 % of the AA group developed end-stage renal failure requiring dialysis, while 71.1 % of the AL group and 56.7 % of the AA group died. Patient and renal survivals were significantly longer in the AA group than in the AL group. eGFR of >60 mL/min/1.73 m 2 at biopsy and an early histological stage of glomerular amyloid deposition were identified as low-risk factors. A multivariate analysis showed that cardiac amyloidosis and steroid therapy significantly influenced patient and renal survivals. Our results showed that heart involvement was the major predictor of poor outcomes in renal amyloidosis, and that the prognosis of AA renal amyloidosis was markedly better than that in previously reported cohorts. Therapeutic advances in inflammatory diseases are expected to improve the prognosis of AA amyloidosis.

  7. The determination of polonium in urine of Filipino non-smokers and smokers

    International Nuclear Information System (INIS)

    Juan, N.B.; Ballelos, E.

    1976-03-01

    Po 210 , a decay product of Ra 226 , is a pure alpha emitter with an energy of 5.3 MeV decaying with a half-life of 138.4 days. It is a natural containment of tobacco and hence a health hazard to smokers. Previous study on Philippine cigarettes revealed that the average Po 210 activity of local brands is 0.0071 pCi/g. while that of foreign brands is 0.0129 pCi/g. Other studies indicate that approximately 0.13% of the total Po 210 in the body is excreted in the urine daily. Po urinalysis can serve as a rough index of the body burden of Po 210 and Ra 226 or anyone of its daughters absorbed in case of exposures. In this study, the Po 210 content in urine of smokers is compared with that of non-smokers. Twenty samples from non-smokers and twenty samples from smokers were analyzed for Po 210 activity. The average Po content of the urine of smokers, 0.2673+-0.1077 pCi/24h appears to be higher than the mean Po activity in urine of non-smokers, 0.1877+-0.1200. The t-value obtained from the comparison of the means was 2.205. This exceeds the t-value at the 0.05 significance level (degrees of freedom equal 19) which is 1.725. Therefore, there exists a significant difference in the Po content in the urine of non-smokers to that of smokers

  8. White Light Generation in Human Saliva

    Science.gov (United States)

    Santhosh, C.; Dharmadhikari, A. K.; Dharmadhikari, J. A.; Alti, K.; Mathur, D.

    2011-07-01

    Interaction of intense, femto-second pulses of infrared light (800 nm) with water generates white light supercontinuum due to nonlinear optical effects. This supercontinuum was found to be suppressed by the addition of alpha amylase, a major protein in the human saliva. We have studied the suppression of supper continuum by human saliva, collected from healthy subjects with and without smoking habits. Suppression of the blue-sided components was observed significantly in non-smokers saliva than chain smokers.

  9. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  10. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  11. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  12. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  13. Prevalence characteristics of COPD in never smokers

    Directory of Open Access Journals (Sweden)

    Ramadan M. Bakr

    2012-07-01

    Conclusions: This study revealed that never smokers constitute a significant proportion of the Egyptian COPD patients. When dealing with COPD management, clinicians must be oriented with the different risk factors, other than tobacco smoke, that play a key role in the development and pathogenesis of COPD, because despite smoking is the most important risk factor, its absence doesn’t exclude COPD diagnosis.

  14. Maternal bonding styles in smokers and non-smokers: a comparative study

    OpenAIRE

    Csala, Iren; Elemery, Monika; Martinovszky, Fruzsina; Dome, Peter; Dome, Balazs; Faludi, Gabor; Sandor, Imola; Gyorffy, Zsuzsa; Birkas, Emma; Lazary, Judit

    2016-01-01

    Background Parental bonding has been implicated in smoking behavior, and the quality of maternal bonding (MB) has been associated with poor mental health and substance use. However, little is known about the association of MB and the smoking of the offspring. Methods In our study, 129 smokers and 610 non-smoker medical students completed the parental bonding instrument, which measures MB along two dimensions: care and overprotection. Four categories can be created by high and low scores on ca...

  15. ALPHA – 1 ANTITRYPSIN IN SMOKERS AND NON SMOKERS CHRONIC OBSTRUCTIVE PULMONARY DISEASE

    Directory of Open Access Journals (Sweden)

    Panchal Mittal A, Shaikh Sahema M, Sadariya Bhavesh R, Bhoi Bharat K, Sharma Hariom M

    2015-01-01

    Full Text Available Aim: The aim of the present study is to correlate and compare alpha-1 antitrypsin level in smoker and non smoker chronic obstructive pulmonary disease patients. Material and Methods: A comparative study was carried out in 200 subjects, more than 40 years of age and having chronic obstructive pulmonary disease for more than 1 year with a history of smoking at least 20 cigarettes per day (Group A and without a history of smoking (Group B. Pulmonary function tests were used to diagnose the disease as per the Global Initiative for Chronic Obstructive Lung Disease (GOLD classification. Alpha-1 antitrypsin level was done by turbidimetry method on fully auto analyzer I-Lab 650 (Instrumentation Laboratory, USA at Clinical Biochemistry Section, Laboratory Services Sir Takhtsinhji Hospital, Bhavnagar. Statistical analysis was done by using unpaired t-test and Pearson’s correlation coefficient. Results: Results of present study shows that alpha-1 antitrypsin level was decreased in smoker chronic obstructive pulmonary disease patients (150.83±18.853 when compared to non smokers (183.97±29.383. There was statistically significant difference in alpha-1 antitrypsin level between the two groups with ‘p’ value of <0.0001. Pearson’s correlation test show negative correlation between smoker and non-smoker chronic obstructive pulmonary disease patients. Conclusion: The values of serum alpha-1 antitrypsin levels were more significantly decreased in smokers indicating an important role of smoking in pathogenesis of chronic obstructive pulmonary disease. Alpha-1 antitrypsin can act as a predictor for future development of chronic obstructive pulmonary disease in smokers and in nonsmokers.

  16. Effects of Exercise on Hemorheological Parameters of Young Nigerian Smokers

    OpenAIRE

    AWODU, Omolade Augustina; FAMODU, Ademola Adekunle

    2014-01-01

    Aim: Regular physical exercise is associated with reduced risk of cardiovascular diseases. In this study, the hypothesis that acute submaximal exercise has similar effects on rheological parameters of smokers and non-smokers was tested. Materials and Methods: Thirty-three male university undergraduates comprised of 18 smokers and 15 non-smokers were studied. All the subjects underwent submaximal exercise on cycloergometer for 30 minutes. Blood for hemorheological parameters was collected 30...

  17. Adolescent cigarette smokers' and non-cigarette smokers' use of alternative tobacco products.

    Science.gov (United States)

    Saunders, Charles; Geletko, Karen

    2012-08-01

    This study uses the most recent data from the nationally representative National Youth Tobacco Survey (NYTS) to examine the use of alternative tobacco products among U.S. cigarette smokers and non-cigarette smokers aged 14-17. Alternative tobacco product use is defined as use of one or more of the following products: smokeless tobacco, cigars, pipes, bidis, or kreteks. Using the results from the 2004, 2006, and 2009 NYTS, multivariate logistic regressions were used to investigate separately the extent of alternative tobacco product use in current cigarette smokers and in those who reported not smoking cigarettes controlling for demographic and other independent influences. The results indicate that for adolescent smokers and nonsmokers, the use of one type of alternative tobacco product made it much more likely the individual would use one or more of the other alternative tobacco products. Non-cigarette smokers using these tobacco products appeared to exhibit symptoms of nicotine dependence comparable to those of cigarette smokers. More information on adolescent use of alternative tobacco products is needed. Current cigarette use declined 3.4% annually over 2004-2009 for the NYTS 14- to 17-year-old population, but this cohort's use of alternative tobacco products was unchanged. The number of adolescents aged 14-17 who did not smoke cigarettes but used alternative tobacco products increased 5.9% per year over the same period. Current surveillance measures need to be expanded in order to gain a more comprehensive understanding of adolescent alternative tobacco use.

  18. What characterises smokers who quit without using help?

    DEFF Research Database (Denmark)

    Mikkelsen, Stine Schou; Dalum, Peter; Skov-Ettrup, Lise Skrubbeltrang

    2015-01-01

    -2008. In all, 6445 persons reporting quitting successfully within the last 5 years were included in analyses. Users and non-users of cessation aid (medical or behavioural support) were compared with regards to age, education, years smoked, tobacco amount, tobacco type and smoking-related disease using logistic......, those who had smoked for 15 years or more also had lower odds of quitting unaided. Smoking 15 or more grams of tobacco daily was inversely associated with quitting unaided (eg, OR among men were 0.38, 95% CI 0.31 to 0.46). CONCLUSIONS: Quitting smoking without the use of formalised aid was the most...... common cessation approach. Quitting unaided was more likely among men, younger age groups, those with a shorter history of smoking and those who were light smokers. These results indicate that awareness of unaided cessation in general and to those for whom it is especially relevant should be increased...

  19. [Tooth decay and its complication prognosis in smokers].

    Science.gov (United States)

    Orekhova, L Iu; Osipova, M V

    2014-01-01

    The study focuses on complicated and non-complicated tooth decay course and prognosis in smokers. Oral status, prevention and treatment effectiveness was assessed in 330 non-smokers and 345 smoking patients. The results allowed concluding with guidelines for tooth decay prevention and treatment in smokers.

  20. Oral hygiene compliance and gingivitis expression in cigarette smokers.

    Science.gov (United States)

    Bergström, J

    1990-12-01

    The compliance with an oral hygiene intervention program and its effect on oral cleanliness and gingivitis was studied in smokers and non-smokers. The study group represented patients with regular dental attendance. It comprised 68 patients 21-60 yr of age, including 28 habitual smokers. The program included toothbrushing with an electric toothbrush for 12 months. Oral cleanliness was evaluated according to a percentage plaque index and gingivitis according to the percentage of bleeding sites. The compliance with the oral hygiene program was very high among smokers and non-smokers. Plaque index at baseline was very similar in smokers and non-smokers and remained so during the course of the investigation. Following the introduction of the oral hygiene program, plaque index decreased in both groups, and there were no statistically significant differences between the two groups. In spite of the similarity in plaque index, gingival bleeding was significantly lower in smokers than non-smokers. The results suggest that smokers and non-smokers do not differ with respect to habitual oral hygiene or compliance with hygiene programs. In smokers, however, the clinical gingivitis expression in response to plaque is suppressed.

  1. A Critical Evaluation of Nicotine Replacement Therapy for Teenage Smokers.

    Science.gov (United States)

    Patten, Christi A.

    2000-01-01

    Evaluates the appropriateness and feasibility of nicotine replacement therapy (NRT) in teenage smokers. Available forms of NRT, theoretical rationale and efficacy of NRT, ethical considerations, and the feasibility of NRT in teenage smokers are addressed. Several characteristics similar to adult nicotine dependent smokers have been found in teen…

  2. The Effects of 8-Weeks Aerobic Exercise Program on Blood Lipids and Cholesterol Profile of Smokers vs. Non Smokers

    Science.gov (United States)

    Taifour, Akef; AL-Shishani, Ahmad; Khasawneh, Aman; AL-Nawaiseh, Ali; Bakeer, Mohammed

    2015-01-01

    The aim of this study was to compare the effects of 8-week aerobic exercise program on blood lipids and cholesterol profile of smoker's vs. non-smokers. A total of 34 male subjects (18 non-smokers and 16 smokers) took part in this study. Both groups were pre- and post tested in their blood-lipids and cholesterol profile before and after the 8-week…

  3. Disparity and Trends in Secondhand Smoke Exposure among Japanese Employees, Particularly Smokers vs. Non-Smokers.

    Science.gov (United States)

    Tabuchi, Takahiro; Colwell, Brian

    2016-01-01

    Monitoring disparities in secondhand smoke (SHS) exposure is important for tailoring smoke-free policies to the needs of different groups. We examined disparity and trends in SHS exposure among both nonsmokers and smokers at Japanese workplaces between 2002 and 2012. A total of 32,940 employees in nationally representative, population-based, repeated cross-sectional surveys in 2002, 2007 and 2012 in Japan was analyzed. Adjusted rate ratios for workplace SHS exposure from other people ("everyday" and "everyday or sometimes") were calculated according to covariates, using log-binomial regression models with survey weights. In this survey, employees who do not smoke at workplace are defined as workplace-nonsmokers; and those smoke at workplace are used as workplace-smokers. SHS exposure for smokers does not involve their own SHS. While everyday SHS exposure prevalence in workplace-nonsmokers decreased markedly (33.2% to 11.4%), that in workplace-smokers decreased only slightly (63.3% to 55.6%). Workplace-smokers were significantly more likely to report everyday SHS exposure than workplace-nonsmokers, and the degree of association increased over time: compared with the nonsmokers (reference), covariates-adjusted rate ratio (95% confidence interval) for the smokers increased from 1.70 (1.62-1.77) in 2002 to 4.16 (3.79-4.56) in 2012. Similar results were observed for everyday or sometimes SHS exposure. Compared with complete workplace smoking bans, partial and no bans were consistently and significantly associated with high SHS exposure among both nonsmokers and smokers. We also observed disparities in SHS exposure by employee characteristics, such as age group and worksite scale. Although overall SHS exposure decreased among Japanese employees between 2002 and 2012, the SHS exposure disparity between nonsmokers and smokers widened. Because smokers reported more frequent SHS exposure than nonsmokers, subsequent mortality due to SHS exposure may be higher in smokers than

  4. An exploration of the Facebook social networks of smokers and non-smokers.

    Directory of Open Access Journals (Sweden)

    Luella Fu

    Full Text Available Social networks influence health behavior, including tobacco use and cessation. To date, little is known about whether and how the networks of online smokers and non-smokers may differ, or the potential implications of such differences with regards to intervention efforts. Understanding how social networks vary by smoking status could inform public health efforts to accelerate cessation or slow the adoption of tobacco use.These secondary analyses explore the structure of ego networks of both smokers and non-smokers collected as part of a randomized control trial conducted within Facebook.During the trial, a total of 14,010 individuals installed a Facebook smoking cessation app: 9,042 smokers who were randomized in the trial, an additional 2,881 smokers who did not meet full eligibility criteria, and 2,087 non-smokers. The ego network for all individuals was constructed out to second-degree connections. Four kinds of networks were constructed: friendship, family, photo, and group networks. From these networks we measured edges, isolates, density, mean betweenness, transitivity, and mean closeness. We also measured diameter, clustering, and modularity without ego and isolates. Logistic regressions were performed with smoking status as the response and network metrics as the primary independent variables and demographics and Facebook utilization metrics as covariates.The four networks had different characteristics, indicated by different multicollinearity issues and by logistic regression output. Among Friendship networks, the odds of smoking were higher in networks with lower betweenness (p = 0.00, lower transitivity (p = 0.00, and larger diameter (p = 0.00. Among Family networks, the odds of smoking were higher in networks with more vertices (p = .01, less transitivity (p = .04, and fewer isolates (p = .01. Among Photo networks, none of the network metrics were predictive of smoking status. Among Group networks, the odds of smoking were higher

  5. An exploration of the Facebook social networks of smokers and non-smokers.

    Science.gov (United States)

    Fu, Luella; Jacobs, Megan A; Brookover, Jody; Valente, Thomas W; Cobb, Nathan K; Graham, Amanda L

    2017-01-01

    Social networks influence health behavior, including tobacco use and cessation. To date, little is known about whether and how the networks of online smokers and non-smokers may differ, or the potential implications of such differences with regards to intervention efforts. Understanding how social networks vary by smoking status could inform public health efforts to accelerate cessation or slow the adoption of tobacco use. These secondary analyses explore the structure of ego networks of both smokers and non-smokers collected as part of a randomized control trial conducted within Facebook. During the trial, a total of 14,010 individuals installed a Facebook smoking cessation app: 9,042 smokers who were randomized in the trial, an additional 2,881 smokers who did not meet full eligibility criteria, and 2,087 non-smokers. The ego network for all individuals was constructed out to second-degree connections. Four kinds of networks were constructed: friendship, family, photo, and group networks. From these networks we measured edges, isolates, density, mean betweenness, transitivity, and mean closeness. We also measured diameter, clustering, and modularity without ego and isolates. Logistic regressions were performed with smoking status as the response and network metrics as the primary independent variables and demographics and Facebook utilization metrics as covariates. The four networks had different characteristics, indicated by different multicollinearity issues and by logistic regression output. Among Friendship networks, the odds of smoking were higher in networks with lower betweenness (p = 0.00), lower transitivity (p = 0.00), and larger diameter (p = 0.00). Among Family networks, the odds of smoking were higher in networks with more vertices (p = .01), less transitivity (p = .04), and fewer isolates (p = .01). Among Photo networks, none of the network metrics were predictive of smoking status. Among Group networks, the odds of smoking were higher when diameter

  6. An exploration of the Facebook social networks of smokers and non-smokers

    Science.gov (United States)

    2017-01-01

    Background Social networks influence health behavior, including tobacco use and cessation. To date, little is known about whether and how the networks of online smokers and non-smokers may differ, or the potential implications of such differences with regards to intervention efforts. Understanding how social networks vary by smoking status could inform public health efforts to accelerate cessation or slow the adoption of tobacco use. Objectives These secondary analyses explore the structure of ego networks of both smokers and non-smokers collected as part of a randomized control trial conducted within Facebook. Methods During the trial, a total of 14,010 individuals installed a Facebook smoking cessation app: 9,042 smokers who were randomized in the trial, an additional 2,881 smokers who did not meet full eligibility criteria, and 2,087 non-smokers. The ego network for all individuals was constructed out to second-degree connections. Four kinds of networks were constructed: friendship, family, photo, and group networks. From these networks we measured edges, isolates, density, mean betweenness, transitivity, and mean closeness. We also measured diameter, clustering, and modularity without ego and isolates. Logistic regressions were performed with smoking status as the response and network metrics as the primary independent variables and demographics and Facebook utilization metrics as covariates. Results The four networks had different characteristics, indicated by different multicollinearity issues and by logistic regression output. Among Friendship networks, the odds of smoking were higher in networks with lower betweenness (p = 0.00), lower transitivity (p = 0.00), and larger diameter (p = 0.00). Among Family networks, the odds of smoking were higher in networks with more vertices (p = .01), less transitivity (p = .04), and fewer isolates (p = .01). Among Photo networks, none of the network metrics were predictive of smoking status. Among Group networks, the

  7. Nasal mucociliary transportability of male and female smokers.

    Science.gov (United States)

    Uzeloto, Juliana Souza; Ramos, Dionei; C F Freire, Ana Paula; G D Christofaro, Diego; M C Ramos, Ercy

    2017-04-08

    Female smoker's present increased susceptibility to several diseases when compared to the opposite gender. However, there are no studies showing differences in nasal mucociliary transport behavior between male and female smokers. To compare the nasal mucociliary transportability in male and female smokers and non-smokers, taking into consideration age, anthropometric data, smoking load and pulmonary function. The analysis included 139 individuals (33 men and 37 women smokers and 32 men and 37 women non-smokers). All participants answered an initial interview to obtain personal data and smoking load. Anthropometric data and carbon monoxide in the exhaled air were assessed. Individuals also performed pulmonary function test and Saccharin Transit Time test. To compare saccharin transit time values between men and women, smokers and non-smokers, stratification of all independent variables was performed (sociodemographic, smoking and respiratory variables) into two categories: below and above the median values. There was no difference between men and women, smokers and non-smokers, regarding nasal mucociliary transportability. Significant differences were only observed between non-smokers. Among those with less forced vital capacity values (transport faster than men. Moreover, it was observed influence of BMI and COex (women smokers), FCV and FEV1 (men non-smokers) and FEF 25-75% (women non-smokers) on saccharin transit time values. Based on the findings of this study, nasal mucociliary transport in male and female adult smokers, apparently healthy, are similar. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  8. Mood, mood regulation, and frontal systems functioning in current smokers, long-term abstinent ex-smokers, and never-smokers.

    Science.gov (United States)

    Lyvers, Michael; Carlopio, Cassandra; Vicole Bothma, Honours; Edwards, Mark S

    2014-01-01

    Indices of mood, mood regulation, and executive functioning were examined in 61 current smokers who have smoked daily for at least one year, 36 ex-smokers who had not smoked a cigarette for at least one year, and 86 never-smokers. All participants completed the following measures online: Depression Anxiety Stress Scales (DASS-21), the Negative Mood Regulation (NMR) scale, the Frontal Systems Behavior Scale (FrSBe), the Fagerström Test for Cigarette Dependence (FTCD), and the Alcohol Use Disorders Identification Test (AUDIT). Multivariate analysis of variance (MANOVA) followed by Tukey post-hoc tests revealed significant differences (p ex-smokers and never-smokers on DASS, NMR, and FrSBe, as well as heavier drinking as measured by AUDIT. These differences remained significant even after controlling for AUDIT scores. Results most plausibly reflect a return to pre-smoking baseline brain function in long-term abstinent ex-smokers.

  9. Is secondhand smoke associated with stress in smokers and non-smokers?

    Science.gov (United States)

    Kim, Seung Ju; Han, Kyu-Tae; Lee, Seo Yoon; Chun, Sung-Youn; Park, Eun-Cheol

    2015-12-17

    Secondhand Smoking (SHS) has been suggested as a major health problem in the world and is known to cause various negative health effects that have in turn caused the deaths of almost 600,000 people per year. Evidence has suggested that SHS may have an effect on health problems and such findings have influenced the implementation of smoking-free areas. However, few studies have investigated the effects of SHS on stress which is considered major risk factor for mental health. Thus, the purpose of our study was to investigate the association between exposure to SHS and stress. We performed a cross-sectional study using data from the Korea National Health and Nutrition Examination Survey (2007-2012). In our study, a total of 33,728 participants were included to evaluate the association between SHS exposure and stress based on smoking status. Association between SHS exposure and stress was examined using logistic regression models. A total of 12,441 participants (42.9 %) were exposed to SHS in the workplace or at home. In our study, exposure to SHS was significantly associated with higher stress compared to non-exposure, regardless of smoking status (smoker odds ratio [OR]: 1.22; ex-smoker OR: 1.25; never-smoker OR: 1.42). Our results showed that the effect of SHS on stress was greater when exposure took place both at home and in the workplace in smokers and never-smokers. Exposure to SHS in the workplace and at home is considered to be a risk factor for high stress in both smokers and never-smoker. Therefore, strict regulations banning smoke which can smoking ban reduce SHS exposure are recommended in order to improve the populations' health.

  10. Black smokers and the Tree of Life

    Science.gov (United States)

    Linich, Michael

    The molecular biology revolution has turned the classification of life on its head. Is Whittaker's five-kingdom scheme for the classification of living things no longer relevant to life science education? Coupled with this is the discovery that most microscopic life cannot yet be brought into culture. One of the key organisms making this knowledge possible is Methanococcus jannishi a microorganism found in black smokers. This workshop presents the development of the Universal Tree of Life in a historical context and then links together major concepts in the New South Wales senior science programs of Earth and Environmental Science and Biology by examining the biological and geological aspects of changes to black smokers over geological time.

  11. (PCL/AA) hydrogel for controlled drug delivery

    Indian Academy of Sciences (India)

    Administrator

    PCL-g-AA) on the .... Solvent replacement method was used for porosity meas- urement. Weighed dried discs were immersed in .... Regression coefficient (r) values obtained from PCL/AA hydrogels at varying contents of AA and EGDMA are.

  12. [Clinical and radiological characteristics of pulmonary tuberculosis in tobacco smokers].

    Science.gov (United States)

    Kombila, U D; Mbaye, F B R; Dia Kane, Y; Ka, W; Toure Badiane, N O

    2018-01-27

    Tobacco smoke alters lung defense mechanisms against infections and so increases the risk of mycobacterium tuberculosis infection. To determine the particular clinical features of tuberculosis in smokers and identify risk factors. We conducted a prospective, cross-sectional study over a period of nine months in Dakar, Senegal. The Chi-square test and multiple logistic regression were used to identify differences between smokers and non-smokers and to identify factors associated with clinical outcomes. We included 165 patients with active pulmonary tuberculosis (59 smokers versus 106 never-smokers). The average age of smokers was 43.8±12.7 versus 32.1±13.1 years (P<0.0001). Smokers were overwhelmingly male (98.3% versus 1.8%, P<0.0001). The average delay to consultation was longer among smokers (90 days [30-120] versus 60 days [30-90] ; P<0.0001). In multivariate analysis, alcohol abuse, increasing age, male sex, and an unknown retroviral status were independent risk factors for pulmonary tuberculosis. Haemoptysis was observed more frequently in smokers (49.1% versus 31.1%, P=0.017). With regards to chest X-ray features, smokers presented with more advanced, bilateral and cavitating lung lesions. Diagnostic delay and haemoptysis are important characteristics of the pulmonary tuberculosis in tobacco smokers. Copyright © 2017 SPLF. Published by Elsevier Masson SAS. All rights reserved.

  13. Racial differences in hair nicotine concentrations among smokers.

    Science.gov (United States)

    Apelberg, Benjamin J; Hepp, Lisa M; Avila-Tang, Erika; Kim, Sungroul; Madsen, Camille; Ma, Jiemin; Samet, Jonathan M; Breysse, Patrick N

    2012-08-01

    In the United States, race/ethnicity is a strong determinant of tobacco use patterns, biomarkers of tobacco smoke components and metabolites, and likelihood of successful cessation. Although Black smokers tend to smoke fewer cigarettes than White smokers, they have higher cotinine levels and disease risk and lower cessation success. We examined racial differences in hair nicotine concentrations among daily tobacco smokers (n = 103) in Baltimore, Maryland. Participants completed a survey, and hair samples were collected and analyzed for nicotine concentration using gas chromatography coupled with mass spectrometry. After adjustment, hair nicotine concentrations among Black smokers were more than 5 times higher than among White smokers (95% CI 3.0, 10.5). Smokers reporting hair treatments other than coloring (bleaching, permanent, or straightening) in the past 12 months had 66% lower (95% CI 32%, 83%) hair nicotine concentrations. Smokers reporting smoking their first cigarette within 30 min of waking had twice the hair nicotine concentrations of those whose time to first cigarette was greater than 30 min after waking (95% CI 1.1, 4.2). For every additional cigarette smoked per day up to 20, mean hair nicotine concentration among all smokers increased by 4% (95% CI -1%, 9%). This study demonstrates that Black smokers have substantially higher hair nicotine levels than White smokers, after controlling for cigarettes smoked per day and other exposure sources. Time to first cigarette, cigarettes smoked per day, and use of hair treatments other than coloring were also associated with hair nicotine concentrations among smokers.

  14. Intent to Quit among Daily and Non-Daily College Student Smokers

    Science.gov (United States)

    Pinsker, E. A.; Berg, C. J.; Nehl, E. J.; Prokhorov, A. V.; Buchanan, T. S.; Ahluwalia, J. S.

    2013-01-01

    Given the high prevalence of young adult smoking, we examined (i) psychosocial factors and substance use among college students representing five smoking patterns and histories [non-smokers, quitters, native non-daily smokers (i.e. never daily smokers), converted non-daily smokers (i.e. former daily smokers) and daily smokers] and (ii) smoking…

  15. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    Science.gov (United States)

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  16. Determination of the polonium-210 content in the urine of Filipino smokers and non-smokers

    International Nuclear Information System (INIS)

    Juan, N.B.; Ballelos, E.; Bartolome, Z.M.

    1975-01-01

    Presence of polonium in tobacco poses a health hazard to smokers. Polonium is a pure alpha emitter with an energy of 5.3 MeV decaying with a half-life 138.4 days to a stable isotope of lead. The polonium content in the urine of Filipino smokers was compared with that of non-smokers. The polonium was recovered from urine by centrifugation and deposition into silver discs. Quantitative results were obtained by counting the silver discs using a silicon surface-barrier detector. The average value obtained for smokers which was 0.5003+-0.2988 pCi/24h sample was significantly higher than the value obtained for non-smokers which was 0.2313+-0.1664 pCi/24h sample. The efficiency of the procedure employed encourages the use of urinalysis as a measure of the polonium body burden and also as a rough index of the dose absorbed from radium or any of its daughters

  17. Maternal bonding styles in smokers and non-smokers: a comparative study.

    Science.gov (United States)

    Csala, Iren; Elemery, Monika; Martinovszky, Fruzsina; Dome, Peter; Dome, Balazs; Faludi, Gabor; Sandor, Imola; Gyorffy, Zsuzsa; Birkas, Emma; Lazary, Judit

    2016-01-01

    Parental bonding has been implicated in smoking behavior, and the quality of maternal bonding (MB) has been associated with poor mental health and substance use. However, little is known about the association of MB and the smoking of the offspring. In our study, 129 smokers and 610 non-smoker medical students completed the parental bonding instrument, which measures MB along two dimensions: care and overprotection. Four categories can be created by high and low scores on care and overprotection: optimal parenting (OP; high care/low overprotection); affectionless control (ALC; low care/high overprotection); affectionate constraint (AC; high care/high overprotection), and neglectful parenting (NP; low care/low overprotection). Nicotine dependence was assessed by the Fagerstrom Nicotine Dependence Test, exhaled CO level, and daily cigarette consumption (CPD). Higher CPD was significantly associated with lower overprotection ( p  = 0.016) and higher care ( p  = 0.023) scores. The odds for being a smoker were significantly higher in the neglectful maternal bonding style compared to the other rearing styles ( p  = 0.022). Besides, smokers showed significantly higher care and lower overprotection scores with the Mann-Whitney U-test than non-smokers, although these associations did not remain significant in multiple regression models. Our results indicate that focusing on early life relationship between patient and mother can be important in psychotherapeutic interventions for smoking. Registration trials retrospectively registered.

  18. Quantitative assessment of elemental carbon in the lungs of never smokers, cigarette smokers, and coal miners

    Energy Technology Data Exchange (ETDEWEB)

    Saxena, R.K.; McClure, M.E.; Hays, M.D.; Green, F.H.Y.; McPhee, L.J.; Vallyathan, V.; Gilmour, M.I. [US EPA, Research Triangle Park, NC (United States)

    2011-07-01

    Inhalation exposure to particulates such as cigarette smoke and coal dust is known to contribute to the development of chronic lung disease. The purpose of this study was to estimate the amount of elemental carbon (EC) deposits from autopsied lung samples from cigarette smokers, miners, and control subjects and explore the relationship between EC level, exposure history, and the extent of chronic lung disease. The samples comprised three subgroups representing never smokers (8), chronic cigarette smokers (26), and coal miners (6). Following the dissolution of lung tissue, the extracted EC residue was quantified using a thermal-optical transmission (TOT) carbon analyzer. Mean EC levels in the lungs of the control group were 56.68 +/- 24.86 (SD) g/g dry lung weight. Respective mean EC values in lung samples from the smokers and coal miners were 449.56 +/- 320.3 g/g and 6678.2 +/- 6162 g/g. These values were significantly higher than those obtained from the never-smoker group. EC levels in the lung and pack-years of cigarette smoking correlated significantly, as did EC levels and the severity of small airway disease. This study provides one of the first quantitative assessments of EC in human lungs from populations at high relative risk for the development of chronic lung disease.

  19. Misperceptions of "light" cigarettes abound: National survey data

    Directory of Open Access Journals (Sweden)

    Thomson George

    2009-05-01

    Full Text Available Abstract Background Many smokers believe that "light" cigarettes are less harmful than regular cigarettes, which is at variance with the scientific evidence. The Framework Convention on Tobacco Control (FCTC aims to address this problem in Article 11 which deals with misleading labelling of tobacco products. In this study we aimed to determine smokers' use and beliefs concerning "light" and "mild" cigarettes ("lights", including in relation to ethnicity, deprivation and other socio-demographic characteristics. Methods The New Zealand (NZ arm of the International Tobacco Control Policy Evaluation Survey (ITC Project uses as its sampling frame the NZ Health Survey. This is a national sample with boosted sampling of Maori, Pacific peoples and Asians. From this sample we surveyed adult smokers (n = 1376 about use and beliefs relating to "light" cigarettes. We assessed the associations with smoking "lights" after adjusting for socio-demographic variables, and smoking-related behaviours and beliefs. Results Many smokers of "lights" believed that smoking "lights" made it easier to quit smoking (25%, that "lights" are less harmful (42%, and that smokers of "lights" take in less tar (43%. Overall most "lights" smokers (60% had at least one of these three beliefs, a proportion significantly higher than for smokers of "regular" cigarettes at 45% (adjusted odds ratio (aOR = 1.96, 95% CI = 1.29 – 2.96. While "lights" smokers had significantly lower tobacco consumption and were more aware of smoking harms, they were no more likely to be intending to quit or have made a previous quit attempt. By ethnicity, both Maori and Pacific people were less likely to smoke "lights" than Europeans (aOR = 0.53, 95% CI = 0.35 – 0.80 and aOR = 0.14, 95% CI = 0.05 – 0.40 respectively. In contrast there was no significant difference by level of deprivation. Roll-your-own (RYO tobacco smokers were less likely to smoke "light" forms of RYO tobacco while both older and women

  20. Comparative study of smokers, ex-smokers, and nonsmokers who have experienced myocardial infarction

    Directory of Open Access Journals (Sweden)

    Nozawa Diogo

    2003-01-01

    Full Text Available OBJECTIVE: To assess the impact of smoking on in-hospital morbidity and mortality in patients who have experienced acute myocardial infarction and to assess the association between smoking and other cardiovascular risk factors and clinical data. METHODS: A prospective cohort study analyzed 121 patients, including 54 smokers, 35 ex-smokers, and 32 nonsmokers. RESULTS: Using the chi-square test (P<0.05, an association between smoking and the risk factors sex, age, and diabetes was documented. Among the morbidity and mortality variables, only acute pulmonary edema showed a statistically significant difference (OR=9.5; 95% CI, which was greater in the ex-smoker group than in the nonsmoker group. CONCLUSION: An association between smoking and some cardiovascular risk factors was observed, but no statistical difference in morbidity and mortality was observed in the groups studied, except for the variable acute pulmonary edema.

  1. Comparison of the validity of periodontal probing measurements in smokers and non-smokers.

    Science.gov (United States)

    Biddle, A J; Palmer, R M; Wilson, R F; Watts, T L

    2001-08-01

    To determine whether the reduced inflammation and bleeding and increased fibrosis reported in tobacco smokers affect the validity of clinical probing measurements by altering probe tip penetration. A constant force probe was used to measure probing depths and sound bone levels at six sites on 64 molar teeth (384 sites) in 20 smoking and 20 non-smoking patients from grooves made with a bur at the gingival margin prior to extraction. Connective tissue attachment levels were measured from the grooves with a dissecting microscope following extraction. Data were analysed using robust regression with sites clustered within subjects. Sites in smokers showed more calculus but less bleeding than sites in non-smokers (pperiodontal patients who smoke.

  2. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  3. Could a scheme for licensing smokers work in Australia?

    Science.gov (United States)

    Magnusson, Roger S; Currow, David C

    2013-08-05

    In this article, we evaluate the possible advantages and disadvantages of a licensing scheme that would require adult smokers to verify their right to purchase tobacco products at point of sale using a smart-card licence. A survey of Australian secondary school students conducted in 2011 found that half of 17-2013-old smokers and one-fifth of 12-2013-old smokers believed it was "easy" or "very easy" to purchase cigarettes themselves. Reducing tobacco use by adolescents now is central to the future course of the current epidemic of tobacco-caused disease, since most current adult smokers began to smoke as adolescents--at a time when they were unable to purchase tobacco lawfully. The requirement for cigarette retailers to reconcile all stock purchased from wholesalers against a digital record of retail sales to licensed smokers would create a robust incentive for retailers to comply with laws that prohibit tobacco sales to children. Foreseeable objections to introducing a smokers licence need to be taken into account, but once we move beyond the "shock of the new", it is difficult to identify anything about a smokers licence that is particularly offensive or demeaning. A smoker licensing scheme deserves serious consideration for its potential to dramatically curtail retailers' violation of the law against selling tobacco to minors, to impose stricter accountability for sale of a uniquely harmful drug and to allow intelligent use of information about smokers' purchases to help smokers quit.

  4. Lack of evidence for protein AA reactivity in amyloid deposits of lattice corneal dystrophy and amyloid corneal degeneration.

    Science.gov (United States)

    Gorevic, P D; Rodrigues, M M; Krachmer, J H; Green, C; Fujihara, S; Glenner, G G

    1984-08-15

    Amyloid fibrils occurring in primary and myeloma-associated (AL), secondary (AA), and certain neuropathic hereditary forms of systemic amyloidosis can be distinguished biochemically or immunohistologically as being composed of immunoglobulin light chain, protein AA, or prealbumin respectively. All types of systemic and several localized forms of amyloidosis contain amyloid P component (protein AP). We studied formalin-fixed tissue from eight cases of lattice corneal dystrophy by the immunoperoxidase method using antisera to proteins AA and AP, to normal serum prealbumin and prealbumin isolated from a case of hereditary amyloidosis, and to light-chain determinants; additional cases were examined by indirect immunofluorescence of fresh-frozen material. We found weak (1:10 dilution) staining with anti-AP, but no reactivity with other antisera. Congo red staining was resistant to pretreatment of sections with potassium permanganate, a characteristic of non-AA amyloid. Two-dimensional gels of solubilized proteins from frozen tissue from two cases of lattice corneal dystrophy resembled those obtained from normal human cornea. Western blots of two cases of polymorphous amyloid degeneration and solubilized protein from normal cornea did not react with radioactive iodine-labeled anti-AA or anti-AP with purified protein AP and unfixed protein AA amyloid tissue as controls. We were unable to corroborate the presence of protein AA in the amyloid deposits of lattice corneal dystrophy. Although staining with antiserum to protein AP was demonstrable, the molecular configuration of this protein in stromal deposits remains to be defined.

  5. Tobacco radioactivity and cancer in smokers

    International Nuclear Information System (INIS)

    Martell, E.A.

    1975-01-01

    The recent finding that 210 Pb, which also is present in inhaled mainstream smoke, is highly concentrated in a small number of insoluble smoke particles changes the whole complexion of the problem of possible health effects of the inhaled radioactivity in cigarette smoke. Because 210 Pb has a radioactive half-life of 22 years, the body burden of the radioactive 210 Pb and its radioactive daughter products 210 Bi and 210 Po can continue to build up throughout the period of smoking. Alpha interactions with chromosomes of cells surrounding these insoluble radioactive smoke particles may cause cancer and contribute to early atherosclerosis development in cigarette smokers. (U.S.)

  6. Comparison of salivary calcium level in smokers and non-smokers with chronic periodontitis, aggressive periodontitis, and healthy controls.

    Science.gov (United States)

    Kambalyal, Preeti; Kambalyal, Prabhuraj; Hungund, Shital

    2015-12-01

    The purpose of this study was to compare salivary calcium (Ca) level in smokers and non-smokers with chronic periodontitis, aggressive periodontitis, and healthy controls. 56 subjects were included in the study and were grouped as follows: 12 subjects who were periodontally healthy (Group I), 12 subjects having chronic periodontitis who were non-smokers (Group II), 12 non-smokers having aggressive periodontitis (Group III), 12 smokers with chronic periodontitis (Group IV), and 8 smokers with aggressive periodontitis (Group V). Clinical measurements and non-stimulated whole saliva samples were obtained and analyzed for Ca levels by ion-selective electrolyte analyzer. When salivary Ca values were compared between the groups, they showed statistically significant values (P periodontitis and smokers with aggressive periodontitis, respectively, than in other groups. Between groups II and III also, the mean salivary Ca level was statistically significant (P periodontitis than in non-smokers having aggressive periodontitis. The present study showed that smokers having chronic periodontitis as well as smokers having aggressive periodontitis have higher salivary calcium levels. Also, patients with aggressive periodontitis were found to have lesser salivary calcium level than chronic periodontitis patients by ion-selective electrolyte analyzer.

  7. Fundamental frequency and voice perturbation measures in smokers and non-smokers: An acoustic and perceptual study

    Science.gov (United States)

    Freeman, Allison

    This research examined the fundamental frequency and perturbation (jitter % and shimmer %) measures in young adult (20-30 year-old) and middle-aged adult (40-55 year-old) smokers and non-smokers; there were 36 smokers and 36 non-smokers. Acoustic analysis was carried out utilizing one task: production of sustained /a/. These voice samples were analyzed utilizing Multi-Dimensional Voice Program (MDVP) software, which provided values for fundamental frequency, jitter %, and shimmer %.These values were analyzed for trends regarding smoking status, age, and gender. Statistical significance was found regarding the fundamental frequency, jitter %, and shimmer % for smokers as compared to non-smokers; smokers were found to have significantly lower fundamental frequency values, and significantly higher jitter % and shimmer % values. Statistical significance was not found regarding fundamental frequency, jitter %, and shimmer % for age group comparisons. With regard to gender, statistical significance was found regarding fundamental frequency; females were found to have statistically higher fundamental frequencies as compared to males. However, the relationships between gender and jitter % and shimmer % lacked statistical significance. These results indicate that smoking negatively affects voice quality. This study also examined the ability of untrained listeners to identify smokers and non-smokers based on their voices. Results of this voice perception task suggest that listeners are not accurately able to identify smokers and non-smokers, as statistical significance was not reached. However, despite a lack of significance, trends in data suggest that listeners are able to utilize voice quality to identify smokers and non-smokers.

  8. AAS 228: Day 1 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  9. Low virulent oral Candida albicans strains isolated from smokers.

    Science.gov (United States)

    de Azevedo Izidoro, Ana Claudia Santos; Semprebom, Andressa Marafon; Baboni, Fernanda Brasil; Rosa, Rosimeire Takaki; Machado, Maria Angela Naval; Samaranayake, Lakshman Perera; Rosa, Edvaldo Antonio Ribeiro

    2012-02-01

    It is widely accepted that tabagism is a predisposing factor to oral candidosis and cumulate data suggest that cigarette compounds may increase candidal virulence. To verify if enhanced virulence occurs in Candida albicans from chronic smokers, a cohort of 42 non-smokers and other of 58 smokers (all with excellent oral conditions and without signs of candidosis) were swabbed on tong dorsum and jugal mucosa. Results showed that oral candidal loads do not differ between smoker and non-smokers. Activities of secreted aspartyl-protease (Sap), phospholipase, chondroitinase, esterase-lipase, and haemolysin secretions were screened for thirty-two C. albicans isolates. There were detected significant increments in phospholipasic and chondroitinasic activities in isolates from non-smokers. For other virulence factors, no differences between both cohorts were achieved. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Magnetic horn of the Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  11. Increased long-term recreational physical activity is associated with older age at natural menopause among heavy smokers: the California Teachers Study.

    Science.gov (United States)

    Emaus, Aina; Dieli-Conwright, Christina; Xu, Xinxin; Lacey, James V; Ingles, Sue A; Reynolds, Peggy; Bernstein, Leslie; Henderson, Katherine D

    2013-03-01

    Although physical activity modulates the hypothalamic-pituitary-ovarian axis, the few studies that have investigated whether physical activity is associated with age at natural menopause have yielded mixed results. We set out to determine whether physical activity is associated with the timing of natural menopause in a large cohort of California women overall and by smoking history. We investigated the association between long-term physical activity (h/wk/y) and age at natural menopause among 97,945 women in the California Teachers Study. Multivariable Cox proportional hazards regression methods were used to calculate hazard ratios (HRs) and 95% confidence intervals (CIs). The impact of cigarette smoking (never smoker, former light smoker, former heavy smoker, current light smoker, and current heavy smoker) as an effect modifier was evaluated. In a multivariable model adjusted for body mass index at age 18 years, age at menarche, race/ethnicity, and age at first full-term pregnancy, increased physical activity was statistically significantly associated with older age at natural menopause (P(trend) = 0.005). Higher body mass index at age 18 years (P(trend) = 0.0003) and older age at menarche (P(trend) = 0.0003) were also associated with older age at natural menopause. Hispanic ethnicity (vs non-Hispanic whites; HR, 1.17; 95% CI, 1.09-1.26), current smokers (vs never smokers; HR, 1.68; 95% CI, 1.60-1.75 for current light smokers; HR, 1.38; 95% CI, 1.33-1.44 for current heavy smokers), and older age at first full-term pregnancy (HR(≥29, 2+ full-term pregnancies) vs HR(menopause. Upon stratification by smoking history, increased physical activity was statistically significantly associated with older age at natural menopause among heavy smokers only (HR(highest quartile) vs HR(lowest quartile), 0.88; 95% CI, 0.81-0.97; P(trend) = 0.02 for former heavy smokers; HR(highest quartile) vs HR(lowest quartile), 0.89; 95% CI, 0.80-0.99; P(trend) = 0.04 for current heavy

  12. Self-esteem, psychological distress, and coping styles in pregnant smokers and non-smokers.

    Science.gov (United States)

    Varescon, Isabelle; Leignel, Shirley; Gérard, Caroline; Aubourg, Frédérique; Detilleux, Michel

    2013-12-01

    The literature underscores that psychological factors could play an important role in smoking behavior, which is considered a coping mechanism. To study relations among measures of self-esteem, psychological distress, anxiety, depressive symptoms, and coping styles in pregnant smokers, a cross-sectional study was conducted. These factors were assessed in two groups of pregnant women (Smokers, n = 40; Non-smokers, n = 40) contacted at one University Hospital in Paris. All participants filled out the Fagerström Test for Nicotine Dependence, the Rosenberg Self-esteem Scale, the General Health Questionnaire, the Hospital Anxiety Depression Scale, and the Brief Cope Scale. Comparisons, correlations, and regression models were used to analyze the data. The results showed that the group of pregnant women who smoked had significantly lower mean self-esteem, elevated psychological distress and anxiety scores, and reported using more emotion-focused coping than the group of pregnant non-smokers. Self-esteem significantly predicted problem-focused coping. This study confirms the importance of assessing these psychological variables to offer women more specific support to quit smoking.

  13. Quantitative assessment of elemental carbon in the lungs of never smokers, cigarette smokers and coal miners

    Science.gov (United States)

    Inhalation exposure to particulates such as cigarette smoke and coal dust is known to contribute to the development of chronic lung disease. The purpose of this study was to estimate the amount of elemental carbon (EC) deposits from autopsied lung samples from cigarette smokers, ...

  14. Monoamine Oxidase and Sensory Gating: Psychophysiological Vulnerabilities among Teenage Smokers

    OpenAIRE

    Wan, Li

    2006-01-01

    Smoking is one of the leading causes of death in the world. About 80% of smokers start smoking before the age of 18. In the Appalachian area and the South in the United States, smoking percentages among adults and adolescents are higher than in other regions. Female smoking shows a variety of different trends from male smoking, and smoking brings particular health problems related to production to female smokers. These findings highlighted the importance of studying female teenage smokers in ...

  15. Young adult smokers' neural response to graphic cigarette warning labels

    Directory of Open Access Journals (Sweden)

    Adam E. Green

    2016-06-01

    Conclusions: In this sample of young adult smokers, GWLs promoted neural activation in brain regions involved in cognitive and affective decision-making and memory formation and the effects of GWLs did not differ on branded or plain cigarette packaging. These findings complement other recent neuroimaging GWL studies conducted with older adult smokers and with adolescents by demonstrating similar patterns of neural activation in response to GWLs among young adult smokers.

  16. Prevalence of chronic obstructive pulmonary disease in asymptomatic smokers.

    Science.gov (United States)

    Sansores, Raúl H; Velázquez-Uncal, Mónica; Pérez-Bautista, Oliver; Villalba-Caloca, Jaime; Falfán-Valencia, Ramcés; Ramírez-Venegas, Alejandra

    2015-01-01

    Physicians do not routinely recommend smokers to undergo spirometry unless they are symptomatic. To test the hypothesis that there are a significant number of asymptomatic smokers with chronic obstructive pulmonary disease (COPD), we estimated the prevalence of COPD in a group of asymptomatic smokers. Two thousand nine hundred and sixty-one smokers with a cumulative consumption history of at least 10 pack-years, either smokers with symptoms or smokers without symptoms (WOS) were invited to perform a spirometry and complete a symptom questionnaire. Six hundred and thirty-seven (21.5%) smokers had no symptoms, whereas 2,324 (78.5%) had at least one symptom. The prevalence of COPD in subjects WOS was 1.5% when considering the whole group of smokers (45/2,961) and 7% when considering only the group WOS (45/637). From 329 smokers with COPD, 13.7% were WOS. Subjects WOS were younger, had better lung function and lower cumulative consumption of cigarettes, estimated as both cigarettes per day and pack-years. According to severity of airflow limitation, 69% vs 87% of subjects were classified as Global Initiative for Chronic Obstructive Lung Disease stages I-II in the WOS and smokers with symptoms groups, respectively (Psmokers. Prevalence of COPD in asymptomatic smokers is 1.5%. This number of asymptomatic smokers may be excluded from the benefit of an "early" intervention, not just pharmacological but also from smoking cessation counseling. The higher forced expiratory volume in 1 second may contribute to prevent early diagnosis.

  17. Impact of smoking on aerobic capacity in young adult smokers

    Directory of Open Access Journals (Sweden)

    Ahmed Abdelmoniem Ibrahim

    2016-12-01

    Full Text Available Cigarette smoking is a worldwide public health challenge, ,Cigarette smoking is also a strong risk factor for musculoskeletal and cardiovascular disease, It is also well known that low and declining muscle strength is linked to increased smoking .[23]Aims of this study was to examine the chronic effects of smoking on cardiovascular fitness in young and healthy male smokers[13]. This study was carried out in university of hail ,physiotherapy lab, ,30male participant was recruited from university students of hail divided into two group 15 smoker (A ,15 nonsmoker (B .All subjects underwent a sub maximal Bruce treadmill test and their HR was recorded during, at peak, and after termination of exercise. Our study revealed that the resting HR was 5.3 bpm higher in smoker than in non smoker (P:0.0001., data indicated that there was a significant difference found between young smokers and non-smokers regarding their sub-maximal HR values (P:0.0063., where smokers had significantly higher HR values. also there was no difference between both groups regarding to recovery heart rate (P:0.56. Smoking was found to affect young smokers’ increasing HR at rest, slowing of HR increase during exercise, and impairing their ability to reach the age predicted HRmax., Also smoking was associated with an attenuated HR. . also Smokers had a higher resting HR and showed a higher HR response during sub-maximal exercise compared to Non smokers .

  18. The acute tobacco withdrawal syndrome among black smokers.

    Science.gov (United States)

    Robinson, Cendrine D; Pickworth, Wallace B; Heishman, Stephen J; Waters, Andrew J

    2014-03-01

    Black smokers have greater difficulty quitting tobacco than White smokers, but the mechanisms underlying between-race differences in smoking cessation are not clear. One possibility is that Black smokers experience greater acute withdrawal than Whites. We investigated whether Black (n = 104) and White smokers (n = 99) differed in abstinence-induced changes in self-report, physiological, and cognitive performance measures. Smokers not wishing to quit completed two counterbalanced experimental sessions. Before one session, they abstained from smoking for at least 12 hr. They smoked normally before the other session. Black smokers reported smaller abstinence-induced changes on a number of subjective measures including the total score of the 10-item Questionnaire for Smoking Urges (QSU) and the total score of the Wisconsin Smoking Withdrawal Scale (WSWS). However, on most subjective measures, and on all objective measures, there were no between-race differences in abstinence-induced change scores. Moreover, Black participants did not report lower QSU and WSWS ratings at the abstinent session, but they did experience significantly higher QSU and WSWS ratings at the nonabstinent session. Abstinence-induced changes in subjective, physiological, and cognitive measures in White smokers were similar for smokers of nonflavored and menthol-flavored cigarettes. There was no evidence that Black smokers experienced greater acute tobacco withdrawal than Whites. To the contrary, Black participants experienced smaller abstinence-induced changes in self-reported craving and withdrawal on some measures. Racial differences in smoking cessation are unlikely to be explained by acute withdrawal.

  19. Community-acquired pneumonia among smokers.

    Science.gov (United States)

    Almirall, Jordi; Blanquer, José; Bello, Salvador

    2014-06-01

    Recent studies have left absolutely no doubt that tobacco increases susceptibility to bacterial lung infection, even in passive smokers. This relationship also shows a dose-response effect, since the risk reduces spectacularly 10 years after giving up smoking, returning to the level of non-smokers. Streptococcus pneumoniae is the causative microorganism responsible for community-acquired pneumonia (CAP) most frequently associated with smoking, particularly in invasive pneumococcal disease and septic shock. It is not clear how it acts on the progress of pneumonia, but there is evidence to suggest that the prognosis for pneumococcal pneumonia is worse. In CAP caused by Legionella pneumophila, it has also been observed that smoking is the most important risk factor, with the risk rising 121% for each pack of cigarettes smoked a day. Tobacco use may also favor diseases that are also known risk factors for CAP, such as periodontal disease and upper respiratory viral infections. By way of prevention, while giving up smoking should always be proposed, the use of the pneumococcal vaccine is also recommended, regardless of the presence of other comorbidities. Copyright © 2013 SEPAR. Published by Elsevier Espana. All rights reserved.

  20. COMPARISON OF MICRONUCLEATED CELL IN BUCCAL SMEARS AMONG SMOKERS AND NON-SMOKERS

    Directory of Open Access Journals (Sweden)

    Vani Dayanand

    2017-01-01

    Full Text Available BACKGROUND The health complexities caused due to tobacco smoking has not been restricted to any geographic region and has spread worldwide. As the oral mucosal cells, which line the oral cavity are the first barrier, they represent the preferred target site for the early genotoxic events. Tobacco use is one of the most important aetiological factors in initiation of oral cancer as it increases the risk of cancer by exposing the buccal mucosal to the carcinogenic chemicals either through inhalation or by ingestion. Micronuclei are round to oval cytoplasmic chromatin mass, which occurs as a result of segregation defects due to chromosomal instability causing chromatin to be excluded from the reformed nucleus. Micronuclei assay in exfoliated buccal cells is a useful and less invasive method for monitoring genetic damage. MATERIALS AND METHODS A total of 100 male subjects (50 smokers, 50 non-smokers were examined. Buccal smears were wet fixed and stained with pap stain. 100 cells per slide were counted and assessed for micronuclei count. T-test and Pearson correlation was used as a statistical tool for analysis. RESULTS Significantly, smokers had higher percentage of micronucleated cells (T-5.865; P (0.000, total number of micronuclei (T- 6.713; P (0.000 and mean micronuclei count (T-5.865; P (0.000 than non-smokers. Pack years correlated significantly and positively with mean micronuclei count. However, pack year did not have significant relation with percentage of micronucleated cells and total number of micronuclei. CONCLUSION The genotoxic effects of tobacco smoke cause chromosomal damage in the epithelial cells of buccal mucosa and are reflected in the increased micronuclei in smokers. Micronuclei assay can be used as a simple and reliable marker for genotoxic evaluation.

  1. Acute effects of Advance: a potential reduced exposure product for smokers.

    Science.gov (United States)

    Breland, A B; Evans, S E; Buchhalter, A R; Eissenberg, T

    2002-12-01

    To examine the acute effects of Advance, a potential reduced exposure product (PREP) for smokers marketed as a means to reduce exposure to toxic gases and tobacco specific nitrosamines. Latin square ordered, three condition, laboratory based, crossover design with 20 smokers of light or ultra-light cigarettes (15 or more cigarettes/day). In each 2.5 hour condition, participants completed an 8-puff smoking bout from their own brand, Advance, or an unlit cigarette (that is, sham smoking) every 30 minutes for a total of four bouts. Subject rated measures of tobacco/nicotine withdrawal; carbon monoxide (CO), and heart rate; plasma nicotine concentrations. Relative to own brand, Advance produced similar withdrawal suppression and heart rate increase, lower CO boost, and higher plasma nicotine concentrations. PREPs for smokers need to be evaluated using a comprehensive strategy that includes empirical examination of acute and long term effects. Adequate withdrawal suppression and potentially lower concentrations of CO associated with Advance use are positive factors, although higher nicotine concentrations do not constitute "reduced exposure". Overall, longer exposure periods are necessary to determine carcinogen delivery. PREP evaluation is complex and should be completed objectively.

  2. Long-term smoking causes more advanced coronary endothelial dysfunction in middle-aged smokers compared to young smokers

    International Nuclear Information System (INIS)

    Naya, Masanao; Goto, Daisuke; Tsutsui, Hiroyuki; Morita, Koichi; Manabe, Osamu; Hirata, Kenji; Tamaki, Nagara; Yoshinaga, Keiichiro; Katoh, Chietsugu

    2011-01-01

    Smoking cessation has been shown to normalize the coronary endothelial dysfunction in healthy young smokers. However, its effect has not been explored in middle-aged smokers with a longer history of smoking. Therefore, we compared the effects of smoking cessation on coronary vasomotor response between both young and middle-aged smokers and identified the predictor for its improvement. This study investigated 14 young healthy smokers (age 25.2 ± 2.3 years), 13 middle-aged smokers (age 42.0 ± 6.5 years) and 10 non-smokers. Myocardial blood flow (MBF) was measured by using 15 O-water positron emission tomography (PET). At baseline, the ratio of MBF during the cold pressor test (CPT) to that at rest (MBF CPT/rest ), the index of coronary endothelial function, was significantly decreased in both young and middle-aged smokers compared to non-smokers (1.24 ± 0.20 and 1.10 ± 0.39 vs 1.53 ± 0.18, p CPT/rest at 1 month after smoking cessation significantly increased in young smokers, but not in middle-aged smokers. By multivariate analysis, baseline serum malondialdehyde-modified low-density lipoprotein (MDA-LDL) was an independent predictor for the changes in MBF CPT/rest after smoking cessation (β = -0.45, p < 0.05). Coronary endothelial dysfunction was reversible by short-term smoking cessation in young smokers, but not in middle-aged smokers, which was associated with serum MDA-LDL levels. Long-term smoking exposure could lead to more advanced coronary endothelial dysfunction and atherosclerosis possibly via oxidative stress. (orig.)

  3. Association between anxiety, obesity and periodontal disease in smokers and non-smokers: A cross-sectional study

    Directory of Open Access Journals (Sweden)

    Abhay P. Kolte

    2016-12-01

    Full Text Available Background. Psychological stress is known to be a relevant risk factor for many inflammatory conditions, including periodontal disease. A few studies have probed the relationship between obesity and periodontal disease. Therefore this cross-sectional study was aimed to examine the relationship between psychological stress and obesity and periodontal disease in smokers and non-smokers. Methods. The participants included 90 patients, equally divided into three groups of non-smokers and periodontally healthy, non-smokers and smokers with untreated moderate-to-severe chronic periodontitis. Socioeconomic data, psychosocial measurements, physical parameters and clinical findings of PPD, CAL, PI and GI were recorded. Results. The clinical parameters were assessed for three groups in three different anxiety levels of mild, moderate and se-vere. Intra-group comparison of PPD and CAL in the three anxiety levels showed increased periodontal destruction with an increase in anxiety levels, the results being statistically highly significant for PPD differences in smokers (P < 0.0001. The mean differences in PPD and CAL in severe anxiety levels between smokers and non-smokers were 0.68 mm and 0.70 mm and both the findings were statistically significant. The mean PPD and CAL in smoker and non-smoker groups in obese patients was higher as compared to non-obese patients and the differences were highly significant (P < 0.001. Conclusion. The results of our study indicated a positive and strong correlation between anxiety, obesity and periodontal disease in smokers and non-smokers. Smoking appears to further attenuate this association.

  4. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    NARCIS (Netherlands)

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg

  5. Obesity is a significant susceptibility factor for idiopathic AA amyloidosis.

    Science.gov (United States)

    Blank, Norbert; Hegenbart, Ute; Dietrich, Sascha; Brune, Maik; Beimler, Jörg; Röcken, Christoph; Müller-Tidow, Carsten; Lorenz, Hanns-Martin; Schönland, Stefan O

    2018-01-24

    To investigate obesity as susceptibility factor in patients with idiopathic AA amyloidosis. Clinical, biochemical and genetic data were obtained from 146 patients with AA amyloidosis. Control groups comprised 40 patients with long-standing inflammatory diseases without AA amyloidosis and 56 controls without any inflammatory disease. Patients with AA amyloidosis had either familial Mediterranean fever (FMF) or long-standing rheumatic diseases as underlying inflammatory disease (n = 111, median age 46 years). However, in a significant proportion of patients with AA amyloidosis no primary disease was identified (idiopathic AA; n = 37, median age 60 years). Patients with idiopathic AA amyloidosis were more obese and older than patients with AA amyloidosis secondary to FMF or rheumatic diseases. Serum leptin levels correlated with the body mass index (BMI) in all types of AA amyloidosis. Elevated leptin levels of more than 30 µg/l were detected in 18% of FMF/rheumatic + AA amyloidosis and in 40% of patients with idiopathic AA amyloidosis (p = .018). Finally, the SAA1 polymorphism was confirmed as a susceptibility factor for AA amyloidosis irrespective of the type of the disease. Obesity, age and the SAA1 polymorphism are susceptibility factors for idiopathic AA amyloidosis. Recent advances in treatment of FMF and rheumatic disorders will decrease the incidence of AA amyloidosis due to these diseases. Idiopathic AA, however, might be an emerging problem in the ageing and increasingly obese population.

  6. Evaluating acute effects of potential reduced-exposure products for smokers: clinical laboratory methodology.

    Science.gov (United States)

    Breland, Alison B; Buchhalter, August R; Evans, Sarah E; Eissenberg, Thomas

    2002-01-01

    Harm reduction for tobacco smokers may involve reducing their exposure to lethal smoke constituents. Assessing smoke constituent exposure and any resulting harm reduction from a potential reduced-exposure product (PREP) will involve preclinical, clinical, and epidemiological research. The purpose of this study was to evaluate a clinical laboratory model for assessing the acute effects of PREPs for smokers. Philip Morris' Accord and R.J. Reynolds' Eclipse were used as examples. Twenty overnight-abstinent smokers (> 15 'light' or 'ultra-light' cigarettes/day) participated in 4 Latin-square ordered, 2.5-hr sessions in which they completed an 8-puff smoking bout every 30 minutes. Sessions were separated by at least 24 hours and differed by product used: own brand, denicotinized tobacco cigarettes, Accord, or Eclipse. Tobacco withdrawal and carbon monoxide (CO) were assessed before and after smoking, heart rate was assessed before and during smoking, and puff volume, duration, and interpuff interval were assessed while subjects smoked. Blood was sampled at the beginning and end of each session. Relative to normal cigarettes, Accord was less effective at suppressing withdrawal and produced minimal CO boost despite the fact that, when using Accord, subjects took bigger and longer puffs. Eclipse suppressed withdrawal fully and increased CO boost by approximately 30%. Own brand, Accord, and Eclipse, but not denicotinized cigarettes, increased plasma nicotine concentration. Taken together, these results suggest that neither Accord nor Eclipse is likely to be an effective reduced-exposure product for smokers and that this clinical laboratory model is valuable.

  7. Cigarette litter: smokers' attitudes and behaviors.

    Science.gov (United States)

    Rath, Jessica M; Rubenstein, Rebecca A; Curry, Laurel E; Shank, Sarah E; Cartwright, Julia C

    2012-06-01

    Cigarette butts are consistently the most collected items in litter clean-up efforts, which are a costly burden to local economies. In addition, tobacco waste may be detrimental to our natural environment. The tobacco industry has conducted or funded numerous studies on smokers' littering knowledge and behavior, however, non-industry sponsored research is rare. We sought to examine whether demographics and smokers' knowledge and beliefs toward cigarette waste as litter predicts littering behavior. Smokers aged 18 and older (n = 1,000) were interviewed about their knowledge and beliefs towards cigarette waste as litter. Respondents were members of the Research Now panel, an online panel of over three million respondents in the United States. Multivariate logistic regressions were conducted to determine factors significantly predictive of ever having littered cigarette butts or having littered cigarette butts within the past month (p-value littered cigarette butts at least once in their life, by disposing of them on the ground or throwing them out of a car window. Over half (55.7%) reported disposing of cigarette butts on the ground, in a sewer/gutter, or down a drain in the past month. Those who did not consider cigarette butts to be litter were over three and half times as likely to report having ever littered cigarette butts (OR = 3.68, 95%CI = 2.04, 6.66) and four times as likely to have littered cigarette butts in the past month (OR = 4.00, 95%CI = 2.53, 6.32). Males were significantly more likely to have littered cigarette butts in the past month compared to females (OR = 1.49, 95%CI = 1.14, 1.94). Holding the belief that cigarette butts are not litter was the only belief in this study that predicted ever or past-month littering of cigarette waste. Messages in anti-cigarette-litter campaigns should emphasize that cigarette butts are not just litter but are toxic waste and are harmful when disposed of improperly.

  8. Automatic Smoker Detection from Telephone Speech Signals

    DEFF Research Database (Denmark)

    Alavijeh, Amir Hossein Poorjam; Hesaraki, Soheila; Safavi, Saeid

    2017-01-01

    This paper proposes an automatic smoking habit detection from spontaneous telephone speech signals. In this method, each utterance is modeled using i-vector and non-negative factor analysis (NFA) frameworks, which yield low-dimensional representation of utterances by applying factor analysis...... on Gaussian mixture model means and weights respectively. Each framework is evaluated using different classification algorithms to detect the smoker speakers. Finally, score-level fusion of the i-vector-based and the NFA-based recognizers is considered to improve the classification accuracy. The proposed...... method is evaluated on telephone speech signals of speakers whose smoking habits are known drawn from the National Institute of Standards and Technology (NIST) 2008 and 2010 Speaker Recognition Evaluation databases. Experimental results over 1194 utterances show the effectiveness of the proposed approach...

  9. Recruiting women smokers: the engineering of consent.

    Science.gov (United States)

    Brandt, A M

    1996-01-01

    A range of social forces contributed to the effective recruitment of women to cigarette smoking in the crucial period between 1900 and 1940. Cigarette advertisers and public relations experts recognized the significance of women's changing roles and the rising culture of consumption, and worked to create specific meanings for the cigarette to make it appeal to women. The cigarette was a flexible symbol, with a remarkably elastic set of meanings; for women, it represented rebellious independence, glamour, seduction, and sexual allure, and served as a symbol for both feminists and flappers. The industry, with the help of advertisers and public relations experts, effectively engineered consent for women as smokers. The "engineering of consent" has a role to play in smoking cessation, since negative meanings for the cigarette can be engineered as well.

  10. A motivational intervention for adolescent smokers.

    Science.gov (United States)

    Lawendowski, L A

    1998-01-01

    Motivational interviewing (MI) is a brief psychotherapeutic intervention to increase the likelihood of a client's considering, initiating, and maintaining specific change strategies to reduce harmful behavior. MI is founded on principles of motivational psychology, client-centered therapy, and stages of change in natural recovery from addiction. Motivational Enhancement Therapy (MET) embeds MI within a structured format of standardized intake assessment, personalized feedback of testing results, and follow-up interview to facilitate treatment outcome evaluation. This paper presents research evidence for the efficacy of MET, a description of the methods and goals of MI counseling approach, and the rationale for MET as an appropriate brief intervention for adolescents. Specific recommendations for application of MI to adolescent smokers are offered. Copyright 1998 American Health Foundation and Academic Press.

  11. The AA disappearing under concrete shielding

    CERN Multimedia

    CERN PhotoLab

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  12. Smokers' Willingness to Protect Children from Secondhand Smoke

    Science.gov (United States)

    King, Keith A.; Vidourek, Rebecca A.; Creighton, Stephanie; Vogel, Stephanie

    2003-01-01

    Objectives: To examine the effectiveness of a secondhand smoke media campaign on adult smokers' willingness to protect children from secondhand smoke. Methods: Following a series of community awareness ads, a random sample of 390 adult smokers was surveyed via telephone regarding their perceptions of secondhand smoke. Results: Seeing or hearing…

  13. Treating Depressed and Anxious Smokers in Smoking Cessation Programs

    Science.gov (United States)

    Richards, C. Steven; Cohen, Lee M.; Morrell, Holly E. R.; Watson, Noreen L.; Low, Blakely E.

    2013-01-01

    Objective: Cigarette smoking is the leading cause of preventable death in the United States. In addition, smoking rates among depressed and anxious smokers are higher than in the population at large. Furthermore, treating depressed and anxious smokers effectively is particularly challenging because of their significant negative affect,…

  14. Distribution of emphysema in heavy smokers: impact on pulmonary function.

    NARCIS (Netherlands)

    Gietema, H.A.; Zanen, P.; Schilham, A.; Ginneken, B. van; Klaveren, R.J.J. van; Prokop, M.; Lammers, J.W.

    2010-01-01

    PURPOSE: To investigate impact of distribution of computed tomography (CT) emphysema on severity of airflow limitation and gas exchange impairment in current and former heavy smokers participating in a lung cancer screening trial. MATERIALS AND METHODS: In total 875 current and former heavy smokers

  15. Spontaneous Action Representation in Smokers when Watching Movie Characters Smoke

    Science.gov (United States)

    Wagner, Dylan D.; Cin, Sonya Dal; Sargent, James D.; Kelley, William M.; Heatherton, Todd F.

    2013-01-01

    Do smokers simulate smoking when they see someone else smoke? For regular smokers, smoking is such a highly practiced motor skill that it often occurs automatically, without conscious awareness. Research on the brain basis of action observation has delineated a frontopareital network that is commonly recruited when people observe, plan or imitate actions. Here, we investigated whether this action observation network would be preferentially recruited in smokers when viewing complex smoking cues, such as those occurring in motion pictures. Seventeen right-handed smokers and seventeen non-smokers watched a popular movie while undergoing functional magnetic resonance imaging. Using a natural stimulus, such as a movie, allowd us to keep both smoking and non-smoking participants naïve to the goals of the experiment. Brain activity evoked by scenes of movie smoking was contrasted with non-smoking control scenes which were matched for frequency and duration. Compared to non-smokers, smokers showed greater activity in left anterior intraparietal sulcus and inferior frontal gyrus, both regions involved in the simulation of contralateral hand-based gestures, when viewing smoking vs. control scenes. These results demonstrate that smokers spontaneously represent the action of smoking when viewing others smoke, the consequence of which may make it more difficult to abstain from smoking. PMID:21248113

  16. Respiratory effects of biomass fuel combustion on rural fish smokers ...

    African Journals Online (AJOL)

    Respiratory effects of biomass fuel combustion on rural fish smokers in a Nigerian fishing settlement: a case control study. Paul Dienye, Alex Akani, Ita Okokon. Abstract. Backgroud: The aim was to study the prevalence of respiratory symptoms and assess the lung function of fish smokers in Nigeria. Methods: A case control ...

  17. Internet and Mobile Phone Text Messaging Intervention for College Smokers

    Science.gov (United States)

    Riley, William; Obermayer, Jami; Jean-Mary, Jersino

    2008-01-01

    Objective: The authors developed a smoking cessation program using mobile phone text messaging to provide tailored and stage-specific messages to college smokers. Participants and Methods: The authors recruited 31 daily smokers who desired to quit from a college campus and asked them to use an Internet and mobile phone text messaging program to…

  18. Outcomes From AAS Hack Day at the 227th AAS Meeting

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    (STScI), and Jana Grcevich (AMNH) developed a filter for digital photos to make them look like they were taken on Mars by Curiosity.Coming soon from @becky1505 co: #marsfilter, for making your images look like they were taken on #Mars! #hackaas pic.twitter.com/2LVA1DRmwh Lucianne Walkowicz (@shaka_lulu) January 8, 2016Different Kind of Kepler Light Curve: Every so often, the Kepler spacecraft sends us an image of its entire field of view rather than just small regions of pixels near specific stars. Jennifer Cash (South Carolina U), Lucianne Walkowicz (Adler), and Joe Filipazzo (CUNY) worked with these Full-Frame Images to identify all the sources. The next step is to identify all the stars in the image and perform aperture photometry.There are likely new exoplanets, binary stars, and other interesting variable sources hidden in this dataset.Exoplanets in the WorldWide Telescope (WWT): Did someone say exoplanets?WWT, now run by the AAS, is an open source data visualization tool often used by planetariums to virtually fly around the Universe.David Weigal (Samford U) worked to improve WWT by adding exoplanetary systems. This was tricky, but he was able to demo one example of a planet orbiting a Sirius-like star.Career Paths: Peter Yoachim (UW) and Eric Bellm (Caltech) took different approaches to study career paths in astronomy. Peter tracked how publishing records affect hiring outcomes, while Eric mapped the careers of astronomers with prize fellowships. Explore their findingshere and here.Preliminary results from Peter Yoachims project show a significantly lower fraction of recent astronomy PhD recipients continue to publish regularly. Figure courtesy of Peter.Testing Stationarity of Time Series Data: Matthew Graham (Caltech) and Phil Marshall (Slac) wrote some codeto determine whether a set of observations taken over a period of time is stationary. This will be useful for surveys like LSST which observe the same source multiple times over many visits. It is important

  19. Long-term smoking causes more advanced coronary endothelial dysfunction in middle-aged smokers compared to young smokers

    Energy Technology Data Exchange (ETDEWEB)

    Naya, Masanao; Goto, Daisuke; Tsutsui, Hiroyuki [Hokkaido University Graduate School of Medicine, Department of Cardiovascular Medicine, Sapporo (Japan); Morita, Koichi; Manabe, Osamu; Hirata, Kenji; Tamaki, Nagara [Hokkaido University Graduate School of Medicine, Department of Nuclear Medicine, Sapporo (Japan); Yoshinaga, Keiichiro [Hokkaido University Graduate School of Medicine, Department of Molecular Imaging, Sapporo (Japan); Katoh, Chietsugu [Hokkaido University Graduate School of Medicine, Department of Health Science, Sapporo (Japan)

    2011-03-15

    Smoking cessation has been shown to normalize the coronary endothelial dysfunction in healthy young smokers. However, its effect has not been explored in middle-aged smokers with a longer history of smoking. Therefore, we compared the effects of smoking cessation on coronary vasomotor response between both young and middle-aged smokers and identified the predictor for its improvement. This study investigated 14 young healthy smokers (age 25.2 {+-} 2.3 years), 13 middle-aged smokers (age 42.0 {+-} 6.5 years) and 10 non-smokers. Myocardial blood flow (MBF) was measured by using {sup 15}O-water positron emission tomography (PET). At baseline, the ratio of MBF during the cold pressor test (CPT) to that at rest (MBF{sub CPT/rest}), the index of coronary endothelial function, was significantly decreased in both young and middle-aged smokers compared to non-smokers (1.24 {+-} 0.20 and 1.10 {+-} 0.39 vs 1.53 {+-} 0.18, p < 0.05 and p < 0.001, respectively). The ratio of MBF during adenosine triphosphate infusion to that at rest was significantly decreased in middle-aged smokers compared to young smokers and non-smokers (3.34 {+-} 1.52 vs 4.43 {+-} 0.92 and 4.69 {+-} 1.25, p < 0.05, respectively). MBF{sub CPT/rest} at 1 month after smoking cessation significantly increased in young smokers, but not in middle-aged smokers. By multivariate analysis, baseline serum malondialdehyde-modified low-density lipoprotein (MDA-LDL) was an independent predictor for the changes in MBF{sub CPT/rest} after smoking cessation ({beta} = -0.45, p < 0.05). Coronary endothelial dysfunction was reversible by short-term smoking cessation in young smokers, but not in middle-aged smokers, which was associated with serum MDA-LDL levels. Long-term smoking exposure could lead to more advanced coronary endothelial dysfunction and atherosclerosis possibly via oxidative stress. (orig.)

  20. Impact of supragingival therapy on subgingival microbial profile in smokers versus non-smokers with severe chronic periodontitis

    Directory of Open Access Journals (Sweden)

    Tatiana Meulman

    2012-01-01

    Full Text Available The aim of this study was to assess subgingival microbiological changes in smokers versus non-smokers presenting severe chronic periodontitis after supragingival periodontal therapy (ST.Non-smokers (n=10 and smokers (n=10 presenting at least nine teeth with probing pocket depth (PPD (≥5 mm, bleeding on probing (BoP, and no history of periodontal treatment in the last 6 months were selected. Clinical parameters assessed were plaque index (PI, BoP, PPD, relative gingival margin position (rGMP and relative clinical attachment level (rCAL. Subgingival biofilm was collected before and 21 days after ST. DNA was extracted and the 16S rRNA gene was amplified with the universal primer pair, 27F and 1492R. Amplified genes were cloned, sequenced, and identified by comparison with known 16S rRNA sequences. Statistical analysis was performed by Student's t and Chi-Square tests (α=5%.Clinically, ST promoted a significant reduction in PI and PPD, and gain of rCAL for both groups, with no significant intergroup difference. Microbiologically, at baseline, data analysis demonstrated that smokers harbored a higher proportion of Porphyromonas endodontalis, Bacteroidetes sp., Fusobacterium sp. and Tannerella forsythia and a lower number of cultivated phylotypes (p<0.05. Furthermore, non-smokers featured significant reductions in key phylotypes associated with periodontitis, whereas smokers presented more modest changes.Within the limits of the present study, ST promoted comparable clinical improvements in smokers and non-smokers with severe chronic periodontitis. However, in smokers, ST only slightly affected the subgingival biofilm biodiversity, as compared with non-smokers.

  1. Nicotine metabolism and addiction among adolescent smokers.

    Science.gov (United States)

    Rubinstein, Mark L; Shiffman, Saul; Moscicki, Anna-Barbara; Rait, Michelle A; Sen, Saunak; Benowitz, Neal L

    2013-02-01

    The purpose of this study was to determine the association between the nicotine metabolic rate and smoking behavior, including addiction, in adolescent smokers. Baseline data from a prospective study of adolescent smoking behaviors and nicotine metabolism. The setting was an out-patient university hospital in San Francisco. Adolescent smokers (n = 164) aged 13-17 years old. Participants completed self-report measures of smoking behavior and nicotine dependence (modified Fagerström Tolerance Questionnaire: mFTQ). The nicotine metabolite ratio (NMR), a phenotypic marker of the rate of nicotine metabolism, was calculated using the ratio of concentrations of deuterium-labeled 3'-hydroxycotinine to cotinine-d(4) . Participants reported smoking a mean of 2.86 cigarettes per day (CPD) [median = 1.78, standard deviation (SD) = 3.35] for 1.37 years (median = 1.0, SD = 1.36). Results from multivariate analyses accounting for age, race/ethnicity, gender and duration of smoking indicated that slower metabolizers smoked more CPD than faster metabolizers (the NMR was inversely related to CPD; P = 0.02). Slower metabolizers also showed greater dependence on the mFTQ (NMR was negatively associated with the mFTQ; P = 0.02). In adolescence, slower clearance of nicotine may be associated with greater levels of addiction, perhaps mediated by a greater number of cigarettes smoked. © 2012 The Authors, Addiction © 2012 Society for the Study of Addiction.

  2. Prevalence of chronic obstructive pulmonary disease in asymptomatic smokers

    Directory of Open Access Journals (Sweden)

    Sansores RH

    2015-11-01

    Full Text Available Raúl H Sansores, Mónica Velázquez-Uncal, Oliver Pérez-Bautista, Jaime Villalba-Caloca, Ramcés Falfán-Valencia, Alejandra Ramírez-VenegasTobacco Smoking and COPD Research Department, National Institute of Respiratory Diseases, Ismael Cosio Villegas, Mexico City, MexicoBackground: Physicians do not routinely recommend smokers to undergo spirometry unless they are symptomatic.Objective: To test the hypothesis that there are a significant number of asymptomatic smokers with chronic obstructive pulmonary disease (COPD, we estimated the prevalence of COPD in a group of asymptomatic smokers.Methods: Two thousand nine hundred and sixty-one smokers with a cumulative consumption history of at least 10 pack-years, either smokers with symptoms or smokers without symptoms (WOS were invited to perform a spirometry and complete a symptom questionnaire.Results: Six hundred and thirty-seven (21.5% smokers had no symptoms, whereas 2,324 (78.5% had at least one symptom. The prevalence of COPD in subjects WOS was 1.5% when considering the whole group of smokers (45/2,961 and 7% when considering only the group WOS (45/637. From 329 smokers with COPD, 13.7% were WOS. Subjects WOS were younger, had better lung function and lower cumulative consumption of cigarettes, estimated as both cigarettes per day and pack-years. According to severity of airflow limitation, 69% vs 87% of subjects were classified as Global Initiative for Chronic Obstructive Lung Disease stages I–II in the WOS and smokers with symptoms groups, respectively (P<0.001. A multivariate analysis showed that forced expiratory volume in 1 second (mL was the only predictive factor for COPD in asymptomatic smokers.Conclusion: Prevalence of COPD in asymptomatic smokers is 1.5%. This number of asymptomatic smokers may be excluded from the benefit of an “early” intervention, not just pharmacological but also from smoking cessation counseling. The higher forced expiratory volume in 1 second may

  3. Similar Squamous Cell Carcinoma Epithelium microRNA Expression in Never Smokers and Ever Smokers.

    Directory of Open Access Journals (Sweden)

    Antonia Kolokythas

    Full Text Available The incidence of oral tumors in patients who never used mutagenic agents such as tobacco is increasing. In an effort to better understand these tumors we studied microRNA (miRNA expression in tumor epithelium of never tobacco users, tumor epithelium of ever tobacco users, and nonpathological control oral epithelium. A comparison of levels among 372 miRNAs in 12 never tobacco users with oral squamous cell carcinoma (OSCC versus 10 healthy controls was made using the reverse transcription quantitative polymerase chain reaction. A similar analysis was done with 8 ever tobacco users with OSCC. These comparisons revealed miR-10b-5p, miR-196a-5p, and miR-31-5p as enriched in the tumor epithelium in OSCC of both never and ever tobacco users. Examination of The Cancer Genome Atlas (TCGA project miRNA data on 305 OSCCs and 30 controls revealed 100% of those miRNAs enriched in never smoker OSCCs in this patient group were also enriched in ever smoker OSCCs. Nonsupervised clustering of TCGA OSCCs was suggestive of two or four subgroups of tumors based on miRNA levels with limited evidence for differences in tobacco exposure among the groups. Results from both patient groups together stress the importance of miR196a-5p in OSCC malignancy in both never and ever smokers, and emphasize the overall similarity of miRNA expression in OSCCs in these two risk groups. It implies that there may be great similarity in etiology of OSCC in never and ever smokers and that classifying OSCC based on tobacco exposure may not be helpful in the clinic.

  4. Black Cigarette Smokers Report More Attention to Smoking Cues Than White Smokers: Implications for Smoking Cessation.

    Science.gov (United States)

    Robinson, Cendrine D; Pickworth, Wallace B; Heishman, Stephen J; Wetter, David W; Cinciripini, Paul M; Li, Yisheng; Rowell, Brigid; Waters, Andrew J

    2015-08-01

    Black cigarette smokers have lower rates of smoking cessation compared with Whites. However, the mechanisms underlying these differences are not clear. Many Blacks live in communities saturated by tobacco advertisements. These cue-rich environments may undermine cessation attempts by provoking smoking. Moreover, attentional bias to smoking cues (attention capture by smoking cues) has been linked to lower cessation outcomes. Cessation attempts among Blacks may be compromised by attentional bias to smoking cues and a cue-rich environment. Attention to smoking cues in Black and White smokers was examined in 2 studies. In both studies, assessments were completed during 2 laboratory visits: a nonabstinent session and an abstinent session. In study 1, nontreatment-seeking smokers (99 Whites, 104 Blacks) completed the Subjective Attentional Bias Questionnaire (SABQ; a self-report measure of attention to cues) and the Smoking Stroop task (a reaction time measure of attentional bias to smoking cues). In study 2, 110 White and 74 Black treatment-seeking smokers completed these assessments and attempted to quit. In study 1, Blacks reported higher ratings than Whites on the SABQ (p = .005). In study 2, Blacks also reported higher ratings than Whites on the SABQ (p = .003). In study 2, Blacks had lower biochemical-verified point prevalence abstinence than Whites, and the between-race difference in outcome was partially mediated by SABQ ratings. Blacks reported greater attention to smoking cues than Whites, possibly due to between-race differences in environments. Greater attention to smoking cues may undermine cessation attempts. © The Author 2015. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Smoking and socioeconomic status in England: the rise of the never smoker and the disadvantaged smoker.

    Science.gov (United States)

    Hiscock, Rosemary; Bauld, Linda; Amos, Amanda; Platt, Stephen

    2012-08-01

    Since 2000 various tobacco control measures have been implemented in the UK. Changes in the smoking status of low and high socioeconomic status (SES) groups in England during this period (2001-08) are explored. Secondary analysis of the Health Survey for England general population samples was undertaken. Over 88 000 adults, age 16 or over, living in England were included. Smoking status (current, ex or never) was reported. SES was assessed through a count of seven possible indicators of disadvantage: National Statistics Socio-Economic Classification (NSSEC), neighbourhood index of multiple deprivation, lone parenting, car availability, housing tenure, income and unemployment. Smoking rates were four times higher among the most disadvantaged [60.7% (95% CI: 58.2-63.3)] than the most affluent [15.3% (95% CI: 14.8-15.8)]. Smoking prevalence declined between 2001 and 2008 except among the multiply disadvantaged. This trend appeared to be due to an increase in never smoking rather than an increase in quitting. Disadvantage declined among non-smokers but not smokers. In general never smoking and affluence increased in England over this period. The disadvantaged, however, did not experience the decline in smoking and smokers missed out from the increase in affluence. Smoking and disadvantage may increasingly coexist.

  6. Detection of AA76, a Common Form of Amyloid A Protein, as a Way of Diagnosing AA Amyloidosis.

    Science.gov (United States)

    Sato, Junji; Okuda, Yasuaki; Kuroda, Takeshi; Yamada, Toshiyuki

    2016-01-01

    Reactive amyloid deposits consist of amyloid A (AA) proteins, the degradation products of serum amyloid A (SAA). Since the most common species of AA is the amino terminal portion produced by cleavage between residues 76 and 77 of SAA (AA76), the presence of AA76 in tissues could be a consequence of AA amyloid deposition. This study assessed the diagnostic significance of the detection of AA76 for AA amyloidosis using two different approaches. Biopsy specimens (n=130 from 54 subjects) from gastroduodenal mucosa or abdominal fat (n=9 from 9 subjects) of patients who had already been diagnosed with or were suspected of having AA amyloidosis were used. Fixed mucosal sections were subjected to immunohistochemistry using a newly developed antibody recognizing the carboxyl terminal end of AA76 (anti-AA76). The non-fixed materials from gastroduodenal mucosa or abdominal fat were subjected to immunoblotting for detection of the size of AA76. Among the gastroduodenal specimens (n=115) from already diagnosed patients, the positive rates of Congo red staining, immunohistochemistry using anti-AA76, and immunoblotting were 68.4%, 73.0%, and 92.2%, respectively. The anti-AA76 did not stain the supposed SAA in the blood or leakage, which was stained by anti-SAA antibody. AA76 was not detected either by immunohistochemistry or by immunoblot in the materials from patients in whom AA amyloidosis had been ruled out. In the abdominal fat, the immunoblot detected AA76 in 8 materials from 8 already diagnosed patients and did not in 1 patient whose gastroduodenal mucosa was negative. In conclusion, the detection of AA76 may alter the ability to diagnose AA amyloidosis. In immunohistochemistry for fixed specimens, the new anti-AA76 antibody can improve the specificity. Immunoblot for non-fixed materials, which can considerably improve the sensitivity, should be beneficial for small materials like abdominal fat. © 2016 by the Association of Clinical Scientists, Inc.

  7. "I Smoke but I Am Not a Smoker": Phantom Smokers and the Discrepancy between Self-Identity and Behavior

    Science.gov (United States)

    Choi, Youjin; Choi, Sejung Marina; Rifon, Nora

    2010-01-01

    Objective: This article presents the development of a new smoking status, the "phantom smokers," who do not view themselves as smokers but report smoking cigarettes. Participants: Students from 2 universities in Michigan (N = 899; October 2005) and Florida (N = 1,517; May 2006) participated in surveys. Methods: Respondents in Michigan…

  8. Determination of a saliva cotinine cut-off to distinguish pregnant smokers from pregnant non-smokers

    DEFF Research Database (Denmark)

    Hegaard, Hanne K; Kjaergaard, Hanne; Møller, Lars F

    2007-01-01

    Objective validation of smoking status is necessary. Earlier studies have used saliva cotinine concentrations between 14.2 and 30 ng/ml as cut-off values to distinguish pregnant smokers from non-smokers. However, these cut-offs derive from studies including men and non-pregnant women. This consti...

  9. Bone density loss on computed tomography at 3-year follow-up in current compared to former male smokers

    International Nuclear Information System (INIS)

    Pompe, E.; Bartstra, J.; Verhaar, H.J.; Koning, H.J. de; Aalst, C.M. van der; Oudkerk, M.; Vliegenthart, R.; Lammers, J.-W.J.; Jong, P.A. de; Mohamed Hoesein, F.A.A.

    2017-01-01

    Objectives: Cigarette smoking negatively affects bone quality and increases fracture risk. Little is known on the effect of smoking cessation and computed tomography (CT)-derived bone mineral density (BMD) decline in the spine. We evaluated the association of current and former smoking with BMD decline after 3-year follow-up. Methods: Male current and former smokers participating in a lung cancer screening trial who underwent baseline and 3-year follow-up CT were included. BMD was measured by manual placement of a region of interest in the first lumbar vertebra and expressed in Hounsfield Unit (HU). Multiple linear regression analysis was used to evaluate the association between pack years smoked and smoking status with BMD decline. Results: 408 participants were included with median (25th–75th percentile) age of 59.4 (55.9–63.5) years. At the start of the study, 197 (48.3%) participants were current smokers and 211 (51.7%) were former smokers and had a similar amount of pack years. Current smokers had quit smoking for 6 (4–8) years prior to inclusion. There was no difference in BMD between current and former smokers at baseline (109 ± 34 HU vs. 108 ± 32 HU, p = 0.96). At 3-year follow-up, current smokers had a mean BMD decline of −3 ± 13 HU (p = 0.001), while BMD in former smokers did not change as compared to baseline (1 ± 13 HU, p = 0.34). After adjustment for BMD at baseline and body mass index, current smoking was independently associated with BMD decline (−3.8 HU, p = 0.003). Age, pack years, and the presence of a fracture at baseline did not associate with BMD decline. Conclusions: Current smokers showed a more rapid BMD decline over a 3-year period compared to former smokers. This information might be important to identify subjects at risk for osteoporosis and emphasizes the importance of smoking cessation in light of BMD decline.

  10. Bone density loss on computed tomography at 3-year follow-up in current compared to former male smokers

    Energy Technology Data Exchange (ETDEWEB)

    Pompe, E., E-mail: e.pompe@umcutrecht.nl [Department of Pulmonology, University Medical Center Utrecht, Utrecht (Netherlands); Bartstra, J. [Department of Radiology, University Medical Center Utrecht, Utrecht (Netherlands); Verhaar, H.J. [Department of Geriatric Medicine, University Medical Center Utrecht, Utrecht (Netherlands); Koning, H.J. de; Aalst, C.M. van der [Department of Public Health, Erasmus MC − University Medical Center Rotterdam, Rotterdam (Netherlands); Oudkerk, M. [University of Groningen, University Medical Center Groningen, Groningen, Department of Radiology (Netherlands); Vliegenthart, R. [University of Groningen, University Medical Center Groningen, Groningen, Department of Radiology (Netherlands); University of Groningen, University Medical Center Groningen, Center for Medical Imaging-North East Netherlands, Groningen (Netherlands); Lammers, J.-W.J. [Department of Pulmonology, University Medical Center Utrecht, Utrecht (Netherlands); Jong, P.A. de; Mohamed Hoesein, F.A.A. [Department of Radiology, University Medical Center Utrecht, Utrecht (Netherlands)

    2017-04-15

    Objectives: Cigarette smoking negatively affects bone quality and increases fracture risk. Little is known on the effect of smoking cessation and computed tomography (CT)-derived bone mineral density (BMD) decline in the spine. We evaluated the association of current and former smoking with BMD decline after 3-year follow-up. Methods: Male current and former smokers participating in a lung cancer screening trial who underwent baseline and 3-year follow-up CT were included. BMD was measured by manual placement of a region of interest in the first lumbar vertebra and expressed in Hounsfield Unit (HU). Multiple linear regression analysis was used to evaluate the association between pack years smoked and smoking status with BMD decline. Results: 408 participants were included with median (25th–75th percentile) age of 59.4 (55.9–63.5) years. At the start of the study, 197 (48.3%) participants were current smokers and 211 (51.7%) were former smokers and had a similar amount of pack years. Current smokers had quit smoking for 6 (4–8) years prior to inclusion. There was no difference in BMD between current and former smokers at baseline (109 ± 34 HU vs. 108 ± 32 HU, p = 0.96). At 3-year follow-up, current smokers had a mean BMD decline of −3 ± 13 HU (p = 0.001), while BMD in former smokers did not change as compared to baseline (1 ± 13 HU, p = 0.34). After adjustment for BMD at baseline and body mass index, current smoking was independently associated with BMD decline (−3.8 HU, p = 0.003). Age, pack years, and the presence of a fracture at baseline did not associate with BMD decline. Conclusions: Current smokers showed a more rapid BMD decline over a 3-year period compared to former smokers. This information might be important to identify subjects at risk for osteoporosis and emphasizes the importance of smoking cessation in light of BMD decline.

  11. A Comparison of Oral Sensory Effects of Three TRPA1 Agonists in Young Adult Smokers and Non-smokers

    Directory of Open Access Journals (Sweden)

    Eva Ø. Hansen

    2017-09-01

    Full Text Available This study profiled intra-oral somatosensory and vasomotor responses to three different transient receptor potential (TRP channels, subfamily A, member 1 (TRPA1 agonists (menthol, nicotine, and cinnamaldehyde in smoking and non-smoking young adults. Healthy non-smokers (N = 30 and otherwise healthy smokers (N = 25 participated in a randomized, double-blinded, cross-over study consisting of three experimental sessions in which they received menthol (30 mg, nicotine (4 mg, or cinnamaldehyde (25 mg chewing gum. Throughout a standardized 10 min chewing regime, burning, cooling, and irritation intensities, and location were recorded. In addition, blood pressure, heart rate and intra-oral temperature were assessed before, during, and after chewing. Basal intra-oral temperature was lower in smokers (35.2°C ± 1.58 as compared to non-smokers (35.9°C ± 1.61 [F(1, 52 = 8.5, P = 0.005, post hoc, p = 0.005]. However, the increase in temperature, heart rate, and blood pressure in response to chewing menthol, nicotine, and cinnamaldehyde gums were similar between smokers and non-smokers. Although smoking status did not influence the intensity of burning, cooling, and irritation, smokers did report nicotine burn more often (92% than non-smokers (63% [χ(1, N=552 = 6.208, P = 0.013]. Reports of nicotine burn consistently occurred at the back of the throat and cinnamaldehyde burn on the tongue. The cooling sensation of menthol was more widely distributed in the mouth of non-smokers as compared to smokers. Smoking alters thermoregulation, somatosensory, and possibly TRPA1 receptor responsiveness and suggests that accumulated exposure of nicotine by way of cigarette smoke alters oral sensory and vasomotor sensitivity.

  12. Steroid resistance in COPD? Overlap and differential anti-inflammatory effects in smokers and ex-smokers.

    Science.gov (United States)

    Hoonhorst, Susan J M; ten Hacken, Nick H T; Vonk, Judith M; Timens, Wim; Hiemstra, Pieter S; Lapperre, Thérèse S; Sterk, Peter J; Postma, Dirkje S

    2014-01-01

    Inhaled corticosteroids (ICS) reduce exacerbation rates and improve health status but can increase the risk of pneumonia in COPD. The GLUCOLD study, investigating patients with mild-to-moderate COPD, has shown that long-term (2.5-year) ICS therapy induces anti-inflammatory effects. The literature suggests that cigarette smoking causes ICS insensitivity. The aim of this study is to compare anti-inflammatory effects of ICS in persistent smokers and persistent ex-smokers in a post-hoc analysis of the GLUCOLD study. Persistent smokers (n = 41) and persistent ex-smokers (n = 31) from the GLUCOLD cohort were investigated. Effects of ICS treatment compared with placebo were estimated by analysing changes in lung function, hyperresponsiveness, and inflammatory cells in sputum and bronchial biopsies during short-term (0-6 months) and long-term (6-30 months) treatment using multiple regression analyses. Bronchial mast cells were reduced by short-term and long-term ICS treatment in both smokers and ex-smokers. In contrast, CD3⁺, CD4⁺, and CD8⁺ cells were reduced by short-term ICS treatment in smokers only. In addition, sputum neutrophils and lymphocytes, and bronchial CD8⁺ cells were reduced after long-term treatment in ex-smokers only. No significant interactions existed between smoking and ICS treatment. Even in the presence of smoking, long-term ICS treatment may lead to anti-inflammatory effects in the lung. Some anti-inflammatory ICS effects are comparable in smokers and ex-smokers with COPD, other effects are cell-specific. The clinical relevance of these findings, however, are uncertain.

  13. Spirometry and health status worsen with weight gain in obese smokers but improve in normal-weight smokers.

    Science.gov (United States)

    Sood, Akshay; Petersen, Hans; Meek, Paula; Tesfaigzi, Yohannes

    2014-02-01

    The literature on the effect of obesity and weight gain on respiratory outcomes in smokers is contradictory. To examine the cross-sectional effect of body mass index (BMI) and the longitudinal effect of change in BMI upon spirometry and health status among smokers at risk for and with milder chronic obstructive pulmonary disease (COPD). Participants from the Lovelace Smokers' Cohort were followed for a median period of 6 years, 75% of whom were at risk and 25% of whom had COPD at baseline examination. BMI and gain in BMI were examined as continuous independent variables overall and after stratification into three categories (normal-weight, overweight, and obese) determined on the basis of baseline weight. Spirometry and health status (as assessed by St. George Respiratory Questionnaire total and subscale scores) were dependent variables. Covariates included age, sex, ethnicity, pack-years of smoking, and current smoking status. Cross-sectional analysis used linear and logistic regression; longitudinal analysis used a mixed model approach. In cross-sectional analyses, higher BMI was associated with worse health status among obese smokers but with better health status among normal-weight smokers. In longitudinal analyses, weight gain was associated with a decrease in FEV1 and health status among obese smokers and with an increase in these outcomes among normal-weight smokers. Weight gain affects respiratory outcomes differently between obese and normal-weight smokers. Whereas FEV1 and health status decrease with weight gain among obese smokers, they improve among normal-weight smokers. The nonlinear relationship between weight gain and respiratory outcomes suggests that this effect of excess weight is unlikely to be mechanical alone.

  14. Dicty_cDB: FC-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  15. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  16. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  17. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  18. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  19. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  20. Dicty_cDB: FC-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  1. Dicty_cDB: FC-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  2. Dicty_cDB: FC-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  3. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  4. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  5. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  6. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  7. Dicty_cDB: FC-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  8. Dicty_cDB: FC-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  9. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  10. Dicty_cDB: FC-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  11. Health professionals' views of overweight people and smokers.

    Science.gov (United States)

    Harvey, E L; Hill, A J

    2001-08-01

    To examine health professionals' views of overweight people, to compare these to their views of smokers, and to explore the role of level of severity on these perceptions. A postal survey of health professionals employing a two by two, independent factorial design. The health category (overweight or smoker) was divided by level of severity (moderate or extreme), so that respondents received questionnaires about either: (i) moderately overweight people; (ii) extremely overweight people; (iii) moderate smokers; or (iv) heavy smokers. Two-hundred and fifty-five general medical practitioners and clinical psychologists in the north of England. A questionnaire was designed to explore beliefs about the causes, attitudes towards, and perceptions of responsibility of overweight people and smokers. Moderately and extremely overweight people were perceived as having reduced self-esteem, sexual attractiveness and health, and to be moderately responsible for changing their situation (but less so than smokers). There were clear level effects in the perceptions of overweight, but not so for smokers. Of the four groups, moderately overweight people were viewed most positively and extremely overweight (obese) people were viewed least positively. Overall, health professionals' attitudes to overweight people were neutral to negative rather than entirely negative. However, where apparent negative attitudes were more likely to be directed at obese people than moderately overweight people. As obesity is a risk to health, the practice implications of health professionals' negative attitudes or patients' reticence to visit professionals who treat them with disregard must be addressed.

  12. Carboxyhemoglobin Levels Induced by Cigarette Smoking Outdoors in Smokers.

    Science.gov (United States)

    Schimmel, Jonathan; George, Naomi; Schwarz, John; Yousif, Sami; Suner, Selim; Hack, Jason B

    2018-03-01

    Non-invasive screening of carboxyhemoglobin saturation (SpCO) in the emergency department to detect occult exposure is increasingly common. The SpCO threshold to consider exposure in smokers is up to 9%. The literature supporting this cutoff is inadequate, and the impact of active smoking on SpCO saturation remains unclear. The primary objective was to characterize baseline SpCO in a cohort of smokers outdoors. Secondary objectives were to explore the impact of active smoking on SpCO and to compare SpCO between smokers and non-smokers. This was a prospective cohort pilot study in two outdoor urban public areas in the USA, in a convenience sample of adult smokers. SpCO saturations were assessed non-invasively before, during, and 2 min after cigarette smoking with pulse CO-oximetry. Analyses included descriptive statistics, correlations, and a generalized estimating equation model. Eighty-five smokers had mean baseline SpCO of 2.7% (SD 2.6) and peak of 3.1% (SD 2.9), while 15 controls had SpCO 1.3% (SD 1.3). This was a significant difference. Time since last cigarette was associated with baseline SpCO, and active smoking increased mean SpCO. There was correlation among individual smokers' SpCO levels before, during, and 2 min after smoking, indicating smokers tended to maintain their baseline SpCO level. This study is the first to measure SpCO during active smoking in an uncontrolled environment. It suggests 80% of smokers have SpCO ≤ 5%, but potentially lends support for the current 9% as a threshold, depending on clinical context.

  13. AA, sandwich line with magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Continuation from 8010293: Finally, the sandwich line with the horn is placed on the ground, for the horn to be inspected and, if needed, exchanged for a new one. The whole procedure was trained with several members of the AA team, for quick and safe handling, and to share the radiation dose amongst them.

  14. Overall view of AA (Bld 193)

    CERN Multimedia

    1980-01-01

    See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  15. Overview of the Antiproton Accumulator (AA)

    CERN Multimedia

    1982-01-01

    See photo 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  16. Overall view of AA in Bld. 193

    CERN Multimedia

    1980-01-01

    See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  17. AA, mating of BST magnet halves

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  18. AA, vacuum tank for stochastic precooling

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  19. Personality and sexual behavior of the adolescent smoker.

    Science.gov (United States)

    Malcolm, S; Shephard, R J

    1978-01-01

    The adolescent smoker (aged 14 to 17 years) shows little difference from the non-smoker in terms of scores on the Cattell 16 personality factor inventory. In particular, there is no evidence of tension, extroversion, or reversal of sexually-biased personality characteristics. The sexual promiscuity of the adolescent smoker is probably related more to liberal attitudes and a propensity for risk-taking behavior than to uncertainty regarding sexuality. In this age group the decision to start smoking regularly may depend more on the influence of parents and friends than on an inherent personality structure.

  20. Real-time craving differences between black and white smokers.

    Science.gov (United States)

    Carter, Brian L; Paris, Megan M; Lam, Cho Y; Robinson, Jason D; Traylor, Amy C; Waters, Andrew J; Wetter, David W; Cinciripini, Paul M

    2010-01-01

    Black and White smokers may experience aspects of nicotine dependence, including craving, differently. This study used a naturalistic technique, ecological momentary assessment (EMA), to explore differences in craving, mood, expectancy, and smoking enjoyment between Black and White smokers. Participants carried personal digital assistants (PDAs) programmed to obtain multiple daily assessments. Black smokers reported higher craving after smoking and at random assessment times and higher cigarette enjoyment. No differences were found in mood or expectancy. Racial differences in psychological factors related to smoking are explored in the contexts of genetic, sociological, and psychophysiological distinctions. Implications for practice and research are discussed. (Am J Addict 2010;00:1-5).

  1. Longitudinal study of experimental induction of AA amyloidosis in mice seeded with homologous and heterologous AA fibrils.

    Science.gov (United States)

    Muhammad, Naeem; Murakami, Tomoaki; Inoshima, Yasuo; Ishiguro, Naotaka

    2016-09-01

    To investigate pathogenesis and kinetics of experimentally induced murine AA amyloidosis seeded with homologous (murine) and heterologous (bovine) AA fibrils. Experimental AA amyloidosis was induced by administration of inflammatory stimulus and preformed AA fibrils to a total of 111 female C57/Black mice. In this longitudinal study, heterologous (bovine) as well as homologous (murine) AA fibrils were injected intraperitoneally to mice in various combinations. Re-stimulation was done at 120 or 300 days post first inoculation. To analyze the intensity of amyloid depositions in mice organs, immunohistochemical techniques and image J software were used. Assessment of cytokines level in sera was done using a Mouse Th1/Th2/Th17 Cytokine CBA Kit. Incidence and severity of AA amyloidosis were quite low in mice inoculated with heterologous bovine AA fibrils than homologous murine one. Homologous AA fibrils administration at first and second inoculation caused maximum amount of amyloid depositions and severe systemic form of amyloidosis. Increase in the level of pro-inflammatory cytokine IL-6 was observed after first inoculation, while second inoculation caused a further increase in the level of anti-inflammatory cytokine IL-10. AA amyloidosis can be induced by heterologous as well as homologous AA fibrils. Severity of AA amyloidosis induced with homologous AA fibrils is higher compared to heterologous AA fibrils.

  2. [Risk control of traditional Chinese medicines containing aristolochis acids (AAs) based on influencing factors of content of AAs].

    Science.gov (United States)

    Tian, Jing-Zhuo; Liang, Ai-Hua; Liu, Jing; Zhang, Bo-Li

    2017-12-01

    Aristolochic acids (AAs) widely exist in such plants as Aristolochia and Asarum. The renal toxicity of AAs as well as its carcinogenicity to urinary system have been widely known. In 2003 and 2004, China prohibited the use of Aristolochiae Radix, Aristolochiae Manshuriensis Caulis and Aristolochiae Fangchi Radix, and required administering other AAs-containing medicines in accordance with the regulations for prescription drugs. In this paper, we retrieved literatures on the content determination of AAs in recent 10 years in China. It suggested that the AAs content is lower in Asarum herb, especially in its roots and rhizomes, and most of which do not show detectable amount of AA-I. Some of traditional Chinese medicines show fairly small amount of detectable AA-I. The AAs content in Aristolochia herb (including Fructus Aristolochiae, kaempfer dutchmanspipe root) is relatively high; however, there are fewer literatures for studying the content determination of AAs in Chinese patent medicines. There were many factors affecting AAs content, including the parts used, origins, processing methods, extraction process. It suggested that we should pay attention to the toxicity of Chinese medicines containing AAs and use these decoction pieces and traditional Chinese medicines cautiously. In addition, basic studies for the origins, processing methods and extraction process of Chinese patent medicines containing AAs, as well as supervision and detection of AAs content in traditional Chinese medicinal materials, decoction pieces and Chinese patent medicines shall be strengthened for reducing medication risk and guaranteeing clinical medication safety. Copyright© by the Chinese Pharmaceutical Association.

  3. Evaluation of salivary catalase, vitamin C, and alpha-amylase in smokers and non-smokers: a retrospective cohort study.

    Science.gov (United States)

    Ahmadi-Motamayel, Fatemeh; Falsafi, Parisa; Goodarzi, Mohammad Taghi; Poorolajal, Jalal

    2017-05-01

    Saliva and its defence systems such as antioxidants and minerals are very important in the pathogenesis of different diseases. Cigarette smoking has many destructive effects. Oxidative stresses play an important role in the side effects of smoking. This study assessed the effect of cigarette smoking on salivary levels of catalase, vitamin C, and α-amylase. This retrospective cohort study was carried out in Hamadan, Iran, on 510 subjects; 259 subjects were smokers (the exposed group) and 251 were non-smokers (the unexposed group). Five microliters of unstimulated saliva was collected by spitting method. Catalase, vitamin C, and α-amylase salivary levels were determined by spectrophotometric assay. Data were analyzed with t-test using STATA 12. Vitamin C level in smokers was significantly lower than that in non-smokers. The salivary catalase levels were lower and α-amylase levels were higher in smokers, but the differences were not statistically significant (P = 0.416 and P = 0.265, respectively). Smokers were younger than non-smokers. Smoking resulted in a change in salivary antioxidant levels. Changes in antioxidant levels can influence the deleterious effects of smoking on oral mucosa; it might also indicate systemic changes and changes in the serum levels of oxidative agents. Further studies are necessary to understand the mechanisms and real effects of smoking, to determine the benefits of supplementary antioxidants for treatment and to reduce the dangerous side effects of smoking. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. The Self-Reported Oral Health Status and Dental Attendance of Smokers and Non-Smokers in England.

    Directory of Open Access Journals (Sweden)

    Julia Csikar

    Full Text Available Smoking has been identified as the second greatest risk factor for global death and disability and has impacts on the oral cavity from aesthetic changes to fatal diseases such as oral cancer. The paper presents a secondary analysis of the National Adult Dental Health Survey (2009. The analysis used descriptive statistics, bivariate analyses and logistic regression models to report the self-reported oral health status and dental attendance of smokers and non-smokers in England. Of the 9,657 participants, 21% reported they were currently smoking. When compared with smokers; non-smokers were more likely to report 'good oral health' (75% versus 57% respectively, p<0.05. Smokers were twice as likely to attend the dentist symptomatically (OR = 2.27, CI = 2.02-2.55 compared with non-smoker regardless the deprivation status. Smokers were more likely to attend symptomatically in the most deprived quintiles (OR = 1.99, CI = 1.57-2.52 and perceive they had poorer oral health (OR = 1.77, CI = 1.42-2.20. The present research is consistent with earlier sub-national research and should be considered when planning early diagnosis and management strategies for smoking-related conditions, considering the potential impact dental teams might have on smoking rates.

  5. Prevalence and incidence of COPD in smokers and non-smokers: the Rotterdam Study.

    Science.gov (United States)

    Terzikhan, Natalie; Verhamme, Katia M C; Hofman, Albert; Stricker, Bruno H; Brusselle, Guy G; Lahousse, Lies

    2016-08-01

    COPD is the third leading cause of death in the world and its global burden is predicted to increase further. Even though the prevalence of COPD is well studied, only few studies examined the incidence of COPD in a prospective and standardized manner. In a prospective population-based cohort study (Rotterdam Study) enrolling subjects aged ≥45, COPD was diagnosed based on a pre-bronchodilator obstructive spirometry (FEV1/FVC spirometry within the Rotterdam Study, cases were defined as having COPD diagnosed by a physician on the basis of clinical presentation and obstructive lung function measured by the general practitioner or respiratory physician. Incidence rates were calculated by dividing the number of incident cases by the total number of person years of subjects at risk. In this cohort of 14,619 participants, 1993 subjects with COPD were identified of whom 689 as prevalent ones and 1304 cases as incident ones. The overall incidence rate (IR) of COPD was 8.9/1000 person-years (PY); 95 % Confidence Interval (CI) 8.4-9.4. The IR was higher in males and in smokers. The proportion of female COPD participants without a history of smoking was 27.2 %, while this proportion was 7.3 % in males. The prevalence of COPD in the Rotterdam Study is 4.7 % and the overall incidence is approximately 9/1000 PY, with a higher incidence in males and in smokers. The proportion of never-smokers among female COPD cases is substantial.

  6. Lung cancer risks from residential radon among smokers and non-smokers

    International Nuclear Information System (INIS)

    Enflo, Anita

    2002-01-01

    Primary lung cancer occurs mainly among elderly smokers. Smoking and radon are generally considered to be the main causes of lung cancer. By simply studying the age dependence of all primary lung cancer incidences it seems plausible to suggest that the risk for obtaining lung cancer from domestic radon is low for children. In addition, as there are few non-smoking primary lung cancer cases at older ages, it seems plausible to suggest that most of the radon-induced lung cancer cases are to be found among the smoking population. Reduction of smoking habits would appear to be the most cost effective method to reduce lung cancer cases. (author)

  7. Cylindrical diffractive lenses recorded on PVA/AA photopolymers

    Science.gov (United States)

    Fernández, R.; Gallego, S.; Márquez, A.; Navarro-Fuster, V.; Francés, J.; Neipp, C.; Beléndez, A.; Pascual, I.

    2016-04-01

    Photopolymers are optical recording materials appealing for many different applications such as holography, data storage, interconnectors, solar concentrations, or wave-guides fabrication. Recently the capacity of photopolymers to record diffractive optical elements (DOE's) has been investigated. Different authors have reported proposes to record DOE like fork gratings, photonics structures, lenses, sinusoidal, blazed or fork gratings. In these experiments there are different experimental set-ups and different photopolymers. In this work due to the improvement in the spatial light modulation technology together with the photopolymer science we propose a recording experimental system of DOE using a Liquid Cristal based on Silicon (LCoS) display as a master to store complex DOE like cylindrical lenses. This technology permits us an accurate control of the phase and the amplitude of the recording beam, with a very small pixel size. The main advantage of this display is that permit us to modify the DOE automatically, we use the software of the LCoS to send the voltage to each pixel In this work we use a photopolymer composed by acrylamide (AA) as polymerizable monomer and polyvinyl alcohol (PVA). We use a coverplated and index matched photopolymer to avoid the influence of the thickness variation on the transmitted light. In order to reproduce the material behaviour during polymerization, we have designed our model to simulate cylindrical lenses and used Fresnel propagation to simulate the light propagation through the DOE and analyze the focal plane and the properties of the recorded lenses.

  8. Smoking addiction: the shift from head to hands: Approach bias towards smoking-related cues in low-dependent versus dependent smokers.

    Science.gov (United States)

    Detandt, Sandrine; Bazan, Ariane; Quertemont, Etienne; Verbanck, Paul

    2017-07-01

    The dual process theory is central to several models of addiction, implying both an increase of stimulus salience and deficits in inhibitory control. Our major aim is to provide behavioral evidence for an approach bias tendency in smokers and more specifically during smoking cue exposure. The second aim is to examine whether this bias differs in low-dependent versus dependent smokers. Thirty-two smokers (17 low dependent and 15 dependent; cut-off FTND of 4) and 28 non-smokers performed a modified Go/NoGo task using tobacco-related words and neutral words as stimuli. Smokers generally made more mistakes and tended to be faster for smoking-related cues specifically. Low dependents acknowledged more their dependency in declarative questionnaires while making more errors and being slower specifically on smoking cues; dependent smokers were less prone to indicate their addiction, but were faster and accurate when it came to picking the smoking cues. These results suggest that a shift has operated from a mental preoccupation with smoking in the low-dependent group, to smoking as a motor habit in our dependent group. This finding invites experts to rethink smoking addiction in the light of this crucial moment, namely, the shift "from head to hands".

  9. Pulmonary functions of narghile smokers compared to cigarette ...

    African Journals Online (AJOL)

    ENS) are few, have some methodological limits, and present contradictory conclusions. The present study aimed to compare the plethysmographic profiles of ENS with age- and height-matched exclusive cigarette smokers (ECS). Methods: ...

  10. Cytogenetical analysis in blood lymphocytes of cigarette smokers in ...

    African Journals Online (AJOL)

    Cytogenetical analysis in blood lymphocytes of cigarette smokers in Tiruchirappalli district, Tamil Nadu, India. S. Christobher, M. Periyasamy, H.E. Syed Mohamed, A. Sadiq Bukhari, Alagamuthu Karthickkumar, Vellingiri Balachandar ...

  11. Attentional Bias in Nicotine Dependent and Non-Dependent Smokers

    OpenAIRE

    Bartlett, James

    2016-01-01

    This is a poster from the BPS Psychobiology Section Annual Scientific Meeting (2015). It explains my third year dissertation project investigating attentional bias, smoking habits, and smoking motives in nicotine dependent and non-dependent smokers.

  12. Bronchodilator responsiveness of peripheral airways in smokers with normal spirometry.

    Science.gov (United States)

    Jetmalani, Kanika; Chapman, David G; Thamrin, Cindy; Farah, Claude S; Berend, Norbert; Salome, Cheryl M; King, Gregory G

    2016-10-01

    Cigarette smoke exposure increases airway smooth muscle (ASM) contractility. Abnormalities in peripheral airway function in smokers with normal spirometry could be due to the effects of ASM tone. We aimed to determine the contribution of ASM tone to peripheral airway function in smokers with normal spirometry from the response to bronchodilator (BD). Ventilation heterogeneity in peripheral conductive (Scond) and acinar (Sacin) airways were measured in 50 asymptomatic smokers and 20 never-smokers using multiple breath nitrogen washout, before and 20 min after inhalation of 200 µg salbutamol and 80 µg ipratropium bromide. Z-scores were calculated to define abnormality in Sacin and Scond. Nineteen smokers had abnormal Sacin, and 12 had abnormal Scond; 7 had abnormalities in both. After BD, Sacin improved in smokers with normal Sacin (6.5 ± 15.9%, P = 0.02), smokers with abnormal Sacin (9.2 ± 16.9%, P = 0.03) and in control subjects (11.7 ± 18.2%, P = 0.01), with no differences in improvements between groups. Sacin remained abnormal in 15/19 smokers and their post-BD values correlated with smoking exposure (r = 0.53, P = 0.02). After BD, Scond improved in smokers with abnormal Scond (28.3 ± 15.9%, P = 0.002) and normalized in 9/12 subjects, but not in those with normal Scond (0.25 ± 32.7%, P = 0.44) or control subjects (-1.7 ± 21.2%, P = 0.64). In smokers with normal spirometry, abnormal conductive airway function could be attributed to increased bronchomotor tone. In contrast, bronchomotor tone in acinar airways is unaffected by smoking and functional abnormality. There may be different causal mechanisms underlying acinar and conductive airway abnormalities in smokers with normal spirometry. © 2016 Asian Pacific Society of Respirology.

  13. Social relations and smoking abstinence among ever-smokers

    DEFF Research Database (Denmark)

    Ross, Lone; Thomsen, Birthe Lykke Riegels; Boesen, Sidsel Helle

    2013-01-01

    Relational strain may be a risk factor for relapse after smoking cessation whereas social support may be protective. This study aimed to assess which aspects of social relations were associated with smoking abstinence among ever-smokers.......Relational strain may be a risk factor for relapse after smoking cessation whereas social support may be protective. This study aimed to assess which aspects of social relations were associated with smoking abstinence among ever-smokers....

  14. Characteristic Comparison of CHD for Active Smoker by Smoking Characteristic

    OpenAIRE

    Diastutik, Desy

    2016-01-01

    Coronary Heart Disease (CHD) is a type of cardiovascular disease that has highest level of morbidity and mortality among non communicable disease group. One of the factor that contribute for coronary heart disease is smoking characteristic. The research was aimed to analyze characteristic comparison of coronary heart disease for active smoker by smoking characteristic. The research was observational study using cross sectional design. Thirty eight active smokers were involved as research samp...

  15. Epidemiological profile of non-daily smokers in South Africa ...

    African Journals Online (AJOL)

    to be the cause of 8% of all annual adult deaths in South Africa.2,3 This estimate is likely to grow in the future as ... study suggests that as many as 39% of women smokers in Australia could be ND smokers.9 Studies from ... and Inequality report18 identified race as one of the most significant indicators of poverty, with 61% of ...

  16. School absenteeism among children living with smokers.

    Science.gov (United States)

    Levy, Douglas E; Winickoff, Jonathan P; Rigotti, Nancy A

    2011-10-01

    Involuntary tobacco smoke exposure causes substantial morbidity in children. We hypothesized that children exposed to tobacco smoke in the home would have increased school absenteeism with associated costs due to lost caregiver wages/time. We analyzed data on health and absenteeism among schoolchildren aged 6 to 11 years identified in the 2005 National Health Interview Survey (NHIS). We used multivariate models to assess the relationships between adult-reported household smoking and child health and school absenteeism. Analyses were adjusted for children's and parents' demographic and socioeconomic characteristics. The value of lost caregiver time was estimated by using self-reported employment and earnings data in the NHIS and publicly available time-use data. Children living with 1 or ≥ 2 adults who smoked in the home had 1.06 (95% confidence interval [CI]: 0.54-1.55) and 1.54 (95% CI: 0.95-2.12) more days absent from school per year, respectively, than children living with 0 smokers in the home. Living with ≥ 2 adults who smoked in the home was associated with increased reports of having ≥ 3 ear infections in the previous 12 months (adjusted odds ratio [aOR]: 2.65 [95% CI: 1.36-5.16]) and having a chest cold in the 2 weeks before interview (aOR: 1.77 [95% CI: 1.03-3.03]) but not with having vomiting/diarrhea in the previous 2 weeks (aOR: 0.93 [95% CI: 0.45-1.89]). Caregivers' time tending children absent from school was valued at $227 million per year. Tobacco smoke exposure has significant consequences for children and families above and beyond child morbidity, including academic disadvantage and financial burden.

  17. Symptoms in smokers trying to quit

    Directory of Open Access Journals (Sweden)

    Helgason Asgeir R

    2006-08-01

    Full Text Available Abstract Aims To describe the prevalence and intensity of different symptoms in relation to tobacco abstinence. To explore latent dimensions between symptoms in smokers trying to quit. Design A cross sectional study using a questionnaire to retrospectively assess symptoms over a period of 12 months. Setting Swedish telephone quitline, a nationwide free of charge service. Participants All 741 individuals who had called the quitline and signed up for smoking cessation treatment between February 2000 to November 2001 and reported to have been smoke free for at least 24 hours during the previous 12 month period from first contact. Measurements Assessments were made by self-report, and abstinence was defined as "not a single puff of smoke during the last week". A factor analysis approach where individual items aggregate into factors was used to explore the relationship between the different symptoms. Findings High intensity of symptoms related to unsuccessful quitting attempts and included craving, irritability, apprehension/anxiety, difficulties concentrating, restlessness, depression/depressed mood, and insomnia. The factor loadings of all 17 symptoms resulted in three factors with factor 1, psychological being the most important. High scores on this factor relates to unsuccessful quitting attempts. Using Nicotine Replacement Therapy (NRT for 5 weeks or longer, reduced symptoms included in factor 1. The other two factors were factor 2 physiological and factor 3 neurological. Conclusion Symptoms that are psychological and/or neurological in nature are interrelated and appear to be the most significant obstacles for successful quitting attempts in a population-based setting. These symptoms may be successfully treated with NRT.

  18. School Absenteeism Among Children Living With Smokers

    Science.gov (United States)

    Winickoff, Jonathan P.; Rigotti, Nancy A.

    2011-01-01

    OBJECTIVE: Involuntary tobacco smoke exposure causes substantial morbidity in children. We hypothesized that children exposed to tobacco smoke in the home would have increased school absenteeism with associated costs due to lost caregiver wages/time. METHODS: We analyzed data on health and absenteeism among schoolchildren aged 6 to 11 years identified in the 2005 National Health Interview Survey (NHIS). We used multivariate models to assess the relationships between adult-reported household smoking and child health and school absenteeism. Analyses were adjusted for children's and parents' demographic and socioeconomic characteristics. The value of lost caregiver time was estimated by using self-reported employment and earnings data in the NHIS and publicly available time-use data. RESULTS: Children living with 1 or ≥2 adults who smoked in the home had 1.06 (95% confidence interval [CI]: 0.54–1.55) and 1.54 (95% CI: 0.95–2.12) more days absent from school per year, respectively, than children living with 0 smokers in the home. Living with ≥2 adults who smoked in the home was associated with increased reports of having ≥3 ear infections in the previous 12 months (adjusted odds ratio [aOR]: 2.65 [95% CI: 1.36–5.16]) and having a chest cold in the 2 weeks before interview (aOR: 1.77 [95% CI: 1.03–3.03]) but not with having vomiting/diarrhea in the previous 2 weeks (aOR: 0.93 [95% CI: 0.45–1.89]). Caregivers' time tending children absent from school was valued at $227 million per year. CONCLUSIONS: Tobacco smoke exposure has significant consequences for children and families above and beyond child morbidity, including academic disadvantage and financial burden. PMID:21890826

  19. Predictors of COPD in symptomatic smokers and ex-smokers seen in primary care

    DEFF Research Database (Denmark)

    Tupper, Oliver Djurhuus; Kjeldgaard, Peter; Løkke, Anders

    2018-01-01

    Even in subjects at high risk of chronic obstructive pulmonary disease (COPD), the diagnosis is often missed due to lack of awareness of symptoms and risk factors. The objective of this study was to identify predictors of a diagnosis of COPD in symptomatic current and ex-smokers seen in a primary....... Information on age, smoking status, body mass index (BMI) and dyspnoea (Medical Research Council (MRC) dyspnoea scale) was obtained. Individuals with airway obstruction (i.e. forced expiratory volume in 1 second (FEV1)/forced vital capacity ratio (FVC) spirometry had a diagnostic spirometry....... Multivariate logistic regression analysis revealed that increasing age 50-59 years (OR 2.4, 95% CI 1.8-3.3), 60-69 years (OR 4.1, 95% CI 3.1-5.5), ≥70 years (OR 5.7, 95% CI 4.2-7.8), BMI smoker (OR 1.2, 95% CI 1.01-1.5), self-reported dyspnoea (OR 1.7, 95% CI 1...

  20. Neural reward and punishment sensitivity in cigarette smokers.

    Science.gov (United States)

    Potts, Geoffrey F; Bloom, Erika L; Evans, David E; Drobes, David J

    2014-11-01

    Nicotine addiction remains a major public health problem but the neural substrates of addictive behavior remain unknown. One characteristic of smoking behavior is impulsive choice, selecting the immediate reward of smoking despite the potential long-term negative consequences. This suggests that drug users, including cigarette smokers, may be more sensitive to rewards and less sensitive to punishment. We used event-related potentials (ERPs) to test the hypothesis that smokers are more responsive to reward signals and less responsive to punishment, potentially predisposing them to risky behavior. We conducted two experiments, one using a reward prediction design to elicit a Medial Frontal Negativity (MFN) and one using a reward- and punishment-motivated flanker task to elicit an Error Related Negativity (ERN), ERP components thought to index activity in the cortical projection of the dopaminergic reward system. The smokers had a greater MFN response to unpredicted rewards, and non-smokers, but not smokers, had a larger ERN on punishment motivated trials indicating that smokers are more reward sensitive and less punishment sensitive than nonsmokers, overestimating the appetitive value and underestimating aversive outcomes of stimuli and actions. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  1. Relationship between compliance and periodontal treatment outcome in smokers.

    Science.gov (United States)

    Jansson, Leif E; Hagström, Karin E

    2002-06-01

    Smoking is an established risk factor of periodontal disease and smokers are regarded as patients with a high risk of periodontitis recurrence during the maintenance phase. Lack of compliance and smoking constitute significant factors for the risk of further periodontitis progression. The purpose of the present study was to investigate the relationship between periodontal status and the tendency to interrupt periodontal treatment and determine if this relationship differs significantly between smokers and non-smokers. The investigation was conducted as a retrospective study on a sample of 325 patients referred for treatment. The patients had been offered full periodontal treatment and a full-mouth oral radiographic examination. In order to investigate any correlations between periodontal status and smoking or interrupted periodontal treatments, stepwise multiple regression analyses were adopted. The mean age of the sample was 49.7 years (range 25 to 83) and a majority were females (57%). The relative frequency of smoking was 52%. The relative frequency of interruption of periodontal treatment was 26% for non-smokers and 31% for smokers. Smokers who interrupted periodontal treatment after the reevaluation were found to have significantly deeper periodontal probing depths at the reevaluation compared to those who did not interrupt the treatment irrespective of smoking habits (Pperiodontitis even if they had completed the treatment plan. An important task in the future will be to find ways to reduce the frequency of non-compliance and thus improve the prognosis.

  2. Racial Differences in Serum Cotinine Levels of Smokers

    Directory of Open Access Journals (Sweden)

    Lisa B. Signorello

    2009-01-01

    Full Text Available The purpose of this study was to estimate black/white differences in cotinine levels for current smokers of both sexes, and to explore the potential contribution of mentholated cigarettes to these differences. Sera from 255 current smokers sampled from Southern Community Cohort Study participants (65 black men, 65 black women, 63 white men, 62 white women were analyzed for cotinine, and linear regression was used to model the effect of race on cotinine level, adjusting for the number of cigarettes smoked within the last 24 hours, use of menthol vs. non-menthol cigarettes, exposure to environmental tobacco smoke, and age. Black smokers smoked fewer cigarettes than white smokers, yet had crude mean cotinine levels nearly as high or higher than white smokers. After multivariate adjustment, cotinine levels were an average of 50 ng/ml higher among black than white women (p=0.008 and non-significantly 12 ng/ml higher among black than white men (p=0.52. We observed no increase in cotinine levels associated with menthol cigarette use. We conclude that differences in cotinine levels among smokers suggest racial variation in exposure to and/or metabolism of tobacco smoke constituents, but our findings do not support a role for menthol preference in this disparity.

  3. Racial differences in serum cotinine levels of smokers.

    Science.gov (United States)

    Signorello, Lisa B; Cai, Qiuyin; Tarone, Robert E; McLaughlin, Joseph K; Blot, William J

    2009-01-01

    The purpose of this study was to estimate black/white differences in cotinine levels for current smokers of both sexes, and to explore the potential contribution of mentholated cigarettes to these differences. Sera from 255 current smokers sampled from Southern Community Cohort Study participants (65 black men, 65 black women, 63 white men, 62 white women) were analyzed for cotinine, and linear regression was used to model the effect of race on cotinine level, adjusting for the number of cigarettes smoked within the last 24 hours, use of menthol vs. non-menthol cigarettes, exposure to environmental tobacco smoke, and age. Black smokers smoked fewer cigarettes than white smokers, yet had crude mean cotinine levels nearly as high or higher than white smokers. After multivariate adjustment, cotinine levels were an average of 50 ng/ml higher among black than white women (p=0.008) and non-significantly 12 ng/ml higher among black than white men (p=0.52). We observed no increase in cotinine levels associated with menthol cigarette use. We conclude that differences in cotinine levels among smokers suggest racial variation in exposure to and/or metabolism of tobacco smoke constituents, but our findings do not support a role for menthol preference in this disparity.

  4. Absorption spectra of AA-stacked graphite

    International Nuclear Information System (INIS)

    Chiu, C W; Lee, S H; Chen, S C; Lin, M F; Shyu, F L

    2010-01-01

    AA-stacked graphite shows strong anisotropy in geometric structures and velocity matrix elements. However, the absorption spectra are isotropic for the polarization vector on the graphene plane. The spectra exhibit one prominent plateau at middle energy and one shoulder structure at lower energy. These structures directly reflect the unique geometric and band structures and provide sufficient information for experimental fitting of the intralayer and interlayer atomic interactions. On the other hand, monolayer graphene shows a sharp absorption peak but no shoulder structure; AA-stacked bilayer graphene has two absorption peaks at middle energy and abruptly vanishes at lower energy. Furthermore, the isotropic features are expected to exist in other graphene-related systems. The calculated results and the predicted atomic interactions could be verified by optical measurements.

  5. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  6. AA, assembly of wide bending magnet

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  7. AA, inner conductor of a magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  8. The Self-Reported Oral Health Status and Dental Attendance of Smokers and Non-Smokers in England

    Science.gov (United States)

    Csikar, Julia; Kang, Jing; Wyborn, Ceri; Dyer, Tom A.; Marshman, Zoe; Godson, Jenny

    2016-01-01

    Smoking has been identified as the second greatest risk factor for global death and disability and has impacts on the oral cavity from aesthetic changes to fatal diseases such as oral cancer. The paper presents a secondary analysis of the National Adult Dental Health Survey (2009). The analysis used descriptive statistics, bivariate analyses and logistic regression models to report the self-reported oral health status and dental attendance of smokers and non-smokers in England. Of the 9,657 participants, 21% reported they were currently smoking. When compared with smokers; non-smokers were more likely to report ‘good oral health’ (75% versus 57% respectively, pattend the dentist symptomatically (OR = 2.27, CI = 2.02–2.55) compared with non-smoker regardless the deprivation status. Smokers were more likely to attend symptomatically in the most deprived quintiles (OR = 1.99, CI = 1.57–2.52) and perceive they had poorer oral health (OR = 1.77, CI = 1.42–2.20). The present research is consistent with earlier sub-national research and should be considered when planning early diagnosis and management strategies for smoking-related conditions, considering the potential impact dental teams might have on smoking rates. PMID:26863107

  9. 40 CFR Appendix A to Subpart Aa of... - Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA

    Science.gov (United States)

    2010-07-01

    ... (40 CFR Part 63, Subpart A) to Subpart AA A Appendix A to Subpart AA of Part 63 Protection of... Hazardous Air Pollutants From Phosphoric Acid Manufacturing Plants Pt. 63, Subpt. AA, App. A Appendix A to Subpart AA of Part 63—Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA 40 CFR...

  10. Dicty_cDB: FC-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  11. Dicty_cDB: FC-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA04 (Link to dictyBase) - - - Contig-U15354-1 FC-AA04P (Li...nk to Original site) FC-AA04F 546 FC-AA04Z 484 FC-AA04P 1030 - - Show FC-AA04 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA04Q.Seq.d/ Representative seq. ID FC-AA...04P (Link to Original site) Representative DNA sequence >FC-AA04 (FC-AA04Q) /CSM/FC/FC-AA/FC-AA04Q.Seq.d/ AA...TAATACACATAAAAAATTTATTAAATAAAAATGACTACAACAACAACAAATGAAGTTT ATATAGTTGATTGTATTCGTACACCAATTGGTAGAGGATATAGTAA

  12. Dicty_cDB: FC-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  13. Female Smokers Are at Greater Risk of Airflow Obstruction Than Male Smokers. UK Biobank.

    Science.gov (United States)

    Amaral, André F S; Strachan, David P; Burney, Peter G J; Jarvis, Deborah L

    2017-05-01

    The prevalence of chronic obstructive pulmonary disease (COPD) is increasing faster among women than among men. To examine sex differences in the risk of airflow obstruction (a COPD hallmark) in relation to smoking history. We analyzed 149,075 women and 100,252 men taking part in the UK Biobank who had provided spirometry measurements and information on smoking. The association of airflow obstruction with smoking characteristics was assessed by sex using regression analysis. The shape of this relationship was examined using restricted cubic splines. The association of airflow obstruction with smoking status was stronger in women (odds ratio for ex-smokers [OR ex ], 1.44; OR current , 3.45) than in men (OR ex , 1.25; OR current , 3.06) (P for interaction = 5.6 × 10 -4 ). In both sexes, the association of airflow obstruction with cigarettes per day, smoking duration, and pack-years did not follow a linear pattern, with the increase in risk at lower doses being steeper among women. For equal doses of exposure, sex differences were present in both ex-smokers and current smokers for cigarettes per day (P for interaction ex  = 6.0 × 10 -8 ; P for interaction current  = 1.1 × 10 -5 ), smoking duration (P for interaction ex  = 7.9 × 10 -4 ; P for interaction current  = 0.004), and pack-years (P for interaction ex  = 6.6 × 10 -18 ; P for interaction current  = 1.3 × 10 -6 ). Overall, those who started smoking before age 18 years were more likely to have airflow obstruction, but a sex difference in this association was not clear. For equal time since quitting, the reduction in risk among women seemed less marked than among men. Exposed to the same dose of smoking, women showed a higher risk of airflow obstruction than men. This could partly explain the increasingly smaller sex difference in the prevalence of COPD, especially in countries where smoking patterns have become similar between women and men.

  14. Role of N-Arachidonoyl-Serotonin (AA-5-HT) in Sleep-Wake Cycle Architecture, Sleep Homeostasis, and Neurotransmitters Regulation.

    Science.gov (United States)

    Murillo-Rodríguez, Eric; Di Marzo, Vincenzo; Machado, Sergio; Rocha, Nuno B; Veras, André B; Neto, Geraldo A M; Budde, Henning; Arias-Carrión, Oscar; Arankowsky-Sandoval, Gloria

    2017-01-01

    The endocannabinoid system comprises several molecular entities such as endogenous ligands [anandamide (AEA) and 2-arachidonoylglycerol (2-AG)], receptors (CB 1 and CB 2 ), enzymes such as [fatty acid amide hydrolase (FAHH) and monoacylglycerol lipase (MAGL)], as well as the anandamide membrane transporter. Although the role of this complex neurobiological system in the sleep-wake cycle modulation has been studied, the contribution of the blocker of FAAH/transient receptor potential cation channel subfamily V member 1 (TRPV1), N -arachidonoyl-serotonin (AA-5-HT) in sleep has not been investigated. Thus, in the present study, varying doses of AA-5-HT (5, 10, or 20 mg/Kg, i.p.) injected at the beginning of the lights-on period of rats, caused no statistical changes in sleep patterns. However, similar pharmacological treatment given to animals at the beginning of the dark period decreased wakefulness (W) and increased slow wave sleep (SWS) as well as rapid eye movement sleep (REMS). Power spectra analysis of states of vigilance showed that injection of AA-5-HT during the lights-off period diminished alpha spectrum across alertness in a dose-dependent fashion. In opposition, delta power spectra was enhanced as well as theta spectrum, during SWS and REMS, respectively. Moreover, the highest dose of AA-5-HT decreased wake-related contents of neurotransmitters such as dopamine (DA), norepinephrine (NE), epinephrine (EP), serotonin (5-HT) whereas the levels of adenosine (AD) were enhanced. In addition, the sleep-inducing properties of AA-5-HT were confirmed since this compound blocked the increase in W caused by stimulants such as cannabidiol (CBD) or modafinil (MOD) during the lights-on period. Additionally, administration of AA-5-HT also prevented the enhancement in contents of DA, NE, EP, 5-HT and AD after CBD of MOD injection. Lastly, the role of AA-5-HT in sleep homeostasis was tested in animals that received either CBD or MOD after total sleep deprivation (TSD). The

  15. Role of N-Arachidonoyl-Serotonin (AA-5-HT in Sleep-Wake Cycle Architecture, Sleep Homeostasis, and Neurotransmitters Regulation

    Directory of Open Access Journals (Sweden)

    Eric Murillo-Rodríguez

    2017-05-01

    Full Text Available The endocannabinoid system comprises several molecular entities such as endogenous ligands [anandamide (AEA and 2-arachidonoylglycerol (2-AG], receptors (CB1 and CB2, enzymes such as [fatty acid amide hydrolase (FAHH and monoacylglycerol lipase (MAGL], as well as the anandamide membrane transporter. Although the role of this complex neurobiological system in the sleep–wake cycle modulation has been studied, the contribution of the blocker of FAAH/transient receptor potential cation channel subfamily V member 1 (TRPV1, N-arachidonoyl-serotonin (AA-5-HT in sleep has not been investigated. Thus, in the present study, varying doses of AA-5-HT (5, 10, or 20 mg/Kg, i.p. injected at the beginning of the lights-on period of rats, caused no statistical changes in sleep patterns. However, similar pharmacological treatment given to animals at the beginning of the dark period decreased wakefulness (W and increased slow wave sleep (SWS as well as rapid eye movement sleep (REMS. Power spectra analysis of states of vigilance showed that injection of AA-5-HT during the lights-off period diminished alpha spectrum across alertness in a dose-dependent fashion. In opposition, delta power spectra was enhanced as well as theta spectrum, during SWS and REMS, respectively. Moreover, the highest dose of AA-5-HT decreased wake-related contents of neurotransmitters such as dopamine (DA, norepinephrine (NE, epinephrine (EP, serotonin (5-HT whereas the levels of adenosine (AD were enhanced. In addition, the sleep-inducing properties of AA-5-HT were confirmed since this compound blocked the increase in W caused by stimulants such as cannabidiol (CBD or modafinil (MOD during the lights-on period. Additionally, administration of AA-5-HT also prevented the enhancement in contents of DA, NE, EP, 5-HT and AD after CBD of MOD injection. Lastly, the role of AA-5-HT in sleep homeostasis was tested in animals that received either CBD or MOD after total sleep deprivation (TSD. The

  16. _. AA~ AA, _ _

    Indian Academy of Sciences (India)

    It is probably very difficult to find a person who has not been charmed by the exquisite beauty of soap bubbles. Invariably, our appre- ciation of soap bubbles ends with an admira- tion of their shapes and colours. We do not realise that there is a profound science behind their beauty. The best book to start learning.

  17. INFLUENCE OF ACUTE EXERCISE ON OXIDATIVE STRESS IN CHRONIC SMOKERS

    Directory of Open Access Journals (Sweden)

    Zehra Serdar

    2003-09-01

    Full Text Available The relative oxidative insult caused by exercise and smoking on biological systems are well documented, however, their cumulative influence needs to be clarified. In order to examine the collective effects of exercise and smoking on oxidant and antioxidant parameters, young male smokers (n=10 and non-smokers (n=10 made to perform a negative slope (10% cycling exercise for 30 minutes at individual load equivalent to 60% maximal oxygen consumption (VO2max. Pre- and post-exercise (post-ex haematocrit, haemoglobin, white blood cells, plasma malondialdehyde (MDA levels, protein carbonyl formation and non-HDL oxidation, erythrocyte superoxide dismutase (SOD and glutathione peroxidase (GPX activities, serum ceruloplasmin (CER and urinary cotinine concentrations were evaluated. Pre-ex CER and urinary cotinine concentrations of smokers were significantly higher (p<0.05 and p<0.01, respectively compared to that of non-smokers and pre-ex CER concentrations were significantly correlated with cotinine levels in all subjects (p<0.05. Significant (p<0.01 increases were observed in non-HDL oxidation following the exercise in both groups and the elevations were more pronounced in smokers. Pre-ex SOD and GPX activities were not different between the two groups, however post-ex enzyme activities were significantly reduced in smokers (p<0.05. MDA and protein carbonyl concentrations were not different between the two groups and there were not any significant changes due to exercise.In conclusion, according to the results of the present study, we suggest that erythrocyte antioxidants SOD and GPX and plasma non-HDL are more prone to the possible oxidant damage of acute physical exercise in chronic smokers.

  18. It's complicated: Examining smokers' relationships with their cigarette brands.

    Science.gov (United States)

    Johnson, Sarah E; Coleman, Blair N; Schmitt, Carol L

    2016-12-01

    Despite increased restrictions and taxes, decreased social acceptability, and widespread awareness of the harms of tobacco use, many in the U.S. continue to smoke cigarettes. Thus, understanding smokers' attitudes and motivations remains an important goal. This study adopts the consumer psychology concept of brand relationship to provide a new lens through which to examine smokers' attitudes about their cigarette use. Twelve focus groups (N = 143) were conducted with adult cigarette smokers from September to November, 2013. Using a semistructured moderator guide and "top of mind" worksheets, the discussion examined participants' attitudes toward (a) their own cigarette brand and (b) tobacco companies in general. Data were coded and analyzed following principles of thematic analysis. Adult smokers reported positive attitudes toward their cigarette brand, as their brand was strongly associated with the positive experience of smoking (e.g., satisfying craving and relief from withdrawal). In contrast, thinking about tobacco companies in general evoked negative reactions, revealing overwhelmingly negative attitudes toward the industry. Findings reveal a complicated relationship between smokers and their cigarette brand: simultaneously embracing their cigarettes and rejecting the industry that makes them. Taken together, these data suggest smokers maintain largely positive brand relationships, diverting negative feelings about smoking toward the tobacco industry. Finally, they highlight the synergy between branding and the subjective smoking experience, whereby positive brand attitudes are reinforced through withdrawal relief. Ultimately, this information could inform a more complete understanding of how smokers interpret and respond to tobacco communications, including marketing from their brand. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  19. Radon-induced lung cancer in smokers and non-smokers: risk implications using a two-mutation carcinogenesis model

    International Nuclear Information System (INIS)

    Leenhouts, H.P.

    1999-01-01

    Three sets of data (population statistics in non-smokers, data from an investigation of the smoking habits of British doctors and a study of Colorado uranium miners) were used to analyse lung cancer in humans as a function of exposure to radon and smoking. One of the aims was to derive implications for radon risk estimates. The data were analysed using a two-mutation radiation carcinogenesis model and a stepwise determination of the model parameters. The basic model parameters for lung cancer were derived from the age dependence fit of the spontaneous lung cancer incidence in non-smokers. The effect of smoking was described by two additional parameters and, subsequently, the effect of radon by three other parameters; these five parameters define the dependence of the two mutation steps on smoking and exposure to radon. Using this approach, a consistent fit and comprehensive description of the three sets of data have been achieved, and the parameters could, at least partly, be related to cellular radiobiological data. The model results explain the different effect of radon on non-smokers and smokers as seen in epidemiological data. Although the analysis was only applied to a limited number of populations, lung cancer incidence as a result of radon exposure is estimated to be about ten times higher for people exposed at the age of about 15 than at about 50, although this effect is masked (especially for smokers) by the high lung cancer incidence from smoking. Using the model to calculate the lung cancer risks from lifetime exposure to radon, as is the case for indoor radon, higher risks were estimated than previously derived from epidemiological studies of the miners' data. The excess absolute risk per unit exposure of radon is about 1.7 times higher for smokers of 30 cigarettes per day than for non-smokers, even though, as a result of the low spontaneous tumour incidence in the non-smokers, the excess relative risk per unit exposure for the smokers is about 20 times

  20. Differentiation of chronic and aggressive forms of periodontitis and of smokers and non-smokers by Fourier-transform infrared spectroscopy

    Directory of Open Access Journals (Sweden)

    Nihal Simsek Ozek

    2016-03-01

    Full Text Available Aim: To determine if Fourier-transform infrared spectroscopy (FTIR could distinguish chronic periodontitis (CP and aggressive periodontitis (AgP patients by cross-sectional salivary spectral analyses and to assess the potential confounding influence of smoking on discriminating spectral signatures. Methods: FTIR analysis of saliva collected from patients with CP (n = 18, 7 smokers, AgP (n = 23, 9 smokers was performed. Smoking status was confirmed by salivary cotinine analysis. Spectral band area analysis, hierarchical cluster analysis was performed. Results: Spectral analyses indicated significantly lower lipid, phospholipid, protein, amino acid, lactic acid, nucleic acid contents in smoker than non-smoker AgP group. Amino acid, phospholipid, lactic acid contents were significantly lower in smoker than non-smoker CP group. Thiocyanate levels successfully differentiated smokers from non-smokers, irrespective of periodontal status. Cluster analysis to discriminate smokers from non-smokers and CP from AgP was highly promising. Conclusions: FTIR can be employed to discriminate smokers from non-smokers and CP from AgP.

  1. E-cigarette use among smokers with serious mental illness.

    Directory of Open Access Journals (Sweden)

    Judith J Prochaska

    Full Text Available We examined electronic cigarette (EC use, correlates of use, and associated changes in smoking behavior among smokers with serious mental illness in a clinical trial.Adult smokers were recruited during acute psychiatric hospitalization (N = 956, 73% enrollment among approached smokers in the San Francisco Bay Area between 2009-2013. At baseline, participants averaged 17 (SD = 10 cigarettes per day for 19 (SD = 14 years; 24% intended to quit smoking in the next month. Analyses examined frequency and correlates of EC use reported over the 18-month trial and changes in smoking behavior by EC use status.EC use was 11% overall, and by year of enrollment, increased from 0% in 2009 to 25% in 2013. In multiple logistic regression, the likelihood of EC use was significantly greater with each additional year of recruitment, for those aged 18-26, and for those in the preparation versus precontemplation stage of change, and unlikely among Hispanic participants. EC use was unrelated to gender, psychiatric diagnosis, and measures of tobacco dependence at baseline. Further, over the 18-month trial, EC use was not associated with changes in smoking status or, among continued smokers, with reductions in cigarettes per day.Within a clinical trial with smokers with serious mental illness, EC use increased over time, particularly among younger adults and those intending to quit tobacco. EC use was unrelated to changes in smoking. The findings are of clinical interest and warrant further study.

  2. Race, gender, and nicotine metabolism in adolescent smokers.

    Science.gov (United States)

    Rubinstein, Mark L; Shiffman, Saul; Rait, Michelle A; Benowitz, Neal L

    2013-07-01

    Differences in the rate of nicotine metabolism between genders and different races have been hypothesized to contribute to disparities in smoking rate, susceptibility to addiction, and ability to quit smoking. The purpose of this study was to determine the effect of race and gender on the rate of nicotine metabolism as indicated by the nicotine metabolite ratio (NMR) in adolescent smokers. One hundred and fifty-nine adolescent smokers aged 13-17 were given 2mg of deuterium-labeled cotinine (cotinine-d4). The NMR was calculated as the ratio of concentrations of deuterium-labeled 3'-hydroxycotinine (ng/ml) to cotinine-d4 (ng/ml) in saliva and is a validated biomarker of the rate of nicotine metabolism. The sample was 67.3% female and racially mixed. On average, Whites had the fastest rates of metabolism compared with both Blacks/African Americans (p smokers, racial variations in rates of nicotine metabolism were similar to those that have been reported in adult smokers. In contrast to findings in adult smokers, the NMR did not vary significantly by gender or self-reported hormone use.

  3. Temporomandibular disorders among smokers and nonsmokers: a longitudinal cohort study.

    Science.gov (United States)

    Wänman, Anders

    2005-01-01

    To evaluate whether smoking influences the presence and/or development of signs and symptoms of temporomandibular disorders (TMD) among adults. A random sample of subjects 35, 50, and 65 years of age was drawn from the general population and examined with the aid of a questionnaire and a clinical examination. Within the sample, smokers were identified based on reported current smoking and nonsmokers were matched to the smokers based on age, gender, educational level, area of residence, and number of teeth. In total, 268 subjects were matched (134 pairs). Six years after the baseline examination, 122 matched pairs were re-examined. Mild symptoms of TMD were reported by approximately 30% of the sample both at baseline and at the follow-up examination 6 years later. Pain in the jaws and/or more severe symptoms of TMD were reported by approximately 15% on both occasions. No significant differences between smokers and nonsmokers were found regarding symptoms of TMD. In both examinations, mild signs (dysfunction index I) were found in approximately 40% of the sample and moderate to severe signs (dysfunction index II to III) in approximately 20%; no statistically significant differences were found between smokers and nonsmokers. No significant differences were found between smokers and nonsmokers regarding the course of symptoms or signs of TMD during the study period. Smoking is not a factor related to the presence or development of signs and symptoms of TMD.

  4. Bronchial diverticula in smokers on thin-section CT

    Energy Technology Data Exchange (ETDEWEB)

    Sverzellati, Nicola; Ingegnoli, Anna [University of Parma, Department of Clinical Sciences, Division of Radiology, Parma (Italy); Calabro, Elisa; Pastorino, Ugo [National Cancer Institute, Division of Thoracic Surgery, Milan (Italy); Randi, Giorgia; La Vecchia, Carlo [Mario Negri Institute, Department of Epidemiology, Milan (Italy); University of Milano, Institute of Medical Statistics and Biometry ' ' G. A. Maccacaro' ' , Milan (Italy); Marchiano, Alfonso [National Cancer Institute, Division of Radiology, Milan (Italy); Kuhnigk, Jan-Martin [Fraunhofer MEVIS - Institute for Medical Image Computing, Bremen (Germany); Hansell, David M. [Royal Brompton Hospital, Department of Radiology, London (United Kingdom); Zompatori, Maurizio [S. Orsola-Malpighi Hospital, Department of Radiology, Bologna (Italy)

    2010-01-15

    The objective was to determine the prevalence of bronchial diverticula in smokers on thin-section CT and the relationship to clinical and other morphological features on CT. Thin-section CT images of 503 cigarette smokers were assessed for the profusion and location of diverticula in the major airways. The extent of the bronchial diverticula was recorded as follows: grade 0, none; grade 1, one to three diverticula; grade 2, more than three diverticula. The extent of emphysema, bronchial wall thickness, clinical features, and pulmonary function were compared in the sub-groups stratified according to the extent of bronchial diverticula. A total of 229/503 (45.5%) smokers had bronchial diverticula, with 168/503 (33.3%) and 61/503 (12.2%) having grade 1 and 2 bronchial diverticula respectively. Subjects with grade 2 bronchial diverticula were heavier smokers, reported a history of coughing more frequently, and showed more severe functional impairment, greater extent of emphysema and more severe bronchial wall thickening compared with subjects with grade 1 and those individuals without bronchial diverticula (P<0.05). Multivariate regression analysis revealed that only bronchial wall thickness predicted the extent of the bronchial diverticula (P<0.0001). Bronchial diverticula are a frequent finding in the major airways of smokers, and they are associated with other markers of smoking-related damage. (orig.)

  5. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  6. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  7. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  8. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  9. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  10. Dicty_cDB: FC-AA11 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  11. Dicty_cDB: FC-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  12. Dicty_cDB: FC-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  13. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  14. A Multi-ringed, Modestly Inclined Protoplanetary Disk around AA Tau

    International Nuclear Information System (INIS)

    Loomis, Ryan A.; Öberg, Karin I.; Andrews, Sean M.; MacGregor, Meredith A.

    2017-01-01

    AA Tau is the archetype for a class of stars with a peculiar periodic photometric variability thought to be related to a warped inner disk structure with a nearly edge-on viewing geometry. We present high resolution (∼0.″2) ALMA observations of the 0.87 and 1.3 mm dust continuum emission from the disk around AA Tau. These data reveal an evenly spaced three-ringed emission structure, with distinct peaks at 0.″34, 0.″66, and 0.″99, all viewed at a modest inclination of 59.°1 ± 0.°3 (decidedly not edge-on). In addition to this ringed substructure, we find non-axisymmetric features, including a “bridge” of emission that connects opposite sides of the innermost ring. We speculate on the nature of this “bridge” in light of accompanying observations of HCO + and 13 CO ( J = 3–2) line emission. The HCO + emission is bright interior to the innermost dust ring, with a projected velocity field that appears rotated with respect to the resolved disk geometry, indicating the presence of a warp or inward radial flow. We suggest that the continuum bridge and HCO + line kinematics could originate from gap-crossing accretion streams, which may be responsible for the long-duration dimming of optical light from AA Tau.

  15. Lung cancer in never smokers: disease characteristics and risk factors.

    Science.gov (United States)

    Pallis, Athanasios G; Syrigos, Konstantinos N

    2013-12-01

    It is estimated that approximately 25% of all lung cancer cases are observed in never-smokers and its incidence is expected to increase due to smoking prevention programs. Risk factors for the development of lung cancer described include second-hand smoking, radon exposure, occupational exposure to carcinogens and to cooking oil fumes and indoor coal burning. Other factors reported are infections (HPV and Mycobacterium tuberculosis), hormonal and diatery factors and diabetes mellitus. Having an affected relative also increases the risk for lung cancer while recent studies have identified several single nucleotide polymorphisms associated with increased risk for lung cancer development in never smokers. Distinct clinical, pathology and molecular characteristics are observed in lung cancer in never smokers; more frequently is observed in females and adenocarcinoma is the predominant histology while it has a different pattern of molecular alterations. The purpose of this review is to summarize our current knowledge of this disease. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  16. Spirometry screening for airway obstruction in asymptomatic smokers.

    Science.gov (United States)

    Wisnivesky, Juan; Skloot, Gwen; Rundle, Andrew; Revenson, Tracey A; Neugut, Alfred

    2014-07-01

    Screening spirometry might help identify patients with chronic obstructive pulmonary disease (COPD) at an earlier stage. In this study, we evaluated the prevalence of airway obstruction in a cohort of asymptomatic smokers who underwent spirometry as part of a routine health maintenance examination. The study cohort consisted of a consecutive sample of 386 asymptomatic smokers (≥5 pack-years) without a history of COPD or asthma, who completed spirometry testing as part of a routine health maintenance examination. Overall, 9 study subjects (2.3%, 95% confidence interval: 1.1-4.4%) had evidence of airway obstruction on spirometry. Univariate and multiple regression analyses showed that the risk of airway obstruction was not significantly associated with age, sex, race, smoking history or past history of respiratory symptoms. Spirometry screening of asymptomatic smokers may help detect a small number of patients with airway obstruction who are at high risk for COPD.

  17. Mechanisms linking socioeconomic disadvantage and BMI in smokers.

    Science.gov (United States)

    Kendzor, Darla E; Businelle, Michael S; Cofta-Woerpel, Ludmila M; Reitzel, Lorraine R; Castro, Yessenia; Vidrine, Jennifer I; Mazas, Carlos A; Cinciripini, Paul M; Wetter, David W

    2013-09-01

    To evaluate a conceptual model of the psychosocial pathways linking socioeconomic status and body mass index (BMI) among smokers. A latent variable modeling approach was used to evaluate the interrelationships among socioeconomic status, perceived neighborhood disadvantage, social support, negative affect, and BMI among smokers recruited from the Houston metropolitan area (N = 424). A total of 42.4% of participants were obese, with the highest prevalence of obesity among Latinos followed by African Americans. Across all racial/ethnic groups, perceived neighborhood disadvantage, social support, and negative affect functioned as pathways linking socioeconomic status and BMI. Findings indicate the need for interventions that target obesity among socioeconomically disadvantaged smokers and provide potential intervention targets for the prevention and treatment of obesity.

  18. Direct Observations of Parenting and Real-time Negative Affect among Adolescent Smokers and Non-Smokers

    Science.gov (United States)

    Richmond, Melanie J.; Mermelstein, Robin J.; Wakschlag, Lauren S.

    2012-01-01

    Objective This longitudinal study examined how observations of parental general communication style and control with their adolescents predicted changes in negative affect over time for adolescent smokers and non-smokers. Method Participants were 9th and 10th grade adolescents (N = 111; 56.8% female) who had all experimented with cigarettes and were thus at risk for continued smoking and escalation; 36% of these adolescents (n = 40) had smoked in the past month at baseline and were considered smokers in the present analyses. Adolescents participated separately with mothers and fathers in observed parent-adolescent problem-solving discussions to assess parenting at baseline. Adolescent negative affect was assessed at baseline, 6- and 24-months via ecological momentary assessment. Results Among both smoking and non-smoking adolescents, escalating negative affect significantly increased risk for future smoking. Higher quality maternal and paternal communication predicted a decline in negative affect over 1.5 years for adolescent smokers but was not related to negative affect for non-smokers. Controlling maternal, but not paternal, parenting predicted escalation in negative affect for all adolescents. Conclusions Findings suggest that reducing negative affect among experimenting youth can reduce risk for smoking escalation. Therefore, family-based prevention efforts for adolescent smoking escalation might consider parental general communication style and control as intervention targets. However, adolescent smoking status and parent gender may moderate these effects. PMID:23153193

  19. A preliminary experimental investigation of peer influence on risk-taking among adolescent smokers and non-smokers.

    Science.gov (United States)

    Cavalca, Eleonora; Kong, Grace; Liss, Thomas; Reynolds, Elizabeth K; Schepis, Ty S; Lejuez, C W; Krishnan-Sarin, Suchitra

    2013-04-01

    Epidemiological evidence suggests that peer influence plays a significant role in a variety of adolescent risk-taking behaviors, including tobacco use. We attempted to establish this relationship in a controlled laboratory setting. We modified the Balloon Analog Risk Task (BART) task to include a peer component to investigate whether peer influences alter risk-taking behaviors. Thirty-nine adolescents (22 smokers, 17 non-smokers) completed one experimental session during which the standard and peer BART were presented in counterbalanced order, with the dependent measures being adjusted mean number of pumps and explosions. We also examined the relationship of changes in the BART (standard-peer) to personality measures of impulsivity (BIS-11) and resistance to peer influence (RPI). A significant interaction of BART type and smoking status was present (p=.05); specifically smokers had a greater increase in the number of explosions by 2.27 (SD=3.12) compared to an increase of .29 (SD=2.87) by non-smokers. BIS-11 scores were related to peer-influenced BART changes: those who were more impulsive experienced greater changes in risk-taking, but no similar relationships were observed for the RPI. These results suggest that peer influences enhance risk-taking among adolescents, and that smokers may be more susceptible to these influences. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  20. AA, Inner Conductor of Magnetic Horn

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  1. Predicting the risk of chronic bronchitis in teenage smokers

    Directory of Open Access Journals (Sweden)

    S.I. Ilchenko

    2017-05-01

    Full Text Available Background. The purpose of the study was to create a prognostic model of the risk of chronic respiratory pathology in teenage smokers comfortable to use in practical medicine. Materials and methods. 73 teenage smokers aged 14–18 years (average age is 16.4 ± 0.2 years have been exa­mined. They were divided into two groups: group 1 consisted of 36 teenage smo­kers with chronic bronchitis (average age is 16.8 ± 0.2 years and comparison group comprised 37 apparently healthy teenage smokers (average age is 15.9 ± 0.2 years. We have studied clinical-anamnestic, functiona­­linstrumental data (spirometry, radiography of chest organs, level of nitric oxide in expired breath condensate, respiratory muscles strength and molecular-genetic factors of the risk of developing chronic pathology of respiratory organs in teenage smokers — 103 characteristics overall. The method of consequent (sequential analysis of Wald and Bayes strategy were used to create a prognostic model of the risk of chronic bronchitis. Results. The principle of working with a mathematical model for predicting the risk of chronic respiratory pathology development in teenage smokers is to sum up diagnostic factors that are consistent with the signs found in the patient. When the sum of diagnostic components is +13, the deve­lopment of chronic bronchitis is diagnosed in teenage smo­kers with error probability ≤ 5 % (р < 0.05; when the sum is +20 — the probability of diagnosis is 99 % (р < 0.01. Conclusions. Our algorithm for predicting the risk of develo­ping chronic bronchitis in teenage smokers will help early detection of high-risk patients in the formation of this pathology for personalized preventive measures that will allow practitioners to prevent chronic pathological processes and to improve the quality of life.

  2. Characteristics of smokers accessing the Puerto Rico Quitline.

    Science.gov (United States)

    Ortiz, Ana Patricia; Díaz-Toro, Elba C; Calo, William A; Correa-Fernández, Virmarie; Cases, Antonio; Santos-Ortiz, María C; Mazas, Carlos; Mejía, Luz; Wetter, David W

    2008-09-01

    In 2004, the Puerto Rico Department of Health implemented the Puerto Rico Quitline (PRQ), a proactive, telephone-based smoking cessation counseling program. This study examines the demographic and smoking-related characteristics of the individuals served by the PRQ. Analyses included PRQ participants registered from December 2004-December 2005. PRQ call rates and rate ratios (RR) were calculated overall, among smokers, and stratified by relevant covariates. Associations between sex and relevant characteristics of PRQ participants were compared using regression models. Call rates per 100,000 smokers in PR were lower among men than women (RR = 0.50, 95% CI = 0.44-0.56), and higher among all age groups > or = 25 years of age as compared to those aged 15-24 years (RRs = 4.34-8.14) and among smokers living in the San Juan metropolitan area relative to smokers residing outside the metropolitan area (RR = 1.45, 95% CI = 1.29-1.63). Mass media was the most common way in which participants learned about the PRQ (> 70%), with only 2-3% of callers reporting a physician's referral as the source of their information about the PRQ. With respect to reasons for quitting, men were less likely than women to report concern about a child's health (OR = 0.62, 95% CI = 0.46-0.84) and cigarette odor (OR = 0.64, 95% CI = 0.41-0.99). Meanwhile, men were more likely (OR = 1.39, 95% CI = 1.01-1.91) to report the influence of other smokers as a barrier during quitting. PRQ promotion and outreach efforts should target populations underserved by the PRQ including male, young adult, and non-metropolitan area smokers. Initiatives that link the PRQ with primary care providers in promoting smoking cessation should be encouraged.

  3. Human Mu Opioid Receptor (OPRM1A118G) polymorphism is associated with brain mu- opioid receptor binding potential in smokers

    Energy Technology Data Exchange (ETDEWEB)

    Ray, R.; Logan, J.; Ray, R.; Ruparel, K.; Newberg, A.; Wileyto, E.P.; Loughead, J.W.; Divgi, C.; Blendy, J.A.; Logan, J.; Zubieta, J.-K.; Lerman, C.

    2011-04-15

    Evidence points to the endogenous opioid system, and the mu-opioid receptor (MOR) in particular, in mediating the rewarding effects of drugs of abuse, including nicotine. A single nucleotide polymorphism (SNP) in the human MOR gene (OPRM1 A118G) has been shown to alter receptor protein level in preclinical models and smoking behavior in humans. To clarify the underlying mechanisms for these associations, we conducted an in vivo investigation of the effects of OPRM1 A118G genotype on MOR binding potential (BP{sub ND} or receptor availability). Twenty-two smokers prescreened for genotype (12 A/A, 10 */G) completed two [{sup 11}C] carfentanil positron emission tomography (PET) imaging sessions following overnight abstinence and exposure to a nicotine-containing cigarette and a denicotinized cigarette. Independent of session, smokers homozygous for the wild-type OPRM1 A allele exhibited significantly higher levels of MOR BP{sub ND} than smokers carrying the G allele in bilateral amygdala, left thalamus, and left anterior cingulate cortex. Among G allele carriers, the extent of subjective reward difference (denicotinized versus nicotine cigarette) was associated significantly with MOR BP{sub ND} difference in right amygdala, caudate, anterior cingulate cortex, and thalamus. Future translational investigations can elucidate the role of MORs in nicotine addiction, which may lead to development of novel therapeutics.

  4. Human Mu Opioid Receptor (OPRM1A118G) polymorphism is associated with brain mu- opioid receptor binding potential in smokers

    International Nuclear Information System (INIS)

    Ray, R.; Logan, J.; Ruparel, K.; Newberg, A.; Wileyto, E.P.; Loughead, J.W.; Divgi, C.; Blendy, J.A.; Logan, J.; Zubieta, J.-K.; Lerman, C.

    2011-01-01

    Evidence points to the endogenous opioid system, and the mu-opioid receptor (MOR) in particular, in mediating the rewarding effects of drugs of abuse, including nicotine. A single nucleotide polymorphism (SNP) in the human MOR gene (OPRM1 A118G) has been shown to alter receptor protein level in preclinical models and smoking behavior in humans. To clarify the underlying mechanisms for these associations, we conducted an in vivo investigation of the effects of OPRM1 A118G genotype on MOR binding potential (BP ND or receptor availability). Twenty-two smokers prescreened for genotype (12 A/A, 10 */G) completed two [ 11 C] carfentanil positron emission tomography (PET) imaging sessions following overnight abstinence and exposure to a nicotine-containing cigarette and a denicotinized cigarette. Independent of session, smokers homozygous for the wild-type OPRM1 A allele exhibited significantly higher levels of MOR BP ND than smokers carrying the G allele in bilateral amygdala, left thalamus, and left anterior cingulate cortex. Among G allele carriers, the extent of subjective reward difference (denicotinized versus nicotine cigarette) was associated significantly with MOR BP ND difference in right amygdala, caudate, anterior cingulate cortex, and thalamus. Future translational investigations can elucidate the role of MORs in nicotine addiction, which may lead to development of novel therapeutics.

  5. Intergranular corrosion in AA5XXX aluminum alloys with discontinuous precipitation at the grain boundaries

    Science.gov (United States)

    Bumiller, Elissa

    The US Navy currently uses AA5xxx aluminum alloys for structures exposed to a marine environment. These alloys demonstrate excellent corrosion resistance over other aluminum alloys (e.g., AA2xxx or AA7xxx) in this environment, filling a niche in the marine structures market when requiring a light-weight alternative to steel. However, these alloys are susceptible to localized corrosion; more specifically, intergranular corrosion (IGC) is of concern. IGC of AA5xxx alloys due to the precipitation of beta phase on the grain boundaries is a well-established phenomenon referred to as sensitization. At high degrees of sensitization, the IGC path is a continuous anodic path of beta phase particles. At lower degrees of sensitization, the beta phase coverage at the grain boundaries is not continuous. The traditional ranges of susceptibility to IGC as defined by ASTM B928 are in question due to recent studies. These studies showed that even at mid range degrees of sensitization where the beta phase is no longer continuous, IGC may still occur. Previous thoughts on IGC of these alloy systems were founded on the idea that once the grain boundary precipitate became discontinuous the susceptibility to IGC was greatly reduced. Additionally, IGC susceptibility has been defined metallurgically by compositional gradients at the grain boundaries. However, AA5xxx alloys show no compositional gradients at the grain boundaries, yet are still susceptible to IGC. The goal of this work is to establish criteria necessary for IGC to occur given no continuous beta phase path and no compositional gradient at the grain boundaries. IGC performance of the bulk alloy system AA5083 has been studied along with the primary phases present in the IGC system: alpha and beta phases using electrochemistry and modeling as the primary tools. Numerical modeling supports that at steady-state the fissure tip is likely saturated with Mg in excess of the 4% dissolved in the matrix. By combining these results

  6. Sex differences in emphysema and airway disease in smokers

    DEFF Research Database (Denmark)

    Camp, Pat G; Coxson, Harvey O; Levy, Robert D

    2009-01-01

    -resolution CT (HRCT) scanning in male and female smokers with and without COPD. METHODS: All subjects completed spirometry and answered an epidemiologic respiratory questionnaire. Inspiratory HRCT scans were obtained on 688 smokers enrolled in a family-based study of COPD. Emphysema was assessed by using...... by calculating the square root of the airway wall area (SQRTWA) and the percentage of the total airway area taken by the airway wall (WA%) relative to the internal perimeter. RESULTS: Women had a similar FEV(1) (women, 65.5% +/- 31.9% predicted; men, 62.1% +/- 30.4% predicted; p = 0.16) but fewer pack...

  7. The power of product innovation: Smokers' perceptions of capsule cigarettes.

    Science.gov (United States)

    Moodie, Crawford; Ford, Allison; Dobbie, Fiona; Thrasher, James F; McKell, Jennifer; Purves, Richard

    2017-08-30

    Since being brought to market in 2007, cigarettes with capsules in the filter that can be burst to change the flavour have had remarkable global success, highlighting the importance of product innovation for tobacco companies. Very few studies have explored how these products are perceived by smokers however. This paper sought to address this gap by exploring smokers' awareness of cigarettes with one or two flavour-changing capsules in the filter and the appeal of these products. Twenty focus groups were conducted in Glasgow and Edinburgh in 2015 with current smokers (N=120), segmented by age (16-17, 18-24, 25-35, 36-50, >50), gender and social grade. Awareness, use and appeal of capsule cigarettes was greater among younger adults (16-35 years), who showed most interest in these products. Those who perceived capsules positively mentioned multiple benefits: the ability to burst the capsule, convenience of being able to share cigarettes among menthol and non-menthol smokers, better taste, fresher breath, reduced smell and greater discretion. It was suggested that capsule cigarettes, particularly the double capsule cigarette (which had two differently flavoured capsules in the filter), would encourage non-smokers to experiment with smoking and discourage smokers from quitting. The findings offer some reasons behind the global growth of the capsule cigarette segment. Cigarettes with flavour-changing capsules in the filter have been one of the most successful product innovations of the last decade for tobacco companies. They have received very little academic attention however. Employing focus groups with 120 smokers aged 16 and over, we found that capsule cigarettes held most appeal to, and were considered to be targeted at, younger people, with it suggested that these products would encourage initiation and discourage cessation. This study provides some understanding of how these products are viewed by smokers. © The Author 2017. Published by Oxford University Press

  8. Experimental immunologically mediated aplastic anemia (AA) in mice: cyclosporin A fails to protect against AA

    International Nuclear Information System (INIS)

    Knospe, W.H.; Steinberg, D.; Gratwohl, A.; Speck, B.

    1984-01-01

    Immunologically mediated aplastic anemia (AA) in mice was induced by the i.v. injection of 10(7) lymph node cells (LNC) from H-2k identical but Mls mismatched CBA/J donor mice into previously irradiated (600 rad total body gamma) C3H/HeJ mice. Cyclosporin A (CsA), 25 mg/kg, was administered subcutaneously from day -1 to day 30. Control mice included C3H/HeJ mice which received 600 rad alone, C3H/HeJ mice which received 600 rad plus CsA as above, and C3H/HeJ mice which received 600 rad total body irradiation followed by 10(7) LNC from CBA/J donors. CsA failed to prevent lethal AA. These results suggest that the pathogenetic mechanisms operating in immunologically mediated AA differ from the mechanisms operating in rodents transplanted with allogeneically mismatched marrow or spleen cells which develop graft-versus-host disease. The results are consistent with a non-T cell-dependent mechanism causing the AA

  9. Test of "Light" cigarette counter-advertising using a standard test of advertising effectiveness

    OpenAIRE

    Shiffman, S.; Burton, S.; Pillitteri, J.; Gitchell, J.; Di, M; Sweeney, C.; Wardle, P.; Koehler, G.

    2001-01-01

    OBJECTIVE—To evaluate systematically the effectiveness of six advertising strategies (two message strategies presented in three different contexts) designed to promote smoking cessation by addressing smokers' misperceptions about Light cigarettes.
DESIGN—Smokers viewed one of six, 30 second test television concept advertisements, which varied by message (one emphasising how the sensory effects of Lights can be deceptive, the other describing the effects of vent blocking) and by ad context (no...

  10. Simon van der Meer in the AA Control Room

    CERN Multimedia

    CERN PhotoLab

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  11. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    DEFF Research Database (Denmark)

    Hansen, Elo Harald

    1996-01-01

    One of the advantages of the flow injection (FI) concept is that it is compatible with virtually all detection techniques. Being a versatile vehicle for enhancing the performance of the individual detection devices, the most spectacular results have possibly been obtained in conjunction with atomic...... absorption spectrometry (AAS). Initially with flame-AAS (fAAS) procedures, later for hydride generation (HG) techniques, and most recently in combination with electrothermal AAS (ETAAS). The common denominator for all these procedures is the inherently precise and strictly reproducible timing in FI from...

  12. Urinary concentrations of acrylamide (AA) and N-acetyl-S-(2-carbamoylethyl)-cysteine (AAMA) and associations with demographic factors in the South Korean population.

    Science.gov (United States)

    Lee, Jin Heon; Lee, Kee Jae; Ahn, Ryoungme; Kang, Hee Sook

    2014-09-01

    Acrylamide (AA) and N-acetyl-S-(2-carbamoylethyl)-cysteine (AAMA) are important urinary biomarkers of acrylamide exposure in human biomonitoring, because AA is classified as a probable carcinogen in humans. In this study, urinary AA and AAMA were assessed in the South Korean adult population aged 18-69, based on the Korean National Human Biomonitoring Survey conducted in 2009. Urinary metabolites in samples were analyzed with LC-MS/MS system. Relying on data from 1873 representative South Korean adults, the population-weighted geometric means of urinary AA and AAMA concentrations were 6.8 ng/ml (95% CI: 6.4-7.3), and 30.0 ng/ml (95% confidence interval (CI): 28.2-31.8), respectively. The creatinine-adjusted geometric means of AA and AAMA were 6.2 μg/g creatinine (95% CI: 5.8-6.7) and 26.4μg/g creatinine (95% CI: 24.9-28.0), respectively. When covariates for predictors of urinary metabolites were adjusted simultaneously in a log-linear multiple regressions, the strongest predictors of urinary AA were education (OR=1.08-1.28; 95% CI: 1.11-1.48; p=0.0024) and age (OR=0.66-0.84; 95% CI: 0.54-0.97; p=0.0003), and those of urinary AAMA were smoking status (OR=1.16-2.63; 95% CI: 0.98-3.08; p=0.001) and education (OR=1.12-1.19; 95% CI: 1.02-1.38; p=0.0425). The ratio of current/never smokers for urinary AA was 1.3, whereas the same ratio for urinary AAMA was 3.0. These findings suggested that most South Koreans had detectable levels of AA and AAMA (98.7% and 99.4%, respectively) in their urine and that the body burden of AA and AAMA varied according to demographic, geographic, and lifestyle (smoking) factors. Copyright © 2014 Elsevier GmbH. All rights reserved.

  13. Moessbauer spectrometer MsAa-3

    International Nuclear Information System (INIS)

    Gornicki, R.; Blachowski, A.; Ruebenbauer, K.

    2007-01-01

    The paper is aimed at the description of the newly developed Moessbauer spectrometer MsAa-3. The spectrometer MsAa-3 consists of a high quality γ--ray spectrometer including either a proportional gas detector head or a scintillation detector head, a transducer driving system including the transducer, data storage system, and data communication system based on the TCP/IP protocol. Additionally, the Michelson-Morley interferometer is provided for precise calibration of the transducer velocity. The spectrometer is equipped with an integrated simple temperature controller. All the essential functions are remotely controlled over the TCP/IP link allowing for the spectrometer set-up as the stand-alone unit in the computer network, e.g. on the Internet. External γ-ray detectors or external complete nuclear blocks could be used as well. The spectrometer is equipped with software allowing for setting all the functions, to perform on-line control, and retrieve data. The Moessbauer data processing software MOSGRAF is enclosed as well. The latter software allows for the calculation of the variety of velocity reference functions. (authors)

  14. Why Don’t More Smokers Switch to Using E-Cigarettes: The Views of Confirmed Smokers

    Science.gov (United States)

    McKeganey, Neil; Dickson, Tiffany

    2017-01-01

    Whilst e-cigarettes have been characterised by Public Health England as being around 95% less harmful than combustible tobacco products, only a minority of current smokers (around 16% within the UK) are using these devices. In this paper we report the results of an online survey of 650 smokers in contact with a smokers’ rights group in the UK. A total of 91% of the smokers surveyed were smoking on a daily basis. Fifty nine percent reported having used electronic nicotine delivery systems, the majority of whom reported having used e-cigarettes. Those smokers that had not used these devices principally explained this in terms of the pleasure they derived from smoking. The features smokers’ liked most about e-cigarette had to do with the range of settings in which they could be used, the lack of an offensive smell associated with their use, the available flavours and the reduced level of harm. The elements which smokers liked least about e-cigarettes had to do with the vaping experience, the technology, the chemical nature of e-liquids and the complex technology that was associated with these devices. If a greater number of smokers are to be encouraged to take up e-cigarettes, it will be necessary not only to convey accurate information on the relative harm of these devices (compared to combustible tobacco products), but to ensure that they are able to be used in a wider range of settings than those within which smoking can currently occur and that the vaping experience more closely resembles the smoking experience. PMID:28621763

  15. Support for smoke-free policies among smokers and non-smokers in six cities in China: ITC China Survey.

    Science.gov (United States)

    Li, Q; Hyland, A; O'Connor, R; Zhao, G; Du, L; Li, X; Fong, G T

    2010-10-01

    To examine levels of support for comprehensive smoke-free policies in six large Chinese cities. Data from Wave 1 of the International Tobacco Control (ITC) China Survey (April-August 2006) were analysed. The ITC China Survey employed a multistage sampling design in Beijing, Shenyang, Shanghai, Changsha, Guangzhou and Yinchuan (none of which has comprehensive smoke-free policies in place). Face-to-face interviews were conducted with 4815 smokers and 1270 non-smokers. Multivariate logistic regression models were used to identify factors associated with support for comprehensive smoke-free policies. About one in two Chinese urban smokers and four in five non-smokers believed that secondhand smoke (SHS) causes lung cancer. The majority of respondents supported comprehensive smoke-free policies in hospitals, schools and public transport vehicles while support for smoke-free workplaces, restaurants and bars was lower. Levels of support were generally comparable between smokers and non-smokers. Support for comprehensive smoke-free policies was positively associated with knowledge about the harm of SHS. Respondents who worked in a smoke-free worksite or who frequented smoke-free indoor entertainment places were more likely to support comprehensive smoking restriction in bars and restaurants. Considerable support for smoke-free policies exists in these six large cities in China. Greater public education about the dangers of SHS may further increase support. Experiencing the benefits of smoke-free indoor entertainment places and/or workplaces increases support for these policies and suggests that some initial smoke-free policy implementation may hasten the diffusion of these public health policies.

  16. "Comparison of AgNORs count in exfoliative cytology of normal oral mucosa in smokers and non- smokers"

    Directory of Open Access Journals (Sweden)

    Shahrabi Sh.

    2005-07-01

    Full Text Available Background and Aim: A strong causal relationship exists between cigarette smoking and development of oral squamous cell carcinoma, so oral screening using exfoliative cytology has been recommended to facilitate the early diagnosis of cellular alterations in oral mucosa and silver staining (AgNOR technique has been proven to be of value in the detection of incipient cellular alterations. The purpose of this study was to compare the argyrophilic nucleolar regions (AgNORs count of cells collected from normal mucosa of cigarette smokers with that obtained from non- smokers. Materials and Methods: In this cross-sectional study, cytologic smears of normal tongue, buccal mucosa and floor of the mouth from 19 smokers and 19 non- smokers were stained for AgNORs. The AgNORs count was established on 100 cells. The count value of groups were compared and analyzed using the Levens, Paired T, Student and Factorial tests. Using P<0.05 as the limit of significance. Results: The AgNORs were round and had a clustered distribution in both groups. The mean AgNORs count was statistically higher in cells of smokers than non- smokers (P<0.05. There was a significant difference between smears from the floor of the mouth and other anatomical sites in both groups. In this study, no correlation was found between AgNORs count and gender. Conclusion: Analysis of AgNORs suggests that there might be a correlation between the smoking habit and an increased rate of cellular proliferation in the oral mucosal cells.

  17. Knowledge about nicotine among HIV-positive smokers: Implications for tobacco regulatory science policy.

    Science.gov (United States)

    Pacek, Lauren R; Rass, Olga; Johnson, Matthew W

    2017-02-01

    The present paper describes the general knowledge of smoking and nicotine among a sample of current smokers living with HIV (n=271) who were recruited via Amazon Mechanical Turk. Descriptive statistics were used to report sociodemographic and smoking characteristics, as well as knowledge about smoking and nicotine. The sample was comprised of relatively light smokers, both in terms of cigarettes per day (M=8.1, SD=9.7) and dependence (67.5% had low dependence according to the Heaviness of Smoking Index). The majority of participants correctly identified smoking as being a potential cause of various smoking-related conditions and correctly identified constituents in cigarette smoke. However, a majority of participants also misattributed nicotine as being a potential cause of smoking-related illness. Accurate knowledge about nicotine was low. These misperceptions are of particular concern for vulnerable populations, such as persons living with HIV, who are disproportionately burdened by the prevalence of smoking and associated morbidities and mortality. These misperceptions could have unintended consequences in the wake of a potential nicotine reduction policy, such that reduced nicotine content products are perceived as safer than normal nicotine content products currently available for sale. Additionally, incorrect knowledge about nicotine has implications for the uptake and continued use of nicotine replacement therapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Effect of Intensity of Cigarette Smoking on Leukocytes among Adult Men and Women Smokers in Bangladesh

    Directory of Open Access Journals (Sweden)

    Shahena Shipa

    2017-03-01

    Full Text Available Background: Smoking is one of the preventable causes of disease in middle and low-income countries. This study was conducted in smokers and non-smokers to observe the changes in total count of leukocytes in cigarette smokers in relation to body mass index (BMI and blood pressure (BP. Methods:The study populations were from different sources including diagnostic center and general hospital, and consisted of 58 smokers and 77 non-smokers, with a broad range of age groups. The variables considered for this study were the smoking status of current smokers and non-smokers, and blood samples of the subject, anthropometric data and also blood pressure data. Results: Total leukocytes in smokers were found to be higher than the non-smokers along with the increasing of lymphocytes. Leukocytes were also found to be increased with intensity of smoking in adult men and women. The BMI of the smokers showed decreasing trend compared to non-smokers. The relation between blood pressure and smoking was not well established, as there were only little changes on systolic blood pressure (SBP of smokers found according to smoking intensity. Conclusion: Cigarette smoking has negative effects on leukocytes both in men and women smokers in terms of certain anthropometric parameters.

  19. Effects of honey supplementation on inflammatory markers among chronic smokers: a randomized controlled trial.

    Science.gov (United States)

    Ghazali, Wan Syaheedah Wan; Romli, Aminah Che; Mohamed, Mahaneem

    2017-03-28

    Honey has been demonstrated to possess anti-inflammatory property. This is a randomized, controlled, open-label trial to determine the effects of 12-week honey oral supplementation on plasma inflammatory markers such as high sensitive C-reactive protein, interleukin-6 and tumor necrosis factor-α among chronic smokers. A total of 32 non-smokers and 64 chronic smokers from Quit Smoking Clinic and Health Campus, Universiti Sains Malaysia participated in the study. Smokers were then randomized into 2 groups: smokers with honey group that received Malaysian Tualang honey (20 g/day daily for 12 weeks) and smokers without honey group. Blood was obtained from non-smokers and smokers at pre-intervention, and from smokers at post-intervention for measurement of the inflammatory markers. At pre-intervention, smokers had significantly higher high sensitive C-reactive protein than non-smokers. In smokers with honey group, tumor necrosis factor-α was significantly increased while high sensitive C-reactive protein was significantly reduced at post-intervention than at pre-intervention. This study suggests that honey supplementation has opposite effects on tumor necrosis factor-α and high sensitive C-reactive protein indicating the inconclusive effect of honey on inflammation among chronic smokers which needs further study on other inflammatory markers. The Trial has been registered in the Australian New Zealand Clinical Trials Registry: ACTRN12615001236583 . Registered 11 November 2015 (Retrospectively Registered).

  20. Comparison of barriers to cessation among Arab American smokers of cigarettes and waterpipe.

    Science.gov (United States)

    Haddad, Linda; El-Shahawy, Omar; Ghadban, Roula

    2014-09-15

    This cross-sectional study examined the differences in barriers to cessation and reasons for quitting smoking among dual smokers of cigarettes and waterpipe tobacco, exclusive cigarette smokers and exclusive waterpipe smokers. Participants were Arab American adults residing in Richmond, Virginia, who were recruited from Middle Eastern grocery stores, restaurants/lounges and faith and charity organizations. The study yielded several key findings: (1) Exclusive cigarette and waterpipe smokers had similar mean barriers to quitting and were more concerned about their health than dual smokers. (F(2, 150) = 5.594, p = 0.0045). This implies that barriers to smoking and health concerns could be a function of the individual who smokes rather than the modality of smoking itself. (2) Exclusive cigarette or waterpipe smokers and dual smokers may have different reasons for quitting, since they have different reasons for smoking. The proportion of smokers who endorsed smoking as a messy habit as the reason among exclusive cigarette smokers was 0.37, whereas the proportion among exclusive waterpipe smokers was 0.04 and among dual smokers 0.39. The difference in proportions is significant, χ2 (df = 2, N = 154) = 13.17, p = 0.0014. In summary, this study supports the need to further investigate dual cigarette and waterpipe smokers, as the study results indicate greater barriers to smoking cessation in this group. Recognition and understanding of these barriers among dual tobacco users would be important for any future tobacco intervention among waterpipe smokers.

  1. Serum Cotinine Levels and Prehypertension in Never Smokers

    Directory of Open Access Journals (Sweden)

    Omayma Alshaarawy

    2013-01-01

    Full Text Available Background. Few studies have shown that self-reported secondhand smoke exposure in never smokers is associated with high blood pressure. However, there are no studies investigating the relationship between secondhand smoke exposure, measured objectively by serum cotinine levels, and high blood pressure in never smokers. Methods. We examined never smokers (n=2027 from the National Health and Nutrition Examination Survey 2005–2008. Our exposure of interest was the secondhand smoke exposure estimated by serum cotinine level and our outcome was prehypertension (n=734, defined as a systolic blood pressure of 120–139 mmHg or diastolic blood pressure of 80–89 mmHg. Results. We found that, in never smokers, serum cotinine levels were positively associated with prehypertension. Compared to those with cotinine levels in the lowest quartile (≤0.024 ng/mL, the multivariable odds ratio (95% confidence interval of prehypertension among those with cotinine levels in the highest quartile (≥0.224 ng/mL was 1.45(1.00, 2.11; P trend =0.0451. In subsequent subgroup analyses, the positive association was found to be stronger among men, non-Whites, and non-obese subjects. Conclusion. Higher secondhand smoke exposure measured objectively by serum cotinine levels was found to be associated with prehypertension in certain subgroups of a representative sample of the US population.

  2. Smokers' hair: Does smoking cause premature hair graying?

    Science.gov (United States)

    Zayed, Ayman A; Shahait, Awni D; Ayoub, Musa N; Yousef, Al-Motassem

    2013-04-01

    To determine if there is a significant association between premature hair graying and cigarette smoking. A cross-sectional observational study was conducted in a nonclinical setting on 207 participants on August 24 until 25, 2010. Participants were classified into two groups [premature hair graying (PHG) and normal hair graying]. PHG was defined as the first appearance of gray hair before the age of 30. Data were collected using an interview questionnaire and measurements of body mass index, waist circumference, fasting blood glucose and blood pressure. Collected data were statistically analyzed using SPSS 16, Chicago, IL. Of the 207 subjects, 104 (50.2%) had first appearance of gray hair before the age of 30 (PHG group) while the other 103 (49.8%) were considered normal hair graying group. The prevalence of smokers in the "PHG" group was higher (40.2% vs. 24.7%, P = 0.031). Smokers had earlier onset of hair graying (smokers: 31 (7.4) vs. nonsmokers: 34 (8.6), P = 0.034). Using multiple logistic regression with conditional likelihood, smokers were two and half times (95% CI: 1.5-4.6) more prone to develop PHG. This study suggests that there is a significant relation (with adjusted odds ratio of two and half) between onset of gray hair before the age of 30 and cigarette smoking.

  3. Response to periodontal therapy in diabetics and smokers.

    Science.gov (United States)

    Grossi, S G; Skrepcinski, F B; DeCaro, T; Zambon, J J; Cummins, D; Genco, R J

    1996-10-01

    Diabetics and smokers are two patient groups at high risk for periodontal disease who also exhibit impaired wound healing and, therefore, constitute two different groups in whom the relationship between host-parasite interaction, outcome of periodontal therapy, and systemic factors is best represented. The results of two independent clinical trials involving treatment of periodontal disease in diabetics and smokers are presented. A new treatment regimen for the management of periodontal disease associated with diabetes mellitus is proposed. This treatment approach incorporates both antimicrobial agents and pharmacological modulation of the host response. Elimination of periodontal infection and reduction of periodontal inflammation in diabetic patients resulted in a significant short-term reduction in the concentration of glycosylated hemoglobin (HbA1c). Control of chronic infections and modulation of the host response offer a new therapeutic approach in the management of patients with both diabetes and periodontal disease. The effect of smoking on periodontal healing is also discussed. The clinical and microbiological response of smokers to non-surgical periodontal therapy is compared to non-smokers. In addition, possible mechanisms whereby diabetes mellitus and cigarette smoking increase the severity of periodontal disease are discussed.

  4. A qualitative investigation of South African cigarette smokers ...

    African Journals Online (AJOL)

    Cigarette smoking continuesto pose a global health risk, including in developing countries. Fear appeal messages have been widely employed in health communication to reduce cigarette smoking, but studies provide confl icting results on their effi cacy. The present qualitative study explores smokers' perceptions of fear ...

  5. High cadmium / zinc ratio in cigarette smokers: potential implications ...

    African Journals Online (AJOL)

    Tobacco smoke may be one of the most common sources of cadmium (Cd) in the general population, particularly in the rising population of smokers in developing countries. Although a relationship between both cigarette smoking and environmental Cd contamination with prostate cancer exist, the mechanisms are unclear.

  6. Use of spirometry in detecting airway obstruction in asymptomatic smokers

    International Nuclear Information System (INIS)

    Bangash, M.H.; Zaidi, S.B.H.; Zaidi, S.M.A.; Khan, I.

    2010-01-01

    Objectives: To detect spirometric abnormalities in asymptomatic smokers in relation to duration of smoking. Study Design: Cross sectional study. Place and Duration of Study: The study was carried out at PNS Shifa from Oct 2006 to June 2007. Subjects and Methods: Hundred individuals were included in this study who fulfilled the required criteria. Spirometry was done after briefing the patient about the procedure. Smokers were divided into two groups. Group I (5 to 9 pack years) and group II (= 10 pack years). All relevant information were recorded on Performa (Annex-A). The data was analyzed through SPSS-10, in terms of Mean +- SD (Standard Deviation) for numeric response variables and independent sample T test was applied to compare significance of proportion for numeric response variables at p < 0.05. Categorical variables were compared by applying Chi-square test at p < 0.05 level of significance. Results: Significant statistical difference was found between the mean age in the two groups with p-value of 0.011. This may be due to the longer duration of smoking history in Group II. Strong association was found between number of cigarette smoked and the pattern of airway obstruction as significant statistical difference of airway obstruction and early airflow limitation was found between the two groups of smokers at p value of 0.004. Conclusion: There is strong association between duration of smoking and development of airway obstruction even before the smoker become symptomatic. (author)

  7. Tips From Former Smokers – Brett

    Centers for Disease Control (CDC) Podcasts

    2014-07-07

    Brett had gum disease—a danger for all smokers. Brett talks about having most of teeth pulled during one long surgery.  Created: 7/7/2014 by Office on Smoking and Health, National Center for Chronic Disease Prevention and Health Promotion.   Date Released: 7/7/2014.

  8. Symptom-based questionnaire for identifying COPD in smokers

    NARCIS (Netherlands)

    Price, David B.; Tinkelman, David G.; Halbert, R. J.; Nordyke, Robert J.; Isonaka, Sharon; Nonikov, Dmitry; Juniper, Elizabeth F.; Freeman, Daryl; Hausen, Thomas; Levy, Mark L.; Ostrem, Anders; van der Molen, Thys; van Schayck, Constant P.

    2006-01-01

    Background: Symptom-based questionnaires may enhance chronic obstructive pulmonary disease (COPD) screening in primary care. Objectives: We prospectively tested questions to help identify COPD among smokers without prior history of lung disease. Methods: Subjects were recruited via random mailing to

  9. Decreased peak expiratory flow in pediatric passive smokers

    Directory of Open Access Journals (Sweden)

    Fitri Yanti

    2011-08-01

    Full Text Available Background Indonesia ranks fifth among countries with the highest aggregate levels of tobacco consumption in the world. Infants and children exposed to environmental tobacco smoke have increased rates of asthma, respiratory and ear infections, as well as reduced lung function. The effects of tobacco smoke exposure on lung function in children have been reported to be dependent on the source of smoke and the length and dose of exposure. Lung function may also be affected by a child’s gender and asthma status. Objective To compare peak expiratory flow (PEF in pediatric passive smokers to that of children not exposed to second hand smoke, and to define factors that may affect PEF in passive smokers. Methods In August 2009 we conducted a cross-sectional study at an elementary school in the Langkat district. Subjects were aged 6 to 12 years, and divided into two groups: passive smokers and those not exposed to secondhand smoke. Subjects’ PEFs were measured with a Mini-Wright peak flow meter. Measurements were performed in triplicate with the highest value recorded as the PEF. Demographic data including age, sex, weight, height, family income, parental education levels and occupations were obtained through questionnaires. Results Of the 170 participants, 100 were passive smokers and 70 were not exposed to secondhand smoke. Age distribution, weight and height were similar in both groups. We observed a significant difference in PEFs between the group of passive smokers and the group not exposed to secondhand smoke, 211.3 L/minute (SD 61.08 and 242.7 L/minute (SD 77.09, respectively (P < 0.005. The number of years of exposure to smoke (P = 0.079 and the number of cigarettes smoked daily in the household (P = 0.098 did not significantly influence PEF. Conclusion The PEF in pediatric passive smokers was significantly lower than that of children not exposed to secondhand smoke. PEF in passive smokers was not influenced by the number of years of smoke

  10. Clinical and Radiologic Disease in Smokers With Normal Spirometry.

    Science.gov (United States)

    Regan, Elizabeth A; Lynch, David A; Curran-Everett, Douglas; Curtis, Jeffrey L; Austin, John H M; Grenier, Philippe A; Kauczor, Hans-Ulrich; Bailey, William C; DeMeo, Dawn L; Casaburi, Richard H; Friedman, Paul; Van Beek, Edwin J R; Hokanson, John E; Bowler, Russell P; Beaty, Terri H; Washko, George R; Han, MeiLan K; Kim, Victor; Kim, Song Soo; Yagihashi, Kunihiro; Washington, Lacey; McEvoy, Charlene E; Tanner, Clint; Mannino, David M; Make, Barry J; Silverman, Edwin K; Crapo, James D

    2015-09-01

    Airflow obstruction on spirometry is universally used to define chronic obstructive pulmonary disease (COPD), and current or former smokers without airflow obstruction may assume that they are disease free. To identify clinical and radiologic evidence of smoking-related disease in a cohort of current and former smokers who did not meet spirometric criteria for COPD, for whom we adopted the discarded label of Global Initiative for Obstructive Lung Disease (GOLD) 0. Individuals from the Genetic Epidemiology of COPD (COPDGene) cross-sectional observational study completed spirometry, chest computed tomography (CT) scans, a 6-minute walk, and questionnaires. Participants were recruited from local communities at 21 sites across the United States. The GOLD 0 group (n = 4388) (ratio of forced expiratory volume in the first second of expiration [FEV1] to forced vital capacity >0.7 and FEV1 ≥80% predicted) from the COPDGene study was compared with a GOLD 1 group (n = 794), COPD groups (n = 3690), and a group of never smokers (n = 108). Recruitment began in January 2008 and ended in July 2011. Physical function impairments, respiratory symptoms, CT abnormalities, use of respiratory medications, and reduced respiratory-specific quality of life. One or more respiratory-related impairments were found in 54.1% (2375 of 4388) of the GOLD 0 group. The GOLD 0 group had worse quality of life (mean [SD] St George's Respiratory Questionnaire total score, 17.0 [18.0] vs 3.8 [6.8] for the never smokers; P smokers had greater emphysema and gas trapping. Advancing age was associated with smoking cessation and with more CT findings of disease. Individuals with respiratory impairments were more likely to use respiratory medications, and the use of these medications was associated with worse disease. Lung disease and impairments were common in smokers without spirometric COPD. Based on these results, we project that there are 35 million current and former smokers older

  11. Laryngeal findings and acoustic changes in hubble-bubble smokers.

    Science.gov (United States)

    Hamdan, Abdul-latif; Sibai, Abla; Oubari, Dima; Ashkar, Jihad; Fuleihan, Nabil

    2010-10-01

    The purpose of our investigation was to evaluate the laryngeal findings and acoustic changes in hubble-bubble smokers. A total of 42 subjects with history of hubble-bubble smoking were recruited for this study. A corresponding group with a history of cigarette smoking and controls were matched. All subjects underwent laryngeal video-endostroboscopic evaluation and acoustic analysis. In the hubble-bubble smoking group, 61.9% were males. The average age was 30.02 +/- 9.48 years and the average number of years of smoking was 8.09 +/- 6.45 years. Three subjects had dysphonia at the time of examination. The incidence of benign lesions of the vocal folds in the hubble-bubble group was 21.5%, with edema being the most common at 16.7% followed by cyst at 4.8%. The incidence of laryngeal findings was significantly higher in the hubble-bubble group compared to controls. In the cigarette-smoking group, the most common finding was vocal fold cyst in 14.8% followed by polyps in 7.4%, and edema, sulcus vocalis and granuloma. These findings were not significantly different from the hubble-bubble group except for the thick mucus, which was significantly higher in the latter. There were no significant changes in any of the acoustic parameters between hubble-bubble smokers and controls except for the VTI and MPT, which were significantly lower in the hubble-bubble group. In comparison with the cigarette-smoking group, hubble-bubble smokers had significantly higher Fundamental frequency and habitual pitch (p value 0.042 and 0.008, respectively). The laryngeal findings in hubble-bubble smokers are comparable to cigarette smokers. These laryngeal findings are not translated acoustically, as all the acoustic parameters are within normal range compared to controls.

  12. Unpacking smokers' beliefs about addiction and nicotine: A qualitative study.

    Science.gov (United States)

    Johnson, Sarah E; Coleman, Blair; Tessman, Greta K; Dickinson, Denise M

    2017-11-01

    Evidence suggests that consumers correctly identify nicotine as addictive; however, many may also harbor misconceptions about its harmfulness. The majority of this evidence is based on survey data, however, which may be prone to some limitations. In the current study, we employed qualitative methods to examine, in their own words, smokers' beliefs about nicotine and addiction. Twelve 1-hr focus groups were conducted in 3 cities in the United States (Columbus, OH; New Orleans, LA; and Washington, DC) from October to November, 2014. Adult cigarette smokers (N = 108), defined as those who reported smoking cigarettes on every day or some days, were segmented by age group (18-25 years and ≥26 years) and tobacco-use behavior. Thematic, in-depth analysis of focus-group discussion transcripts was conducted. Participant demographic information was recorded. Results showed that smokers identify nicotine as a cause of addiction to cigarettes; however, they also attribute their addiction to other factors. When asked about nicotine's effects on the body, immediate physiological effects of smoking (e.g., stimulation, relaxation) were top of mind. Opinions varied in terms of whether nicotine itself was harmful or harmless; many were unsure and/or had not considered this question. Discussions revealed heterogeneity in smokers' beliefs as well as recognition of their own uncertainty and lack of knowledge. The current findings provide insight that smokers may not be as misinformed regarding the relative harms of nicotine and tobacco, as has been suggested by quantitative evidence. Implications for future research are discussed. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  13. Factors influencing quit attempts among male daily smokers in China.

    Science.gov (United States)

    Zhao, Luhua; Song, Yang; Xiao, Lin; Palipudi, Krishna; Asma, Samira

    2015-12-01

    China has the largest population of smokers in the world, yet the quit rate is low. We used data from the 2010 Global Adult Tobacco Survey China to identify factors influencing quit attempts among male Chinese daily smokers. The study sample included 3303 male daily smokers. To determine the factors that were significantly associated with making a quit attempt, we conducted logistic regression analyses. In addition, mediation analyses were carried out to investigate how the intermediate association among demographics (age, education, urbanicity) and smoking-related variables affected making a quit attempt. An estimated 11.0% of male daily smokers tried to quit smoking in the 12 months prior to the survey. Logistic regression analysis indicated that younger age (15-24 years), being advised to quit by a health care provider (HCP) in the past 12 months, lower cigarette cost per pack, monthly or less frequent exposure to smoking at home, and awareness of the harms of tobacco use were significantly associated with making a quit attempt. Additional mediation analyses showed that having knowledge of the harm of tobacco, exposure to smoking at home, and having been advised to quit by an HCP were mediators of making a quit attempt for other independent variables. Evidence-based tobacco control measures such as conducting educational campaigns on the harms of tobacco use, establishing smoke-free policies at home, and integrating tobacco cessation advice into primary health care services can increase quit attempts and reduce smoking among male Chinese daily smokers. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Factors influencing quit attempts among male daily smokers in China✩

    Science.gov (United States)

    Zhao, Luhua; Song, Yang; Xiao, Lin; Palipudi, Krishna; Asma, Samira

    2015-01-01

    Background China has the largest population of smokers in the world, yet the quit rate is low. We used data from the 2010 Global Adult Tobacco Survey China to identify factors influencing quit attempts among male Chinese daily smokers. Methods The study sample included 3303 male daily smokers. To determine the factors that were significantly associated with making a quit attempt, we conducted logistic regression analyses. In addition, mediation anal yses were carried out to investigate how the intermediate association among demographics (age, education, urbanicity) and smoking related variables affected making a quit attempt. Results An estimated 11.0% of male daily smokers tried to quit smoking in the 12 months prior to the survey. Logistic regression analysis indicated that younger age (15–24 years), being advised to quit by a health care provider (HCP) in the past 12 months, lower cigarette cost per pack, monthly or less frequent exposure to smoking at home, and awareness of the harms of tobacco use were significantly associated with making a quit attempt. Additional mediation analyses showed that having knowledge of the harm of tobacco, exposure to smoking at home, and having been advised to quit by an HCP were mediators of making a quit attempt for other independent variables. Conclusion Evidence-based tobacco control measures such as conducting educational campaigns on the harms of tobacco use, establishing smoke-free policies at home, and integrating tobacco cessation advice into primary health care services can increase quit attempts and reduce smoking among male Chinese daily smokers. PMID:26441296

  15. Impact of the Spanish smoking law in smoker hospitality workers.

    Science.gov (United States)

    Martínez-Sánchez, Jose M; Fernández, Esteve; Fu, Marcela; Pérez-Ríos, Mónica; López, María J; Ariza, Carles; Pascual, José A; Schiaffino, Anna; Pérez-Ortuño, Raúl; Saltó, Esteve; Nebot, Manel

    2009-09-01

    A smoke-free law went into effect in Spain on 1 January 2006, affecting all enclosed workplaces except hospitality venues, where only partial bans were implemented. The objective was to evaluate the impact of the law among hospitality workers who smoke. The study design is a before-and-after evaluation. We formed a cohort at baseline, during the 3 months before the law went into effect, with 431 hospitality workers (222 smokers). From them, 288 were successfully followed-up 12 months after the ban (118 were smokers at baseline). We analyzed the quit rate, the reduction in the number of cigarettes smoked per day, changes in the Fagerström Test for Nicotine Dependence (FTND) scores, and changes in salivary cotinine concentrations in smokers from baseline to 1 year after the ban. Among 118 smokers, six (5.1%) quit smoking. Among the 112 remaining smokers, the mean number of cigarettes smoked decreased by 8.9% after the ban (from 17.9 to 16.3 cigarettes/day, p 6) was reduced by half after the ban (19.5% vs. 9.7%, p = .03). Salivary cotinine decreased by 4.4% after the ban (geometric mean 104.3 vs. 99.7 ng/ml, p = .02). No meaningful differences were found in quit rates and the FTND scores according to type of regulation. The Spanish smoking law has had beneficial effects (reduction in number of cigarettes smoked, cotinine levels, and FTND score) among hospitality workers who smoke.

  16. Serum cotinine levels and diabetes mellitus in never smokers.

    Science.gov (United States)

    Alshaarawy, Omayma; Elbaz, Hosam A

    2015-01-01

    The aim of the current study is to examine the association of environmental tobacco smoke (ETS) exposure evident by serum cotinine level, and diabetes mellitus in never smokers. Previous studies suggest that active tobacco cigarette smoking is associated with diabetes mellitus risk. However it is not clear if the low-level "background" ETS exposure is associated with diabetes among never smokers. We present evidence from five independent replications based on the US nationally representative National Health and Nutrition Examination Surveys (NHANES) conducted 2003-12. Our exposure of interest is ETS exposure among never smokers, measured by serum cotinine levels (ng/mL), and our main outcome is diabetes mellitus assessed via self-reported physician-diagnosis, current use of insulin and/or oral hypoglycemic medications, plasma fasting glucose levels ≥126mg/dL or glycohemoglobin levels ≥6.5%. The conceptual model encompassed age, sex, ethnic self-identification, education, poverty-income ratio, alcohol drinking, total cholesterol and body mass index. In never smokers, higher serum cotinine levels were positively associated with diabetes mellitus (the meta-analytic summary estimate is 1.2, 95% CI=1.1, 1.2). This association was not evident among never smokers with cotinine levels below 3ng/mL. These replications help sustain evidence of ETS-diabetes mellitus association, which might be explained by shared psychosocial characteristics. Prospective studies with appropriate biomarkers are needed to further investigate this association. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Prevalence and Effects of Emphysema in Never-Smokers with Rheumatoid Arthritis Interstitial Lung Disease

    Directory of Open Access Journals (Sweden)

    Joseph Jacob

    2018-02-01

    Conclusion: 27% of RA-ILD never-smokers demonstrate emphysema on CT. Emphysema presence in never-smokers independently associates with a definite CT-UIP pattern and a worsened outcome following adjustment for baseline disease severity.

  18. Salivary immunoglobulin classes in Nigerian cigarette smokers: Indication for increased risk of oral diseases

    Directory of Open Access Journals (Sweden)

    Ayodeji Olatunde Olayanju

    2012-01-01

    Conclusion: Our study showed that there is decreased salivary IgM in smokers. This observation suggests that reduced salivary immunoglobulin level of IgM might be involved in the pathogenesis of oral diseases in cigarette smokers.

  19. Idiopathic systemic AA-amyloidosis in a skunk (Mephitis mephitis).

    Science.gov (United States)

    Elhensheri, Mohamed; Linke, Reinhold P; Blankenburg, Anja; Beineke, Andreas

    2012-03-01

    This report describes a case of systemic amyloidosis in a captive striped skunk. At necropsy, bilateral alopecia, as well as reno-, hepato-, and splenomegaly were present. Congo red staining and immunohistochemistry revealed depositions of AA-amyloid in different organs. The lack of a predisposing disease is suggestive of idiopathic systemic AA-amyloidosis.

  20. Partially melted zone cracking in AA6061 welds

    International Nuclear Information System (INIS)

    Prasad Rao, K.; Ramanaiah, N.; Viswanathan, N.

    2008-01-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043

  1. Partially melted zone cracking in AA6061 welds

    Energy Technology Data Exchange (ETDEWEB)

    Prasad Rao, K. [Department of Metallurgical and Materials Engineering, Indian Institute of Technology Madras, Chennai (India)], E-mail: kpr@iitm.ac.in; Ramanaiah, N. [Sri Kalahasteeswara Institute of Technology, Srikalahasti (India); Viswanathan, N. [Defence Research and Development Laboratory, Hyderabad (India)

    2008-07-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043.

  2. The Use of Soil Palynomorphs in Forensics * ABDULRAHAMAN, AA ...

    African Journals Online (AJOL)

    ADOWIE PERE

    The Use of Soil Palynomorphs in Forensics. *. 1. ABDULRAHAMAN, AA;. 2. AL SAHLI, AA;. 1. OKOLI, JU. 1Applied Plant Anatomy and Wood Technology Laboratory, Department of Plant Biology, University of Ilorin, Ilorin, Nigeria. 2Department of Botany and Microbiology, College of Science, King Saud University, Riyadh, ...

  3. Evolution of geomagnetic aa index near sunspot minimum

    Directory of Open Access Journals (Sweden)

    R. P. Kane

    2002-10-01

    Full Text Available The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min occurred earlier than Rz(min, but remained at that low from a few months before Rz(min to a few months after Rz(min. In two cycles, Rz(min and aa(min coincided within a month or two. In nine cycles, aa(min occurred more than three months later than Rz(min. The aa(min coincided with the minima of some solar radio emission indices originating in the solar corona. For sunspot cycles 21, 22, 23, the minimum of solar wind velocity V occurred 0–9 months later than the aa(min. The minimum of solar wind total magnetic field B occurred near Rz(min. The solar wind ion density N had maxima (instead of minima near Rz(min, and again near Rz(max, indicating a  ~5-year periodicity, instead of an 11-year periodicity. The maxima of aa, V and B occurred near Rz(max and/or later in the declining phase of Rz. The aa index was very well correlated with the functions BV and BV 2.Key words. Geomagnetism and paleomagnetism (time variations, diurnal to secular – time variations, secular and long term Interplanetary physics (interplanetary magnetic field

  4. AA, shims and washers on quadrupole ends

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  5. Hot stamping of AA7075 aluminum sheets

    Science.gov (United States)

    Mendiguren, J.; Saenz de Argandona, E.; Galdos, L.

    2016-11-01

    In this work the formability of a high strength aluminium alloy (AA7075-T6) for the stamping of an automotive component has been studied. Due to the low formability of the selected alloy, two different heat assisted forming strategies have been analysed. On the one hand, the W-temper process, where the thermal process is carried out prior to the forming operation. On the other hand, the hot stamping process, where the thermal process is carried out at the same time as the forming. The results showed that both technology were able to form the component avoiding any failure of the material. On the contrary, both processes reduced the final mechanical properties of the material compared to the as received material condition. However, the obtained mechanical properties doubled the strength of commonly used 5xxx and 6xxx aluminium alloys.

  6. DETERMINATION of the TRACE ELEMENT LEVELS in HAIR of SMOKERS and NON-SMOKERS by ICP-MS

    Directory of Open Access Journals (Sweden)

    Elif Varhan Oral

    2016-09-01

    Full Text Available For at least 50 years, determination of the trace element levels in human hair has been used to assess environmental and vocational exposure to toxic elements . As compared to other biological matrices (e.g. blood, urine, human hair is stable and therefore useful as a matrice. In this study, analyses of toxic and essential trace elements, such as Cd, Pb, Cu and Fe, were done in hair samples which we collected from male smokers (10 people and non-smokers (10 people who live in Diyarbakır, Turkey and concentrations in hair samples were compared. Hair samples were washed by a standard procedure proposed by the International Atomic Energy Agency. Then the samples were dried for 16 h at 110°C in an oven. Solubilization procedure was carried out by nitric acid hydrogen peroxide mixture (3:1 in closed vessels in a microwave oven. Trace element analyses were carried out by using inductively coupled plasma-mass spectrometry (ICP-MS  technique. In our study, while concentrations of Cd, Pb, and Fe elements were found to be considerably higher in smokers than non-smokers, similar results were observed in Cu concentrations. The precision and accuracy of the method was evaluated by applying spike method to samples. Analytical recovery results were found between 91.2% and 104.6%.

  7. Using student and school factors to differentiate adolescent current smokers from experimental smokers in Canada: a multilevel analysis.

    Science.gov (United States)

    Kaai, Susan C; Leatherdale, Scott T; Manske, Stephen R; Brown, K Stephen

    2013-08-01

    In order to understand the factors that differentiate adolescents who have tried smoking from those who have become established smokers, this study examined which student- and school-level factors differentiated current smokers from experimental smokers among a nationally representative sample of Canadian secondary school students. Student-level secondary data from the 2008-2009 Canadian Youth Smoking Survey was linked with school-level data from the 2006 Census and one built environment characteristic, and examined using multilevel logistic regression analyses. The current smoking rates varied (Pschools. The number of tobacco retailers surrounding the schools was associated with current smoking when adjusting for student characteristics. Additionally, students were more likely to be current smokers if they were: male, in higher grades, believed that smoking can help when they are bored, reported low school connectedness, used marijuana, had a sibling or close friend who smoked, and had no smoking bans at home. These study findings suggest that school anti-smoking strategies need to target males, increase students' attachment to their school, address tobacco-related beliefs, and include interventions targeting smoking siblings and friends. The government should consider zoning restrictions to limit sales of tobacco products near schools. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Correlation of Cadmium and Magnesium in the Blood and Serum Samples of Smokers and Non-Smokers Chronic Leukemia Patients.

    Science.gov (United States)

    Khan, Noman; Afridi, Hasan Imran; Kazi, Tasneem Gul; Arain, Muhammad Balal; Bilal, Muhammad; Akhtar, Asma; Khan, Mustafa

    2017-03-01

    It was studied that cancer-causing processes are related with the disproportions of essential and toxic elements in body tissues and fluid. The purpose of the current study was to evaluate the levels of magnesium (Mg) and cadmium (Cd) in serum and blood samples of smokers and nonsmokers who have chronic myeloid (CML) and lymphocytic (CLL) leukemia, age ranged 31-50 years. For comparative study, age-matched smokers and nonsmoker males were chosen as controls/referents. The levels of elements in patient were analyzed before any treatment by atomic absorption spectrophotometer, after microwave assisted acid digestion. The validation of the method was done by using certified reference materials of serum and blood samples. The resulted data indicated that the adult male smokers and nonsmokers have two- to fourfold higher levels of Cd in the blood and sera samples as compared to the referents (p blood and serum samples of both types of leukemia patients as related to referent values. The resulted data indicates significant negative correlation among Mg and Cd in leukemia patients and smoker referents. Further studies are needed to clarify the role of these elements in pathogenesis of chronic leukemia.

  9. NNAL exposure by race and menthol cigarette use among U.S. smokers.

    Science.gov (United States)

    Rostron, Brian

    2013-05-01

    Researchers have recently suggested that nicotine and carcinogen exposure as measured by biomarkers such as cotinine and NNAL (4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol) does not vary with cigarettes smoked per day (CPD) among Black smokers. Researchers have also suggested that nicotine exposure does not differ between menthol and nonmenthol smokers. In this study, we examine NNAL exposure for U.S. smokers by race, CPD, and menthol cigarette use. We analyzed urinary NNAL concentrations for more than 1500 everyday smokers participating in the National Health and Nutrition Examination Survey from 2007-2010. For purposes of comparison, we also analyzed serum cotinine concentrations for these smokers. We used linear regression analysis to estimate mean biomarker concentrations by CPD and race/ethnicity group and to examine the association between biomarker concentrations and menthol cigarette use by race/ethnicity group, controlling for other demographic and smoking characteristics. Biomarker concentrations increased with CPD for White, Black, and Hispanic smokers although NNAL concentrations leveled off for Black smokers at lower CPD levels compared with other smokers. Mean NNAL concentrations were lower among menthol smokers compared with nonmenthol smokers among smokers overall (β = -0.165, p = .032) and White smokers (β = -0.207, p = .048). We find evidence in national health survey data that nicotine and carcinogen exposure generally increases with CPD across race/ethnicity groups although the pattern of NNAL exposure differs by race/ethnicity group at high CPD levels. We also find evidence of differences in NNAL exposure for menthol smokers compared with nonmenthol smokers among smokers overall and White smokers.

  10. Unique Relationships between Facets of Mindfulness and Eating Pathology among Female Smokers

    OpenAIRE

    Adams, Claire E.; McVay, Megan Apperson; Kinsaul, Jessica; Benitez, Lindsay; Vinci, Christine; Stewart, Diana W.; Copeland, Amy L.

    2012-01-01

    Female smokers often have higher levels of eating disorder symptoms than non-smokers, and concerns about eating and weight might interfere with smoking cessation. Thus, it is critical to identify factors to promote healthier eating and body image in this population. Initial research suggests that specific aspects of trait mindfulness predict lower body dissatisfaction and eating disorder symptoms among non-smokers. However, these relationships are unknown among smokers. The current study exam...

  11. The French Observational Cohort of Usual Smokers (FOCUS) cohort: French smokers perceptions and attitudes towards smoking cessation.

    Science.gov (United States)

    Aubin, Henri-Jean; Peiffer, Gérard; Stoebner-Delbarre, Anne; Vicaut, Eric; Jeanpetit, Yasmine; Solesse, Anne; Bonnelye, Geneviève; Thomas, Daniel

    2010-02-26

    Despite increasing governmental anti-smoking measures, smoking prevalence remains at a high level in France. The objectives of this panel study were (1) to estimate smoking prevalence in France, (2) to identify smokers' profiles according to their perceptions, attitudes and behaviour in relation to smoking cessation, (3) to determine predictive factors of quit attempts, and (4) to assess tobacco-related behaviours and their evolutions according to the changes in the smokers' environments. A representative sample of French population was defined using the quota method. The identified cohort of smokers was assessed, in terms of smoking behaviour, previous quit attempts, and intention to quit smoking. A response rate of 66% for the screening enabled to identify a representative sample of the French population (N = 3 889) comprising 809 current smokers (21%). A majority of current smokers (63%) had made an attempt to quit smoking. Main reasons for having made the last attempt were cost (44%), social pressure (39%), wish to improve physical fitness (36%), fear of a future smoking-related disease (24%), and weariness of smoking (21%). Few attempts (16%) were encouraged by a physician. In those who used some kind of support (38%), NRT was the mostly used. Relapse was triggered by craving (45%), anxiety/stress (34%), a significant life event (21), weight gain (18%), and irritability (16%). Depression was rarely quoted (5%). Forty percent of smokers declared they intended to quit smoking permanently. Main reasons were cost (65%), physical fitness improvement (53%), fear of a future smoking-related disease (43%), weariness of tobacco (34%), and social pressure (30%). Using a smoking cessation treatment was considered by 43% of smokers that intended to quit. Barriers to smoking cessation were mainly fear of increased stress (62%), irritability (51%), and anxiety (42%), enjoying smoking (41%), and weight concerns (33%). Smoking prevalence and smoking cessation attempts rate

  12. A Qualitative Study of Smokers' Responses to Messages Discouraging Dual Tobacco Product Use

    Science.gov (United States)

    Popova, Lucy; Kostygina, Ganna; Sheon, Nicolas M.; Ling, Pamela M.

    2014-01-01

    Cigarette companies increasingly promote novel smokeless tobacco products to smokers, encouraging them to use smokeless tobacco in smoke-free environments. New messages may counteract this promotion. We developed 12 initial anti-smokeless message ideas and tested them in eight online focus groups with 75 US smokers. Those smokers who never tried…

  13. Impact of the removal of light and mild descriptors from cigarette packages in Ontario, Canada: switching to "light replacement" brand variants.

    Science.gov (United States)

    Cohen, Joanna E; Yang, Jingyan; Donaldson, Elisabeth A

    2014-12-01

    This study assessed cessation and brand switching among smokers in Ontario, Canada after tobacco companies' voluntary removal of 'light' and 'mild' descriptors from cigarette packages. We analyzed longitudinal data on brand preference and cessation from a cohort of smokers (n=632) in the Ontario Tobacco Survey in Canada from 2006 to 2008 with a longitudinal regression model. While cessation differed by brand variant prior to the ban (7% light vs. 3% regular; Pbrand variant after the ban was implemented. In 2008, when light cigarette brand variants were no longer available, 33% of the sample still reported smoking lights and 31% smoked light replacement brand variants. During each subsequent follow-up, light brand smokers had 2 times the odds of smoking regular brand variants (Adjusted OR: 2.03, 95% CI 1.80,2.29), and almost 5 times the odds of using light replacement brand variants (Adjusted OR: 4.87, 95% CI 4.07,5.84), respectively, compared to continuing to smoke lights. Even after removing misleading descriptors from cigarette packs, smokers continued to report using light brand variants, and many switched to newly introduced light replacement brand variants. After full implementation of the ban, cessation did not vary by brand variant. Copyright © 2014. Published by Elsevier Inc.

  14. Dicty_cDB: FC-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA17Q.Seq.d/ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  15. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...22Q.Seq.d/ Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  16. Dicty_cDB: FC-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA05Q.Se...q.d/ Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  17. Dicty_cDB: FC-AA16 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA16Q.Se...q.d/ Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  18. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...06Q.Seq.d/ Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  19. Dicty_cDB: FC-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA15Q.Se...q.d/ Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  20. Dicty_cDB: FC-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA21Q.Seq.d/ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  1. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...23Q.Seq.d/ Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  2. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...18Q.Seq.d/ Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  3. Dicty_cDB: FC-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA22Q.Seq.d/ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  4. States' Flexibility Waiver Plans for Alternate Assessments Based on Alternate Achievement Standards (AA-AAS). Synthesis Report 96

    Science.gov (United States)

    Lazarus, Sheryl S.; Edwards, Lynn M.; Thurlow, Martha L.; Hodgson, Jennifer R.

    2014-01-01

    All states have alternate assessments based on alternate achievement standards (AA-AAS) for students with the most significant cognitive disabilities. For accountability purposes, the Elementary and Secondary Education Act (ESEA) allows up to 1% of students to be counted as proficient with this assessment option. In 2011 the U.S. Department of…

  5. Perceptions of Snus Among US Adult Smokers Given Free Product.

    Science.gov (United States)

    Meier, Ellen; Burris, Jessica L; Wahlquist, Amy; Garrett-Mayer, Elizabeth; Gray, Kevin M; Alberg, Anthony J; Cummings, K Michael; Carpenter, Matthew J

    2017-12-13

    Snus uptake is nominal among US smokers. This longitudinal study examines (1) perceptions of snus among US smokers given free snus for 6 weeks and (2) a method for assessment of an alternative tobacco product at the population level. Adult smokers (n = 543; 69.2% female; Mage = 49.3 years), uninterested in quitting, received free snus for ad libitum use. Based on their snus use during a 6-week sampling period, participants included: (1) never users (18.4%, n = 100); (2) experimenters; that is, used ≥ once, but not during the last week of sampling (33.1%; n = 180); and (3) persistent users; that is, used ≥ once during the final week, and ≥ once during any other week of the sampling period. (48.4%; n = 263). Following the sampling period, those who became persistent users were more likely than experimenters to report that switching to alternative tobacco products would lower their risk for health problems (66.5% vs. 50.0%; p = .006). Persistent users also reported greater negative affect relief and craving reduction (ps tobacco products, including e-cigarettes, to help understand the role new products may have in the tobacco landscape. This is the first large scale, US-based naturalistic assessment of smokers' reactions to snus during an extended sampling period. This study is directly in line with FDA goals to better understand predictors of initiation, uptake, and use of other tobacco products such as snus, and serves as model for assessment methods of alternative tobacco products at the population level. Most smokers tried the provided sample of snus (approximately 82%). Subjective experiences with snus, rather than nicotine dependence, explained experimentation versus persistent use. Even among smokers who became persistent snus users, snus was perceived as a poor substitute for cigarettes. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e

  6. A six-month crossover chemoprevention clinical trial of tea in smokers and non-smokers: methodological issues in a feasibility study

    Directory of Open Access Journals (Sweden)

    Dash Chiranjeev

    2012-07-01

    Full Text Available Abstract Background Chemoprevention crossover trials of tea can be more efficient than parallel designs but the attrition and compliance rates with such trials are unknown. Methods Attrition (dropouts and compliance with treatment were assessed in a 25-week randomized, placebo controlled, crossover, feasibility clinical trial of four tea treatments to investigate the effect of tea on oral cancer biomarkers. Each treatment lasted 4 weeks with 2 weeks of washout in between. Participants were 32 smokers and 33 non-smokers without any evidence of premalignant oral lesions. The interventions consisted of packets of green tea, black tea, caffeinated water, or placebo. Participants were assigned to each treatment for four weeks, and were instructed to drink five packets per day while on the treatment. Dropout from the trial and compliance (consumption of ≥ 85% of the prescribed treatment packets are the main outcome measures reported. Results There was a high rate of dropout (51% from the study, and the rates were significantly higher among smokers (64% than non-smokers (36%. Among participants who completed the study the rate of compliance was 72%. The highest rates of dropouts occurred between the first and second treatment visits in both smokers (38% dropout and non-smokers (18% dropout. Throughout the study smokers were more likely to dropout than non-smokers. Black tea treatment was associated with the highest rates of dropout among smokers (37%, but was associated with the lowest rate of dropout among non-smokers (4%. Conclusions In a study conducted to test the feasibility of a four-treatment crossover tea trial, a high rate of dropout among smokers and non-smokers was observed. Multi-arm crossover tea trials might pose a higher burden on participants and research is needed to improve adherence and treatment compliance in such trials. Trial registration number ISRCTN70410203

  7. A six-month crossover chemoprevention clinical trial of tea in smokers and non-smokers: methodological issues in a feasibility study

    Science.gov (United States)

    2012-01-01

    Background Chemoprevention crossover trials of tea can be more efficient than parallel designs but the attrition and compliance rates with such trials are unknown. Methods Attrition (dropouts) and compliance with treatment were assessed in a 25-week randomized, placebo controlled, crossover, feasibility clinical trial of four tea treatments to investigate the effect of tea on oral cancer biomarkers. Each treatment lasted 4 weeks with 2 weeks of washout in between. Participants were 32 smokers and 33 non-smokers without any evidence of premalignant oral lesions. The interventions consisted of packets of green tea, black tea, caffeinated water, or placebo. Participants were assigned to each treatment for four weeks, and were instructed to drink five packets per day while on the treatment. Dropout from the trial and compliance (consumption of ≥ 85% of the prescribed treatment packets) are the main outcome measures reported. Results There was a high rate of dropout (51%) from the study, and the rates were significantly higher among smokers (64%) than non-smokers (36%). Among participants who completed the study the rate of compliance was 72%. The highest rates of dropouts occurred between the first and second treatment visits in both smokers (38% dropout) and non-smokers (18% dropout). Throughout the study smokers were more likely to dropout than non-smokers. Black tea treatment was associated with the highest rates of dropout among smokers (37%), but was associated with the lowest rate of dropout among non-smokers (4%). Conclusions In a study conducted to test the feasibility of a four-treatment crossover tea trial, a high rate of dropout among smokers and non-smokers was observed. Multi-arm crossover tea trials might pose a higher burden on participants and research is needed to improve adherence and treatment compliance in such trials. Trial registration number ISRCTN70410203 PMID:22800470

  8. The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Akira [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Bainy, Afonso C.D. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Departamento de Bioquímica, CCB, Universidade Federal de Santa Catarina, Florianopolis, SC 88040-900 (Brazil); Woodin, Bruce R.; Goldstone, Jared V. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

    2013-10-01

    The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs. On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with

  9. Lack of Associations of CHRNA5-A3-B4 Genetic Variants with Smoking Cessation Treatment Outcomes in Caucasian Smokers despite Associations with Baseline Smoking.

    Directory of Open Access Journals (Sweden)

    Rachel F Tyndale

    Full Text Available CHRNA5-A3-B4 variants, rs16969968, rs588765 and rs578776, are consistently associated with tobacco consumption among smokers, but the association with smoking cessation is less consistent. Among the studies that reported significant associations with cessation, the effects were observed in smokers treated with placebo treatment in some studies and conversely in those receiving active pharmacological therapy (bupropion and nicotine replacement therapies in others. Thus, it remains unclear whether CHRNA5-A3-B4 is a useful marker for optimizing smoking cessation. Using data from 654 Caucasian smokers treated with placebo, nicotine patch or varenicline, we investigated whether CHRNA5-A3-B4 variants were associated with smoking cessation outcomes, and whether there were significant genotype-by-treatment or haplotype-by-treatment interactions. We observed no significant associations between CHRNA5-A3-B4 variants and smoking cessation, despite replicating previous associations with baseline tobacco consumption. At end of treatment the effect size on smoking cessation in the placebo, patch and varenicline groups for rs16969968 [GG vs. GA+AA] was OR = 0.66 (P = 0.23, OR = 1.01 (P = 0.99, and OR = 1.30 (P = 0.36 respectively, of rs588765 [CC vs. CT+TT] was OR = 0.96 (P = 0.90, OR = 0.84 (P = 0.58, and OR = 0.74 (P = 0.29 respectively, and for rs578776 [GG vs. GA+AA] on smoking cessation was OR = 1.02 (P = 0.95, OR = 0.75 (P = 0.35, and OR = 1.20 (P = 0.51 respectively. Furthermore, we observed no associations with cessation using the CHRNA5-A3-B4 haplotype (constructed using rs16969968 and rs588765, nor did we observe any significant genotype-by-treatment interactions, with or without adjusting for the rate of nicotine metabolism (all P>0.05. We also observed no significant genetic associations with 6 month or 12 month smoking abstinence. In conclusion, we found no association between CHRNA5-A3-B4 variants and smoking cessation rates in this clinical

  10. The taxes of sin. Do smokers and drinkers pay their way?

    Science.gov (United States)

    Manning, W G; Keeler, E B; Newhouse, J P; Sloss, E M; Wasserman, J

    1989-03-17

    We estimate the lifetime, discounted costs that smokers and drinkers impose on others through collectively financed health insurance, pensions, disability insurance, group life insurance, fires, motor-vehicle accidents, and the criminal justice system. Although nonsmokers subsidize smokers' medical care and group life insurance, smokers subsidize nonsmokers' pensions and nursing home payments. On balance, smokers probably pay their way at the current level of excise taxes on cigarettes; but one may, nonetheless, wish to raise those taxes to reduce the number of adolescent smokers. In contrast, drinkers do not pay their way: current excise taxes on alcohol cover only about half the costs imposed on others.

  11. Social norms of cigarette and hookah smokers in Iranian universities

    DEFF Research Database (Denmark)

    Roohafza, Hamidreza; Sadeghi, Masoumeh; Shahnam, Maryam

    2013-01-01

    BACKGROUND: First experiences of tobacco use usually occur in adolescence. The recognition of social norms leading to youth smoking is hence necessary. We tried to assess the social norms among Iranian young cigarette and hookah smokers. METHODS: This cross-sectional study was conducted on 451...... girls and 361 boys aging 20-25 years old who entered Isfahan and Kashan Universities (Iran) in 2007. Demographic factors (age, gender, and age at smoking onset) cigarette and hookah smoking status, having a smoking father or smoking friends and four related social norms were recorded. Binary logistic...... regression analysis was used to separately determine associations between hookah and cigarette smoking and the four social norm variables. RESULTS: CIGARETTE AND HOOKAH SMOKERS HAD SIGNIFICANT DIFFERENCES WITH NONSMOKERS IN TWO SOCIAL NORMS: "Perceived smoking by important characters" [odds ratio (OR) = 1...

  12. Exploring Factors Influencing Smokers' Information Seeking for Smoking Cessation.

    Science.gov (United States)

    Noh, Ghee-Young; Lee, Sun Young; Choi, Jounghwa

    2016-08-01

    This study addressed the factors influencing smokers' information seeking pertaining to the health risks of smoking. In particular, this study aimed to extend the risk information seeking and processing model by taking into account the role of autonomous motivations used to stimulate smokers' information-seeking behavior. The results of a Web-based survey indicated that information insufficiency was positively associated with health information-seeking behavior and that negative affective responses were positively associated with information insufficiency and health information-seeking behavior. In addition, autonomous motivations were positively associated with information insufficiency and information-seeking behavior. The results indicated that risk perception was positively related to autonomous motivations and negative affective response. Finally, informational subjective norm was positively related to autonomous motivations and negative affective responses. The implications of this study for future research are discussed.

  13. Urinary excretion of copper and zinc among cigarette smokers.

    Science.gov (United States)

    El-Safty, I A; Shouman, A E

    1997-01-01

    The urinary levels of cadmium (Cd), zinc (Zn) and copper (Cu) were measured among 11 adult male non-smokers and 38 adult male cigarette smokers to investigate the effect of cigarette smoking on the urinary excretion of Zn and Cu in relation to urinary Cd level. The results indicated that among non-smokers, the urinary levels of Cd, Zn, and Cu were: 1.17-5.24 (3.73 +/- 1.23) microg Cd/gm urinary creatinine, 66.73-156.13 (109.28 +/- 30.27) microg Zn/gm urinary creatinine, 83.17-195.65 (126.72 +/- 41.46) microg Cu/gm urinary creatinine, respectively. The cigarette smokers were classified into two groups according to the level of urinary Cd. The first group contains 13 cases with urinary Cd levels within the normal range of non-smokers, and the urinary levels of both Zn and Cu were observed to be also within the normal range of non-smokers (2.14-4.98 (3.85 +/- 0.97) microg Cd/gm urinary creatinine, 69.40-150.59 (97.61 +/- 21.39) microg Zn/gm urinary creatinine, 85.33-137.42 (96.11 +/- 13.60) microg Cu/gm urinary creatinine, respectively]. The second group contains 25 cases with elevated urinary Cd levels (5.44-40.37 (14.08 +/- 9.69 microg Cd/gm urinary creatinine]. The latter group was further subdivided into two subgroups according to the urinary levels of Zn and Cu. The first subgroup contains 15 cases with urinary levels of both Zn and Cu within the normal range of non-smokers [5.44-13.58 (7.74 +/- 2.11) microg Cd/gm urinary creatinine, 69.54-133.46 (96.95 +/- 22.91) microg Zn/gm urinary creatinine, 93.06-191.90 (133.7 +/- 32.80) microg Cu/gm urinary creatinine, respectively]. The second subgroup contains 10 cases with elevated urinary levels of Zn and/or Cu [13.81-40.37 (23.57 +/- 8.74) microg Cd/gm urinary creatinine, 141.53-511.11 (284.76 +/- 132.45) microg Zn/gm urinary creatinine, 193.06-705.48 (388.49 +/- 158.66) microg Cu/gm urinary creatinine, respectively). In the latter subgroup it was noted that only one case showed elevated levels of urinary Cd and Zn

  14. Imaging-based assessment of dyspnea in cigarette smokers

    Science.gov (United States)

    Galvin, Jeffrey R.; Chang, Paul J.; Schwartz, David A.; Hunninghake, Gary W.; Helmers, Richard; Mori, Masaki

    1994-05-01

    Patients with pulmonary fibrosis frequently smoke cigarettes. The cause of dyspnea in these patients is often complex because of the coexistence of multiple disease processes. We investigated 10 cigarette smokers with pulmonary fibrosis who were referred for evaluation of new onset or worsening dyspnea. Chest radiographs and pulmonary function tests were obtained in addition to high-resolution computed tomography (HRCT). In those patients with HRCT evidence of both diseases, spirometry and lung volumes were most often normal. Although plain films provided a reasonable assessment of fibrosis, they underestimated the severity of emphysema. Quantitation of both emphysema and fibrosis by HRCT was reproducible and correlated with key pulmonary function tests. Our findings indicate that the HRCT scan is a useful diagnostic test in patients with pulmonary fibrosis who are also cigarette smokers.

  15. Social norms of cigarette and hookah smokers in Iranian universities

    DEFF Research Database (Denmark)

    Roohafza, Hamidreza; Sadeghi, Masoumeh; Shahnam, Maryam

    2013-01-01

    regression analysis was used to separately determine associations between hookah and cigarette smoking and the four social norm variables. RESULTS: CIGARETTE AND HOOKAH SMOKERS HAD SIGNIFICANT DIFFERENCES WITH NONSMOKERS IN TWO SOCIAL NORMS: "Perceived smoking by important characters" [odds ratio (OR) = 1......BACKGROUND: First experiences of tobacco use usually occur in adolescence. The recognition of social norms leading to youth smoking is hence necessary. We tried to assess the social norms among Iranian young cigarette and hookah smokers. METHODS: This cross-sectional study was conducted on 451...... girls and 361 boys aging 20-25 years old who entered Isfahan and Kashan Universities (Iran) in 2007. Demographic factors (age, gender, and age at smoking onset) cigarette and hookah smoking status, having a smoking father or smoking friends and four related social norms were recorded. Binary logistic...

  16. Constant-load exercise decreases the serum concentration of myeloperoxidase in healthy smokers and smokers with COPD.

    Science.gov (United States)

    Holz, Olaf; Roepcke, Stefan; Watz, Henrik; Tegtbur, Uwe; Lahu, Gezim; Hohlfeld, Jens M

    2015-01-01

    There is an ongoing demand for easily accessible biomarkers related to pathophysiological processes in chronic obstructive pulmonary disease (COPD). Short-term intense exercise is known to increase the peripheral blood levels of cytokines. Therefore, we tested the potential and the repeatability of an exercise challenge to amplify seven serum biomarkers (interleukin 6 [IL6], C-reactive protein [CRP], myeloperoxidase [MPO], leukotriene B4, soluble intercellular adhesion molecule 1, soluble vascular cell adhesion molecule 1, and von Willebrand factor [VWF]) in smokers with and without COPD. Twenty-three smokers with moderate COPD (GOLD 2) and 23 sex- and age-matched healthy smokers underwent up to 30-minute submaximal, constant-load exercise (75% of maximum work load) on two occasions separated by 4 weeks (second challenge n=19/20). Serum samples were obtained before, 5 minutes after the start, at the end of exercise (maximum 30 minutes or until exhaustion), and after additional 20 minutes of rest. The median (interquartile range) exercise time until exhaustion in the two challenges was 10.0 (4.0) minutes and 10.0 (8.0) minutes in smokers with COPD and 22.0 (16.0) minutes and 26.5 (14.5) minutes in healthy smokers. The exercise challenge significantly increased the serum concentrations of IL6 and VWF, but decreased the concentrations of MPO. Healthy smokers showed a significantly greater increase (at the end of exercise compared to before exercise) in IL6 (P=0.01) and a larger decline (P=0.03) in MPO. The overall profile of the serum markers during the exercise challenge was shown to be repeatable in the second challenge. In summary, intense load exercise is capable of changing the concentration of inflammatory and endothelial function markers. Especially, the decline in the level of MPO, a marker closely related to cardiovascular risk, appears to be of clinical interest, as the exercise-induced decline might be related to the beneficial effects of physical activity

  17. Constant-load exercise decreases the serum concentration of myeloperoxidase in healthy smokers and smokers with COPD

    Directory of Open Access Journals (Sweden)

    Holz O

    2015-07-01

    Full Text Available Olaf Holz,1,* Stefan Roepcke,2,* Henrik Watz,3 Uwe Tegtbur,4 Gezim Lahu,2 Jens M Hohlfeld1 1Fraunhofer Institute for Toxicology and Experimental Medicine (ITEM, German Center for Lung Research (DZL, BREATH, Hannover, Germany; 2Takeda Pharmaceuticals International GmbH, Glattpark-Opfikon, Switzerland; 3Pulmonary Research Institute at Lung Clinic Grosshansdorf, German Center for Lung Research (DZL, ARCN, Grosshansdorf, 4Institute for Sports Medicine, Hannover Medical School (MHH, Hannover, Germany *These authors contributed equally to this work Abstract: There is an ongoing demand for easily accessible biomarkers related to pathophysiological processes in chronic obstructive pulmonary disease (COPD. Short-term intense exercise is known to increase the peripheral blood levels of cytokines. Therefore, we tested the potential and the repeatability of an exercise challenge to amplify seven serum biomarkers (interleukin 6 [IL6], C-reactive protein [CRP], myeloperoxidase [MPO], leukotriene B4, soluble intercellular adhesion molecule 1, soluble vascular cell adhesion molecule 1, and von Willebrand factor [VWF] in smokers with and without COPD. Twenty-three smokers with moderate COPD (GOLD 2 and 23 sex- and age-matched healthy smokers underwent up to 30-minute submaximal, constant-load exercise (75% of maximum work load on two occasions separated by 4 weeks (second challenge n=19/20. Serum samples were obtained before, 5 minutes after the start, at the end of exercise (maximum 30 minutes or until exhaustion, and after additional 20 minutes of rest. The median (interquartile range exercise time until exhaustion in the two challenges was 10.0 (4.0 minutes and 10.0 (8.0 minutes in smokers with COPD and 22.0 (16.0 minutes and 26.5 (14.5 minutes in healthy smokers. The exercise challenge significantly increased the serum concentrations of IL6 and VWF, but decreased the concentrations of MPO. Healthy smokers showed a significantly greater increase (at

  18. Clinical inquiries. Does office spirometry improve quit rates in smokers?

    Science.gov (United States)

    Spata, Jennifer; Kelsberg, Gary; Safranek, Sarah

    2010-10-01

    It depends. Simply performing spirometry and offering cessation advice doesn't improve quit rates in patients who smoke (strength of recommendation [SOR]: A, systematic review of randomized controlled trials [RCTs]). However, when the spirometry results are communicated in terms of "lung age", smokers are more likely to quit (SOR: B, large RCT). Patients with abnormal spirometry results may be more likely to quit than patients with normal results (SOR: B, cohort studies).

  19. Differential use of other tobacco products among current and former cigarette smokers by income level.

    Science.gov (United States)

    Vijayaraghavan, Maya; Pierce, John P; White, Martha; Messer, Karen

    2014-10-01

    With the declining sales of cigarettes, the tobacco industry has been promoting other forms of combustible and smokeless tobacco to current and former cigarette smokers. Exposure to the promotion of tobacco products has been shown to vary by income level. We combined the 2006 through 2011 National Surveys on Drug Use and Health to compare the prevalence and patterns of other tobacco use (cigar, snuff, and chewing tobacco) between current and former cigarette smokers by income level. Other tobacco use was minimal among females and among male non-smokers. Approximately a third of both current and former male cigarette smokers reported past-year other tobacco use. Overall, current smokers were more likely than former smokers to have used cigars (adjusted odds ratio (AOR) 1.69, 95% CI 1.50-1.92) or snuff (AOR 1.14, 95% CI 1.01-1.28) in the past year. The association of smoking status with other tobacco use differed by income level (interaction term p-value<0.001). Among lower income groups, current smokers were more likely to use cigars and snuff compared to former smokers. Among the highest income group, former smokers were just as likely to use smokeless tobacco as current smokers. The differing patterns of use of other tobacco between current and former smokers by income level highlight a need for studies to understand the motivations for the use of these products and their role in smoking cessation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. The risk of arrhythmias following coronary artery bypass surgery: do smokers have a paradox effect?

    LENUS (Irish Health Repository)

    Al-Sarraf, Nael

    2010-11-01

    Smoking is reported to increase the risk of arrhythmias. However, there are limited data on its effects on arrhythmias following coronary artery bypass graft (CABG). This is a retrospective review of a prospective database of all CABG patients over an eight-year period. Our cohort (n=2813) was subdivided into: current (n=1169), former (n=837), and non-smokers (n=807). Predictors of arrhythmias following CABG in relation to smoking status were analysed. Atrial arrhythmias occurred in 942 patients (33%). Ventricular arrhythmias occurred in 48 patients (2%) and high-grade atrioventricular block occurred in five patients (0.2%). Arrhythmias were lower in current smokers than former and non-smokers (29% vs. 40% vs. 39%, respectively P<0.001). Logistic regression analysis showed 30% arrhythmia risk reduction in smokers compared to non-smokers [odds ratio (OR) 0.7, 95% confidence intervals (CI) 0.5-0.8] and this effect persisted after accounting for potential confounders while former smokers had the same risk as non-smokers (OR 1.04, CI 0.9-1.3). There were no significant differences in mortality. Smokers are less prone to develop arrhythmias following CABG. This paradox effect is lost in former smokers. This effect is possibly due to a lower state of hyper adrenergic stimulation observed in smokers than non-smokers following the stress of surgery.

  1. Body mass index and lung cancer risk in never smokers

    International Nuclear Information System (INIS)

    Kagohashi, K.; Satoh, H.; Kurishima, K.; Ishikawa, H.; Ohtsuka, M.

    2006-01-01

    Background. A relationship between body mass index (BMI) and lung cancer risk in never smokers has not been reported precisely. To evaluate the risk of lung cancer associated with BMI in never smokers, we conducted a case-control study. Methods. The relationship between BMI and the risk of lung cancer in never smokers was investigated in a study of 204 lung cancer cases and 398 controls admitted between 1987 and 2005. Controls were selected from hospitalized age-matched never-smoking patients with non-malignant respiratory disease. Results. When compared with BMI of the leanest group (BMI<20.8) in men, no inverse association between BMI and lung cancer was observed after the adjustment for age (the second BMI group: BMI≥ 20.8 to < 22.9; p=0.683, the third BMI group: BMI≥ 22.9 to < 24.9; p=0.745, and the highest BMI group: BMI≥ 25.0; p=0.327). Similarly, no association in women was found between BMI and lung cancer in these three BMI groups (the second group, p=0.639; the third group, p=0.667; the highest group, p=0.978) when compared with that of the leanest BMI group. Conclusions. Our present study indicated that the association between leanness and the risk of lung cancer might be influenced by other factors such as smoking. (author)

  2. Smokers' sources of e-cigarette awareness and risk information.

    Science.gov (United States)

    Wackowski, Olivia A; Bover Manderski, Michelle T; Delnevo, Cristine D

    Few studies have explored sources of e-cigarette awareness and peoples' e-cigarette information needs, interests or behaviors. This study contributes to both domains of e-cigarette research. Results are based on a 2014 e-cigarette focused survey of 519 current smokers from a nationally representative research panel. Smokers most frequently reported seeing e-cigarettes in stores (86.4%) and used in person (83%). Many (73%) had also heard about e-cigarettes from known users, broadcast media ads (68%), other (print, online) advertisements (71.5%), and/or from the news (60.9%); sources of awareness varied by e-cigarette experience. Most smokers (59.9%) believed e-cigarettes are less harmful than regular cigarettes, a belief attributed to "common sense" (76.4%), the news (39.2%) and advertisements (37.2%). However, 79.5% felt e-cigarette safety information was important. Over one-third said they would turn to a doctor first for e-cigarette safety information, though almost a quarter said they would turn to the Internet or product packaging first. Most (59.6%) ranked doctors as the most trustworthy risk source, and 6.8% had asked a health professional about e-cigarettes. Future research should explore the content of e-cigarette information sources, their potential impact, and ways they might be strengthened or changed through regulatory and/or educational efforts.

  3. Smoking topography and abstinence in adult female smokers.

    Science.gov (United States)

    McClure, Erin A; Saladin, Michael E; Baker, Nathaniel L; Carpenter, Matthew J; Gray, Kevin M

    2013-12-01

    Preliminary evidence, within both adults and adolescents, suggests that the intensity with which cigarettes are smoked (i.e., smoking topography) is predictive of success during a cessation attempt. These reports have also shown topography to be superior compared to other variables, such as cigarettes per day, in the prediction of abstinence. The possibility that gender may influence this predictive relationship has not been evaluated but may be clinically useful in tailoring gender-specific interventions. Within the context of a clinical trial for smoking cessation among women, adult daily smokers completed a laboratory session that included a 1-hour ad libitum smoking period in which measures of topography were collected (N=135). Participants were then randomized to active medication (nicotine patch vs. varenicline) and abstinence was monitored for 4weeks. Among all smoking topography measures and all abstinence outcomes, a moderate association was found between longer puff duration and greater puff volume and continued smoking during the active 4-week treatment phase, but only within the nicotine patch group. Based on the weak topography-abstinence relationship among female smokers found in the current study, future studies should focus on explicit gender comparisons to examine if these associations are specific to or more robust in male smokers. © 2013 Elsevier Ltd. All rights reserved.

  4. Smoking patterns and stimulus control in intermittent and daily smokers.

    Directory of Open Access Journals (Sweden)

    Saul Shiffman

    Full Text Available Intermittent smokers (ITS - who smoke less than daily - comprise an increasing proportion of adult smokers. Their smoking patterns challenge theoretical models of smoking motivation, which emphasize regular and frequent smoking to maintain nicotine levels and avoid withdrawal, but yet have gone largely unexamined. We characterized smoking patterns among 212 ITS (smoking 4-27 days per month compared to 194 daily smokers (DS; smoking 5-30 cigarettes daily who monitored situational antecedents of smoking using ecological momentary assessment. Subjects recorded each cigarette on an electronic diary, and situational variables were assessed in a random subset (n=21,539 smoking episodes; parallel assessments were obtained by beeping subjects at random when they were not smoking (n=26,930 non-smoking occasions. Compared to DS, ITS' smoking was more strongly associated with being away from home, being in a bar, drinking alcohol, socializing, being with friends and acquaintances, and when others were smoking. Mood had only modest effects in either group. DS' and ITS' smoking were substantially and equally suppressed by smoking restrictions, although ITS more often cited self-imposed restrictions. ITS' smoking was consistently more associated with environmental cues and contexts, especially those associated with positive or "indulgent" smoking situations. Stimulus control may be an important influence in maintaining smoking and making quitting difficult among ITS.

  5. Smoking Patterns and Stimulus Control in Intermittent and Daily Smokers

    Science.gov (United States)

    Shiffman, Saul; Dunbar, Michael S.; Li, Xiaoxue; Scholl, Sarah M.; Tindle, Hilary A.; Anderson, Stewart J.; Ferguson, Stuart G.

    2014-01-01

    Intermittent smokers (ITS) – who smoke less than daily – comprise an increasing proportion of adult smokers. Their smoking patterns challenge theoretical models of smoking motivation, which emphasize regular and frequent smoking to maintain nicotine levels and avoid withdrawal, but yet have gone largely unexamined. We characterized smoking patterns among 212 ITS (smoking 4–27 days per month) compared to 194 daily smokers (DS; smoking 5–30 cigarettes daily) who monitored situational antecedents of smoking using ecological momentary assessment. Subjects recorded each cigarette on an electronic diary, and situational variables were assessed in a random subset (n = 21,539 smoking episodes); parallel assessments were obtained by beeping subjects at random when they were not smoking (n = 26,930 non-smoking occasions). Compared to DS, ITS' smoking was more strongly associated with being away from home, being in a bar, drinking alcohol, socializing, being with friends and acquaintances, and when others were smoking. Mood had only modest effects in either group. DS' and ITS' smoking were substantially and equally suppressed by smoking restrictions, although ITS more often cited self-imposed restrictions. ITS' smoking was consistently more associated with environmental cues and contexts, especially those associated with positive or “indulgent” smoking situations. Stimulus control may be an important influence in maintaining smoking and making quitting difficult among ITS. PMID:24599056

  6. An overview of oral mucosa condition of shisha smoker

    Directory of Open Access Journals (Sweden)

    Rahmi Amtha

    2016-08-01

    Full Text Available Shisha is a water pipe that tobacco extract and fruit scented burnt using coal. It produces the smoke through the vessel and inhaled using a hose with good taste. The culture of shisha smoking is popular in Midle East country that curently has been also entering Indonesia. The side effect of shisha smoking habit is still very rare reported. Aim of this study is to describe the oral mucosa condition of shisha user. A preliminary observasional study was conducted at several sisha cafe at South Jakarta. Under informed consent, subject with habit of tobacco and shisha smoker were included. Sociodemographic data (age, gender, duration, frequency of smoking, salivary flow rate and oral mucosa changes were documented. Eighteen subjects were recruited into this study. Most of shisha smoker was also tobacco smoker. Shisha was more practiced by male at  age (15-24 years old. The oral mucosa changes such as keratosis, melanosis, leukoedema, coated tongue, gingivitis and xerostomia were found on subject with habit of tobacco smoking habit only or both shisha and tobacco smoking. In conclusion apparently the shisha smoking habit may casue oral mucosa changes almost the same with tobacco smoking habit

  7. Increased levels of metallothionein in placenta of smokers

    International Nuclear Information System (INIS)

    Ronco, Ana Maria; Arguello, Graciela; Suazo, Myriam; Llanos, Miguel N.

    2005-01-01

    Experiments were designed to evaluate and compare metallothionein (MT), zinc and cadmium levels in human placentas of smoking and non-smoking women. Smoking was assessed by self-reported cigarette consumption and urine cotinine levels before delivery. Smoking pregnant women with urine cotinine levels higher than 130 ng/ml were included in the smoking group. Determination of placental MT was performed by western blot analysis after tissue homogenization and saturation with cadmium chloride (1000 ppm). Metallothionein was analyzed with a monoclonal antibody raised against MT-1 and MT-2 and with a second anti mouse antibody conjugated to alkaline phosphatase. Zinc and cadmium were determined by neutron activation analysis and atomic absorption spectrometry respectively. Smokers showed higher placental MT and cadmium levels, together with decreased newborn birth weights, as compared to non-smokers. The semi-quantitative analysis of western blots by band densitometry indicated that darker bands corresponded to MT present in smokers' samples. This study confirms that cigarette smoking increases cadmium accumulation in placental tissue and suggests that this element has a stimulatory effect on placental MT production

  8. Mucociliary clearance and its relation with the level of physical activity in daily life in healthy smokers and nonsmokers

    Directory of Open Access Journals (Sweden)

    M. Proença

    2012-09-01

    Full Text Available Objectives: To investigate the relationship between mucociliary transport and physical activity in daily life (PADL in smokers and nonsmokers. Methods: Fifty-two current smokers were submitted to an assessment of mucociliary transport (saccharin transit time, STT, carbon monoxide levels in the exhaled air, lung function and smoking history. In addition, subjects kept a pedometer worn at the waist for six days in order to determine their level of PADL (steps/day. The tests were also performed on 30 matched healthy nonsmokers who served as control group. Results: Light smokers (≤15 cigarettes/day had a STT of 9 (7–11 min (median [confidence interval], which was similar to nonsmokers (8 [8–11] min; p = 0.8. Both moderate (16–25 cigarettes/day and heavy (>25 cigarettes/day smokers had a significantly higher STT (13 [11–17] min and 13 [10–21] min, respectively than nonsmokers and light smokers (p  0.05 for all. In the general group of smokers, STT was not significantly correlated with PADL, pack/years index, years of smoking or age (r  0.09 for all. There was significant negative correlation between STT and PADL only in light smokers (r = −0.55; p = 0.02 and nonsmokers (r = −0.42; p = 0.02, but not in moderate and heavy smokers. Conclusion: In light smokers and non-smokers, better mucociliary function is associated to higher daily physical activity level, as opposed to the decreased mucociliary function observed in smokers, i.e., those with moderate and heavy cigarette consumption. Resumo: Objetivos: Investigar a relação entre o transporte mucociliar e a atividade física na vida diária (AFVD em fumantes e não fumantes. Métodos: Cinquenta e dois fumantes foram submetidos à avaliação do transporte mucociliar (Tempo de Trânsito de Sacarina, TTS, dos níveis de monóxido de carbono no ar expirado, da função pulmonar e do hist

  9. Corrosion issues of powder coated AA6060 aluminium profiles

    DEFF Research Database (Denmark)

    Din, Rameez Ud; Valgarðsson, Smári; Jellesen, Morten Stendahl

    2015-01-01

    In this study detailed microstructural investigation of the reason for unexpected corrosion of powder coated aluminium alloy AA6060 windows profiles has been performed. The results from this study reveals that the failure of the window profiles was originated from the surface defects present...... on the extruded AA6060 aluminium profile after metallurgical process prior to powder coating. Surface defects are produced due to intermetallic particles in the alloy, which disturb the flow during the extrusion process. The corrosion mechanism leading to the failure of the powder coated AA6060 aluminium profiles...

  10. Software papers and citation in the AAS Journals

    Science.gov (United States)

    Robitaille, Thomas; Lintott, Chris

    2018-01-01

    At the start of 2016, AAS Publishing released a policy statement that officially opened the door for papers describing novel software to be published in the AAS Journals without a requirement for novel results to also be included. This statement also describes how the use of software should be cited in articles. In this talk, I will give an overview of this policy and will give an overview of the growth of software papers and software citation in AAS Journals over the last two years.

  11. Effect of pressurized steam on AA1050 aluminium

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Møller, Per; Ambat, Rajan

    2012-01-01

    Purpose - The purpose of this paper is to understand the effect of pressurized steam on surface changes, structures of intermetallic particles and corrosion behavior of AA1050 aluminium. Design/methodology/approach - Industrially pure aluminium (AA1050, 99.5 per cent) surfaces were exposed...... reactivities was observed due to the formation of the compact oxide layer. Originality/value - This paper reveals a detailed investigation of how pressurized steam can affect the corrosion behaviour of AA1050 aluminium and the structure of Fe-containing intermetallic particles....

  12. Compounds enhanced in a mass spectrometric profile of smokers' exhaled breath versus non-smokers as determined in a pilot study using PTR-MS.

    Science.gov (United States)

    Kushch, Ievgeniia; Schwarz, Konrad; Schwentner, Lukas; Baumann, Bettina; Dzien, Alexander; Schmid, Alex; Unterkofler, Karl; Gastl, Günter; Spaněl, Patrik; Smith, David; Amann, Anton

    2008-06-01

    A pilot study has been carried out to define typical characteristics of the trace gas compounds in exhaled breath of non-smokers and smokers to assist interpretation of breath analysis data from patients who smoke with respiratory diseases and lung cancer. Exhaled breath was analyzed using proton transfer reaction-mass spectrometry (PTR-MS) for 370 volunteers (81 smokers, 210 non-smokers, 79 ex-smokers). Volatile organic compounds corresponding to product ions at seven mass-to-charge ratios (m/z 28, 42, 69, 79, 93, 97, 123) in the PTR-MS spectra differentiated between smokers and non-smokers. The Youden index (= maximum of sensitivity + specificity - 1, YI) as a measure for differentiation between smokers and non-smokers was YI = 0.43 for ions at the m/z values 28 (tentatively identified as HCN), YI = 0.75 for m/z = 42 (tentatively identified as acetonitrile) and YI = 0.53 for m/z = 79 (tentatively identified as benzene). No statistically significant difference between smokers and non-smokers was observed for the product ions at m/z = 31 and 33 (compounds tentatively identified as formaldehyde and methanol). When interpreting the exhaled breath of lung cancer or COPD patients, who often smoke, compounds appearing at the above-mentioned seven mass-to-charge ratios should be considered with appropriate care to avoid misdiagnosis. Validation studies in larger numbers of patients with more precise delineation of their smoking behavior and using additional analytical techniques such as GC/MS and SIFT-MS should be carried out.

  13. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA14Q.Seq.d/ Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  14. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...19Q.Seq.d/ Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA

  15. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA17Q.Seq.d/ Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  16. Simulation de la formabilite des alliages d'aluminium AA5754 et AA6063

    Science.gov (United States)

    Eljaafari, Samira

    Les besoins de reduction du poids se sont concretement traduits par l'introduction de nouvelles nuances plus legeres dans les structures automobiles. Ainsi, des alliages d'aluminium ont commence a etre integres dans les pieces de structure de plusieurs vehicules. La faible masse volumique des alliages d'aluminium (2,7g/cm3) permet d'alleger le poids du vehicule qui entraine une diminution de la consommation de carburant et, donc, des emissions de gaz a effet de serre. La striction et la rupture sont les principaux modes de defaillance qui entrainent le rebut systematique des pieces. C'est pourquoi, ameliorer la prediction d'apparition de ces defauts lors de la simulation va dans le sens d'une meilleure maitrise du procede. Dans le cadre de ce travail doctoral, deux modeles sont developpes pour simuler le comportement a grandes deformations d'alliages d'aluminium: un modele polycristallin de type Taylor et un modele a un ou plusieurs elements finis par grain. Les diagrammes limites de formage (DLF) pour les deux alliages d'aluminium AA5754 et AA6063 ont ete simules numeriquement en utilisant une formulation par elements finis pour les polycristaux basee sur l'hypothese de Taylor. Les DLF conventionnels et de l'hydroformage ont ete traces. L'effet des chemins de deformation sur la formabilite des alliages d'aluminium a aussi ete etudie. Finalement, des simulations numeriques avec les donnees de diffraction des electrons retrodiffuses (EBSD) pour 1'alliage d'aluminium AA5754 ont ete effectuees en utilisant le modele a un ou plusieurs elements par grain. Ces simulations sont executees avec differents modeles du durcissement (Asaro, Bassani et puissance). Mots-cles: Formabilite; Alliage d'aluminium; Hydroformage; Glissement cristallographique; Durcissement; Calcul parallele; Diagramme limite de formage (DLF); Diffraction electron.

  17. Changes in volume-corrected whole-lung density in smokers and former smokers during the ITALUNG screening trial.

    Science.gov (United States)

    Mascalchi, Mario; Sverzellati, Nicola; Falchini, Massimo; Favilli, Giuditta; Lombardo, Simone; Macconi, Letizia; Paci, Eugenio; Pegna, Andrea Lopes; Falaschi, Fabio; Zompatori, Maurizio; Diciotti, Stefano

    2012-07-01

    To evaluate with a volume-corrected whole-lung approach changes in lung density over 2 years consistent with progression of pulmonary emphysema in smokers and former smokers enrolled in the ITALUNG trial of lung cancer screening using low-dose computed tomography (LDCT). A total of 103 subjects (mean age 63±4 y with a pack-year history of at least 20) underwent 2 whole-lung LDCT examinations 2 years apart. Visual assessment was made independently by 2 experienced observers on the initial LDCT examination with a 0 to 4 grading system for each of 6 regions (right and left upper, mid, and lower lung). The whole-lung 15th percentile of attenuation coefficient and relative area (RA) at -910 HU, both corrected to the individual lung volume (Perc15v and RA910v), were measured on the 2 LDCT examinations. The intrasubject variability of Perc15v and RA910v was previously determined in 32 other subjects of the trial examined using the same scanner and technique twice over a 3-month interval for suspicious nodules. The 2 operators agreed on the presence of mild to severe emphysema (visual score ≥1 in at least 1 region) at initial LDCT examination in 24 (23%) of the 103 subjects. Fifteen subjects (15%) showed a Perc15v change between the 2 examinations exceeding the lower 95% limit of agreement, indicating progression of emphysema with a mean difference in lung density of -14.7%±2.6%. Ten of the 15 were identified as showing emphysema progression by RA910v as well. No association was observed between progression of emphysema and visual evidence of emphysema at initial LDCT examination, smoking status, or pack-years at baseline, or intervening changes in smoking habits. Once variations in inspiratory lung volumes are taken into account, changes in lung density over 2 years consistent with progression of pulmonary emphysema in elderly smokers and former smokers are uncommon.

  18. Bridges, Lights, and Hubris: Examples of Excessive Light Pollution

    Science.gov (United States)

    Upgren, A. R.

    2000-12-01

    Recently many new lighting projects have been planned, frequently for the purpose of bringing attention to a tower or bridge, with the intent of promoting it as a tourist attraction. Examples of this form of light pollution are illustrated here. Many proceed with plans to mount new floodlights pointed upward with most of the light shining directly up into the sky. At least three of the more excessive among them have been tabled or aborted upon objections by members of the International Dark-Sky Association and other environmental groups. Opposition to the most ill-conceived of these plans centers on waste of money and energy, excessive fatalities among migratory birds, damage to the aesthetic beauty and study of the night sky, and (near seacoasts) damage to the nesting and hatching of sea turtles. Constructive opposition to lighting excess and glare may include the substitution of tracer lights, such as the ones that adorn the great suspension bridges of New York and San Francisco. Tracer lights using full-cutoff shielding outline a structure much as lights on a Christmas tree delineate its shape, but floodlights in the mix render a washed-out effect similar to a Christmas tree in broad daylight. The AAS Committee on Light Pollution, Radio Interference, and Space Debris encourages a greater role for the Society in coordinating opposition to such projects, which is too often local and inexperienced.

  19. Male smoker and non-smoker responses to television advertisements on the harms of secondhand smoke in China, India and Russia.

    Science.gov (United States)

    Murukutla, Nandita; Bayly, Megan; Mullin, Sandra; Cotter, Trish; Wakefield, Melanie

    2015-02-01

    Mass media campaigns can play an important role in strengthening support for smoke-free policies and reducing exposure to secondhand smoke (SHS). Identifying anti-SHS advertisements that are effective in diverse cultural contexts may allow for resource sharing in low- and middle-income countries. A convenience sample of 481 male cigarette smokers and non-smokers in three high tobacco burden and culturally dissimilar countries (India, China and Russia) viewed and rated five anti-SHS ads. Multivariate logistic regression analyses were conducted for 'Message Acceptance', 'Negative Emotion', 'Perceived Effectiveness' and 'Behavioral Intentions'. Smokers and non-smokers in all countries consistently rated the strong graphic, health harm ads as the most effective, and the 'informational' ad as the least effective overall: the graphic ad 'Baby Alive' was at least 1.8 times more likely than the informational ad 'Smoke-free works' to receive positive ratings on all four outcomes (all P < 0.001). Graphic, health harm messages about SHS exposure have the greatest universal appeal and are the most effective in motivating changes in behavioral intentions. Similarity in reactions between smokers and non-smokers, and across countries, suggests that resource sharing and the use of a single graphic ad targeted at smokers and non-smokers would be cost-efficient strategies. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  20. A&A Painting and Restoration Co., Inc. Information Sheet

    Science.gov (United States)

    A&A Painting and Restoration Co., Inc. (the Company) is located in Great Mills, Maryland. The settlement involves renovation activities conducted at properties constructed prior to 1978, located in Drayden, Maryland.

  1. A P-Glycoprotein Is Linked to Resistance to the Bacillus thuringiensis Cry3Aa Toxin in a Leaf Beetle

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    2016-12-01

    Full Text Available Chrysomela tremula is a polyvoltine oligophagous leaf beetle responsible for massive attacks on poplar trees. This beetle is an important model for understanding mechanisms of resistance to Bacillus thuringiensis (Bt insecticidal toxins, because a resistant C. tremula strain has been found that can survive and reproduce on transgenic poplar trees expressing high levels of the Cry3Aa Bt toxin. Resistance to Cry3Aa in this strain is recessive and is controlled by a single autosomal locus. We used a larval midgut transcriptome for C. tremula to search for candidate resistance genes. We discovered a mutation in an ABC protein, member of the B subfamily homologous to P-glycoprotein, which is genetically linked to Cry3Aa resistance in C. tremula. Cultured insect cells heterologously expressing this ABC protein swell and lyse when incubated with Cry3Aa toxin. In light of previous findings in Lepidoptera implicating A subfamily ABC proteins as receptors for Cry2A toxins and C subfamily proteins as receptors for Cry1A and Cry1C toxins, this result suggests that ABC proteins may be targets of insecticidal three-domain Bt toxins in Coleoptera as well.

  2. Pathology of AA amyloidosis in domestic sheep and goats.

    Science.gov (United States)

    Ménsua, C; Carrasco, L; Bautista, M J; Biescas, E; Fernández, A; Murphy, C L; Weiss, D T; Solomon, A; Luján, L

    2003-01-01

    We describe the main pathologic changes in small ruminants affected by AA amyloidosis, together with the partial sequence of the protein involved. Twenty-one sheep and one goat were selected for presenting macroscopic kidney lesions compatible with systemic amyloidosis. Available tissue samples were studied by histologic, immunopathologic, and ultrastructural means. Renal lesions were characterized grossly by pale cortical surfaces with scattered, miliary, whitish-yellow foci and on cut cortical surfaces by straight, whitish-yellow striations. Gangrenous pneumonia was observed in 16 out of 21 affected sheep (76.2%), although other chronic inflammations were also observed. Amyloid was detected in all grossly affected kidneys using Congo red staining, lesions being most remarkable in glomeruli, affecting 95.5% of animals studied. Congophilic deposits were also observed in intertubular interstitium (68.2%) and medulla (57.1%). All amyloid-affected animals presented proximal convoluted tubule lesions, mostly characterized by an increase in diameter and by hyaline granular degeneration that were responsible for the macroscopic appearance of the kidney. Histologically, amyloid was also seen in blood vessels, spleen, liver, lymph nodes, gastrointestinal tract, and adrenal glands. All amyloid deposits demonstrated greenish-yellow birefringence with polarized light, and the antisera prepared against goat amyloid extracts specifically reacted with birefringent congophilic deposits of both sheep and goats. Ultrastructurally, these deposits were formed by masses of straight, nonbranching fibrils located predominantly in the basement membranes of glomerular capillaries and in the mesangium. Partial sequence of the protein in sheep and goats indicated a high degree of homology with the previously reported sequence of sheep Serum Amyloid A.

  3. A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.

    Science.gov (United States)

    Lutz, Sharon M; Cho, Michael H; Young, Kendra; Hersh, Craig P; Castaldi, Peter J; McDonald, Merry-Lynn; Regan, Elizabeth; Mattheisen, Manuel; DeMeo, Dawn L; Parker, Margaret; Foreman, Marilyn; Make, Barry J; Jensen, Robert L; Casaburi, Richard; Lomas, David A; Bhatt, Surya P; Bakke, Per; Gulsvik, Amund; Crapo, James D; Beaty, Terri H; Laird, Nan M; Lange, Christoph; Hokanson, John E; Silverman, Edwin K

    2015-12-03

    Pulmonary function decline is a major contributor to morbidity and mortality among smokers. Post bronchodilator FEV1 and FEV1/FVC ratio are considered the standard assessment of airflow obstruction. We performed a genome-wide association study (GWAS) in 9919 current and former smokers in the COPDGene study (6659 non-Hispanic Whites [NHW] and 3260 African Americans [AA]) to identify associations with spirometric measures (post-bronchodilator FEV1 and FEV1/FVC). We also conducted meta-analysis of FEV1 and FEV1/FVC GWAS in the COPDGene, ECLIPSE, and GenKOLS cohorts (total n = 13,532). Among NHW in the COPDGene cohort, both measures of pulmonary function were significantly associated with SNPs at the 15q25 locus [containing CHRNA3/5, AGPHD1, IREB2, CHRNB4] (lowest p-value = 2.17 × 10(-11)), and FEV1/FVC was associated with a genomic region on chromosome 4 [upstream of HHIP] (lowest p-value = 5.94 × 10(-10)); both regions have been previously associated with COPD. For the meta-analysis, in addition to confirming associations to the regions near CHRNA3/5 and HHIP, genome-wide significant associations were identified for FEV1 on chromosome 1 [TGFB2] (p-value = 8.99 × 10(-9)), 9 [DBH] (p-value = 9.69 × 10(-9)) and 19 [CYP2A6/7] (p-value = 3.49 × 10(-8)) and for FEV1/FVC on chromosome 1 [TGFB2] (p-value = 8.99 × 10(-9)), 4 [FAM13A] (p-value = 3.88 × 10(-12)), 11 [MMP3/12] (p-value = 3.29 × 10(-10)) and 14 [RIN3] (p-value = 5.64 × 10(-9)). In a large genome-wide association study of lung function in smokers, we found genome-wide significant associations at several previously described loci with lung function or COPD. We additionally identified a novel genome-wide significant locus with FEV1 on chromosome 9 [DBH] in a meta-analysis of three study populations.

  4. Characteristics of AA amyloidosis patients in San Francisco.

    Science.gov (United States)

    Lejmi, Hiba; Jen, Kuang-Yu; Olson, Jean L; James, Sam H; Sam, Ramin

    2016-04-01

    AA amyloidosis due to subcutaneous injection of drugs of abuse has been described in the USA, but all the existing literature is from more than 20 years ago. There is more recent literature from Europe. We have observed a high incidence of AA amyloidosis in the county hospital in San Francisco. Here, we describe 24 patients who had kidney biopsy-proven AA amyloidosis from our hospital from 1998 to 2013. All the patients were thought to have AA amyloidosis from skin popping of illicit drugs after having exhausted the intravenous route. These patients with biopsy-proven AA amyloidosis were analysed further. All patients were found to have hepatitis C infection, hypertension was not common, most had advanced kidney failure, and acidosis was common as was tubulointerstitial involvement on the kidney biopsy. Other organ involvement included hepatomegaly and splenomegaly in a number of patients; direct myocardial involvement was not seen, but pulmonary hypertension, history of deep vein thrombosis and pulmonary embolism were common. The prognosis of these patients was poor. The mortality rate approached 50% 1 year after biopsy, and most of the patient needed dialysis shortly after diagnosis. Cessation of drug use seemed beneficial but rarely achievable. AA amyloidosis from skin popping is common in San Francisco. Most patients with renal involvement end up on dialysis, and mortality rates are exceedingly high. © 2015 Asian Pacific Society of Nephrology.

  5. Bake hardening of nanograin AA7075 aluminum alloy

    International Nuclear Information System (INIS)

    Dehghani, Kamran

    2011-01-01

    Highlights: ► The bake hardening behavior of AA7075 was studied and compared with its coarse-grain counterpart. ► Nanograin AA7075 exhibited 88–100% increase in bake hardenability. ► Nanograin AA7075 exhibited 36–38% increase in final yield strength after baking. ► Maximum bake hardenability and final yield stress were about 185 MPa and 719 MPa. - Abstract: In the present work, the bake hardening of nanostructured AA7075 aluminum alloy was compared with that of its coarse-grain counterpart. Surface severe plastic deformation (SSPD) was used to produce nanograin layers on both surfaces of workpieces. The nanostructured layers were characterized using scanning electron microscopy (SEM) and atomic force microscopy (AFM) techniques. The thickness of nanostructured layer, having the grains of 50–110 nm, was about 75 μm on each side of workpiece. The bake hardenability of nanograin and coarse-grain AA7075 was then compared by pre-straining to 2, 4 and 6% followed by baking at 100 °C and 200 °C for 20 min. Comparing to coarse-grain case, there was about 88–100% increase in bake hardenability and about 36–38% increase in yield strength after the bake hardening of present nanograin AA7075. Such an increase in bake hardenability and strength was achieved when the thickness of two nanograin layers was about only one-tenth of the whole thickness.

  6. Altered interhemispheric resting-state functional connectivity in young male smokers.

    Science.gov (United States)

    Yu, Dahua; Yuan, Kai; Bi, Yanzhi; Luo, Lin; Zhai, Jinquan; Liu, Bo; Li, Yangding; Cheng, Jiadong; Guan, Yanyan; Xue, Ting; Bu, Limei; Su, Shaoping; Ma, Yao; Qin, Wei; Tian, Jie; Lu, Xiaoqi

    2018-03-01

    With the help of advanced neuroimaging approaches, previous studies revealed structural and functional brain changes in smokers compared with healthy non-smokers. Homotopic resting-state functional connectivity between the corresponding regions in cerebral hemispheres may help us to deduce the changes of functional coordination in the whole brain of young male smokers. Functional homotopy reflects an essential aspect of brain function and communication between the left and right cerebral hemispheres, which is important for the integrity of brain function. However, few studies used voxel mirrored homotopic connectivity (VMHC) method to investigate the changes of homotopic connectivity in young male smokers. Twenty-seven young male smokers and 27 matched healthy male non-smokers were recruited in our study. Compared with healthy male non-smokers, young male smokers showed decreased VMHC values in the insula and putamen, and increased VMHC values in the prefrontal cortex. Correlation analysis demonstrated that there were significant positive correlations between the average VMHC values of the prefrontal cortex and pack-years in young male smokers. In addition, significant negative correlation was found between the average VMHC values in the insula and pack-years. Our results revealed the disrupted homotopic resting-state functional connectivity in young male smokers. The novel findings may extend our understanding of smoking. © 2017 Society for the Study of Addiction.

  7. Characteristics of hardcore smokers in South Korea from 2007 to 2013.

    Science.gov (United States)

    Kang, EunKyo; Lee, Jung A; Cho, Hong-Jun

    2017-05-26

    As the prevalence of smoking decreased in western countries, a significant proportion of smokers appeared to be particularly resistant to quitting- "hardcore" smokers. This study examines the characteristics of hardcore smokers in South Korea. We used the data from 2007 to 2013 from the Korea National Health and Nutrition Examination Survey. Hardcore smoking was defined as (1) smoking >15 cigarettes per day, (2) having no plans of quitting, and (3) having made no attempts to quit. Multiple logistic regression analyses were used to investigate the association between various sociodemographic variables and hardcore smoking. The proportion of hardcore smokers among smokers did not change significantly from 23.1% in 2007 to 23.0% in 2013. None of the three characteristics of hardcore smokers for either gender showed a significant change from 2007 to 2013. Multiple logistic regression analysis showed that hardcore smokers were 1.64 times (95% confidence interval [CI], 1.28-2.11) greater among those aging 40-49 years than among those aging 19-29 years, and four times greater among men than women. Never-married smokers were less likely to be hardcore smokers than married ones (odds ratio 0.79; 95% CI, 0.66-0.96). Household income and education level did not have any significant association with the likelihood of a hardcore smoker. Hardcore smoking was more prevalent among men, unmarried men and those aging 40-49 years.

  8. Pulmonary function responses to ozone in smokers with a limited smoking history.

    Science.gov (United States)

    Bates, Melissa L; Brenza, Timothy M; Ben-Jebria, Abdellaziz; Bascom, Rebecca; Eldridge, Marlowe W; Ultman, James S

    2014-07-01

    In non-smokers, ozone (O3) inhalation causes decreases in forced expiratory volume (FEV1) and dead space (VD) and increases the slope of the alveolar plateau (SN). We previously described a population of smokers with a limited smoking history that had enhanced responsiveness to brief O3 boluses and aimed to determine if responsiveness to continuous exposure was also enhanced. Thirty smokers (19M, 11F, 24±4 years, 6±4 total years smoking,4±2 packs/week) and 30 non-smokers (17M, 13F, 25±6 years) exercised for 1h on a cycle ergometer while breathing 0.30ppm O3. Smokers and non-smokers were equally responsive in terms of FEV1 (-9.5±1.8% vs -8.7±1.9%). Smokers alone were responsive in terms of VD (-6.1±1.2%) and SN (9.1±3.4%). There was no difference in total delivered dose. Dead space ventilation (VD/VT) was not initially different between the two groups, but increased in the non-smokers (16.4±2.8%) during the exposure, suggesting that the inhaled dose may be distributed more peripherally in smokers. We also conclude that these cigarette smokers retain their airway responsiveness to O3 and, uniquely, experience changes in VD that lead to heterogeneity in airway morphometry and an increase in SN. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Menthol cigarette smoking and obesity in young adult daily smokers in Hawaii

    Directory of Open Access Journals (Sweden)

    Alyssa Marie M. Antonio

    2015-01-01

    Full Text Available This study investigates 1 the relationship between menthol cigarette smoking and obesity and 2 the association of body mass index with the nicotine metabolite ratio among menthol and non-menthol daily smokers aged 18–35 (n = 175. A brief survey on smoking and measures of height and weight, carbon monoxide, and saliva samples were collected from participants from May to December 2013 in Honolulu, Hawaii. Multiple regression was used to estimate differences in body mass index among menthol and non-menthol smokers and the association of menthol smoking with obesity. We calculated the log of the nicotine metabolite ratio to examine differences in the nicotine metabolite ratio among normal, overweight, and obese smokers. Sixty-eight percent of smokers used menthol cigarettes. Results showed that 62% of normal, 54% of overweight, and 91% of obese smokers used menthol cigarettes (p = .000. The mean body mass index was significantly higher among menthol compared with non-menthol smokers (29.4 versus 24.5, p = .000. After controlling for gender, marital status, educational attainment, employment status, and race/ethnicity, menthol smokers were more than 3 times as likely as non-menthol smokers to be obese (p = .04. The nicotine metabolite ratio was significantly lower for overweight menthol smokers compared with non-menthol smokers (.16 versus .26, p = .02 in the unadjusted model, but was not significant after adjusting for the covariates. Consistent with prior studies, our data show that menthol smokers are more likely to be obese compared with non-menthol smokers. Future studies are needed to determine how flavored tobacco products influence obesity among smokers.

  10. Clinical and microbiological effects of mechanical instrumentation and local antimicrobials during periodontal supportive therapy in aggressive periodontitis patients: smoker versus non-smoker patients.

    Science.gov (United States)

    Guarnelli, Maria Elena; Farina, Roberto; Cucchi, Alessandro; Trombelli, Leonardo

    2010-11-01

    To compare the clinical and microbiological effects of ultrasonic mechanical instrumentation (UMI) associated to home-care use of amine fluoride/stannous fluoride (AmF/SnF(2) )-containing mouthrinse and toothpaste in smoker and non-smoker patients affected by generalized aggressive periodontitis (G-AgP) during a recall session of supportive periodontal therapy (SPT). Thirteen smokers and 25 non-smokers G-AgP patients enrolled in an SPT programme received a single session of UMI associated with home-care use of AmF/SnF(2) -containing mouthrinse and toothpaste. Clinical and microbiological parameters were assessed pre-treatment, at 6 and 12 weeks post-treatment. In both groups, UMI plus AmF/SnF(2) -implemented oral hygiene use determined a significant decrease of total bacterial counts, with non-smokers exhibiting a lower count compared with smokers at 12 weeks. No significant differences were observed between smokers and non-smokers in the counts of total pathogens and red complex species at each observation interval. Clinically, a significant reduction of supragingival plaque, gingival inflammation and probing pocket depth was similarly observed in both groups. A combined mechanical/chemical plaque control approach based on UMI and the use of AmF/SnF(2) agents resulted in the reduction of supragingival plaque deposits, gingival inflammation and subgingival periodontal pathogens in G-AgP patients during SPT, with no substantial difference between smokers and non-smokers. © 2010 John Wiley & Sons A/S.

  11. A novel Cry9Aa with increased toxicity for Spodoptera exigua (Hübner)

    NARCIS (Netherlands)

    Naimov, S.; Nedyalkova, R.; Staykov, N.; Weemen-Hendriks, M.; Minkov, I.; Maagd, de R.A.

    2014-01-01

    Cry9Aa, produced by Bacillus thuringiensis is reported to be not active against Spodoptera exigua (beet armyworm). In this study we have cloned a new cry9Aa5 gene encoding a protoxin with increased activity against S. exigua as compared to Cry9Aa1. When aligned to Cry9Aa1, four amino acid

  12. Light Pollution

    Science.gov (United States)

    Riegel, Kurt W.

    1973-01-01

    Outdoor lighting is light pollution which handicaps certain astronomical programs. Protective measures must be adopted by the government to aid observational astronomy without sacrificing legitimate outdoor lighting needs. (PS)

  13. Cytopathological effects of Bacillus sphaericus Cry48Aa/Cry49Aa toxin on binary toxin-susceptible and -resistant Culex quinquefasciatus larvae.

    Science.gov (United States)

    de Melo, Janaina Viana; Jones, Gareth Wyn; Berry, Colin; Vasconcelos, Romero Henrique Teixeira; de Oliveira, Cláudia Maria Fontes; Furtado, André Freire; Peixoto, Christina Alves; Silva-Filha, Maria Helena Neves Lobo

    2009-07-01

    The Cry48Aa/Cry49Aa mosquitocidal two-component toxin was recently characterized from Bacillus sphaericus strain IAB59 and is uniquely composed of a three-domain Cry protein toxin (Cry48Aa) and a binary (Bin) toxin-like protein (Cry49Aa). Its mode of action has not been elucidated, but a remarkable feature of this protein is the high toxicity against species from the Culex complex, besides its capacity to overcome Culex resistance to the Bin toxin, the major insecticidal factor in B. sphaericus-based larvicides. The goal of this work was to investigate the ultrastructural effects of Cry48Aa/Cry49Aa on midgut cells of Bin-toxin-susceptible and -resistant Culex quinquefasciatus larvae. The major cytopathological effects observed after Cry48Aa/Cry49Aa treatment were intense mitochondrial vacuolation, breakdown of endoplasmic reticulum, production of cytoplasmic vacuoles, and microvillus disruption. These effects were similar in Bin-toxin-susceptible and -resistant larvae and demonstrated that Cry48Aa/Cry49Aa toxin interacts with and displays toxic effects on cells lacking receptors for the Bin toxin, while B. sphaericus IAB59-resistant larvae did not show mortality after treatment with Cry48Aa/Cry49Aa toxin. The cytopathological alterations in Bin-toxin-resistant larvae provoked by Cry48Aa/Cry49Aa treatment were similar to those observed when larvae were exposed to a synergistic mixture of Bin/Cry11Aa toxins. Such effects seemed to result from a combined action of Cry-like and Bin-like toxins. The complex effects caused by Cry48Aa/Cry49Aa provide evidence for the potential of these toxins as active ingredients of a new generation of biolarvicides that conjugate insecticidal factors with distinct sites of action, in order to manage mosquito resistance.

  14. Smoking Expectancies and Intention to Quit in Smokers with Schizophrenia, Schizoaffective Disorder and Non-Psychiatric Controls

    OpenAIRE

    Tidey, Jennifer W.; Rohsenow, Damaris J.

    2009-01-01

    Cigarette smoking expectancies are systematically related to intention to quit smoking in adult smokers without psychiatric illness, but little is known about these relationships in smokers with serious mental illness. In this study, we compared positive and negative smoking expectancies, and examined relationships between expectancies and intention to quit smoking, in smokers with schizophrenia (n = 46), smokers with schizoaffective disorder (n = 35), and smokers without psychiatric illness ...

  15. Influence of Process Parameters in the Friction Surfacing of AA 6082-T6 over AA 2024-T3

    OpenAIRE

    Gandra, J.; Pereira, D.; Miranda, R.M.; Vilaça, P.

    2013-01-01

    VK: T20309 Friction Surfacing is a solid state coating technique with applications in hardfacing, corrosion protection and repair. Since it doesn’t require the fusion of the materials involved, it is suitable to join aluminium alloys while avoiding several of their processing difficulties. The present study addresses the deposition of AA 6082-T6 coatings on AA 2024-T3 substrates, while focusing on the effect of process parameters, such as, axial force, rotation and travel speed. Sound alum...

  16. Lung disease with chronic obstruction in opium smokers in Singapore

    Science.gov (United States)

    Da Costa, J. L.; Tock, E. P. C.; Boey, H. K.

    1971-01-01

    Fifty-four opium smokers with chronic obstructive lung disease were studied for two-and-a-half years. Forty-eight patients had a cough for at least two years before the onset of inappropriate exertional dyspnoea. Fine, bubbling adventitious sounds suggesting small airway disease were heard on auscultation over the middle and lower lobes in 38 patients. The prevalence of inflammatory lung disease and chronic respiratory failure in this series is suggested as the main cause for the frequent finding of right ventricular hypertrophy and congestive heart failure. Physiological studies revealed moderate to severe airways obstruction with gross over-inflation and, in 32 patients, an additional restrictive defect probably due to peribronchiolar fibrosis. Radiological evidence of chronic bronchitis and bronchiolitis was observed in 45 patients, `pure' chronic bronchiolitis in six patients, and `widespread' emphysema in 25 patients respectively. Necropsy examinations in nine patients, however, showed destructive emphysema of variable severity in all. Chronic bronchiolitis often associated with striking bronchiolectasis was present in six cases. More severe bronchiolar rather than bronchial inflammation was noted. The heavy opium smokers had characteristic nodular shadows on chest radiography, sometimes associated with a striking reticular pattern not seen in `pure' cigarette smokers. This was due to gross pigmented dust (presumably carbon) deposition in relation to blood vessels, lymphatics, and bronchioles, and also within the alveoli. It is speculated that the initial lesion is an acquired bronchiolitis. Opium smoking induces an irritative bronchopathy favouring repeated attacks of acute bronchiolitis and eventually resulting in obliterative bronchiolitis, peribronchiolar fibrosis, chronic bronchitis, and destructive emphysema. Images PMID:5134057

  17. [Vaping (electronic cigarette): how to advise smokers in 2017 ?

    Science.gov (United States)

    Jacot Sadowski, Isabelle; Humair, Jean-Paul; Cornuz, Jacques

    2017-06-07

    Questions about electronic cigarettes, also called electronic nicotine delivery systems (ENDS), are very common when advising patients to stop smoking in medical practice. It is widely recognized that the risks of vaping are significantly lower than those of smoking, although there are uncertainties about its long-term health effects. Some studies suggest that vaping helps to stop smoking. Effective smoking cessation medications should be recommended in first line but vaping should not be discouraged when patients choose to use this device, as the main aim is smoking cessation. This paper proposes recommendations about vaping in common situations in medical practice with smokers.

  18. Tobacco harm reduction: an alternative cessation strategy for inveterate smokers

    Directory of Open Access Journals (Sweden)

    Godshall William T

    2006-12-01

    Full Text Available Abstract According to the Centers for Disease Control and Prevention, about 45 million Americans continue to smoke, even after one of the most intense public health campaigns in history, now over 40 years old. Each year some 438,000 smokers die from smoking-related diseases, including lung and other cancers, cardiovascular disorders and pulmonary diseases. Many smokers are unable – or at least unwilling – to achieve cessation through complete nicotine and tobacco abstinence; they continue smoking despite the very real and obvious adverse health consequences. Conventional smoking cessation policies and programs generally present smokers with two unpleasant alternatives: quit, or die. A third approach to smoking cessation, tobacco harm reduction, involves the use of alternative sources of nicotine, including modern smokeless tobacco products. A substantial body of research, much of it produced over the past decade, establishes the scientific and medical foundation for tobacco harm reduction using smokeless tobacco products. This report provides a description of traditional and modern smokeless tobacco products, and of the prevalence of their use in the United States and Sweden. It reviews the epidemiologic evidence for low health risks associated with smokeless use, both in absolute terms and in comparison to the much higher risks of smoking. The report also describes evidence that smokeless tobacco has served as an effective substitute for cigarettes among Swedish men, who consequently have among the lowest smoking-related mortality rates in the developed world. The report documents the fact that extensive misinformation about ST products is widely available from ostensibly reputable sources, including governmental health agencies and major health organizations. The American Council on Science and Health believes that strong support of tobacco harm reduction is fully consistent with its mission to promote sound science in regulation and in

  19. SEPAR-ALAT Consensus Document on Antipneumoccal Vaccination in Smokers.

    Science.gov (United States)

    Jiménez Ruiz, Carlos A; Buljubasich, Daniel; Sansores, Raúl; Riesco Miranda, Juan Antonio; Guerreros Benavides, Alfredo; Luhning, Susana; Chatkin, José Miguel; Zabert, Gustavo; de Granda Orive, José Ignacio; Solano Reina, Segismundo; Casas Herrera, Alejandro; de Lucas Ramos, Pilar

    2015-07-01

    Streptococcus pneumoniae is responsible for several clinical syndromes, such as community-acquired pneumonia, sinusitis, otitis media, and others. The most severe clinical entity caused by this bacteria is undoubtedly invasive pneumococcal disease. Certain factors are known to increase the risk of presenting invasive pneumococcal disease, the most important being smoking habit and underlying concomitant diseases. This article comprises a consensus document on antipneumococcal vaccination in smokers, drawn up by a Smoking Expert Group from the Spanish Society of Pulmonology and Thoracic Surgery and the Latin American Chest Association. Copyright © 2014 SEPAR. Published by Elsevier Espana. All rights reserved.

  20. Effect of heating on the stability of amyloid A (AA) fibrils and the intra- and cross-species transmission of AA amyloidosis.

    Science.gov (United States)

    Ogawa, Saki; Murakami, Tomoaki; Inoshima, Yasuo; Ishiguro, Naotaka

    2015-01-01

    Amyloid A (AA) amyloidosis is a protein misfolding disease characterized by extracellular deposition of AA fibrils. AA fibrils are found in several tissues from food animals with AA amyloidosis. For hygienic purposes, heating is widely used to inactivate microbes in food, but it is uncertain whether heating is sufficient to inactivate AA fibrils and prevent intra- or cross-species transmission. We examined the effect of heating (at 60 °C or 100 °C) and autoclaving (at 121 °C or 135 °C) on murine and bovine AA fibrils using Western blot analysis, transmission electron microscopy (TEM), and mouse model transmission experiments. TEM revealed that a mixture of AA fibrils and amorphous aggregates appeared after heating at 100 °C, whereas autoclaving at 135 °C produced large amorphous aggregates. AA fibrils retained antigen specificity in Western blot analysis when heated at 100 °C or autoclaved at 121 °C, but not when autoclaved at 135 °C. Transmissible pathogenicity of murine and bovine AA fibrils subjected to heating (at 60 °C or 100 °C) was significantly stimulated and resulted in amyloid deposition in mice. Autoclaving of murine AA fibrils at 121 °C or 135 °C significantly decreased amyloid deposition. Moreover, amyloid deposition in mice injected with murine AA fibrils was more severe than that in mice injected with bovine AA fibrils. Bovine AA fibrils autoclaved at 121 °C or 135 °C did not induce amyloid deposition in mice. These results suggest that AA fibrils are relatively heat stable and that similar to prions, autoclaving at 135 °C is required to destroy the pathogenicity of AA fibrils. These findings may contribute to the prevention of AA fibril transmission through food materials to different animals and especially to humans.

  1. Cell recovery in bronchoalveolar lavage fluid in smokers is dependent on cumulative smoking history.

    Directory of Open Access Journals (Sweden)

    Reza Karimi

    Full Text Available BACKGROUND: Smoking is a risk factor for various lung diseases in which BAL may be used as a part of a clinical investigation. Interpretation of BAL fluid cellularity is however difficult due to high variability, in particular among smokers. In this study we aimed to evaluate the effect of smoking on BAL cellular components in asymptomatic smokers. The effects of smoking cessation, age and gender were also investigated in groups of smokers and exsmokers. METHODS: We performed a retrospective review of BAL findings, to our knowledge the largest single center investigation, in our department from 1999 to 2009. One hundred thirty two current smokers (48 males and 84 females and 44 ex-smokers (16 males and 28 females were included. A group of 295 (132 males and 163 females never-smokers served as reference. RESULT: The median [5-95 pctl] total number of cells and cell concentration in current smokers were 63.4 [28.6-132.1]×10(6 and 382.1 [189.7-864.3]×10(6/L respectively and correlated positively to the cumulative smoking history. Macrophages were the predominant cell type (96.7% [90.4-99.0] followed by lymphocytes (2% [0.8-7.7] and neutrophils (0.6% [0-2.9]. The concentration of all inflammatory cells was increased in smokers compared to never smokers and ex-smokers. BAL fluid recovery was negatively correlated with age (p<0.001. Smoking men had a lower BAL fluid recovery than smoking women. CONCLUSION: Smoking has a profound effect on BAL fluid cellularity, which is dependent on smoking history. Our results performed on a large group of current smokers and ex-smokers in a well standardized way, can contribute to better interpretation of BAL fluid cellularity in clinical context.

  2. Nicotinic acetylcholine receptor availability in cigarette smokers: effect of heavy caffeine or marijuana use.

    Science.gov (United States)

    Brody, Arthur L; Hubert, Robert; Mamoun, Michael S; Enoki, Ryutaro; Garcia, Lizette Y; Abraham, Paul; Young, Paulina; Mandelkern, Mark A

    2016-09-01

    Upregulation of α4β2* nicotinic acetylcholine receptors (nAChRs) is one of the most well-established effects of chronic cigarette smoking on the brain. Prior research by our group gave a preliminary indication that cigarette smokers with concomitant use of caffeine or marijuana have altered nAChR availability. We sought to determine if smokers with heavy caffeine or marijuana use have different levels of α4β2* nAChRs than smokers without these drug usages. One hundred and one positron emission tomography (PET) scans, using the radiotracer 2-FA (a ligand for β2*-containing nAChRs), were obtained from four groups of males: non-smokers without heavy caffeine or marijuana use, smokers without heavy caffeine or marijuana use, smokers with heavy caffeine use (mean four coffee cups per day), and smokers with heavy marijuana use (mean 22 days of use per month). Total distribution volume (Vt/fp) was determined for the brainstem, prefrontal cortex, and thalamus, as a measure of nAChR availability. A significant between-group effect was found, resulting from the heavy caffeine and marijuana groups having the highest Vt/fp values (especially for the brainstem and prefrontal cortex), followed by smokers without such use, followed by non-smokers. Direct between-group comparisons revealed significant differences for Vt/fp values between the smoker groups with and without heavy caffeine or marijuana use. Smokers with heavy caffeine or marijuana use have higher α4β2* nAChR availability than smokers without these drug usages. These findings are likely due to increased nicotine exposure but could also be due to an interaction on a cellular/molecular level.

  3. Altered White Matter Integrity in Smokers Is Associated with Smoking Cessation Outcomes

    OpenAIRE

    Huang, Peiyu; Shen, Zhujing; Wang, Chao; Qian, Wei; Zhang, Huan; Yang, Yihong; Zhang, Minming

    2017-01-01

    Smoking is a significant cause of preventable mortality worldwide. Understanding the neural mechanisms of nicotine addiction and smoking cessation may provide effective targets for developing treatment strategies. In the present study, we explored whether smokers have white matter alterations and whether these alterations are related to cessation outcomes and smoking behaviors. Sixty-six smokers and thirty-seven healthy non-smokers were enrolled. The participants underwent magnetic resonance ...

  4. Muscle fatigue resistance during stimulated contractions is reduced in young male smokers.

    NARCIS (Netherlands)

    Morse, C.I.; Wust, R.C.I.; Jones, D.A.; de Haan, A.; Degens, H.

    2007-01-01

    Aim: To determine whether muscle function is compromised in healthy smokers in comparison with activity-matched non-smokers. Methods: Nine male smokers (aged 22.2 ± 2.5 years: mean ± SD) with a smoking history of 2.5 ± 3.1 pack years, and ten male control participants (25.4 ± 2.9 years) matched for

  5. Pulmonary function responses to ozone in smokers with a limited smoking history

    International Nuclear Information System (INIS)

    Bates, Melissa L.; Brenza, Timothy M.; Ben-Jebria, Abdellaziz; Bascom, Rebecca; Eldridge, Marlowe W.; Ultman, James S.

    2014-01-01

    In non-smokers, ozone (O 3 ) inhalation causes decreases in forced expiratory volume (FEV 1 ) and dead space (V D ) and increases the slope of the alveolar plateau (S N ). We previously described a population of smokers with a limited smoking history that had enhanced responsiveness to brief O 3 boluses and aimed to determine if responsiveness to continuous exposure was also enhanced. Thirty smokers (19 M, 11 F, 24 ± 4 years, 6 ± 4 total years smoking,4 ± 2 packs/week) and 30 non-smokers (17 M, 13 F, 25 ± 6 years) exercised for 1 h on a cycle ergometer while breathing 0.30 ppm O 3 . Smokers and non-smokers were equally responsive in terms of FEV 1 (− 9.5 ± 1.8% vs − 8.7 ± 1.9%). Smokers alone were responsive in terms of V D (− 6.1 ± 1.2%) and S N (9.1 ± 3.4%). There was no difference in total delivered dose. Dead space ventilation (V D /V T ) was not initially different between the two groups, but increased in the non-smokers (16.4 ± 2.8%) during the exposure, suggesting that the inhaled dose may be distributed more peripherally in smokers. We also conclude that these cigarette smokers retain their airway responsiveness to O 3 and, uniquely, experience changes in V D that lead to heterogeneity in airway morphometry and an increase in S N . - Highlights: • We previously found lung function responses to O 3 bolus exposure in smokers. • Here, we describe their responsiveness to continuous O 3 exposure with exercise. • Spirometry and capnography were used to assess pulmonary function changes. • Enhanced bronchoconstriction in smokers increases parenchymal delivery of O 3

  6. Analysis of circulating insulin-like growth factor-1 (IGF-1 and IGF binding protein-3 (IGFBP-3 in tobacco smokers and non-smokers

    Directory of Open Access Journals (Sweden)

    Palmer RM

    2002-06-01

    Full Text Available Abstract Background IGF-1 and the major serum IGF-1 binding protein, IGFBP-3, are under extensive investigation as potential prognostic markers of specific malignancies and vascular diseases. However, there is conflicting evidence that tobacco smoking may influence systemic concentrations of IGF-1 and IGFBP-3. Subjects and methods Serum concentrations of IGF-1 and IGFBP-3 were measured in 20 smokers and 20 non-smokers, matched for age and gender. Serum concentrations of cotinine, the major metabolite of nicotine, and ICAM-1, known to exhibit a dose-dependent relationship with cotinine, were also assayed. Results There was no difference between the systemic concentrations of IGF-1 or IGFBP-3 found in smokers and non-smokers (IGF-1: mean [s.d]; 104 29 vs 101 24 ng ml-1, respectively; and IGFBP-3: 2562 [522] vs 2447 [570] ng ml-1, respectively. Similarly, there was no correlation between serum cotinine and IGF-1 or IGFBP-3 concentrations in smokers. Soluble ICAM-1 concentrations were significantly increased in smokers, compared to non-smokers (mean [s.d]; 258 [60] vs 194 [50] ng ml-1, respectively; p = 0.002. Conclusion There was no relationship noted between tobacco smoking and either IGF-1 or IGFBP-3. These data suggest that smoking would not appear to be a major confounder of the reported clinical associations between IGF-1, IGFBP-3, or IGF-1/IGFBP-3 ratios and specific disease entities.

  7. Analysis of circulating insulin-like growth factor-1 (IGF-1 and IGF binding protein-3 (IGFBP-3 in tobacco smokers and non-smokers

    Directory of Open Access Journals (Sweden)

    Wilson RF

    2003-01-01

    Full Text Available Abstract Background IGF-1 and the major serum IGF-1 binding protein, IGFBP-3, are under extensive investigation as potential prognostic markers of specific malignancies and vascular diseases. However, there is conflicting evidence that tobacco smoking may influence systemic concentrations of IGF-1 and IGFBP-3. Subjects and methods Serum concentrations of IGF-1 and IGFBP-3 were measured in 20 smokers and 20 non-smokers, matched for age and gender. Serum concentrations of cotinine, the major metabolite of nicotine, and ICAM-1, known to exhibit a dose-dependent relationship with cotinine, were also assayed. Results There was no difference between the systemic concentrations of IGF-1 or IGFBP-3 found in smokers and non-smokers (IGF-1: mean [s.d]; 104 29 vs 101 24 ng ml-1, respectively; and IGFBP-3: 2562 [522] vs 2447 [570] ng ml-1, respectively. Similarly, there was no correlation between serum cotinine and IGF-1 or IGFBP-3 concentrations in smokers. Soluble ICAM-1 concentrations were significantly increased in smokers, compared to non-smokers (mean [s.d]; 258 [60] vs 194 [50] ng ml-1, respectively; p = 0.002. Conclusion There was no relationship noted between tobacco smoking and either IGF-1 or IGFBP-3. These data suggest that smoking would not appear to be a major confounder of the reported clinical associations between IGF-1, IGFBP-3, or IGF-1/IGFBP-3 ratios and specific disease entities.

  8. "Tangible Lights"

    DEFF Research Database (Denmark)

    Sørensen, Tor; Merritt, Timothy; Andersen, Oskar

    2015-01-01

    interaction with lighting technology beyond the smartphone and physical controllers. We examine the usefulness of the in-air gestural interaction style for lighting control. We bring forward "Tangible Lights", which serves as a novel interface for in-air interaction with lighting, drawing on existing...

  9. Light contamination

    International Nuclear Information System (INIS)

    Cepeda Pena, William Enrique

    1998-01-01

    The article tries on the wrong use of the artificial light, of the main problems of the light contamination, dispersion of the light, noxious effects of the light contamination, ecological effects, effects on the man's biological rhythm, economic effects and effects about the civic and vial security, among other topics

  10. Self-efficacy modulates the neural correlates of craving in male smokers and ex-smokers: an fMRI study.

    Science.gov (United States)

    Ono, Miki; Kochiyama, Takanori; Fujino, Junya; Sozu, Takashi; Kawada, Ryosaku; Yokoyama, Naoto; Sugihara, Genichi; Murai, Toshiya; Takahashi, Hidehiko

    2017-09-07

    The regulation of cue-induced craving for cigarettes is a key factor in smoking cessation. Outcomes of smoking cessation have been linked to self-efficacy, faith in one's own ability, in smokers. However, no study has examined the neural basis of self-efficacy during the control of craving. We examined whether self-efficacy can affect the neural response to smoking cues in smokers and ex-smokers using functional magnetic resonance imaging. During scanning, participants were instructed (1) to view smoking-related images passively, (2) to view the smoking-related images with a strategy focused on self-efficacy to control cue-induced craving or (3) to view neutral images. In smokers, the self-efficacy strategy significantly reduced self-reported craving. This strategy was related to increased activation in the rostral medial prefrontal cortex (rmPFC) and the pregenual anterior cingulate cortex in smokers compared with ex-smokers. Furthermore, smokers showed increased effective connectivity between rmPFC and hippocampus and between pregenual anterior cingulate cortex and parahippocampus gyrus when employing the self-efficacy strategy compared with ex-smokers. The magnitude of the rmPFC-hippocampus connectivity was positively correlated with self-reported self-efficacy. Our findings suggest that in smokers, self-efficacy is related to activation and connectivity in brain regions involved in regulating craving and self-assessment. The current study provides evidence for understanding the vunderlying cognitive and neurobiological mechanisms involved in the control of craving to smoke cigarettes. © 2017 Society for the Study of Addiction.

  11. Interaction of Lysinibacillus sphaericus Cry48Aa/Cry49Aa toxin with midgut brush-border membrane fractions from Culex quinquefasciatus larvae.

    Science.gov (United States)

    Guo, Q-Y; Hu, X-M; Cai, Q-X; Yan, J-P; Yuan, Z-M

    2016-04-01

    The Cry48Aa/Cry49Aa mosquitocidal toxin from Lysinibacillus sphaericus was uniquely composed of a three-domain (Cry) toxin and binary (Bin) toxin-like protein, with high toxicity against Culex spp. However, its mode of action against the target mosquitoes is still unknown. In this study, Cry48Aa, Cry49Aa and its N- and C-terminal truncated proteins were expressed and purified, and the binding affinities of the purified proteins with midgut brush-border membrane fractions (BBMFs) from Culex quin-quefasciatus larvae were performed. The results showed that both Cry48Aa and Cry49Aa have specific and high binding affinity to BBMFs, with dissociation constants of 9.5 ± 1.8 and 25.4 ± 3.8 nM, respectively. Competition assays demonstrated that Cry49Aa C-terminal derivatives were able to bind to the BBMFs, whereas Far-Western dot blot analysis revealed that its N-terminal constructs interacted with Cry48Aa. Nevertheless, larvicidal activity was almost lost when Cry49Aa truncated proteins, either individually or in pairs, combined with Cry48Aa. It is concluded that Cry49Aa is responsible for receptor binding and interaction with Cry48Aa and plays an important role in the mechanism of action of these two-component toxins. © 2016 The Royal Entomological Society.

  12. The human placenta from heavy smokers: evaluation of vasoactive peptides by immunohistochemistry

    DEFF Research Database (Denmark)

    Clausen, H V; Larsen, L Grupe; Jørgensen, A

    2007-01-01

    The study aimed to demonstrate the expression of nitric oxide converting enzyme, nitric oxide synthase (e-NOS), and endothelin-1 (Et-1) in formalin-fixed paraffin-embedded placental tissue, and to demonstrate a difference in staining intensity between heavy smokers and non-smokers. Term placentas...... from pregnancies from otherwise healthy women smoking 15 or more cigarettes per day (heavy smokers) and term placentas from a matching group of non-smokers were included. The antibodies for Et-1 and e-NOS are recommended for cryostat sections. We evaluated the antibodies on paraffin-embedded tissue...

  13. Emotion regulation in heavy smokers: experiential, expressive and physiological consequences of cognitive reappraisal

    Directory of Open Access Journals (Sweden)

    Lingdan eWu

    2015-10-01

    Full Text Available Emotion regulation dysfunctions are assumed to contribute to the development of tobacco addiction and relapses among smokers attempting to quit. To further examine this hypothesis, the present study compared heavy smokers with nonsmokers in a reappraisal task. Specifically, we investigated whether nondeprived smokers and deprived smokers differ from nonsmokers in cognitive emotion regulation and whether there is an association between the outcome of emotion regulation and the cigarette craving. Sixty-five participants (23 nonsmokers, 22 nondeprived smokers, and 20 deprived smokers were instructed to down-regulate emotions by reappraising negative or positive pictorial scenarios. Self-ratings of valence, arousal and cigarette craving as well as facial electromyography and electroencephalograph activities were measured. Ratings, facial EMG, and EEG data indicated that both nondeprived smokers and deprived smokers performed comparably to nonsmokers in regulating emotional responses via reappraisal, irrespective of the valence of pictorial stimuli. Interestingly, changes in cigarette craving were positively associated with regulation of emotional arousal irrespective of emotional valence. These results suggest that heavy smokers are capable to regulate emotion via deliberate reappraisal and smokers’ cigarette craving is associated with emotional arousal rather than emotional valence. This study provides preliminary support for the therapeutic use of reappraisal to replace maladaptive emotion-regulation strategies in nicotine addicts.

  14. Abnormal brain white matter network in young smokers: a graph theory analysis study.

    Science.gov (United States)

    Zhang, Yajuan; Li, Min; Wang, Ruonan; Bi, Yanzhi; Li, Yangding; Yi, Zhang; Liu, Jixin; Yu, Dahua; Yuan, Kai

    2018-04-01

    Previous diffusion tensor imaging (DTI) studies had investigated the white matter (WM) integrity abnormalities in some specific fiber bundles in smokers. However, little is known about the changes in topological organization of WM structural network in young smokers. In current study, we acquired DTI datasets from 58 male young smokers and 51 matched nonsmokers and constructed the WM networks by the deterministic fiber tracking approach. Graph theoretical analysis was used to compare the topological parameters of WM network (global and nodal) and the inter-regional fractional anisotropy (FA) weighted WM connections between groups. The results demonstrated that both young smokers and nonsmokers had small-world topology in WM network. Further analysis revealed that the young smokers exhibited the abnormal topological organization, i.e., increased network strength, global efficiency, and decreased shortest path length. In addition, the increased nodal efficiency predominately was located in frontal cortex, striatum and anterior cingulate gyrus (ACG) in smokers. Moreover, based on network-based statistic (NBS) approach, the significant increased FA-weighted WM connections were mainly found in the PFC, ACG and supplementary motor area (SMA) regions. Meanwhile, the network parameters were correlated with the nicotine dependence severity (FTND) scores, and the nodal efficiency of orbitofrontal cortex was positive correlation with the cigarette per day (CPD) in young smokers. We revealed the abnormal topological organization of WM network in young smokers, which may improve our understanding of the neural mechanism of young smokers form WM topological organization level.

  15. Aging-related systemic manifestations in COPD patients and cigarette smokers.

    Science.gov (United States)

    Boyer, Laurent; Chouaïd, Christos; Bastuji-Garin, Sylvie; Marcos, Elisabeth; Margarit, Laurent; Le Corvoisier, Philippe; Vervoitte, Laetitia; Hamidou, Leila; Frih, Lamia; Audureau, Etienne; Covali-Noroc, Ala; Andujar, Pascal; Saakashvili, Zakaria; Lino, Anne; Ghaleh, Bijan; Hue, Sophie; Derumeaux, Geneviève; Housset, Bruno; Dubois-Randé, Jean-Luc; Boczkowski, Jorge; Maitre, Bernard; Adnot, Serge

    2015-01-01

    Chronic obstructive pulmonary disease (COPD) is often associated with age-related systemic abnormalities that adversely affect the prognosis. Whether these manifestations are linked to the lung alterations or are independent complications of smoking remains unclear. To look for aging-related systemic manifestations and telomere shortening in COPD patients and smokers with minor lung destruction responsible for a decline in the diffusing capacity for carbon monoxide (DLCO) corrected for alveolar volume (KCO). Cross-sectional study in 301 individuals (100 with COPD, 100 smokers without COPD, and 101 nonsmokers without COPD). Compared to control smokers, patients with COPD had higher aortic pulse-wave velocity (PWV), lower bone mineral density (BMD) and appendicular skeletal muscle mass index (ASMMI), and shorter telomere length (TL). Insulin resistance (HOMA-IR) and glomerular filtration rate (GFR) were similar between control smokers and COPD patients. Smokers did not differ from nonsmokers for any of these parameters. However, smokers with normal spirometry but low KCO had lower ASMMI values compared to those with normal KCO. Moreover, female smokers with low KCO, had lower BMD and shorter TL compared to those with normal KCO. Aging-related abnormalities in patients with COPD are also found in smokers with minor lung dysfunction manifesting as a KCO decrease. Decreased KCO might be useful, particularly among women, for identifying smokers at high risk for aging-related systemic manifestations and telomere shortening.

  16. The impact of repeated spirometry and smoking cessation advice on smokers with mild COPD.

    Science.gov (United States)

    Stratelis, Georgios; Mölstad, Sigvard; Jakobsson, Per; Zetterström, Olle

    2006-09-01

    Smoking cessation is the most important therapeutic intervention in patients with chronic obstructive pulmonary diseases (COPD) and the health benefits are immediate and substantial. Major efforts have been made to develop methods with high smoking cessation rates. To study whether a combination of spirometry and brief smoking cessation advice to smokers with COPD, annually for three years, increased their smoking cessation rate in comparison with groups of smokers with normal lung function. Prospective, randomized study in primary care. Smoking cessation rates were compared between smokers with COPD followed-up yearly over a period of three years and smokers with normal lung function followed-up yearly for three years or followed-up only once after three years. The point-prevalence abstinence rate and prolonged abstinence rate at 6 and 12 months increased yearly and in smokers with COPD at year 3 was 29%, 28%, and 25%, respectively. The abstinence rates were significantly higher in smokers with COPD than in smokers with normal lung function. Smoking cessation rates among smokers with normal lung function did not increase with increasing number of follow-ups. Smokers diagnosed with COPD stopped smoking significantly more often than those with normal lung function.

  17. Aging-related systemic manifestations in COPD patients and cigarette smokers.

    Directory of Open Access Journals (Sweden)

    Laurent Boyer

    Full Text Available Chronic obstructive pulmonary disease (COPD is often associated with age-related systemic abnormalities that adversely affect the prognosis. Whether these manifestations are linked to the lung alterations or are independent complications of smoking remains unclear.To look for aging-related systemic manifestations and telomere shortening in COPD patients and smokers with minor lung destruction responsible for a decline in the diffusing capacity for carbon monoxide (DLCO corrected for alveolar volume (KCO.Cross-sectional study in 301 individuals (100 with COPD, 100 smokers without COPD, and 101 nonsmokers without COPD.Compared to control smokers, patients with COPD had higher aortic pulse-wave velocity (PWV, lower bone mineral density (BMD and appendicular skeletal muscle mass index (ASMMI, and shorter telomere length (TL. Insulin resistance (HOMA-IR and glomerular filtration rate (GFR were similar between control smokers and COPD patients. Smokers did not differ from nonsmokers for any of these parameters. However, smokers with normal spirometry but low KCO had lower ASMMI values compared to those with normal KCO. Moreover, female smokers with low KCO, had lower BMD and shorter TL compared to those with normal KCO.Aging-related abnormalities in patients with COPD are also found in smokers with minor lung dysfunction manifesting as a KCO decrease. Decreased KCO might be useful, particularly among women, for identifying smokers at high risk for aging-related systemic manifestations and telomere shortening.

  18. Deadly Attraction - Attentional Bias toward Preferred Cigarette Brand in Smokers.

    Science.gov (United States)

    Domaradzka, Ewa; Bielecki, Maksymilian

    2017-01-01

    Numerous studies have shown that biases in visual attention might be evoked by affective and personally relevant stimuli, for example addiction-related objects. Despite the fact that addiction is often linked to specific products and systematic purchase behaviors, no studies focused directly on the existence of bias evoked by brands. Smokers are characterized by high levels of brand loyalty and everyday contact with cigarette packaging. Using the incentive-salience mechanism as a theoretical framework, we hypothesized that this group might exhibit a bias toward the preferred cigarette brand. In our study, a group of smokers ( N = 40) performed a dot probe task while their eye movements were recorded. In every trial a pair of pictures was presented - each of them showed a single cigarette pack. The visual properties of stimuli were carefully controlled, so branding information was the key factor affecting subjects' reactions. For each participant, we compared gaze behavior related to the preferred vs. other brands. The analyses revealed no attentional bias in the early, orienting phase of the stimulus processing and strong differences in maintenance and disengagement. Participants spent more time looking at the preferred cigarettes and saccades starting at the preferred brand location had longer latencies. In sum, our data shows that attentional bias toward brands might be found in situations not involving choice or decision making. These results provide important insights into the mechanisms of formation and maintenance of attentional biases to stimuli of personal relevance and might serve as a first step toward developing new attitude measurement techniques.

  19. Young smokers' narratives: public health, disadvantage and structural violence.

    Science.gov (United States)

    Lewis, Sue; Russell, Andrew

    2013-06-01

    This research article on youth smoking in disadvantaged communities is the product of a qualitative study to understand the issues faced by young smokers--and those trying not to be smokers--in such communities. Environmental factors and peer influence are widely recognised influences on adolescents' take-up and continuation of smoking but less is known about whether, what, how and why circumstances in disadvantaged communities affect young people's pathways towards and away from smoking. Focusing on a youth club in a disadvantaged neighbourhood in the North East of England, narratives about young people's relationships with tobacco provide an ethnographically rich, thick description of the experiences of a group that is too often easily ignored. We argue that young people are caught between competing domains that together exert a form of structural violence. These are, first, the economic and political structures that have overseen de-industrialisation; second, the media structures that create desire for what they cannot afford; third the structures of international organised crime that conspire to provide them with the means to consume from which 'legitimate' structures effectively exclude them. Rather than expecting young people to comply with the health imperative, interventions need to bridge issues of agency and critical consciousness, which structural violence otherwise insidiously erodes. © 2013 The Authors. Sociology of Health & Illness © 2013 Foundation for the Sociology of Health & Illness/John Wiley & Sons Ltd.

  20. Continental smokers couple mantle degassing and distinctive microbiology within continents

    Science.gov (United States)

    Crossey, Laura J.; Karlstrom, Karl E.; Schmandt, Brandon; Crow, Ryan R.; Colman, Daniel R.; Cron, Brandi; Takacs-Vesbach, Cristina D.; Dahm, Clifford N.; Northup, Diana E.; Hilton, David R.; Ricketts, Jason W.; Lowry, Anthony R.

    2016-02-01

    The discovery of oceanic black (and white) smokers revolutionized our understanding of mid-ocean ridges and led to the recognition of new organisms and ecosystems. Continental smokers, defined here to include a broad range of carbonic springs, hot springs, and fumaroles that vent mantle-derived fluids in continental settings, exhibit many of the same processes of heat and mass transfer and ecosystem niche differentiation. Helium isotope (3He/4He) analyses indicate that widespread mantle degassing is taking place in the western U.S.A., and that variations in mantle helium values correlate best with low seismic-velocity domains in the mantle and lateral contrasts in mantle velocity rather than crustal parameters such as GPS, proximity to volcanoes, crustal velocity, or composition. Microbial community analyses indicate that these springs can host novel microorganisms. A targeted analysis of four springs in New Mexico yield the first published occurrence of chemolithoautotrophic Zetaproteobacteria in a continental setting. These observations lead to two linked hypotheses: that mantle-derived volatiles transit through conduits in extending continental lithosphere preferentially above and at the edges of mantle low velocity domains. High CO2 and other constituents ultimately derived from mantle volatiles drive water-rock interactions and heterogeneous fluid mixing that help structure diverse and distinctive microbial communities.

  1. Acute autonomic effects of vitamins and fats in male smokers.

    Science.gov (United States)

    Wright, C I; Ruediger, H; Kroner, C I; Janssen, B J A; Draijer, R

    2009-02-01

    Vitamins can help improve cardiovascular control. In contrast, smoking works in the opposite fashion, reducing the baroreflex control of heart rate (HR) possibly via oxidative stress. High-fat challenges also impair cardiovascular regulation. Whether vitamins have acute beneficial effects on the baroreflex control of HR in smokers is unclear. A randomized, placebo-controlled crossover study in 30 male smokers (34.2+/-6.9 years). Interventions were: (1) moderate (vitamin C (300 mg) and E (75 IU) and folic acid (1 mg)); (2) high doses of vitamins (vitamin C (2 g) and E (800 IU), and folic acid (5 mg)); or, (3) placebo. Vitamins were ingested with cream (a high-fat challenge) or milk (low-fat control). Four hours later, blood was withdrawn and radial pulse wave forms recorded via tonometry. Spontaneous beat-to-beat variations in HR and systolic blood pressure (SBP) were analysed by spectral analysis techniques and sympathovagal control of HR and baroreflex sensitivity (BRS) were assessed. High doses of vitamins increased plasma vitamin C, E and folic acid levels (P0.05, analysis of variance). Plasma vitamin levels did not correlate with any cardiovascular parameters. Moderate vitamins increased the vagal control of HR (+23%; Peffect on BRS and minor effects on the cardiovascular system were seen following acute fat and vitamin ingestion.

  2. Hospitalized smokers' expectancies for electronic cigarettes versus tobacco cigarettes.

    Science.gov (United States)

    Hendricks, Peter S; Cases, Mallory G; Thorne, Christopher B; Cheong, JeeWon; Harrington, Kathleen F; Kohler, Connie L; Bailey, William C

    2015-02-01

    The objectives of the current study were to compare hospitalized smokers' expectancies for electronic cigarettes (e-cigarettes) against their expectancies for tobacco cigarettes and evaluate relationships between e-cigarette expectancies and intention to use e-cigarettes. Analysis of baseline data from a one-year longitudinal observational study. The setting was a tertiary care academic center hospital in the Southeastern U.S. Participants were 958 hospitalized tobacco cigarette smokers. A questionnaire of e-cigarette expectancies based on the Brief Smoking Consequences Questionnaire-Adult (BSCQ-A) was developed and administered along with the original, tobacco-specific, BSCQ-A. Intention to use e-cigarettes was assessed with a single 10-point Likert scale item. Participants reported significantly weaker expectancies for e-cigarettes relative to tobacco cigarettes on all 10 BSCQ-A scales. Participants held sizably weaker expectancies that e-cigarettes pose health risks (pcigarettes were greater expectancies that e-cigarettes taste pleasant (pcigarettes versus tobacco cigarettes. This suggests that e-cigarettes might be viable though imperfect substitutes for tobacco cigarettes. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Leptin Influence in Craving and Relapse of Alcoholics and Smokers

    Science.gov (United States)

    Aguiar-Nemer, Aline S.; Toffolo, Mayla C. F.; da Silva, Claudio Jeronimo; Laranjeira, Ronaldo; Silva-Fonseca, Vilma A.

    2013-01-01

    Leptin inhibits signaling of dopamine in the nucleus accumbens, suggesting its role in regulating stress and its possible involvement in the neurobiology of reward system. The aim of this study was to review of the literature on the influence of leptin in the craving for alcohol and tobacco and whether there is already evidence that leptin may be a biomarker to indicate risk for craving and relapse. The review used as data bases Medline, LILACS and SciElo in the period between 2000 and 2012. Keywords were leptin, substance use disorders, craving and withdrawal, in Portuguese and English. Only 12 articles were met the inclusion criteria, relating leptin with craving in alcoholics (n = 10) and smokers (n = 2). No studies were found in the LILACS database. Leptin levels increase during abstinence and this may be related to a reduction of dopaminergic action in mesolimbic system, resulting in a greater intensity of craving and maintenance of addictive behavior. Although there are few studies, the most recent results indicate the usefulness of leptin as a marker of risk for relapse among smokers and alcoholics in abstinence. PMID:23671541

  4. Significant association between renal function and area of amyloid deposition in kidney biopsy specimens in both AA amyloidosis associated with rheumatoid arthritis and AL amyloidosis.

    Science.gov (United States)

    Kuroda, Takeshi; Tanabe, Naohito; Hasegawa, Eriko; Wakamatsu, Ayako; Nozawa, Yukiko; Sato, Hiroe; Nakatsue, Takeshi; Wada, Yoko; Ito, Yumi; Imai, Naofumi; Ueno, Mitsuhiro; Nakano, Masaaki; Narita, Ichiei

    2017-06-01

    The kidney is a major target organ for systemic amyloidosis, which results in proteinuria and an elevated serum creatinine level. The clinical manifestations and precursor proteins of amyloid A (AA) and light-chain (AL) amyloidosis are different, and the renal damage due to amyloid deposition also seems to differ. The purpose of this study was to clarify haw the difference in clinical features between AA and AL amyloidosis are explained by the difference in the amount and distribution of amyloid deposition in the renal tissues. A total of 119 patients participated: 58 patients with an established diagnosis of AA amyloidosis (AA group) and 61 with AL amyloidosis (AL group). We retrospectively investigated the correlation between clinical data, pathological manifestations, and the area occupied by amyloid in renal biopsy specimens. In most of the renal specimens the percentage area occupied by amyloid was less than 10%. For statistical analyses, the percentage area of amyloid deposition was transformed to a common logarithmic value (Log 10 %amyloid). The results of sex-, age-, and Log 10 %amyloid-adjusted analyses showed that systolic blood pressure (SBP) was higher in the AA group. In terms of renal function parameters, serum creatinine, creatinine clearance (Ccr) and estimated glomerular filtration rate (eGFR) indicated significant renal impairment in the AA group, whereas urinary protein indicated significant renal impairment in the AL group. Pathological examinations revealed amyloid was predominantly deposited at glomerular basement membrane (GBM) and easily transferred to the mesangial area in the AA group, and it was predominantly deposited at in the AL group. The degree of amyloid deposition in the glomerular capillary was significantly more severe in AL group. The frequency of amyloid deposits in extraglomerular mesangium was not significantly different between the two groups, but in AA group, the degree amyloid deposition was significantly more severe, and

  5. The rise in narghile (shisha, hookah waterpipe tobacco smoking: A qualitative study of perceptions of smokers and non smokers

    Directory of Open Access Journals (Sweden)

    Afifi Rema A

    2011-05-01

    Full Text Available Abstract Background The prevalence of waterpipe tobacco smoking (WTS in the Middle East region and worldwide is increasing. There is evidence to indicate both short term and long term health effects of WTS, resulting in the issuance of an advisory note by the World Health Organization. Methods This research aimed at gaining an in-depth understanding of the factors contributing to the rise in WTS in Lebanon. Qualitative focus groups (25 and in-depth interviews (9 were conducted with adults in Lebanon in 2007. Participants were recruited to represent diversity in smoking status, gender, age groups and urban/rural residence. The interviews and focus groups were thematically analyzed, and recurrent themes noted and summarized. Results The main themes identified were availability, affordability, innovation, influence of media, lack of a policy framework, and the sensory characteristics evoked from WTS. Men and women, smokers and non-smokers, and younger and older participants differed in their emphases on the above themes. These themes, though specific to waterpipe, are similar to themes manipulated by the cigarette industry, and eventually controlled through tobacco control policies. Conclusions Understanding reasons behind the rise in waterpipe tobacco use is important if appropriate prevention, cessation, and policy interventions are to be formulated. Strict adherence to the FCTC is warranted, with careful and vigilant attention that all tobacco products are covered by laws in both high as well as middle to lower income countries.

  6. Attitudes, perceptions, habits of smoker non-smoker general practitioners and why they fail to motivate patients to quit smoking

    International Nuclear Information System (INIS)

    Nawaz, A.; Naqvi, S.A.A.

    2008-01-01

    To investigate attitudes, perceptions and habits of General Practitioners (GPs) who smoke and those who do not smoke cigarettes, with particular attention to smoking cessation. Two physician groups were targeted: GPs who smoke and those who do not smoke. They were screened based on the inclusion and exclusion criteria. A unique country-specific questionnaire was developed to conduct a 20-minute telephonic interview. Survey was started from December 2006 and completed in May 2007. Simple statistical calculations were used to interpret the data. GPs view smoking as the most harmful behaviour among the risk factors. 94% agreed that smoking should be classified as a medical condition and if it were so would encourage more smokers to quit smoking and they have suggested the need of prescription therapies for their patients to quit smoking. Significant discontent exists between physicians and smokers. The main cause of this discontent is physician perceived inability to provide successful solutions to quit smoking due to low awareness level and lack of training. This issue, when properly addressed, can be useful as an additional tool to aid patients in quitting. (author)

  7. A comparison of smoking behaviour characteristics between Caucasian smokers in the United Kingdom and Malay smokers in Malaysia.

    Science.gov (United States)

    Robson, Noorzurani; Bond, Alyson; Wolff, Kim

    2013-01-01

    There is evidence that smoking behaviour differs by ethnicity. This study aims to compare smoking behaviour characteristics between Caucasian and Malay smokers. A cross sectional survey, involving 175 smokers attending smoking cessation clinics at the Institute of Psychiatry, London, United Kingdom and University Malaya, Kuala Lumpur, Malaysia between May 2005 and February 2007. Data on demographics, smoking history, nicotine dependence and smoking behaviour were collected. All participants were males, mean age 30.7 ± 10.3 years. Caucasians initiated smoking significantly earlier (mean age 14.8 ± 2.8 years) (p = 0.001) and smoked regularly significantly earlier (mean age 17.3 ± 3.5) (p = 0.003) than Malays (mean starting age 16.9 ± 4.4 years and mean age regular use 19.5 ± 4.5 years), respectively. Caucasians smoked less for social integration than Malays (p = 0.03) but smoked more for regulation of negative affect than Malays (p = 0.008) and smoked more for hedonism than Malays (p < 0.001). Malays smoke as a means of socially integrating. This has important public health implications. Social reasons and the social environment play a role in smoking uptake, smoking maintenance and smoking cessation and this should be borne in mind for strategies planning to promote smoking cessation. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Fecal transmission of AA amyloidosis in the cheetah contributes to high incidence of disease

    Science.gov (United States)

    Zhang, Beiru; Une, Yumi; Fu, Xiaoying; Yan, Jingmin; Ge, FengXia; Yao, Junjie; Sawashita, Jinko; Mori, Masayuki; Tomozawa, Hiroshi; Kametani, Fuyuki; Higuchi, Keiichi

    2008-01-01

    AA amyloidosis is one of the principal causes of morbidity and mortality in captive cheetahs (Acinonyx jubatus), which are in danger of extinction, but little is known about the underlying mechanisms. Given the transmissible characteristics of AA amyloidosis, transmission between captive cheetahs may be a possible mechanism involved in the high incidence of AA amyloidosis. In this study of animals with AA amyloidosis, we found that cheetah feces contained AA amyloid fibrils that were different from those of the liver with regard to molecular weight and shape and had greater transmissibility. The infectious activity of fecal AA amyloid fibrils was reduced or abolished by the protein denaturants 6 M guanidine·HCl and formic acid or by AA immunodepletion. Thus, we propose that feces are a vehicle of transmission that may accelerate AA amyloidosis in captive cheetah populations. These results provide a pathogenesis for AA amyloidosis and suggest possible measures for rescuing cheetahs from extinction. PMID:18474855

  9. Formation of black and white smokers in the North Fiji Basin: Sulfur and lead isotope constraints

    Science.gov (United States)

    Kim, J.; Lee, I.; Lee, K.; Yoo, C.; Ko, Y.

    2004-12-01

    The hydrothermal chimneys were recovered from 16o50¡_S triple junction area in the North Fiji Basin. The chimney samples are divided into three groups according to their mineralogy and metal contents; 1) Black smoker, 2) White smoker, 3) Transitional type. Black smoker chimneys are mainly composed of chalcopyrite and pyrite, and are enriched in high temperature elements such as Cu, Co, Mo, and Se. White smoker chimneys consist of sphalerite and marcasite with trace of pyrite and chalcopyrite, and are enriched in low temperature elements (Zn, Cd, Pb, As, and Ga). Transitional chimneys show intermediate characteristics in mineralogy and composition between black and white smokers. Basaltic rocks sampled from the triple junction show wide variation in geochemistry. Trace elements composition of basaltic rocks indicates that the magma genesis in the triple junction area was affected by mixing between N-MORB and E-MORB sources. The sulfur and lead isotope compositions of hydrothermal chimneys show distinct differences between the black and white smokers. Black smokers are depleted in 34S (Øä34S = +0.4 to +4.8) and are low in lead isotope composition (206Pb/204Pb = 18.082 to 18.132; 207Pb/204Pb = 15.440 to 15.481; 208Pb/204Pb = 37.764 to 37.916) compared to white smoker and transitional chimneys (Øä34S = +2.4 to +5.6; 206Pb/204Pb = 18.122 to 18.193; 207Pb/204Pb = 15.475 to 15.554; 208Pb/204Pb = 37.882 to 38.150). The heavier sulfur isotopic fractionation in white smoker can be explained by boiling of hydrothermal fluids and mixing with ambient seawater. The lead isotope compositions of the hydrothermal chimneys indicate that the metal in black and white smokers come from hydrothermal reaction with N-MORB and E-MORB, respectively. Regarding both black and white smoker are located in the same site, the condition of phase separation of hydrothermal fluid that formed white smokers might result from P-T condition of high temperature reaction zone below the hydrothermal

  10. Yield and flow properties of aluminum alloy AA 8001

    International Nuclear Information System (INIS)

    Lyons, J.S.; Johnson, H.W.; Han, E.G.

    1995-01-01

    Aluminum alloy AA 8001 is being used at the Westinghouse Savannah River Company (WSRC) for nuclear reactor fuel and target components. The objective of this research was to determine parameters for predictive models of the compressive flow properties of AA 8001. Seventy-five true strain-rate, hot compression tests were performed. New, quantitative information about the yield and flow behavior of aluminum alloy AA 8001 was determined. Parameters were determined to use in a hyperbolic sine constitutive law so that the yield stress, the peak stress, and the peak strain can be predicted from the temperature-compensated strain-rate, Z. It was found that the onset of strain softening was more strongly dependent on Z than the onset of yielding was

  11. Can you please put it out? Predicting non-smokers' assertiveness intentions at work.

    Science.gov (United States)

    Aspropoulos, Eleftherios; Lazuras, Lambros; Rodafinos, Angelos; Eiser, J Richard

    2010-04-01

    The present study aimed to identify the psychosocial predictors of non-smoker employee intentions to ask smokers not to smoke at work. The predictive effects of past behaviour, anticipated regret, social norms, attitudinal, outcome expectancy and behavioural control beliefs were investigated in relation to the Attitudes-Social influence-self-Efficacy (ASE) model. Data were collected from Greek non-smoker employees (n=137, mean age=33.5, SD=10.5, 54.7% female) in 15 companies. The main outcome measure was assertiveness intention. Data on participants' past smoking, age, gender and on current smoking policy in the company were also collected. The majority of employees (77.4%) reported being annoyed by exposure to passive smoking at work, but only 37% reported having asked a smoker colleague not to smoke in the last 30 days. Regression analysis showed that the strongest predictor of non-smokers' assertiveness intentions was how often they believed that other non-smokers were assertive. Perceived control over being assertive, annoyance with secondhand smoke (SHS) exposure at work and past assertive behaviour also significantly predicted assertiveness intentions. Assertiveness by non-smoker employees seems to be guided mainly by normative and behavioural control beliefs, annoyance with SHS exposure at work, and past behaviour. Interventions to promote assertiveness in non-smokers might benefit from efficacy training combined with conveying the messages that the majority of other non-smokers are frequently annoyed by exposure to SHS, and that nearly half of all non-smokers are assertive towards smokers.

  12. Exploring socio-contextual factors associated with male smoker's intention to quit smoking.

    Science.gov (United States)

    Jung, Minsoo

    2016-05-13

    Programs to encourage smokers to quit smoking tobacco have been implemented worldwide and are generally viewed as an effective public health intervention program. However, few studies have examined the social factors that influence a smoker's intention to quit smoking. This study investigated the socio-contextual factors that are associated with the intention to quit smoking among male smokers in South Korea. Data were obtained from a 2014 nationally representative panel that examined the influences of mass media on the health of the Korean population. Members of this panel were recruited using a mixed-method sampling and a combination of random digit dial and address-based sampling designs. Survey questions were based on those used in previous studies that assessed the effects of social context, including mass media and social capital, on health. Multivariate logistic regression analyses of the answers of 313 male smokers were undertaken. Male smokers who participated in community-based activities were 2.45 times more likely to intend to quit smoking compared to male smokers in general (95 % confidence interval [CI]: 1.25-6.82). In addition, male smokers who participated in informal social gathering networks were 2.38 times more likely to intend to quit smoking compared to male smokers in general (95 % CI: 1.11-5.10). Moreover, male smokers with high smartphone use were 1.93 times more likely than smokers with low smartphone use to intend to quit smoking within one year (95 % CI: 1.07-3.46). A supportive environment that enables male smokers to access beneficial health information and that encourages them to quit smoking is necessary for a stop-smoking program to be effective. The result of this study contribute to establishing a new smoking control policy by identifying socio-contextual factors related to the intention to quit smoking.

  13. Lifestyle, health characteristics and alcohol abuse in young adults who are non-daily smokers

    Directory of Open Access Journals (Sweden)

    Maria Izabel de Ugalde Marques da Rocha

    Full Text Available CONTEXT AND OBJECTIVES: Despite the decline in the prevalence of tobacco use in many countries, including Brazil, there are growing numbers of smokers who continue to smoke at a low daily rate, or less frequently (non-daily smokers. This group needs to be better characterized in order to direct preventive actions and public health policies. The aim here was to compare lifestyle, health characteristics and alcoholism problems among young adult smokers, non-daily smokers and non-smokers. DESIGN AND SETTING: This was a cross-sectional study in which volunteers from the university community and its surrounds in Santa Maria, State of Rio Grande do Sul, Brazil, were included between October 2007 and January 2008. METHODS: Out of 1240 volunteers initially contacted in a university cafeteria, a total of 728 participants of mean age 22.45 ± 3.32 years were selected for final analysis. Data were collected using structured questionnaires. RESULTS: In general, it was observed that the non-daily smokers showed intermediate characteristics in relation to the smokers and non-smokers. However, there was a significant association between non-daily smoking and alcohol abuse. The non-daily smokers presented an odds ratio of 2.4 (95% confidence interval: 1.10-5.48 in relation to the daily smokers and an odds ratio of 3.3 (confidence interval: 1.7-6.5 in relation to the non-smokers, with regard to presenting a positive CAGE test, thereby indicating alcohol abuse or dependence. CONCLUSION: The study suggested that non-daily smoking and alcohol consumption were concomitant behaviors.

  14. Lifestyle, health characteristics and alcohol abuse in young adults who are non-daily smokers.

    Science.gov (United States)

    Rocha, Maria Izabel de Ugalde Marques da; Barrio-Lera, Juan Pablo; Jardim, Gabriel Behr Gomes; Mucellini, Amanda Brondani; Cirolini, Luiza; Jung, Ivo Emilio da Cruz; Mânica-Cattani, Maria Fernanda; Silveira, Aron Ferreira da; Souza Filho, Olmiro Cezimbra de; Cruz, Ivana Beatrice Mânica da

    2010-12-01

    Despite the decline in the prevalence of tobacco use in many countries, including Brazil, there are growing numbers of smokers who continue to smoke at a low daily rate, or less frequently (non-daily smokers). This group needs to be better characterized in order to direct preventive actions and public health policies. The aim here was to compare lifestyle, health characteristics and alcoholism problems among young adult smokers, non-daily smokers and non-smokers. This was a cross-sectional study in which volunteers from the university community and its surrounds in Santa Maria, State of Rio Grande do Sul, Brazil, were included between October 2007 and January 2008. Out of 1240 volunteers initially contacted in a university cafeteria, a total of 728 participants of mean age 22.45 ± 3.32 years were selected for final analysis. Data were collected using structured questionnaires. In general, it was observed that the non-daily smokers showed intermediate characteristics in relation to the smokers and non-smokers. However, there was a significant association between non-daily smoking and alcohol abuse. The non-daily smokers presented an odds ratio of 2.4 (95% confidence interval: 1.10-5.48) in relation to the daily smokers and an odds ratio of 3.3 (confidence interval: 1.7-6.5) in relation to the non-smokers, with regard to presenting a positive CAGE test, thereby indicating alcohol abuse or dependence. The study suggested that non-daily smoking and alcohol consumption were concomitant behaviors.

  15. Quit Attempt Correlates among Smokers by Race/Ethnicity

    Directory of Open Access Journals (Sweden)

    Anna Teplinskaya

    2011-09-01

    Full Text Available Introduction: Cigarette smoking is the leading preventable cause of premature deaths in the U.S., accounting for approximately 443,000 deaths annually. Although smoking prevalence in recent decades has declined substantially among all racial/ethnic groups, disparities in smoking-related behaviors among racial/ethnic groups continue to exist. Two of the goals of Healthy People 2020 are to reduce smoking prevalence among adults to 12% or less and to increase smoking cessation attempts by adult smokers from 41% to 80%. Our study assesses whether correlates of quit attempts vary by race/ethnicity among adult (≥18 years smokers in the U.S. Understanding racial/ethnic differences in how both internal and external factors affect quit attempts is important for targeting smoking-cessation interventions to decrease tobacco-use disparities. Methods: We used 2003 Tobacco Use Supplement to the Current Population Survey (CPS data from 16,213 adults to examine whether the relationship between demographic characteristics, smoking behaviors, smoking policies and having made a quit attempt in the past year varied by race/ethnicity. Results: Hispanics and persons of multiple races were more likely to have made a quit attempt than whites. Overall, younger individuals and those with >high school education, who smoked fewer cigarettes per day and had smoked for fewer years were more likely to have made a quit attempt. Having a smoke-free home, receiving a doctor’s advice to quit, smoking menthol cigarettes and having a greater time to when you smoked your first cigarette of the day were also associated with having made a quit attempt. The relationship between these four variables and quit attempts varied by race/ethnicity; most notably receiving a doctor’s advice was not related to quit attempts among Asian American/Pacific Islanders and menthol use among whites was associated with a lower prevalence of quit attempts while black menthol users were more likely

  16. Fatigue behaviour of GMAW welded aluminium alloy AA7020

    OpenAIRE

    Bloem, Carlos; Salvador Moya, Mª Dolores; Amigó, Vicente; Vicente-Escuder, Ángel

    2009-01-01

    [EN] The aim of this investigation is to evaluate the influence on fatigue behaviour of the finishing of the bulge in a welded aluminium zinc magnesium alloy AA7020. It was determined that total or partial elimination of the bulge has very little influence on its behaviour, giving a very similar result on both cases, where one is better than the other by only 3%. Bloem, C.; Salvador Moya, MD.; Amigó, V.; Vicente-Escuder, Á. (2009). Fatigue behaviour of GMAW welded aluminium alloy AA7020. W...

  17. Predicting tensile strength of friction stir welded AA6061 aluminium alloy joints by a mathematical model

    International Nuclear Information System (INIS)

    Elangovan, K.; Balasubramanian, V.; Babu, S.

    2009-01-01

    AA6061 aluminium alloy (Al-Mg-Si alloy) has gathered wide acceptance in the fabrication of light weight structures requiring a high strength-to weight ratio and good corrosion resistance. Compared to the fusion welding processes that are routinely used for joining structural aluminium alloys, friction stir welding (FSW) process is an emerging solid state joining process in which the material that is being welded does not melt and recast. This process uses a non-consumable tool to generate frictional heat in the abutting surfaces. The welding parameters such as tool rotational speed, welding speed, axial force etc., and tool pin profile play a major role in deciding the joint strength. An attempt has been made to develop a mathematical model to predict tensile strength of the friction stir welded AA6061 aluminium alloy by incorporating FSW process parameters. Four factors, five levels central composite design has been used to minimize number of experimental conditions. Response surface method (RSM) has been used to develop the model. Statistical tools such as analysis of variance (ANOVA), student's t-test, correlation co-efficient etc. have been used to validate the developed model. The developed mathematical model can be effectively used to predict the tensile strength of FSW joints at 95% confidence level

  18. WOW: light print, light propel, light point

    DEFF Research Database (Denmark)

    Glückstad, Jesper; Bañas, Andrew Rafael; Aabo, Thomas

    2012-01-01

    We are presenting so-called Wave-guided Optical Waveguides (WOWs) fabricated by two-photon polymerization and capable of being optically manipulated into any arbitrary orientation. By integrating optical waveguides into the structures we have created freestanding waveguides which can be positioned...... anywhere in a sample at any orientation using real-time 3D optical micromanipulation with six degrees of freedom. One of the key aspects of our demonstrated WOWs is the change in direction of in-coupled light and the marked increase in numerical aperture of the out-coupled light. Hence, each light...... propelled WOW can tap from a relatively broad incident beam and generate a much more tightly confined light at its tip. The presentation contains both numerical simulations related to the propagation of light through a WOW and preliminary experimental demonstrations on our BioPhotonics Workstation...

  19. Light Robotics

    DEFF Research Database (Denmark)

    Glückstad, Jesper; Palima, Darwin

    Light Robotics - Structure-Mediated Nanobiophotonics covers the latest means of sculpting of both light and matter for achieving bioprobing and manipulation at the smallest scales. The synergy between photonics, nanotechnology and biotechnology spans the rapidly growing field of nanobiophotonics...

  20. Experimental transmission of AA amyloidosis by injecting the AA amyloid protein into interleukin-1 receptor antagonist knockout (IL-1raKO) mice.

    Science.gov (United States)

    Watanabe, K; Uchida, K; Chambers, J K; Tei, M; Shoji, A; Ushio, N; Nakayama, H

    2015-05-01

    The incidence of AA amyloidosis is high in humans with rheumatoid arthritis and several animal species, including cats and cattle with prolonged inflammation. AA amyloidosis can be experimentally induced in mice using severe inflammatory stimuli and a coinjection of AA amyloid; however, difficulties have been associated with transmitting AA amyloidosis to a different animal species, and this has been attributed to the "species barrier." The interleukin-1 receptor antagonist knockout (IL-1raKO) mouse, a rodent model of human rheumatoid arthritis, has been used in the transmission of AA amyloid. When IL-1raKO and BALB/c mice were intraperitoneally injected with mouse AA amyloid together with a subcutaneous pretreatment of 2% AgNO3, all mice from both strains that were injected with crude or purified murine AA amyloid developed AA amyloidosis. However, the amyloid index, which was determined by the intensity of AA amyloid deposition, was significantly higher in IL-1raKO mice than in BALB/c mice. When IL-1raKO and BALB/c mice were injected with crude or purified bovine AA amyloid together with the pretreatment, 83% (5/6 cases) and 38% (3/8 cases) of IL-1raKO mice and 17% (1/6 cases) and 0% (0/6 cases) of BALB/c mice, respectively, developed AA amyloidosis. Similarly, when IL-1raKO and BALB/c mice were injected with crude or purified feline AA amyloid, 33% (2/6 cases) and 88% (7/8 cases) of IL-1raKO mice and 0% (0/6 cases) and 29% (2/6 cases) of BALB/c mice, respectively, developed AA amyloidosis. These results indicated that IL-1raKO mice are a useful animal model for investigating AA amyloidogenesis. © The Author(s) 2014.

  1. Effect of ammonia in cigarette tobacco on nicotine absorption in human smokers

    NARCIS (Netherlands)

    Amsterdam, van J.; Sleijffers, A.; Spiegel, van P.; Blom, R.; Witte, M.; Kassteele, van de J.; Blokland, M.H.; Steerenberg, P.; Opperhuizen, A.

    2011-01-01

    The function of ammonia as tobacco additive is subject of scientific debate. It is argued that ammonia, by increasing the proportion of free nicotine, increases the absorption of nicotine in smokers. As a result of the addition of ammonia to cigarettes, smokers get exposed to higher internal

  2. Effects of Smoking Cessation on Presynaptic Dopamine Function of Addicted Male Smokers

    DEFF Research Database (Denmark)

    Rademacher, Lena; Prinz, Susanne; Winz, Oliver

    2016-01-01

    putamen of consuming smokers. CONCLUSIONS: The results suggest a lower dopamine synthesis capacity in nicotine-dependent smokers that appears to normalize with abstinence. Further investigations are needed to clarify the role of dopamine in nicotine addiction to help develop smoking prevention...

  3. Effect of Nicotine on Cognitive Performance in Non-smokers in a ...

    African Journals Online (AJOL)

    The effects of nicotine on cognition are still elusive. The aim of the present study is to determine how exposure to nicotine affects specific cognitive domains in a random population of non-smokers in the age range 18-35 years. Ninety-nine non-smokers (80 males and 19 females), with no clinically classified blood pressure ...

  4. Adverse Reaction to Nicotine Gum in Malay Female Smoker: A Case Report

    Science.gov (United States)

    Noorzurani, Md Haris Robson; Bond, Alyson; Wolff, Kim

    2008-01-01

    Nicotine replacement therapies (NRT) are prescribed in smoking cessation programmes to help smokers stop smoking. The ideal dosage of NRT should control cravings and withdrawal symptoms but avoid adverse reactions. This report describes a case of adverse reaction to nicotine gum in a female Malay smoker. Assays taken 2 h after the gum, showed that…

  5. Targeting hardcore smokers : The effects of an online tailored intervention, based on motivational interviewing techniques

    NARCIS (Netherlands)

    Bommelé, Jeroen; Schoenmakers, Tim M.; Kleinjan, Marloes; Peters, Gjalt-Jorn Ygram; Dijkstra, Arie; van de Mheen, Dike

    OBJECTIVES: Hardcore smokers have smoked for many years and do not intend to quit. They also seem unreceptive to information about smoking cessation. We developed a 30-min, tailored web-based intervention that includes motivational interviewing principles. It aims to increase hardcore smokers'

  6. Targeting hardcore smokers : The effects of an online tailored intervention, based on motivational interviewing techniques

    NARCIS (Netherlands)

    Bommelé, J.; Schoenmakers, T.M.; Kleinjan, M.; Peters, G.J.Y.; Dijkstra, A.; van de Mheen, D.

    Hardcore smokers have smoked for many years and do not intend to quit. They also seem unreceptive to information about smoking cessation. We developed a 30-min, tailored web-based intervention that includes motivational interviewing principles. It aims to increase hardcore smokers' intention to quit

  7. Does green tea consumption improve the salivary antioxidant status of smokers?

    Science.gov (United States)

    Azimi, Somayyeh; Mansouri, Zahra; Bakhtiari, Sedigheh; Tennant, Marc; Kruger, Estie; Rajabibazl, Masoumeh; Daraei, Azam

    2017-06-01

    
Considering the higher rate of oral cancer, and reduction in salivary antioxidants in smokers as indicated in previous studies, antioxidant- containing nutrients such as green tea, seem to be beneficial in counteracting against oxidative stress in this group. This study assessed the salivary total antioxidant alteration in smokers compared to nonsmokers, after short-tem (7days) and long-term (3 weeks), green tea drinking. In this experimental study, 20 volunteer moderate-to-heavy male smokers, and 20 matched healthy non-smokers were selected to participate, according to the inclusion criteria. Participants were instructed to drink two cups of green tea per day, by dissolving 2g of green tea in 150ml of hot water for each cup. After saliva collection, antioxidant capacity of saliva was measured at baseline, after 7days, and after 21days. Statistical evaluation was done by SPSS 21, using paired samplet tests, one-way ANOVA and Bonferroni tests. 
 At day zero nonsmokers had a higher antioxidant capacity than smokers (686.6±62.22 vs. 338.8±59.9) mM/50μl, Pantioxidant capacity after one week and three weeks of green tea consumption (Pantioxidant capacity alteration in smokers compared to non-smokers from baseline to day 21. Results support the effectiveness of green tea consumption in salivary antioxidants enhancement in smokers, in both the short- and long term. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Targeting African American Nonsmokers to Motivate Smokers to Quit: A Qualitative Inquiry

    Science.gov (United States)

    Thomas, Janet L.; Scherber, Robyn M.; Stewart, Diana W.; Lynam, Ian M.; Daley, Christine M.; Ahluwalia, Jasjit S.

    2010-01-01

    African Americans bear a disproportionate health burden from smoking but are less likely than other populations to engage in cessation treatment. Intervening on adult nonsmokers residing with a smoker might represent an innovative approach to motivate smokers to engage in smoking behavior change. Twelve focus groups were conducted with African…

  9. Use of and Interest in Smoking Cessation Strategies among Daily and Nondaily College Student Smokers

    Science.gov (United States)

    Berg, Carla J.; Sutfin, Erin L.; Mendel, Jennifer; Ahluwalia, Jasjit S.

    2012-01-01

    Objective: To examine use of and interest in cessation strategies among nondaily and daily college student smokers. Participants: 800 undergraduate student smokers aged 18 to 25. Methods: The authors examined nondaily versus daily smoking in relation to use of and interest in cessation strategies using an online survey. Results: Nondaily (65.8%)…

  10. Smokers with emphysema and small airway disease on computed tomography have lower bone density

    NARCIS (Netherlands)

    Pompe, Esther|info:eu-repo/dai/nl/413994848; de Jong, Pim A|info:eu-repo/dai/nl/287955672; van Rikxoort, Eva M; Gallardo Estrella, Leticia; de Jong, W.U.; Vliegenthart, Rozemarijn; Oudkerk, Matthijs; van der Aalst, Carlijn M; van Ginneken, Bram|info:eu-repo/dai/nl/216387809; Lammers, Jan-Willem J|info:eu-repo/dai/nl/071697624; Mohamed Hoesein, Firdaus Aa|info:eu-repo/dai/nl/341235512

    2016-01-01

    Osteoporosis is more common in patients with COPD and in smokers. The aim of this study was to assess whether measures of emphysema and airway disease on computed tomography (CT) were associated with lower bone density or vertebral fractures in smokers with and without COPD. For this purpose, we

  11. Quitline utilization rates of African-American and white smokers: the California experience.

    Science.gov (United States)

    Zhu, Shu-Hong; Gardiner, Phillip; Cummins, Sharon; Anderson, Christopher; Wong, Shiushing; Cowling, David; Gamst, Anthony

    2011-01-01

    To compare the utilization rate of a statewide tobacco quitline by African-American smokers to that of white smokers. Observational study of 18 years of state quitline operation in California. Subjects were 61,096 African-American and 279,042 white smokers who called the quitline from August 1992 to December 2009. Data from six California Tobacco Surveys, 1993, 1996, 1999, 2002, 2005, and 2008 were also used. Callers' answers to the question how they heard about the quitline were grouped into four categories: media, health care providers, friends/family, and others. The averaged annual quitline call volume for each ethnic group was divided by the total number of smokers in that group, based on California Tobacco Surveys, to produce the annual quitline utilization rate. In five out of six periods of comparison, African-American smokers had a higher annual utilization rate than white smokers. The odds ratios [ORs] ranged from 1.44 to 2.40 (all p smokers were significantly more likely to call the state quitline than white smokers were. Promoting the quitline as part of antismoking media campaigns can help reduce disparity in cessation service utilization.

  12. Risk for COPD with Obstruction of Active Smokers with Normal Spirometry and Reduced Diffusion Capacity

    Science.gov (United States)

    Kaner, Robert J.; Sanders, Abraham; Vincent, Thomas L.; Mezey, Jason G.; Crystal, Ronald G.

    2016-01-01

    Background Smokers are assessed for COPD using spirometry, with COPD defined by the Global Initiative for Chronic Obstructive Lung Disease (GOLD) as airflow limitation not fully reversible with bronchodilators. There is a subset of smokers with normal spirometry (by GOLD criteria), who have a low diffusion capacity (DLCO), a parameter linked to emphysema and small airway disease. The natural history of these “normal spirometry/low DLCO” smokers is unknown. Methods From a cohort of 1570 smokers in the New York City metropolitian area, all of whom had normal spirometry, two groups were randomly selected for lung function follow-up: smokers with normal spirometry/normal DLCO (n=59) and smokers with normal spirometry/low DLCO (n=46). All had normal history, physical examination, CBC, urinalysis, HIV status, α1-antitrypsin level, chest X-ray, FEV1, FVC, FEV1/FVC ratio and total lung capacity (TLC). Throughout the study, all continued to be active smokers. Findings In the normal spirometry/normal DLCO group assessed over 45 ± 20 months, 3% developed GOLD-defined COPD. In contrast, in the normal spirometry/low DLCO group, followed over 41 ± 31 months, 22% developed GOLD-defined COPD. Interpretation Despite appearing “normal” by GOLD, smokers with normal spirometry but low DLCO are at significant risk for developing COPD with obstruction to airflow. PMID:26541521

  13. Attention Training in Smokers: A Feasibility Study of an Ecological Momentary Assessment Approach

    Science.gov (United States)

    2011-01-04

    adult community-based smokers in the Washington D.C. metropolitan area. Participant recruitment was accomplished by advertising for smokers age 18 – 65...in the cinema , etc.? The first cigarette in the morning Any cigarette other than the first one Which cigarette would you hate to give

  14. Comparison of color discrimination in chronic heavy smokers and healthy subjects [version 3; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Thiago Monteiro de Paiva Fernandes

    2017-08-01

    Full Text Available Background: Cigarette smoke is probably the most significant source of exposure to toxic chemicals for humans, involving health-damaging components, such as nicotine, hydrogen cyanide and formaldehyde. The aim of the present study was to assess the influence of chronic heavy smoking on color discrimination (CD. Methods: All subjects were free of any neuropsychiatric disorder, identifiable ocular disease and had normal acuity. No abnormalities were detected in the fundoscopic examination and in the optical coherence tomography exam. We assessed color vision for healthy heavy smokers (n = 15; age range, 20-45 years, deprived smokers (n = 15, age range 20-45 years and healthy non-smokers (n = 15; age range, 20-45 years, using the psychophysical forced-choice method. All groups were matched for gender and education level. In this test, the volunteers had to choose the pseudoisochromatic stimulus containing a test frequency at four directions (e.g., up, down, right and left in the subtest of Cambridge Colour Test (CCT: Trivector. Results: Performance on CCT differed between groups, and the observed pattern was that smokers had lower discrimination compared to non-smokers. In addition, deprived smokers presented lower discrimination to smokers and non-smokers. Contrary to expectation, the largest differences were observed for medium and long wavelengths. Conclusions: These results suggests that cigarette smoking, chronic exposure to its compounds, and withdrawal from nicotine affect color discrimination. This highlights the importance of understanding the diverse effects of nicotine on attentional bias.

  15. Non-specific interstitial pneumonia in cigarette smokers: a CT study

    International Nuclear Information System (INIS)

    Marten, Katharina; Milne, David; Antoniou, Katerina M.; Nicholson, Andrew G.; Tennant, Rachel C.; Wells, Athol U.; Hansel, Trevor T.; Hansell, David M.

    2009-01-01

    The goal of this study was to seek indirect evidence that smoking is an aetiological factor in some patients with non-specific interstitial pneumonia (NSIP). Ten current and eight ex-smokers with NSIP were compared to controls including 137 current smokers with no known interstitial lung disease and 11 non-smokers with NSIP. Prevalence and extent of emphysema in 18 smokers with NSIP were compared with subjects meeting GOLD criteria for chronic obstructive pulmonary disease (COPD; group A; n = 34) and healthy smokers (normal FEV 1 ; group B; n = 103), respectively. Emphysema was present in 14/18 (77.8%) smokers with NSIP. Emphysema did not differ in prevalence between NSIP patients and group A controls (25/34, 73.5%), but was strikingly more prevalent in NSIP patients than in group B controls (18/103, 17.5%, P < 0.0005). On multiple logistic regression, the likelihood of emphysema increased when NSIP was present (OR = 18.8; 95% CI = 5.3-66.3; P < 0.0005) and with increasing age (OR = 1.04; 95% CI = 0.99-1.11; P = 0.08). Emphysema is as prevalent in smokers with NSIP as in smokers with COPD, and is strikingly more prevalent in these two groups than in healthy smoking controls. The association between NSIP and emphysema provides indirect support for a smoking pathogenesis hypothesis in some NSIP patients. (orig.)

  16. Comparison of color discrimination in chronic heavy smokers and healthy subjects.

    Science.gov (United States)

    Fernandes, Thiago Monteiro de Paiva; Almeida, Natalia Leandro; Dos Santos, Natanael Antonio

    2017-01-01

    Background: Cigarette smoke is probably the most significant source of exposure to toxic chemicals for humans, involving health-damaging components, such as nicotine, hydrogen cyanide and formaldehyde. The aim of the present study was to assess the influence of chronic heavy smoking on color discrimination (CD). Methods: All subjects were free of any neuropsychiatric disorder, identifiable ocular disease and had normal acuity. No abnormalities were detected in the fundoscopic examination and in the optical coherence tomography exam. We assessed color vision for healthy heavy smokers ( n = 15; age range, 20-45 years), deprived smokers ( n = 15, age range 20-45 years) and healthy non-smokers ( n = 15; age range, 20-45 years), using the psychophysical forced-choice method. All groups were matched for gender and education level. In this test, the volunteers had to choose the pseudoisochromatic stimulus containing a test frequency at four directions (e.g., up, down, right and left) in the subtest of Cambridge Colour Test (CCT): Trivector. Results: Performance on CCT differed between groups, and the observed pattern was that smokers had lower discrimination compared to non-smokers. In addition, deprived smokers presented lower discrimination to smokers and non-smokers. Contrary to expectation, the largest differences were observed for medium and long wavelengths. Conclusions: These results suggests that cigarette smoking, chronic exposure to its compounds, and withdrawal from nicotine affect color discrimination. This highlights the importance of understanding the diverse effects of nicotine on attentional bias.

  17. Differences in regional air trapping in current smokers with normal spirometry.

    Science.gov (United States)

    Karimi, Reza; Tornling, Göran; Forsslund, Helena; Mikko, Mikael; Wheelock, Åsa M; Nyrén, Sven; Sköld, C Magnus

    2017-01-01

    We investigated regional air trapping on computed tomography in current smokers with normal spirometry. It was hypothesised that presence of regional air trapping may indicate a specific manifestation of smoking-related changes.40 current smokers, 40 patients with chronic obstructive pulmonary disease (COPD), and 40 healthy never- smokers underwent computed tomography scans. Regional air trapping was assessed on end-expiratory scans and emphysema, micronodules and bronchial wall thickening on inspiratory scans. The ratio of expiratory and inspiratory mean lung attenuation (E/I) was calculated as a measure of static (fixed) air trapping.Regional air trapping was present in 63% of current smokers, in 45% of never smokers and in 8% of COPD patients (psmokers with and without regional air trapping had E/I ratio of 0.81 and 0.91, respectively (psmokers with regional air trapping.Current smokers with regional air trapping had higher FEV 1 and less emphysema on computed tomography. In contrast, current smokers without regional air trapping resembled COPD. Our results highlight heterogeneity among smokers with normal spirometry and may contribute to early detection of smoking related structural changes in the lungs. Copyright ©ERS 2017.

  18. Aspirin and Zileuton and Biomarker Expression in Nasal Tissue of Current Smokers | Division of Cancer Prevention

    Science.gov (United States)

    This randomized phase II trial studies the effects of aspirin and zileuton on genes related to tobacco use in current smokers. Aspirin and zileuton may interfere with genes related to tobacco use and may be useful in preventing lung cancer in current smokers. |

  19. SCHOOL LIGHTING

    Science.gov (United States)

    1965

    SEVERAL ARTICLES ON SCHOOL LIGHTING ARE CONTAINED IN THIS JOURNAL. THE TITLES AND AUTHORS INCLUDED ARE AS FOLLOWS--(1) "TODAY'S CONCEPTS IN SCHOOL LIGHTING" BY CHARLES D. GIBSON, (2) "CHALLENGE OF TOMMORROW'S LIGHTING" BY S.K. GUTH AND E.H. WITTE, (3) "PEEK PREVIEW OF THE WINDOWLESS SCHOOL" BY JAMES J. MORISSEAU, (4) "MAINTENANCE BEGINS BEFORE…

  20. Twisted light

    CSIR Research Space (South Africa)

    Forbes, A

    2010-12-01

    Full Text Available Research at the Mathematical Optics Group uses "twisted" light to study new quatum-based information security systems. In order to understand the structure of "twisted" light, it is useful to start with an ordinary light beam with zero twist, namely...

  1. Severe obstructive disease: Similarities and differences between smoker and non-smoker patients with COPD and/or bronchiectasis

    Directory of Open Access Journals (Sweden)

    J. Rezende Gonçalves

    2013-01-01

    Full Text Available Introduction: Poorly reversible airflow obstruction may or may not be related to smoking. Objectives: To describe patients with severe obstructive lung disease including etiology, imaging, functional aspects, systemic manifestations, and the pattern of bronchodilator response. Methods: Sixty-eight patients (age 55.9 ± 13.7 years, FEV1 [forced expiratory volume in one second] 31.9 ± 10.2% predicted underwent spirometry, evaluation of body mass composition, 6-minute walk test, X-ray, thorax high-resolution CT scanning, and clinical evaluation. Results: Of 68 patients enrolled, 37 had chronic obstructive pulmonary disease (COPD and 31, extensive bronchiectasis. Among COPD patients the CT scans showed emphysema in 78.4%, and bronchiectasis in 48.6%. There were no significant differences between smokers and non-smokers, except for vital capacity, significantly smaller in non-smokers (p  1 = flow responder or 1= respondedor de fluxo, se > 1 respondedor de volume, e 20 RV pelos criterios da ATS/ERS. De acordo com os critérios de Paré et al., existiam 18 pacientes com FEV1< 30% previsto entre os 29 RV, e 12 com FEV1 < 30% previsto entre os 39 sem resposta a uma prova de volume (p = 0,0101. Conclusões: Em pacientes com obstrução grave, o tabagismo não parece ser relevante na determinação de diferenças funcionais ou sistémicas, e os critérios de Paré et al. podem detetar mais RV. A bronquiectasias é uma descoberta comum em DPOC grave. Keywords: Airway obstruction, Respiratory function tests, Bronchitis, Bronchiectasis, Bronchodilator tests, Computed tomography of the thorax, Palavras-chave: Obstrução das Vias Respiratórias, Testes de Função Respiratória, Bronquite, Bronquiectasias, Testes de Broncodilatador, Tomografia de tórax

  2. Severe obstructive disease: Similarities and differences between smoker and non-smoker patients with COPD and/or bronchiectasis

    Directory of Open Access Journals (Sweden)

    J. Rezende Gonçalves

    2013-01-01

    Full Text Available Introduction: Poorly reversible airflow obstruction may or may not be related to smoking. Objectives: To describe patients with severe obstructive lung disease including etiology, imaging, functional aspects, systemic manifestations, and the pattern of bronchodilator response. Methods: Sixty-eight patients (age 55.9 ± 13.7 years, FEV1 [forced expiratory volume in one second] 31.9 ± 10.2% predicted underwent spirometry, evaluation of body mass composition, 6-minute walk test, X-ray, thorax high-resolution CT scanning, and clinical evaluation. Results: Of 68 patients enrolled, 37 had chronic obstructive pulmonary disease (COPD and 31, extensive bronchiectasis. Among COPD patients the CT scans showed emphysema in 78.4%, and bronchiectasis in 48.6%. There were no significant differences between smokers and non-smokers, except for vital capacity, significantly smaller in non-smokers (p  1 = flow responder or 1= respondedor de fluxo, se > 1 respondedor de volume, e 20 RV pelos criterios da ATS/ERS. De acordo com os critérios de Paré et al., existiam 18 pacientes com FEV1< 30% previsto entre os 29 RV, e 12 com FEV1 < 30% previsto entre os 39 sem resposta a uma prova de volume (p = 0,0101. Conclusões: Em pacientes com obstrução grave, o tabagismo não parece ser relevante na determinação de diferenças funcionais ou sistémicas, e os critérios de Paré et al. podem detetar mais RV. A bronquietasia é uma descoberta comum em DPOC grave. Keywords: Airway obstruction, Respiratory function tests, Bronchitis, Bronchiectasis, Bronchodilator tests, Computed tomography of the thorax, Palavras-chave: Obstrução das Vias Respiratórias, Testes de Função Respiratória, Bronquite, Bronquiectasia, Testes de Broncodilatador, Tomografia de tórax

  3. Helping adolescents quit smoking:a needs assessment of current and former teen smokers.

    Science.gov (United States)

    Pingree, Suzanne; Boberg, Eric; Patten, Christi; Offord, Kenneth; Gaie, Martha; Schensky, Ann; Gustafson, David H; Dornelas, Ellen; Ahluwalia, Jasjit

    2004-01-01

    This study compared the survey responses of 280 current and former adolescent smokers for what they perceived would be helpful (or what had helped) in quitting smoking. The survey was developed from focus groups and was structured using Prochaska and DiClementes Stages of Change health behavior framework. Results showed that former smokers and current smokers in the preparation stage of change shared beliefs about the importance of interpersonal support, those who were contemplating a quit decision worried about obstacles and internal issues, and current smokers not thinking about quitting focused on external rewards. The findings that significant differences exist based on the adolescent smokers Stage of Change imply that this framework can be appropriately applied to this context.

  4. Characteristics of adult smokers presenting to a mind-body medicine clinic.

    Science.gov (United States)

    Luberto, Christina M; Chad-Friedman, Emma; Dossett, Michelle L; Perez, Giselle K; Park, Elyse R

    2018-05-01

    Mind-body interventions can improve vulnerabilities that underlie smoking behavior. The characteristics of smokers who use mind-body medicine have not been explored, preventing the development of targeted interventions. Patients ( N = 593) presenting to a mind-body medicine clinic completed self-report measures. Patients were 67 percent never smokers, 27 percent former smokers, and 6 percent current smokers. Current smokers were younger; more likely to be single, unemployed, or on disability; and report greater depression symptoms, greater pain, and lower social support ( ps mind-body medicine have unique psychosocial needs that should be targeted in mind-body smoking cessation interventions.

  5. The social support and social network characteristics of smokers in methadone maintenance treatment.

    Science.gov (United States)

    de Dios, Marcel Alejandro; Stanton, Cassandra A; Caviness, Celeste M; Niaura, Raymond; Stein, Michael

    2013-01-01

    Previous studies have shown social support and social network variables to be important factors in smoking cessation treatment. Tobacco use is highly prevalent among individuals in methadone maintenance treatment (MMT). However, smoking cessation treatment outcomes in this vulnerable subpopulation have been poor and social support and social network variables may contribute. The current study examined the social support and social network characteristics of 151 MMT smokers involved in a randomized clinical trial of smoking cessation treatments. Participants were 50% women and 78% Caucasian. A high proportion (57%) of MMT smokers had spouses or partners who smoke and over two-thirds of households (68.5%) included at least one smoker. Our sample was characterized by relatively small social networks, but high levels of general social support and quitting support. The number of cigarettes per day was found to be positively associated with the number of smokers in the social network (r = .239, p social support and social networks of smokers in MMT.

  6. Different Resting-State Functional Connectivity Alterations in Smokers and Nonsmokers with Internet Gaming Addiction

    Directory of Open Access Journals (Sweden)

    Xue Chen

    2014-01-01

    Full Text Available This study investigated changes in resting-state functional connectivity (rsFC of posterior cingulate cortex (PCC in smokers and nonsmokers with Internet gaming addiction (IGA. Twenty-nine smokers with IGA, 22 nonsmokers with IGA, and 30 healthy controls (HC group underwent a resting-state fMRI scan. PCC connectivity was determined in all subjects by investigating synchronized low-frequency fMRI signal fluctuations using a temporal correlation method. Compared with the nonsmokers with IGA, the smokers with IGA exhibited decreased rsFC with PCC in the right rectus gyrus. Left middle frontal gyrus exhibited increased rsFC. The PCC connectivity with the right rectus gyrus was found to be negatively correlated with the CIAS scores in the smokers with IGA before correction. Our results suggested that smokers with IGA had functional changes in brain areas related to motivation and executive function compared with the nonsmokers with IGA.

  7. Ig light chain variability in DNP494-KLH immunised sea bass (Dicentrarchus labrax L.) : evidence for intra-molecular induced suppression

    NARCIS (Netherlands)

    Santos, dos N.M.S.; Hermsen, T.; Rombout, J.H.W.M.; Pilström, L.; Stet, R.J.M.

    2001-01-01

    The coding sequence of the sea bass light chain was obtained by sequential anchored PCR on a head kidney cDNA library of a DNP494-KLH immunised sea bass. The cDNA sequence obtained codes for a leader peptide of 21 aa and a mature IgL chain of 223 aa. Both the amino acid sequence comparisons and

  8. Characteristics of hardcore smokers in South Korea from 2007 to 2013

    Directory of Open Access Journals (Sweden)

    EunKyo Kang

    2017-05-01

    Full Text Available Abstract Background As the prevalence of smoking decreased in western countries, a significant proportion of smokers appeared to be particularly resistant to quitting- “hardcore” smokers. This study examines the characteristics of hardcore smokers in South Korea. Methods We used the data from 2007 to 2013 from the Korea National Health and Nutrition Examination Survey. Hardcore smoking was defined as (1 smoking >15 cigarettes per day, (2 having no plans of quitting, and (3 having made no attempts to quit. Multiple logistic regression analyses were used to investigate the association between various sociodemographic variables and hardcore smoking. Results The proportion of hardcore smokers among smokers did not change significantly from 23.1% in 2007 to 23.0% in 2013. None of the three characteristics of hardcore smokers for either gender showed a significant change from 2007 to 2013. Multiple logistic regression analysis showed that hardcore smokers were 1.64 times (95% confidence interval [CI], 1.28–2.11 greater among those aging 40–49 years than among those aging 19–29 years, and four times greater among men than women. Never-married smokers were less likely to be hardcore smokers than married ones (odds ratio 0.79; 95% CI, 0.66–0.96. Household income and education level did not have any significant association with the likelihood of a hardcore smoker. Conclusions Hardcore smoking was more prevalent among men, unmarried men and those aging 40–49 years.

  9. Health care costs and work absenteeism in smokers: study in an urban community.

    Science.gov (United States)

    Suárez-Bonel, María Pilar; Villaverde-Royo, María Victoria; Nerín, Isabel; Sanz-Andrés, Concepción; Mezquida-Arno, Julia; Córdoba-García, Rodrigo

    2015-12-01

    Higher morbidity caused by smoking-related diseases could increase health costs. We analyzed differences in the use of healthcare resources, healthcare costs and days of work absenteeism among smokers and non-smokers. Cross-sectional study in smokers and non-smokers, aged between 45 and 74 years, from one urban health area. The variables studied were: age, sex, alcohol intake, physical activity, obesity, diseases, attendance at primary care clinics and hospital emergency rooms, days of hospitalization, prescription drug consumption and work absenteeism (in days). Annual cost according to the unit cost of each service (direct costs), and indirect costs according to the number of days missed from work was calculated. Crude and adjusted risks were calculated using logistic regression. Five hundred patients were included: 50% were smokers, 74% (372) men and 26% (128) women. Smokers used more healthcare resources, consumed more prescription drugs and had more days off work than non-smokers. Respective direct and indirect costs in smokers were 848.64 euros (IQ 25-75: 332.65-1517.10) and 2253.90 euros (IQ 25-75: 1024.50-13113.60), and in non-smokers were 474.71 euros (IQ 25-75: 172.88-979.59) and 1434.30 euros (IQ 25-75: 614.70-4712.70). The likelihood of generating high healthcare costs was more than double for smokers (OR=2.14; 95% CI: 1.44-3.19). More investment in programs for the prevention and treatment of smoking, as a health policy priority, could help to reduce the health and social costs of smoking. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

  10. Neural responses to smoking stimuli are influenced by smokers' attitudes towards their own smoking behaviour.

    Directory of Open Access Journals (Sweden)

    Bastian Stippekohl

    Full Text Available An important feature of addiction is the high drug craving that may promote the continuation of consumption. Environmental stimuli classically conditioned to drug-intake have a strong motivational power for addicts and can elicit craving. However, addicts differ in the attitudes towards their own consumption behavior: some are content with drug taking (consonant users whereas others are discontent (dissonant users. Such differences may be important for clinical practice because the experience of dissonance might enhance the likelihood to consider treatment. This fMRI study investigated in smokers whether these different attitudes influence subjective and neural responses to smoking stimuli. Based on self-characterization, smokers were divided into consonant and dissonant smokers. These two groups were presented smoking stimuli and neutral stimuli. Former studies have suggested differences in the impact of smoking stimuli depending on the temporal stage of the smoking ritual they are associated with. Therefore, we used stimuli associated with the beginning (BEGIN-smoking-stimuli and stimuli associated with the terminal stage (END-smoking-stimuli of the smoking ritual as distinct stimulus categories. Stimulus ratings did not differ between both groups. Brain data showed that BEGIN-smoking-stimuli led to enhanced mesolimbic responses (amygdala, hippocampus, insula in dissonant compared to consonant smokers. In response to END-smoking-stimuli, dissonant smokers showed reduced mesocortical responses (orbitofrontal cortex, subcallosal cortex compared to consonant smokers. These results suggest that smoking stimuli with a high incentive value (BEGIN-smoking-stimuli are more appetitive for dissonant than consonant smokers at least on the neural level. To the contrary, smoking stimuli with low incentive value (END-smoking-stimuli seem to be less appetitive for dissonant smokers than consonant smokers. These differences might be one reason why dissonant

  11. Systemic AA amyloidosis in the red fox (Vulpes vulpes).

    Science.gov (United States)

    Rising, Anna; Cederlund, Ella; Palmberg, Carina; Uhlhorn, Henrik; Gaunitz, Stefan; Nordling, Kerstin; Ågren, Erik; Ihse, Elisabet; Westermark, Gunilla T; Tjernberg, Lars; Jörnvall, Hans; Johansson, Jan; Westermark, Per

    2017-11-01

    Amyloid A (AA) amyloidosis occurs spontaneously in many mammals and birds, but the prevalence varies considerably among different species, and even among subgroups of the same species. The Blue fox and the Gray fox seem to be resistant to the development of AA amyloidosis, while Island foxes have a high prevalence of the disease. Herein, we report on the identification of AA amyloidosis in the Red fox (Vulpes vulpes). Edman degradation and tandem MS analysis of proteolyzed amyloid protein revealed that the amyloid partly was composed of full-length SAA. Its amino acid sequence was determined and found to consist of 111 amino acid residues. Based on inter-species sequence comparisons we found four residue exchanges (Ser31, Lys63, Leu71, Lys72) between the Red and Blue fox SAAs. Lys63 seems unique to the Red fox SAA. We found no obvious explanation to how these exchanges might correlate with the reported differences in SAA amyloidogenicity. Furthermore, in contrast to fibrils from many other mammalian species, the isolated amyloid fibrils from Red fox did not seed AA amyloidosis in a mouse model. © 2017 The Protein Society.

  12. Contribution to comprehensive study of aluminium alloy Aa 5083 ...

    African Journals Online (AJOL)

    Corrosion induced by elemental mercury in aqueous media of industrial Aluminium alloys AA5083 used in heat exchanger industries of natural gas liquefaction has been studied by linear sweep voltammétry on rotating amalgamated disk electrode. Corrosion process depends on: • Chemical processes of amalgamation of ...

  13. Churg-Strauss syndrome associated with AA amyloidosis: a case ...

    African Journals Online (AJOL)

    Churg Strauss syndrome is a rare systemic and pulmonary vasculitis exceptionally associated with AA amyloidosis. We report the case of a 65-year old woman with past medical history of asthma. She developed polyarthralgia, headache and purpura. A laboratory workout found hypereosinophilia (1150/μL), positive ...

  14. Backend solutions for AA in the MUSE network supporting FMC

    NARCIS (Netherlands)

    Neerbos, A.N.R. van; Prins, M.; Melander, B.; Pimilla Larrucea, I.; Thakur, M.J.; Fredricx, F.

    2007-01-01

    The European MUSE project investigated fixed-mobile convergence from the perspective of an unbundled fixed network. A major part of the work consisted of finding solutions for the authentication and authorisation of users who roam from their home network to a visited network. This paper shows how AA

  15. Three body abrasion of laser surface alloyed aluminium AA1200

    CSIR Research Space (South Africa)

    Mabhali, Luyolo AB

    2012-06-01

    Full Text Available Laser surface alloying of aluminium AA1200 was performed with a 4 kW Nd:YAG laser to improve the abrasion wear resistance. Aluminium surfaces reinforced with metal matrix composites and intermetallic phases were achieved. The phases present depended...

  16. Recovery and recrystallization in the superplastic deformation of AA5182

    NARCIS (Netherlands)

    Chen, Z.; Kazantzis, A. V.; De Hosson, J. Th. M.

    The coarse-grained Al alloy AA5182 exhibits poor superplasticity with a maximum elongation to failure not exceeding 220% at 450 degrees C and at 10(-2) s(-1). The low values of the strain rate sensitivity indicate that the dislocation velocity is quite high and necking is developed quite soon during

  17. Impact toughness of laser alloyed aluminium AA1200 alloys

    CSIR Research Space (South Africa)

    Mabhali, Luyolo AB

    2013-08-01

    Full Text Available Laser surface alloying of aluminium AA1200 was performed with a 4kW Nd:YAG laser and impact resistance of the alloys was investigated. The alloying powders were a mixture of Ni, Ti and SiC in different proportions. Surfaces reinforced...

  18. Pollution assessment and heavy metal determination by AAS in ...

    African Journals Online (AJOL)

    Foisal

    below detective level. This study points out the health risk status of waste water for residents and aquatic living being, an ultimate concern for their survival in the region. Key words: Waste water, pollution assessment, physico-chemical parameters, atomic absorption spectrophotometer (AAS), heavy metal contamination.

  19. Making ET AAS Determination Less Dependent on Vapourization ...

    African Journals Online (AJOL)

    NICO

    The quantification of the analytes in ET AAS is normally attained by the measurement and integration of transient absorbance. High degree of atomization and constant vapour transportation rate for the analyte atoms in the absorption volume are considered to be crucial to grant correctness of the measurements. However ...

  20. Light at deep sea hydrothermal vents

    Science.gov (United States)

    Van Dover, Cindy Lee; Cann, J. R.; Cavanaugh, Colleen; Chamberlain, Steven; Delaney, John R.; Janecky, David; Imhoff, Johannes; Tyson, J. Anthony

    We usually think of the bottom of the sea as a dark environment, lit only by flashes of bioluminescent light. Discovery of light associated with geothermal processes at deep sea hydrothermal vents forces us to qualify our textbook descriptions of the seafloor as a uniformly dark environment. While a very dim glow emitted from high temperature (350°) vents (black smokers) at mid-oceanic ridge spreading centers has been documented [Van Dover et al, 1988], the source of this light and its role, if any, in the evolution and adaptation of photobiochemical processes have yet to be determined. Preliminary studies indicate that thermal radiation alone may account for the “glow” ]Smith and Delaney, 1989] and that a novel photoreceptor in shrimp-colonizing black smoker chimneys may detect this “glow” [Van Dover et al., 1989; Pelli and Chamberlain, 1989]. A more controversial question, posed by C. L. Van Dover, J. R. Cann, and J. R. Delaney at the 1993 LITE Workshop at the Woods Hole Oceanographic Institution in Massachusetts, is whether there may be sufficient light of appropriate wavelengths to support geothermally driven photosynthesis by microorganisms.