WorldWideScience

Sample records for aa genome oryza

  1. Rapid diversification of five Oryza AA genomes associated with rice adaptation

    OpenAIRE

    Zhang, Qun-Jie; Zhu, Ting; Xia, En-Hua; Shi, Chao; Liu, Yun-Long; Zhang, Yun; Liu, Yuan; Jiang, Wen-Kai; Zhao, You-Jie; Mao, Shu-Yan; Zhang, Li-Ping; Huang, Hui; Jiao, Jun-Ying; Xu, Ping-Zhen; Yao, Qiu-Yang

    2014-01-01

    Asian rice (Oryza sativa) is among the world’s most important crops. The genus Oryza has become a model for the study of plant genome structure, function, and evolution. We have undertaken de novo, full-genome sequence analysis of five diploid AA-genome species that are closely related to O. sativa. These species are native to quite different environments, representing four continents, thus exhibiting very different adaptations. Our studies identify specific genetic changes, in both gene copy...

  2. SSR Analysis on Diversity of AA Genome Oryza Species in the Southeast and South Asia

    Institute of Scientific and Technical Information of China (English)

    LU Jian-zhen; ZHANG Xiao-li; WANG Hai-gang; YUAN Xiao-ping; XU Qun; WANG Yi-ping; YU Han-yong; TANG Sheng-xiang; WEI Xing-hua

    2008-01-01

    To investigate genetic diversities among the AA genome Oryza species in the Southeast and South'Asia, a total of 428 accessions of the AA genome Oryza species were genotyped using 36 simple sequence repeats (SSR) markers distributed throughout the rice genome. All of the 36 SSR markers generated polymorphic bands, revealing 100% polymorphism. The number of alleles per locus ranged from 3 to 17 with the mean of 8.6. The Nei's genetic diversity index (He) ranged from 0.337 at RM455 to 0.865 at RM 169 with an average value of 0.650. The genetic diversity of the AA genome Oryza species in the Southeast Asia was obviously higher than that in the South Asia. Among the detected Oryza species in the South and Southeast Asia, O. rufipogon showed the highest genetic diversity. Meanwhile, a higher genetic differentiation (Fst) was found among the detected Oryza species in the Southeast Asia than in the South Asia. The Fst value between O. nivara and O. sativa was the highest. The results from the number of specific alleles, specific loci, and allele frequency confirmed the greater genetic variation among the detected species. In addition, the specific allele in RM161 displayed higher frequency (0.193), suggesting its important function in identifying Oryza species of AA genome.

  3. Relationships of wild and domesticated rices (Oryza AA genome species) based upon whole chloroplast genome sequences

    OpenAIRE

    Wambugu, Peterson W.; Marta Brozynska; Agnelo Furtado; Daniel L. Waters; Robert J. Henry

    2015-01-01

    Rice is the most important crop in the world, acting as the staple food for over half of the world’s population. The evolutionary relationships of cultivated rice and its wild relatives have remained contentious and inconclusive. Here we report on the use of whole chloroplast sequences to elucidate the evolutionary and phylogenetic relationships in the AA genome Oryza species, representing the primary gene pool of rice. This is the first study that has produced a well resolved and strongly su...

  4. Relationships of wild and domesticated rices (Oryza AA genome species) based upon whole chloroplast genome sequences.

    Science.gov (United States)

    Wambugu, Peterson W; Brozynska, Marta; Furtado, Agnelo; Waters, Daniel L; Henry, Robert J

    2015-01-01

    Rice is the most important crop in the world, acting as the staple food for over half of the world's population. The evolutionary relationships of cultivated rice and its wild relatives have remained contentious and inconclusive. Here we report on the use of whole chloroplast sequences to elucidate the evolutionary and phylogenetic relationships in the AA genome Oryza species, representing the primary gene pool of rice. This is the first study that has produced a well resolved and strongly supported phylogeny of the AA genome species. The pan tropical distribution of these rice relatives was found to be explained by long distance dispersal within the last million years. The analysis resulted in a clustering pattern that showed strong geographical differentiation. The species were defined in two primary clades with a South American/African clade with two species, O glumaepatula and O longistaminata, distinguished from all other species. The largest clade was comprised of an Australian clade including newly identified taxa and the African and Asian clades. This refined knowledge of the relationships between cultivated rice and the related wild species provides a strong foundation for more targeted use of wild genetic resources in rice improvement and efforts to ensure their conservation. PMID:26355750

  5. Seed Length Controlled by Same Locus in Four Different AA Genome Species of Genus Oryza

    Institute of Scientific and Technical Information of China (English)

    ZHANG Yu; LI Jing; ZHOU Jia-wu; XU Peng; DENG Xian-neng; YANG Fei; DENG Wei; HU Feng-yi; TAO Da-yun

    2014-01-01

    To broaden the genetic basis and overcome the yield plateau in Asian cultivated rice, the exploitation and utilization of favorable alleles from rice species with the AA genome has become important and urgent in modern breeding programs. Four different interspecific populations were used to detect quantitative trait locus (QTL) for seed length, including a BC4F2 population derived from Oryza glumaepatula crossed with Dianjingyou 1 (a japonica cultivar), a BC4F2 population derived from O. nivara crossed with Dianjingyou 1, a BC7F1 population derived from a cross between O. longistaminata and RD23 (an indica cultivar), and a BC8F1 population derived from a cross between O. glaberrima and Dianjingyou 1. The QTLs for seed length in four different populations were termed as SL-3a, SL-3b, SL-3c and SL-3d, respectively. They had good collinearity and accounted for 49% to 60% of the phenotypic variations. Sequencing data indicated that four QTLs were different alleles of GS3 which were responsible for the seed length variation between O. sativa and its four AA genome relatives. These results will be valuable for confirming the evolution of GS3 and also be helpful for rice breeding.

  6. Progress on Transferring Elite Genes from Non-AA Genome Wild Rice into Oryza sativa through Interspecific Hybridization

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The progress of research on transferring elite genes from non-AA genome wild rice into Oryza sativa through interspecific hybridization are in three respects,that is,breeding monosomic alien addition lines (MAALs),constructing introgression lines (ILs) and analyzing the heredity of the characters and mapping the related genes.There are serious reproductive barriers,mainly incrossability and hybrid sterility,in the interspecific hybridization of O.sativa with non-AA genome wild rice.These are the 'bottleneck' for transferring elite genes from wild rice to O.sativa.Combining traditional crossing method with biotechnique is a reliable way to overcome the reproductive barriers and to improve the utilizing efficiency of non-AA genome wild rice.

  7. OryzaGenome: Genome Diversity Database of Wild Oryza Species.

    Science.gov (United States)

    Ohyanagi, Hajime; Ebata, Toshinobu; Huang, Xuehui; Gong, Hao; Fujita, Masahiro; Mochizuki, Takako; Toyoda, Atsushi; Fujiyama, Asao; Kaminuma, Eli; Nakamura, Yasukazu; Feng, Qi; Wang, Zi-Xuan; Han, Bin; Kurata, Nori

    2016-01-01

    The species in the genus Oryza, encompassing nine genome types and 23 species, are a rich genetic resource and may have applications in deeper genomic analyses aiming to understand the evolution of plant genomes. With the advancement of next-generation sequencing (NGS) technology, a flood of Oryza species reference genomes and genomic variation information has become available in recent years. This genomic information, combined with the comprehensive phenotypic information that we are accumulating in our Oryzabase, can serve as an excellent genotype-phenotype association resource for analyzing rice functional and structural evolution, and the associated diversity of the Oryza genus. Here we integrate our previous and future phenotypic/habitat information and newly determined genotype information into a united repository, named OryzaGenome, providing the variant information with hyperlinks to Oryzabase. The current version of OryzaGenome includes genotype information of 446 O. rufipogon accessions derived by imputation and of 17 accessions derived by imputation-free deep sequencing. Two variant viewers are implemented: SNP Viewer as a conventional genome browser interface and Variant Table as a text-based browser for precise inspection of each variant one by one. Portable VCF (variant call format) file or tab-delimited file download is also available. Following these SNP (single nucleotide polymorphism) data, reference pseudomolecules/scaffolds/contigs and genome-wide variation information for almost all of the closely and distantly related wild Oryza species from the NIG Wild Rice Collection will be available in future releases. All of the resources can be accessed through http://viewer.shigen.info/oryzagenome/. PMID:26578696

  8. Transposable element distribution, abundance and role in genome size variation in the genus Oryza

    Directory of Open Access Journals (Sweden)

    Collura Kristi

    2007-08-01

    Full Text Available Abstract Background The genus Oryza is composed of 10 distinct genome types, 6 diploid and 4 polyploid, and includes the world's most important food crop – rice (Oryza sativa [AA]. Genome size variation in the Oryza is more than 3-fold and ranges from 357 Mbp in Oryza glaberrima [AA] to 1283 Mbp in the polyploid Oryza ridleyi [HHJJ]. Because repetitive elements are known to play a significant role in genome size variation, we constructed random sheared small insert genomic libraries from 12 representative Oryza species and conducted a comprehensive study of the repetitive element composition, distribution and phylogeny in this genus. Particular attention was paid to the role played by the most important classes of transposable elements (Long Terminal Repeats Retrotransposons, Long interspersed Nuclear Elements, helitrons, DNA transposable elements in shaping these genomes and in their contributing to genome size variation. Results We identified the elements primarily responsible for the most strikingly genome size variation in Oryza. We demonstrated how Long Terminal Repeat retrotransposons belonging to the same families have proliferated to very different extents in various species. We also showed that the pool of Long Terminal Repeat Retrotransposons is substantially conserved and ubiquitous throughout the Oryza and so its origin is ancient and its existence predates the speciation events that originated the genus. Finally we described the peculiar behavior of repeats in the species Oryza coarctata [HHKK] whose placement in the Oryza genus is controversial. Conclusion Long Terminal Repeat retrotransposons are the major component of the Oryza genomes analyzed and, along with polyploidization, are the most important contributors to the genome size variation across the Oryza genus. Two families of Ty3-gypsy elements (RIRE2 and Atlantys account for a significant portion of the genome size variations present in the Oryza genus.

  9. Genome sequence and rapid evolution of the rice pathogen Xanthomonas oryzae pv. oryzae PXO99A

    Directory of Open Access Journals (Sweden)

    Szurek Boris

    2008-05-01

    Full Text Available Abstract Background Xanthomonas oryzae pv. oryzae causes bacterial blight of rice (Oryza sativa L., a major disease that constrains production of this staple crop in many parts of the world. We report here on the complete genome sequence of strain PXO99A and its comparison to two previously sequenced strains, KACC10331 and MAFF311018, which are highly similar to one another. Results The PXO99A genome is a single circular chromosome of 5,240,075 bp, considerably longer than the genomes of the other strains (4,941,439 bp and 4,940,217 bp, respectively, and it contains 5083 protein-coding genes, including 87 not found in KACC10331 or MAFF311018. PXO99A contains a greater number of virulence-associated transcription activator-like effector genes and has at least ten major chromosomal rearrangements relative to KACC10331 and MAFF311018. PXO99A contains numerous copies of diverse insertion sequence elements, members of which are associated with 7 out of 10 of the major rearrangements. A rapidly-evolving CRISPR (clustered regularly interspersed short palindromic repeats region contains evidence of dozens of phage infections unique to the PXO99A lineage. PXO99A also contains a unique, near-perfect tandem repeat of 212 kilobases close to the replication terminus. Conclusion Our results provide striking evidence of genome plasticity and rapid evolution within Xanthomonas oryzae pv. oryzae. The comparisons point to sources of genomic variation and candidates for strain-specific adaptations of this pathogen that help to explain the extraordinary diversity of Xanthomonas oryzae pv. oryzae genotypes and races that have been isolated from around the world.

  10. Construction of Oryza Sativa genome contigs by fingerprint strategy

    Institute of Scientific and Technical Information of China (English)

    TAOQUAZHOU; GUOFANHONG; 等

    1995-01-01

    We described the construction of BAC contigs of the genome of a indica variety of Oryza sativa.Guang Lu Ai 4. An entire representative(Sixfold coverage of rice chromosomes)and genetically stable BAC library of rice genome constructed in this lab has been systematically analysed by restriction enzyme fragmentation and polyacrylamide gel electrophoresis.And all the images thus obtained were subject to image-processing,which consisted of preliminary location of bands,cooperative tracking of lanes by correlation of adjacent bads.a precise densitometric pass,alignment at the marker bands with the standard,optional interactive editing,and normalization of the accepted bands.The contigs were generated based on the Computer Software specially designed for genome mapping.The number of contigs with 600 kb in length on average was 464.of contigs with 1000kb in length on average was 107; of contigs with 1500 kb in length on average was Construction of Oryza Sativa genome contigs.23.Therefor,all the contigs we have obtained ampunted up to 420 megabases in length.Considering the size of rice genome(430 megabased),the contigs generated in this lab have covered nearly 98% of the rice genome.We are now in the process of mapping the contigs to chromosomes.

  11. Development and validation of cross-transferable and polymorphic DNA markers for detecting alien genome introgression in Oryza sativa from Oryza brachyantha.

    Science.gov (United States)

    Ray, Soham; Bose, Lotan K; Ray, Joshitha; Ngangkham, Umakanta; Katara, Jawahar L; Samantaray, Sanghamitra; Behera, Lambodar; Anumalla, Mahender; Singh, Onkar N; Chen, Meingsheng; Wing, Rod A; Mohapatra, Trilochan

    2016-08-01

    African wild rice Oryza brachyantha (FF), a distant relative of cultivated rice Oryza sativa (AA), carries genes for pests and disease resistance. Molecular marker assisted alien gene introgression from this wild species to its domesticated counterpart is largely impeded due to the scarce availability of cross-transferable and polymorphic molecular markers that can clearly distinguish these two species. Availability of the whole genome sequence (WGS) of both the species provides a unique opportunity to develop markers, which are cross-transferable. We observed poor cross-transferability (~0.75 %) of O. sativa specific sequence tagged microsatellite (STMS) markers to O. brachyantha. By utilizing the genome sequence information, we developed a set of 45 low cost PCR based co-dominant polymorphic markers (STS and CAPS). These markers were found cross-transferrable (84.78 %) between the two species and could distinguish them from each other and thus allowed tracing alien genome introgression. Finally, we validated a Monosomic Alien Addition Line (MAAL) carrying chromosome 1 of O. brachyantha in O. sativa background using these markers, as a proof of concept. Hence, in this study, we have identified a set molecular marker (comprising of STMS, STS and CAPS) that are capable of detecting alien genome introgression from O. brachyantha to O. sativa. PMID:27299359

  12. The whole chloroplast genome of wild rice (Oryza australiensis).

    Science.gov (United States)

    Wu, Zhiqiang; Ge, Song

    2016-01-01

    The whole chloroplast genome of wild rice (Oryza australiensis) is characterized in this study. The genome size is 135,224  bp, exhibiting a typical circular structure including a pair of 25,776  bp inverted repeats (IRa,b) separated by a large single-copy region (LSC) of 82,212  bp and a small single-copy region (SSC) of 12,470  bp. The overall GC content of the genome is 38.95%. 110 unique genes were annotated, including 76 protein-coding genes, 4 ribosomal RNA genes, and 30t RNA genes. Among these, 18 are duplicated in the inverted repeat regions, 13 genes contain one intron, and 2 genes (rps12 and ycf3) have two introns.

  13. Characterization of Interspecific Hybrids Between Oryza sativa L. and Three Wild Rice Species of China by Genomic In Situ Hybridization

    Institute of Scientific and Technical Information of China (English)

    Guang-Xuan Tan; Zhi-Yong Xiong; Hua-Jun Jin; Gang Li; Li-Li Zhu; Li-Hui Shu; Guang-Cun He

    2006-01-01

    In the genus Oryza, interspecific hybrids are useful bridges for transferring the desired genes from wild species to cultivated rice (Oryza sativa L.). In the present study, hybrids between O. sativa (AA genome)and three Chinese wild rices, namely O. rufipogon (AA genome), O. officinalis (CC genome), and O. meyeriana (GG genome), were produced. Agricultural traits of the F1 hybrids surveyed were intermediate between their parents and appreciably resembled wild rice parents. Except for the O. sativa × O. rufipogon hybrid,the other F1 hybrids were completely sterile. Genomic in situ hybridization (GISH) was used for hybrid verification. Wild rice genomic DNAs were used as probes and cultivated rice DNA was used as a block. With the exception of O. rufipogon chromosomes, this method distinguished the other two wild rice and cultivated rice chromosomes at the stage of mitotic metaphase with different blocking ratios. The results suggest that a more distant phylogenetic relationship exists between O. meyeriana and O. sativa and that O. rufipogon and O. sativa share a high degree of sequence homology. The average mitotic chromosome length of O. officinalis and O. meyeriana was 1.25- and 1.51-fold that of O. sativa, respectively. 4',6'-Diamidino2-phenylindole staining showed that the chromosomes of O. officinalis and O. meyeriana harbored more heterochromatin, suggesting that the C and G genomes were amplified with repetitive sequences compared with the A genome. Although chromocenters formed by chromatln compaction were detected with wild rice-specific signals corresponding to the C and G genomes in discrete domains of the F1 hybrid interphase nuclei, the size and number of O. meyeriana chromocenters were bigger and greater than those of O. officinalis. The present results provide an important understanding of the genomic relationships and a tool for the transfer of useful genes from three native wild rice species in China to cultivars.

  14. Improved annotation through genome-scale metabolic modeling of Aspergillus oryzae

    DEFF Research Database (Denmark)

    Vongsangnak, Wanwipa; Olsen, Peter; Hansen, Kim;

    2008-01-01

    Background: Since ancient times the filamentous fungus Aspergillus oryzae has been used in the fermentation industry for the production of fermented sauces and the production of industrial enzymes. Recently, the genome sequence of A. oryzae with 12,074 annotated genes was released but the number...

  15. Comparison of Genomes of Three Xanthomonas oryzae Bacteriophages

    Directory of Open Access Journals (Sweden)

    Chen Hui-Yi

    2007-11-01

    Full Text Available Abstract Background Xp10 and OP1 are phages of Xanthomonas oryzae pv. oryzae (Xoo, the causative agent of bacterial leaf blight in rice plants, which were isolated in 1967 in Taiwan and in 1954 in Japan, respectively. We recently isolated the Xoo phage Xop411. Results The linear Xop411 genome (44,520 bp, 58 ORFs sequenced here is 147 bp longer than that of Xp10 (60 ORFs and 735 bp longer than that of OP1 (59 ORFs. The G+C contents of OP1 (51% and Xop411 and Xp10 (52% each are less than that of the host (65%. The 9-bp 3'-overhangs (5'-GGACAGTCT-3' in Xop411 and Xp10 are absent from OP1. More of the deduced Xop411 proteins share higher degrees of identity with Xp10 than with OP1 proteins, while the right end of the genomes of Xp10 and OP1, containing all predicted promoters, share stronger homology. Xop411, Xp10, and OP1 contain 8, 7, and 6 freestanding HNH endonuclease genes, respectively. These genes can be classified into five groups depending on their possession of the HNH domain (HNN or HNH type and/or AP2 domain in intact or truncated forms. While the HNN-AP2 type endonuclease genes dispersed in the genome, the HNH type endonuclease genes, each with a unique copy, were located within the same genome context. Mass spectrometry and N-terminal sequencing showed nine Xop411 coat proteins, among which three were identified, six were assigned as coat proteins (4 and conserved phage proteins (2 in Xp10. The major coat protein, in which only the N-terminal methionine is removed, appears to exist in oligomeric forms containing 2 to 6 subunits. The three phages exhibit different patterns of domain duplication in the N-terminus of the tail fiber, which are involved in determination of the host range. Many short repeated sequences are present in and around the duplicated domains. Conclusion Geographical separation may have confined lateral gene transfer among the Xoo phages. The HNN-AP2 type endonucleases were more likely to transfer their genes

  16. Comparative analysis of A, B,C and D genomes in the genus Oryza with C0t-1 DNA of C genome

    Institute of Scientific and Technical Information of China (English)

    LAN Weizhen; QIN Rui; LI Gang; HE Guangcun

    2006-01-01

    Fluorescence in situ hybridization (FISH)was applied to somatic chromosomes preparations of Oryza officinalis Wall. (CC), O. sativa L. (AA)×O. officinalis F1 hybrid (AC), backcross progenies BC1 (AAC and ACC), O. latifolia Desv. (CCDD), O. alta Swallen (CCDD) and O. punctata Kotschy (BBCC)with a labelled probe of Cot-1 DNA from O. officinalis.In O. officinalis, the homologous chromosomes showed similar signal bands probed by C0t-1 DNA and karyotype analysis was conducted based on the band patterns. Using no blocking DNA, the probe identified the chromosomes of C genome clearly, but detected few signals on chromosomes of A genome in the F1 hybrid and two backcross progenies of BC1.It is obvious that the highly and moderately repetitive DNA sequences were considerably different between C and A genomes. The chromosomes of C genome were also discriminated from the chromosomes of D-and B-genome in the tetraploid species O. latifolia, O.alta and O. punctata by C0t-1 DNA-FISH. Comparison of the fluorescence intensity on the chromosomes of B, C and D genomes in O. latifolia, O. alta,and O. punctata indicated that the differentiations between C and D genomes are less than that between C and B genomes. The relationship between C and D genomes in O. alta is closer than that of C and D genomes in O. latifolia. This would be one of the causes for the fact that both the genomes are of the same karyotype (CCDD) but belong to different species. The above results showed that the C0t-1 DNA had a high specificity of genome and species. In this paper, the origin of allotetraploid in genus Oryza is also discussed.

  17. A Microarray Based Genomic Hybridization Method for Identification of New Genes in Plants: Case Analyses of Arabidopsis and Oryza

    Institute of Scientific and Technical Information of China (English)

    Chuanzhu Fan; Maria D. Vibranovski; Ying Chen; Manyuan Long

    2007-01-01

    To systematically estimate the gene duplication events in closely related species, we have to use comparative genomic approaches, either through genomic sequence comparison or comparative genomic hybridization (CGH). Given the scarcity of complete genomic sequences of plant species, in the present study we adopted an array based CGH to investigate gene duplications in the genus Arabidopsis. Fragment genomic DNA from four species, namely Arabidopsis thaliana, A. lyrata subsp. lyrata, A. lyrata subsp. petraea, and A. halleri, was hybridized to Affymetrix (Santa Clara, CA, USA) tiling arrays that are designed from the genomic sequences of A. thaliana. Pairwise comparisons of signal intensity were made to infer the potential duplicated candidates along each phylo-genetic branch. Ninety-four potential candidates of gene duplication along the genus were identified. Among them, the majority (69 of 94) were A. thaliana lineage specific. This result indicates that the array based CGH approach may be used to identify candidates of duplication in other plant genera containing closely related species, such as Oryza, particularly for the AA genome species. We compared the degree of gene duplication through retrotransposon between O. sativa and A. thaliana and found a strikingly higher number of chimera retroposed genes in rice. The higher rate of gene duplication through retroposition and other mechanisms may indicate that the grass species is able to adapt to more diverse environments.

  18. Genome analysis of rice-blast fungus Magnaporthe oryzae field isolates from southern India

    OpenAIRE

    Malali Gowda; Meghana D. Shirke; Mahesh, H. B.; Pinal Chandarana; Anantharamanan Rajamani; Chattoo, Bharat B

    2015-01-01

    The Indian subcontinent is the center of origin and diversity for rice (Oryza sativa L.). The O. sativa ssp. indica is a major food crop grown in India, which occupies the first and second position in area and production, respectively. Blast disease caused by Magnaporthe oryzae is a major constraint to rice production. Here, we report the analysis of genome architecture and sequence variation of two field isolates, B157 and MG01, of the blast fungus from southern India. The 40 Mb genome of B1...

  19. Construction of an electronic physical map of Magnaporthe oryzae using genomic position-ready SSR markers

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Magnaporthe oryzae is a model for plant pathogenic filamentous fungi. We have assembled a simple sequence repeat (SSR)-based physical map of the species, using in silico sequence data. A set of 120 SSR markers was developed from the genomic sequence of the reference isolate 70-15. These markers were readily amplified from the genomic DNA of other isolates, and high levels of allelic variation characterised the parental isolates of the two crosses tested. All the markers were locatable to one of the seven M. oryzae chromosomes. An SSR-based physical in silico map was constructed, and pre-existing SSR and RFLP loci were integrated into the map, along with 23 Avr (avirulence) genes and two other genes of importance to the plant/pathogen interaction. This map provides a platform for population genetics and functional genomics studies in the model pathogen, and even in other evolutionally related pathogens.

  20. Genome analysis of rice-blast fungus Magnaporthe oryzae field isolates from southern India

    Directory of Open Access Journals (Sweden)

    Malali Gowda

    2015-09-01

    Full Text Available The Indian subcontinent is the center of origin and diversity for rice (Oryza sativa L.. The O. sativa ssp. indica is a major food crop grown in India, which occupies the first and second position in area and production, respectively. Blast disease caused by Magnaporthe oryzae is a major constraint to rice production. Here, we report the analysis of genome architecture and sequence variation of two field isolates, B157 and MG01, of the blast fungus from southern India. The 40 Mb genome of B157 and 43 Mb genome of MG01 contained 11,344 and 11,733 predicted genes, respectively. Genomic comparisons unveiled a large set of SNPs and several isolate specific genes in the Indian blast isolates. Avr genes were analyzed in several sequenced Magnaporthe strains; this analysis revealed the presence of Avr-Pizt and Avr-Ace1 genes in all the sequenced isolates. Availability of whole genomes of field isolates from India will contribute to global efforts to understand genetic diversity of M. oryzae population and to track the emergence of virulent pathotypes.

  1. Genomic structure analysis of a set of Oryza nivara introgression lines and identification of yield-associated QTLs using whole-genome resequencing.

    Science.gov (United States)

    Ma, Xin; Fu, Yongcai; Zhao, Xinhui; Jiang, Liyun; Zhu, Zuofeng; Gu, Ping; Xu, Wenying; Su, Zhen; Sun, Chuanqing; Tan, Lubin

    2016-01-01

    Oryza nivara, an annual wild AA-genome species of rice, is an important gene pool for broadening the genetic diversity of cultivated rice (O. sativa L.). Towards identifying and utilizing favourable alleles from O. nivara, we developed a set of introgression lines (ILs) by introducing O. nivara segments into the elite indica rice variety 93-11 background through advanced backcrossing and repeated selfing. Using whole-genome resequencing, a high-density genetic map containing 1,070 bin-markers was constructed for the 131 ILs, with an average length of 349 kb per bin. The 131 ILs cover 95% of O. nivara genome, providing a relatively complete genomic library for introgressing O. nivara alleles for trait improvement. Using this high-density bin-map, QTL mapping for 13 yield-related traits was performed and a total of 65 QTLs were detected across two environments. At ~36.9% of detected QTLs, the alleles from O. nivara conferred improving effects on yield-associated traits. Six cloned genes, Sh4/SHA1, Bh4, Sd1, TE/TAD1, GS3 and FZP, colocalised in the peak intervals of 9 QTLs. In conclusion, we developed new genetic materials for exploration and use of beneficial alleles from wild rice and provided a basis for future fine mapping and cloning of the favourable O. nivara-derived QTLs. PMID:27251022

  2. Genome information of Methylobacterium oryzae, a plant-probiotic methylotroph in the phyllosphere.

    Directory of Open Access Journals (Sweden)

    Min-Jung Kwak

    Full Text Available Pink-pigmented facultative methylotrophs in the Rhizobiales are widespread in the environment, and many Methylobacterium species associated with plants produce plant growth-promoting substances. To gain insights into the life style at the phyllosphere and the genetic bases of plant growth promotion, we determined and analyzed the complete genome sequence of Methylobacterium oryzae CBMB20T, a strain isolated from rice stem. The genome consists of a 6.29-Mb chromosome and four plasmids, designated as pMOC1 to pMOC4. Among the 6,274 coding sequences in the chromosome, the bacterium has, besides most of the genes for the central metabolism, all of the essential genes for the assimilation and dissimilation of methanol that are either located in methylotrophy islands or dispersed. M. oryzae is equipped with several kinds of genes for adaptation to plant surfaces such as defense against UV radiation, oxidative stress, desiccation, or nutrient deficiency, as well as high proportion of genes related to motility and signaling. Moreover, it has an array of genes involved in metabolic pathways that may contribute to promotion of plant growth; they include auxin biosynthesis, cytokine biosynthesis, vitamin B12 biosynthesis, urea metabolism, biosorption of heavy metals or decrease of metal toxicity, pyrroloquinoline quinone biosynthesis, 1-aminocyclopropane-1-carboxylate deamination, phosphate solubilization, and thiosulfate oxidation. Through the genome analysis of M. oryzae, we provide information on the full gene complement of M. oryzae that resides in the aerial parts of plants and enhances plant growth. The plant-associated lifestyle of M. oryzae pertaining to methylotrophy and plant growth promotion, and its potential as a candidate for a bioinoculant targeted to the phyllosphere and focused on phytostimulation are illuminated.

  3. Phylogeny and species delimitation of the C-genome diploid species in Oryza

    Institute of Scientific and Technical Information of China (English)

    Li-Li ZANG; Xin-Hui ZOU; Fu-Min ZHANG; Ziheng YANG; Song GE

    2011-01-01

    The diploid Oryza species with C-genome type possesses abundant genes useful for rice improvement and provides parental donors of many tetraploid species with the C-genome (BBCC,CCDD).Despite extensive studies,the phylogenetic relationship among the C-genome species and the taxonomic status of some taxa remain controversial.In this study,we reconstructed the phylogeny of three diploid species with C-genome (Oryza officinalis,O.rhizomatis,and O.eichingeri) based on sequences of 68 nuclear single-copy genes.We obtained a fully resolved phylogenetic tree,clearly indicating the sister relationship of O.officinalis and O.rhizomatis,with O.eichingeri being the more divergent lineage.Incongruent phylogenies of the C-genome species found in previous studies might result from lineage sorting,introgression/hybridization and limited number of genetic markers used.We further applied a recently developed Bayesian species delimitation method to investigate the species status of the Sri Lankan and African O.eichingeri.Analyses of two datasets (68 genes with a single sample,and 10 genes with multiple samples) support the distinct species status of the Sri Lankan and African O.eichingeri.In addition,we evaluated the impact of the number of sampled individuals and loci on species delimitation.Our simulation suggests that sampling multiple individuals is critically important for species delimitation,particularly for closely related species.

  4. Draft Genome Sequence of "Candidatus Phytoplasma oryzae" Strain Mbita1, the Causative Agent of Napier Grass Stunt Disease in Kenya.

    Science.gov (United States)

    Fischer, Anne; Santana-Cruz, Ivette; Wambua, Lillian; Olds, Cassandra; Midega, Charles; Dickinson, Matthew; Kawicha, Praphat; Khan, Zeyaur; Masiga, Daniel; Jores, Joerg; Schneider, Bernd

    2016-01-01

    Phytoplasmas are bacterial plant pathogens with devastating impact on agricultural production worldwide. In eastern Africa, Napier grass stunt disease causes serious economic losses in the smallholder dairy industry. This draft genome sequence of " ITALIC! CandidatusPhytoplasma oryzae" strain Mbita1 provides insight into its genomic organization and the molecular basis of pathogenicity. PMID:27103722

  5. The Genomes of Oryza sativa: a history of duplications.

    Directory of Open Access Journals (Sweden)

    Jun Yu

    2005-02-01

    Full Text Available We report improved whole-genome shotgun sequences for the genomes of indica and japonica rice, both with multimegabase contiguity, or almost 1,000-fold improvement over the drafts of 2002. Tested against a nonredundant collection of 19,079 full-length cDNAs, 97.7% of the genes are aligned, without fragmentation, to the mapped super-scaffolds of one or the other genome. We introduce a gene identification procedure for plants that does not rely on similarity to known genes to remove erroneous predictions resulting from transposable elements. Using the available EST data to adjust for residual errors in the predictions, the estimated gene count is at least 38,000-40,000. Only 2%-3% of the genes are unique to any one subspecies, comparable to the amount of sequence that might still be missing. Despite this lack of variation in gene content, there is enormous variation in the intergenic regions. At least a quarter of the two sequences could not be aligned, and where they could be aligned, single nucleotide polymorphism (SNP rates varied from as little as 3.0 SNP/kb in the coding regions to 27.6 SNP/kb in the transposable elements. A more inclusive new approach for analyzing duplication history is introduced here. It reveals an ancient whole-genome duplication, a recent segmental duplication on Chromosomes 11 and 12, and massive ongoing individual gene duplications. We find 18 distinct pairs of duplicated segments that cover 65.7% of the genome; 17 of these pairs date back to a common time before the divergence of the grasses. More important, ongoing individual gene duplications provide a never-ending source of raw material for gene genesis and are major contributors to the differences between members of the grass family.

  6. The Genomes of Oryza sativa: a history of duplications.

    Science.gov (United States)

    Yu, Jun; Wang, Jun; Lin, Wei; Li, Songgang; Li, Heng; Zhou, Jun; Ni, Peixiang; Dong, Wei; Hu, Songnian; Zeng, Changqing; Zhang, Jianguo; Zhang, Yong; Li, Ruiqiang; Xu, Zuyuan; Li, Shengting; Li, Xianran; Zheng, Hongkun; Cong, Lijuan; Lin, Liang; Yin, Jianning; Geng, Jianing; Li, Guangyuan; Shi, Jianping; Liu, Juan; Lv, Hong; Li, Jun; Wang, Jing; Deng, Yajun; Ran, Longhua; Shi, Xiaoli; Wang, Xiyin; Wu, Qingfa; Li, Changfeng; Ren, Xiaoyu; Wang, Jingqiang; Wang, Xiaoling; Li, Dawei; Liu, Dongyuan; Zhang, Xiaowei; Ji, Zhendong; Zhao, Wenming; Sun, Yongqiao; Zhang, Zhenpeng; Bao, Jingyue; Han, Yujun; Dong, Lingli; Ji, Jia; Chen, Peng; Wu, Shuming; Liu, Jinsong; Xiao, Ying; Bu, Dongbo; Tan, Jianlong; Yang, Li; Ye, Chen; Zhang, Jingfen; Xu, Jingyi; Zhou, Yan; Yu, Yingpu; Zhang, Bing; Zhuang, Shulin; Wei, Haibin; Liu, Bin; Lei, Meng; Yu, Hong; Li, Yuanzhe; Xu, Hao; Wei, Shulin; He, Ximiao; Fang, Lijun; Zhang, Zengjin; Zhang, Yunze; Huang, Xiangang; Su, Zhixi; Tong, Wei; Li, Jinhong; Tong, Zongzhong; Li, Shuangli; Ye, Jia; Wang, Lishun; Fang, Lin; Lei, Tingting; Chen, Chen; Chen, Huan; Xu, Zhao; Li, Haihong; Huang, Haiyan; Zhang, Feng; Xu, Huayong; Li, Na; Zhao, Caifeng; Li, Shuting; Dong, Lijun; Huang, Yanqing; Li, Long; Xi, Yan; Qi, Qiuhui; Li, Wenjie; Zhang, Bo; Hu, Wei; Zhang, Yanling; Tian, Xiangjun; Jiao, Yongzhi; Liang, Xiaohu; Jin, Jiao; Gao, Lei; Zheng, Weimou; Hao, Bailin; Liu, Siqi; Wang, Wen; Yuan, Longping; Cao, Mengliang; McDermott, Jason; Samudrala, Ram; Wang, Jian; Wong, Gane Ka-Shu; Yang, Huanming

    2005-02-01

    We report improved whole-genome shotgun sequences for the genomes of indica and japonica rice, both with multimegabase contiguity, or almost 1,000-fold improvement over the drafts of 2002. Tested against a nonredundant collection of 19,079 full-length cDNAs, 97.7% of the genes are aligned, without fragmentation, to the mapped super-scaffolds of one or the other genome. We introduce a gene identification procedure for plants that does not rely on similarity to known genes to remove erroneous predictions resulting from transposable elements. Using the available EST data to adjust for residual errors in the predictions, the estimated gene count is at least 38,000-40,000. Only 2%-3% of the genes are unique to any one subspecies, comparable to the amount of sequence that might still be missing. Despite this lack of variation in gene content, there is enormous variation in the intergenic regions. At least a quarter of the two sequences could not be aligned, and where they could be aligned, single nucleotide polymorphism (SNP) rates varied from as little as 3.0 SNP/kb in the coding regions to 27.6 SNP/kb in the transposable elements. A more inclusive new approach for analyzing duplication history is introduced here. It reveals an ancient whole-genome duplication, a recent segmental duplication on Chromosomes 11 and 12, and massive ongoing individual gene duplications. We find 18 distinct pairs of duplicated segments that cover 65.7% of the genome; 17 of these pairs date back to a common time before the divergence of the grasses. More important, ongoing individual gene duplications provide a never-ending source of raw material for gene genesis and are major contributors to the differences between members of the grass family. PMID:15685292

  7. Comparative analysis of the genomes of two field isolates of the rice blast fungus Magnaporthe oryzae.

    Directory of Open Access Journals (Sweden)

    Minfeng Xue

    Full Text Available Rice blast caused by Magnaporthe oryzae is one of the most destructive diseases of rice worldwide. The fungal pathogen is notorious for its ability to overcome host resistance. To better understand its genetic variation in nature, we sequenced the genomes of two field isolates, Y34 and P131. In comparison with the previously sequenced laboratory strain 70-15, both field isolates had a similar genome size but slightly more genes. Sequences from the field isolates were used to improve genome assembly and gene prediction of 70-15. Although the overall genome structure is similar, a number of gene families that are likely involved in plant-fungal interactions are expanded in the field isolates. Genome-wide analysis on asynonymous to synonymous nucleotide substitution rates revealed that many infection-related genes underwent diversifying selection. The field isolates also have hundreds of isolate-specific genes and a number of isolate-specific gene duplication events. Functional characterization of randomly selected isolate-specific genes revealed that they play diverse roles, some of which affect virulence. Furthermore, each genome contains thousands of loci of transposon-like elements, but less than 30% of them are conserved among different isolates, suggesting active transposition events in M. oryzae. A total of approximately 200 genes were disrupted in these three strains by transposable elements. Interestingly, transposon-like elements tend to be associated with isolate-specific or duplicated sequences. Overall, our results indicate that gain or loss of unique genes, DNA duplication, gene family expansion, and frequent translocation of transposon-like elements are important factors in genome variation of the rice blast fungus.

  8. Evolutionary history of Oryza sativa LTR retrotransposons: a preliminary survey of the rice genome sequences

    Directory of Open Access Journals (Sweden)

    Ganko Eric W

    2004-03-01

    Full Text Available Abstract Background LTR Retrotransposons transpose through reverse transcription of an RNA intermediate and are ubiquitous components of all eukaryotic genomes thus far examined. Plant genomes, in particular, have been found to be comprised of a remarkably high number of LTR retrotransposons. There is a significant body of direct and indirect evidence that LTR retrotransposons have contributed to gene and genome evolution in plants. Results To explore the evolutionary history of long terminal repeat (LTR retrotransposons and their impact on the genome of Oryza sativa, we have extended an earlier computer-based survey to include all identifiable full-length, fragmented and solo LTR elements in the rice genome database as of April 2002. A total of 1,219 retroelement sequences were identified, including 217 full-length elements, 822 fragmented elements, and 180 solo LTRs. In order to gain insight into the chromosomal distribution of LTR-retrotransposons in the rice genome, a detailed examination of LTR-retrotransposon sequences on Chromosome 10 was carried out. An average of 22.3 LTR-retrotransposons per Mb were detected in Chromosome 10. Conclusions Gypsy-like elements were found to be >4 × more abundant than copia-like elements. Eleven of the thirty-eight investigated LTR-retrotransposon families displayed significant subfamily structure. We estimate that at least 46.5% of LTR-retrotransposons in the rice genome are older than the age of the species (

  9. Transcriptome population genomics reveals severe bottleneck and domestication cost in the African rice (Oryza glaberrima).

    Science.gov (United States)

    Nabholz, Benoit; Sarah, Gautier; Sabot, François; Ruiz, Manuel; Adam, Hélène; Nidelet, Sabine; Ghesquière, Alain; Santoni, Sylvain; David, Jacques; Glémin, Sylvain

    2014-05-01

    The African cultivated rice (Oryza glaberrima) was domesticated in West Africa 3000 years ago. Although less cultivated than the Asian rice (O. sativa), O. glaberrima landraces often display interesting adaptation to rustic environment (e.g. drought). Here, using RNA-seq technology, we were able to compare more than 12,000 transcripts between 9 O. glaberrima, 10 wild O. barthii and one O. meridionalis individuals. With a synonymous nucleotide diversity πs = 0.0006 per site, O. glaberrima appears as the least genetically diverse crop grass ever documented. Using approximate Bayesian computation, we estimated that O. glaberrima experienced a severe bottleneck during domestication. This demographic scenario almost fully accounts for the pattern of genetic diversity across O. glaberrima genome as we detected very few outliers regions where positive selection may have further impacted genetic diversity. Moreover, the large excess of derived nonsynonymous substitution that we detected suggests that the O. glaberrima population suffered from the 'cost of domestication'. In addition, we used this genome-scale data set to demonstrate that (i) O. barthii genetic diversity is positively correlated with recombination rate and negatively with gene density, (ii) expression level is negatively correlated with evolutionary constraint, and (iii) one region on chromosome 5 (position 4-6 Mb) exhibits a clear signature of introgression with a yet unidentified Oryza species. This work represents the first genome-wide survey of the African rice genetic diversity and paves the way for further comparison between the African and the Asian rice, notably regarding the genetics underlying domestication traits.

  10. A draft sequence of the rice(Oryza sativa ssp. indica) genome

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The sequence of the rice genome holds fundamental information for its biology, including physiology, genetics, development, and evolution, as well as information on many beneficial phenotypes of economic significance. Using a "whole genome shotgun" approach, we have produced a draft rice genome sequence of Oryza sativa ssp. indica, the major crop rice subspecies in China and many other regions of Asia. The draft genome sequence is constructed from over 4.3 million successful sequencing traces with an accumulative total length of 2214.9 Mb. The initial assembly of the non-redundant sequences reached 409.76 Mb in length, based on 3.30 million successful sequencing traces with a total length of 1797.4 Mb from an indica variant cultivar 93-11, giving an estimated coverage of 95.29% of the rice genome with an average base accuracy of higher than 99%. The coverage of the draft sequence, the randomness of the sequence distribution, and the consistency of BIG-ASSEM- BLER, a custom-designed software package used for the initial assembly, were verified rigorously by comparisons against finished BAC clone sequences from both indica and japanica strains, available from the public databases. Over all, 96.3% of full-length cDNAs, 96.4% of STS, STR, RFLP markers, 94.0% of ESTs and 94.9% unigene clusters were identified from the draft sequence. Our preliminary analysis on the data set shows that our rice draft sequence is consistent with the comman standard accepted by the genome sequencing community. The unconditional release of the draft to the public also undoubtedly provides a fundamental resource to the international scientific communities to facilitate genomic and genetic studies on rice biology.

  11. The organelle genomes of Hassawi rice (Oryza sativa L.) and its hybrid in saudi arabia: genome variation, rearrangement, and origins.

    Science.gov (United States)

    Zhang, Tongwu; Hu, Songnian; Zhang, Guangyu; Pan, Linlin; Zhang, Xiaowei; Al-Mssallem, Ibrahim S; Yu, Jun

    2012-01-01

    Hassawi rice (Oryza sativa L.) is a landrace adapted to the climate of Saudi Arabia, characterized by its strong resistance to soil salinity and drought. Using high quality sequencing reads extracted from raw data of a whole genome sequencing project, we assembled both chloroplast (cp) and mitochondrial (mt) genomes of the wild-type Hassawi rice (Hassawi-1) and its dwarf hybrid (Hassawi-2). We discovered 16 InDels (insertions and deletions) but no SNP (single nucleotide polymorphism) is present between the two Hassawi cp genomes. We identified 48 InDels and 26 SNPs in the two Hassawi mt genomes and a new type of sequence variation, termed reverse complementary variation (RCV) in the rice cp genomes. There are two and four RCVs identified in Hassawi-1 when compared to 93-11 (indica) and Nipponbare (japonica), respectively. Microsatellite sequence analysis showed there are more SSRs in the genic regions of both cp and mt genomes in the Hassawi rice than in the other rice varieties. There are also large repeats in the Hassawi mt genomes, with the longest length of 96,168 bp and 96,165 bp in Hassawi-1 and Hassawi-2, respectively. We believe that frequent DNA rearrangement in the Hassawi mt and cp genomes indicate ongoing dynamic processes to reach genetic stability under strong environmental pressures. Based on sequence variation analysis and the breeding history, we suggest that both Hassawi-1 and Hassawi-2 originated from the Indonesian variety Peta since genetic diversity between the two Hassawi cultivars is very low albeit an unknown historic origin of the wild-type Hassawi rice. PMID:22870184

  12. Genomic organization and sequence dynamics of the AvrPiz-t locus in Magnaporthe oryzae

    Institute of Scientific and Technical Information of China (English)

    Ping LI; Bin BAI; Hong-yan ZHANG; Heng ZHOU; Bo ZHOU

    2012-01-01

    Plants utilize multiple layers of defense mechanisms to fight against the invasion of diverse pathogens.The R gene mediates resistance,in most cases,dependent on the co-existence of its cognate pathogen-derived avirulence (Avr) gene.The rice blast R gene Piz-t corresponds in gene-for-gene fashion to the Magnaporthe oryzae Avrgene AvrPiz-t.In this study,we determined and compared the genomic sequences surrounding the AvrPiz-t gene in both avirulent and virulent isolates,designating as AvrPiz-t-ZB15 and avrPiz-t-70-15 regions,respectively.The sequence of the AvrPiz-t-ZB15 region is 120966 bp whereas avrPiz-t-70-15 is 146292 bp in length.The extreme sequence similarity and good synteny in gene order and content along with the absence of two predicted genes in the avrPiz-t-70-15 region were observed in the predicted protein-coding regions in the AvrPiz-t locus.Nevertheless,frequent presence/absence and highly dynamic organization of transposable elements (TEs) were identified,representing the major variation of the AvrPiz-t locus between different isolates.Moreover,TEs constitute 27.3% and 43.2%of the genomic contents of the AvrPiz-t-ZB15 and avrPiz-t-70-15 regions,respectively,indicating that TEs contribute largely to the organization and evolution of AvrPiz-t locus.The findings of this study suggest that M.oryzae could benefit in an evolutionary sense from the presence of active TEs in genes conferring avirulence and provide an ability to rapidly change and thus to overcome host R genes.

  13. Construction of a full bacterial artificial chromosome (BAC) library of Oryza sativa genome

    Institute of Scientific and Technical Information of China (English)

    TAOQUANZHOU; HAIYINGZHAO; 等

    1994-01-01

    We have constructed a full BAC library for the superior early indica variety of Oryza sativa,Guang Lu Ai 4.The MAX Efficiency DH10B with increased stability of inserts was used as BAC host cells.The potent pBelo BACII with double selection markers was used as cloning vector.The cloning efficiency we have reached was as high as 98%,and the transformation efficiency was raised up to 106 transformants/μg of large fragment DNA.The BAC recombinant transformants were picked at random and analyzed for the size of inserts,which turned out to be of 120 kb in length on average.We have obtained more than 20,000 such BAC clones.According to conventional probability equation,they covered the entire rice genome of 420,000 kb in length.The entire length of inserts of the library obtained has the 5-to 6-fold coverage of the genome.To our knowledge,this is the first reported full BAC library for a complex genome.

  14. A two-genome microarray for the rice pathogens Xanthomonas oryzae pv. oryzae and X. oryzae pv. oryzicola and its use in the discovery of a difference in their regulation of hrp genes

    Directory of Open Access Journals (Sweden)

    Lin Ye

    2008-06-01

    Full Text Available Abstract Background Xanthomonas oryzae pv. oryzae (Xoo and X. oryzae pv. oryzicola (Xoc are bacterial pathogens of the worldwide staple and grass model, rice. Xoo and Xoc are closely related but Xoo invades rice vascular tissue to cause bacterial leaf blight, a serious disease of rice in many parts of the world, and Xoc colonizes the mesophyll parenchyma to cause bacterial leaf streak, a disease of emerging importance. Both pathogens depend on hrp genes for type III secretion to infect their host. We constructed a 50–70 mer oligonucleotide microarray based on available genome data for Xoo and Xoc and compared gene expression in Xoo strains PXO99A and Xoc strain BLS256 grown in the rich medium PSB vs. XOM2, a minimal medium previously reported to induce hrp genes in Xoo strain T7174. Results Three biological replicates of the microarray experiment to compare global gene expression in representative strains of Xoo and Xoc grown in PSB vs. XOM2 were carried out. The non-specific error rate and the correlation coefficients across biological replicates and among duplicate spots revealed that the microarray data were robust. 247 genes of Xoo and 39 genes of Xoc were differentially expressed in the two media with a false discovery rate of 5% and with a minimum fold-change of 1.75. Semi-quantitative-RT-PCR assays confirmed differential expression of each of 16 genes each for Xoo and Xoc selected for validation. The differentially expressed genes represent 17 functional categories. Conclusion We describe here the construction and validation of a two-genome microarray for the two pathovars of X. oryzae. Microarray analysis revealed that using representative strains, a greater number of Xoo genes than Xoc genes are differentially expressed in XOM2 relative to PSB, and that these include hrp genes and other genes important in interactions with rice. An exception was the rax genes, which are required for production of the host resistance elicitor AvrXa21

  15. The evolutionary imprint of domestication on genome variation and function of the filamentous fungus Aspergillus oryzae.

    Science.gov (United States)

    Gibbons, John G; Salichos, Leonidas; Slot, Jason C; Rinker, David C; McGary, Kriston L; King, Jonas G; Klich, Maren A; Tabb, David L; McDonald, W Hayes; Rokas, Antonis

    2012-08-01

    The domestication of animals, plants, and microbes fundamentally transformed the lifestyle and demography of the human species [1]. Although the genetic and functional underpinnings of animal and plant domestication are well understood, little is known about microbe domestication [2-6]. Here, we systematically examined genome-wide sequence and functional variation between the domesticated fungus Aspergillus oryzae, whose saccharification abilities humans have harnessed for thousands of years to produce sake, soy sauce, and miso from starch-rich grains, and its wild relative A. flavus, a potentially toxigenic plant and animal pathogen [7]. We discovered dramatic changes in the sequence variation and abundance profiles of genes and wholesale primary and secondary metabolic pathways between domesticated and wild relative isolates during growth on rice. Our data suggest that, through selection by humans, an atoxigenic lineage of A. flavus gradually evolved into a "cell factory" for enzymes and metabolites involved in the saccharification process. These results suggest that whereas animal and plant domestication was largely driven by Neolithic "genetic tinkering" of developmental pathways, microbe domestication was driven by extensive remodeling of metabolism.

  16. Significant Comparative Characteristics between Orphan and Nonorphan Genes in the Rice (Oryza sativa L. Genome

    Directory of Open Access Journals (Sweden)

    Wen-Jiu Guo

    2007-01-01

    Full Text Available Microsatellites are short tandem repeats of one to six bases in genomic DNA. As microsatellites are highly polymorphic and play a vital role in gene function and recombination, they are an attractive subject for research in evolution and in the genetics and breeding of animals and plants. Orphan genes have no known homologs in existing databases. Using bioinformatic computation and statistical analysis, we identified 19,26 orphan genes in the rice (Oryza sativa ssp. Japanica cv. Nipponbare proteome. We found that a larger proportion of orphan genes are expressed after sexual maturation and under environmental pressure than nonorphan genes. Orphan genes generally have shorter protein lengths and intron size, and are faster evolving. Additionally, orphan genes have fewer PROSITE patterns with larger pattern sizes than those in nonorphan genes. The average microsatellite content and the percentage of trinucleotide repeats in orphan genes are also significantly higher than in nonorphan genes. Microsatellites are found less often in PROSITE patterns in orphan genes. Taken together, these orphan gene characteristics suggest that microsatellites play an important role in orphan gene evolution and expression.

  17. Genome-Wide Comparative Analysis and Expression Pattern of TCP Gene Families in Arabidopsis thaliana and Oryza sativa

    Institute of Scientific and Technical Information of China (English)

    Xuan Yao; Hong Ma; Jian Wang; Dabing Zhang

    2007-01-01

    Several TCP genes have been reported to play important roles in plant development; the TCP homologs encode a plant-specific family of putative transcription factors. To understand the evolutionary relationship of TCP genes of Arabidopsis thaliana and Oryza sativa L. (hereafter called rice), we have identified 23 and 22 TCP genes in the Arabidopsls and rice genomes, respectively. Using phylogenetic analysis, we grouped these TCP genes into three classes. In addition, the motifs outside the TCP domain further support the evolutionary relationships among these genes. The genome distribution of the TCP genes strongly supports the hypothesis that genome-wide and tandem duplication contributed to the expansion of the TCP gene family. The expression pattern of the TCP genes was analyzed further, providing useful clues about the function of these genes.

  18. Genome-wide comparative analysis of the IQD gene families in Arabidopsis thaliana and Oryza sativa

    Directory of Open Access Journals (Sweden)

    Levy Maggie

    2005-12-01

    Full Text Available Abstract Background Calcium signaling plays a prominent role in plants for coordinating a wide range of developmental processes and responses to environmental cues. Stimulus-specific generation of intracellular calcium transients, decoding of calcium signatures, and transformation of the signal into cellular responses are integral modules of the transduction process. Several hundred proteins with functions in calcium signaling circuits have been identified, and the number of downstream targets of calcium sensors is expected to increase. We previously identified a novel, calmodulin-binding nuclear protein, IQD1, which stimulates glucosinolate accumulation and plant defense in Arabidopsis thaliana. Here, we present a comparative genome-wide analysis of a new class of putative calmodulin target proteins in Arabidopsis and rice. Results We identified and analyzed 33 and 29 IQD1-like genes in Arabidopsis thaliana and Oryza sativa, respectively. The encoded IQD proteins contain a plant-specific domain of 67 conserved amino acid residues, referred to as the IQ67 domain, which is characterized by a unique and repetitive arrangement of three different calmodulin recruitment motifs, known as the IQ, 1-5-10, and 1-8-14 motifs. We demonstrated calmodulin binding for IQD20, the smallest IQD protein in Arabidopsis, which consists of a C-terminal IQ67 domain and a short N-terminal extension. A striking feature of IQD proteins is the high isoelectric point (~10.3 and frequency of serine residues (~11%. We compared the Arabidopsis and rice IQD gene families in terms of gene structure, chromosome location, predicted protein properties and motifs, phylogenetic relationships, and evolutionary history. The existence of an IQD-like gene in bryophytes suggests that IQD proteins are an ancient family of calmodulin-binding proteins and arose during the early evolution of land plants. Conclusion Comparative phylogenetic analyses indicate that the major IQD gene lineages

  19. Helminthosporium oryzae, Pyricularia oryzae

    OpenAIRE

    Karov, Ilija

    1983-01-01

    Helminthosporium oryzae-Simptomi bolesti se ispoljavaju u dva oblika: palez klijanaca i mrku pegavost. Prvi se javlja odmah po klijanju ili nicanju biljke, a drugi u toku cele vegetacije. Pyricularia oryzae-Simptomi bolesti -Plamenjaca je vazno oboljenje na pirincu i javlja se u svim reonima gde se pirinae gaji u Makedoniji. P.oryzae uzrokuje tri tipa bolesti »lisnu plamenjacu", »nodusnu plamenjacu« i »plevicnu plamenjacu. U SR Makedoniji ona se javlja u sva tri oblika, zajedno iii pojedin...

  20. Genome-scale analysis of the high-efficient protein secretion system of Aspergillus oryzae

    DEFF Research Database (Denmark)

    Liu, Lifang; Feizi, Amir; Osterlund, Tobias;

    2014-01-01

    Background: The koji mold, Aspergillus oryzae is widely used for the production of industrial enzymes due to its particularly high protein secretion capacity and ability to perform post-translational modifications. However, systemic analysis of its secretion system is lacking, generally due to th...

  1. Experimental evolution reveals genome-wide spectrum and dynamics of mutations in the rice blast fungus, Magnaporthe oryzae.

    Directory of Open Access Journals (Sweden)

    Junhyun Jeon

    Full Text Available Knowledge on mutation processes is central to interpreting genetic analysis data as well as understanding the underlying nature of almost all evolutionary phenomena. However, studies on genome-wide mutational spectrum and dynamics in fungal pathogens are scarce, hindering our understanding of their evolution and biology. Here, we explored changes in the phenotypes and genome sequences of the rice blast fungus Magnaporthe oryzae during the forced in vitro evolution by weekly transfer of cultures on artificial media. Through combination of experimental evolution with high throughput sequencing technology, we found that mutations accumulate rapidly prior to visible phenotypic changes and that both genetic drift and selection seem to contribute to shaping mutational landscape, suggesting the buffering capacity of fungal genome against mutations. Inference of mutational effects on phenotypes through the use of T-DNA insertion mutants suggested that at least some of the DNA sequence mutations are likely associated with the observed phenotypic changes. Furthermore, our data suggest oxidative damages and UV as major sources of mutation during subcultures. Taken together, our work revealed important properties of original source of variation in the genome of the rice blast fungus. We believe that these results provide not only insights into stability of pathogenicity and genome evolution in plant pathogenic fungi but also a model in which evolution of fungal pathogens in natura can be comparatively investigated.

  2. Genome-wide analysis of basic leucine zipper transcription factor families in Arabidopsis thaliana, Oryza saliva and Populus trichocarpa

    Institute of Scientific and Technical Information of China (English)

    JI Qian; ZHANG Liang-sheng; WANG Yi-fei; WANG Jian

    2009-01-01

    The basic leucine zipper (bZIP) transcription factors form a large gene family that is important in pathogen defense, light and stress signaling, etc. The Completed whole genome sequences of model plants Arabidopsis (Arabidopsis thaliana), rice (Oryza saliva) and poplar (Populus trichocarpa) constitute a valuable resource for genome-wide analysis and genomic comparative analysis, as they are representatives of the two major evolutionary lineages within the angiosperms: the monocotyledons and the dicotyledons. In this study, bioinformatics analysis identified 74, 89 and 88 bZIP genes respectively in Arabidopsis, rice and poplar. Moreover, a comprehensive overview of this gene family is presented, including the gene structure, phylogeny, chromosome distribution, conserved motifs. As a result, the plant bZIPs were organized into 10 subfamilies on basis of phylogenetic relationship. Gene duplication events during the family evolution history were also investigated. And it was further concluded that chromosomal/segmental duplication might have played a key role in gene expansion of bZIP gene family.

  3. The oryza map alignment project: the golden path to unlocking the genetic potential of wild rice species.

    Science.gov (United States)

    Wing, Rod A; Ammiraju, Jetty S S; Luo, Meizhong; Kim, Hyeran; Yu, Yeisoo; Kudrna, Dave; Goicoechea, Jose L; Wang, Wenming; Nelson, Will; Rao, Kiran; Brar, Darshan; Mackill, Dave J; Han, Bin; Soderlund, Cari; Stein, Lincoln; SanMiguel, Phillip; Jackson, Scott

    2005-09-01

    The wild species of the genus Oryza offer enormous potential to make a significant impact on agricultural productivity of the cultivated rice species Oryza sativa and Oryza glaberrima. To unlock the genetic potential of wild rice we have initiated a project entitled the 'Oryza Map Alignment Project' (OMAP) with the ultimate goal of constructing and aligning BAC/STC based physical maps of 11 wild and one cultivated rice species to the International Rice Genome Sequencing Project's finished reference genome--O. sativa ssp. japonica c. v. Nipponbare. The 11 wild rice species comprise nine different genome types and include six diploid genomes (AA, BB, CC, EE, FF and GG) and four tetrapliod genomes (BBCC, CCDD, HHKK and HHJJ) with broad geographical distribution and ecological adaptation. In this paper we describe our strategy to construct robust physical maps of all 12 rice species with an emphasis on the AA diploid O. nivara--thought to be the progenitor of modern cultivated rice. PMID:16217601

  4. Population structure and diversity of the aa genome of rice based on simple sequence repeats variation in organelle genome

    International Nuclear Information System (INIS)

    Maternally inherited mitochondrial and chloroplast genomes based Simple Sequence Repeat (SSR) variations were examined for their contribution to diversity of rice genome. Population structure and diversity analysis based on mitochondria and chloroplast inherited genome has been studied less as compared to nuclear genome inheritance. The present study was designed to evaluate the population structure and diversity of rice grown in Pakistan along with other countries based on maternally inherited mitochondria and chloroplast genome. The mitochondrial and chloroplast genomes were analyzed by using 42 mitochondrial and 20 chloroplast pairs of SSR primers. A slightly higher percentage of polymorphism was observed in chloroplast (30 percentage) than mitochondria (28.57 percentage). The average gene diversity for both mitochondrial and chloroplast was 0.32 oscillating from 0.041 to 0.620. The Polymorphism Information Content (PIC) value ranged from 0.040 to 0.543 with an average of 0.282, while the allelic richness ranged from two to four alleles with an average of 2.779 alleles. Mononucleotide repeats stood first (50 percentage polymorphic) for detecting polymorphism for organelle genomes followed by tri- (25 percentage), tetra- (14.29 percentage) and dinucleotide (12.5 percentage), respectively. Cluster and population structure analysis revealed two groups of accessions. On the basis of our results the AA genome of Asian cultivated rice diverges from the same origin during evolution. (author)

  5. Analysis of Magnaporthe oryzae Genome Reveals a Fungal Effector, Which Is Able to Induce Resistance Response in Transgenic Rice Line Containing Resistance Gene, Pi54.

    Science.gov (United States)

    Ray, Soham; Singh, Pankaj K; Gupta, Deepak K; Mahato, Ajay K; Sarkar, Chiranjib; Rathour, Rajeev; Singh, Nagendra K; Sharma, Tilak R

    2016-01-01

    Rice blast caused by Magnaporthe oryzae is one of the most important diseases of rice. Pi54, a rice gene that imparts resistance to M. oryzae isolates prevalent in India, was already cloned but its avirulent counterpart in the pathogen was not known. After decoding the whole genome of an avirulent isolate of M. oryzae, we predicted 11440 protein coding genes and then identified four candidate effector proteins which are exclusively expressed in the infectious structure, appresoria. In silico protein modeling followed by interaction analysis between Pi54 protein model and selected four candidate effector proteins models revealed that Mo-01947_9 protein model encoded by a gene located at chromosome 4 of M. oryzae, interacted best at the Leucine Rich Repeat domain of Pi54 protein model. Yeast-two-hybrid analysis showed that Mo-01947_9 protein physically interacts with Pi54 protein. Nicotiana benthamiana leaf infiltration assay confirmed induction of hypersensitive response in the presence of Pi54 gene in a heterologous system. Genetic complementation test also proved that Mo-01947_9 protein induces avirulence response in the pathogen in presence of Pi54 gene. Here, we report identification and cloning of a new fungal effector gene which interacts with blast resistance gene Pi54 in rice. PMID:27551285

  6. Biallelic and Genome Wide Association Mapping of Germanium Tolerant Loci in Rice (Oryza sativa L..

    Directory of Open Access Journals (Sweden)

    Partha Talukdar

    Full Text Available Rice plants accumulate high concentrations of silicon. Silicon has been shown to be involved in plant growth, high yield, and mitigating biotic and abiotic stresses. However, it has been demonstrated that inorganic arsenic is taken up by rice through silicon transporters under anaerobic conditions, thus the ability to efficiently take up silicon may be considered either a positive or a negative trait in rice. Germanium is an analogue of silicon that produces brown lesions in shoots and leaves, and germanium toxicity has been used to identify mutants in silicon and arsenic transport. In this study, two different genetic mapping methods were performed to determine the loci involved in germanium sensitivity in rice. Genetic mapping in the biparental cross of Bala × Azucena (an F6 population and a genome wide association (GWA study with 350 accessions from the Rice Diversity Panel 1 were conducted using 15 μM of germanic acid. This identified a number of germanium sensitive loci: some co-localised with previously identified quantitative trait loci (QTL for tissue silicon or arsenic concentration, none co-localised with Lsi1 or Lsi6, while one single nucleotide polymorphism (SNP was detected within 200 kb of Lsi2 (these are genes known to transport silicon, whose identity was discovered using germanium toxicity. However, examining candidate genes that are within the genomic region of the loci detected above reveals genes homologous to both Lsi1 and Lsi2, as well as a number of other candidate genes, which are discussed.

  7. Separation of Pyricularia oryzae chromosomal DNA by PFGE

    Institute of Scientific and Technical Information of China (English)

    HUANGDanian; YANGWei; NiYunmei

    1994-01-01

    Pyricularia oryzae is a fungal pathogen of rice. Few researches had been reported on the analysis of its genome, partly because the genomes can't be separated by general agarose gel electrophoresis.We herein report a technique to separate Pyricularia oryzae genomic DNA by pulse-field gel electrophoresis (PFGE).

  8. Purification and enzymatic characterization of secretory glycoside hydrolase family 3 (GH3) aryl β-glucosidases screened from Aspergillus oryzae genome.

    Science.gov (United States)

    Kudo, Kanako; Watanabe, Akira; Ujiie, Seiryu; Shintani, Takahiro; Gomi, Katsuya

    2015-12-01

    By a global search of the genome database of Aspergillus oryzae, we found 23 genes encoding putative β-glucosidases, among which 10 genes with a signal peptide belonging to glycoside hydrolase family 3 (GH3) were overexpressed in A. oryzae using the improved glaA gene promoter. Consequently, crude enzyme preparations from three strains, each harboring the genes AO090038000223 (bglA), AO090103000127 (bglF), and AO090003001511 (bglJ), showed a substrate preference toward p-nitrophenyl-β-d-glucopyranoside (pNPGlc) and thus were purified to homogeneity and enzymatically characterized. All the purified enzymes (BglA, BglF, and BglJ) preferentially hydrolyzed aryl β-glycosides, including pNPGlc, rather than cellobiose, and these enzymes were proven to be aryl β-glucosidases. Although the specific activity of BglF toward all the substrates tested was significantly low, BglA and BglJ showed appreciably high activities toward pNPGlc and arbutin. The kinetic parameters of BglA and BglJ for pNPGlc suggested that both the enzymes had relatively higher hydrolytic activity toward pNPGlc among the fungal β-glucosidases reported. The thermal and pH stabilities of BglA were higher than those of BglJ, and BglA was particularly stable in a wide pH range (pH 4.5-10). In contrast, BglJ was the most heat- and alkaline-labile among the three β-glucosidases. Furthermore, BglA was more tolerant to ethanol than BglJ; as a result, it showed much higher hydrolytic activity toward isoflavone glycosides in the presence of ethanol than BglJ. This study suggested that the mining of novel β-glucosidases exhibiting higher activity from microbial genome sequences is of great use for the production of beneficial compounds such as isoflavone aglycones. PMID:25936960

  9. Fine de novo sequencing of a fungal genome using only SOLiD short read data: verification on Aspergillus oryzae RIB40.

    Directory of Open Access Journals (Sweden)

    Myco Umemura

    Full Text Available The development of next-generation sequencing (NGS technologies has dramatically increased the throughput, speed, and efficiency of genome sequencing. The short read data generated from NGS platforms, such as SOLiD and Illumina, are quite useful for mapping analysis. However, the SOLiD read data with lengths of <60 bp have been considered to be too short for de novo genome sequencing. Here, to investigate whether de novo sequencing of fungal genomes is possible using only SOLiD short read sequence data, we performed de novo assembly of the Aspergillus oryzae RIB40 genome using only SOLiD read data of 50 bp generated from mate-paired libraries with 2.8- or 1.9-kb insert sizes. The assembled scaffolds showed an N50 value of 1.6 Mb, a 22-fold increase than those obtained using only SOLiD short read in other published reports. In addition, almost 99% of the reference genome was accurately aligned by the assembled scaffold fragments in long lengths. The sequences of secondary metabolite biosynthetic genes and clusters, whose products are of considerable interest in fungal studies due to their potential medicinal, agricultural, and cosmetic properties, were also highly reconstructed in the assembled scaffolds. Based on these findings, we concluded that de novo genome sequencing using only SOLiD short reads is feasible and practical for molecular biological study of fungi. We also investigated the effect of filtering low quality data, library insert size, and k-mer size on the assembly performance, and recommend for the assembly use of mild filtered read data where the N50 was not so degraded and the library has an insert size of ∼2.0 kb, and k-mer size 33.

  10. Genome-wide profiling of DNA methylation provides insights into epigenetic regulation of fungal development in a plant pathogenic fungus, Magnaporthe oryzae.

    Science.gov (United States)

    Jeon, Junhyun; Choi, Jaeyoung; Lee, Gir-Won; Park, Sook-Young; Huh, Aram; Dean, Ralph A; Lee, Yong-Hwan

    2015-02-24

    DNA methylation is an important epigenetic modification that regulates development of plants and mammals. To investigate the roles of DNA methylation in fungal development, we profiled genome-wide methylation patterns at single-nucleotide resolution during vegetative growth, asexual reproduction, and infection-related morphogenesis in a model plant pathogenic fungus, Magnaporthe oryzae. We found that DNA methylation occurs in and around genes as well as transposable elements and undergoes global reprogramming during fungal development. Such reprogramming of DNA methylation suggests that it may have acquired new roles other than controlling the proliferation of TEs. Genetic analysis of DNA methyltransferase deletion mutants also indicated that proper reprogramming in methylomes is required for asexual reproduction in the fungus. Furthermore, RNA-seq analysis showed that DNA methylation is associated with transcriptional silencing of transposable elements and transcript abundance of genes in context-dependent manner, reinforcing the role of DNA methylation as a genome defense mechanism. This comprehensive approach suggests that DNA methylation in fungi can be a dynamic epigenetic entity contributing to fungal development and genome defense. Furthermore, our DNA methylomes provide a foundation for future studies exploring this key epigenetic modification in fungal development and pathogenesis.

  11. Polyploid evolution in Oryza officinalis complex of the genus Oryza

    Directory of Open Access Journals (Sweden)

    Li Changbao

    2009-10-01

    Full Text Available Abstract Background Polyploidization is a prominent process in plant evolution, whereas the mechanism and tempo-spatial process remained poorly understood. Oryza officinalis complex, a polyploid complex in the genus Oryza, could exemplify the issues not only for it covering a variety of ploidy levels, but also for the pantropical geographic pattern of its polyploids in Asia, Africa, Australia and Americas, in which a pivotal genome, the C-genome, witnessed all the polyploidization process. Results Tracing the C-genome evolutionary history in Oryza officinalis complex, this study revealed the genomic relationships, polyploid forming and diverging times, and diploidization process, based on phylogeny, molecular-clock analyses and fluorescent in situ hybridization using genome-specific probes. Results showed that C-genome split with B-genome at ca. 4.8 Mya, followed by a series of speciation of C-genome diploids (ca. 1.8-0.9 Mya, which then partook in successive polyploidization events, forming CCDD tetraploids in ca. 0.9 Mya, and stepwise forming BBCC tetraploids between ca. 0.3-0.6 Mya. Inter-genomic translocations between B- and C-genomes were identified in BBCC tetraploid, O. punctata. Distinct FISH (fluorescent in situ hybridization patterns among three CCDD species were visualized by C-genome-specific probes. B-genome was modified before forming the BBCC tetraploid, O. malampuzhaensis. Conclusion C-genome, shared by all polyploid species in the complex, had experienced different evolutionary history particularly after polyploidization, e.g., inter-genomic exchange in BBCC and genomic invasion in CCDD tetraploids. It diverged from B-genome at 4.8 Mya, then participated in the tetraploid formation spanning from 0.9 to 0.3 Mya, and spread into tropics of the disjunct continents by transcontinentally long-distance dispersal, instead of vicariance, as proposed by this study, given that the continental splitting was much earlier than the C-genome

  12. Genome-wide analysis of the phospholipase D family in Oryza sativa and functional characterization of PLDβ1 in seed germination

    Institute of Scientific and Technical Information of China (English)

    Gang Li; Fang Lin; Hong-Wei Xue

    2007-01-01

    Phospholipase D(PLD)plays a critical role in plant growth and development,as well as in hormone and stress re-sponses.PLD encoding genes constitute a large gene family that are present in higher plants.There are 12 members ofthe PLD family in Arabidopsis thaliana and several of them have been functionally characterized;however,the membersofthe PLD family in Oryza sativa remain to be fully described.Through genome-wide analysis,17 PLD members foundin difrerent chromosomes have been identified in rice.Protein domain structural analysis reveals a novel subfamily,besides the C2-PLDs and PXPH@LDs,that is present in rice-the SP-PLD.SP-PLD harbors a signal peptide insteadof the C2 or PXPH domains at the N-terminus.Expression pattern analysis indicates that most PLD-encoding genes aredifferentially expressed in various tissues,or are induced by hormones or stress conditions,suggesting the involvement of PLD in multiple developmental processes.Transgenic studies have shown that the suppressed expression of rice PLDβ1results in reduced sensitivity to exogenous ABA during seed germination.Further analysis of the expression of ABAsignaling-related genes has revealed that PLDβ1 stimulates ABA signaling by activating SAPK,thus repressing G Amybexpression and inhibiting seed germination.

  13. A genome-wide view of miniature inverted-repeat transposable elements (MITEs) in rice, Oryza sativa ssp. japonica.

    Science.gov (United States)

    Oki, Nobuhiko; Yano, Kentaro; Okumoto, Yutaka; Tsukiyama, Takuji; Teraishi, Masayoshi; Tanisaka, Takatoshi

    2008-08-01

    Transposable elements (TEs) have played important roles in the evolution of genes and genomes of higher eukaryotes. Among the TEs in the rice genome, miniature inverted-repeat transposable elements (MITEs) exist at the highest copy number. Some of MITEs in the rice genome contain poly(A) signals and putative cis-acting regulatory domains. Insertion events of such MITEs may have caused many structural and functional changes of genomes. The genome-wide examination of MITE-derived sequences could elucidate the contribution of MITEs to gene evolution. Here we report on the MITEs in the rice genome that have contributed to the emergence of novel genes and the expansion of the sequence diversity of the genome and mRNAs. Of the MITE-derived sequences, approximately 6000 were found in gene regions (exons and introns) and 67,000 in intergenic regions. In gene regions, most MITEs are located in introns rather than exons. For over 300 protein-coding genes, coding sequences, poly(A) sites, transcription start sites, and splicing sites overlap with MITEs. These sequence alterations via MITE insertions potentially affect the biological functions of gene products. Many MITE insertions also exist in 5'-untranslated regions (UTRs), 3'-UTRs, and in the proximity of genes. Although mutations in these non-protein coding regions do not alter protein sequences, these regions have key roles for gene regulation. Moreover, MITE family sequences (Tourist, Stowaway, and others) are unevenly distributed in introns. Our findings suggest that MITEs may have contributed to expansion of genome diversity by causing alterations not only in gene functions but also in regulation of many genes. PMID:18931457

  14. Genetic relatedness of genus Oryza from Eastern Himalayan region as revealed by chloroplast matK gene

    Directory of Open Access Journals (Sweden)

    Doris Zodinpuii

    2013-12-01

    Full Text Available Phylogenetic relationship was studied in wild and cultivated rice using the chloroplast matK gene. The aligned sequence fragments were 826bp in length with 7.02% variable and 4.47% phylogenetically informative sites and the estimated Transition/Transversion bias (R was 1.97. Seven hundred and two characters were constant, 74 variable characters were parsimony-uninformative and 50 were parsimony–informative. Haplotypes of Mizoram rice and wild relatives (A genome were more similar than those of distantly related species (B, C/CD, E and G genomes. It further revealed that the EE genome species is most closely related to the CC genome and CCDD genomes. The BBCC genome species had different origins, and their maternal parents had either the BB or CC genome. An additional genome type, HHKK was recognized in O. coarctata and O. schlechteri. Within the AA genome the African, O. glaberrima and O. longistaminatea and American, O. glumipatula and O. barthii were closer to the Indian Oryza species, O. nivara and O. rufipogon. The unknown genome O. malampuzhaensis from India is closer to BB and BBCC genome containing respectively O. punctata from Cameroon and O. minuta from Philippines. CpG rich matK sequences were rich in GG and FF genotypes, whereas CpA rich sequences belonged to BB and BBCC related genomes variety.

  15. Genome-wide association mapping revealed a diverse genetic basis of seed dormancy across subpopulations in rice (Oryza sativa L.)

    OpenAIRE

    Magwa, Risper Auma; Zhao, Hu; Xing, Yongzhong

    2016-01-01

    Background Seed dormancy is an adaptive trait employed by flowering plants to avoid harsh environmental conditions for the continuity of their next generations. In cereal crops, moderate seed dormancy could help prevent pre-harvest sprouting and improve grain yield and quality. We performed a genome wide association study (GWAS) for dormancy, based on seed germination percentage (GP) in freshly harvested seeds (FHS) and after-ripened seeds (ARS) in 350 worldwide accessions that were character...

  16. Recurrent parent genome recovery analysis in a marker-assisted backcrossing program of rice (Oryza sativa L.).

    Science.gov (United States)

    Miah, Gous; Rafii, Mohd Y; Ismail, Mohd R; Puteh, Adam B; Rahim, Harun A; Latif, Mohammad A

    2015-02-01

    Backcross breeding is the most commonly used method for incorporating a blast resistance gene into a rice cultivar. Linkage between the resistance gene and undesirable units can persist for many generations of backcrossing. Marker-assisted backcrossing (MABC) along with marker-assisted selection (MAS) contributes immensely to overcome the main limitation of the conventional breeding and accelerates recurrent parent genome (RPG) recovery. The MABC approach was employed to incorporate (a) blast resistance gene(s) from the donor parent Pongsu Seribu 1, the blast-resistant local variety in Malaysia, into the genetic background of MR219, a popular high-yielding rice variety that is blast susceptible, to develop a blast-resistant MR219 improved variety. In this perspective, the recurrent parent genome recovery was analyzed in early generations of backcrossing using simple sequence repeat (SSR) markers. Out of 375 SSR markers, 70 markers were found polymorphic between the parents, and these markers were used to evaluate the plants in subsequent generations. Background analysis revealed that the extent of RPG recovery ranged from 75.40% to 91.3% and from 80.40% to 96.70% in BC1F1 and BC2F1 generations, respectively. In this study, the recurrent parent genome content in the selected BC2F2 lines ranged from 92.7% to 97.7%. The average proportion of the recurrent parent in the selected improved line was 95.98%. MAS allowed identification of the plants that are more similar to the recurrent parent for the loci evaluated in backcross generations. The application of MAS with the MABC breeding program accelerated the recovery of the RP genome, reducing the number of generations and the time for incorporating resistance against rice blast. PMID:25553855

  17. Production of Haploid Tissues and SNP Analysis of the Genome in Musa acuminata cv.'Matti'(AA)

    International Nuclear Information System (INIS)

    Haploid and doubled haploid plants are of considerable value in genetic studies, genomics and plant breeding, allowing characterization and exploitation of genes where only one allele is present. Inbred banana lines have not been developed and with very few haploids or homozygotes reported, we aimed to develop new materials for genetic and genomic studies and to see if protocols could be improved using a range of genetic material not previously investigated. Anther culture was carried out using four Musa acuminata (AA) cultivars grown in homestead cultivation in Kerala, southern India. Protocols based on using modified MS medium supplemented with 2,4-D and BA (0.1 mg 1-1 each) were used. Embryogenic callus was regenerated from 4% of anthers of cv. Matti. The callus produced somatic embryosthat developed small leaves but haploid plant regeneration was not achieved. Regenerated leaf tissues had a haploid set of chromosome complements. The haploid tissuesprovided a source of DNA which may be suitable for whole genome shotgun approaches to re-sequencing, where the high levels of heterozygosity in Musa would impair assembly. (author)

  18. Genome-scale analysis and comparison of gene expression profiles in developing and germinated pollen in Oryza sativa

    Directory of Open Access Journals (Sweden)

    Xue Yongbiao

    2010-05-01

    Full Text Available Abstract Background Pollen development from the microspore involves a series of coordinated cellular events, and the resulting mature pollen has a specialized function to quickly germinate, produce a polar-growth pollen tube derived from the vegetative cell, and deliver two sperm cells into the embryo sac for double fertilization. The gene expression profiles of developing and germinated pollen have been characterised by use of the eudicot model plant Arabidopsis. Rice, one of the most important cereal crops, has been used as an excellent monocot model. A comprehensive analysis of transcriptome profiles of developing and germinated pollen in rice is important to understand the conserved and diverse mechanism underlying pollen development and germination in eudicots and monocots. Results We used Affymetrix GeneChip® Rice Genome Array to comprehensively analyzed the dynamic changes in the transcriptomes of rice pollen at five sequential developmental stages from microspores to germinated pollen. Among the 51,279 transcripts on the array, we found 25,062 pollen-preferential transcripts, among which 2,203 were development stage-enriched. The diversity of transcripts decreased greatly from microspores to mature and germinated pollen, whereas the number of stage-enriched transcripts displayed a "U-type" change, with the lowest at the bicellular pollen stage; and a transition of overrepresented stage-enriched transcript groups associated with different functional categories, which indicates a shift in gene expression program at the bicellular pollen stage. About 54% of the now-annotated rice F-box protein genes were expressed preferentially in pollen. The transcriptome profile of germinated pollen was significantly and positively correlated with that of mature pollen. Analysis of expression profiles and coexpressed features of the pollen-preferential transcripts related to cell cycle, transcription, the ubiquitin/26S proteasome system, phytohormone

  19. Genetic architecture of aluminum tolerance in rice (Oryza sativa determined through genome-wide association analysis and QTL mapping.

    Directory of Open Access Journals (Sweden)

    Adam N Famoso

    2011-08-01

    Full Text Available Aluminum (Al toxicity is a primary limitation to crop productivity on acid soils, and rice has been demonstrated to be significantly more Al tolerant than other cereal crops. However, the mechanisms of rice Al tolerance are largely unknown, and no genes underlying natural variation have been reported. We screened 383 diverse rice accessions, conducted a genome-wide association (GWA study, and conducted QTL mapping in two bi-parental populations using three estimates of Al tolerance based on root growth. Subpopulation structure explained 57% of the phenotypic variation, and the mean Al tolerance in Japonica was twice that of Indica. Forty-eight regions associated with Al tolerance were identified by GWA analysis, most of which were subpopulation-specific. Four of these regions co-localized with a priori candidate genes, and two highly significant regions co-localized with previously identified QTLs. Three regions corresponding to induced Al-sensitive rice mutants (ART1, STAR2, Nrat1 were identified through bi-parental QTL mapping or GWA to be involved in natural variation for Al tolerance. Haplotype analysis around the Nrat1 gene identified susceptible and tolerant haplotypes explaining 40% of the Al tolerance variation within the aus subpopulation, and sequence analysis of Nrat1 identified a trio of non-synonymous mutations predictive of Al sensitivity in our diversity panel. GWA analysis discovered more phenotype-genotype associations and provided higher resolution, but QTL mapping identified critical rare and/or subpopulation-specific alleles not detected by GWA analysis. Mapping using Indica/Japonica populations identified QTLs associated with transgressive variation where alleles from a susceptible aus or indica parent enhanced Al tolerance in a tolerant Japonica background. This work supports the hypothesis that selectively introgressing alleles across subpopulations is an efficient approach for trait enhancement in plant breeding programs

  20. Post-genomic insights into the plant polysaccharide degradation potential of Aspergillus nidulans and comparison to Aspergillus niger and Aspergillus oryzae

    DEFF Research Database (Denmark)

    Coutinho, Pedro M.; Andersen, Mikael Rørdam; Kolenova, Katarina;

    2009-01-01

    The plant polysaccharide degradative potential of Aspergillus nidulans was analysed in detail and compared to that of Aspergillus niger and Aspergillus oryzae using a combination of bioinformatics, physiology and transcriptomics. Manual verification indicated that 28.4% of the A. nidulans ORFs...

  1. QTL analysis of novel genomic regions associated with yield and yield related traits in new plant type based recombinant inbred lines of rice (Oryza sativa L.

    Directory of Open Access Journals (Sweden)

    Marathi Balram

    2012-08-01

    Full Text Available Abstract Background Rice is staple food for more than half of the world’s population including two billion Asians, who obtain 60-70% of their energy intake from rice and its derivatives. To meet the growing demand from human population, rice varieties with higher yield potential and greater yield stability need to be developed. The favourable alleles for yield and yield contributing traits are distributed among two subspecies i.e., indica and japonica of cultivated rice (Oryza sativa L.. Identification of novel favourable alleles in indica/japonica will pave way to marker-assisted mobilization of these alleles in to a genetic background to break genetic barriers to yield. Results A new plant type (NPT based mapping population of 310 recombinant inbred lines (RILs was used to map novel genomic regions and QTL hotspots influencing yield and eleven yield component traits. We identified major quantitative trait loci (QTLs for days to 50% flowering (R2 = 25%, LOD = 14.3, panicles per plant (R2 = 19%, LOD = 9.74, flag leaf length (R2 = 22%, LOD = 3.05, flag leaf width (R2 = 53%, LOD = 46.5, spikelets per panicle (R2 = 16%, LOD = 13.8, filled grains per panicle (R2 = 22%, LOD = 15.3, percent spikelet sterility (R2 = 18%, LOD = 14.24, thousand grain weight (R2 = 25%, LOD = 12.9 and spikelet setting density (R2 = 23%, LOD = 15 expressing over two or more locations by using composite interval mapping. The phenotypic variation (R2 ranged from 8 to 53% for eleven QTLs expressing across all three locations. 19 novel QTLs were contributed by the NPT parent, Pusa1266. 15 QTL hotpots on eight chromosomes were identified for the correlated traits. Six epistatic QTLs effecting five traits at two locations were identified. A marker interval (RM3276-RM5709 on chromosome 4 harboring major QTLs for four traits was identified. Conclusions The present study reveals that favourable alleles for

  2. OsSERK1 regulates rice development but not immunity to Xanthomonas oryzae pv. oryzae or Magnaporthe oryzae

    Institute of Scientific and Technical Information of China (English)

    Shimin Zuo; and Pamela C Ronald; Xiaogang Zhou; Mawsheng Chen; Shilu Zhang; Benjamin Schwessinger; Deling Ruan; Can Yuan; Jing Wang; Xuewei Chen

    2014-01-01

    Somatic embryogenesis receptor kinase (SERK) proteins play pivotal roles in regulation of plant development and immunity. The rice genome contains two SERK genes, OsSerk1 and OsSerk2. We previously demonstrated that OsSerk2 is required for rice Xa21‐mediated resistance to Xanthomonas oryzae pv. oryzae (Xoo) and for normal development. Here we report the molecular characterization of OsSerk1. Overexpres-sion of OsSerk1 results in a semi‐dwarf phenotype whereas silencing of OsSerk1 results in a reduced angle of the lamina joint. OsSerk1 is not required for rice resistance to Xoo or Magnaporthe oryzae. Overexpression of OsSerk1 in OsSerk2‐silenced lines complements phenotypes associated with brassinosteroid (BR) signaling defects, but not the disease resistance phenotype mediated by Xa21. In yeast, OsSERK1 interacts with itself forming homodimers, and also interacts with the kinase domains of OsSERK2 and BRI1, respectively. OsSERK1 is a functional protein kinase capable of auto‐phosphorylation in vitro. We conclude that, whereas OsSERK2 regulates both rice development and immunity, OsSERK1 functions in rice development but not immunity to Xoo and M. oryzae.

  3. Telomere hypervariability in Magnaporthe oryzae.

    Science.gov (United States)

    Farman, Mark L; Kim, Yun-Sik

    2005-05-01

    SUMMARY The gray leaf spot disease of perennial ryegrass and tall fescue is caused by the fungus Magnaporthe oryzae (anamorph = Pyricularia oryzae). A collection of single-copy and repetitive DNA markers was used to investigate genetic diversity among 22 isolates of the gray leaf spot pathogen. The single-copy DNA markers revealed only three polymorphisms among 95 restriction fragments spanning approximately 0.6% of the genome. In addition, Southern hybridization analysis and mating tests revealed that all isolates possessed the MAT1-2 mating-type allele. Fingerprinting of repetitive DNA loci using the Pot2 and MGR583 probes also revealed a high degree of genetic similarity (> 85%) among isolates. These data are consistent with the gray leaf spot pathogens having a recent evolutionary origin. In contrast to the results obtained with probes for internal chromosome loci, a telomere probe revealed that the chromosome ends of the very same isolates are highly divergent, with most isolates sharing less than 20% fingerprint similarity with any other isolate. Telomere mutations arise extremely frequently and changes in telomere fingerprint profiles were readily observed during vegetative growth and among cultures derived from single spores isolated from agar medium and from lesions on perennial ryegrass leaves. PMID:20565657

  4. The distribution and copy number of copia-like retrotransposons in rice (Oryza sativa L.) and their implications in the organization and evolution of the rice genome

    OpenAIRE

    Wang, Shiping; Liu, Nan; Peng, Kaiman; Zhang, Qifa

    1999-01-01

    We used 22 fragments corresponding to the reverse transcriptase domain of copia-like retrotransposons as representatives to study the organization and distribution of these elements in the rice genome. The loci detected by these 22 fragments were assigned to 47 locations in the molecular-linkage map involving all 12 chromosomes. The distributional features of copia-like retrotransposons found in the rice genome indicated that (i) the loci detected were located mainly in one arm of each chromo...

  5. Cytological mechanisms of interspecific incrossability and hybrid sterility between Oryza sativa L. and O.alta Swallen

    Institute of Scientific and Technical Information of China (English)

    FU XueLin; LU YongGen; LIU XiangDong; Li JinQuan; Feng JiuHuan

    2007-01-01

    Oryza sativa and O. alta belong to AA and CCDD genomes in Oryza, respectively. Interspecific reproductive isolation limits the transfer of favorable genes from O. alta into O. sativa. The cytological mechanisms of interspecific incrossability and hybrid sterility between O. sativa and O. alta were studied systematically in this paper. We indentified two cytological causes of interspecific incrossability. First, we observed embryo sac incompatibility that caused fertilization barriers of variable severity such as non-fertilization, fertilization stagnation and egg cell single-fertilization. Second, we observed hybrid inviability, the major cause for incrossability, apparent from hybrid embryo developmental stagnation and embryo abortion. Hybrid sterility included both embryo sac sterility and pollen sterility.The hybrid embryo sac was completely sterile and exhibited mainly embryo sac degeneration. Hybrid pollen was also sterile and mainly typical abortive. Hybrid sterility was mainly caused by severely abnormal meioses of megasporocytes and pollen mother cells; it is the most important abnormality, being chromosome sterility. Several methods are suggested to overcome the interspecific reproductive isolation between O. sativa and O. alta.

  6. The Population Structure of African Cultivated Rice Oryza glaberrima (Steud.)

    DEFF Research Database (Denmark)

    Semon, Mande; Nielsen, Rasmus; Jones, Monty P.;

    2005-01-01

    Genome-wide linkage disequilibrium (LD) was investigated for 198 accessions of Oryza glaberrima using 93 nuclear microsatellite markers. Significantly elevated levels of LD were detected, even among distantly located markers. Free recombination among loci at the population genetic level was shown...

  7. Fine De Novo Sequencing of a Fungal Genome Using only SOLiD Short Read Data: Verification on Aspergillus oryzae RIB40

    OpenAIRE

    Myco Umemura; Yoshinori Koyama; Itaru Takeda; Hiroko Hagiwara; Tsutomu Ikegami; Hideaki Koike; Masayuki Machida

    2013-01-01

    The development of next-generation sequencing (NGS) technologies has dramatically increased the throughput, speed, and efficiency of genome sequencing. The short read data generated from NGS platforms, such as SOLiD and Illumina, are quite useful for mapping analysis. However, the SOLiD read data with lengths of

  8. Genome-wide association mapping for yield and other agronomic traits in an elite breeding population of tropical rice (Oryza sativa).

    Science.gov (United States)

    Begum, Hasina; Spindel, Jennifer E; Lalusin, Antonio; Borromeo, Teresita; Gregorio, Glenn; Hernandez, Jose; Virk, Parminder; Collard, Bertrand; McCouch, Susan R

    2015-01-01

    Genome-wide association mapping studies (GWAS) are frequently used to detect QTL in diverse collections of crop germplasm, based on historic recombination events and linkage disequilibrium across the genome. Generally, diversity panels genotyped with high density SNP panels are utilized in order to assay a wide range of alleles and haplotypes and to monitor recombination breakpoints across the genome. By contrast, GWAS have not generally been performed in breeding populations. In this study we performed association mapping for 19 agronomic traits including yield and yield components in a breeding population of elite irrigated tropical rice breeding lines so that the results would be more directly applicable to breeding than those from a diversity panel. The population was genotyped with 71,710 SNPs using genotyping-by-sequencing (GBS), and GWAS performed with the explicit goal of expediting selection in the breeding program. Using this breeding panel we identified 52 QTL for 11 agronomic traits, including large effect QTLs for flowering time and grain length/grain width/grain-length-breadth ratio. We also identified haplotypes that can be used to select plants in our population for short stature (plant height), early flowering time, and high yield, and thus demonstrate the utility of association mapping in breeding populations for informing breeding decisions. We conclude by exploring how the newly identified significant SNPs and insights into the genetic architecture of these quantitative traits can be leveraged to build genomic-assisted selection models.

  9. Crossability Barriers in the Interspecific Hybridization between Oryza sativa and O. meyeriana

    Institute of Scientific and Technical Information of China (English)

    Xue-Lin Fu; Yong-Gen Lu; Xiang-Dong Liu; Jin-Quan Li

    2009-01-01

    Oryza meyerlana Baill (GG genome) Is a precious germplaem in the tertiary gene pool of cultivated rice (AA genome), and possesses important traits such as resistance and tolerance to biotic and abiotic stress. However, interspecific crossability barrier, a critical bottleneck restricting genes transfer from O. meyeriana to cultivars has led to no hybrids through conventional reproduction. Therefore, the reasons undedying incrossability were investigated in the present report. The results showed that: (ⅰ) at 3-7 d after pollination (DAP), many hybdd embryos degenerated at the earlier globular-shaped stage, and could not develop into the later pear-shaped stage. Meanwhile, free endosperm nuclei started to degenerate at 1 DAP, and cellular endosperm could not form st 3 DAP, leading to nutrition starvation for young embryo development; (ⅱ) st 11-13 DAP, almost all hybrid ovaries aborted. Even though 72.22% of hybrid young embryos were produced in the interspecific hybridization between O. sativa and O. meyeriana, young embryos were not able to further develop into hybrid plantlets via culturing in vitro. The main reason for the incrossability was hybrid embryo inviability, presenting as embryo development stagnation and degeneration since 3 DAP. Some possible approaches to overcome the crossability banders in the interspecific hybridization between O. sativa and O. meyeriana are discussed.

  10. Developing high throughput genotyped chromosome segment substitution lines based on population whole-genome re-sequencing in rice (Oryza sativa L.

    Directory of Open Access Journals (Sweden)

    Gu Minghong

    2010-11-01

    Full Text Available Abstract Background Genetic populations provide the basis for a wide range of genetic and genomic studies and have been widely used in genetic mapping, gene discovery and genomics-assisted breeding. Chromosome segment substitution lines (CSSLs are the most powerful tools for the detection and precise mapping of quantitative trait loci (QTLs, for the analysis of complex traits in plant molecular genetics. Results In this study, a wide population consisting of 128 CSSLs was developed, derived from the crossing and back-crossing of two sequenced rice cultivars: 9311, an elite indica cultivar as the recipient and Nipponbare, a japonica cultivar as the donor. First, a physical map of the 128 CSSLs was constructed on the basis of estimates of the lengths and locations of the substituted chromosome segments using 254 PCR-based molecular markers. From this map, the total size of the 142 substituted segments in the population was 882.2 Mb, was 2.37 times that of the rice genome. Second, every CSSL underwent high-throughput genotyping by whole-genome re-sequencing with a 0.13× genome sequence, and an ultrahigh-quality physical map was constructed. This sequencing-based physical map indicated that 117 new segments were detected; almost all were shorter than 3 Mb and were not apparent in the molecular marker map. Furthermore, relative to the molecular marker-based map, the sequencing-based map yielded more precise recombination breakpoint determination and greater accuracy of the lengths of the substituted segments, and provided more accurate background information. Third, using the 128 CSSLs combined with the bin-map converted from the sequencing-based physical map, a multiple linear regression QTL analysis mapped nine QTLs, which explained 89.50% of the phenotypic variance for culm length. A large-effect QTL was located in a 791,655 bp region that contained the rice 'green revolution' gene. Conclusions The present results demonstrated that high

  11. Effector Diversification Contributes to Xanthomonas oryzae pv. oryzae Phenotypic Adaptation in a Semi-Isolated Environment

    Science.gov (United States)

    Quibod, Ian Lorenzo; Perez-Quintero, Alvaro; Booher, Nicholas J.; Dossa, Gerbert S.; Grande, Genelou; Szurek, Boris; Vera Cruz, Casiana; Bogdanove, Adam J.; Oliva, Ricardo

    2016-01-01

    Understanding the processes that shaped contemporary pathogen populations in agricultural landscapes is quite important to define appropriate management strategies and to support crop improvement efforts. Here, we took advantage of an historical record to examine the adaptation pathway of the rice pathogen Xanthomonas oryzae pv. oryzae (Xoo) in a semi-isolated environment represented in the Philippine archipelago. By comparing genomes of key Xoo groups we showed that modern populations derived from three Asian lineages. We also showed that diversification of virulence factors occurred within each lineage, most likely driven by host adaptation, and it was essential to shape contemporary pathogen races. This finding is particularly important because it expands our understanding of pathogen adaptation to modern agriculture. PMID:27667260

  12. Cell biology of the Koji mold Aspergillus oryzae.

    Science.gov (United States)

    Kitamoto, Katsuhiko

    2015-01-01

    Koji mold, Aspergillus oryzae, has been used for the production of sake, miso, and soy sauce for more than one thousand years in Japan. Due to the importance, A. oryzae has been designated as the national micro-organism of Japan (Koku-kin). A. oryzae has been intensively studied in the past century, with most investigations focusing on breeding techniques and developing methods for Koji making for sake brewing. However, the understanding of fundamental biology of A. oryzae remains relatively limited compared with the yeast Saccharomyces cerevisiae. Therefore, we have focused on studying the cell biology including live cell imaging of organelles, protein vesicular trafficking, autophagy, and Woronin body functions using the available genomic information. In this review, I describe essential findings of cell biology of A. oryzae obtained in our study for a quarter of century. Understanding of the basic biology will be critical for not its biotechnological application, but also for an understanding of the fundamental biology of other filamentous fungi.

  13. Genomics of Industrial Aspergilli and Comparison with Toxigenic Relatives

    Science.gov (United States)

    Aspergillus oryzae has been widely used in Japanese fermentation industries for longer than a thousand years. A. oryzae produces large amounts of various hydrolytic enzymes and has been successfully applied to modern biotechnology. The A. oryzae genome size (37.5 Mb) is very close to those of A. f...

  14. Genome wide association mapping of grain arsenic, copper, molybdenum and zinc in rice (Oryza sativa L. grown at four international field sites.

    Directory of Open Access Journals (Sweden)

    Gareth J Norton

    Full Text Available The mineral concentrations in cereals are important for human health, especially for individuals who consume a cereal subsistence diet. A number of elements, such as zinc, are required within the diet, while some elements are toxic to humans, for example arsenic. In this study we carry out genome-wide association (GWA mapping of grain concentrations of arsenic, copper, molybdenum and zinc in brown rice using an established rice diversity panel of ∼ 300 accessions and 36.9 k single nucleotide polymorphisms (SNPs. The study was performed across five environments: one field site in Bangladesh, one in China and two in the US, with one of the US sites repeated over two years. GWA mapping on the whole dataset and on separate subpopulations of rice revealed a large number of loci significantly associated with variation in grain arsenic, copper, molybdenum and zinc. Seventeen of these loci were detected in data obtained from grain cultivated in more than one field location, and six co-localise with previously identified quantitative trait loci. Additionally, a number of candidate genes for the uptake or transport of these elements were located near significantly associated SNPs (within 200 kb, the estimated global linkage disequilibrium previously employed in this rice panel. This analysis highlights a number of genomic regions and candidate genes for further analysis as well as the challenges faced when mapping environmentally-variable traits in a highly genetically structured diversity panel.

  15. Gene Ontology annotation of the rice blast fungus, Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Deng Jixin

    2009-02-01

    Full Text Available Abstract Background Magnaporthe oryzae, the causal agent of blast disease of rice, is the most destructive disease of rice worldwide. The genome of this fungal pathogen has been sequenced and an automated annotation has recently been updated to Version 6 http://www.broad.mit.edu/annotation/genome/magnaporthe_grisea/MultiDownloads.html. However, a comprehensive manual curation remains to be performed. Gene Ontology (GO annotation is a valuable means of assigning functional information using standardized vocabulary. We report an overview of the GO annotation for Version 5 of M. oryzae genome assembly. Methods A similarity-based (i.e., computational GO annotation with manual review was conducted, which was then integrated with a literature-based GO annotation with computational assistance. For similarity-based GO annotation a stringent reciprocal best hits method was used to identify similarity between predicted proteins of M. oryzae and GO proteins from multiple organisms with published associations to GO terms. Significant alignment pairs were manually reviewed. Functional assignments were further cross-validated with manually reviewed data, conserved domains, or data determined by wet lab experiments. Additionally, biological appropriateness of the functional assignments was manually checked. Results In total, 6,286 proteins received GO term assignment via the homology-based annotation, including 2,870 hypothetical proteins. Literature-based experimental evidence, such as microarray, MPSS, T-DNA insertion mutation, or gene knockout mutation, resulted in 2,810 proteins being annotated with GO terms. Of these, 1,673 proteins were annotated with new terms developed for Plant-Associated Microbe Gene Ontology (PAMGO. In addition, 67 experiment-determined secreted proteins were annotated with PAMGO terms. Integration of the two data sets resulted in 7,412 proteins (57% being annotated with 1,957 distinct and specific GO terms. Unannotated proteins

  16. Comparative chemistry of Aspergillus oryzae (RIB40) and A. flavus (NRRL 3357)

    DEFF Research Database (Denmark)

    Rank, Christian; Klejnstrup, Marie Louise; Petersen, Lene Maj;

    2012-01-01

    Aspergillus oryzae and A. flavus are important species in industrial biotechnology and food safety and have been some of the first aspergilli to be fully genome sequenced. Bioinformatic analysis has revealed 99.5% gene homology between the two species pointing towards a large coherence in the sec...... alkaloids related to the A. flavus metabolites ditryptophenalines and miyakamides. Generally the secondary metabolite capability of A. oryzae presents several novel end products likely to result from the domestication process from A. flavus....

  17. Assessment of genetic diversity of Xanthomonas oryzae pv. oryzae

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    @@Bacterial blight of rice, caused by Xanthomonas oryzae pv. Oryzae(Xoo. ), is one of the major rice diseases in China. Making clear the shift of genetic diversity of the pathogen will provide important information for rice breeding. Strains collected from 11 provinces located in Southern region of the Changjiang River in China were assessed by using inoculation method and IS-PCR(Insertion Sequence-Based Polymerase Chain Reaction) analysis.

  18. Reconstruction of putative DNA virus from endogenous rice tungro bacilliform virus-like sequences in the rice genome: implications for integration and evolution

    Directory of Open Access Journals (Sweden)

    Kishima Yuji

    2004-10-01

    Full Text Available Abstract Background Plant genomes contain various kinds of repetitive sequences such as transposable elements, microsatellites, tandem repeats and virus-like sequences. Most of them, with the exception of virus-like sequences, do not allow us to trace their origins nor to follow the process of their integration into the host genome. Recent discoveries of virus-like sequences in plant genomes led us to set the objective of elucidating the origin of the repetitive sequences. Endogenous rice tungro bacilliform virus (RTBV-like sequences (ERTBVs have been found throughout the rice genome. Here, we reconstructed putative virus structures from RTBV-like sequences in the rice genome and characterized to understand evolutionary implication, integration manner and involvements of endogenous virus segments in the corresponding disease response. Results We have collected ERTBVs from the rice genomes. They contain rearranged structures and no intact ORFs. The identified ERTBV segments were shown to be phylogenetically divided into three clusters. For each phylogenetic cluster, we were able to make a consensus alignment for a circular virus-like structure carrying two complete ORFs. Comparisons of DNA and amino acid sequences suggested the closely relationship between ERTBV and RTBV. The Oryza AA-genome species vary in the ERTBV copy number. The species carrying low-copy-number of ERTBV segments have been reported to be extremely susceptible to RTBV. The DNA methylation state of the ERTBV sequences was correlated with their copy number in the genome. Conclusions These ERTBV segments are unlikely to have functional potential as a virus. However, these sequences facilitate to establish putative virus that provided information underlying virus integration and evolutionary relationship with existing virus. Comparison of ERTBV among the Oryza AA-genome species allowed us to speculate a possible role of endogenous virus segments against its related disease.

  19. Genomic selection and association mapping in rice (Oryza sativa): effect of trait genetic architecture, training population composition, marker number and statistical model on accuracy of rice genomic selection in elite, tropical rice breeding lines.

    Science.gov (United States)

    Spindel, Jennifer; Begum, Hasina; Akdemir, Deniz; Virk, Parminder; Collard, Bertrand; Redoña, Edilberto; Atlin, Gary; Jannink, Jean-Luc; McCouch, Susan R

    2015-02-01

    Genomic Selection (GS) is a new breeding method in which genome-wide markers are used to predict the breeding value of individuals in a breeding population. GS has been shown to improve breeding efficiency in dairy cattle and several crop plant species, and here we evaluate for the first time its efficacy for breeding inbred lines of rice. We performed a genome-wide association study (GWAS) in conjunction with five-fold GS cross-validation on a population of 363 elite breeding lines from the International Rice Research Institute's (IRRI) irrigated rice breeding program and herein report the GS results. The population was genotyped with 73,147 markers using genotyping-by-sequencing. The training population, statistical method used to build the GS model, number of markers, and trait were varied to determine their effect on prediction accuracy. For all three traits, genomic prediction models outperformed prediction based on pedigree records alone. Prediction accuracies ranged from 0.31 and 0.34 for grain yield and plant height to 0.63 for flowering time. Analyses using subsets of the full marker set suggest that using one marker every 0.2 cM is sufficient for genomic selection in this collection of rice breeding materials. RR-BLUP was the best performing statistical method for grain yield where no large effect QTL were detected by GWAS, while for flowering time, where a single very large effect QTL was detected, the non-GS multiple linear regression method outperformed GS models. For plant height, in which four mid-sized QTL were identified by GWAS, random forest produced the most consistently accurate GS models. Our results suggest that GS, informed by GWAS interpretations of genetic architecture and population structure, could become an effective tool for increasing the efficiency of rice breeding as the costs of genotyping continue to decline.

  20. Molecular detection of Xanthomonas oryzae pv. oryzae, Xanthomonas oryzae pv. oryzicola, and Burkholderia glumae in infected rice seeds and leaves

    Science.gov (United States)

    Polymerase chain reaction (PCR) is particularly useful for plant pathogen detection. In the present study, multiplex PCR and SYBR green real-time PCR were developed to facilitate simultaneous detection of three important rice pathogens, Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, and Bur...

  1. AA Index

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  2. Molecular Cytogenetic Analysis of Spontaneous Interspecific Hybrid Between Oryza sativa and Oryza minuta

    Institute of Scientific and Technical Information of China (English)

    YI Chuan-deng; CHENG Xu; WANG Bei-bei; LIANG Guo-hua; GONG Zhi-yun; TANG Shu-zhu; GU Ming-hong

    2008-01-01

    Genomic in situ hybridization (GISH) is a powerful tool to characterize parental chromosomes in interspecific hybrids, including the behaviour of autosynapsis and chromosome paidng. It was used to distinguish the chromosomes of Oryza sativa from wild species in a spontaneous interspecific hybdd and to investigate the chromosome pairing at metaphase I in meiosis of the hybdd in this study. The hybrid was a triploid with 36 chromosomes according to the chromosome nurnber investigated in mitosis of root tips. During metaphase I of meiosis in the hybrid, less chromosome pairing was observed and most of the chromosomes existed as univalent. Based on GISH and FISH (Fluorescent in situ hybridization) analyses, the chromosomes of the hybrid were composed of genomes A, B and C. Thus, it was believed that the hybrid was the result of natural hybridization between cultivated rice and wild species O. minuta which was planted in experimental fields.

  3. Estimation of genome length

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The genome length is a fundamental feature of a species. This note outlined the general concept and estimation method of the physical and genetic length. Some formulae for estimating the genetic length were derived in detail. As examples, the genome genetic length of Pinus pinaster Ait. and the genetic length of chromosome Ⅵ of Oryza sativa L. were estimated from partial linkage data.

  4. Combination Patterns of Major R Genes Determine the Level of Resistance to the M. oryzae in Rice (Oryza sativa L..

    Directory of Open Access Journals (Sweden)

    Yunyu Wu

    Full Text Available Rice blast caused by Magnaporthe oryzae is the most devastating disease of rice and poses a serious threat to world food security. In this study, the distribution and effectiveness of 18 R genes in 277 accessions were investigated based on pathogenicity assays and molecular markers. The results showed that most of the accessions exhibited some degree of resistance (resistance frequency, RF >50%. Accordingly, most of the accessions were observed to harbor two or more R genes, and the number of R genes harbored in accessions was significantly positively correlated with RF. Some R genes were demonstrated to be specifically distributed in the genomes of rice sub-species, such as Pigm, Pi9, Pi5 and Pi1, which were only detected in indica-type accessions, and Pik and Piz, which were just harbored in japonica-type accessions. By analyzing the relationship between R genes and RF using a multiple stepwise regression model, the R genes Pid3, Pi5, Pi9, Pi54, Pigm and Pit were found to show the main effects against M. oryzae in indica-type accessions, while Pita, Pb1, Pik, Pizt and Pia were indicated to exhibit the main effects against M. oryzae in japonica-type accessions. Principal component analysis (PCA and cluster analysis revealed that combination patterns of major R genes were the main factors determining the resistance of rice varieties to M. oryzae, such as 'Pi9+Pi54', 'Pid3+Pigm', 'Pi5+Pid3+Pigm', 'Pi5+Pi54+Pid3+Pigm', 'Pi5+Pid3' and 'Pi5+Pit+Pid3' in indica-type accessions and 'Pik+Pib', 'Pik+Pita', 'Pik+Pb1', 'Pizt+Pia' and 'Pizt+Pita' in japonica-type accessions, which were able to confer effective resistance against M. oryzae. The above results provide good theoretical support for the rational utilization of combinations of major R genes in developing rice cultivars with broad-spectrum resistance.

  5. Identification of Chromosomes from Multiple Rice Genomes Using a Universal Molecular Cytogenetic Marker System

    Institute of Scientific and Technical Information of China (English)

    Xiaomin Tang; Weidong Bao; Wenli Zhang; Zhukuan Cheng

    2007-01-01

    To develop reliable techniques for chromosome identification is critical for cytogenetic research, especially for genomes with a large number and smaller-sized chromosomes. An efficient approach using bacterial artificial chromosome (BAG) clones as molecular cytological markers has been developed for many organisms. Herein, we present a set of chromosomal arm-specific molecular cytological markers derived from the gene-enriched regions of the sequenced rice genome. All these markers are able to generate very strong signals on the pachytene chromosomes of Oryza satlva L. (AA genome) when used as fluorescence in situ hybridization (FISH) probes. We further probed those markers to the pachytene chromosomes of O. punctata (BB genome) and O. officinalis (CC genome) and also got very strong signals on the relevant pachytene chromosomes. The signal position of each marker on the related chromosomes from the three different rice genomes was pretty much stable, which enabled us to identify different chromosomes among various rice genomes. We also constructed the karyotype for both O. punctata and O. officinalis with the BB and CC genomes, respectively, by analysis of 10 pachytene cells anchored by these chromosomal arm-specific markers.

  6. In planta gene expression analysis of Xanthomonas oryzae pathovar oryzae, African strain MAI1

    Directory of Open Access Journals (Sweden)

    Verdier Valérie

    2010-06-01

    Full Text Available Abstract Background Bacterial leaf blight causes significant yield losses in rice crops throughout Asia and Africa. Although both the Asian and African strains of the pathogen, Xanthomonas oryzae pv. oryzae (Xoo, induce similar symptoms, they are nevertheless genetically different, with the African strains being more closely related to the Asian X. oryzae pv. oryzicola (Xoc. Results Changes in gene expression of the African Xoo strain MAI1 in the susceptible rice cultivar Nipponbare were profiled, using an SSH Xoo DNA microarray. Microarray hybridization was performed comparing bacteria recovered from plant tissues at 1, 3, and 6 days after inoculation (dai with bacteria grown in vitro. A total of 710 bacterial genes were found to be differentially expressed, with 407 up-regulated and 303 down-regulated. Expression profiling indicated that less than 20% of the 710 bacterial transcripts were induced in the first 24 h after inoculation, whereas 63% were differentially expressed at 6 dai. The 710 differentially expressed genes were one-end sequenced. 535 sequences were obtained from which 147 non-redundant sequences were identified. Differentially expressed genes were related to metabolism, secretion and transport, pathogen adherence to plant tissues, plant cell-wall degradation, IS elements, and virulence. In addition, various other genes encoding proteins with unknown function or showing no similarity to other proteins were also induced. The Xoo MAI1 non-redundant set of sequences was compared against several X. oryzae genomes, revealing a specific group of genes that was present only in MAI1. Numerous IS elements were also found to be differentially expressed. Quantitative real-time PCR confirmed 86% of the identified profile on a set of 14 genes selected according to the microarray analysis. Conclusions This is the first report to compare the expression of Xoo genes in planta across different time points during infection. This work shows that

  7. Rating AAs.

    Science.gov (United States)

    Carter, Susan J.

    2001-01-01

    Why alternative investments? In a word: performance. Many higher education endowment and foundation managers are making increasing commitments to alternative investments, or AAs, in order to obtain higher returns and broader diversification for their investment portfolios than public securities instruments can usually provide. Learn how to handle…

  8. Isolation and characterization of 17 different genes encoding putative endopolygalacturonase genes from Rhizopus oryzae

    Science.gov (United States)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens and, more recently, production of biofuels from citrus wastes. In a search of the recently sequenced Rhizopus oryzae strain 99-880 genome database, 18 putative endopolygalacturonase genes were identified, w...

  9. Identification, Characterization, and Evolution of a Large Polygalacturonase Gene Family from Rhizopus oryzae

    Science.gov (United States)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens, clarification of juices, and more recently, production of value-added products from citrus wastes. A search of the recently sequenced Rhizopus oryzae strain 99-880 genome database uncovered 18 putative pol...

  10. Antimicrobial peptide melittin against Xanthomonas oryzae pv. oryzae, the bacterial leaf blight pathogen in rice

    OpenAIRE

    SHI, Wei; Li, Caiyun; Li, Man; Zong, Xicui; Han, Dongju; Chen, Yuqing

    2016-01-01

    Xanthomonas oryzae pv. oryzae is a destructive bacterial disease of rice, and the development of an environmentally safe bactericide is urgently needed. Antimicrobial peptides, as antibacterial sources, may play important roles in bactericide development. In the present study, we found that the antimicrobial peptide melittin had the desired antibacterial activity against X. oryzae pv. oryzae. The antibacterial mechanism was investigated by examining its effects on cell membranes, energy metab...

  11. A novel non-thermostable deuterolysin from Aspergillus oryzae.

    Science.gov (United States)

    Maeda, Hiroshi; Katase, Toru; Sakai, Daisuke; Takeuchi, Michio; Kusumoto, Ken-Ichi; Amano, Hitoshi; Ishida, Hiroki; Abe, Keietsu; Yamagata, Youhei

    2016-09-01

    Three putative deuterolysin (EC 3.4.24.29) genes (deuA, deuB, and deuC) were found in the Aspergillus oryzae genome database ( http://www.bio.nite.go.jp/dogan/project/view/AO ). One of these genes, deuA, was corresponding to NpII gene, previously reported. DeuA and DeuB were overexpressed by recombinant A. oryzae and were purified. The degradation profiles against protein substrates of both enzymes were similar, but DeuB showed wider substrate specificity against peptidyl MCA-substrates compared with DeuA. Enzymatic profiles of DeuB except for thermostability also resembled those of DeuA. DeuB was inactivated by heat treatment above 80° C, different from thermostable DeuA. Transcription analysis in wild type A. oryzae showed only deuB was expressed in liquid culture, and the addition of the proteinous substrate upregulated the transcription. Furthermore, the NaNO3 addition seems to eliminate the effect of proteinous substrate for the transcription of deuB. PMID:27050120

  12. Functional genomics in the rice blast fungus to unravel the fungal pathogenicity

    Institute of Scientific and Technical Information of China (English)

    Junhyun JEON; Jaehyuk CHOI; Jongsun PARK; Yong-Hwan LEE

    2008-01-01

    A rapidly growing number of successful genome sequencing projects in plant pathogenic fungi greatly increase the demands for tools and methodologies to study fungal pathogenicity at genomic scale. Magnaporthe oryzae is an economically important plant pathogenic fungus whose genome is fully sequenced. Recently we have reported the development and application of functional genomics platform technologies in M. oryzae. This model approach would have many practical ramifications in design and implementation of upcoming functional genomics studies of filamentous fungi aimed at understanding fungal pathogenicity.

  13. OryzaPG-DB: Rice Proteome Database based on Shotgun Proteogenomics

    Directory of Open Access Journals (Sweden)

    Tomita Masaru

    2011-04-01

    Full Text Available Abstract Background Proteogenomics aims to utilize experimental proteome information for refinement of genome annotation. Since mass spectrometry-based shotgun proteomics approaches provide large-scale peptide sequencing data with high throughput, a data repository for shotgun proteogenomics would represent a valuable source of gene expression evidence at the translational level for genome re-annotation. Description Here, we present OryzaPG-DB, a rice proteome database based on shotgun proteogenomics, which incorporates the genomic features of experimental shotgun proteomics data. This version of the database was created from the results of 27 nanoLC-MS/MS runs on a hybrid ion trap-orbitrap mass spectrometer, which offers high accuracy for analyzing tryptic digests from undifferentiated cultured rice cells. Peptides were identified by searching the product ion spectra against the protein, cDNA, transcript and genome databases from Michigan State University, and were mapped to the rice genome. Approximately 3200 genes were covered by these peptides and 40 of them contained novel genomic features. Users can search, download or navigate the database per chromosome, gene, protein, cDNA or transcript and download the updated annotations in standard GFF3 format, with visualization in PNG format. In addition, the database scheme of OryzaPG was designed to be generic and can be reused to host similar proteogenomic information for other species. OryzaPG is the first proteogenomics-based database of the rice proteome, providing peptide-based expression profiles, together with the corresponding genomic origin, including the annotation of novelty for each peptide. Conclusions The OryzaPG database was constructed and is freely available at http://oryzapg.iab.keio.ac.jp/.

  14. Development and Identification of Introgression Lines from Cross of Oryza sativa and Oryza minuta

    Institute of Scientific and Technical Information of China (English)

    GUO Si-bin; WEI Yu; LI Xiao-qiong; LIU Kai-qiang; HUANG Feng-kuan; CHEN Cai-hong; GAO Guo-qing

    2013-01-01

    Introgression line population is effectively used in mapping quantitative trait loci (QTLs),identifying favorable genes,discovering hidden genetic variation,evaluating the action or interaction of QTLs in multiple conditions and providing the favorable experimental materials for plant breeding and genetic research.In this study,an advanced backcross and consecutive selfing strategy was used to develop introgression lines (ILs),which derived from an accession of Oryza minuta (accession No.101133) with BBCC genome,as the donor,and an elite indica cultivar IR24 (O.sativa),as the recipient.Introgression segments from O.minuta were screened using 164 polymorphic simple sequence repeat (SSR) markers in the genome of each IL.Introgressed segments carried by 131 ILs covered the whole O.sativa genome.The average number of homozygous O.minuta segments per introgression line was about 9.99.The average length of introgressed segments was approximate 14.78 cM,and about 79.64%of these segments had sizes less than 20 cM.In the genome of each introgression line,the O.minuta chromosomal segments harbored chromosomal fragments of O.sativa ranging from 1.15% to 27.6%,with an overall average of 8.57%.At each locus,the ratio of substitution of O.minuta alleles had a range of 1.5%-25.2%,with an average of 8.3% Based on the evaluation of the phenotype of these ILs,a wide range of alterations in morphological and yield-related traits were found.After inoculation,ILs 41,11 and 7 showed high resistance to bacterial blight,brown planthopper and whitebacked planthopper,respectively.These O.minuta-O.sativa ILs will serve as genetic materials for identifying and using favorable genes from O.minuta.

  15. The rice proteogenomics database OryzaPG-DB: development, expansion and new features

    Directory of Open Access Journals (Sweden)

    Mohamed eHelmy

    2012-04-01

    Full Text Available Proteogenomics is the utilization of large-scale proteome data in genome annotation refinement. Our recently developed rice proteogenomics database (OryzaPG-DB is the first sustainable resource for rice shotgun-based proteogenomics, providing information on peptides identified in rice protein digested peptides measured by means of liquid chromatography-tandem mass spectrometry (LC-MS/MS, and mapping of the peptides to their genomic origins and the genomic novelty of each peptide. The sequences of the peptides, proteins, cDNAs and genes, and the gene annotations are available for download in FASTA and GFF3 formats, respectively. Further, an annotated visualization of the gene models, corresponding peptides and genomic novelty is available for each gene, and MS/MS spectra are available for each peptide. In this article, we discuss the utilization of OryzaPG-DB and report on its development, recent content expansions and newly added features in the current version (OryzaPG-DB v1.1.

  16. Xanthomonas oryzae pv oryzae triggers immediate transcriptomic modulations in rice

    Directory of Open Access Journals (Sweden)

    Grewal Rumdeep K

    2012-01-01

    Full Text Available Abstract Background Xanthomonas oryzae pv oryzae is a devastating pathogen of rice and has been extensively studied as a model pathogen of monocotyledons. Expressional studies in both the contenders have been undertaken in past to understand the molecular mechanism underlying the compatible and incompatible interactions in the pathosystem. Continuous update on database and gene annotations necessitates constant updating on the roles of the new entities as well as reinterpretation of regulations of the previous ones. Moreover the past endeavors have addressed the middle or late defense responses of the rice plant whereas in the present study an attempt has been made to investigate the early defense responses taking place immediately after inoculation. Results Microarray was used to study the transcriptional modulations in eighteen days old rice seedling leaves of both susceptible and resistant genotypes one hour after inoculation. In resistant plants as compared to susceptible ones 274 genes were found to be differentially expressed. Annotations could be assigned to 112 up- and 73 down-regulated transcripts and gene interaction maps were generated for 86 transcripts. Expressional data and interaction maps were used to develop a hypothetical scheme of the molecular events taking place during early defense response. Network analysis with the differential transcripts showed up-regulation of major clusters of cell signaling proteins and transcription factors while growth and basal metabolic components were largely found to be down-regulated. Conclusions This study provides an understanding of the early defense signaling in rice cells. Components of the calcium and lipid signaling as well as MAPK cascade were modulated, by signals from surface receptors and cytosolic R-proteins, to arouse jasmonic acid and ethylene signaling and suppress auxin signaling through various transcription factors. Abscisic acid modulation was also evident through the

  17. Molecular detection of Xanthomonas oryzae pv.oryzae, Xanthomonas oryzae pv. oryzicola, and Burkholderia glumae in infected rice seeds and leaves

    Institute of Scientific and Technical Information of China (English)

    Wen; Lu; Luqi; Pan; Haijun; Zhao; Yulin; Jia; Yanli; Wang; Xiaoping; Yu; Xueyan; Wang

    2014-01-01

    The polymerase chain reaction(PCR) is particularly useful for plant pathogen detection. In the present study, multiplex PCR and SYBR Green real-time PCR were developed to facilitate the simultaneous detection of three important rice pathogens, Xanthomonas oryzae pv.oryzae, X. oryzae pv. oryzicola, and Burkholderia glumae. The unique PCR primer sets were designed from portions of a putative glycosyltransferase gene of X. oryzae pv. oryzae, an Avr Rxo gene of X. oryzae pv. oryzicola, and an internal transcribed spacer(ITS) sequence of B. glumae. Using a multiplex PCR assay, X. oryzae pv. oryzae, X. oryzae pv. oryzicola, and B. glumae were detected in one PCR reaction that contained the newly developed primer set mix. Using SYBR Green real-time PCR assays, X. oryzae pv. oryzae, X. oryzae pv. oryzicola, and B. glumae were detected at 1, 1, and 10 fg μL-1, respectively. These newly designed molecular assays are sensitive and could be reliable tools for pathogen detection and disease forecasting.

  18. Antibacterial phycocyanin from Anabaena oryzae SOS13

    OpenAIRE

    Mahmoud Sitohy; Ali Osman; Abdel Ghany Abdel Ghany; Ali Salama

    2015-01-01

    Summary. The antimicrobial activity of phycocyanin extracted from Anabaena oryzae SOS13 was assayed against 4 pathogenic bacteria using agar well-diffusion assay and using benzyl Penicillin, Clindamycin, Ofloxacin and Doxycycline as positive controls. The concentration inhibiting 50% bacterial growth and the minimum inhibition concentration (MIC). The mode of action of phycocyanin on bacteria was explored using electron microscopy (SEM & TEM). Phycocyanin from Anabaena oryzae SOS13 has α and ...

  19. Diversity of Aspergillus oryzae genotypes (RFLP) isolated from traditional soy sauce production within Malaysia and Southeast Asia

    Science.gov (United States)

    DNA fingerprinting was performed on 64 strains of Aspergillus oryzae and one strain of A. sojae isolated from soysauce factories within Malaysia and Southeast Asia that use primitive traditional methods in producing 'tamari type' Cantonese soy sauce. PstI digests of total genomic DNA from each isol...

  20. The transfer RNA genes in Oryza sativa L.ssp.indica

    Institute of Scientific and Technical Information of China (English)

    王希胤; 史晓黎; 郝柏林

    2002-01-01

    The availability of the draft genome sequence of Oryza sativa L. ssp. indica has made it possible to study the rice tRNA genes. A total of 596 tRNA genes, including 3 selenocysteine tRNA genes and one suppressor tRNA gene are identified in 127551 rice contigs. There are 45 species of tRNA genes and the revised wobble hypothesis proposed by Guthrie and Abelson is perfectly obeyed. The relationship between codon usage and the number of corresponding tRNA genes is discussed. Redundancy may exist in the present list of tRNA genes and novel ones may be found in the future. A set of 33 tRNA genes is discovered in the complete chloroplast genome of Oryza sativa L. ssp. indica. These tRNA genes are identical to those in ssp. japonica identified by us independently from the origional annotation.

  1. Predicting the Interactome of Xanthomonas oryzae pathovar oryzae for target selection and DB service

    Directory of Open Access Journals (Sweden)

    Yoon Kyong-Oh

    2008-01-01

    Full Text Available Abstract Background Protein-protein interactions (PPIs play key roles in various cellular functions. In addition, some critical inter-species interactions such as host-pathogen interactions and pathogenicity occur through PPIs. Phytopathogenic bacteria infect hosts through attachment to host tissue, enzyme secretion, exopolysaccharides production, toxins release, iron acquisition, and effector proteins secretion. Many such mechanisms involve some kind of protein-protein interaction in hosts. Our first aim was to predict the whole protein interaction pairs (interactome of Xanthomonas oryzae pathovar oryzae (Xoo that is an important pathogenic bacterium that causes bacterial blight (BB in rice. We developed a detection protocol to find possibly interacting proteins in its host using whole genome PPI prediction algorithms. The second aim was to build a DB server and a bioinformatic procedure for finding target proteins in Xoo for developing pesticides that block host-pathogen protein interactions within critical biochemical pathways. Description A PPI network in Xoo proteome was predicted by bioinformatics algorithms: PSIMAP, PEIMAP, and iPfam. We present the resultant species specific interaction network and host-pathogen interaction, XooNET. It is a comprehensive predicted initial PPI data for Xoo. XooNET can be used by experimentalists to pick up protein targets for blocking pathological interactions. XooNET uses most of the major types of PPI algorithms. They are: 1 Protein Structural Interactome MAP (PSIMAP, a method using structural domain of SCOP, 2 Protein Experimental Interactome MAP (PEIMAP, a common method using public resources of experimental protein interaction information such as HPRD, BIND, DIP, MINT, IntAct, and BioGrid, and 3 Domain-domain interactions, a method using Pfam domains such as iPfam. Additionally, XooNET provides information on network properties of the Xoo interactome. Conclusion XooNET is an open and free public

  2. Differentiation of Indica-Japonica rice revealed by insertion/deletion (InDel) fragments obtained from the comparative genomic study of DNA sequences between 93-11 (Indica) and Nipponbare (Japonica)

    Institute of Scientific and Technical Information of China (English)

    CAI Xingxing; LIU Jing; QIU Yinqiu; ZHAO Wei; SONG Zhiping; LU Baorong

    2007-01-01

    DNA polymorphisms from nucleotide insertion/deletions (InDels) in genomic sequences are the basis for developing InDel molecular markers.To validate the InDel primer pairs on the basis of the comparative genomic study on DNA sequences between an Indica rice 93-11 and a Japonica rice Nipponbare for identifying Indica and Japonica rice varieties and studying wild Oryza species,we studied 49 Indica,43 Japonica,and 24 wild rice accessions collected from ten Asian countries using 45 InDel primer pairs.Results indicated that of the 45 InDel primer pairs,41 can accurately identify Indica and Japonica rice varieties with a reliability of over 80%.The scatter plotting data of the principal component analysis (PCA) indicated that:(i) the InDel primer pairs can easily distinguish Indica from Japonica rice varieties,in addition to revealing their genetic differentiation;(ii) the AA-genome wild rice species showed a relatively close genetic relationship with the Indica rice varieties;and (iii)the non-AA genome wild rice species did not show evident differentiation into the Indica and Japonica types.It is concluded from the study that most of the InDel primer pairs obtained from DNA sequences of 93-11 and Nipponbare can be used for identifying lndica and Japonica rice varieties,and for studying genetic relationships of wild rice species,particularly in terms of the Indica-Japonica differentiation.

  3. Analysis of in planta Expressed Orphan Genes in the Rice Blast Fungus Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Abu Sadat

    2014-12-01

    Full Text Available Genomes contain a large number of unique genes which have not been found in other species. Although the origin of such “orphan” genes remains unclear, they are thought to be involved in species-specific adaptive processes. Here, we analyzed seven orphan genes (MoSPC1 to MoSPC7 prioritized based on in planta expressed sequence tag data in the rice blast fungus, Magnaporthe oryzae. Expression analysis using qRT-PCR confirmed the expression of four genes (MoSPC1, MoSPC2, MoSPC3 and MoSPC7 during plant infection. However, individual deletion mutants of these four genes did not differ from the wild-type strain for all phenotypes examined, including pathogenicity. The length, GC contents, codon adaptation index and expression during mycelial growth of the four genes suggest that these genes formed during the evolutionary history of M. oryzae. Synteny analyses using closely related fungal species corroborated the notion that these genes evolved de novo in the M. oryzae genome. In this report, we discuss our inability to detect phenotypic changes in the four deletion mutants. Based on these results, the four orphan genes may be products of de novo gene birth processes, and their adaptive potential is in the course of being tested for retention or extinction through natural selection.

  4. Antimicrobial peptide melittin against Xanthomonas oryzae pv. oryzae, the bacterial leaf blight pathogen in rice.

    Science.gov (United States)

    Shi, Wei; Li, Caiyun; Li, Man; Zong, Xicui; Han, Dongju; Chen, Yuqing

    2016-06-01

    Xanthomonas oryzae pv. oryzae is a destructive bacterial disease of rice, and the development of an environmentally safe bactericide is urgently needed. Antimicrobial peptides, as antibacterial sources, may play important roles in bactericide development. In the present study, we found that the antimicrobial peptide melittin had the desired antibacterial activity against X. oryzae pv. oryzae. The antibacterial mechanism was investigated by examining its effects on cell membranes, energy metabolism, and nucleic acid, and protein synthesis. The antibacterial effects arose from its ability to interact with the bacterial cell wall and disrupt the cytoplasmic membrane by making holes and channels, resulting in the leakage of the cytoplasmic content. Additionally, melittin is able to permeabilize bacterial membranes and reach the cytoplasm, indicating that there are multiple mechanisms of antimicrobial action. DNA/RNA binding assay suggests that melittin may inhibit macromolecular biosynthesis by binding intracellular targets, such as DNA or RNA, and that those two modes eventually lead to bacterial cell death. Melittin can inhibit X. oryzae pv. oryzae from spreading, alleviating the disease symptoms, which indicated that melittin may have potential applications in plant protection. PMID:26948237

  5. The Perennial Ryegrass GenomeZipper – Targeted Use of Genome Resources for Comparative Grass Genomics

    DEFF Research Database (Denmark)

    Pfeiffer, Matthias; Martis, Mihaela; Asp, Torben;

    2013-01-01

    (Lolium perenne) genome on the basis of conserved synteny to barley (Hordeum vulgare) and the model grass genome Brachypodium (Brachypodium distachyon) as well as rice (Oryza sativa) and sorghum (Sorghum bicolor). A transcriptome-based genetic linkage map of perennial ryegrass served as a scaffold to...... assignment of 3,315 out of 8,876 previously unmapped genes to the respective chromosomes. In total, the GenomeZipper incorporates 4,035 conserved grass gene loci, which were used for the first genome-wide sequence divergence analysis between perennial ryegrass, barley, Brachypodium, rice, and sorghum. The...

  6. Suppressive effects of mycoviral proteins encoded by Magnaporthe oryzae chrysovirus 1 strain A on conidial germination of the rice blast fungus.

    Science.gov (United States)

    Urayama, Syun-Ichi; Kimura, Yuri; Katoh, Yu; Ohta, Tomoko; Onozuka, Nobuya; Fukuhara, Toshiyuki; Arie, Tsutomu; Teraoka, Tohru; Komatsu, Ken; Moriyama, Hiromitsu

    2016-09-01

    Magnaporthe oryzae chrysovirus 1 strain A (MoCV1-A) is the causal agent of growth repression and attenuated virulence (hypovirulence) of the rice blast fungus, Magnaporthe oryzae. We previously revealed that heterologous expression of the MoCV1-A ORF4 protein resulted in cytological damage to the yeasts Saccharomyces cerevisiae and Cryptococcus neoformans. Since the ORF4 protein is one of the components of viral particles, we evaluated the inhibitory effects of the purified virus particle against the conidial germination of M. oryzae, and confirmed its suppressive effects. Recombinant MoCV1-A ORF4 protein produced in Pichia pastoris was also effective for suppression of conidial germination of M. oryzae. MoCV1-A ORF4 protein sequence showed significant similarity to 6 related mycoviral proteins; Botrysphaeria dothidea chrysovirus 1, two Fusarium graminearum viruses, Fusarium oxysporum f. sp. dianthi mycovirus 1, Penicillium janczewski chrysovirus and Agaricus bisporus virus 1 in the Chrysoviridae family. Multiple alignments of the ORF4-related protein sequences showed that their central regions (210-591 aa in MoCV1-A ORF4) are relatively conserved. Indeed, yeast transformants expressing the conserved central region of MoCV1-A ORF4 protein (325-575 aa) showed similar impaired growth phenotypes as those observed in yeasts expressing the full-length MoCV1-A ORF4 protein. These data suggest that the mycovirus itself and its encoded viral protein can be useful as anti-fungal proteins to control rice blast disease caused by M. oryzae and other pathogenic fungi. PMID:27329666

  7. Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae.

    Science.gov (United States)

    Galagan, James E; Calvo, Sarah E; Cuomo, Christina; Ma, Li-Jun; Wortman, Jennifer R; Batzoglou, Serafim; Lee, Su-In; Baştürkmen, Meray; Spevak, Christina C; Clutterbuck, John; Kapitonov, Vladimir; Jurka, Jerzy; Scazzocchio, Claudio; Farman, Mark; Butler, Jonathan; Purcell, Seth; Harris, Steve; Braus, Gerhard H; Draht, Oliver; Busch, Silke; D'Enfert, Christophe; Bouchier, Christiane; Goldman, Gustavo H; Bell-Pedersen, Deborah; Griffiths-Jones, Sam; Doonan, John H; Yu, Jaehyuk; Vienken, Kay; Pain, Arnab; Freitag, Michael; Selker, Eric U; Archer, David B; Peñalva, Miguel A; Oakley, Berl R; Momany, Michelle; Tanaka, Toshihiro; Kumagai, Toshitaka; Asai, Kiyoshi; Machida, Masayuki; Nierman, William C; Denning, David W; Caddick, Mark; Hynes, Michael; Paoletti, Mathieu; Fischer, Reinhard; Miller, Bruce; Dyer, Paul; Sachs, Matthew S; Osmani, Stephen A; Birren, Bruce W

    2005-12-22

    The aspergilli comprise a diverse group of filamentous fungi spanning over 200 million years of evolution. Here we report the genome sequence of the model organism Aspergillus nidulans, and a comparative study with Aspergillus fumigatus, a serious human pathogen, and Aspergillus oryzae, used in the production of sake, miso and soy sauce. Our analysis of genome structure provided a quantitative evaluation of forces driving long-term eukaryotic genome evolution. It also led to an experimentally validated model of mating-type locus evolution, suggesting the potential for sexual reproduction in A. fumigatus and A. oryzae. Our analysis of sequence conservation revealed over 5,000 non-coding regions actively conserved across all three species. Within these regions, we identified potential functional elements including a previously uncharacterized TPP riboswitch and motifs suggesting regulation in filamentous fungi by Puf family genes. We further obtained comparative and experimental evidence indicating widespread translational regulation by upstream open reading frames. These results enhance our understanding of these widely studied fungi as well as provide new insight into eukaryotic genome evolution and gene regulation. PMID:16372000

  8. AA magnet measurement team

    CERN Multimedia

    1978-01-01

    Quickly improvised measurement equipment for the AA (Antiproton Accumulator) was all the tight schedule permitted, but the high motivation of the team made up for the lack of convenience. From left to right: Roy Billinge (Joint AA Project Leader, the other one was Simon van der Meer); Bruno Autin, Brian Pincott, Colin Johnson.

  9. Aspergillus oryzae pathways that convert phenylalanine into the flavor volatile 2-phenylethanol.

    Science.gov (United States)

    Masuo, Shunsuke; Osada, Lisa; Zhou, Shengmin; Fujita, Tomoya; Takaya, Naoki

    2015-04-01

    The filamentous fungus Aspergillus oryzae RIB40 produced 2-phenylethanol (PE) when cultured in minimum medium containing l-phenylalanine as a sole source of nitrogen. The fungus accumulated less PE in the absence of l-phenylalanine, indicating that it converted l-phenylalanine to PE. The PE production associated with fungal glucose consumption was repressed by exogenous ammonium, indicating that nitrogen-metabolite repression controls the pathway that produces PE. We identified the A. oryzae ppdA gene that is expressed at high levels in the presence of exogenous l-phenylalanine and its encoded protein was an active phenylpyruvate decarboxylase. The fungal genome encodes predicted aminotransferases of phenylalanine and PE dehydrogenases, which, together with PpdA, are likely to constitute an Erlich pathway similar to that in Saccharomyces cerevisiae that produces PE. We also identified an A. oryzae aromatic amino acid decarboxylase (AadA) that converted l-phenylalanine to phenylethylamine (PEA), and phenylalanine-inducible PEA oxidase activity in fungal cell extracts, and found that both constitute an alternative pathway through which PEA generates PE. Incubating fungal cultures with l-[(2)H8] phenylalanine to distinguish PE produced by these pathways, indicated that the fungus produced PE by both pathways, but to a greater extent by the Erlich pathway. Gene disruption of ppdA and aadA showed that both pathways participate in the fungal conversion of l-phenylalanine to PE.

  10. Discovery and analysis of an active long terminal repeat-retrotransposable element in Aspergillus oryzae.

    Science.gov (United States)

    Jie Jin, Feng; Hara, Seiichi; Sato, Atsushi; Koyama, Yasuji

    2014-01-01

    Wild-type Aspergillus oryzae RIB40 contains two copies of the AO090005001597 gene. We previously constructed A. oryzae RIB40 strain, RKuAF8B, with multiple chromosomal deletions, in which the AO090005001597 copy number was found to be increased significantly. Sequence analysis indicated that AO090005001597 is part of a putative 6,000-bp retrotransposable element, flanked by two long terminal repeats (LTRs) of 669 bp, with characteristics of retroviruses and retrotransposons, and thus designated AoLTR (A. oryzae LTR-retrotransposable element). AoLTR comprised putative reverse transcriptase, RNase H, and integrase domains. The deduced amino acid sequence alignment of AoLTR showed 94% overall identity with AFLAV, an A. flavus Tf1/sushi retrotransposon. Quantitative real-time RT-PCR showed that AoLTR gene expression was significantly increased in the RKuAF8B, in accordance with the increased copy number. Inverse PCR indicated that the full-length retrotransposable element was randomly integrated into multiple genomic locations. However, no obvious phenotypic changes were associated with the increased AoLTR gene copy number. PMID:24646755

  11. Rice Snl6, a cinnamoyl-CoA reductase-like gene family member, is required for NH1-mediated immunity to Xanthomonas oryzae pv. oryzae.

    Directory of Open Access Journals (Sweden)

    Rebecca S Bart

    2010-09-01

    Full Text Available Rice NH1 (NPR1 homolog 1 is a key mediator of innate immunity. In both plants and animals, the innate immune response is often accompanied by rapid cell death at the site of pathogen infection. Over-expression of NH1 in rice results in resistance to the bacterial pathogen, Xanthomonas oryzae pv. oryzae (Xoo, constitutive expression of defense related genes and enhanced benzothiadiazole (BTH- mediated cell death. Here we describe a forward genetic screen that identified a suppressor of NH1-mediated lesion formation and resistance, snl6. Comparative genome hybridization and fine mapping rapidly identified the genomic location of the Snl6 gene. Snl6 is a member of the cinnamoyl-CoA reductase (CCR-like gene family. We show that Snl6 is required for NH1-mediated resistance to Xoo. Further, we show that Snl6 is required for pathogenesis-related gene expression. In contrast to previously described CCR family members, disruption of Snl6 does not result in an obvious morphologic phenotype. Snl6 mutants have reduced lignin content and increased sugar extractability, an important trait for the production of cellulosic biofuels. These results suggest the existence of a conserved group of CCR-like genes involved in the defense response, and with the potential to alter lignin content without affecting development.

  12. Mapping of a new gene for brown planthopper resistance in cultivated rice introgressed from Oryza eichingeri

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Wild rice species is an important source of useful genes for cultivated rice improvement. Some accessions of Oryza eichingeri (2n = 24, CC) from Africa confer strong resistance to brown planthopper (BPH), whitebacked planthopper (WBPH) and bacterial blight (BB). In the present study, restriction fragments length polymorphism (RFLP) and simple sequence repeats (SSR) analysis were performed on disomic backcross plants between Oryza sativa (2n = 24, AA) and O. eichingeri in order to identify the presenee of O. eichingeri segments and further to localize BPH-resistant gene. In the introgression lines, 1-6O. eichingeri segments were detected on rice chromosomes 1, 2, 6, or/and 10. The dominant BPH resistant gene, tentatively named Bph13(t), was mapped to chromosome 2, being 6.1 and 5.5 cM away from two microsatellite markers RM240 and RM250, respectively. The transfer and localization of this gene from O. eichingeri will contribute to the improvement of BPH resistance in cultivated rice.``

  13. AAS 228: Welcome!

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Greetings from the 228th American Astronomical Society meeting in San Diego, California! This week, along with a team of fellow authorsfrom astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting twiceeach day. You can follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre at the meeting, come stop by the AAS booth (Booth #211-213) to learn about the newly-announced partnership between AAS and astrobites and pick up some swag.And dont forget to visit the IOP booth in the Exhibit Hall (Booth #223) to learn more about the new corridors for AAS Journals and to pick up a badge pin to representyour corridor!

  14. AA Narrow Quadrupole

    CERN Multimedia

    1979-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). This is the first one of the narrow quadrupoles, delivered by industry early in 1979.

  15. AAS 227: Welcome!

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Greetings from the 227th American Astronomical Society meeting in Kissimmee, Florida! This week, along with several fellow authors from astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting at the end of each day. You can follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre an author or referee (or plan to be!) and youre here at the meeting, consider joining us at our Author and Referee Workshop on Wednesday in the Tallahassee room, where well be sharingsome of the exciting new features of the AAS journals. You can drop intoeither of the two-hour sessions(10 AM 12 PM or 1 PM 3 PM), and there will be afree buffet lunch at noon.Heres the agenda:Morning SessionTopic Speaker10:00 am 10:05 amIntroductionsJulie Steffen10:05 am 10:35 amChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac10:35 am 11:00 amThe Peer Review ProcessButler Burton11:00 am 11:15 amAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler11:15 am 11:30 amFixing Software and Instrumentation Publishing: New Paper Styles in AAS JournalsChris Lintott11:30 am 11:45 amMaking Article Writing Easier with the New AASTeX v6.0Greg Schwarz11:45 am 12:00 pmBringing JavaScript and Interactivity to Your AAS Journal FiguresGus MuenchLunch SessionTopic Speaker12:00 pm 12:15 pmUnified Astronomy ThesaurusKatie Frey12:15 pm 12:30 pmAAS/ADS ORCID Integration ToolAlberto Accomazzi12:30 pm 12:45 pmWorldWide Telescope and Video AbstractsJosh Peek12:45 pm 01:00 pmArizona Astronomical Data Hub (AADH)Bryan HeidornAfternoon SessionTopic Speaker01:00 pm 01:05 pmIntroductionsJulie Steffen01:05 pm 01:35 pmChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac01:35 pm 02:00 pmThe Peer Review ProcessButler Burton02:00 pm 02:15 pmAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler02:15 pm 02:30 pm

  16. Geomagnetic aa Indices

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  17. Detection of Magnaporthe oryzae chrysovirus 1 in Japan and establishment of a rapid, sensitive and direct diagnostic method based on reverse transcription loop-mediated isothermal amplification.

    Science.gov (United States)

    Komatsu, Ken; Urayama, Syun-Ichi; Katoh, Yu; Fuji, Shin-Ichi; Hase, Shu; Fukuhara, Toshiyuki; Arie, Tsutomu; Teraoka, Tohru; Moriyama, Hiromitsu

    2016-02-01

    Magnaporthe oryzae chrysovirus 1 (MoCV1) is a mycovirus with a dsRNA genome that infects the rice blast fungus Magnaporthe oryzae and impairs its growth. To date, MoCV1 has only been found in Vietnamese isolates of M. oryzae, and the distribution of this virus in M. oryzae isolates from other parts of the world remains unknown. In this study, using a one-step reverse transcription PCR (RT-PCR) assay, we detected a MoCV1-related virus in M. oryzae in Japan (named MoCV1-AK) whose sequence shares considerable similarity with that of the MoCV1 Vietnamese isolate. To establish a system for a comprehensive survey of MoCV1 infection in the field, we developed a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for direct detection of the virus. The sensitivity of the RT-LAMP assay was at least as high as that of the one-step RT-PCR assay. In addition, we detected MoCV1-AK in M. oryzae-infected oatmeal agar plates and lesions on rice leaves using the RT-LAMP assay without dsRNA extraction, by simple sampling with a toothpick. Preliminary screening of MoCV1 in Japanese M. oryzae isolates indicated that MoCV1 is currently distributed in rice fields in Japan. Our results provide a first example of the application of RT-LAMP for the detection of mycoviruses, which will accelerate surveys for mycovirus infection. PMID:26547578

  18. Genetic relationships between interspecific lines derived from Oryza glaberrima and Oryza sativa crosses using microsatellites and agro-morphological markers

    Directory of Open Access Journals (Sweden)

    Yonnelle D. Moukoumbi

    2015-06-01

    Full Text Available New Rice(s for Africa (NERICA are high yielding rice varieties mostly cultivated in Sub-Saharan Africa and developed by the Africa Rice Center. This study is aimed at investigating the proportion of introgression of parental genomic contribution of 60 lowland NERICA varieties and establishment of molecular profiling. Agro-morphological data from 17 characteristics was recorded and significant (p<0.05 to high significant (p<0.0001 differences were obtained with leaf length and width, plant height at maturity, days to heading, maturity, primary and secondary branching of panicles, and grain width and grain thickness. A total of 114 microsatellite polymorphic markers covering 2183.13 cM of the rice genome showed the proportions of alleles introgressed from the donor parent (Oryza glaberrima into 52 lowland NERICA lines (TOG5681 and IR64as follows: 11% for BC2, 6.07% for BC3, and 7.55% for BC4. The introgression proportions for the eight remaining lowland NERICA lines derived from other crosses ranged from 5.5 to 11.3%. The proportion recorded with the recurrent parent was 83.99%. The highest introgression proportions of the O. glaberrima allele for all 60 lowland NERICA lines were found on chromosomes 2, 6, and 12 (TOG5681/IR64 and on chromosome 3 with NERIC-L-29 (TOG5681/IR1529-680-3-2. Multivariate analyses performed using an association of agro-morphological and molecular data revealed two major groups according to the distribution of the lowland NERICAs including the lowland NERICAs released were found in cluster 1 of the dendrogram. Genetic and genomic studies, QTL identification and analysis using agro-morphologically significant traits revealed should be used to develop mega-varieties adapted in rice growth conditions in Sub-Saharan Africa.

  19. Genotype × Environment Interactions of Yield Traits in Backcross Introgression Lines Derived from Oryza sativa cv. Swarna/Oryza nivara

    Science.gov (United States)

    Balakrishnan, Divya; Subrahmanyam, Desiraju; Badri, Jyothi; Raju, Addanki Krishnam; Rao, Yadavalli Venkateswara; Beerelli, Kavitha; Mesapogu, Sukumar; Surapaneni, Malathi; Ponnuswamy, Revathi; Padmavathi, G.; Babu, V. Ravindra; Neelamraju, Sarla

    2016-01-01

    Advanced backcross introgression lines (BILs) developed from crosses of Oryza sativa var. Swarna/O. nivara accessions were grown and evaluated for yield and related traits. Trials were conducted for consecutive three seasons in field conditions in a randomized complete block design with three replications. Data on yield traits under irrigated conditions were analyzed using the Additive Main Effect and Multiplicative Interaction (AMMI), Genotype and Genotype × Environment Interaction (GGE) and modified rank-sum statistic (YSi) for yield stability. BILs viz., G3 (14S) and G6 (166S) showed yield stability across the seasons along with high mean yield performance. G3 is early in flowering with high yield and has good grain quality and medium height, hence could be recommended for most of the irrigated locations. G6 is a late duration genotype, with strong culm strength, high grain number and panicle weight. G6 has higher yield and stability than Swarna but has Swarna grain type. Among the varieties tested DRRDhan 40 and recurrent parent Swarna showed stability for yield traits across the seasons. The component traits thousand grain weight, panicle weight, panicle length, grain number and plant height explained highest genotypic percentage over environment and interaction factors and can be prioritized to dissect stable QTLs/ genes. These lines were genotyped using microsatellite markers covering the entire rice genome and also using a set of markers linked to previously reported yield QTLs. It was observed that wild derived lines with more than 70% of recurrent parent genome were stable and showed enhanced yield levels compared to genotypes with higher donor genome introgressions.

  20. Functional analysis of histone deacetylase and its role in stress response, drug resistance and solid-state cultivation in Aspergillus oryzae.

    Science.gov (United States)

    Kawauchi, Moriyuki; Iwashita, Kazuhiro

    2014-08-01

    In the eukaryotic cell, histone deacetylases (HDACs) play key roles in the regulation of fundamental cellular process such as development regulation, stress response, secondary metabolism and genome integrity. Here, we provide a comprehensive phenotypic analysis using HDAC disruptants in Aspergillus oryzae. Our study revealed that four HDACs, hdaA/Aohda1, hdaB/Aorpd3, hdaD/Aohos2 and hst4/AohstD were involved in stress response, cell wall synthesis and chromatin integrity in A. oryzae. Osmotic stress sensitivity of HDAC disruptants differed between plate cultures and liquid cultures, suggesting that HDACs adapt to the difference environmental conditions. Using a common A. oryzae fermentation medium, rice-koji, we also characterized HDACs related to growth and enzyme production to investigate which HDACs will be required for adaptation to environmental conditions and stress resistances. Because HDACs are widely conserved, our study has broad applications and may inform work with filamentous fungi and other eukaryote. PMID:24613105

  1. 21 CFR 173.130 - Carbohydrase derived from Rhizopus oryzae.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Carbohydrase derived from Rhizopus oryzae. 173.130 Section 173.130 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES..., Phycomycetes; order, Mucorales; family, Mucoraceae; genus, Rhizopus; species, Rhizopus oryzae. (b) The...

  2. Aroma chemistry of African Oryza glaberrima and Oryza sativa rice and their interspecific hybrids

    NARCIS (Netherlands)

    Cho, S.; Nuijten, H.A.C.P.; Shewfelt, R.L.; Kays, S.J.

    2014-01-01

    BackgroundTo increase rice production in Africa, considerable research has focused on creating interspecific hybrids between African (Oryza glaberrima Steud.) and Asian (O. sativa L.) rice in an attempt to obtain the positive attributes of each in new cultivars. Since flavor is a key criterion in co

  3. Xanthomonas oryzae pv oryzae the Causal Agent of Bacterial Leaf Blight of rice: Isolation, Characterization, and Study of Transposon Mutagenesis

    Directory of Open Access Journals (Sweden)

    Abdjad Asih Nawangsih

    2011-04-01

    Full Text Available Xanthomonas oryzae pv oryzae the Causal Agent of Bacterial Leaf Blight of rice: Isolation, Characterization, and Study of Transposon Mutagenesis. X. oryzae pv. oryzae (Xoo causes bacterial leaf blight (BLB of rice (Oryza sativa L., a major disease that constrains production of the staple crop in many countries of the world. Identification of X. oryzae pv. oryzae (Xoo was conducted based on the disease symptoms, pathogenicity, morphological, physiological, and genetic characteristics of bacterial cultures isolated from the infected plants. Fifty bacterial isolates predicted as Xoo have been successfully isolated. They are aerobic, rod shaped, and Gram negative bacteria. The isolates were evaluated for their hypersensitivity in tobacco and pathogenicity in rice plant. Fifty isolates induced hypersensitive reaction in tobacco and showed pathogenicity symptom in rice in different length. Based on physiological test, hypersensitivity and pathogenicity reactions, three bacterial isolates strongly predicted as Xoo, i.e. STG21, STG42, and STG46, were non indole formation, non pigment fluorescent, hydrolyzed casein, catalase activity positive, but negative oxidase. Partial sequencing of 16S rRNA genes of STG21 and STG42 showed 80% and 82% homology with X. oryzae, respectively, while STG46 showed 84% homology with X. campestris. Mini-Tn5 transposon mutagenesis of STG21 generated one of the mutants (M5 lossed it’s ability to induce hypersensitive reaction in tobacco plant and deficient in pathogenicity on rice. The lesion length of rice leaf caused by the mutant M5 decreased up to 80%.

  4. Genomewide survey and characterization of metacaspase gene family in rice (Oryza sativa)

    Indian Academy of Sciences (India)

    Likai Wang; Hua Zhang

    2014-04-01

    Metacaspases (MCs), which are cysteine-dependent proteases found in plants, fungi, and protozoa, may be involved in programmed cell death processes, being distant relatives of metazoan caspases. In this study, we analysed the structures, phylogenetic relationship, genome localizations, expression patterns and domestic selections of eight MC genes identified in rice (OsMC). Alignment analysis of the corresponding protein sequences suggested OsMC proteins can be classified into two sub-types. The expression profiles of eight OsMC genes were analysed in 27 tissues covering the whole life cycle of rice. There are four OsMC genes uniquely expressed in mature tissues, indicating that these genes might play certain roles in senescence. Under abiotic and biotic stresses, four OsMC genes were expressed with treatments of one or more of Magnaporthe oryzae (M. oryzae) infected, pest damaged, cold stress and drought stress, indicating they might be involved in plant defense. In addition, gene trees and genetic diversity $(\\pi)$ were performed to measure whether candidate genes were selected during rice domestication. The results suggested that all the type I genes could not be domestication genes. However, two of five type II OsMC genes showed strong evidence for selective sweep, suggesting that these genes might be involved in cultivated rice domestication. These results provide a foundation for future functional genomic studies of this family in rice.

  5. Chloroplast DNA diversity in wild and cultivated species of rice (Genus Oryza, section Oryza). Cladistic-mutation and genetic-distance analysis.

    Science.gov (United States)

    Dally, A M; Second, G

    1990-08-01

    Using a novel nonaqueous procedure, chloroplast DNA was isolated from 318 individual adult rice plants, representing 247 accessions and the breadth of the diversity in section Oryza of genus Oryza. Among them, 32 different cpDNA restriction patterns were distinguished using the restriction endonucleases EcoRI and AvaI, and they were further characterized by restriction with BamHI, HindIII, SmaI, PstI, and BstEII enzymes. The differences in the electrophoretic band patterns were parsimoniously interpreted as being the result of 110 mutations, including 47 restriction site mutations. The relationships between band patterns were studied by a cladistic analysis based on shared mutations and by the computation of genetic distances based on shared bands. The deduced relationships were compared with earlier taxonomical studies. The maternal parents for BC genome allotetraploids were deduced. Within species, cpDNA diversity was found larger in those species with an evolutionary history of recent introgression and/or allotetraploidization. Occasional paternal inheritance and recombination of cpDNA in rice was suggested.

  6. Variation suggestive of horizontal gene transfer at a lipopolysaccharide (lps biosynthetic locus in Xanthomonas oryzae pv. oryzae, the bacterial leaf blight pathogen of rice

    Directory of Open Access Journals (Sweden)

    Sonti Ramesh V

    2004-10-01

    Full Text Available Abstract Background In animal pathogenic bacteria, horizontal gene transfer events (HGT have been frequently observed in genomic regions that encode functions involved in biosynthesis of the outer membrane located lipopolysaccharide (LPS. As a result, different strains of the same pathogen can have substantially different lps biosynthetic gene clusters. Since LPS is highly antigenic, the variation at lps loci is attributed to be of advantage in evading the host immune system. Although LPS has been suggested as a potentiator of plant defense responses, interstrain variation at lps biosynthetic gene clusters has not been reported for any plant pathogenic bacterium. Results We report here the complete sequence of a 12.2 kb virulence locus of Xanthomonas oryzae pv. oryzae (Xoo encoding six genes whose products are homologous to functions involved in LPS biosynthesis and transport. All six open reading frames (ORFs have atypical G+C content and altered codon usage, which are the hallmarks of genomic islands that are acquired by horizontal gene transfer. The lps locus is flanked by highly conserved genes, metB and etfA, respectively encoding cystathionine gamma lyase and electron transport flavoprotein. Interestingly, two different sets of lps genes are present at this locus in the plant pathogens, Xanthomonas campestris pv. campestris (Xcc and Xanthomonas axonopodis pv. citri (Xac. The genomic island is present in a number of Xoo strains from India and other Asian countries but is not present in two strains, one from India (BXO8 and another from Nepal (Nepal624 as well as the closely related rice pathogen, Xanthomonas oryzae pv. oryzicola (Xoor. TAIL-PCR analysis indicates that sequences related to Xac are present at the lps locus in both BXO8 and Nepal624. The Xoor strain has a hybrid lps gene cluster, with sequences at the metB and etfA ends, being most closely related to sequences from Xac and the tomato pathogen, Pseudomonas syringae pv. tomato

  7. Deciphering the signaling mechanisms of the plant cell wall degradation machinery in Aspergillus oryzae

    DEFF Research Database (Denmark)

    Udatha, D. B. R. K. Gupta; Topakas, Evangelos; Salazar, Margarita Pena;

    2015-01-01

    Background: The gene expression and secretion of fungal lignocellulolytic enzymes are tightly controlled at the transcription level using independent mechanisms to respond to distinct inducers from plant biomass. An advanced systems-level understanding of transcriptional regulatory networks...... is required to rationally engineer filamentous fungi for more efficient bioconversion of different types of biomass. Results: In this study we focused on ten chemically defined inducers to drive expression of cellulases, hemicellulases and accessory enzymes in the model filamentous fungus Aspergillus oryzae....... oryzae genome were only partially explained by the chemical similarity of the enzyme inducers. Genes encoding enzymes that have attracted considerable interest such as cellobiose dehydrogenases and copper-dependent polysaccharide mono-oxygenases presented a substrate-specific induction. Several homology...

  8. AAS Career Services

    Science.gov (United States)

    Marvel, Kevin B.

    2012-08-01

    The American Astronomical Society provides substantial programs in the area of Career Services.Motivated by the Society's mission to enhance and share humanity's understanding of the Universe, the AAS provides a central resource for advertising positions, interviewing opportunities at its annual winter meeting and information, workshops and networks to enable astronomers to find employment.The programs of the Society in this area are overseen by an active committee on employment and the AAS Council itself.Additional resources that help characterize the field, its growth and facts about employment such as salaries and type of jobs available are regularly summarized and reported on by the American Institute of Physics.

  9. Homeobox transcription factors are required for conidiation and appressorium development in the rice blast fungus Magnaporthe oryzae.

    Directory of Open Access Journals (Sweden)

    Seryun Kim

    2009-12-01

    Full Text Available The appropriate development of conidia and appressoria is critical in the disease cycle of many fungal pathogens, including Magnaporthe oryzae. A total of eight genes (MoHOX1 to MoHOX8 encoding putative homeobox transcription factors (TFs were identified from the M. oryzae genome. Knockout mutants for each MoHOX gene were obtained via homology-dependent gene replacement. Two mutants, DeltaMohox3 and DeltaMohox5, exhibited no difference to wild-type in growth, conidiation, conidium size, conidial germination, appressorium formation, and pathogenicity. However, the DeltaMohox1 showed a dramatic reduction in hyphal growth and increase in melanin pigmentation, compared to those in wild-type. DeltaMohox4 and DeltaMohox6 showed significantly reduced conidium size and hyphal growth, respectively. DeltaMohox8 formed normal appressoria, but failed in pathogenicity, probably due to defects in the development of penetration peg and invasive growth. It is most notable that asexual reproduction was completely abolished in DeltaMohox2, in which no conidia formed. DeltaMohox2 was still pathogenic through hypha-driven appressoria in a manner similar to that of the wild-type. However, DeltaMohox7 was unable to form appressoria either on conidial germ tubes, or at hyphal tips, being non-pathogenic. These factors indicate that M. oryzae is able to cause foliar disease via hyphal appressorium-mediated penetration, and MoHOX7 is mutually required to drive appressorium formation from hyphae and germ tubes. Transcriptional analyses suggest that the functioning of M. oryzae homeobox TFs is mediated through the regulation of gene expression and is affected by cAMP and Ca(2+ signaling and/or MAPK pathways. The divergent roles of this gene set may help reveal how the genome and regulatory pathways evolved within the rice blast pathogen and close relatives.

  10. Two ancient rounds of polyploidy in rice genome

    Institute of Scientific and Technical Information of China (English)

    ZHANG Yang; XU Guo-hua; GUO Xing-yi; FAN Long-jiang

    2005-01-01

    An ancient genome duplication (PPP 1) that predates divergence ofthe cereals has recently been recognihere another potentially older large-scale duplication (PPP2) event that predates monocot-dicot divergence in the genome of rice (Oryza sativa L.), as inferred from the age distribution of pairs of duplicate genes based on recent genome data for rice. Our results suggest that paleopolyploidy was widespread and played an important role in the evolution of rice.

  11. AAS Oral History Project

    Science.gov (United States)

    Buxner, Sanlyn; Holbrook, Jarita; AAS Oral History Team

    2016-06-01

    Now in its fourth year, the AAS Oral History Project has interviewed over 80 astronomers from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from astronomers at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees’ personal and professional lives. Questions include those about one’s family, childhood, strong influences on one’s scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at https://www.aip.org/history-programs/niels-bohr-library/oral-histories. Future analysis will reveal a rich story of astronomers and will help the community address issues of diversity, controversies, and the changing landscape of science. We are still recruiting individuals to be interviewed from all stages of career from undergraduate students to retired and emeritus astronomers. Contact Jarita Holbrook to schedule an interview or to find out more information about the project (astroholbrook@gmail.com). Also, contact Jarita Holbrook if you would like to become an interviewer for the project.

  12. Screening of gamma radiation-induced pathogen resistance rice lines against Xanthomonas oryzae pv. oryzae

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Chan Ju; Lee, Ha Yeon; Kim, Woong Bom; Ahmad, Raza; Moon, Jae Sun; Kwon, Suk Yoon [Korea Research Institute of Beoscience and Biotechnology, Daejeon (Korea, Republic of); Kim, Dong Sub [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2010-09-15

    Bacterial blight is one of the most serious diseases of rice (Oryza sativa L.), and it has been known that Xanthomonas oryzae pv. oryzae (Xoo) causes this disease symptom. To develop resistance rice cultivars against Xoo, 3,000 lines of M{sub 3}, which were irradiated with gamma ray, were tested by 'scissor-dip method' primarily, and 191 putative resistant lines were selected. In M{sub 4} generation, these lines were screened again with various ways such as measuring of symptom of bacterial blight in leaf, number of tiller, fresh weight, and phenotypic segregation ratio in next generation. Finally, six resistance lines were selected. RT-PCR analysis revealed that these lines displayed high level of R-genes such as Xa21, Pi36, and Pi-ta. These results indicate that mutations by gamma ray cause disruptions of regulatory signal transduction systems of these R-genes. Furthermore, these selected mutants could be useful for the development of rice cultivar resistant to Xoo.

  13. Lethal and mutagenic effects of ion beams and γ-rays in Aspergillus oryzae

    Energy Technology Data Exchange (ETDEWEB)

    Toyoshima, Yoshiyuki, E-mail: toyoshima@yamasa.com [Soy Sauce Laboratory, Yamasa Corporation, 2-10-1 Araoicho, Choshi, Chiba 288-0056 (Japan); Takahashi, Akemi; Tanaka, Hisaki; Watanabe, Jun; Mogi, Yoshinobu; Yamazaki, Tatsuo [Soy Sauce Laboratory, Yamasa Corporation, 2-10-1 Araoicho, Choshi, Chiba 288-0056 (Japan); Hamada, Ryoko; Iwashita, Kazuhiro [Fundamental Research Division, National Research Institute of Brewing, 3-7-1 Kagamiyama, Higashihiroshima, Hiroshima 739-0046 (Japan); Satoh, Katsuya; Narumi, Issay [Ion Beam Mutagenesis Research Group, Quantum Beam Science Directorate, Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan)

    2012-12-15

    Highlights: ► We investigated the effects of different LET radiation in A. oryzae. ► Both γ-rays and ion beams induced base substitutions, frameshifts, deletions. ► Both γ-rays and ion beams induced genome-wide large-scale mutations in A. oryzae. ► Some differences in the types and frequencies of mutations were found. ► Our results provide new basic insights into the mutation breeding of A. oryzae. - Abstract: Aspergillus oryzae is a fungus that is used widely in traditional Japanese fermentation industries. In this study, the lethal and mutagenic effects of different linear energy transfer (LET) radiation in freeze-dried conidia of A. oryzae were investigated. The lethal effect, which was evaluated by a 90% lethal dose, was dependent on the LET value of the ionizing radiation. The most lethal ionizing radiation among that tested was {sup 12}C{sup 5+} ion beams with an LET of 121 keV/μm. The {sup 12}C{sup 5+} ion beams had a 3.6-times higher lethal effect than low-LET (0.2 keV/μm) γ-rays. The mutagenic effect was evaluated by the frequency of selenate resistant mutants. {sup 12}C{sup 6+} ion beams with an LET of 86 keV/μm were the most effective in inducing selenate resistance. The mutant frequency following exposure to {sup 12}C{sup 6+} ion beams increased with an increase in dose and reached 3.47 × 10{sup −3} at 700 Gy. In the dose range from 0 to 700 Gy, {sup 12}C{sup 5+} ion beams were the second most effective in inducing selenate resistance, the mutant frequency of which reached a maximum peak (1.67 × 10{sup −3}) at 400 Gy. To elucidate the characteristics of mutation induced by ionizing radiation, mutations in the sulphate permease gene (sB) and ATP sulfurylase gene (sC) loci, the loss of function of which results in a selenate resistant phenotype, were compared between {sup 12}C{sup 5+} ion beams and γ-rays. We detected all types of transversions and transitions. For frameshifts, the frequency of a +1 frameshift was the highest in all

  14. 水稻黄单胞菌三型分泌系统效应物的研究进展%Current progresses in study on T3SS effectors of Xanthomonas oryzae

    Institute of Scientific and Technical Information of China (English)

    赵帅; 张子宇; 冯家勋

    2011-01-01

    The type Ⅲ secretion system (T3SS) effector is considered as one of the key virulence factors in Xanthomonas oryzae. X. Oryzae pv. Oryzae and X. Oryzae pv. Oryzicola cause bacterial leaf blight and bacterial leaf streak in rice, which are important bacterial diseases of rice. Based on bioinformatic analysis of the bacterial genome and other recent reports,X. Oryzae contains at least 28 classes of T3SS effectors, divided into two groups: TAL (transcription activator-like) effectors and non-TAL (non transcription activator-like) effectors. This paper reviews the number, classes, structure and host targets of T3SS effectors in X. Oryzae, which may provide a new insight into the mechanism of rice-X. Oryzae interaction, regulatory network and molecular breeding of rice.%水稻黄单胞菌(X.oryzae)三-型分泌系统(Type Ⅲ secretion system,T3SS)效应物(Effector)一直被认为是水稻黄单胞菌最重要的致病因子之一.水稻黄单胞菌水稻致病变种(Xanthomonas oryzae pv.oryzae)和水稻黄单胞菌栖稻致病变种(Xanthomonas oryzae pv.oryzicola)分别引起水稻两大细菌病害水稻白叶枯病(Bacterial leaf blight)和水稻细菌性条斑病(Bacterial leaf streak).基因组分析揭示,水稻黄单胞菌中至少存在28个类型的T3SS效应物,分为TAL(Transcription activator-like effectors)效应物和non-TAL效应物(Non transcription activator-like effectors)两大类.通过对水稻黄单胞菌中T3SS效应物的数量、种类、结构、宿主靶标等方面进行综述,为全面了解水稻-水稻黄单胞菌互作的分子机理,调控网络以及水稻分子育种提供一种新洞察力.

  15. HrcQ is necessary for Xanthomonas oryzae pv. oryzae HR-induction in non-host tobacco and pathogenicity in host rice

    Institute of Scientific and Technical Information of China (English)

    Xiaoping; Zhang; Chunlian; Wang; Chongke; Zheng; Jinying; Che; Yanqiang; Li; Kaijun; Zhao

    2013-01-01

    Bacterial blight, caused by Xanthomonas oryzae pv. oryzae(Xoo), is one of the most destructive diseases of rice(Oryza sativa L.) worldwide. The type III secretion system(T3SS) of Xoo, encoded by the hrp(hypersensitive response and pathogenicity) genes, plays critical roles in conferring pathogenicity in host rice and triggering a hypersensitive response(HR) in non-host plants. To investigate the major genes conferring the pathogenicity and avirulence of Xoo, we previously constructed a random Tn5-insertion mutant library of Xoo strain PXO99A. We report here the isolation and characterization of a Tn5-insertion mutant PXM69. Tn5-insertion mutants were screened on indica rice JG30, which is highly susceptible to PXO99A, by leaf-cutting inoculation.Four mutants with reduced virulence were obtained after two rounds of screening. Among them, the mutant PXM69 had completely lost virulence to the rice host and ability to elicit HR in non-host tobacco. Southern blotting analysis showed a single copy of a Tn5-insertion in the genome of PXM69. PCR walking and sequencing analysis revealed that the Tn5 transposon was inserted at nucleotide position 70,192–70,201 in the genome of PXO99A, disrupting the type III hrc(hrp-conserved) gene hrcQ, the first gene in the D operon of the hrp cluster in Xoo. To confirm the relationship between the Tn5-insertion and the avirulence phenotype of PXM69, we used the marker exchange mutagenesis to create a PXO99Amutant, ΔhrcQ::KAN, in which the hrcQ was disrupted by a kanamycin-encoding gene cassette at the same site as that of the Tn5-insertion. ΔhrcQ::KAN showed the same phenotype as mutant PXM69. Reintroduction of the wild-type hrcQ gene partially complemented the pathogenic function of PXM69. RT-PCR and cellulase secretion assays showed that the Tn5-disruption of hrcQ did not affect transcription of downstream genes in the D operon and function of the type II secretion system. Our results provide new insights into the pathogenic

  16. HrcQ is necessary for Xanthomonas oryzae pv. oryzae HR-induction in non-host tobacco and pathogenicity in host rice

    Directory of Open Access Journals (Sweden)

    Xiaoping Zhang

    2013-12-01

    Full Text Available Bacterial blight, caused by Xanthomonas oryzae pv. oryzae (Xoo, is one of the most destructive diseases of rice (Oryza sativa L. worldwide. The type III secretion system (T3SS of Xoo, encoded by the hrp (hypersensitive response and pathogenicity genes, plays critical roles in conferring pathogenicity in host rice and triggering a hypersensitive response (HR in non-host plants. To investigate the major genes conferring the pathogenicity and avirulence of Xoo, we previously constructed a random Tn5-insertion mutant library of Xoo strain PXO99A. We report here the isolation and characterization of a Tn5-insertion mutant PXM69. Tn5-insertion mutants were screened on indica rice JG30, which is highly susceptible to PXO99A, by leaf-cutting inoculation. Four mutants with reduced virulence were obtained after two rounds of screening. Among them, the mutant PXM69 had completely lost virulence to the rice host and ability to elicit HR in non-host tobacco. Southern blotting analysis showed a single copy of a Tn5-insertion in the genome of PXM69. PCR walking and sequencing analysis revealed that the Tn5 transposon was inserted at nucleotide position 70,192–70,201 in the genome of PXO99A, disrupting the type III hrc (hrp-conserved gene hrcQ, the first gene in the D operon of the hrp cluster in Xoo. To confirm the relationship between the Tn5-insertion and the avirulence phenotype of PXM69, we used the marker exchange mutagenesis to create a PXO99A mutant, ΔhrcQ::KAN, in which the hrcQ was disrupted by a kanamycin-encoding gene cassette at the same site as that of the Tn5-insertion. ΔhrcQ::KAN showed the same phenotype as mutant PXM69. Reintroduction of the wild-type hrcQ gene partially complemented the pathogenic function of PXM69. RT-PCR and cellulase secretion assays showed that the Tn5-disruption of hrcQ did not affect transcription of downstream genes in the D operon and function of the type II secretion system. Our results provide new insights into

  17. Niclosamide inhibits leaf blight caused by Xanthomonas oryzae in rice

    OpenAIRE

    Sung-Il Kim; Jong Tae Song; Jin-Yong Jeong; Hak Soo Seo

    2016-01-01

    Rice leaf blight, which is caused by the bacterial pathogen Xanthomonas oryzae pv. oryzae (Xoo), results in huge losses in grain yield. Here, we show that Xoo-induced rice leaf blight is effectively controlled by niclosamide, an oral antihelminthic drug and molluscicide, which also functions as an anti-tumor agent. Niclosamide directly inhibited the growth of the three Xoo strains PXO99, 10208 and K3a. Niclosamide moved long distances from the site of local application to distant rice tissues...

  18. Immobilization of Isolated Lipase From Moldy Copra (Aspergillus Oryzae)

    OpenAIRE

    Seniwati

    2012-01-01

    Enzyme immobilization is a recovery technique that has been studied in several years, using support as a media to help enzyme dissolutions to the reaction substrate. Immobilization method used in this study was adsorption method, using specific lipase from Aspergillus oryzae. Lipase was partially purified from the culture supernatant of Aspergillus oryzae. Enzyme was immobilized by adsorbed on silica gel. Studies on free and immobilized lipase systems for determination of op...

  19. Immobilization of Isolated Lipase From Moldy Copra (Aspergillus Oryzae)

    OpenAIRE

    Seniwati Dali; A. B. D. Rauf Patong; M.Noor Jalaluddin; Pirman; Baharuddin Hamzah

    2011-01-01

    Enzyme immobilization is a recovery technique that has been studied in several years, using support as a media to help enzyme dissolutions to the reaction substrate. Immobilization method used in this study was adsorption method, using specific lipase from Aspergillus oryzae. Lipase was partially purified from the culture supernatant of Aspergillus oryzae. Enzyme was immobilized by adsorbed on silica gel. Studies on free and immobilized lipase systems for determination of optimum pH, optimum ...

  20. Meroterpenes from Psoralea corylifolia against Pyricularia oryzae.

    Science.gov (United States)

    Huang, Youwu; Liu, Xiaoyu; Wu, Yingchun; Li, Yiming; Guo, Fujiang

    2014-10-01

    Six new meroterpenes, namely, 13-methoxyisobakuchiol (1), 13-ethoxyisobakuchiol (2), 12,13-dihydro-13-hydroxybakuchiol (3), Δ(10)-12,13-dihydro-12-(R,S)-methoxyisobakuchiol (4 and 5), and 15-demetyl-12,13-dihydro-13-ketobakuchiol (6), together with four known ones, namely, Δ(3),2-hydroxybakuchiol (7), Δ(1),3-hydroxybakuchiol (8), bakuchiol (9), and Δ(1,3)-bakuchiol (10), were isolated from the seeds of Psoralea corylifolia. Their structures were identified based on spectral data, including those obtained via 1D and 2D NMR, and MS spectral analyses. Antifungal screening results indicated that all compounds showed moderate inhibitory activities against Pyricularia oryzae. PMID:25127019

  1. Analysis on Genomic Structure Changes and Diversity of Introgression Lines in Dongxiang Wild Rice (Oryza rufipogon Griff.)%东乡野生稻渐渗系基因组结构变化及多样性分析

    Institute of Scientific and Technical Information of China (English)

    邓晓娟; 罗向东; 谢建坤; 万勇; 胡标林; 曹娟芳; 戴亮芳

    2012-01-01

    [Objective] The aim of the study was to make research on genomic struc- ture variation and variety analysis of Dongxiang wild rice. [Method] Introgression groups of BC1F6 were based on donor of Oryza rufipogon Griff. and receptor of O. sativa sp. indica Kate. Strains of 239 in the group were analyzed on Polymor- phism with the help of 25 couples of SSR primers distributed in 12 pairs of chromo- somes. [Result] Gene fragments of O. rufipogon Griff. were found penetrated in the 25 microsatellite sites and most of the groups kept the parents of Xieqinzao B or DNA sequence of O. rufipogon Griff. The average rate of recurrent homozygous bands was 78.13% in the ILs, but the highest was 94.98% (amplified by primer RM131) and the lowest was 60.25% (RM171). The average rate of donor homozy- gous bands was 13.37%, but the highest was 32.64% (RM171) and the lowest was 2.93% (RM1095). There were numerous heterozygous sites in the population and the average heterozygosis rate was 5.62%, while the highest was 10.04%(RM401). Moreover, we found some parental fragments were lost and some novel fragments were not detected in either parent in BC1F6 population. The average rate of lost bands was 2.88%, while the highest was 13.39% (RM311) and the lowest was 0 (RM401). The average rate of new bands was 1%. The average of Nei's gene di- versity (He) and Shannon's Information index (I) were 0.276 and 0.457 respectively in high generation of introgression lines. [Conclusion] The study demonstrated that distant hybridization led to extensive genetic and epigenetic variations in high gener- ation of introgression lines, which expanded the base of genetic variation and laid an important foundation for rice improvement and germplasm innovation.%[目的】研究东乡野生稻渐渗系基因组结构变化及对其进行多样性分析。[方法]以东乡野生稻(O.rufipogonGriff.,供体)和栽培稻协青早B(O.sativasp.indicaKato.

  2. NCBI nr-aa BLAST: CBRC-GGAL-03-0025 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-03-0025 ref|YP_450021.1| aminotransferase [Xanthomonas oryzae pv. oryzae ...MAFF 311018] ref|YP_199733.6| aspartate aminotransferase [Xanthomonas oryzae pv. oryzae KACC10331] dbj|BAE67...747.1| aminotransferase [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_450021.1 5.5 30% ...

  3. Roles of Forkhead-box Transcription Factors in Controlling Development, Pathogenicity, and Stress Response in Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Jaejin Park

    2014-06-01

    Full Text Available Although multiple transcription factors (TFs have been characterized via mutagenesis to understand their roles in controlling pathogenicity and infection-related development in Magnaporthe oryzae, the causal agent of rice blast, if and how forkhead-box (FOX TFs contribute to these processes remain to be characterized. Four putative FOX TF genes were identified in the genome of M. oryzae, and phylogenetic analysis suggested that two of them (MoFKH1 and MoHCM1 correspond to Ascomycota-specific members of the FOX TF family while the others (MoFOX1 and MoFOX2 are Pezizomycotina-specific members. Deletion of MoFKH1 (ΔMofkh1 resulted in reduced mycelial growth and conidial germination, abnormal septation and stress response, and reduced virulence. Similarly, ΔMohcm1 exhibited reduced mycelial growth and conidial germination. Conidia of ΔMofkh1 and ΔMohcm1 were more sensitive to one or both of the cell cycle inhibitors hydroxyurea and benomyl, suggesting their role in cell cycle control. On the other hand, loss of MoFOX1 (ΔMofox1 did not show any noticeable changes in development, pathogenicity, and stress response. Deletion of MoFOX2 was not successful even after repeated attempts. Taken together, these results suggested that MoFKH1 and Mo-HCM1 are important in fungal development and that MoFKH1 is further implicated in pathogenicity and stress response in M. oryzae.

  4. Differential Gene Expression Reflects Morphological Characteristics and Physiological Processes in Rice Immunity against Blast Pathogen Magnaporthe oryzae.

    Science.gov (United States)

    Azizi, Parisa; Rafii, Mohd Y; Mahmood, Maziah; Abdullah, Siti N A; Hanafi, Mohamed M; Nejat, Naghmeh; Latif, Muhammad A; Sahebi, Mahbod

    2015-01-01

    The rice blast fungus Magnaporthe oryzae is a serious pathogen that jeopardises the world's most important food-security crop. Ten common Malaysian rice varieties were examined for their morphological, physiological and genomic responses to this rice blast pathogen. qPCR quantification was used to assess the growth of the pathogen population in resistant and susceptible rice varieties. The chlorophyll content and photosynthesis were also measured to further understand the disruptive effects that M. oryzae has on infected plants of these varieties. Real-time PCR was used to explore the differential expression of eight blast resistance genes among the ten local varieties. Blast disease has destructive effects on the growth of rice, and the findings of our study provide evidence that the Pikh, Pi9, Pi21, and Osw45 genes are involved in defence responses in the leaves of Malaysian rice at 31 h after inoculation with M. oryzae pathotype P7.2. Both the chlorophyll content and photosynthesis were reduced, but the levels of Pikh gene expression remained constant in susceptible varieties, with a developed pathogen population and mild or severe symptoms. The Pi9, Pi21, and Osw45 genes, however, were simultaneously upregulated in infected rice plants. Therefore, the presence of the Pikh, Pi9, Pi21, and Osw45 genes in the germplasm is useful for improving the resistance of rice varieties. PMID:26001124

  5. Crystallization and preliminary crystallographic studies of LipA, a secretory lipase/esterase from Xanthomonas oryzae pv. oryzae

    International Nuclear Information System (INIS)

    The crystallization and preliminary crystallographic studies of LipA, a lipase/esterase secreted by X. oryzae pv. oryzae during its infection of rice plants, are reported. Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight, a serious disease of rice. Several enzymes that are secreted through the type II secretion system of this bacterium play an important role in the plant–microbe interaction, being important for virulence and also being able to induce potent host defence responses. One of these enzymes is a secretory lipase/esterase, LipA, which shows a very weak homology to other bacterial lipases and gives a positive tributyrin plate assay. In this study, LipA was purified from the culture supernatant of an overexpressing clone of X. oryzae pv. oryzae and two types of crystals belonging to space group C2 but with two different unit-cell parameters were obtained using the hanging-drop vapour-diffusion method. Type I crystals diffract to a maximum resolution of 1.89 Å and have unit-cell parameters a = 93.1, b = 62.3, c = 66.1 Å, β = 90.8°. Type II crystals have unit-cell parameters a = 103.6, b = 54.6, c = 66.3 Å, β = 92.6° and diffract to 1.86 Å. Solvent-content analysis shows one monomer in the asymmetric unit in both the crystal forms

  6. Crystallization and preliminary crystallographic studies of LipA, a secretory lipase/esterase from Xanthomonas oryzae pv. oryzae

    Energy Technology Data Exchange (ETDEWEB)

    Aparna, Gudlur; Chatterjee, Avradip; Jha, Gopaljee; Sonti, Ramesh V.; Sankaranarayanan, Rajan, E-mail: sankar@ccmb.res.in [Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad 500 007 (India)

    2007-08-01

    The crystallization and preliminary crystallographic studies of LipA, a lipase/esterase secreted by X. oryzae pv. oryzae during its infection of rice plants, are reported. Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight, a serious disease of rice. Several enzymes that are secreted through the type II secretion system of this bacterium play an important role in the plant–microbe interaction, being important for virulence and also being able to induce potent host defence responses. One of these enzymes is a secretory lipase/esterase, LipA, which shows a very weak homology to other bacterial lipases and gives a positive tributyrin plate assay. In this study, LipA was purified from the culture supernatant of an overexpressing clone of X. oryzae pv. oryzae and two types of crystals belonging to space group C2 but with two different unit-cell parameters were obtained using the hanging-drop vapour-diffusion method. Type I crystals diffract to a maximum resolution of 1.89 Å and have unit-cell parameters a = 93.1, b = 62.3, c = 66.1 Å, β = 90.8°. Type II crystals have unit-cell parameters a = 103.6, b = 54.6, c = 66.3 Å, β = 92.6° and diffract to 1.86 Å. Solvent-content analysis shows one monomer in the asymmetric unit in both the crystal forms.

  7. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  8. Dissection of the genetic architecture of rice resistance to the blast fungus Magnaporthe oryzae.

    Science.gov (United States)

    Kang, Houxiang; Wang, Yue; Peng, Shasha; Zhang, Yanli; Xiao, Yinghui; Wang, Dan; Qu, Shaohong; Li, Zhiqiang; Yan, Shuangyong; Wang, Zhilong; Liu, Wende; Ning, Yuese; Korniliev, Pavel; Leung, Hei; Mezey, Jason; McCouch, Susan R; Wang, Guo-Liang

    2016-08-01

    Resistance in rice cultivars to the rice blast fungus Magnaporthe oryzae is complex and is controlled by both major genes and quantitative trait loci (QTLs). We undertook a genome-wide association study (GWAS) using the rice diversity panel 1 (RDP1) that was genotyped using a high-density (700 000 single nucleotide polymorphisms) array and inoculated with five diverse M. oryzae isolates. We identified 97 loci associated with blast resistance (LABRs). Among them, 82 were new regions and 15 co-localized with known blast resistance loci. The top 72 LABRs explained up to 98% of the phenotypic variation. The candidate genes in the LABRs encode nucleotide-binding site leucine-rich repeat (NBS-LRR) resistance proteins, receptor-like protein kinases, transcription factors and defence-related proteins. Among them, LABR_64 was strongly associated with resistance to all five isolates. We analysed the function of candidate genes underlying LABR_64 using RNA interference (RNAi) technology and identified two new resistance alleles at the Pi5 locus. We demonstrate an efficient strategy for rapid allele discovery using the power of GWAS, coupled with RNAi technology, for the dissection of complex blast resistance in rice. PMID:26574735

  9. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  10. Coevolutionary Dynamics of Rice Blast Resistance Gene Pi-ta and Magnaporthe oryzae Avirulence Gene AVR-Pita 1.

    Science.gov (United States)

    Jia, Yulin; Zhou, Erxun; Lee, Seonghee; Bianco, Tracy

    2016-07-01

    The Pi-ta gene in rice is effective in preventing infections by Magnaporthe oryzae strains that contain the corresponding avirulence gene, AVR-Pita1. Diverse haplotypes of AVR-Pita1 have been identified from isolates of M. oryzae from rice production areas in the United States and worldwide. DNA sequencing and mapping studies have revealed that AVR-Pita1 is highly unstable, while expression analysis and quantitative resistance loci mapping of the Pi-ta locus revealed complex evolutionary mechanisms of Pi-ta-mediated resistance. Among these studies, several Pi-ta transcripts were identified, most of which are probably derived from alternative splicing and exon skipping, which could produce functional resistance proteins that support a new concept of coevolution of Pi-ta and AVR-Pita1. User-friendly DNA markers for Pi-ta have been developed to support marker-assisted selection, and development of new rice varieties with the Pi-ta markers. Genome-wide association studies revealed a link between Pi-ta-mediated resistance and yield components suggesting that rice has evolved a complicated defense mechanism against the blast fungus. In this review, we detail the current understanding of Pi-ta allelic variation, its linkage with rice productivity, AVR-Pita allelic variation, and the coevolution of Pi-ta and AVR-Pita in Oryza species and M. oryzae populations, respectively. We also review the genetic and molecular basis of Pi-ta and AVR-Pita interaction, and its value in marker-assisted selection and engineering resistance. PMID:27070427

  11. Purification and characterization of a novel hypersensitive response-inducing elicitor from Magnaporthe oryzae that triggers defense response in rice.

    Directory of Open Access Journals (Sweden)

    Mingjia Chen

    Full Text Available BACKGROUND: Magnaporthe oryzae, the rice blast fungus, might secrete certain proteins related to plant-fungal pathogen interactions. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we report the purification, characterization, and gene cloning of a novel hypersensitive response-inducing protein elicitor (MoHrip1 secreted by M. oryzae. The protein fraction was purified and identified by de novo sequencing, and the sequence matched the genomic sequence of a putative protein from M. oryzae strain 70-15 (GenBank accession No. XP_366602.1. The elicitor-encoding gene mohrip1 was isolated; it consisted of a 429 bp cDNA, which encodes a polypeptide of 142 amino acids with a molecular weight of 14.322 kDa and a pI of 4.53. The deduced protein, MoHrip1, was expressed in E. coli. And the expression protein collected from bacterium also forms necrotic lesions in tobacco. MoHrip1 could induce the early events of the defense response, including hydrogen peroxide production, callose deposition, and alkalization of the extracellular medium, in tobacco. Moreover, MoHrip1-treated rice seedlings possessed significantly enhanced systemic resistance to M. oryzae compared to the control seedlings. The real-time PCR results indicated that the expression of some pathogenesis-related genes and genes involved in signal transduction could also be induced by MoHrip1. CONCLUSION/SIGNIFICANCE: The results demonstrate that MoHrip1 triggers defense responses in rice and could be used for controlling rice blast disease.

  12. DNA Polymorphism Among Yewei B, V20B, and Oryza minuta J. S. Presl. ex C. B. Presl.

    Institute of Scientific and Technical Information of China (English)

    Bing-Ran ZHAO; Quan-Hua XING; Hong-Ai XIA; He-Hua YANG; De-Min JIN; Xia LIU; Song-Wen WANG; Bin WANG; Long-Ping YUAN

    2005-01-01

    The new cytoplasmic male sterile (CMS) line YeweiA and its maintainer line Yewei B, with better agronomic characteristics, have been developed from a mutant of V20B (a rice maintainer line) through transformation of genomic DNA of wild rice (Oryza minuta J. S. Presl. ex C. B. Presl.). Analysis of molecular markers, DNA sequences, and Southern blot revealed that high DNA polymorphism exists between the mutant and its receptor, indicating that the special DNA fragment from O. minuta may be integrated into the genome of Yewei B. Therefore, transformation of genomic DNA from distant relatives to the plant of a target receptor may open an avenue for creating a new rice germplasm.

  13. Polygalacturonase from Sitophilus oryzae: Possible horizontal transfer of a pectinase gene from fungi to weevils

    Directory of Open Access Journals (Sweden)

    Zhicheng Shen

    2003-08-01

    Full Text Available Endo-polygalacturonase, one of the group of enzymes known collectively as pectinases, is widely distributed in bacteria, plants and fungi. The enzyme has also been found in several weevil species and a few other insects, such as aphids, but not in Drosophila melanogaster, Anopheles gambiae, or Caenorhabditis elegans or, as far as is known, in any more primitive animal species. What, then, is the genetic origin of the polygalacturonases in weevils? Since some weevil species harbor symbiotic microorganisms, it has been suggested, reasonably, that the symbionts' genomes of both aphids and weevils, rather than the insects' genomes, could encode polygalacturonase. We report here the cloning of a cDNA that encodes endo-polygalacturonase in the rice weevil, Sitophilus oryzae (L., and investigations based on the cloned cDNA. Our results, which include analysis of genes in antibiotic-treated rice weevils, indicate that the enzyme is, in fact, encoded by the insect genome. Given the apparent absence of the gene in much of the rest of the animal kingdom, it is therefore likely that the rice weevil polygalacturonase gene was incorporated into the weevil's genome by horizontal transfer, possibly from a fungus.

  14. Drought-tolerant rice germplasm developed from an Oryza officinalis transformation-competent artificial chromosome clone.

    Science.gov (United States)

    Liu, R; Zhang, H H; Chen, Z X; Shahid, M Q; Fu, X L; Liu, X D

    2015-10-29

    Oryza officinalis has proven to be a natural gene reservoir for the improvement of domesticated rice as it carries many desirable traits; however, the transfer of elite genes to cultivated rice by conventional hybridization has been a challenge for rice breeders. In this study, the conserved sequence of plant stress-related NAC transcription factors was selected as a probe to screen the O. officinalis genomic transformation-competent artificial chromosome library by Southern blot; 11 positive transformation-competent artificial chromosome clones were subsequently detected. By Agrobacterium-mediated transformation, an indica rice variety, Huajingxian 74 (HJX74), was transformed with a TAC clone harboring a NAC gene-positive genomic fragment from O. officinalis. Molecular analysis revealed that the O. officinalis genomic fragment was integrated into the genome of HJX74. The transgenic lines exhibited high tolerance to drought stress. Our results demonstrate that the introduction of stress-related transformation-competent artificial chromosome clones, coupled with a transgenic validation approach, is an effective method of transferring agronomically important genes from O. officinalis to cultivated rice.

  15. First report of wheat blast caused by magnaporthe oryzae pathotype triticum in Bangladesh

    Science.gov (United States)

    Wheat blast or ‘brusone’, caused by the ascomycetous fungus Magnaporthe oryzae B.C. Couch (synonym Pyricularia oryzae Cavara), was first identified in 1985 in Brazil. M. oryzae is composed of a range of morphologically identical but genetically different host-specific pathotypes that are specialized...

  16. Morphological and molecular characterization of fungal pathogen, Magnaphorthe oryzae

    Energy Technology Data Exchange (ETDEWEB)

    Hasan, Nor’Aishah, E-mail: aishahnh@ns.uitm.edu.my [Faculty of Applied Science, UniversitiTeknologi MARA (UiTM), Kuala Pilah, Negeri Sembilan (Malaysia); Rafii, Mohd Y., E-mail: mrafii@upm.edu.my [Institute of Tropical Agriculture, Universiti Putra Malaysia (UPM), Serdang, Selangor (Malaysia); Department of Crop Science, Universiti Putra Malaysia (UPM), Serdang, Selangor (Malaysia); Rahim, Harun A. [Agrotechnology & Bioscience Division, Malaysian Nuclear Agency, Bangi, Kajang, Selangor (Malaysia); Ali, Nusaibah Syd [Department of Plant Protection, Universiti Putra Malaysia (UPM), Serdang, Selangor (Malaysia); Mazlan, Norida [Department of Agriculture Technology, Universiti Putra Malaysia (UPM), Serdang, Selangor (Malaysia); Abdullah, Shamsiah [Faculty of Plantation and Agrotechnology, UniversitiTeknologi MARA (UiTM), Shah Alam, Selangor (Malaysia)

    2016-02-01

    Rice is arguably the most crucial food crops supplying quarter of calories intake. Fungal pathogen, Magnaphorthe oryzae promotes blast disease unconditionally to gramineous host including rice species. This disease spurred an outbreaks and constant threat to cereal production. Global rice yield declining almost 10-30% including Malaysia. As Magnaphorthe oryzae and its host is model in disease plant study, the rice blast pathosystem has been the subject of intense interest to overcome the importance of the disease to world agriculture. Therefore, in this study, our prime objective was to isolate samples of Magnaphorthe oryzae from diseased leaf obtained from MARDI Seberang Perai, Penang, Malaysia. Molecular identification was performed by sequences analysis from internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes. Phylogenetic affiliation of the isolated samples were analyzed by comparing the ITS sequences with those deposited in the GenBank database. The sequence of the isolate demonstrated at least 99% nucleotide identity with the corresponding sequence in GenBank for Magnaphorthe oryzae. Morphological observed under microscope demonstrated that the structure of conidia followed similar characteristic as M. oryzae. Finding in this study provide useful information for breeding programs, epidemiology studies and improved disease management.

  17. Morphological and molecular characterization of fungal pathogen, Magnaphorthe oryzae

    International Nuclear Information System (INIS)

    Rice is arguably the most crucial food crops supplying quarter of calories intake. Fungal pathogen, Magnaphorthe oryzae promotes blast disease unconditionally to gramineous host including rice species. This disease spurred an outbreaks and constant threat to cereal production. Global rice yield declining almost 10-30% including Malaysia. As Magnaphorthe oryzae and its host is model in disease plant study, the rice blast pathosystem has been the subject of intense interest to overcome the importance of the disease to world agriculture. Therefore, in this study, our prime objective was to isolate samples of Magnaphorthe oryzae from diseased leaf obtained from MARDI Seberang Perai, Penang, Malaysia. Molecular identification was performed by sequences analysis from internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes. Phylogenetic affiliation of the isolated samples were analyzed by comparing the ITS sequences with those deposited in the GenBank database. The sequence of the isolate demonstrated at least 99% nucleotide identity with the corresponding sequence in GenBank for Magnaphorthe oryzae. Morphological observed under microscope demonstrated that the structure of conidia followed similar characteristic as M. oryzae. Finding in this study provide useful information for breeding programs, epidemiology studies and improved disease management

  18. Reprodução Sexuada em Pyricularia oryzae

    Directory of Open Access Journals (Sweden)

    Silvino Intra Moreira

    2015-09-01

    Full Text Available A brusone é causada pelo fungo Ascomyceto Pyricularia oryzae, sendo a doença mundialmente mais importante do arroz. Além do arroz, P. oryzae causa a brusone em trigo no Brasil, no Paraguai e na Bolívia. A alta variabilidade genético-patotípica observada em populações locais de P. oryzae, é possivelmente responsável pela baixa durabilidade da resistência de cultivares de arroz e trigo a referida doença, e talvez também seja determinante em eventos de 'mudança de hospedeiro' pelo patógeno. Esta revisão tem por objetivo apresentar aspectos relevantes da reprodução sexuada de P. oryzae, bem como informações sobre mecanismos de regulação do ciclo reprodutivo sexual do patógeno por meio dos genes mating type e feromônios, num sistema de reconhecimento específico. O conhecimento da biologia reprodutiva e da importância da reprodução sexuada em P. oryzae é essencial para o manejo da brusone baseado em resistência durável.

  19. Cloning and characterization of a new actin gene from Oryza sativa L.

    Institute of Scientific and Technical Information of China (English)

    LIANG Weihong; TANG Chaorong; WU Naihu

    2004-01-01

    Using Rho family member osRACD as bait, a new member of actin gene family -Act was isolated from Oryza sativa by yeast two-hybrid system. The full-length cDNA was cloned with 5' RACE technology, which contains an open reading frame of 1134 bp with a predicted protein of 377 amino acids. Sequence alignment revealed 96% to 81.8% identities with some known actin proteins in plants. The method of bioinformatics was used to analyze the protein modification sites, structure and evolution of the gene. Southern blot analysis showed that Act is a single-copy gene in the genome. The result of RT-PCR showed it is ubiquitously expressed in root, shoot, callus and panicle in a temporal fashion. The relationship between Rho family and actin family in evolution and function was also studied.

  20. Molecular Cloning and Characterization of Citrate Synthase Gene in Rice( Oryza sativa)

    Institute of Scientific and Technical Information of China (English)

    ZHANG Shan-shan; MING Feng; LU Qun; GUO Bin; SHEN Da-leng

    2005-01-01

    The full-length OsCS encoding citrate synthase was isolated from rice (Oryza sativa L. subsp. japonica). OsCS is 1477-bp long and encodes a 474 amino acid polypeptide. Its putative protein sequence is highly identical to Daucus carota, Nicotiana tabacum,Beta vulgaris subsp., Arabidopsis thaliana, and Citrus junos (>70%). The deduced amino-terminal sequence of OsCS showes characteristics of mitochondrial targeting signal. Southern blot analysis using ORF of the OsCS as the probe indicated that this gene exists in multiple copies in rice genome. The band with predicated size of 82 kD was detected by Western blot after being induced by 0.4 mmol/L IPTG.

  1. A new diketopiperazine alkaloid from Aspergillus oryzae.

    Science.gov (United States)

    Shaaban, Mohamed; El-Metwally, Mohammad Magdy; Nasr, Hamdi

    2014-01-01

    Investigation of bioactive secondary metabolites from terrestrial Aspergillus oryzae sp. MMAO1 using M2 medium afforded a new diketopiperazine alkaloid, 7,9-dihydroxy-3-(1H-indol-3-ylmethyl)-8-methoxy-2,3,11,11a-tetrahydro-6H-pyrazino[1,2-b]isoquinoline-1,4-dione (1a), containing the unusual amino acid L-6,8-dihydroxy-7-methoxyphenylalanine. This was co-isolated with ditryptophenaline (2), cyclo-(Tryp,Tyr) (4), cyclo-(Pro,Val), α-cyclopiazonic acid (3), kojic acid and uridine. Re-cultivation of the fungal strain on Dox medium led to the production of bisdethio(bismethylthio)gliotoxin (5), pseurotin A (6) along with linoleic acid, α-cyclopiazonic acid (3) and kojic acid. The chemical structure of the new diketopiperazine alkaloid including the relative configuration was determined by 1D and 2D NMR spectroscopy and HR-ESI-MS spectrometry, and by comparison with the related literature. The new alkaloid (1a) showed no antimicrobial activity or cytotoxicity against brine shrimps.

  2. AvrXa3:A novel member of avrBs3 gene family from Xanthomonas oryzae pv.oryzae has a dual function

    Institute of Scientific and Technical Information of China (English)

    LI Ping; LONG Juying; HUANG Yingchun; ZHANG Yan; WANG Jinsheng

    2004-01-01

    Two positive clones pUAV45 and pUAV47 were identified from the cDNA library of JxoⅢ, a race 3 strain of Xanthomonas oryzae pv. Oryzae Dye (Xoo) in Japanese system, using Tn5 based technology. pUAV45 clone contained a 25.4 kb Xoo genomic DNA insert. Southern blot analysis with avrXa10 as the probe showed that DNA insert in pUAV45 shares homology with avrX10. Furthermore within the Xoo insert, a smaller 5.7 kb KpnI fragment (pUAVSk) was identified through hybridization with avrXa10. The transformation of pUAV45 and pUAV5k into the strain Pxo99 (race 6 in Philippine system) led to the decrease of Pxo99pathogenicity on rice cultivar Wase Aikoku 3 (Xa3) and the increase of the pathogen pathogenicity on Cas209 (Xa10). The result of sequence analysis showed that there is a 2598 bp open reading frame (ORF) within the 5.7 kb Kpn 1 fragment (pUAVSk). The ORF shared high identity (97 % ) with avrXa10. The deduced sequence of the ORF contained 8.5 tandem repeat units of 34-amino-acids, one leucine zipper (LZ), three nuclear localization signal (NLS) motifs, and an acidic activation transcriptional domain (AAD) at C-terminus.We named this ORF avrXa3 and it is classified as a new member of avrBs3 (avr/pth) family with the dual-function determined by alternations of avirulence and aggressiveness on rice cultivars carrying different ‘ R' genes.

  3. Cloning and expression of a IuxRhomologue from Xanthomonas oryzae pv.Oryzae

    Institute of Scientific and Technical Information of China (English)

    Liang Bin; Guo Bin; Yang Chen; Zhang Xinjun; Dai Luyuan; Yu Tengqiong; Shen Daleng

    2006-01-01

    LuxR homologues are the main components of LuxR/LuxI circuit in Quorum Sensing(QS)of Gram-negative bacteria.A luxR homologue,designated as xooR,was cloned from Ⅹ.oryzae pv.oryzae.The xooR gene is atranscription factor with 765 bp inlength,and encodes a 254-amino acid putative protein with a molecular weight and an isoelectric point of 28.3 ku and 8.72 respectively.Amino acids 15 to 171 from the N-terminus are the Autoin-bind domain of XooR whereas amino acids 191 to 245 form a helix-turn-helix(HTH)motif that serves as the DNA-binding domain.In this study,XooR was expressed as a fusion protein along with green fluorescent protein(GFP),using pET-24a-d(+),a prokaryotic expression vector.Western blot showed that the xooR gene was successfully expressed in vitro in E.coli as a XooR-GFP fusion protein with a size of 54 ku.

  4. A new function of graphene oxide emerges: inactivating phytopathogenic bacterium Xanthomonas oryzae pv. Oryzae

    Energy Technology Data Exchange (ETDEWEB)

    Chen Juanni; Wang Xiuping; Han Heyou, E-mail: hyhan@mail.hzau.edu.cn [College of Science, Huazhong Agricultural University, State Key Laboratory of Agricultural Microbiology (China)

    2013-05-15

    Xanthomonas oryzae pv. oryzae (Xoo) is one representative phytopathogenic bacterium causing bacteria infections in rice. The antibacterial activity of graphene suspended in different dispersants against Xoo was first investigated. Bacteriological test data, fluorescence microscope and transmission electron microscopy images are provided, which yield insight into the antibacterial action of the nanoscale materials. Surprisingly, the results showed graphene oxide (GO) exhibits superior bactericidal effect even at extremely low dose in water (250 {mu}g/mL), almost killing 94.48% cells, in comparison to common bactericide bismerthiazol with only 13.3% mortality. The high efficiency in inactivating the bacteria on account of considerable changes in the cell membranes caused by the extremely sharp edges of graphene oxide and generation of reactive oxygen species, which may be the fatal factor for bacterial inactivation. Given the superior antibacterial effect of GO and the fact that GO can be mass-produced with low cost, we expect a new application could be developed as bactericide for controlling plant disease, which may be a matter of great importance for agricultural development.

  5. Cloning and characterization of filamentous temperature-sensitive protein Z from Xanthomonas oryzae pv. Oryzae.

    Science.gov (United States)

    Dai, Leng; Huang, Yunhong; Chen, Yang; Long, Zhong-Er

    2016-01-01

    The ftsZ gene from Xanthomonas oryzae pv. Oryzae was amplified by PCR with the specific primers, and the recombinant plasmid pET-22b-ftsZ was constructed successfully. The FtsZ with a 6× His tag was overexpressed in a soluble form in Escherichia coli BL21 and purified through a Ni-NTA agarose column. The purified recombinant FtsZ showed a single band on SDS-PAGE with an apparent molecular mass of about 44 kDa, and confirmed by western blotting analysis. The optimum temperature for GTPase activity of the recombined FtsZ was 50 °C, and the optimum pH was 7.0. The recombinant FtsZ showed good stability and retained >95 % activity at 50 °C for 240 min. The GTPase activity followed Michaelis-Menten kinetics with the KM of 1.750 mM and the Vmax of 0.155 nmol Pi/min/nmol FtsZ respectively. PMID:27026842

  6. NCBI nr-aa BLAST: CBRC-DDIS-03-0106 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DDIS-03-0106 ref|YP_450521.1| hypothetical protein XOO_1492 [Xanthomonas oryza...e pv. oryzae MAFF 311018] ref|YP_200246.6| hypothetical protein XOO1607 [Xanthomonas oryzae pv. oryzae KACC1...0331] dbj|BAE68247.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_450521.1 7e-31 28% ...

  7. Analysis of DNA repair helicase UvrD from Arabidopsis thaliana and Oryza sativa.

    Science.gov (United States)

    Tuteja, Renu; Tuteja, Narendra

    2013-10-01

    Mismatch repair (MMR) proteins play important roles in maintaining genome stability in all the organisms. Studies of MMR genes in plants have identified several homologs of the Escherichia coli genes. Crop yield is directly related to genome stability, which is crucially required for optimal plant growth and development. Numerous genotoxic stresses such as UV light, radiations, pollutants and heavy metals cause DNA damage leading to genome instability, which can interfere with the plant growth and crop productivity. But the efficient repair mechanisms can help to overcome the deleterious effects of the damage. Therefore it is important to study the genes involved in various repair pathways in the plants in greater detail. UvrD helicase is a component of MMR complex and plays an essential role in the DNA repair by providing the unwinding function. In the present manuscript we present an in silico analysis of UvrD helicase from two plant species (Arabidopsis and rice). The Arabidopsis thaliana and Oryza sativa UvrD are 1149 (~129 kDa) and 1165 amino-acids (~130 kDa) proteins, respectively. These proteins contain all the conserved domains and are larger than the E. coli UvrD because they contain a longer N-terminal extension. In order to decipher the role of plant UvrD in various stresses it will be important to study the biochemical and functional properties of this enzyme. PMID:23974358

  8. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  9. Development of a novel strategy for fungal transformation based on a mutant locus conferring carboxin-resistance in Magnaporthe oryzae.

    Science.gov (United States)

    Guo, Min; Zhu, Xiaolei; Li, Hongxia; Tan, Leyong; Pan, Yuemin

    2016-12-01

    The accurate manipulation of genomic integration of mutant alleles or fluorescent fusion-protein constructs is necessary for understanding of pathogenic mechanism of Magnaporthe oryzae. Recently, this can be achieved by integrating of exogenous DNA randomly into genome of this pathogen, but ectopic integration may result in alteration of gene expression or gene disruption due to unpredictable position effects and/or disruption of protein-coding regions. In this study, we establish a novel strategy for locus-specific integration of exogenous DNA via carboxin-resistance reconstitution by a point-mutation (H245L) on succinate dehydrogenase subunit Mosdi1. Independent transformants derived from the same reconstitution construct showed consistent fluorescent signal and undiversified phenotypes, including hyphae growth, conidiation and pathogenicity, in M. oryzae. Meanwhile, 96 % of all transformants integrate correctly into the Mosdi1 locus as a single copy. Furthermore, we provide a vector carrying yeast recombination cassette and thus allow assembly of multiple overlapping DNA fragments by yeast in vivo recombination for gene complementation and protein localization assay. PMID:27558019

  10. BGI-RIS: an integrated information resource and comparative analysis workbench for rice genomics

    DEFF Research Database (Denmark)

    Zhao, Wenming; Wang, Jing; He, Ximiao;

    2004-01-01

    . In addition to comprehensive data from Oryza sativa L. ssp. indica sequenced by BGI, BGI-RIS also hosts carefully curated genome information from Oryza sativa L. ssp. japonica and EST sequences available from other cereal crops. In this resource, sequence contigs of indica (93-11) have been further assembled......Rice is a major food staple for the world's population and serves as a model species in cereal genome research. The Beijing Genomics Institute (BGI) has long been devoting itself to sequencing, information analysis and biological research of the rice and other crop genomes. In order to facilitate...... the application of the rice genomic information and to provide a foundation for functional and evolutionary studies of other important cereal crops, we implemented our Rice Information System (BGI-RIS), the most up-to-date integrated information resource as well as a workbench for comparative genomic analysis...

  11. A Novel Manganese Efflux System, YebN, Is Required for Virulence by Xanthomonas oryzae pv. oryzae

    OpenAIRE

    Chunxia Li; Jun Tao; Daqing Mao; Chaozu He

    2011-01-01

    Manganese ions (Mn(2+)) play a crucial role in virulence and protection against oxidative stress in bacterial pathogens. Such pathogens appear to have evolved complex mechanisms for regulating Mn(2+) uptake and efflux. Despite numerous studies on Mn(2+) uptake, however, only one efflux system has been identified to date. Here, we report on a novel Mn(2+) export system, YebN, in Xanthomonas oryzae pv. oryzae (Xoo), the causative agent of bacterial leaf blight. Compared with wild-type PXO99, th...

  12. AAS 227: Day 1

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  13. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  14. Identification of genes required for nonhost resistance to Xanthomonas oryzae pv. oryzae reveals novel signaling components.

    Directory of Open Access Journals (Sweden)

    Wen Li

    Full Text Available BACKGROUND: Nonhost resistance is a generalized, durable, broad-spectrum resistance exhibited by plant species to a wide variety of microbial pathogens. Although nonhost resistance is an attractive breeding strategy, the molecular basis of this form of resistance remains unclear for many plant-microbe pathosystems, including interactions with the bacterial pathogen of rice, Xanthomonas oryzae pv. oryzae (Xoo. METHODS AND FINDINGS: Virus-induced gene silencing (VIGS and an assay to detect the hypersensitive response (HR were used to screen for genes required for nonhost resistance to Xoo in N. benthamiana. When infiltrated with Xoo strain YN-1, N. benthamiana plants exhibited a strong necrosis within 24 h and produced a large amount of H(2O(2 in the infiltrated area. Expression of HR- and defense-related genes was induced, whereas bacterial numbers dramatically decreased during necrosis. VIGS of 45 ACE (Avr/Cf-elicited genes revealed identified seven genes required for nonhost resistance to Xoo in N. benthamiana. The seven genes encoded a calreticulin protein (ACE35, an ERF transcriptional factor (ACE43, a novel Solanaceous protein (ACE80, a hydrolase (ACE117, a peroxidase (ACE175 and two proteins with unknown function (ACE95 and ACE112. The results indicate that oxidative burst and calcium-dependent signaling pathways play an important role in nonhost resistance to Xoo. VIGS analysis further revealed that ACE35, ACE80, ACE95 and ACE175, but not the other three ACE genes, interfered with the Cf-4/Avr4-dependent HR. CONCLUSIONS/SIGNIFICANCE: N. benthamiana plants inoculated with Xoo respond by rapidly eliciting an HR and nonhost resistance. The oxidative burst and other signaling pathways are pivotal in Xoo-N. benthamiana nonhost resistance, and genes involved in this response partially overlap with those involved in Cf/Avr4-dependent HR. The seven genes required for N. benthamiana-mediated resistance to Xoo provide a basis for further dissecting

  15. Pathotype and genetic diversity amongst Indian isolates of Xanthomonas oryzae pv. oryzae.

    Directory of Open Access Journals (Sweden)

    Deo Mishra

    Full Text Available A number of rice resistance genes, called Xa genes, have been identified that confer resistance against various strains of Xanthomonas oryzae pv. oryzae (Xoo, the causal agent of bacterial blight. An understanding of pathotype diversity within the target pathogen population is required for identifying the Xa genes that are to be deployed for development of resistant rice cultivars. Among 1024 isolates of Xoo collected from 20 different states of India, 11 major pathotypes were distinguished based on their reaction towards ten Xa genes (Xa1, Xa3, Xa4, xa5, Xa7, xa8, Xa10, Xa11, xa13, Xa21. Isolates belonging to pathotype III showing incompatible interaction towards xa8, xa13 and Xa21 and compatible interaction towards the rest of Xa genes formed the most frequent (41% and widely distributed pathotype. The vast majority of the assayed Xoo isolates were incompatible with one or more Xa genes. Exceptionally, the isolates of pathotype XI were virulent on all Xa genes, but have restricted distribution. Considering the individual R-genes, Xa21 appeared as the most broadly effective, conferring resistance against 88 % of the isolates, followed in decreasing order by xa13 (84 %, xa8 (64 %, xa5 (30 %, Xa7 (17 % and Xa4 (14 %. Fifty isolates representing all the eleven pathotypes were analyzed by southern hybridization to determine their genetic relatedness using the IS1112 repeat element of Xoo. Isolates belonging to pathotype XI were the most divergent. The results suggest that one RFLP haplotype that is widely distributed all over India and is represented in strains from five different pathotypes might be an ancestral haplotype. A rice line with xa5, xa13 and Xa21 resistance genes is resistant to all strains, including those belonging to pathotype XI. This three gene combination appears to be the most suitable Xa gene combination to be deployed in Indian rice cultivars.

  16. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  17. NCBI nr-aa BLAST: CBRC-XTRO-01-0645 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-0645 ref|YP_451034.1| hypothetical protein XOO_2005 [Xanthomonas oryza...e pv. oryzae MAFF 311018] dbj|BAE68760.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_451034.1 2e-41 40% ...

  18. NCBI nr-aa BLAST: CBRC-LAFR-01-0180 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-LAFR-01-0180 ref|YP_453064.1| hypothetical protein XOO_4035 [Xanthomonas oryza...e pv. oryzae MAFF 311018] dbj|BAE70790.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_453064.1 6.5 37% ...

  19. NCBI nr-aa BLAST: CBRC-ACAR-01-0713 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0713 ref|YP_200709.1| glucose-galactose transporter [Xanthomonas oryza...e pv. oryzae KACC10331] gb|AAW75324.1| fucose permease [Xanthomonas oryzae pv. oryzae KACC10331] YP_200709.1 3.6 35% ...

  20. NCBI nr-aa BLAST: CBRC-ACAR-01-0713 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0713 ref|YP_450980.1| glucose-galactose transporter [Xanthomonas oryza...e pv. oryzae MAFF 311018] dbj|BAE68706.1| glucose-galactose transporter [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_450980.1 4.7 35% ...

  1. EFEITO DE FUNGICIDAS NO CONTROLE DE BRUSONE (Pyricularia oryzae E MANCHA PARDA (Helminthosporium oryzae NO ARROZ EFFECT OF FUNGICIDES IN THE CONTROL OF RICE BLAST Pyricularia oryzae AND Helminthosporium oryzae

    Directory of Open Access Journals (Sweden)

    Wilson Ferreira de Oliveira

    2007-09-01

    Full Text Available

    Foi avaliado, a nível de campo, o efeito dos fungicidas ethiltrianol e edifienphos no controle de brusone (Pyricularia oryzae Cav. e Helminthosporium oryzae Breda de Haan na cultura do arroz, variedade IAC - 47. Os fungicidas foram pulverizados uma ou duas vezes, em diferentes concentrações a partir da emissão das panículas. Os resultados apurados indicaram que quanto a lesões nas panículas, nos grãos e produtividade, não houve diferença significativa entre os tratamentos. Com relação ao parâmetro lesões nas folhas bandeiras houve diferença entre todos os tratamentos com fungicidas e a testemunha.

    The effect of the fungicides ethiltrianol and edifenphos was evaluated, on level of field, aiming control rice blast (Pyricularia oryzae and Helminthosporium oryzae in variety IAC - 47. The fungicides were pulverized one or two times in different concentrations in the stage of panicles emission. The results showed that, as to infection level in the panicles, grain lesions and productivity there was no significant statistical difference between treatments. Refering to infection level in the banner leaves, there was significant statistical difference between treatments and the control.

  2. Study on the structures of papilla of lemma in Oryza

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    @@ Structures of papilla of lemma among 23 Oryza species were investigated and classified into 6 kinds by scanning electron microscopy. The lemma surface was composed of papilla pedestals with multi-row longitudinal ordered arrangements and the papilla was inserted into pedestal. The morphology and characterization of papilla varied among species.

  3. Pathogenicity of Rice Blast Fungus Magnaporthe oryzae on Brachypodium distachyon

    Institute of Scientific and Technical Information of China (English)

    WANG Jiao-yu; WANG Xiao-yan; LI Ling; ZHANG Xin; WANG Yan-li; CHAI Rong-yao; SUN Guo-chang

    2012-01-01

    Inoculation methods for rice blast fungus Magnaporthe oryzae to Brachypodium distachyon were developed to investigate the infection process and symptom development in comparison with those on rice (Oryza sativa) and barley (Hordeum vulgare).M.oryzae could infect leaves,sheathes,stems and panicles of B.distachyon and cause blast disease.Spraying conidial suspension on either intact seedlings or leaf segments induced typical symptoms on B distachyon.During the intact seedling inoculation,the symptom developed on B.distachyon leaves closely resembled that on rice; but the lesions on B.distachyon had better uniformity in shapes and sizes than those on rice or barley.In the leaf segments inoculation,only initial and low-developed lesions could be found on rice,while normal symptoms on B.distachyon and barley.Inoculated with low-virulent mutants of M.oryzae,B.distachyon produced low-level symptoms.The symptom level of each mutant on B.distachyon corresponded well to that on rice.In addition,typical infection processes presented on B.distachyon leaves:forming melanized appressoria,penetrating into host epidermis and then forming hyphae in epidermal cells.According to these results,B.distachyon can be used as a candidate for studying fungus-plant interactions and as a probable source of disease resistance.

  4. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  5. The Drentsche Aa valley system

    International Nuclear Information System (INIS)

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  6. ANTAGONISTIC ACTIVITY OF SERRATIA MARCESCENS AGAINST PYRICULARIA ORYZAE

    Directory of Open Access Journals (Sweden)

    V. JAIGANESH

    2007-08-01

    Full Text Available Rice is an important crop, widely affected by quite a number of diseases that results in higher yield losses. Among the fungal diseases, blast incited by Pyricularia oryzae is a major disease. The biological method of plant disease management seems to be an alternative to chemical fungicides in managing the blast disease. A new bio control agent viz., Serratia marcescens appears to be an ideal agent for the control of P. oryzae, because it produces chitinolytic enzymes which causes degradation of the fungal cell walls, induction of plant defence reaction and certain antifungal low molecular weight molecules. A study was undertaken to investigate the effect of a new bio control agent like S. marcescens against P. oryzae. The talc based formulation of S. marcescens (@ 1.0, 1.5, 2.0 and 2.5 kg/ha was sprayed on old IR 50 rice plants in fields. Out of the six-bio protectants tested, S. marcescens was found very effective against P. oryzae under in vitro conditions. S. marcescens could be isolated from shoots as well as roots emerging from the treated seeds and the plant parts from treated seeds inhibited P. oryzae. The antagonist S. marcescens survived in the phyllosphere even 80 days after spray. The results revealed that rice blast control was achieved by spraying S. marcescens @ 1.0 kg/ha. The increasing dose of talc-based inoculum when applied on foliage increased the phyllosphere population of S. marcescens and controlled rice blast. The maximum disease control was achieved when inoculum was applied at 2.5 kg/ha.

  7. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  8. A novel l-arabinose-responsive regulator discovered in the rice-blast fungus Pyricularia oryzae (Magnaporthe oryzae)

    NARCIS (Netherlands)

    Klaubauf, Sylvia; Zhou, Miaomiao; Lebrun, Marc-Henri; de Vries, Ronald P; Battaglia, Evy

    2016-01-01

    In this study we identified the l-arabinose-responsive regulator of Pyricularia oryzae that regulates l-arabinose release and catabolism. Previously we identified the Zn2Cys6 transcription factor (TF), AraR, that has this role in the Trichocomaceae family (Eurotiales), but is absent in other fungi.

  9. Characterisation of some Accessions of Indigenous Rice (Oryza glaberrima Steud) in Ghana

    International Nuclear Information System (INIS)

    African rice (Oryza glaberrima Steud), a relative of the commonly consumed Asian (white) rice (Oryza sativa L.) is resistant to a number of biotic and abiotic stress factors and contains higher amounts of some essential mineral elements required for human health and growth, compared to the latter. Seventeen local accessions collected from four geographical regions in Ghana were characterised alongside NERICA 1, a high yielding, protein-rich hybrid line purposely bred for Africa, using 32 IBPGR-IRRI agro-botanical traits. Molecular characterisation was done using 24 standard simple sequence repeat markers. The accessions were also evaluated for seven essential mineral elements: calcium (Ca), copper (Cu), iron (Fe), magnesium (Mg), Manganese (Mn), potassium (K) and zinc (Zn) in the caryopsis, using Atomic Absorption Spectrophotometry (AAS) supported by Neutron Activation Analysis (NAA). The aim was to assess genetic diversity of the accessions and identify superior ones for incorporation in future breeding programmes. Cluster analysis (UPGMA), principal component analysis (Axes), correlation and population genetic analysis were used to group the accessions. The single link cluster technique classified the qualitative and quantitative traits of 18 accessions into six and four clusters respectively while the use of molecular traits grouped them into four clusters. Principal component analysis (PCA) re-ordered the accessions into four broad groups which had within-cluster and inter-cluster variations. Two pairs of duplicate accessions were revealed from the dendogram generated using morphological characters. SSRs were highly polymorphic, more discriminatory and informative at 77.3% and 80.0% similarity distance respectively, they were able to discriminate between these pairs of accessions earlier identified as duplicates using botanical descriptors. The overall genetic diversity of the accessions was relatively high (He = 0.625; Nei's He = 0.608 and I = 1.178) with

  10. Transcriptomic Analysis and the Expression of Disease-Resistant Genes in Oryza meyeriana under Native Condition.

    Directory of Open Access Journals (Sweden)

    Bin He

    Full Text Available Oryza meyeriana (O. meyeriana, with a GG genome type (2n = 24, accumulated plentiful excellent characteristics with respect to resistance to many diseases such as rice shade and blast, even immunity to bacterial blight. It is very important to know if the diseases-resistant genes exist and express in this wild rice under native conditions. However, limited genomic or transcriptomic data of O. meyeriana are currently available. In this study, we present the first comprehensive characterization of the O. meyeriana transcriptome using RNA-seq and obtained 185,323 contigs with an average length of 1,692 bp and an N50 of 2,391 bp. Through differential expression analysis, it was found that there were most tissue-specifically expressed genes in roots, and next to stems and leaves. By similarity search against protein databases, 146,450 had at least a significant alignment to existed gene models. Comparison with the Oryza sativa (japonica-type Nipponbare and indica-type 93-11 genomes revealed that 13% of the O. meyeriana contigs had not been detected in O. sativa. Many diseases-resistant genes, such as bacterial blight resistant, blast resistant, rust resistant, fusarium resistant, cyst nematode resistant and downy mildew gene, were mined from the transcriptomic database. There are two kinds of rice bacterial blight-resistant genes (Xa1 and Xa26 differentially or specifically expressed in O. meyeriana. The 4 Xa1 contigs were all only expressed in root, while three of Xa26 contigs have the highest expression level in leaves, two of Xa26 contigs have the highest expression profile in stems and one of Xa26 contigs was expressed dominantly in roots. The transcriptomic database of O. meyeriana has been constructed and many diseases-resistant genes were found to express under native condition, which provides a foundation for future discovery of a number of novel genes and provides a basis for studying the molecular mechanisms associated with disease

  11. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  12. Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa.

    Science.gov (United States)

    Morin, Ryan D; Aksay, Gozde; Dolgosheina, Elena; Ebhardt, H Alexander; Magrini, Vincent; Mardis, Elaine R; Sahinalp, S Cenk; Unrau, Peter J

    2008-04-01

    The diversity of microRNAs and small-interfering RNAs has been extensively explored within angiosperms by focusing on a few key organisms such as Oryza sativa and Arabidopsis thaliana. A deeper division of the plants is defined by the radiation of the angiosperms and gymnosperms, with the latter comprising the commercially important conifers. The conifers are expected to provide important information regarding the evolution of highly conserved small regulatory RNAs. Deep sequencing provides the means to characterize and quantitatively profile small RNAs in understudied organisms such as these. Pyrosequencing of small RNAs from O. sativa revealed, as expected, approximately 21- and approximately 24-nt RNAs. The former contained known microRNAs, and the latter largely comprised intergenic-derived sequences likely representing heterochromatin siRNAs. In contrast, sequences from Pinus contorta were dominated by 21-nt small RNAs. Using a novel sequence-based clustering algorithm, we identified sequences belonging to 18 highly conserved microRNA families in P. contorta as well as numerous clusters of conserved small RNAs of unknown function. Using multiple methods, including expressed sequence folding and machine learning algorithms, we found a further 53 candidate novel microRNA families, 51 appearing specific to the P. contorta library. In addition, alignment of small RNA sequences to the O. sativa genome revealed six perfectly conserved classes of small RNA that included chloroplast transcripts and specific types of genomic repeats. The conservation of microRNAs and other small RNAs between the conifers and the angiosperms indicates that important RNA silencing processes were highly developed in the earliest spermatophytes. Genomic mapping of all sequences to the O. sativa genome can be viewed at http://microrna.bcgsc.ca/cgi-bin/gbrowse/rice_build_3/.

  13. Prediction and Expression Analysis of miRNAs Associated with Heat Stress in Oryza sativa

    Institute of Scientific and Technical Information of China (English)

    B.SAILAJA; S.R.VOLETI; D.SUBRAHMANYAM; N.SARLA; V.VISHNU PRASANTH; V.P.BHADANA; S.K.MANGRAUTHIA

    2014-01-01

    Computational prediction of potential microRNAs (miRNAs) and their target genes was performed to identify the miRNAs and genes associated with temperature response in rice. The data of temperature-responsive miRNAs of Arabidopsis, and miRNAs and the whole genome data of rice were used to predict potential miRNAs in Oryza sativa involved in temperature response. A total of 55 miRNAs were common in both the species, and 27 miRNAs were predicted at the first time in rice. Target genes were searched for these 27 miRNAs in rice genome following stringent criteria. Real time PCR based on expression analysis of nine miRNAs showed that majority of the miRNAs were down regulated under heat stress for rice cultivar Nagina 22. Furthermore, miR169, miR1884 and miR160 showed differential expression in root and shoot tissues of rice. Identification and expression studies of miRNAs during heat stress will advance the understanding of gene regulation under stress in rice.

  14. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  15. Oryza Tag Line, a phenotypic mutant database for the Genoplante rice insertion line library

    OpenAIRE

    Larmande, Pierre; Gay, Celine; Lorieux, Mathias; Perin, Christophe; Bouniol, Matthieu; Droc, Gaëtan; Sallaud, Christophe; Perez, Pascual; Barnola, Isabelle; Biderre-Petit, Corinne; Martin, Jérôme; Morel, Jean-Benoit; Johnson, Alexander A. T.; Bourgis, Fabienne; Ghesquière, Alain

    2008-01-01

    International audience To organize data resulting from the phenotypic characterization of a library of 30,000 T-DNA enhancer trap (ET) insertion lines of rice (Oryza sativa L cv. Nipponbare), we developed the Oryza Tag Line (OTL) database (http://urgi.versailles.inra.fr/OryzaTagLine/). OTL structure facilitates forward genetic search for specific phenotypes, putatively resulting from gene disruption, and/or for GUSA or GFP reporter gene expression patterns, reflecting ET-mediated endogenou...

  16. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  17. Molecular progress on the mapping and cloning of functional genes for blast disease in rice (Oryza sativa L.): current status and future considerations.

    Science.gov (United States)

    Ashkani, S; Rafii, M Y; Shabanimofrad, M; Ghasemzadeh, A; Ravanfar, S A; Latif, M A

    2016-01-01

    Rice blast disease, which is caused by the fungal pathogen Magnaporthe oryzae, is a recurring problem in all rice-growing regions of the world. The use of resistance (R) genes in rice improvement breeding programmes has been considered to be one of the best options for crop protection and blast management. Alternatively, quantitative resistance conferred by quantitative trait loci (QTLs) is also a valuable resource for the improvement of rice disease resistance. In the past, intensive efforts have been made to identify major R-genes as well as QTLs for blast disease using molecular techniques. A review of bibliographic references shows over 100 blast resistance genes and a larger number of QTLs (∼500) that were mapped to the rice genome. Of the blast resistance genes, identified in different genotypes of rice, ∼22 have been cloned and characterized at the molecular level. In this review, we have summarized the reported rice blast resistance genes and QTLs for utilization in future molecular breeding programmes to introgress high-degree resistance or to pyramid R-genes in commercial cultivars that are susceptible to M. oryzae. The goal of this review is to provide an overview of the significant studies in order to update our understanding of the molecular progress on rice and M. oryzae. This information will assist rice breeders to improve the resistance to rice blast using marker-assisted selection which continues to be a priority for rice-breeding programmes.

  18. Niclosamide inhibits leaf blight caused by Xanthomonas oryzae in rice.

    Science.gov (United States)

    Kim, Sung-Il; Song, Jong Tae; Jeong, Jin-Yong; Seo, Hak Soo

    2016-01-01

    Rice leaf blight, which is caused by the bacterial pathogen Xanthomonas oryzae pv. oryzae (Xoo), results in huge losses in grain yield. Here, we show that Xoo-induced rice leaf blight is effectively controlled by niclosamide, an oral antihelminthic drug and molluscicide, which also functions as an anti-tumor agent. Niclosamide directly inhibited the growth of the three Xoo strains PXO99, 10208 and K3a. Niclosamide moved long distances from the site of local application to distant rice tissues. Niclosamide also increased the levels of salicylate and induced the expression of defense-related genes such as OsPR1 and OsWRKY45, which suppressed Xoo-induced leaf wilting. Niclosamide had no detrimental effects on vegetative/reproductive growth and yield. These combined results indicate that niclosamide can be used to block bacterial leaf blight in rice with no negative side effects. PMID:26879887

  19. Kinetics of alpha-amylase secretion in Aspergillus oryzae

    DEFF Research Database (Denmark)

    Henriksen, Anne Laurence Santerre; Carlsen, Morten; Bang de, H.;

    1999-01-01

    Pulse and pulse-chase experiments have been performed to study L-[S-35] methionine incorporation and protein secretion kinetics in Aspergillus oryzae. Pulse experiments confirmed the mechanism of methionine uptake reported previously for Penicillium chrysogenum (Benko et al., 1967). Pulse......-chase experiments were carried out to investigate the alpha-amylase secretion kinetics in A. oryzae. No unglycosylated alpha-amylase was detected neither intracellularly nor extracellularly demonstrating that glycosylation was not the rate controlling step in the secretory pathway. The pulse chase experiments...... indicated that there are two pools of intracellular alpha-amylase: a fast secreted and a slow secreted. The secretion of those two pools were described with a kinetic model, which was fitted to the pulse chase experiments. (C) 1999 John Wiley & Sons, Inc. Biotechnol Bioeng 65: 76-82, 1999....

  20. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor

    OpenAIRE

    Pérez, Claudia; Fernandez, Luisa E.; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S.; Soberón, Mario; Bravo, Alejandra

    2005-01-01

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa bind...

  1. SSR Marker Analysis on indica-japonica Differentiation of Natural Population of Oryza rufipogon in Yuanjiang, Yunnan Province

    Institute of Scientific and Technical Information of China (English)

    LI Ya-li; YANG Xiao-xi; ZHAO Feng-ping; XU Ming-hui

    2006-01-01

    By using 19 pairs of primers that could identify two subspecies (indica and japonica) of cultivated rice (Oryza sativa L.), the indica-japonica differentiation of 56 individuals from the natural population of common wild rice (Oryza rufipogon Griff.) in Yuanjiang was analyzed by SSR (microsatellite DNAs, or simple sequence repeat). Of the 19 pairs of primers, 17 pairs (89.47%) could amplify only one kind of band type among ail of the individuals, but primers RM251 and RM18 could amplify polymorphic band types. The bands amplified by 16 pairs of primers (84.21%) were identical to the indica-japonica diagnostic bands of relevant locus in cultivated rice, including 11 japonica-like loci and 4 indica-like loci. The bands amplified by the other three pairs of primers (RM18, RM202,RM205) were different from indica or japonica diagnostic bands of cultivated rice. The results showed that according to 19 loci analyzed, 84.21% of SSR loci in genomic DNA of common wild rice in Yuanjiang displayed indica-japonica differentiation and 13.79% of the loci still kept primitive, and most of the detected loci were homogenetic in the natural population.

  2. Pyricularia oryzae en cultivos de cebada en Corrientes (Argentina

    Directory of Open Access Journals (Sweden)

    Susana Alejandra Gutiérrez

    2015-12-01

    Full Text Available RESUMENDurante la campaña 2012-2013, en cultivos de cebada forrajera (Hordeumvulgare var. Alicia INTA, se observaron síntomas de tizón foliar. El agente causal (Pyricularia oryzae fue identificado según características morfométricas, culturales y de patogenicidad. Constituye ésta la primera información del patógeno para cultivos de cebada forrajera en Argentina.

  3. Multiple translocation of the AVR-Pita effector gene among chromosomes of the rice blast fungus Magnaporthe oryzae and related species.

    Directory of Open Access Journals (Sweden)

    Izumi Chuma

    2011-07-01

    Full Text Available Magnaporthe oryzae is the causal agent of rice blast disease, a devastating problem worldwide. This fungus has caused breakdown of resistance conferred by newly developed commercial cultivars. To address how the rice blast fungus adapts itself to new resistance genes so quickly, we examined chromosomal locations of AVR-Pita, a subtelomeric gene family corresponding to the Pita resistance gene, in various isolates of M. oryzae (including wheat and millet pathogens and its related species. We found that AVR-Pita (AVR-Pita1 and AVR-Pita2 is highly variable in its genome location, occurring in chromosomes 1, 3, 4, 5, 6, 7, and supernumerary chromosomes, particularly in rice-infecting isolates. When expressed in M. oryzae, most of the AVR-Pita homologs could elicit Pita-mediated resistance, even those from non-rice isolates. AVR-Pita was flanked by a retrotransposon, which presumably contributed to its multiple translocation across the genome. On the other hand, family member AVR-Pita3, which lacks avirulence activity, was stably located on chromosome 7 in a vast majority of isolates. These results suggest that the diversification in genome location of AVR-Pita in the rice isolates is a consequence of recognition by Pita in rice. We propose a model that the multiple translocation of AVR-Pita may be associated with its frequent loss and recovery mediated by its transfer among individuals in asexual populations. This model implies that the high mobility of AVR-Pita is a key mechanism accounting for the rapid adaptation toward Pita. Dynamic adaptation of some fungal plant pathogens may be achieved by deletion and recovery of avirulence genes using a population as a unit of adaptation.

  4. Reduction of aflatoxins by Rhizopus oryzae and Trichoderma reesei.

    Science.gov (United States)

    Hackbart, H C S; Machado, A R; Christ-Ribeiro, A; Prietto, L; Badiale-Furlong, E

    2014-08-01

    This study evaluated the ability of the microorganisms Rhizopus oryzae (CCT7560) and Trichoderma reesei (QM9414), producers of generally recognized as safe (GRAS) enzymes, to reduce the level of aflatoxins B1, B2, G1, G2, and M1. The variables considered to the screening were the initial number of spores in the inoculum and the culture time. The culture was conducted in contaminated 4 % potato dextrose agar (PDA) medium, and the residual mycotoxins were determined every 24 h by HPLC-FL. The fungus R. oryzae has reduced aflatoxins B1, B2, and G1 in the 96 h and aflatoxins M1 and G2 in the range of 120 h of culture by approximately 100 %. The fungus T. reesei has reduced aflatoxins B1, B2, and M1 in the 96 h and aflatoxin G1 in the range of 120 h of culture by approximately 100 %. The highest reduction occurred in the middle of R. oryzae culture.

  5. Jewelry boxes contaminated by Aspergillus oryzae: an occupational health risk?

    Science.gov (United States)

    Bellanger, Anne-Pauline; Roussel, Anaïs; Millon, Laurence; Delaforge, Marcel; Reboux, Gabriel

    2012-01-01

    In 2009, 100,000 jewelry boxes, manufactured in China, were delivered to a jewelry manufacturer in Besançon, France. All the boxes were contaminated by mold. Because the workers refused to handle these jewelry boxes, the company contacted our laboratory to determine how to deal with the problem. Three choices were available: (1) decontaminate the boxes, (2) return the boxes to the Chinese manufacturer, or (3) destroy the entire shipment. Based on microscopic identification, the culture analysis was positive for A. oryzae. This could not be confirmed by molecular techniques because of the genetic proximity of A. oryzae and A. flavus. Because A. flavus can produce aflatoxins, we tested for them using mass spectrometry. Aflatoxins B1, B2, G1, G2, and M1 were not detected; however, given the specifics of this situation, we could not discard the possibility of the presence of other aflatoxins, such as P1, B3, GM2, and ethoxyaflatoxin B2. We concluded that the contamination by A. oryzae was probably due to food products. However, because of the possible presence of aflatoxins, occupational health risks could not be entirely ruled out. The decision was therefore taken to destroy all the jewelry boxes by incineration. To avoid a similar situation we propose: (1) to maintain conditions limiting mold contamination during production (not eating on the work site, efficient ventilation systems); (2) to desiccate the products before sending them; and (3) to closely control the levels of dampness during storage and transport.

  6. Reduction of aflatoxins by Rhizopus oryzae and Trichoderma reesei.

    Science.gov (United States)

    Hackbart, H C S; Machado, A R; Christ-Ribeiro, A; Prietto, L; Badiale-Furlong, E

    2014-08-01

    This study evaluated the ability of the microorganisms Rhizopus oryzae (CCT7560) and Trichoderma reesei (QM9414), producers of generally recognized as safe (GRAS) enzymes, to reduce the level of aflatoxins B1, B2, G1, G2, and M1. The variables considered to the screening were the initial number of spores in the inoculum and the culture time. The culture was conducted in contaminated 4 % potato dextrose agar (PDA) medium, and the residual mycotoxins were determined every 24 h by HPLC-FL. The fungus R. oryzae has reduced aflatoxins B1, B2, and G1 in the 96 h and aflatoxins M1 and G2 in the range of 120 h of culture by approximately 100 %. The fungus T. reesei has reduced aflatoxins B1, B2, and M1 in the 96 h and aflatoxin G1 in the range of 120 h of culture by approximately 100 %. The highest reduction occurred in the middle of R. oryzae culture. PMID:24925827

  7. 水稻PIN家族的生物信息学分析%Bioinformatics Analysis of PIN-formed Family in Oryza sativa

    Institute of Scientific and Technical Information of China (English)

    丁懿; 石彩娟; 王万军

    2012-01-01

    PIN family is the most important auxin efflux carrier in plants, which encompasses lots of members in nearly all the higher plants. It turns out that there are as many as 12 PIN genes in Oryza sativa when we perform BLAST search against its genome. Our studies show that PIN genes in Oryza saliva are asymmetrically distributed; The exon-inlron structure of the PIN genes are much the same in Oryza saliva; PIN proteins have all the necessary elements for acting as carrier proteins; the hydrophobicity profile, trans membrane domain; Motif analysis suggests that there are NPNXY motifs, a well characterized IM motif, and 7 other uncharacterized motif in almost all the PIN proteins; Neigh-bour-joing phylogenelic trees show that PINs family split into two major families in early stages, which can be distinguished by the length of hydrogen loop in the center of proteins, and later lineage-specific duplication appeared in Oryza saliva, resulting a bunch of paralogous in the genome of Oryza sativa.%作为植物中最重要的生长素外输载体,PIN家族在各种植物中都拥有众多成员.对水稻基因组的BLAST搜索获得了12个PIN家族成员,分析发现:水稻PIN基因不均衡地分布在基因组染色体上;其内含子、外显子结构类似;PIN蛋白质拥有典型的载体蛋白序列特征,即亲/疏水性反复变化,存在多次跨膜结构域;几乎所有PIN蛋白都有一个NPNXY的内化结构域和7个功能未知的基序;PIN在早期即分化为两组成员,主要区别在于中间亲水环的部分缺失;并且在后来发生了支系特异的复制事件,从而形成了众多旁系同源基因.

  8. A novel L-arabinose-responsive regulator discovered in the rice-blast fungus Pyricularia oryzae (Magnaporthe oryzae).

    Science.gov (United States)

    Klaubauf, Sylvia; Zhou, Miaomiao; Lebrun, Marc-Henri; de Vries, Ronald P; Battaglia, Evy

    2016-02-01

    In this study we identified the L-arabinose-responsive regulator of Pyricularia oryzae that regulates L-arabinose release and catabolism. Previously we identified the Zn2Cys6 transcription factor (TF), AraR, that has this role in the Trichocomaceae family (Eurotiales), but is absent in other fungi. Candidate Zn2Cys6 TF genes were selected according to their transcript profiles on L-arabinose. Deletion mutants of these genes were screened for their growth phenotype on L-arabinose. One mutant, named Δara1, was further analyzed. Our analysis demonstrated that Ara1 from P. oryzae is the functional analog of AraR from A. niger, while there is no significant sequence similarity between them. PMID:26790567

  9. Production of bacterial blight resistant lines from somatic hybridization between Oryza sativa L. and Oryza meyeriana L.

    Institute of Scientific and Technical Information of China (English)

    严成其; 钱凯先; 薛刚平; 吴忠长; 陈跃磊; 颜秋生; 张雪琴; 吴平

    2004-01-01

    Novel bacterial blight (BB) resistance gene(s) for rice was (were) introduced into a cultivated japonica rice variety Oryza sativa (cv. 8411), via somatic hybridization using the wild rice Oryza meyeriana as the donor of the resistance gene(s). Twenty-nine progenies of somatically hybridized plants were obtained. Seven somatically hybridized plants and their parents were used for AFLP (amplified fragment length polymorphism) analysis using 8 primer pairs. Results confirmed that these plants were somatic hybrids containing the characteristic bands of both parents. The morphology of the regenerated rice showed characters of both O.sativa and O.meyeriana. Two somatic hybrids showed highest BB resistance and the other 8 plants showed moderate resistance. The new germplasms with highest resistance have been used in the rice breeding program for the improvement of bacterial blight resistance.

  10. Production of bacterial blight resistant lines from somatic hybridization between Oryza sativa L.and Oryza meyeriana L.

    Institute of Scientific and Technical Information of China (English)

    严成其; 钱凯先; 薛刚平; 吴忠长; 陈跃磊; 颜秋生; 张雪琴; 吴平

    2004-01-01

    Novel bacterial blight (BB) resistance gene(s) for rice was (were) introduced into a cultivated japonica rice variety Oryza sativa (cv. 8411), via somatic hybridization using the wild rice Oryza meyeriana as the donor of the resistance gene(s). Twenty-nine progenies of somatically hybridized plants were obtained. Seven somatically hybridized plants and their parents were used for AFLP (amplified fragment length polymorphism) analysis using 8 primer pairs. Results confirmed that these plants were somatic hybrids containing the characteristic bands of both parents. The morphology of the regenerated rice showed characters of both O. sativa and O. meyeriana. Two somatic hybrids showed highest BB resistance and the other 8 plants showed moderate resistance. The new germplasms with highest resistance have been used in the rice bfeeding program for the improvement of bacterial blight resistance.

  11. Is amyloid A (AA) amyloidosis always secondary?

    OpenAIRE

    Maury, C P; Törnroth, T; Wegelius, O

    1985-01-01

    The case is reported of a patient with systemic AA amyloidosis associated with non-specific mesenteric lymphadenitis and chronic sideropenia. Renal, small bowel, and rectal biopsies showed amyloid deposits containing AA protein, as defined by potassium permanganate sensitivity and by reactivity with AA antiserum. Reversal of the nephrotic syndrome occurred during steroid-azathioprine therapy.

  12. The thiG Gene Is Required for Full Virulence of Xanthomonas oryzae pv. oryzae by Preventing Cell Aggregation.

    Directory of Open Access Journals (Sweden)

    Xiaoyue Yu

    Full Text Available Bacterial blight of rice is an important serious bacterial diseases of rice in many rice-growing regions, caused by Xanthomonas oryzae pv. oryzae (Xoo. The thiG gene from Xoo strain ZJ173, which is involved with thiazole moiety production in the thiamine biosynthesis pathway, is highly conserved among the members of Xanthomonas. The thiG deletion mutant displayed impaired virulence and growth in thiamine-free medium but maintained its normal growth rate in the rice tissues, indicating that the thiG gene is involved in Xoo virulence. Compared to the wild type strain, the formation of cell-cell aggregates was affected in thiG deletion mutants. Although biofilm formation was promoted, motility and migration in rice leaves were repressed in the thiG mutants, and therefore limited the expansion of pathogen infection in rice. Quorum sensing and extracellular substance are two key factors that contribute to the formation of cell-cell aggregates. Our study found that in the thiG mutant the expression of two genes, rpfC and rpfG, which form a two-component regulatory signal system involved in the regulation of biofilm formation by a second messenger cyclic di-GMP is down-regulated. In addition, our study showed that xanthan production was not affected but the expression of some genes associated with xanthan biosynthesis, like gumD, gumE, gumH and gumM, were up-regulated in thiG mutants. Taken together, these findings are the first to demonstrate the role of the thiazole biosynthsis gene, thiG, in virulence and the formation of aggregates in Xanthomonas oryzae pv. oryzae.

  13. STUDI ENZIM LIPASE DARI Aspergillus oryzae PADA KOPRA BERJAMUR SEBAGAI BIOKATALISATOR UNTUK HIDROLISIS MINYAK KELAPA MENJADI DIASILGLISEROL

    OpenAIRE

    seniwati

    2012-01-01

    SENIWATI DALI. Studi Enzim Lipase dari Aspergillus oryzae pada Kopra Berjamur Sebagai Biokatalisator untuk Hidrolisis Minyak Kelapa Menjadi Diasilgliserol (dibimbing oleh Abd. Rauf Patong, M. Noor Jalaluddin dan Pirman AP). Penelitian ini bertujuan (1) menentukan kondisi optimum produksi enzim lipase dari A. oryzae pada kopra berjamur, (2) memurnikan dan mengkarakterisasi enzim lipase dari A. oryzae, (3) menentukan unjuk kerja enzim lipase imobil dari A. oryzae sebagai bi...

  14. Comparison of Expression of Secondary Metabolite Biosynthesis Cluster Genes in Aspergillus flavus, A. parasiticus, and A. oryzae

    Directory of Open Access Journals (Sweden)

    Kenneth C. Ehrlich

    2014-06-01

    Full Text Available Fifty six secondary metabolite biosynthesis gene clusters are predicted to be in the Aspergillus flavus genome. In spite of this, the biosyntheses of only seven metabolites, including the aflatoxins, kojic acid, cyclopiazonic acid and aflatrem, have been assigned to a particular gene cluster. We used RNA-seq to compare expression of secondary metabolite genes in gene clusters for the closely related fungi A. parasiticus, A. oryzae, and A. flavus S and L sclerotial morphotypes. The data help to refine the identification of probable functional gene clusters within these species. Our results suggest that A. flavus, a prevalent contaminant of maize, cottonseed, peanuts and tree nuts, is capable of producing metabolites which, besides aflatoxin, could be an underappreciated contributor to its toxicity.

  15. Comparison of expression of secondary metabolite biosynthesis cluster genes in Aspergillus flavus, A. parasiticus, and A. oryzae.

    Science.gov (United States)

    Ehrlich, Kenneth C; Mack, Brian M

    2014-06-23

    Fifty six secondary metabolite biosynthesis gene clusters are predicted to be in the Aspergillus flavus genome. In spite of this, the biosyntheses of only seven metabolites, including the aflatoxins, kojic acid, cyclopiazonic acid and aflatrem, have been assigned to a particular gene cluster. We used RNA-seq to compare expression of secondary metabolite genes in gene clusters for the closely related fungi A. parasiticus, A. oryzae, and A. flavus S and L sclerotial morphotypes. The data help to refine the identification of probable functional gene clusters within these species. Our results suggest that A. flavus, a prevalent contaminant of maize, cottonseed, peanuts and tree nuts, is capable of producing metabolites which, besides aflatoxin, could be an underappreciated contributor to its toxicity.

  16. Genome sequence of the cultivated cotton Gossypium arboreum

    Science.gov (United States)

    Cotton is one of the most economically important natural fiber crops in the world, and the complex tetraploid nature of its genome (AADD, 2n = 52) makes genetic, genomic and functional analyses extremely challenging. Here we sequenced and assembled 98.3% of the 1.7-gigabase G. arboreum (AA, 2n = 26...

  17. Genome-wide pooling approach identifies SPATA5 as a new susceptibility locus for alopecia areata

    OpenAIRE

    2011-01-01

    Abstract Alopecia areata (AA) is a common hair loss disorder which is thought to be a tissue-specific autoimmune disease. Previous research has identified a few AA susceptibility genes, most of which are implicated in autoimmunity. To identify new genetic variants and further elucidate the genetic basis of AA, we performed a genome-wide association study using the strategy of pooled DNA genotyping (729 cases; 656 controls). The strongest association was for variants in the HLA regi...

  18. First Report of Rhizopus oryzae as a Postharvest Pathogen of Apple in Korea.

    Science.gov (United States)

    Kwon, Jin-Hyeuk; Kim, Jinwoo; Kim, Won-Il

    2011-06-01

    Soft rot in apple caused by Rhizopus oryzae was found for the first time in Korea. A detailed description of the specimen is given along with its internal transcribed spacer rDNA sequence. The fungus was identified as Rhizopus oryzae based on the mycological characteristics, molecular data, and pathogenicity testing.

  19. Identification of secreted proteins of Aspergillus oryzae associated with growth on solid cereal substrates

    NARCIS (Netherlands)

    Biesebeke, R. te; Boussier, A.; Biezen, N. van; Hondel, C.A.M.J.J. van den; Punt, P.J.

    2006-01-01

    Filamentous growth of Aspergillus oryzae on solid cereal substrates involves secretion of substrate converting enzymes and a solid substrate specific polarised hyphal growth phenotype. To identify proteins produced under these specific conditions, the extracts of A. oryzae grown on wheat-based media

  20. Comparative Study of Substrates and Inhibitors of Azospirillum lipoferum and Pyricularia oryzae Laccases

    OpenAIRE

    Faure, D.; Bouillant, M.; Bally, R.

    1995-01-01

    Azospirillum lipoferum and Pyricularia oryzae laccases were compared, using several substrates and inhibitors. Sixteen phenolic or nonphenolic compounds were found to be substrates of both fungal and bacterial laccases. In the presence of different phenol oxidase inhibitors, P. oryzae and A. lipoferum laccase activities had similar properties.

  1. Regulation of plant polysaccharide utilisation in Magnaporthe oryzae and other ascomycetous fungi

    NARCIS (Netherlands)

    Klaubauf, S.

    2015-01-01

    Magnaporthe oryzae is a fungal plant pathogen of many grasses including rice. Since arabinoxylan is one of the major components of the plant cell wall of grasses, M. oryzae is likely to degrade this polysaccharide for supporting its growth in infected leaves. D-xylose is released from arabinoxylan b

  2. Characterization of field isolates of Magnaporthe oryzae with mating type, DNA fingerprinting, and pathogenicity assays

    Science.gov (United States)

    Due to the harmful nature of the rice blast fungus, Magnaporthe oryzae, it is beneficial to characterize field isolates to help aid in the deployment of resistance (R) genes in rice. In the present study, 190 field isolates of M. oryzae, collected from rice fields of Yunnan province in China, were a...

  3. Secreted fungal sulfhydryl oxidases: sequence analysis and characterisation of a representative flavin-dependent enzyme from Aspergillus oryzae

    Directory of Open Access Journals (Sweden)

    Faccio Greta

    2010-08-01

    Full Text Available Abstract Background Sulfhydryl oxidases are flavin-dependent enzymes that catalyse the formation of de novo disulfide bonds from free thiol groups, with the reduction of molecular oxygen to hydrogen peroxide. Sulfhydryl oxidases have been investigated in the food industry to remove the burnt flavour of ultraheat-treated milk and are currently studied as potential crosslinking enzymes, aiming at strengthening wheat dough and improving the overall bread quality. Results In the present study, potential sulfhydryl oxidases were identified in the publicly available fungal genome sequences and their sequence characteristics were studied. A representative sulfhydryl oxidase from Aspergillus oryzae, AoSOX1, was expressed in the fungus Trichoderma reesei. AoSOX1 was produced in relatively good yields and was purified and biochemically characterised. The enzyme catalysed the oxidation of thiol-containing compounds like glutathione, D/L-cysteine, beta-mercaptoethanol and DTT. The enzyme had a melting temperature of 57°C, a pH optimum of 7.5 and its enzymatic activity was completely inhibited in the presence of 1 mM ZnSO4. Conclusions Eighteen potentially secreted sulfhydryl oxidases were detected in the publicly available fungal genomes analysed and a novel proline-tryptophan dipeptide in the characteristic motif CXXC, where X is any amino acid, was found. A representative protein, AoSOX1 from A. oryzae, was produced in T. reesei in an active form and had the characteristics of sulfhydryl oxidases. Further testing of the activity on thiol groups within larger peptides and on protein level will be needed to assess the application potential of this enzyme.

  4. Suppression of Rice Blast by Preinoculation with Avirulent Pyricularia oryzae and the Nonrice Pathogen Bipolaris sorokiniana.

    Science.gov (United States)

    Manandhar, H K; Lyngs Jørgensen, H J; Mathur, S B; Smedegaard-Petersen, V

    1998-07-01

    ABSTRACT Avirulent isolates of Pyricularia oryzae and isolates of Bipolaris sorokiniana, a nonrice pathogen, were used to suppress rice blast caused by P. oryzae. In greenhouse experiments, both fungi substantially reduced leaf blast when applied 24 h or more before the pathogen. B. sorokiniana, but not avirulent isolates of P. oryzae, systemically reduced disease in leaf 5 when applied to whole plants at the four-leaf stage. In field experiments, both fungi were able to reduce neck blast significantly. No increase in grain yield was obtained by using avirulent isolates of P. oryzae, whereas five sprays with B. sorokiniana from seedling to heading stages increased the grain yield in two of three experiments conducted at two locations in Nepal. The significant increase in yield was observed under high inoculum pressure of P. oryzae. Induced resistance is suggested to be involved in the suppression of disease. PMID:18944948

  5. Suppression of Rice Blast by Preinoculation with Avirulent Pyricularia oryzae and the Nonrice Pathogen Bipolaris sorokiniana.

    Science.gov (United States)

    Manandhar, H K; Lyngs Jørgensen, H J; Mathur, S B; Smedegaard-Petersen, V

    1998-07-01

    ABSTRACT Avirulent isolates of Pyricularia oryzae and isolates of Bipolaris sorokiniana, a nonrice pathogen, were used to suppress rice blast caused by P. oryzae. In greenhouse experiments, both fungi substantially reduced leaf blast when applied 24 h or more before the pathogen. B. sorokiniana, but not avirulent isolates of P. oryzae, systemically reduced disease in leaf 5 when applied to whole plants at the four-leaf stage. In field experiments, both fungi were able to reduce neck blast significantly. No increase in grain yield was obtained by using avirulent isolates of P. oryzae, whereas five sprays with B. sorokiniana from seedling to heading stages increased the grain yield in two of three experiments conducted at two locations in Nepal. The significant increase in yield was observed under high inoculum pressure of P. oryzae. Induced resistance is suggested to be involved in the suppression of disease.

  6. Identification and toxigenic potential of the industrially important fungi, Aspergillus oryzae and Aspergillus sojae

    DEFF Research Database (Denmark)

    Jørgensen, Thomas R

    2007-01-01

    Mold strains belonging to the species Aspergillus oryzae and Aspergillus sojae are highly valued as koji molds in the traditional preparation of fermented foods, such as miso, sake, and shoyu, and as protein production hosts in modern industrial processes. A. oryzae and A. sojae are relatives....... sojae strains. Separation of A. oryzae and A. sojae from A. flavus and A. parasiticus, respectively, is inconsistent, and both morphologic and molecular evidence support conspecificity. The high degree of identity is reflected by the divergent identification of reference cultures maintained in culture...... collections. As close relatives of aflatoxin-producing wild molds, koji molds possess an aflatoxin gene homolog cluster. Some strains identified as A. oryzae and A. sojae have been implicated in aflatoxin production. Identification of a strain as A. oryzae or A. sojae is no guarantee of its inability...

  7. The Subtelomere of Oryza sativa Chromosome 3 Short Arm as a Hot Bed of New Gene Origination in Rice

    Institute of Scientific and Technical Information of China (English)

    Chuanzhu Fan; Yong Zhang; Yeisoo Yu; Steve Rounsley; Manyuan Long; Rod A.Wing

    2008-01-01

    Despite general observations of non-random genomic distribution of new genes,it is unclear whether or not new genes preferentially occur in certain genomic regions driven by related molecular mechanisms.Using 1.5 Mb of genomic sequences from short arms of chromosome 3 of Oryza glaberrima and O.punctata,we conducted a comparative genomic analysis with the reference O.sativa ssp-japonica genome.We identified a 60-kb segment Iocated in the middle of the subtelomeric region of chromosome 3,which is unique to the species O.sativa.The region contained gene duplicares that occurred in Asian cultivated rice species that diverged from the ancestor of Asian and African cultivated rice one million years ago(MYA).For the 12 genes and one complete retrotransposon identified in this segment in O.sativa ssp.japonica,we searched for their parental genes.The high similarity between duplicated paralogs further supports the recent origination of these genes.We found that this segment was recently generated through multiple independent gene recombination and transposon insertion events.Among the 12 genes,we found that five had chimeric gene structures derived from multiple parental genes.Nine out of the 12 new genes seem to be functional,as suggested by Ka/Ks analysis and the presence of cDNA and/or MPSS data.Furthermore,for the eight transcribed genes,at least two genes could be classified as defense or stress response-related genes.Given these findings,and the fact that subtelomeres are associated with high rates of recombination and transcription,it is likely that subtelomeres may facilitate gene recombination and transposon insertions and serve as hot spots for new gene origination in rice genomes.

  8. NCBI nr-aa BLAST: CBRC-PMAR-01-0384 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0384 ref|YP_200844.1| putative manganese transport protein MntH [Xanthomonas... oryzae pv. oryzae KACC10331] gb|AAW75459.1| manganese transport protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_200844.1 1.7 33% ...

  9. NCBI nr-aa BLAST: CBRC-LAFR-01-0066 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-LAFR-01-0066 ref|YP_201438.1| drug resistance translocase [Xanthomonas oryzae ...pv. oryzae KACC10331] gb|AAW76053.1| drug resistance translocase [Xanthomonas oryzae pv. oryzae KACC10331] YP_201438.1 2.2 31% ...

  10. NCBI nr-aa BLAST: CBRC-TNIG-22-0185 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-22-0185 ref|YP_200844.1| putative manganese transport protein MntH [Xanthomonas... oryzae pv. oryzae KACC10331] gb|AAW75459.1| manganese transport protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_200844.1 0.030 28% ...

  11. NCBI nr-aa BLAST: CBRC-TBEL-01-1996 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-1996 ref|YP_202056.1| hypothetical protein XOO3417 [Xanthomonas oryzae... pv. oryzae KACC10331] gb|AAW76671.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_202056.1 2.5 23% ...

  12. NCBI nr-aa BLAST: CBRC-MEUG-01-2504 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-2504 ref|YP_001915750.1| hypothetical protein PXO_02997 [Xanthomonas o...ryzae pv. oryzae PXO99A] gb|ACD61218.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae PXO99A] YP_001915750.1 0.33 35% ...

  13. NCBI nr-aa BLAST: CBRC-TNIG-22-0185 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-22-0185 ref|YP_451103.1| manganese transport protein [Xanthomonas oryzae ...pv. oryzae MAFF 311018] dbj|BAE68829.1| manganese transport protein [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_451103.1 0.030 28% ...

  14. NCBI nr-aa BLAST: CBRC-DYAK-04-0090 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DYAK-04-0090 ref|YP_451289.1| YapH protein [Xanthomonas oryzae pv. oryzae MAFF... 311018] dbj|BAE69015.1| YapH protein [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_451289.1 0.044 24% ...

  15. NCBI nr-aa BLAST: CBRC-LAFR-01-0180 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-LAFR-01-0180 ref|YP_202918.1| hypothetical protein XOO4279 [Xanthomonas oryzae... pv. oryzae KACC10331] gb|AAW77533.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_202918.1 5.0 37% ...

  16. NCBI nr-aa BLAST: CBRC-BTAU-01-2358 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-2358 ref|YP_200700.1| hypothetical protein XOO2061 [Xanthomonas oryzae... pv. oryzae KACC10331] gb|AAW75315.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_200700.1 2.4 31% ...

  17. NCBI nr-aa BLAST: CBRC-XTRO-01-0645 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-0645 ref|YP_200775.1| hypothetical protein XOO2136 [Xanthomonas oryzae... pv. oryzae KACC10331] gb|AAW75390.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_200775.1 3e-41 40% ...

  18. NCBI nr-aa BLAST: CBRC-ACAR-01-0222 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0222 ref|YP_201677.1| hypothetical protein XOO3038 [Xanthomonas oryzae... pv. oryzae KACC10331] gb|AAW76292.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_201677.1 0.004 27% ...

  19. Characterization and Mapping of a Salt-Sensitive Mutant in Rice (Oryza sativa L.)

    Institute of Scientific and Technical Information of China (English)

    Jingwei Zhou; Fuzheng Wang; Ping Deng; Wen Jing; Wenhua Zhang

    2013-01-01

    A salt-sensitive mutant designated rice salt sensitive 2 (rss2) was isolated from the M2 generation of the rice cultivar Nipponbare (Oryza sativa L.ssp.japonica) mutagenized with ethyl methanesulfonate (EMS).This mutant exhibited a greater decrease in salt tolerance with a significant increase in Na+ content in its shoots.Genetic analysis indicated that the increase in Na+ in rss2 was controlled by a single recessive gene.Further genome-wide analysis of the linkage map constructed from the F2 population of rss2/Zhaiyeqing 8 (ZYQ8) showed that two quantitative trait loci (QTLs) on chromosomes 1 and 6 were responsible for the Na+ concentration in shoots,which explained 14.5% and 53.3%,respectively,of the phenotypic variance.The locus on chromosome 1,but not that on chromosome 6,was also detected in the F2 population of Nipponbare/ZYQ8,suggesting that the QTL on chromosome 6 was responsible for the salt sensitivity in rss2.By analyzing the recombination events in 220 mutant individuals of an enlarged mapping population of rss2/ZYQ8,the rss2 locus was precisely mapped to an interval of 605.3 kb between insertion/deletion (InDel) markers IM21962 and IM22567.This finding will facilitate the cloning of the rss2 locus and provide insight into the physiological mechanisms of salt sensitivity in rice.

  20. A collection of glycosyltransferases from rice (Oryza sativa) exposed to atrazine.

    Science.gov (United States)

    Lu, Yi Chen; Yang, Sheng Ning; Zhang, Jing Jing; Zhang, Jia Jun; Tan, Li Rong; Yang, Hong

    2013-12-01

    The rice (Oryza sativa) GTs belong to a super family possibly with hundreds of members. However, which GTs are involved in plant response to toxic chemicals is unknown. Here, we demonstrated 59 novel GT genes screened from our recent genome-wide sequencing datasets of rice crops exposed to atrazine (a herbicide persistent in ecosystems). Analysis of GT genes showed that most of the GTs contain functional domains typically found in proteins transferring glycosyl moieties to their target compounds. A phylogenetic analysis revealed that many GT genes from different families have diverse cis-elements necessary for response to biotic and environmental stresses. Experimental validation for the GTs was undertaken through a microarray, and 36 GT genes were significantly detected with an expression pattern similar to that from deep-sequencing datasets. Furthermore, 12 GT genes were randomly selected and confirmed by quantitative real-time RT-PCR. Finally, the special activity of total GTs was determined in rice roots and shoots, with an increased activity under the atrazine exposure. This response was closely associated with atrazine absorption in the rice tissues. These results indicate that exposure to atrazine can trigger specific GT genes and enzyme activities in rice.

  1. Sequence analysis of ORF IV RTBV isolated from tungro infected Oryza sativa L. cv Ciherang

    Science.gov (United States)

    Hastilestari, Bernadetta Rina; Astuti, Dwi; Estiati, Amy; Nugroho, Satya

    2015-09-01

    The Effort to increase rice production is often constrained by pest and disease such as Tungro. The Tungro disease is caused by the joint infection with two dissimilar viruses; a bacil-form-DNA virus, the Rice tungro bacilliform virus(RTBV) and the spherical RNA virus, Rice tungro spherical virus (RTSV) and transmitted by Green leafhopper (Nephotettix virescens). The symptom of disease is caused by the presence of RTBV. The genome of RTBV consists of four Open reading frames (ORFs) which encode functional proteins. Of the four, ORF IV is unique because it exists only in RTBV. The most efficient method of generating disease resistance plants is to look for natural sources of resistance genes in wild or germplasm and then transfer the gene and the accompanying resistance in cultivated crop varieties. The aim of this study is, therefore, to isolate and analyze of 1170 bp gene of ORF 4 of Tungro virus isolated from an Indonesian rice cultivar, Ciherang (Oryza sativa L. cv Indica). DNA sequencing analysis using BLAST showed 94% similarity with the reference sequence gen bank Acc.M65026.1. The comparisons and mutation analysis of DNA sequences were discussed in this research.

  2. An improved Agrobacterium-mediated transformation of recalcitrant indica rice (Oryza sativa L.) cultivars.

    Science.gov (United States)

    Shri, Manju; Rai, Arti; Verma, Pankaj Kumar; Misra, Prashant; Dubey, Sonali; Kumar, Smita; Verma, Sikha; Gautam, Neelam; Tripathi, Rudra Deo; Trivedi, Prabodh Kumar; Chakrabarty, Debasis

    2013-04-01

    Agrobacterium-mediated transformation of indica rice varieties has been quite difficult as these are recalcitrant to in vitro responses. In the present study, we established a high-efficiency Agrobacterium tumefaciens-mediated transformation system of rice (Oryza sativa L. ssp. indica) cv. IR-64, Lalat, and IET-4786. Agrobacterium strain EHA-101 harboring binary vector pIG121-Hm, containing a gene encoding for β-glucuronidase (GUS) and hygromycin resistance, was used in the transformation experiments. Manipulation of different concentrations of acetosyringone, days of co-culture period, bacterial suspension of different optical densities (ODs), and the concentrations of L-cysteine in liquid followed by solid co-culture medium was done for establishing the protocol. Among the different co-culture periods, 5 days of co-culture with bacterial cells (OD600 nm = 0.5-0.8) promoted the highest frequency of transformation (83.04 %) in medium containing L-cysteine (400 mg l(-1)). Putative transformed plants were analyzed for the presence of a transgene through genomic PCR and GUS histochemical analyses. Our results also suggest that different cultural conditions and the addition of L-cysteine in the co-culture medium improve the Agrobacterium-mediated transformation frequencies from an average of 12.82 % to 33.33 % in different indica rice cultivars.

  3. Evolutionary Genomics of Weedy Rice in the USA

    Institute of Scientific and Technical Information of China (English)

    Kenneth M. Olsen; Ana L. Caicedo; Yulin Jia

    2007-01-01

    Red rice is an interfertile, weedy form of cultivated rice (Oryza sativa L.) that competes aggressively with the crop in the southern US, reducing yields and contaminating harvests. No wild Oryza species occur in North America and the weed has been proposed to have evolved through multiple mechanisms, including "de-domestication" of US crop cultivars, accidental introduction of Asian weeds, and hybridization between US crops and Asian wild/weedy Oryza strains. The phenotype of US red rice ranges from "crop mimics", which share some domestication traits with the crop, to strains closely resembling Asian wild Oryza species. Assessments of genetic diversity have indicated that many weed strains are closely related to Asian taxa (including indica and aus rice varieties, which have never been cultivated in the US, and the Asian crop progenitor O. rufipogon), whereas others show genetic similarity to the tropical japonlca varieties cultivated in the southern US. Herein, we review what is known about the evolutionary origins and genetic diversity of US red rice and describe an ongoing research project to further characterize the evolutionary genomics of this aggressive weed.

  4. Pemeraman untuk meningkatkan kualitas keju yang diinnokulasi Rhizopus oryzae

    Directory of Open Access Journals (Sweden)

    SOLIKAH ANA ESTIKOMAH

    2010-11-01

    Full Text Available Estikomah SA, Sutarno, Pangastuti A. 2010. Pemeraman untuk meningkatkaan kualitas keju yang diinokulasi Rhizopus oryzae. Bioteknologi 7: 55-62. Keju merupakan makanan hasil fermentasi dari susu yang proses fermentasinya dilakukan oleh bakteri asam laktat maupun jamur. Rhizopus oryzae diketahui mampu menghasilkan asam laktat, protease, dan lipase. Perubahan cita rasa dan tekstur keju terjadi selama pemeraman keju. Tujuan penelitian ini adalah untuk meningkatkan kualitas keju yang diinokulasi R. oryzae melalui pemeraman. Pemeraman dilakukan dengan variasi waktu (7, 14 hari dan suhu (5ºC, 10ºC, 15ºC. Penelitian ini terdiri dua tahap, yaitu pembuataan keju mentah diikuti pemeraman keju mentah tersebut. Keju penelitian dianalisis nilai pH, kadar lemak, kadar protein, kadar asam amino dan diidentifikasi mikrobanya. Data hasil penellitian dianalisis dengan uji siidik ragam (ANAVA, kemudian dilanjutkan dengan uji berjarak ganda Duncan (DMRT pada taraf signifikansi 5%. Data hasil tingkat kesukaan dianalisis dengan statistik nonparametrik uji Fridman yang dilanjutkaan dengan Wilcoxon Signed Rank Test (WSRT pada taraf sigifikansi 5%. Hasil penelitian menunjukkan bahwa keju peram yang disukai panelis adalah keju peram pada suhu 15ºC selama 14 hari. Kondisi pemeraman berpengaruh terhadap nilai pH, kadar lemak,, kadar proteinn dan tidak berpengaruh pada kadar asam amino. Kualitas keju peram terbaik terdapat pada kondisi suhu 15°C selama 14 hari, memiliki nilai pH 4,40, kadar protein tertinggi yaitu sebesar 99,78%, dan kadar lemak sebesar 35,02%. Hasil identifikasi mikroba pada keju mentah dan keju peram meliputi Enterococcus hirae (Enterococcus faecalis, Bacillus subtilis, dan Aspergillus sp.

  5. A comparison of rice chloroplast genomes

    DEFF Research Database (Denmark)

    Tang, Jiabin; Xia, Hong'ai; Cao, Mengliang;

    2004-01-01

    Using high quality sequence reads extracted from our whole genome shotgun repository, we assembled two chloroplast genome sequences from two rice (Oryza sativa) varieties, one from 93-11 (a typical indica variety) and the other from PA64S (an indica-like variety with maternal origin of japonica......), which are both parental varieties of the super-hybrid rice, LYP9. Based on the patterns of high sequence coverage, we partitioned chloroplast sequence variations into two classes, intravarietal and intersubspecific polymorphisms. Intravarietal polymorphisms refer to variations within 93-11 or PA64S...... to intersubspecific polymorphisms. In our study, we found that the intersubspecific variations of 93-11 (indica) and PA64S (japonica) chloroplast genomes consisted of 72 single nucleotide polymorphisms and 27 insertions or deletions. The intersubspecific polymorphism rates between 93-11 and PA64S were 0...

  6. Laboratory Astrophysics Division of the AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  7. Evidence for biotrophic lifestyle and biocontrol potential of dark septate endophyte Harpophora oryzae to rice blast disease.

    Directory of Open Access Journals (Sweden)

    Zhen-Zhu Su

    Full Text Available The mutualism pattern of the dark septate endophyte (DSE Harpophora oryzae in rice roots and its biocontrol potential in rice blast disease caused by Magnaporthe oryzae were investigated. Fluorescent protein-expressing H. oryzae was used to monitor the colonization pattern. Hyphae invaded from the epidermis to the inner cortex, but not into the root stele. Fungal colonization increased with root tissue maturation, showing no colonization in the meristematic zone, slight colonization in the elongation zone, and heavy colonization in the differentiation zone. H. oryzae adopted a biotrophic lifestyle in roots accompanied by programmed cell death. Real-time PCR facilitated the accurate quantification of fungal growth and the respective plant response. The biocontrol potential of H. oryzae was visualized by inoculation with eGFP-tagged M. oryzae in rice. H. oryzae protected rice from M. oryzae root invasion by the accumulation of H2O2 and elevated antioxidative capacity. H. oryzae also induced systemic resistance against rice blast. This systemic resistance was mediated by the OsWRKY45-dependent salicylic acid (SA signaling pathway, as indicated by the strongly upregulated expression of OsWRKY45. The colonization pattern of H. oryzae was consistent with the typical characteristics of DSEs. H. oryzae enhanced local resistance by reactive oxygen species (ROS and high antioxidative level and induced OsWRKY45-dependent SA-mediated systemic resistance against rice blast.

  8. De Novo Transcriptome Sequencing of Oryza officinalis Wall ex Watt to Identify Disease-Resistance Genes

    Directory of Open Access Journals (Sweden)

    Bin He

    2015-12-01

    Full Text Available Oryza officinalis Wall ex Watt is one of the most important wild relatives of cultivated rice and exhibits high resistance to many diseases. It has been used as a source of genes for introgression into cultivated rice. However, there are limited genomic resources and little genetic information publicly reported for this species. To better understand the pathways and factors involved in disease resistance and accelerating the process of rice breeding, we carried out a de novo transcriptome sequencing of O. officinalis. In this research, 137,229 contigs were obtained ranging from 200 to 19,214 bp with an N50 of 2331 bp through de novo assembly of leaves, stems and roots in O. officinalis using an Illumina HiSeq 2000 platform. Based on sequence similarity searches against a non-redundant protein database, a total of 88,249 contigs were annotated with gene descriptions and 75,589 transcripts were further assigned to GO terms. Candidate genes for plant–pathogen interaction and plant hormones regulation pathways involved in disease-resistance were identified. Further analyses of gene expression profiles showed that the majority of genes related to disease resistance were all expressed in the three tissues. In addition, there are two kinds of rice bacterial blight-resistant genes in O. officinalis, including two Xa1 genes and three Xa26 genes. All 2 Xa1 genes showed the highest expression level in stem, whereas one of Xa26 was expressed dominantly in leaf and other 2 Xa26 genes displayed low expression level in all three tissues. This transcriptomic database provides an opportunity for identifying the genes involved in disease-resistance and will provide a basis for studying functional genomics of O. officinalis and genetic improvement of cultivated rice in the future.

  9. Mutation of Oryza sativa CORONATINE INSENSITIVE 1b (OsCOI1b) delays leaf senescence

    Institute of Scientific and Technical Information of China (English)

    Sang-Hwa Lee; Yasuhito Sakuraba; Taeyoung Lee; Kyu-Won Kim; Gynheung An; Han Yong Lee; Nam-Chon Paek

    2015-01-01

    Jasmonic acid (JA) functions in plant development, including senescence and immunity. Arabidopsis thaliana CORONATINE INSENSITIVE 1 encodes a JA receptor and functions in the JA‐responsive signaling pathway. The Arabidopsis genome harbors a single COI gene, but the rice (Oryza sativa) genome harbors three COI homologs, OsCOI1a, OsCOI1b, and OsCOI2. Thus, it remains unclear whether each OsCOI has distinct, additive, synergistic, or redundant func-tions in development. Here, we use the oscoi1b‐1 knockout mutants to show that OsCOI1b mainly affects leaf senescence under senescence‐promoting conditions. oscoi1b‐1 mutants stayed green during dark‐induced and natural senescence, with substantial retention of chlorophylls and photosyn-thetic capacity. Furthermore, several senescence‐associated genes were downregulated in oscoi1b‐1 mutants, including homologs of Arabidopsis thaliana ETHYLENE INSENSITIVE 3 and ORESARA 1, important regulators of leaf senescence. These results suggest that crosstalk between JA signaling and ethylene signaling affects leaf senescence. The Arabidopsis coi1‐1 plants containing 35S:OsCOI1a or 35S:OsCOI1b rescued the delayed leaf senescence during dark incubation, sug-gesting that both OsCOI1a and OsCOI1b are required for promoting leaf senescence in rice. oscoi1b‐1 mutants showed significant decreases in spikelet fertility and grain weight, leading to severe reduction of grain yield, indicating that OsCOI1‐mediated JA signaling affects spikelet fertility and grain filling.

  10. Identification and gene prediction of a 24 kb region containing xa5, a recessive bacterial blight resistance gene in rice (Oryza sativa L.)

    Institute of Scientific and Technical Information of China (English)

    ZHONG Yiming; JIANG Guanghuai; CHEN Xuewei; XIA Zhihui; LI Xiaobing; ZHU Lihuang; ZHAI Wenxue

    2003-01-01

    Rice xa5 gene provides recessive, race-specific resistance to bacterial blight disease caused by the pathogen Xanthomonas oryzae pv. oryzae and has great value for research and breeding. In an effort to clone xa5, an F2 population of 4892 individuals was developed from the xa5 near isogenic lines, IR24 and IRBB5. A fine mapping procedure was conducted and tightly linked RFLP markers were used to screen a BAC library of IRBB56, a resistant rice line containing the xa5 gene. A 213 kb contig covering the xa5 locus was constructed. According to the sequences from the International Rice Genome Sequening Project (IRGSP), the Chinese Superhybrid Rice Genome Project (SRGP) and some sub-clones of the contig, twelve SSLP and CAPS markers were developed for fine mapping. The xa5 gene was mapped to a 0.3 cM interval between markers K5 and T4, which spanned an interval of approximately 24 kb, co-segregating with marker T2. Sequence analysis of the 24 kb region revealed that an ABC transporter and a basal transcription factor (TFIIa) were potential candidates for the xa5 resistance gene product. The molecular mechanism by which the xa5 gene provides recessive, race-specific resistance to bacterial blight will be elucidated by the functional tests of the 24 kb DNA and the candidate genes.

  11. Ricebase: a breeding and genetics platform for rice, integrating individual molecular markers, pedigrees, and whole-genome-based data

    Science.gov (United States)

    Ricebase (http://ricebase.org) is an integrative genomic database for rice (Oryza sativa) with an emphasis on combining data sets in a way that maintains the key links between past and current genetic studies. Ricebase includes DNA sequence data, gene annotations, nucleotide variation data, and mol...

  12. Identification of Intergeneric Hybrid Plants Between Oryza sativa and O. minuta via GISH and RAPD

    Institute of Scientific and Technical Information of China (English)

    YU Shun-wu; CHEN Bao-tang; TAO Ai-lin; ZHANG Duan-pin

    2003-01-01

    To transfer desirable resistance traits from O. minuta to O. sativa, intergeneric hybrid plants between O. sativa (AA, 2n=2X=24) and O. minuta (BBCC, 2n=4X=48) were produced by embryo rescue after sexual cross. Morphological observation and chromosome counts indicated their hybrid status (ABC, 2n =3X=36). Genomic in situ hybridization (GISH) was further applied to confirm the parentage of the chromosomes of F1 hybrids. Chromosomes of O. minuta and O. sativa were distinguishable in the hybrids in different fluorescence colors. GISH indicated that A and BC chromosomes were not randomly assembled in a cell.RAPD profiles unequivocally revealed their hybrids with double parent patterns. The results of blast tests showed that the hybrids had obtained disease resistance from O. minuta, and had a level of susceptibility between the parents.

  13. Genome-wide association study of age at menarche in African-American women

    OpenAIRE

    Demerath, Ellen W; Liu, Ching-Ti; Franceschini, Nora; Chen, Gary; Palmer, Julie R.; Smith, Erin N.; Chen, Christina T. L.; Ambrosone, Christine B.; Arnold, Alice M.; Bandera, Elisa V.; Berenson, Gerald S.; Bernstein, Leslie; Britton, Angela; Cappola, Anne R.; Carlson, Christopher S.

    2013-01-01

    African-American (AA) women have earlier menarche on average than women of European ancestry (EA), and earlier menarche is a risk factor for obesity and type 2 diabetes among other chronic diseases. Identification of common genetic variants associated with age at menarche has a potential value in pointing to the genetic pathways underlying chronic disease risk, yet comprehensive genome-wide studies of age at menarche are lacking for AA women. In this study, we tested the genome-wide associati...

  14. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor.

    Science.gov (United States)

    Pérez, Claudia; Fernandez, Luisa E; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S; Soberón, Mario; Bravo, Alejandra

    2005-12-20

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa binding to Aedes aegypti brush border membrane vesicles enhanced the binding of biotinylated-Cry11Aa. The Cyt1Aa- and Cry11Aa-binding epitopes were mapped by means of the yeast two-hybrid system, peptide arrays, and heterologous competition assays with synthetic peptides. Two exposed regions in Cyt1Aa, loop beta6-alphaE and part of beta7, bind Cry11Aa. On the other side, Cry11Aa binds Cyt1Aa proteins by means of domain II-loop alpha8 and beta-4, which are also involved in midgut receptor interaction. Characterization of single-point mutations in Cry11Aa and Cyt1Aa revealed key Cry11Aa (S259 and E266) and Cyt1Aa (K198, E204 and K225) residues involved in the interaction of both proteins and in synergism. Additionally, a Cyt1Aa loop beta6-alphaE mutant (K198A) with enhanced synergism to Cry11Aa was isolated. Data provided here strongly indicates that Cyt1Aa synergizes or suppresses resistance to Cry11Aa toxin by functioning as a membrane-bound receptor. Bacillus thuringiensis subsp. israelensis is a highly effective pathogenic bacterium because it produces a toxin and also its functional receptor, promoting toxin binding to the target membrane and causing toxicity. PMID:16339907

  15. Toward understanding of rice innate immunity against Magnaporthe oryzae.

    Science.gov (United States)

    Azizi, P; Rafii, M Y; Abdullah, S N A; Nejat, N; Maziah, M; Hanafi, M M; Latif, M A; Sahebi, M

    2016-01-01

    The blast fungus, Magnaporthe oryzae, causes serious disease on a wide variety of grasses including rice, wheat and barley. The recognition of pathogens is an amazing ability of plants including strategies for displacing virulence effectors through the adaption of both conserved and variable pathogen elicitors. The pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-triggered immunity (ETI) were reported as two main innate immune responses in plants, where PTI gives basal resistance and ETI confers durable resistance. The PTI consists of extracellular surface receptors that are able to recognize PAMPs. PAMPs detect microbial features such as fungal chitin that complete a vital function during the organism's life. In contrast, ETI is mediated by intracellular receptor molecules containing nucleotide-binding (NB) and leucine rich repeat (LRR) domains that specifically recognize effector proteins produced by the pathogen. To enhance crop resistance, understanding the host resistance mechanisms against pathogen infection strategies and having a deeper knowledge of innate immunity system are essential. This review summarizes the recent advances on the molecular mechanism of innate immunity systems of rice against M. oryzae. The discussion will be centered on the latest success reported in plant-pathogen interactions and integrated defense responses in rice.

  16. Some studies of alpha-amylase production using Aspergillus oryzae.

    Science.gov (United States)

    Esfahanibolandbalaie, Z; Rostami, K; Mirdamadi, S S

    2008-11-15

    The extracellular alpha-amylase production by Aspergillus oryzae was studied in submerged fermentation using an Adlof-Kuhner orbital shaker. The effect of initial pH values in the range of 4 to 7.5 on enzyme production was investigated and initial pH medium of 6.2 +/- 0.1 resulted in enhanced alpha-amylase production. The effect of carbon and nitrogen source and composition was examined and it has been observed that corn starch concentration of 15 g L(-1) has sound effect on enzyme production. The medium containing corn starch, sodium nitrate resulted in considerable higher enzyme production. Further, the yeast extract of 2.5 g L(-1) in the medium produced higher enzyme in view to other organic nitrogen sources. The effect of temperature on alpha-amylase production from 20 to 40 degrees C has been studied and at 35 +/- 1 degrees C higher alpha-amylase has been obtained. The effect of shaker's speed on alpha-amylase production from 50 to 200 rpm was investigated. And at about 180 rpm higher enzyme production has been observed. In the present study, it has been found that glucose has repressing effect on a-amylase production using A. oryzae PTCC5164. PMID:19260332

  17. WRKY transcription factor genes in wild rice Oryza nivara.

    Science.gov (United States)

    Xu, Hengjian; Watanabe, Kenneth A; Zhang, Liyuan; Shen, Qingxi J

    2016-08-01

    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara. PMID:27345721

  18. Genome-wide transcription analyses in rice using tiling microarrays

    DEFF Research Database (Denmark)

    Li, Lei; Wang, Xiangfeng; Stolc, Viktor;

    2006-01-01

    Sequencing and computational annotation revealed several features, including high gene numbers, unusual composition of the predicted genes and a large number of genes lacking homology to known genes, that distinguish the rice (Oryza sativa) genome from that of other fully sequenced model species....... We report here a full-genome transcription analysis of the indica rice subspecies using high-density oligonucleotide tiling microarrays. Our results provided expression data support for the existence of 35,970 (81.9%) annotated gene models and identified 5,464 unique transcribed intergenic regions...... activity between duplicated segments of the genome. Collectively, our results provide the first whole-genome transcription map useful for further understanding the rice genome. Udgivelsesdato: 2006-Jan...

  19. Chemical rationale for selection of isolates for genome sequencing

    DEFF Research Database (Denmark)

    Rank, Christian; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    The advances in gene sequencing will in the near future enable researchers to affordably acquire the full genomes of handpicked isolates. We here present a method to evaluate the chemical potential of an entire species and select representatives for genome sequencing. The selection criteria for new...... strains to be sequenced can be manifold, but for studying the functional phenotype, using a metabolome based approach offers a cheap and rapid assessment of critical strains to cover the chemical diversity. We have applied this methodology on the complex A. flavus/A. oryzae group. Though these two species...

  20. Uptake of trace elements by rice plants inoculated with Pyricularia oryzae

    Energy Technology Data Exchange (ETDEWEB)

    Ambe, Shizuko E-mail: fsambe@jcom.home.ne.jp; Sekido, Shigeko; Ozaki, Takuo; Yamaguchi, Isamu

    2002-03-01

    The ability of rice plants inoculated with Pyricularia oryzae (P. oryzae ) to take up trace elements was studied by the radioactive multitracer technique. Among various elements, only Mn, Co, Zn, Se, Rb, Sr, Tc, and Re were found to be transferred to rice shoots from soil. The concentrations of essential elements, Mn and Zn, in the shoots of rice plants inoculated with P. oryzae were slightly higher than those in the control plant shoots, while Se, Rb, Tc, and Re showed almost the same concentrations for both the shoots.

  1. Synthesis, characterization, and antibacterial activity of chitosan/TiO2 nanocomposite against Xanthomonas oryzae pv. oryzae.

    Science.gov (United States)

    Li, Bin; Zhang, Yang; Yang, Yingzi; Qiu, Wen; Wang, Xiaoxuan; Liu, Baoping; Wang, Yanli; Sun, Guochang

    2016-11-01

    This present study deals with synthesis, characterization and antibacterial activity of chitosan/TiO2 nanocomposites. Results indicated that chitosan/TiO2 nanocomposite at the ratio of 1:5 showed the strongest inhibition in growth of rice bacterial pathogen Xanthomonas oryzae pv. oryzae (Xoo). Furthermore, the antibacterial activity of chitosan/TiO2 nanocomposite against Xoo is significantly higher than that of the two individual components under both light and dark conditions. Regardless of the presence or absence of extracellular polymeric substances, chitosan/TiO2 nanocomposite showed strong antibacterial activity, however, the absence increased the sensitivity of Xoo to chitosan/TiO2 nanocomposite. In addition, the surface morphology and physicochemical properties of chitosan/TiO2 nanocomposite is different from the two individual components based on scanning electron microscopic observation, fourier transform infrared spectra, and X-ray diffraction pattern, as well as elemental and thermo gravimetric analysis. Overall, this study indicated that this synthesized chitosan/TiO2 nanocomposite is promising to be developed as a new antibacterial material. PMID:27516334

  2. Molecular and pathogenic characterization of new Xanthomonas oryzae pv. oryzae strains from the coastline region of Fangchenggang city in China.

    Science.gov (United States)

    Yang, Shu-Qing; Liu, Shu-Yan; Zhao, Shuai; Yu, Yan-Hua; Li, Rong-Bai; Duan, Cheng-Jie; Tang, Ji-Liang; Feng, Jia-Xun

    2013-04-01

    Virulence assays and DNA polymorphism analyses were used to characterize 33 Xanthomonas oryzae pv. oryzae (Xoo) strains collected from the coastline region of Fangchenggang city in China. Two new pathogenic races (FXP1 and FXP2), were determined by leaf-clipping inoculation of 12 near-isogenic International Rice-Bacterial Blight (IRBB) rice lines, each containing a single resistance gene. Race FXP1 consisted of twenty-eight strains that were incompatible on IRBB5 and IRBB7, while race FXP2 included five strains that were incompatible on IRBB5 and IRBB7 and moderately virulent on IRBB8 containing the xa8 gene. Restriction fragment length polymorphism (RFLP) analysis revealed that each probe of avrXa10 and IS1112 resolved two haplotypes. In a dendrogram generated from the combined RFLP data, the 33 Xoo strains were resolved into two clusters. There was a weak correlation (r = 0.53) between race and haplotype. All of the rice cultivars planted in the coastline region of Fangchenggang city were susceptible to the representative Xoo strains tested above. However, we found that four rice cultivars used as breeding materials in the laboratory could fully resist infection by the Xoo strains, suggesting that the isolated Xoo strains could be used to detect resistant rice cultivars suitable for planting in the local rice field.

  3. The Fd-GOGAT1 mutant gene lc7 confers resistance to Xanthomonas oryzae pv. Oryzae in rice.

    Science.gov (United States)

    Chen, Honglin; Li, Chunrong; Liu, Liping; Zhao, Jiying; Cheng, Xuzhen; Jiang, Guanghuai; Zhai, Wenxue

    2016-01-01

    Disease resistance is an important goal of crop improvement. The molecular mechanism of resistance requires further study. Here, we report the identification of a rice leaf color mutant, lc7, which is defective in chlorophyll synthesis and photosynthesis but confers resistance to Xanthomonas oryzae pv. Oryzae (Xoo). Map-based cloning revealed that lc7 encodes a mutant ferredoxin-dependent glutamate synthase1 (Fd-GOGAT1). Fd-GOGAT1 has been proposed to have great potential for improving nitrogen-use efficiency, but its function in bacterial resistance has not been reported. The lc7 mutant accumulates excessive levels of ROS (reactive oxygen species) in the leaves, causing the leaf color to become yellow after the four-leaf stage. Compared to the wild type, lc7 mutants have a broad-spectrum high resistance to seven Xoo strains. Differentially expressed genes (DEGs) and qRT-PCR analysis indicate that many defense pathways that are involved in this broad-spectrum resistance are activated in the lc7 mutant. These results suggest that Fd-GOGAT1 plays an important role in broad-spectrum bacterial blight resistance, in addition to modulating nitrogen assimilation and chloroplast development. PMID:27211925

  4. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  5. Evolution of an avirulence gene, AVR1-CO39, concomitant with the evolution and differentiation of Magnaporthe oryzae.

    Science.gov (United States)

    Tosa, Yukio; Osue, Jun; Eto, Yukiko; Oh, Hong-Sik; Nakayashiki, Hitoshi; Mayama, Shigeyuki; Leong, Sally A

    2005-11-01

    The significance of AVR1-CO39, an avirulence gene of the blast fungus corresponding to Pi-CO39(t) in rice cultivars, during the evolution and differentiation of the blast fungus was evaluated by studying its function and distribution in Pyricularia spp. When the presence or absence of AVR1-CO39 was plotted on a dendrogram constructed from ribosomal DNA sequences, a perfect parallelism was observed between its distribution and the phylogeny of Pyricularia isolates. AVR1-CO39 homologs were exclusively present in one species, Pyricularia oryzae, suggesting that AVR1-CO39 appeared during the early stage of evolution of P. oryzae. Transformation assays showed that all the cloned homologs tested are functional as an avirulence gene, indicating that selection has maintained their function. Nevertheless, Oryza isolates (isolates virulent on Oryza spp.) in P. oryzae were exceptionally noncarriers of AVR1-CO39. All Oryza isolates suffered from one of the two types of known rearrangements at the Avr1-CO39 locus (i.e., G type and J type). These types were congruous to the two major lineages of Oryza isolates from Japan determined by MGR586 and MAGGY. These results indicate that AVR1-CO39 was lost during the early stage of evolution of the Oryza-specific subgroup of P. oryzae. Interestingly, its corresponding resistance gene, Pi-CO39(t), is not widely distributed in Oryza spp. PMID:16353550

  6. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  7. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  8. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  9. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  10. The effects of various media on sporulation and growth of Pyricularia oryzae Cavara

    Directory of Open Access Journals (Sweden)

    A. N. Ibrahim

    2014-11-01

    Full Text Available The authors have investigated the effect of many media on the development of 10 isolates of Pyricularia oryzae in order to obtain abundant sporulation, to facilitate the determination of physiological races and preparation of phytopathological tested.

  11. A genomic glimpse of aminoacyl-tRNA synthetases in malaria parasite Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    Santoni Daniele

    2009-12-01

    Full Text Available Abstract Background Plasmodium parasites are causative agents of malaria which affects >500 million people and claims ~2 million lives annually. The completion of Plasmodium genome sequencing and availability of PlasmoDB database has provided a platform for systematic study of parasite genome. Aminoacyl-tRNA synthetases (aaRSs are pivotal enzymes for protein translation and other vital cellular processes. We report an extensive analysis of the Plasmodium falciparum genome to identify and classify aaRSs in this organism. Results Using various computational and bioinformatics tools, we have identified 37 aaRSs in P. falciparum. Our key observations are: (i fraction of proteome dedicated to aaRSs in P. falciparum is very high compared to many other organisms; (ii 23 out of 37 Pf-aaRS sequences contain signal peptides possibly directing them to different cellular organelles; (iii expression profiles of Pf-aaRSs vary considerably at various life cycle stages of the parasite; (iv several PfaaRSs posses very unusual domain architectures; (v phylogenetic analyses reveal evolutionary relatedness of several parasite aaRSs to bacterial and plants aaRSs; (vi three dimensional structural modelling has provided insights which could be exploited in inhibitor discovery against parasite aaRSs. Conclusion We have identified 37 Pf-aaRSs based on our bioinformatics analysis. Our data reveal several unique attributes in this protein family. We have annotated all 37 Pf-aaRSs based on predicted localization, phylogenetics, domain architectures and their overall protein expression profiles. The sets of distinct features elaborated in this work will provide a platform for experimental dissection of this family of enzymes, possibly for the discovery of novel drugs against malaria.

  12. Uji Efektivitas Beberapa Rimpang Zingiberceae Terhadap Kumbang Beras (Sitophylus oryzae L.) Di laboratorium

    OpenAIRE

    Parinduri, Muhammad Asmui

    2011-01-01

    Muhammad Asmui Parinduri, Effectiveness Test Against Multiple Zingiberceae Rhizome Weevil Rice (Sitophylus oryzae L.) in the laboratory. This research aims to determine the effectiveness of some zingiberaceae rhizome against Sitophylus oryzae L. on rice in the laboratory. This research was conducted in the laboratory of Plant Pests and Diseases Faculty of Agriculture, University of North Sumatra with elevation of ± 32 m above sea level. This research was conducted from March 2010 to M...

  13. Studies on Aspergillus oryzae Mutants for the Production of Single Cell Proteins from Deoiled Rice Bran

    OpenAIRE

    Ravinder, Rudravaram; Venkateshwar Rao, Linga; Ravindra, Pogaku

    2003-01-01

    Ethyl methyl sulphonate was used to induce point mutation in Aspergillus oryzae (MTCC 1846). Incubation with ethyl methyl sulphonate for 1 h resulted in 98 % killing of spores. By screening the survived colonies three hypermorphs were found (Shan1, Shan2 and Shan3). These three mutants along with the A. oryzae (MTCC 1846) were used for the production of single cell proteins. They grew profusely on deoiled rice bran and produced higher percentage of protein. Among the three mutants Shan2 ha...

  14. Cultivation characteristics of immobilized Aspergillus oryzae for kojic acid production.

    Science.gov (United States)

    Kwak, M Y; Rhee, J S

    1992-04-15

    Aspergillus oryzae in situ grown from spores entrapped in calcium alginate gel beads was used for the production of kojic acid. The immobilized cells in flask cultures produced kojic acid in a linear proportion while maintaining the stable metabolic activity for a prolonged production period. Kojic acid was accumulated up to a high concentration of 83 g/L, at which the kojic acid began to crystallize, and, thus, the culture had to be replaced with fresh media for the next batch culture. The overall productivities of two consecutive cultivations were higher than that of free mycelial fermentation. However, the production rate of kojic acid by the immobilized cells was suddenly decreased with the appearance of central cavernae inside the immobilized gel beads after 12 days of the third batch cultivation. PMID:18601027

  15. Oxygen dynamics in submerged rice (Oryza sativa L.)

    DEFF Research Database (Denmark)

    Colmer, Timothy D.; Pedersen, Ole

    2008-01-01

    Complete submergence of plants prevents direct O2 and CO2 exchange with air. Underwater photosynthesis can result in marked diurnal changes in O2 supply to submerged plants. Dynamics in pO2 had not been measured directly for submerged rice (Oryza sativa), but in an earlier study, radial O2 loss...... from roots showed an initial peak following shoot illumination.  O2 dynamics in shoots and roots of submerged rice were monitored during light and dark periods, using O2 microelectrodes. Tissue sugar concentrations were also measured.  On illumination of shoots of submerged rice, pO2 increased rapidly...... of magnitude higher than in darkness, enhancing also pO2 in roots.The initial peak in pO2 following illumination of submerged rice was likely to result from high initial rates of net photosynthesis, fuelled by CO2 accumulated during the dark period. Nevertheless, since sugars decline with time in submerged...

  16. Monoolein production by triglycerides hydrolysis using immobilized Rhizopus oryzae lipase.

    Science.gov (United States)

    Ghattas, Nesrine; Abidi, Ferid; Galai, Said; Marzouki, M Nejib; Salah, Abderraouf Ben

    2014-07-01

    Lipase extracted from Rhizopus oryzae was immobilized in alginate gel beads. The effects of the immobilization conditions, such as, alginate concentration, CaCl2 concentration and amount of initial enzyme on retained activity (specific activity ratio of entrapped active lipase to free lipase) were investigated. The optimal conditions for lipase entrapment were determined: 2% (w/v) alginate concentration, 100mM CaCl2 and enzyme ratio of 2000IU/mL.In such conditions, immobilized lipase by inclusion in alginate showed a highest stability and activity, on olive oil hydrolysis reaction where it could be reused for 10 cycles. After 15min of hydrolysis reaction, the mass composition of monoolein, diolein and triolein were about 78%, 10% and 12%. Hydrolysis' products purification by column chromatography lead to a successful separation of reaction compounds and provide a pure fraction of monoolein which is considered as the widest used emulsifier in food and pharmaceutical industries. PMID:24755261

  17. Monoolein production by triglycerides hydrolysis using immobilized Rhizopus oryzae lipase.

    Science.gov (United States)

    Ghattas, Nesrine; Abidi, Ferid; Galai, Said; Marzouki, M Nejib; Salah, Abderraouf Ben

    2014-07-01

    Lipase extracted from Rhizopus oryzae was immobilized in alginate gel beads. The effects of the immobilization conditions, such as, alginate concentration, CaCl2 concentration and amount of initial enzyme on retained activity (specific activity ratio of entrapped active lipase to free lipase) were investigated. The optimal conditions for lipase entrapment were determined: 2% (w/v) alginate concentration, 100mM CaCl2 and enzyme ratio of 2000IU/mL.In such conditions, immobilized lipase by inclusion in alginate showed a highest stability and activity, on olive oil hydrolysis reaction where it could be reused for 10 cycles. After 15min of hydrolysis reaction, the mass composition of monoolein, diolein and triolein were about 78%, 10% and 12%. Hydrolysis' products purification by column chromatography lead to a successful separation of reaction compounds and provide a pure fraction of monoolein which is considered as the widest used emulsifier in food and pharmaceutical industries.

  18. EFFECT OF CHEMICAL SEED TREATMENT IN THE CONTROL OF BLAST DISEASE AND BROWN SPOT OF RICE EFEITO DO TRATAMENTO QUÍMICO DE SEMENTES NO CONTROLE DE BRUSONE (Pyricularia oryzae) E MANCHA PARDA (Helminthosporium oryzae) DO ARROZ

    OpenAIRE

    Valácia Lemes da Silva; Wilson Ferreira de Oliveira; Meire Aparecida Damaceno

    2007-01-01

    With the objective of controlling blast disease (Pyricularia oryzae) and brown spot (Helminthosporium oryzae) of rice (Oryza sativa), different fungicides were tested, through seeds treatment, at field culture in low land soil. The results showed, preliminarily and in general terms that fungicides dichlofluanid and terbuconazole propitiated in the stand increase superior to 30% when confronted with standard fungici...

  19. EFICIÊNCIA DE FUNGICIDAS NO CONTROLE DE MANCHA PARDA (Bipolaris oryzae EM ARROZ (Oryza sativa EFFICIENCY OF FUNGICIDES IN THE CONTROL OF RICE (Oryza sativa BROWN SPOT (Bipolaris oryzae

    Directory of Open Access Journals (Sweden)

    Eric Guicherit

    2007-09-01

    Full Text Available

    Em situações nas quais a brusone tem pouca importância na sanidade da lavoura de arroz, o controle da mancha parda (Bipolaris Oryzõe pode mostrar-se altamente eficiente com pulverizações de fungicidas no campo. Assim, realizou-se um experimento em Indiara (GO com o objetivo de comparar a eficácia de diferentes produtos fungicidas no controle da mancha parda em condições pouco favoráveis à brusone. Foram comparados difenoconazole, propiconazole e tryfloxystrobin em diferentes combinações e dosagens, e os resultados mostraram que, em situações nas quais a brusone tem pouca importância na sanidade da lavoura do arroz, o controle da mancha parda pode mostrar-se altamente eficiente com pulverizações de fungicidas no campo.

    PALAVRAS-CHAVE: Helminthosporium oryzae; controle químico; patógeno; doença.

    In situations where the blight (Pyricularia grisea is not limiting the rice crop, the brown spot (Bipolaris oryzae control can be extremely efficient with field sprayings. This experiment was conduced in Indiara (GO aiming to compare the efficiency of different fungicides in one or two dosages in the control of brown spot under low blight conditions. All treatments showed efficiency in the control of brown spot, with no signifficant difference among them.

    KEY-WORDS: Chemical control; pathogens; disease.

  20. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  1. Linoleic and linolenic acids analysis of soybean tofu with Rhizopus oryzae and Rhizopus oligosporus as coagulant

    Directory of Open Access Journals (Sweden)

    SUPYANI

    2009-07-01

    Full Text Available Sudaryatiningsih C, Supyani. 2009. Linoleic and linolenic acids analysis of soybean tofu with Rhizopus oryzae and Rhizopus oligosporus as coagulant. Nusantara Bioscience 1: 110-116. The aims of this research are to know the potency of Rhizopus oligosporus and Rhizopus oryzae as a coagulant in tofu processing for increasing the amount of linoleic and linolenic acids, and to know the time that needed by R. oligosporus and R. oryzae for increasing the amount of linoleic and linolenic acids. It uses PDA for inoculating fungi, and it is done at Sub-Lab Chemistry, Central Laboratory for Mathematics and Natural Sciences, Sebelas Maret University, Surakarta. The tofu making was done in “Dele Emas” Tofu Factory, Surakarta. Analysis of linoleic and linolenic acids were done by Gas Chromatography, in LPPT-UGM Yogyakarta. The conclusion of this research are R. oligosporus dan R. oryzae having a potency as a coagulant in tofu processing for increasing the amount of linoleic and linolenic acids. R. oryzae needs 18 hours to coagulate the tofu, and R. oligosporus needs 12 hours for the same process. The highest amount of linoleic and linolenic acids were obtained by R. oryzae at 6 hours of fermentation (0.26% and 0.14%, and 24 hours of fermentation by R. oligosporus (0.06% and 0.04%.

  2. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  3. The Xanthomonas oryzae pv. oryzae PilZ Domain Proteins Function Differentially in Cyclic di-GMP Binding and Regulation of Virulence and Motility.

    Science.gov (United States)

    Yang, Fenghuan; Tian, Fang; Chen, Huamin; Hutchins, William; Yang, Ching-Hong; He, Chenyang

    2015-07-01

    The PilZ domain proteins have been demonstrated to be one of the major types of receptors mediating cyclic di-GMP (c-di-GMP) signaling pathways in several pathogenic bacteria. However, little is known about the function of PilZ domain proteins in c-di-GMP regulation of virulence in the bacterial blight pathogen of rice Xanthomonas oryzae pv. oryzae. Here, the roles of PilZ domain proteins PXO_00049 and PXO_02374 in c-di-GMP binding, regulation of virulence and motility, and subcellular localization were characterized in comparison with PXO_02715, identified previously as an interactor with the c-di-GMP receptor Filp to regulate virulence. The c-di-GMP binding motifs in the PilZ domains were conserved in PXO_00049 and PXO_02374 but were less well conserved in PXO_02715. PXO_00049 and PXO_02374 but not PXO_02715 proteins bound to c-di-GMP with high affinity in vitro, and the R(141) and R(10) residues in the PilZ domains of PXO_00049 and PXO_02374, respectively, were crucial for c-di-GMP binding. Gene deletion of PXO_00049 and PXO_02374 resulted in significant increases in virulence and hrp gene transcription, indicating their negative regulation of virulence via type III secretion system expression. All mutants showed significant changes in sliding motility but not exopolysaccharide production and biofilm formation. In trans expression of the full-length open reading frame (ORF) of each gene in the relevant mutants led to restoration of the phenotype to wild-type levels. Moreover, PXO_00049 and PXO_02374 displayed mainly multisite subcellular localizations, whereas PXO_02715 showed nonpolar distributions in the X. oryzae pv. oryzae cells. Therefore, this study demonstrated the different functions of the PilZ domain proteins in mediation of c-di-GMP regulation of virulence and motility in X. oryzae pv. oryzae.

  4. Small-Scale Duplications Play a Significant Role in Rice Genome Evolution

    Institute of Scientific and Technical Information of China (English)

    GUO Xin-yi; XU Guo-hua; ZHANG Yang; HU Wei-min; FAN Long-jiang

    2005-01-01

    Genes are continually being created by the processes of genome duplication (ohnolog) and gene duplication (paralog)Whole-genome duplications have been found to be widespread in plant species and play an important role in plant evolution. Clearly un-overlapping duplicated blocks of whole-genome duplications can be detected in the genome of sequenced rice (Oryza sativa).Syntenic ohnolog pairs (ohnologues) of the whole-genome duplications in rice were identified based on their syntenic duplicate lines.The paralogs of ohnologues were further scanned using multi-round reciprocal BLAST best-hit searching (E<e-14). The results indicated that an average of 0.55 sister paralogs could be found for every ohnologue in rice. These results suggest that small-scale duplications, as well as whole-genome duplications, play a significant role in the two duplicated rice genomes.

  5. Molecular Evolution of the TAC1 Gene from Rice (Oryza sativa L.)

    Institute of Scientific and Technical Information of China (English)

    Jiahuan Jiang; Lubin Tan; Zuofeng Zhu; Yongcai Fu; Fengxia Liu; Hongwei Cai; Chuanqing Sun

    2012-01-01

    Tiller angle is a key feature of the architecture of cultivated rice (Oryza sativa),since it determines planting density and influences rice yield.Our previous work identified Tiller Angle Control 1 (TAC1) as a major quantitative trait locus that controls rice tiller angle.To further clarify the evolutionary characterization of the TAC1 gene,we compared a TAC1-containing 3164-bp genomic region among 113 cultivated varieties and 48 accessions of wild rice,including 43 accessions of O.rufipogon and five accessions of O.nivara.Only one single nucleotide polymorphism (SNP),a synonymous substitution,was detected in TAC1 coding regions of the cultivated rice varieties,whereas one synonymous and one nonsynonymous SNP were detected among the TAC1 coding regions of wild rice accessions.These data indicate that little natural mutation and modification in the TAC1 coding region occurred within the cultivated rice and its progenitor during evolution.Nucleotide diversities in the TAC1 gene regions of O.sativa and O.rufipogon of 0.00116 and 0.00112,respectively,further indicate that TAC1 has been highly conserved during the course of rice domestication.A functional nucleotide polymorphism (FNP) of TAC1 was only found in the japonica rice group.A neutrality test revealed strong selection,especially in the 3'-flanking region of the TAC1 coding region containing the FNP in the japonica rice group.However,no selection occurred in the indica and wild-rice groups.A phylogenetic tree derived from TAC1 sequence analysis suggests that the indica and japonica subspecies arose independently during the domestication of wild rice.

  6. A novel manganese efflux system, YebN, is required for virulence by Xanthomonas oryzae pv. oryzae.

    Directory of Open Access Journals (Sweden)

    Chunxia Li

    Full Text Available Manganese ions (Mn(2+ play a crucial role in virulence and protection against oxidative stress in bacterial pathogens. Such pathogens appear to have evolved complex mechanisms for regulating Mn(2+ uptake and efflux. Despite numerous studies on Mn(2+ uptake, however, only one efflux system has been identified to date. Here, we report on a novel Mn(2+ export system, YebN, in Xanthomonas oryzae pv. oryzae (Xoo, the causative agent of bacterial leaf blight. Compared with wild-type PXO99, the yebN mutant was highly sensitive to Mn(2+ and accumulated high concentrations of intracellular manganese. In addition, we found that expression of yebN was positively regulated by Mn(2+ and the Mn(2+-dependent transcription regulator, MntR. Interestingly, the yebN mutant was more tolerant to methyl viologen and H(2O(2 in low Mn(2+ medium than PXO99, but more sensitive in high Mn(2+ medium, implying that YebN plays an important role in Mn(2+ homoeostasis and detoxification of reactive oxygen species (ROS. Notably, deletion of yebN rendered Xoo sensitive to hypo-osmotic shock, suggesting that YebN may protect against such stress. That mutation of yebN substantially reduced the Xoo growth rate and lesion formation in rice implies that YebN could be involved in Xoo fitness in host. Although YebN has two DUF204 domains, it lacks homology to any known metal transporter. Hence, this is the first report of a novel metal export system that plays essential roles in hypo-osmotic and oxidative stress, and virulence. Our results lay the foundations for elucidating the complex and fascinating relationship between metal homeostasis and host-pathogen interactions.

  7. Identification of an avirulence gene,avrxa5,from the rice pathogen Xanthomonas oryzae pv.oryzae

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Xanthomonas oryzae pv.oryzae,the causal agent of bacterial blight in rice,interacts with rice plants in a gene-for-gene manner.The specificity of the interaction is dictated by avirulence(avr) genes in the pathogen and resistance(R) genes in the host.To date,no avr genes that correspond to recessive R genes have been isolated.We isolated an avrBs3/pthA family gene,avrxa5,from our previously isolated clone p58,which was originally from strain JXOIII.The avrxa5 gene converted the PXO99A strain from compatible to incompatible in rice cultivars containing the recessive xa5 gene,but not in those containing the dominant Xa5 gene.Sequencing indicated that avrxa5,which is highly similar to members of the avrBs3/pthA family,encodes a protein of 1238 amino acid residues with a conserved carboxy-terminal region containing three nuclear localization signals and a transcription activation domain.It has 19.5 34-amino-acid direct repeats,but the 13th amino acid is missing in the fifth and ninth repetitive units.Domain swapping of the repetitive regions between avrxa5 and avrXa7 changed the avirulence specificity of the genes in xa5 and Xa7 rice lines,respectively.This indicates that avrxa5 is distinct from previously characterized avrBs3/pthA members.The specificity of avrxa5 toward recessive xa5 in rice could help us better understand the molecular mechanisms of plant-pathogen specific interactions.

  8. Endogenous florendoviruses are major components of plant genomes and hallmarks of virus evolution

    OpenAIRE

    Maumus, Florian; Copetti, Dario; Choisne, Nathalie; Zwickl, Derrick J; Zytnicki, Matthias; McTaggart, Alistair R.; Scalabrin, Simone; Vezzulli, Silvia; Wing, Rod A.; Quesneville, Hadi; Teycheney, Pierre-Yves

    2014-01-01

    The extent and importance of endogenous viral elements have been extensively described in animals but are much less well understood in plants. Here we describe a new genus of Caulimoviridae called ‘Florendovirus’, members of which have colonized the genomes of a large diversity of flowering plants, sometimes at very high copy numbers (>0.5% total genome content). The genome invasion of Oryza is dated to over 1.8 million years ago (MYA) but phylogeographic evidence points to an even older age ...

  9. Evaluation of commercial soy sauce koji strains of Aspergillus oryzae for γ-aminobutyric acid (GABA) production.

    Science.gov (United States)

    Ab Kadir, Safuan; Wan-Mohtar, Wan Abd Al Qadr Imad; Mohammad, Rosfarizan; Abdul Halim Lim, Sarina; Sabo Mohammed, Abdulkarim; Saari, Nazamid

    2016-10-01

    In this study, four selected commercial strains of Aspergillus oryzae were collected from soy sauce koji. These A. oryzae strains designated as NSK, NSZ, NSJ and NST shared similar morphological characteristics with the reference strain (A. oryzae FRR 1675) which confirmed them as A. oryzae species. They were further evaluated for their ability to produce γ-aminobutyric acid (GABA) by cultivating the spore suspension in a broth medium containing 0.4 % (w/v) of glutamic acid as a substrate for GABA production. The results showed that these strains were capable of producing GABA; however, the concentrations differed significantly (P soy sauce production. PMID:27541157

  10. Use of the Aspergillus oryzae actin gene promoter in a novel reporter system for exploring antifungal compounds and their target genes.

    Science.gov (United States)

    Marui, Junichiro; Yoshimi, Akira; Hagiwara, Daisuke; Fujii-Watanabe, Yoshimi; Oda, Ken; Koike, Hideaki; Tamano, Koichi; Ishii, Tomoko; Sano, Motoaki; Machida, Masayuki; Abe, Keietsu

    2010-08-01

    Demand for novel antifungal drugs for medical and agricultural uses has been increasing because of the diversity of pathogenic fungi and the emergence of drug-resistant strains. Genomic resources for various living species, including pathogenic fungi, can be utilized to develop novel and effective antifungal compounds. We used Aspergillus oryzae as a model to construct a reporter system for exploring novel antifungal compounds and their target genes. The comprehensive gene expression analysis showed that the actin-encoding actB gene was transcriptionally highly induced by benomyl treatment. We therefore used the actB gene to construct a novel reporter system for monitoring responses to cytoskeletal stress in A. oryzae by introducing the actB promoter::EGFP fusion gene. Distinct fluorescence was observed in the reporter strain with minimum background noise in response to not only benomyl but also compounds inhibiting lipid metabolism that is closely related to cell membrane integrity. The fluorescent responses indicated that the reporter strain can be used to screen for lead compounds affecting fungal microtubule and cell membrane integrity, both of which are attractive antifungal targets. Furthermore, the reporter strain was shown to be technically applicable for identifying novel target genes of antifungal drugs triggering perturbation of fungal microtubules or membrane integrity.

  11. Further increased production of free fatty acids by overexpressing a predicted transketolase gene of the pentose phosphate pathway in Aspergillus oryzae faaA disruptant.

    Science.gov (United States)

    Tamano, Koichi; Miura, Ai

    2016-09-01

    Free fatty acids are useful as source materials for the production of biodiesel fuel and various chemicals such as pharmaceuticals and dietary supplements. Previously, we attained a 9.2-fold increase in free fatty acid productivity by disrupting a predicted acyl-CoA synthetase gene (faaA, AO090011000642) in Aspergillus oryzae. In this study, we achieved further increase in the productivity by overexpressing a predicted transketolase gene of the pentose phosphate pathway in the faaA disruptant. The A. oryzae genome is predicted to have three transketolase genes and overexpression of AO090023000345, one of the three genes, resulted in phenotypic change and further increase (corresponding to an increased production of 0.38 mmol/g dry cell weight) in free fatty acids at 1.4-fold compared to the faaA disruptant. Additionally, the biomass of hyphae increased at 1.2-fold by the overexpression. As a result, free fatty acid production yield per liter of liquid culture increased at 1.7-fold by the overexpression.

  12. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  13. Complete Genome Sequence of Bacillus velezensis CBMB205, a Phosphate-Solubilizing Bacterium Isolated from the Rhizoplane of Rice in the Republic of Korea

    Science.gov (United States)

    Hwangbo, Kyeong; Um, Yurry; Kim, Ki Yoon; Madhaiyan, Munusamy; Sa, Tong Min

    2016-01-01

    Bacillus velezensis CBMB205 (= KACC 13105T = NCCB 100236T) was isolated from the rhizoplane of rice (Oryza sativa L. cv. O-dae). According to previous studies, this bacterium has several genes that can promote plant growth, such as the phosphorus-solubilizing protein-coding gene. Here, we present the first complete genome of B. velezensis CBMB205. PMID:27417835

  14. Rice-Map: a new-generation rice genome browser

    Directory of Open Access Journals (Sweden)

    Luo Jingchu

    2011-03-01

    Full Text Available Abstract Background The concurrent release of rice genome sequences for two subspecies (Oryza sativa L. ssp. japonica and Oryza sativa L. ssp. indica facilitates rice studies at the whole genome level. Since the advent of high-throughput analysis, huge amounts of functional genomics data have been delivered rapidly, making an integrated online genome browser indispensable for scientists to visualize and analyze these data. Based on next-generation web technologies and high-throughput experimental data, we have developed Rice-Map, a novel genome browser for researchers to navigate, analyze and annotate rice genome interactively. Description More than one hundred annotation tracks (81 for japonica and 82 for indica have been compiled and loaded into Rice-Map. These pre-computed annotations cover gene models, transcript evidences, expression profiling, epigenetic modifications, inter-species and intra-species homologies, genetic markers and other genomic features. In addition to these pre-computed tracks, registered users can interactively add comments and research notes to Rice-Map as User-Defined Annotation entries. By smoothly scrolling, dragging and zooming, users can browse various genomic features simultaneously at multiple scales. On-the-fly analysis for selected entries could be performed through dedicated bioinformatic analysis platforms such as WebLab and Galaxy. Furthermore, a BioMart-powered data warehouse "Rice Mart" is offered for advanced users to fetch bulk datasets based on complex criteria. Conclusions Rice-Map delivers abundant up-to-date japonica and indica annotations, providing a valuable resource for both computational and bench biologists. Rice-Map is publicly accessible at http://www.ricemap.org/, with all data available for free downloading.

  15. First circulating beam in the AA

    CERN Multimedia

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  16. Loss of a 1.6 Mb chromosome in Pyricularia oryzae harboring two alleles of AvrPik leads to acquisition of virulence to rice cultivars containing resistance alleles at the Pik locus.

    Science.gov (United States)

    Kusaba, Motoaki; Mochida, Taiga; Naridomi, Takeshi; Fujita, Yoshikatsu; Chuma, Izumi; Tosa, Yukio

    2014-11-01

    A small and extra chromosome of 1.6 Mb was previously identified in a Pyricularia oryzae strain, 84R-62B. To understand a role of the 1.6 Mb chromosome in the pathogenic changeability of P. oryzae, we performed experiments designed to characterize the 1.6 Mb chromosome in the present study. A gene family encoding secreted protein Pex31s in P. oryzae consists of five homologs, Pex31-A to -E. Among them, Pex31-A and -D are known to be recognized by Pik-m and Pik/Pik-m/Pik-p, respectively. In the present study, we identified Pex31-A and -D in the genome of 84R-62B. Segregation analyses using an F1 population between 84R-62B and another rice blast strain, Y93-245c-2, revealed a strong linkage between the two homologs and the 1.6 Mb chromosome of 84R-62B. A CHEF-Southern analysis revealed an association between the 1.6 Mb chromosome and the homologs, indicating that both homologs are located on the 1.6 Mb chromosome of 84R-62B. The loss of the 1.6 Mb chromosome was observed in subcultures of a F1 progeny, F1-327. These subcultures concomitantly acquired virulence on Pik, Pik-m, and Pik-p. The present study is the first report showing that loss of a small and extra chromosome leads to pathogenic mutation of P. oryzae and may provide a new insight into the mechanisms generating pathogenic variation of this fungus. PMID:25056242

  17. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    NARCIS (Netherlands)

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    2000-01-01

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg e

  18. Limitations to photosynthesis in leaves of wheat plants infected by Pyricularia oryzae.

    Science.gov (United States)

    Debona, Daniel; Rodrigues, Fabrício Ávila; Rios, Jonas Alberto; Martins, Samuel Cordeiro Vitor; Pereira, Lucas Felisberto; DaMatta, Fábio Murilo

    2014-01-01

    Blast, caused by Pyricularia oryzae, has become an economically important disease in wheat in Brazil, but little effort has been devoted to understanding the wheat-P. oryzae interaction. This study was intended to determine the effects of P. oryzae infection on the photosynthetic process in wheat plants using a susceptible (BR 18) and a partially resistant cultivar (BRS 229). It was found that the net carbon assimilation rate (A), stomatal conductance (gs), and transpiration rate were dramatically reduced in both cultivars due to P. oryzae infection but to a lesser degree in BRS 229. Photosynthesis was impaired in asymptomatic leaf tissues, indicating that blast severity is not an acceptable indicator for predicting P. oryzae-induced reductions in A. The proportionally larger decreases in A than in gs, in parallel with increases in internal CO2 concentration (Ci), suggest that the lower influx of CO2 into the diseased leaves caused by stomatal closure was not a prominent factor associated with the reduction in A. Additional support for this conclusion comes from the nonsignificant correlation between A and gs, the negative correlation between A and Ci and the positive correlation between blast severity and Ci. Both the maximum rate of carboxylation and the maximum rate of electron transport were dramatically depressed at advanced stages of P. oryzae infection, mainly in BR 18, although the reduction in A was not closely related to the decrease in the electron transport rate. In conclusion, biochemical limitations likely related to the reduced activity of Rubisco, rather than diffusive limitations, were the main factor associated with decreases in A during the infection process of P. oryzae on wheat leaves. PMID:23901830

  19. [A novel method of the genome-wide prediction for the target genes and its application].

    Science.gov (United States)

    Zhang, Jing-Jing; Feng, Jing; Zhu, Ying-Guo; Li, Yang-Sheng

    2006-10-01

    Based on the protein databases of several model species, this study developed a new method of the Genome-wide prediction for the target genes, using Hidden Markov model by Perl programming. The advantages of this method are high throughput, high quality and easy prediction, especially in the case of multi-domains proteins families. By this method, we predicted the PPR and TPR proteins families in whole genome of several model species. There were 536 PPR proteins and 199 TPR proteins in Oryza sativa ssp. japonica, 519 PPR proteins and 177 TPR proteins in Oryza sativa L. ssp. indica, 735 PPR proteins and 292 TPR proteins in Arabidopsis thaliana, 6 PPR proteins and 32 TPR proteins in Cyanidioschyzon merolae. Synechococcus and Thermophilic archaebacterium did not have PPR proteins. By contrast, 10 TPR proteins were found in Synechococcus and 4 TPR proteins were found in Thermophilic archaebacterium. Moreover, of these results, some further bioinformatics analyses were conducted.

  20. Friction Stir Weldabilities of AA1050-H24 and AA6061-T6 Aluminum Alloys

    Institute of Scientific and Technical Information of China (English)

    Huijie LIU; Hidetoshi FUJIN; Masakatsu MAEDA; Kiyoshi NOGI

    2005-01-01

    The friction stir weldabilities of the strain-hardened AA1050-H24 and precipitate-hardened AA6061-T6 aluminum alloys were examined to reveal the effects of material properties on the friction stir welding behavior. The experimental results are obtlained. (1) For AA1050-H24, the weld can possess smoother surface ripples; there is no elliptical weld nugget in the weld; there is no discernible interface between the stir zone and the thermomechanically affected zone;and the internal defect of the weld looks like a long crack and is located in the lower part of the weld. (2) For AA6061-T6, the weld usually possesses slightly rougher surface ripples; an elliptical weld nugget clearly exists in the weld; there are discernible interfaces among the weld nugget, thermomechanically affected zone and heat affected zone; and the internal defect of the weld is similar to that of the AA1050-H24 weld. (3) The effective range of welding parameters for AA1050-H24 is narrow, while the one for AA6061-T6 is very wide. (4) The maximum tensile strength efficiency of the AA1050-H24 joints is similar to that of the AA6061-T6 joints, i.e. 79% and 77%, respectively.

  1. Development of Oryza rufipogon and O. sativa Introgression Lines and Assessment for Yield-related Quantitative Trait Loci

    Institute of Scientific and Technical Information of China (English)

    Lubin Tan; Fengxia Liu; Wei Xue; Guijuan Wang; Sheng Ye; Zuofeng Zhu; Yongcai Fu; Xiangkun Wang; Chuanqing Sun

    2007-01-01

    Introgression lines population was effectively used in mapping quantitative trait loci (QTLs), identifying favorable genes, discovering hidden genetic variation, evaluating the action or interaction of QTLs in multiple conditions and providing the favorable experimental materials for plant breeding and genetic research. In this study, an advanced backcross and consecutive selfing strategy was used to develop introgression lines (ILs), which derived from an accession of Oryza rufipogon Griff, collected from Yuanjiang County, Yunnan Province of China, as the donor, and an elite indica cultivar Teqing (O. sativa L.), as the recipient. Introgression segments from O. rufipogon were screened using 179 polymorphic simple sequence repeats (SSR) markers in the genome of each IL. Introgressed segments carried by the introgression lines population contained 120 ILs covering the whole O. rufipogon genome. The mean number of homozygous O. rufipogon segments per introgression line was about 3.88. The average length of introgressed segments was approximate 25.5 cM, and about 20.8% of these segments had sizes less than 10 cM. The genome of each IL harbored the chromosomal fragments of O. rufipogon ranging from 0.54% to 23.7%, with an overall average of 5.79%. At each locus, the ratio of substitution of O. rufipogon alleles had a range of 1.67-9.33, with an average of 5.50. A wide range of alterations in morphological and yield-related traits were also found in the introgression lines population. Using single-point analysis, a total of 37 putative QTLs for yield and yield components were detected at two sites with 7%-20% explaining the phenotypic variance. Nineteen QTLs (51.4%) were detected at both sites, and the alleles from O. rufipogon at fifteen loci (40.5%) improved the yield and yield components in the Teqing background. These O. rufipogon-O. sativa introgression lines will serve as genetic materials for identifying and using favorable genes from common wild rice.

  2. The power of alternative assessments (AAs)

    Institute of Scientific and Technical Information of China (English)

    张千茜

    2013-01-01

    This article starts by discussing the potential disadvantages of traditional assessment towards young English as a Second Language (ESL) learners within the American public school education system. In response to such disadvantages, researchers ’call for the implementation of alternative assessments (AAs) is therefore introduced along with the various benefits of AAs. However, the current mainstream education policy in the US, namely No Child Left Behind (NCLB) Policy, is still largely based on the tra-ditional ways of testing, making policy-oriented implementation of AAs on large scales remarkably difficult. After careful analysis, the author points out several implications concerning how, under such an existing policy of NCLB, can practitioners effectively accommodate young ESL learners by applying the power of AAs.

  3. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  4. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  5. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  6. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  7. Dicty_cDB: FC-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  8. Dicty_cDB: FC-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  9. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  10. Dicty_cDB: FC-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  11. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  12. Dicty_cDB: FC-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  13. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  14. Dicty_cDB: FC-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA23 (Link to dictyBase) - - - Contig-U16090-1 FC-AA23E (Li...nk to Original site) - - - - - - FC-AA23E 387 Show FC-AA23 Library FC (Link to library) Clone ID FC-AA23 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA23Q.Seq.d/ Representative seq. ID FC-AA...23E (Link to Original site) Representative DNA sequence >FC-AA23 (FC-AA23Q) /CSM/FC/FC-AA/FC-AA23Q.Seq.d/ AAACTCGATTATATTCTTAA...TCTTAAAGTTCAAGATTTCATGGAAAGACGTCTCCAAACT TTAGTCTTCAAAAATGGTCTTGCCAAATCAATCCATCACGCTCGTGTTTTAATCAAA

  15. Dicty_cDB: FC-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA12 (Link to dictyBase) - - - Contig-U15087-1 FC-AA12E (Li...nk to Original site) - - - - - - FC-AA12E 454 Show FC-AA12 Library FC (Link to library) Clone ID FC-AA12 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA12Q.Seq.d/ Representative seq. ID FC-AA...12E (Link to Original site) Representative DNA sequence >FC-AA12 (FC-AA12Q) /CSM/FC/FC-AA/FC-AA12Q.Seq.d/ AAATAATAATAATATAAAAA...TGGAAATTAAAGTTTTAGCTAAAAGAAAAGTATCAGCAAA ACGTGCAAATGAAATATTAGGAAAATTTATTTTAGAAAGAAAAGCAAATGAAGAAAA

  16. Dicty_cDB: FC-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  17. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  18. Dicty_cDB: FC-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  19. Dicty_cDB: FC-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  20. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  1. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  2. NCBI nr-aa BLAST: CBRC-OSAT-07-0070 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OSAT-07-0070 ref|NP_001060484.1| Os07g0650600 [Oryza sativa (japonica cultivar...-group)] dbj|BAC20065.2| BLE2 protein [Oryza sativa (japonica cultivar-group)] dbj|BAD32037.1| BLE2 protein [Oryza sativa... (japonica cultivar-group)] dbj|BAF22398.1| Os07g0650600 [Oryza sativa (japonica cultivar-group)] NP_001060484.1 1e-124 52% ...

  3. Magnetic horn of the Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  4. Expression, crystallization and preliminary X-ray crystallographic analysis of XometC, a cystathionine γ-lyase-like protein from Xanthomonas oryzae pv. oryzae

    Energy Technology Data Exchange (ETDEWEB)

    Ngo, Phuong-Thuy Ho; Kim, Jin-Kwang [Department of Advanced Technology Fusion, Konkuk University, Hwayang-dong, Gwangjin-gu, Seoul 143-701 (Korea, Republic of); Kim, Hyesoon [Major in Life Science, College of Natural Sciences, Sangmyung University, 7 Hongji-dong, Jongno-gu, Seoul 110-743 (Korea, Republic of); Jung, Junho [Department of Advanced Technology Fusion, Konkuk University, Hwayang-dong, Gwangjin-gu, Seoul 143-701 (Korea, Republic of); Ahn, Yeh-Jin [Major in Life Science, College of Natural Sciences, Sangmyung University, 7 Hongji-dong, Jongno-gu, Seoul 110-743 (Korea, Republic of); Kim, Jeong-Gu; Lee, Byoung-Moo [Microbial Genetics Division, National Institute of Agricultural Biotechnology (NIAB), Rural Development Administration (RDA), Suwon 441-707 (Korea, Republic of); Kang, Hee-Wan, E-mail: kanghw2@hknu.ac.kr [Graduate School of Biotechnology and Information, Hankyong National University, Ansung 456-749 (Korea, Republic of); Kang, Lin-Woo, E-mail: kanghw2@hknu.ac.kr [Department of Advanced Technology Fusion, Konkuk University, Hwayang-dong, Gwangjin-gu, Seoul 143-701 (Korea, Republic of)

    2008-08-01

    XometC, a cystathionine γ-lyase-like protein from X. oryzae pv. oryzae and an antibacterial drug-target protein against bacterial blight, was cloned, purified and crystallized. Preliminary X-ray crystallographic analysis of XometC crystals was carried out. Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial blight of rice (Oryza sativa L.), one of the most devastating diseases of rice in most rice-growing countries. XometC, a cystathionine γ-lyase (CGL) like protein that is an antibacterial drug-target protein against Xoo, was cloned, expressed, purified and crystallized. CGL catalyzes the second step in the reverse-transsulfuration pathway, which is essential for the metabolic interconversion of the sulfur-containing amino acids cysteine and methionine. Crystals of two different shapes, plate-shaped and pyramid-shaped, diffracted to 2.9 and 3.2 Å resolution and belonged to the primitive orthogonal space group P2{sub 1}2{sub 1}2{sub 1} and the tetragonal space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = 73.0, b = 144.9, c = 152.3 Å and a = b = 78.2, c = 300.7 Å, respectively. For the P2{sub 1}2{sub 1}2{sub 1} crystals, three or four monomers exist in the asymmetric unit with a corresponding V{sub M} of 3.02 or 2.26 Å{sup 3} Da{sup −1} and a solvent content of 59.3 or 45.7%. For the P4{sub 1} (or P4{sub 3}) crystals, four or five monomers exist in the asymmetric unit with a corresponding V{sub M} of 2.59 or 2.09 Å{sup 3} Da{sup −1} and a solvent content of 52.5 or 40.6%.

  5. Resistência de cultivares de arroz a Rhizoctonia solani e Rhizoctonia oryzae Resistance of rice cultivars to Rhizoctonia solani and Rhizoctonia oryzae

    Directory of Open Access Journals (Sweden)

    Anne Sitarama Prabhu

    2002-05-01

    Full Text Available Isolados de Rhizoctonia solani e Rhizoctonia oryzae, agentes causais da queima-da-bainha e mancha-da-bainha, respectivamente, foram coletados em lavouras de arroz irrigado no Estado do Tocantins. O objetivo deste trabalho foi avaliar a resistência de 12 cultivares de arroz a essas doenças, sob condições artificiais de inoculação, em casa de vegetação. Não houve correlação entre resistência das cultivares a R. oryzae e R. solani quanto ao comprimento da lesão na bainha infectada pelo método de palito de dentes. A relação entre tamanho da lesão na bainha e folha foi linear e significativamente negativa (r = -0,66, PIsolates of Rhizoctonia solani and Rhizoctonia oryzae, the causal agents of sheath blight and sheath rot diseases, respectively, were collected from irrigated rice fields in the State of Tocantins, Brazil. The main objective of the investigation was to assess the resistance of 12 genotypes to these diseases, under artificial inoculation tests in greenhouse condition. There was no correlation between the resistance of cultivars to R. oryzae and R. solani for lesion extension on sheath infection obtained by the toothpick method. The relationship between lesion size on sheath and leaf was linear and significantly negative (r = -0.66, P<=0.05, thereby indicating that there is no relationship between resistance of sheath and leaf to infection by R. solani in rice cultivars. Among the early maturing genotypes Labelle was highly susceptible in all methods of inoculation. The area under disease progress curve based on lesion height on the culm and the inoculation method with rice husk and grain were found more adequate for determining the differences in the degree of resistance among cultivars. Leaves exhibited resistance to infection by R. oryzae in inoculation tests with mycelial discs.

  6. Autolysis of Aspergillus oryzae Mycelium and Effect on Volatile Flavor Compounds of Soy Sauce.

    Science.gov (United States)

    Xu, Ning; Liu, Yaqi; Hu, Yong; Zhou, Mengzhou; Wang, Chao; Li, Dongsheng

    2016-08-01

    The autolyzed mycelia of Aspergillus oryzae are rich in proteins, nucleic acids, sugar, and other biomacromolecules, and are one of the main contributors to the flavor profile of commercially important fermented goods, including soy sauce and miso. We induced autolysis of the mycelia of A. oryzae over 1 to 10 d, and found that the maximum dissolved amounts of total protein and nucleic acid ratio accounted for 28.63% and 88.93%, respectively. The organic acid content, such as citric acid, tartaric acid, succinic acid, lactic acid, and acetic acid, initially increased and then decreased as autolysis progressed, corresponding to changes in pH levels. The main characteristic flavor compounds in soy sauce, namely, ethanol, 2-phenylethanol, and 2-methoxy-4-vinylphenol, were all detected in the autolysate. Subsequently, we tested the effect of adding mycelia of A. oryzae during the fermentation process of soy sauce for 60 d, and found that addition of 1.2‰ A. oryzae mycelia provided the richest flavor. Overall, our findings suggest that compounds found in the autolysate of A. oryzae may promote the flavor compounds of soy sauce, such as alcohols, aldehydes, phenols, and esters.

  7. Utilization of Aspergillus oryzae to produce pectin lyase from various agro-industrial residues

    Directory of Open Access Journals (Sweden)

    Safia Koser

    2014-07-01

    Full Text Available The present study was aimed to investigate the culture influence on pectin lyase production potential of fungal strain Aspergillus oryzae. The enzyme profile of A. oryzae showed highest activity of pectin lyase after 3rd day of incubation on lemon peel waste under solid state fermentation conditions. To induce the pectin lyase synthesis capability of A. oryzae at optimal level various culture variables including physical and nutritional parameters were optimized by adopting classical optimization technique. Therefore, through fermentation process optimization the production of pectin lyase was substantially induced up to the level of 875 U/mL, when fermentation medium of lemon peel waste inoculated with 5 mL spore suspension of A. oryzae. The optimal fermentation conditions for maximum pectin lyase yield were as: optimum pH 5, 70% moisture level and incubated at 40 °C in addition with 1% sterile glucose solution as readily available carbon source and 0.2% yeast extract as an inexpensive nitrogen supplement (1%. The results obtained in current investigation so far demonstrated that culture conditions have great influence on the pectin lyase production potential of A. oryzae.

  8. Autolysis of Aspergillus oryzae Mycelium and Effect on Volatile Flavor Compounds of Soy Sauce.

    Science.gov (United States)

    Xu, Ning; Liu, Yaqi; Hu, Yong; Zhou, Mengzhou; Wang, Chao; Li, Dongsheng

    2016-08-01

    The autolyzed mycelia of Aspergillus oryzae are rich in proteins, nucleic acids, sugar, and other biomacromolecules, and are one of the main contributors to the flavor profile of commercially important fermented goods, including soy sauce and miso. We induced autolysis of the mycelia of A. oryzae over 1 to 10 d, and found that the maximum dissolved amounts of total protein and nucleic acid ratio accounted for 28.63% and 88.93%, respectively. The organic acid content, such as citric acid, tartaric acid, succinic acid, lactic acid, and acetic acid, initially increased and then decreased as autolysis progressed, corresponding to changes in pH levels. The main characteristic flavor compounds in soy sauce, namely, ethanol, 2-phenylethanol, and 2-methoxy-4-vinylphenol, were all detected in the autolysate. Subsequently, we tested the effect of adding mycelia of A. oryzae during the fermentation process of soy sauce for 60 d, and found that addition of 1.2‰ A. oryzae mycelia provided the richest flavor. Overall, our findings suggest that compounds found in the autolysate of A. oryzae may promote the flavor compounds of soy sauce, such as alcohols, aldehydes, phenols, and esters. PMID:27464006

  9. Transcriptome analysis of Rhizopus oryzae in response to xylose during fumaric acid production.

    Science.gov (United States)

    Xu, Qing; Liu, Ying; Li, Shuang; Jiang, Ling; Huang, He; Wen, Jianping

    2016-08-01

    Xylose is one of the most abundant lignocellulosic components, but it cannot be used by R. oryzae for fumaric acid production. Here, we applied high-throughput RNA sequencing to generate two transcriptional maps of R. oryzae following fermentation in glucose or xylose. The differential expression analysis showed that, genes involved in amino acid metabolism, fatty acid metabolism, and gluconeogenesis, were up-regulated in response to xylose. Moreover, we discovered the potential presence of oxidative stress in R. oryzae during xylose fermentation. To adapt to this unfavorable condition, R. oryzae displayed reduced growth and induce of a number of antioxidant enzymes, including genes involved in glutathione, trehalose synthesis, and the proteasomal pathway. These responses might divert the flow of carbon required for the accumulation of fumaric acid. Furthermore, using high-throughput RNA sequencing, we identified a large number of novel transcripts and a substantial number of genes that underwent alternative splicing. Our analysis provides remarkable insight into the mechanisms underlying xylose fermentation by R. oryzae. These results may reveal potential target genes or strategies to improve xylose fermentation. PMID:27170374

  10. Systematic analysis of rice (Oryza sativa) metabolic responses to herbivory.

    Science.gov (United States)

    Alamgir, Kabir Md; Hojo, Yuko; Christeller, John T; Fukumoto, Kaori; Isshiki, Ryutaro; Shinya, Tomonori; Baldwin, Ian T; Galis, Ivan

    2016-02-01

    Plants defend against attack from herbivores by direct and indirect defence mechanisms mediated by the accumulation of phytoalexins and release of volatile signals, respectively. While the defensive arsenals of some plants, such as tobacco and Arabidopsis are well known, most of rice's (Oryza sativa) defence metabolites and their effectiveness against herbivores remain uncharacterized. Here, we used a non-biassed metabolomics approach to identify many novel herbivory-regulated metabolic signatures in rice. Most were up-regulated by herbivore attack while only a few were suppressed. Two of the most prominent up-regulated signatures were characterized as phenolamides (PAs), p-coumaroylputrescine and feruloylputrescine. PAs accumulated in response to attack by both chewing insects, i.e. feeding of the lawn armyworm (Spodoptera mauritia) and the rice skipper (Parnara guttata) larvae, and the attack of the sucking insect, the brown planthopper (Nilaparvata lugens, BPH). In bioassays, BPH insects feeding on 15% sugar solution containing p-coumaroylputrescine or feruloylputrescine, at concentrations similar to those elicited by heavy BPH attack in rice, had a higher mortality compared to those feeding on sugar diet alone. Our results highlight PAs as a rapidly expanding new group of plant defence metabolites that are elicited by herbivore attack, and deter herbivores in rice and other plants.

  11. The WRKY Gene Family in Rice (Oryza sativa)

    Institute of Scientific and Technical Information of China (English)

    Christian A. Ross; Yue Liu; Qingxi J. Shen

    2007-01-01

    WRKYgenes encode transcription factors that are involved in the regulation of various biological processes. These zinc-finger proteins, especially those members mediating stress responses, are uniquely expanded in plants. To facilitate the study of the evolutionary history and functions of this supergene family, we performed an exhaustive search for WRKY genes using HMMER and a Hidden Markov Model that was specifically trained for rice. This work resulted in a comprehensive list of WRKY gene models in Oryza sativa L. ssp. indica and L. ssp. japonica. Mapping of these genes to individual chromosomes facilitated elimination of the redundant, leading to the identification of 98 WRKY genes in japonica and 102 in indica rice. These genes were further categorized according to the number and structure of their zinc-finger domains. Based on a phylogenetic tree of the conserved WRKY domains and the graphic display of WRKY loci on corresponding indica and japonica chromosomes, we identified possible WRKY gene duplications within, and losses between the two closely related rice subspecies. Also reviewed are the roles of WRKY genes in disease resistance and responses to salicylic acid and jasmonic acid, seed development and germination mediated by gibberellins, other developmental processes including senescence, and responses to abiotic stresses and abscisic acid in rice and other plants. The signaling pathways mediating WRKY gene expression are also discussed.

  12. Phylogeny of Plant CAMTAs and Role of AtCAMTAs in Nonhost Resistance to Xanthomonas oryzae pv. oryzae.

    Science.gov (United States)

    Rahman, Hafizur; Yang, Juan; Xu, You-Ping; Munyampundu, Jean-Pierre; Cai, Xin-Zhong

    2016-01-01

    regulated the immunity triggered by flg22 and nonhost resistance to Xanthomonas oryzae pv. oryzae via repressing accumulation of reactive oxygen species probably by targeting CBP60G, EDS1, and NDR1 and involving SA pathway.

  13. Phylogeny of plant CAMTAs and role of AtCAMTAs in nonhost resistance to Xanthomonas oryzae pv. oryzae

    Directory of Open Access Journals (Sweden)

    Hafizur eRahman

    2016-02-01

    negatively regulated the immunity triggered by flg22 and nonhost resistance to Xanthomonas oryzae pv. oryzae via repressing accumulation of reactive oxygen species probably by targeting CBP60G, EDS1 and NDR1 and involving SA pathway.

  14. Population structure and pathotype diversity of the wheat blast pathogen Magnaporthe oryzae 25 years after its emergence in Brazil

    NARCIS (Netherlands)

    Nunes Maciel, J.L.; Ceresini, P.; Castroagudin, V.L.; Zala, M.; Kema, G.H.J.

    2014-01-01

    Since its first report in Brazil in 1985, wheat blast, caused by Magnaporthe oryzae (anamorph: Pyricularia oryzae), has become increasingly important in South America, where the disease is still spreading. We used 11 microsatellite loci to elucidate the population structure of the wheat blast pathog

  15. Significance of bed porosity, bran and specific surface area in solid-state cultivation of Aspergillus oryzae

    NARCIS (Netherlands)

    Rahardjo, Y.S.P.; Jolink, F.; Haemers, S.; Tramper, J.; Rinzema, A.

    2005-01-01

    In this paper, the effects of bed porosity, bran and specific surface area on the oxygen uptake rate and ¿-amylase production during growth of Aspergillus oryzae on wheat grain and wheat¿flour substrate are reported. The high oxygen uptake rate found during cultivation of A. oryzae on wheat¿flour su

  16. Evaluation of commercial soy sauce koji strains of Aspergillus oryzae for γ-aminobutyric acid (GABA) production.

    Science.gov (United States)

    Ab Kadir, Safuan; Wan-Mohtar, Wan Abd Al Qadr Imad; Mohammad, Rosfarizan; Abdul Halim Lim, Sarina; Sabo Mohammed, Abdulkarim; Saari, Nazamid

    2016-10-01

    In this study, four selected commercial strains of Aspergillus oryzae were collected from soy sauce koji. These A. oryzae strains designated as NSK, NSZ, NSJ and NST shared similar morphological characteristics with the reference strain (A. oryzae FRR 1675) which confirmed them as A. oryzae species. They were further evaluated for their ability to produce γ-aminobutyric acid (GABA) by cultivating the spore suspension in a broth medium containing 0.4 % (w/v) of glutamic acid as a substrate for GABA production. The results showed that these strains were capable of producing GABA; however, the concentrations differed significantly (P GABA concentration was obtained from NSK (194 mg/L) followed by NSZ (63 mg/L), NSJ (51.53 mg/L) and NST (31.66 mg/L). Therefore, A. oryzae NSK was characterized and the sequence was found to be similar to A. oryzae and A. flavus with 99 % similarity. The evolutionary distance (K nuc) between sequences of identical fungal species was calculated and a phylogenetic tree prepared from the K nuc data showed that the isolate belonged to the A. oryzae species. This finding may allow the development of GABA-rich ingredients using A. oryzae NSK as a starter culture for soy sauce production.

  17. Data set from the phosphoproteomic analysis of Magnaporthe oryzae-responsive proteins in susceptible and resistant rice cultivars

    Directory of Open Access Journals (Sweden)

    Yunfeng Li

    2015-06-01

    Full Text Available Rice blast, caused by the fungal pathogen Magnaporthe oryzae, is the most destructive disease of rice and causes tremendous losses of rice yield worldwide. To explore the molecular mechanisms involved in the rice–M. oryzae interaction, we conducted a time-course phosphoproteomic analysis of leaf samples from resistant and susceptible rice cultivars infected with M. oryzae. This data article contains additional results and analysis of M. oryzae-regulated phosphoproteins in rice leaves [1]. We report the analysis of M. oryzae-regulated phosphoproteins at all time points, including Venn diagram analysis, close-up views, relative intensities, and functional category, and the MS spectra of representative phosphoprotein and representative phosphorylated peptides.

  18. Fermentation Kinetics of Media Optimization for the Production of Alpha Amylase by a New Isolate of Aspergillus Oryzae

    Institute of Scientific and Technical Information of China (English)

    Ikram-ul-Haq; Roheena Abdullah; Hamid Mukhtar; Muhammad Nauman Aftab

    2007-01-01

    The present study is concerned with the isolation and screening of different strains of Aspergillus oryzae for the production of alpha amylase. Ninety strains were isolated from soil and tested for the production of alpha amylase in shake flasks. Of all the strains tested,Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35 gave maximum production of alpha amylase. Different culture media were screened for maximum production of alpha amylase by both the strains Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35. Kinetic analysis revealed that the values of product yield coefficient (Yp/x) and specific product yield coefficient( qp ) were found highly significant (p ≤ 0.05 ) when medium M1 was used for the enzyme production.

  19. Cancer genomics

    DEFF Research Database (Denmark)

    Norrild, Bodil; Guldberg, Per; Ralfkiær, Elisabeth Methner

    2007-01-01

    Almost all cells in the human body contain a complete copy of the genome with an estimated number of 25,000 genes. The sequences of these genes make up about three percent of the genome and comprise the inherited set of genetic information. The genome also contains information that determines whe...

  20. Construction of an insecticidal baculovirus expressing insect-specific neurotoxin AaIT

    Institute of Scientific and Technical Information of China (English)

    姚斌; 庞义; 范云六; 赵荣敏; 杨应昌; 王天原

    1996-01-01

    Considering the factors which affect gene transcription, translation and the stability of mRNA, without changing the amino acid composition of the encoded polypeptide, AaIT gene encoding insect-specific neurotoxin was designed and synthesized according to bias in codon choice, overall G+C content and G + C content of bases at the third position in codons of polyhedrin genes of baculovirus and of plant genes as well. AaIT gene was fused behind a synthetic gp67 signal sequence and then recombined into the genome of Trichoplusia ni nuclear polyhedrosis virus (TnNPV) by transfer vector pSXIV VI+X3. The recombinant virus TnNPV-AalT (occ+-gal-) was screened. The results of Southern blotting and SDS-PAGE demonstrated that AaIT gene had integrated into the genome of virus and expressed. Bioassays on the 3rd-instar Trichoplusia ni larvae showed that recombinant viruses TnNPV-AalT could shorten the time of killing insect and improve the efficiency of killing agronomically important insects.

  1. AAS 228: Day 3 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  2. First case of Tritirachium oryzae as agent of onychomycosis and its susceptibility to antifungal drugs.

    Science.gov (United States)

    Naseri, Ali; Fata, Abdolmajid; Najafzadeh, Mohammad Javad

    2013-08-01

    The first case of Tritirachium oryzae isolated from an Iranian patient is reported. A 44-year-old woman with a lesion in her fingernail was examined for onychomycosis. Direct microscopic examination of the nail clippings revealed fungal filaments and inoculation of portions of the nail clippings on cultures media yielded T. oryzae after 8 days. The isolate was identified as Tritirachium spp. on the basis of gross morphological characteristics of the fungal colony and microscopic characterization of slide cultures. The diagnosis of T. oryzae was confirmed by PCR sequencing of the internal transcribed spacer domain of the rDNA gene. In vitro antifungal susceptibility test demonstrated that the fungus was susceptible to itraconazole and posaconazole. The patient was treated with oral itraconazole. PMID:23591624

  3. Expression of Dm-AMP1 in rice confers resistance to Magnaporthe oryzae and Rhizoctonia solani.

    Science.gov (United States)

    Jha, Sanjay; Tank, Harsukh G; Prasad, Bishun Deo; Chattoo, Bharat B

    2009-02-01

    Magnaporthe oryzae and Rhizoctonia solani, are among the most important pathogens of rice, severely limiting its productivity. Dm-AMP1, an antifungal plant defensin from Dahlia merckii, was expressed in rice (Oryza sativa L. sp. indica cv. Pusa basmati 1) using Agrobacterium tumefaciens-mediated transformation. Expression levels of Dm-AMP1 ranged from 0.43% to 0.57% of total soluble protein in transgenic plants. It was observed that constitutive expression of Dm-AMP1 suppresses the growth of M. oryzae and R. solani by 84% and 72%, respectively. Transgenic expression of Dm-AMP1 was not accompanied by an induction of pathogenesis-related (PR) gene expression, indicating that the expression of DmAMP1 directly inhibits the pathogen. The results of in vitro, in planta and microscopic analyses suggest that Dm-AMP1 expression has the potential to provide broad-spectrum disease resistance in rice. PMID:18618285

  4. Triterpenoid glycosides from Medicago sativa as antifungal agents against Pyricularia oryzae.

    Science.gov (United States)

    Abbruscato, Pamela; Tosi, Solveig; Crispino, Laura; Biazzi, Elisa; Menin, Barbara; Picco, Anna M; Pecetti, Luciano; Avato, Pinarosa; Tava, Aldo

    2014-11-19

    The antifungal properties of saponin mixtures from alfalfa (Medicago sativa L.) tops and roots, the corresponding mixtures of prosapogenins from tops, and purified saponins and sapogenins against the causal agent of rice blast Pyricularia oryzae isolates are presented. In vitro experiments highlighted a range of activities, depending upon the assayed metabolite. The antifungal effects of the most promising prosapogenin mixture from alfalfa tops were confirmed by means of in planta tests using three different Italian cultivars of rice (Oryza sativa L. ssp. japonica), known to possess high, medium, and low blast resistance. The evidenced antifungal properties of the tested metabolites allowed some considerations on their structure-activity relationship. Results indicate that prosapogenins are active compounds to prevent the fungal attack of P. oryzae on different rice cultivars. Therefore, if properly formulated, these substances could represent a promising and environmentally friendly treatment to control rice blast. PMID:25361378

  5. Morphological and molecular characterization of Magnaporthe oryzae (fungus) from infected rice leaf samples

    Science.gov (United States)

    Muni, Nurulhidayah Mat; Nadarajah, Kalaivani

    2014-09-01

    Magnaporthe oryzae is a plant-pathogenic fungus that causes a serious disease affecting rice called rice blast. Outbreaks of rice blast have been a threat to the global production of rice. This fungal disease is estimated to cause production losses of US55 million each year in South and Southeast Asia. It has been used as a primary model for elucidating various aspects of the host-pathogen interaction with its host. We have isolated five isolates of Magnaporthe oryzae from diseased leaf samples obtained from the field at Kompleks Latihan MADA, Kedah, Malaysia. We have identified the isolates using morphological and microscopic studies on the fungal spores and the lesions on the diseased leaves. Amplification of the internal transcribed spacer (ITS) was carried out with universal primers ITS1 and ITS4. The sequence of each isolates showed at least 99% nucleotide identity with the corresponding sequence in GenBank for Magnaporthe oryzae.

  6. Comparative Analysis of the Korean Population of Magnaporthe oryzae by Multilocus Microsatellite Typing

    Directory of Open Access Journals (Sweden)

    Jaehyuk Choi

    2013-12-01

    Full Text Available Rice blast fungus, Magnaporthe oryzae, inflicts serious damage to global rice production. Due to high variability of this fungal pathogen, resistance of newly-released rice cultivars is easily broken down. To understand the population structure of M. oryzae, we analyzed the genetic diversity of the Korean population using multilocus microsatellite typing. Eleven microsatellite markers were applied to the population of 190 rice isolates which had been collected in Korea for two decades since the 1980’s. Average values of gene diversity and allele frequency were 0.412 and 6.5, respectively. Comparative analysis of the digitized allele information revealed that the Korean population exhibited a similar level of allele diversity to the integrated diversity of the world populations, suggesting a particularly high diversity of the Korean population. Therefore, these microsatellite markers and the comprehensive collection of field isolates will be useful genetic resources to identify the genetic diversity of M. oryzae population.

  7. Enhanced L-(+)-lactic acid production by an adapted strain of Rhizopus oryzae using corncob hydrolysate

    DEFF Research Database (Denmark)

    Bai, Dongmei; Li, S.Z.; Liu, Z.L.;

    2008-01-01

    -added production of a variety of bioproducts. Lactic acid can be used as a precursor for poly-lactic acid production. Although current industrial lactic acid is produced by lactic acid bacteria using enriched medium, production by Rhizopus oryzae is preferred due to its exclusive formation of the......-isomer and a simple nutrition requirement by the fungus. Production of-L-(+)-lactic acid by R. oryzae using xylose has been reported; however, its yield and conversion rate are poor compared with that of using glucose. In this study, we report an adapted R. oryzae strain HZS6 that significantly improved efficiency...... of substrate utilization and enhanced production of L-(+)-lactic acid from corncob hydrolysate. It increased L-(+)-lactic acid final concentration, yield, and volumetric productivity more than twofold compared with its parental strain. The optimized growth and fermentation conditions for Strain HZS6 were...

  8. Mutation of the rice XA21 predicted nuclear localization sequence does not affect resistance to Xanthomonas oryzae pv. oryzae

    Science.gov (United States)

    Ho, Yuen Ting

    2016-01-01

    Background The rice receptor kinase XA21 confers robust resistance to the bacterial pathogen Xanthomonas oryzaepv. oryzae(Xoo). We previously reported that XA21 is cleaved in transgenic plants overexpressing XA21 with a GFP tag (Ubi-XA21-GFP) and that the released C-terminal domain is localized to the nucleus. XA21 carries a predicted nuclear localization sequence (NLS) that directs the C-terminal domain to the nucleus in transient assays, whereas alanine substitutions in the NLS disrupt the nuclear localization. Methods To determine if the predicted NLS is required for XA21-mediated immunity in planta, we generated transgenic plants overexpressing an XA21 variant carrying the NLS with the same alanine substitutions (Ubi-XA21nls-GFP). Results Ubi-XA21nls-GFP plants displayed slightly longer lesion lengths, higher Xoobacterial populations after inoculation and lower levels of reactive oxygen species production compared with the Ubi-XA21-GFP control plants. However, the Ubi-XA21nls-GFP plants express lower levels of protein than that observed in Ubi-XA21-GFP. Discussion These results demonstrate that the predicted NLS is not required for XA21-mediated immunity.

  9. Exploration of plant genomes in the FLAGdb++ environment

    Directory of Open Access Journals (Sweden)

    Leplé Jean-Charles

    2011-03-01

    Full Text Available Abstract Background In the contexts of genomics, post-genomics and systems biology approaches, data integration presents a major concern. Databases provide crucial solutions: they store, organize and allow information to be queried, they enhance the visibility of newly produced data by comparing them with previously published results, and facilitate the exploration and development of both existing hypotheses and new ideas. Results The FLAGdb++ information system was developed with the aim of using whole plant genomes as physical references in order to gather and merge available genomic data from in silico or experimental approaches. Available through a JAVA application, original interfaces and tools assist the functional study of plant genes by considering them in their specific context: chromosome, gene family, orthology group, co-expression cluster and functional network. FLAGdb++ is mainly dedicated to the exploration of large gene groups in order to decipher functional connections, to highlight shared or specific structural or functional features, and to facilitate translational tasks between plant species (Arabidopsis thaliana, Oryza sativa, Populus trichocarpa and Vitis vinifera. Conclusion Combining original data with the output of experts and graphical displays that differ from classical plant genome browsers, FLAGdb++ presents a powerful complementary tool for exploring plant genomes and exploiting structural and functional resources, without the need for computer programming knowledge. First launched in 2002, a 15th version of FLAGdb++ is now available and comprises four model plant genomes and over eight million genomic features.

  10. Crucial roles of abscisic acid biogenesis in virulence of rice blast fungus Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Carla eSpence

    2015-12-01

    Full Text Available Rice suffers dramatic yield losses due to blast pathogen Magnaporthe oryzae. Pseudomonas chlororaphis EA105, a bacterium that was isolated from the rice rhizosphere, inhibits M. oryzae. It was shown previously that pre-treatment of rice with EA105 reduced the size of blast lesions through JA- and ETH-mediated ISR. ABA acts antagonistically towards SA, JA, and ETH signaling, to impede plant defense responses. EA105 may be reducing the virulence of M. oryzae by preventing the pathogen from up-regulating the key ABA biosynthetic gene NCED3 in rice roots, as well as a β-glucosidase likely involved in activating conjugated inactive forms of ABA. However, changes in total ABA concentrations were not apparent, provoking the question of whether ABA concentration is an indicator of ABA signaling and response. In the rice-M. oryzae interaction, ABA plays a dual role in disease severity by increasing plant susceptibility and accelerating pathogenesis in the fungus itself. ABA is biosynthesized by M. oryzae. Further, exogenous ABA increased spore germination and appressoria formation, distinct from other plant growth regulators. EA105, which inhibits appressoria formation, counteracted the virulence-promoting effects of ABA on M. oryzae. The role of endogenous fungal ABA in blast disease was confirmed through the inability of a knockout mutant impaired in ABA biosynthesis to form lesions on rice. Therefore, it appears that EA105 is invoking multiple strategies in its protection of rice from blast including direct mechanisms as well as those mediated through plant signaling. ABA is a molecule that is likely implicated in both tactics.

  11. Multiple rice microRNAs are involved in immunity against the blast fungus Magnaporthe oryzae.

    Science.gov (United States)

    Li, Yan; Lu, Yuan-Gen; Shi, Yi; Wu, Liang; Xu, Yong-Ju; Huang, Fu; Guo, Xiao-Yi; Zhang, Yong; Fan, Jing; Zhao, Ji-Qun; Zhang, Hong-Yu; Xu, Pei-Zhou; Zhou, Jian-Min; Wu, Xian-Jun; Wang, Ping-Rong; Wang, Wen-Ming

    2014-02-01

    MicroRNAs (miRNAs) are indispensable regulators for development and defense in eukaryotes. However, the miRNA species have not been explored for rice (Oryza sativa) immunity against the blast fungus Magnaporthe oryzae, the most devastating fungal pathogen in rice production worldwide. Here, by deep sequencing small RNA libraries from susceptible and resistant lines in normal conditions and upon M. oryzae infection, we identified a group of known rice miRNAs that were differentially expressed upon M. oryzae infection. They were further classified into three classes based on their expression patterns in the susceptible japonica line Lijiangxin Tuan Hegu and in the resistant line International Rice Blast Line Pyricularia-Kanto51-m-Tsuyuake that contains a single resistance gene locus, Pyricularia-Kanto 51-m (Pikm), within the Lijiangxin Tuan Hegu background. RNA-blot assay of nine of them confirmed sequencing results. Real-time reverse transcription-polymerase chain reaction assay showed that the expression of some target genes was negatively correlated with the expression of miRNAs. Moreover, transgenic rice plants overexpressing miR160a and miR398b displayed enhanced resistance to M. oryzae, as demonstrated by decreased fungal growth, increased hydrogen peroxide accumulation at the infection site, and up-regulated expression of defense-related genes. Taken together, our data indicate that miRNAs are involved in rice immunity against M. oryzae and that overexpression of miR160a or miR398b can enhance rice resistance to the disease. PMID:24335508

  12. The complete genome sequence and genome structure of passion fruit mosaic virus.

    Science.gov (United States)

    Song, Yeon Sook; Ryu, Ki Hyun

    2011-06-01

    In this study, we determined the complete sequence of the genomic RNA of a Florida isolate of maracuja mosaic virus (MarMV-FL) and compared it to that of a Peru isolate of the virus (MarMV-P) and those of other known tobamoviruses. Complete sequence analysis revealed that the isolate should be considered a member of a new species and named passion fruit mosaic virus (PafMV). The genomic RNA of PafMV consists of 6,791 nucleotides and encodes four open reading frames (ORFs) coding for proteins of 125 kDa (1,101 aa), 184 kDa (1,612 aa), 34 kDa (311 aa) and 18 kDa (164 aa) in consecutive order from the 5' to the 3' end. The sequence homologies of the four ORFs of PafMV were from 78.8% to 81.6% to those of MarMV-P at the amino acid level. The sequence homologies of the four ORFs of PafMV ranged from 36.0% to 77.9% and from 21.7% to 81.6% to those of other tobamoviruses, at the nucleotide and amino acid level, respectively. Phylogenetic analysis revealed that these PafMV-encoded proteins are closely related to those of MarMV-P. In conclusion, the results indicate that PafMV and MarMV-P belong to different species within the genus Tobamovirus. PMID:21547441

  13. Polyol accumulation by Aspergillus oryzae at low water activity in solid-state fermentation

    OpenAIRE

    Ruijter, G J G; J. Visser; Rinzema, A.

    2004-01-01

    Polyol accumulation and metabolism were examined in Aspergillus oryzae cultured on whole wheat grains or on wheat dough as a model for solid-state culture. In solid-state fermentation (SSF), water activity (a(w)) is typically low resulting in osmotic stress. In addition to a high level of mannitol, which is always present in the cells, A. oryzae accumulated high concentrations of glycerol, erythritol and arabitol at relatively low a(w) (0(.)96-0(.)97) in SSF. Accumulation of such a mixture of...

  14. Investigation of the biological roles of autophagy in appressorium morphogenesis in Magnaporthe oryzae

    Institute of Scientific and Technical Information of China (English)

    Xiao-hong LIU; Fu-cheng LIN

    2008-01-01

    Magnaporthe oryzae has been used as a primary model organism for investigating fungus-plant interaction. Many researches focused on molecular mechanisms of appressorium formation to restrain this fungal pathogen. Autophagy is a very high conserved process in eukaryotic cells. Recently, autophagy has been considered as a key process in development and differentiation in M. oryzae. In this report, we present and discuss the current state of our knowledge on gene expression in appressorium formation and the progress in autophagy of rice blast fungi.

  15. Kinetic studies of acid inactivation of alpha-amylase from Aspergillus oryzae

    DEFF Research Database (Denmark)

    Carlsen, Morten; Nielsen, Jens Bredal; Villadsen, John

    1996-01-01

    The stability of alpha-amylase from Aspergillus oryzae has been studied at different pH. The enzyme is extremely stable at neutral pH (pH 5-8), whereas outside this pH-range a substantial loss of activity is observed. The acid-inactivation of alpha-amylase from A. oryzae was monitored on...... regains part of its activity, and the reactivation process also follows first-order kinetics. The irreversible loss of activity is found not to result from a protease contamination of the protein samples. A proposed model, where irreversibly inactivated a-amylase is formed both directly from the active...

  16. AAS 228: Day 1 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  17. Domestication and geographic origin of Oryza sativa in China: insights from multilocus analysis of nucleotide variation of O. sativa and O. rufipogon.

    Science.gov (United States)

    Wei, Xin; Qiao, Wei-Hua; Chen, You-Tao; Wang, Rong-Sheng; Cao, Li-Rong; Zhang, Wan-Xia; Yuan, Nan-Nan; Li, Zi-Chao; Zeng, Han-Lai; Yang, Qing-Wen

    2012-10-01

    Previous studies have indicated that China is one of the domestication centres of Asian cultivated rice (Oryza sativa), and common wild rice (O. rufipogon) is the progenitor of O. sativa. However, the number of domestication times and the geographic origin of Asian cultivated rice in China are still under debate. In this study, 100 accessions of Asian cultivated rice and 111 accessions of common wild rice in China were selected to examine the relationship between O. sativa and O. rufipogon and thereby infer the domestication and evolution of O. sativa in China through sequence analyses of six gene regions, trnC-ycf6 in chloroplast genomes, cox3 in mitochondrial genomes and ITS, Ehd1, Waxy, Hd1 in nuclear genomes. The results indicated that the two subspecies of O. sativa (indica and japonica) were domesticated independently from different populations of O. rufipogon with gene flow occurring later from japonica to indica; Southern China was the genetic diversity centre of O. rufipogon, and the Pearl River basin near the Tropic of Cancer was the domestication centre of O. sativa in China.

  18. The AA disappearing under concrete shielding

    CERN Multimedia

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  19. Genome-Wide Association of Body Fat Distribution in African Ancestry Populations Suggests New Loci

    OpenAIRE

    Liu, Ching-Ti; Keri L Monda; Taylor, Kira C.; Lange, Leslie; Demerath, Ellen W; Palmas, Walter; Wojczynski, Mary K.; Jaclyn C Ellis; Mara Z Vitolins; Liu, Simin; Papanicolaou, George J.; Irvin, Marguerite R.; Xue, Luting; Griffin, Paula J.; Michael A Nalls

    2013-01-01

    Central obesity, measured by waist circumference (WC) or waist-hip ratio (WHR), is a marker of body fat distribution. Although obesity disproportionately affects minority populations, few studies have conducted genome-wide association study (GWAS) of fat distribution among those of predominantly African ancestry (AA). We performed GWAS of WC and WHR, adjusted and unadjusted for BMI, in up to 33,591 and 27,350 AA individuals, respectively. We identified loci associated with fat distribution in...

  20. SET DOMAIN GROUP 708, a histone H3 lysine 36-specific methyltransferase, controls flowering time in rice (Oryza sativa).

    Science.gov (United States)

    Liu, Bing; Wei, Gang; Shi, Jinlei; Jin, Jing; Shen, Ting; Ni, Ting; Shen, Wen-Hui; Yu, Yu; Dong, Aiwu

    2016-04-01

    As a key epigenetic modification, the methylation of histone H3 lysine 36 (H3K36) modulates chromatin structure and is involved in diverse biological processes. To better understand the language of H3K36 methylation in rice (Oryza sativa), we chose potential histone methylation enzymes for functional exploration. In particular, we characterized rice SET DOMAIN GROUP 708 (SDG708) as an H3K36-specific methyltransferase possessing the ability to deposit up to three methyl groups on H3K36. Compared with the wild-type, SDG708-knockdown rice mutants displayed a late-flowering phenotype under both long-day and short-day conditions because of the down-regulation of the key flowering regulatory genes Heading date 3a (Hd3a), RICE FLOWERING LOCUS T1 (RFT1), and Early heading date 1 (Ehd1). Chromatin immunoprecipitation experiments indicated that H3K36me1, H3K36me2, and H3K36me3 levels were reduced at these loci in SDG708-deficient plants. More importantly, SDG708 was able to directly target and effect H3K36 methylation on specific flowering genes. In fact, knockdown of SDG708 led to misexpression of a set of functional genes and a genome-wide decrease in H3K36me1/2/3 levels during the early growth stages of rice. SDG708 is a methyltransferase that catalyses genome-wide deposition of all three methyl groups on H3K36 and is involved in many biological processes in addition to flowering promotion. PMID:26639303

  1. Identiifcation of differentially-expressed genes of rice in overlapping responses to bacterial infection by Xanthomonas oryzae pv. oryzae and nitrogen deifciency

    Institute of Scientific and Technical Information of China (English)

    YU Chao; CHEN Hua-min; TIAN Fang; BI Yong-mei; Rothstein J Steven; Leach E Jan; HE Chen-yang

    2015-01-01

    Bacterial blight of rice caused by Xanthomonas oryzae pv. oryzae (Xoo) is one of high nitrogen (N) responsive diseases. Rice plants became more disease resistant with decreasing N suggesting that the crosstalk between disease resistance and N utilization pathways might exist. However, the co-regulatory components in such crosstalk have not been elucidated. Here, we comparatively analyzed the gene expression proifling of rice under Xoo inoculation, low N treatment, or a combi-nation of both stresses, and identiifed the differential y-expressed genes (DEGs) in overlapping responses. These DEGs were involved in different biological processes, including innate immunity and nitrogen metabolism. The randomly-selected DEGs expression was validated by quantitative real-time PCR assays. Temporal expression of six genes from different functional categories suggested that N condition was the dominant factor when both stresses were present. These DEGs identiifed provide novel insights into the coordinated regulatory mechanism in biotic and abiotic stress responses in rice.

  2. Efectividad biológica delazoxystrobin para el control de pyricularia oryzae cav. y cercospora oryzae miyake. en arroz de temporal en Veracruz, México

    Directory of Open Access Journals (Sweden)

    Enrique Becerra

    2001-01-01

    Full Text Available El estado de Veracruz, México, siembra anualmente 22000 ha de arroz de temporal con un rendimiento medio de 3,5 t/ha, debido principalmente a problemas de sequía lo cual favorece la presencia de hongos como Pyricularia oryzae Cav. (quema del arroz y Cercospora oryzae Miyake. (Mancha angosta. Con el objeto de conocer el comportamiento de nuevos fungicidas se evaluó la eficacia del Azoxystrobin en el control de estos hongos. El experimento se estableció en el municipio de Tres Valles, Veracruz, durante el temporal de 1999, con semilla de Milagro Filipino Depurado. El diseño estadístico utilizado fue bloques al azar con cuatro repeticiones. Los tratamientos evaluados fueron: Azoxystrobin a 0,2, 0,4 y 0,6 l/ha vs Tecto60 a 0,5 kg/ha y un testigo sin aplicación. Estos fueron aplicados al presentarse los primeros síntomas de las enfermedades. Se evaluó la incidencia, número de lesiones en 20 plantas, índice de intensidad, el rendimiento de grano y fitotoxicidad. Se encontró que el Azoxystrobin obtuvo mejores resultados que el Tecto 60 y éste a su vez que el testigo no tratado. El mejor control para P. oryzae y C. oryzae y el mayor rendimiento de grano (4432 kg/ha se logró cuando se aplicó Azoxystrobin en dosis de 0,6 l/ha, aunque con 0,2 y 0,4 l/ha de este fungicida tuvo un buen control de estas enfermedades. Ninguno de los fungicidas causó toxicidad al arroz

  3. Applications of the double-barreled data in whole-genome shotgun sequence assembly and analysis

    Institute of Scientific and Technical Information of China (English)

    HAN Yujun; WANG Jing; GU Xiaocheng; YU Jun; LI Songgang; NI Peixiang; L(U) Hong; YE Jia; HU Jianfei; CHEN Chen; HUANG Xiangang; CONG Lijuan; LI Guangyuan

    2005-01-01

    Double-barreled (DB) data have been widely used for the assembly of large genomes. Based on the experience of building the whole-genome working draft of Oryza sativa L.ssp. Indica, we present here the prevailing and improved uses of DB data in the assembly procedure and report on novel applications during the following data-mining processes such as acquiring precise insert fragment information of each clone across the genome, and a new kind of Iow-cost whole-genome microarray. With the increasing number of organisms being sequenced,we believe that DB data will play an important role both in other assembly procedures and infuture genomic studies.

  4. AAS Nova and Astrobites: Making current astronomy research accessible

    Science.gov (United States)

    Kohler, Susanna; Astrobites Team

    2016-10-01

    AAS Nova and Astrobites are two resources available for astronomers, astronomy students, and astronomy enthusiasts to keep up with some of the most recent research published across the field of astronomy. Both supported by the AAS, these two daily astrophysical literature blogs provide accessible summaries of recent publications on the arXiv and in AAS journals. We present the goals, content, and readership of AAS Nova and Astrobites, and discuss how they might be used as tools in the undergraduate classroom.

  5. EFEITO DO TRATAMENTO QUÍMICO DE SEMENTES NO CONTROLE DE BRUSONE (Pyricularia oryzae) E MANCHA PARDA (Helminthosporium oryzae) DO ARROZ EFFECT OF CHEMICAL SEED TREATMENT IN THE CONTROL OF BLAST DISEASE AND BROWN SPOT OF RICE

    OpenAIRE

    Wilson Ferreira de Oliveira; Valácia Lemes da Silva; Meire Aparecida Damaceno

    2007-01-01

    Com o objetivo de controlar brusone (Pyricularia oryzae) e mancha parda (Helminthosporium oryzae) do arroz (Oryza sativa), diferentes fungicidas foram testados, através do tratamento de sementes, a nível de campo em solo de várzea (glei pouco húmico). Os resultados mostraram, preliminarmente e de modo geral, que os fungicidas dichlofluanid e terbuconazole propiciaram aumento no “stand” superiores a 30% quando compar...

  6. Dicty_cDB: FC-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  7. Dicty_cDB: FC-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  8. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    DEFF Research Database (Denmark)

    Hansen, Elo Harald

    1996-01-01

    of (especially HG- forming) elements. In the words of the one of the authorities of AAS and foremost pioneers of FI-AAS - Professor Z. L. Fang, who is the author on two recently published monographs on this hyphenated technique - the impact of FI on AAS is "so dramatic" that it has brought "new vitality...

  9. An unusual ulcer: A case of cutaneous mucormycosis caused by Rhizopus oryzae

    Directory of Open Access Journals (Sweden)

    Bradley J. Gardiner

    2015-03-01

    Full Text Available Mucormycoses are high-mortality infections feared by clinicians worldwide. They predominantly affect immunocompromised hosts and are associated with a spectrum of disease. We describe a case of cutaneous mucormycosis caused by Rhizopus oryzae in a patient with multiple risk factors cured with complete surgical excision and a short course of antifungal therapy.

  10. Organic anion exudation by lowland rice (Oryza sativa L.) at zinc and phosphorus deficiency

    NARCIS (Netherlands)

    Hoffland, E.; Wei, C.Z.; Wissuwa, M.

    2006-01-01

    The objectives of this paper were to determine (1) if lowland rice (Oryza sativa L.) plants respond similarly to low zinc (Zn) and phosphorus (P) availability by increased root exudation of low-molecular weight organic anions (LMWOAs) and (2) if genotypic variation in tolerance to low soil supply of

  11. Toxic effects of essential plant oils in adult Sitophilus oryzae (Linnaeus (Coleoptera, Curculionidae

    Directory of Open Access Journals (Sweden)

    Andréa Roveré Franz

    2011-03-01

    Full Text Available Toxic effects of essential plant oils in adult Sitophilus oryzae (Linnaeus (Coleoptera, Curculionidae. Stored grains are subject to losses in quality nutritional value and in sanitation from the time they are stored to the time they are consumed. Botanical insecticides may offer an alternative solution for pest control. The objective was to test the insecticidal properties of the essential oils of Cymbopogon citratus (leaf, Zingiber officinale (root and Mentha sp. (leaf. The efficacy of these oils was tested to control the rice weevil, S. oryzae, using hydrodistillation. Chemical analysis of the essential oils was carried out by gas chromatography. Major components of C. citratus were geranial (48% and neral (31%, of Z. officinale were α-zingibereno (13%, geranial (16%, neral (10% and α-farneseno (5% and of Mentha sp. was menthol (92%. Bioassays were carried out by fumigation and topical application. In topical application assays, the essential oil of C. citratus had greater toxicity (LC50 0.027 µL mL-1 and shorter exposure time than the oils of the other two plants. After 24 h and 48 h, 70% and 100% mortality of S. oryzae occurred, respectively. In fumigation assays, essential oil of Z. officinale had a lower LC50 (1.18 µL cm-2 and 70% mortality after 24 h exposure. Therefore, we recommend the use of essential oils of C. citratus and Z. officinale to control the rice weevil S. oryzae.

  12. STANDARDIZATION OF METHODOLOGY FOR STUDYING PATHOGENECITY OF XANTHOMONAS CAMPESTRIS PV ORYZAE TO RICE

    OpenAIRE

    Jaya Bhagat*, P Shukla and PK Mishra

    2013-01-01

    Rice is the most important food crop of India and its production has increased significantly during last few years. However, Infection of Xanthomonas campestris pv. Oryzae considerably decrease its productivity. It is important to study pathogenecity of causative organism before any defense strategy is decided. Present paper deals with standardization of technology for microscopic study of pathogen.

  13. Identification of molecular markers linked to rice bacterial blight resistance genes from Oryza meyeriana

    Directory of Open Access Journals (Sweden)

    Jing WANG,Chen CHENG,Yanru ZHOU,Yong YANG,Qiong MEI,Junmin LI,Ye CHENG,Chengqi YAN,Jianping CHEN

    2015-09-01

    Full Text Available Y73 is a progeny of asymmetric somatic hybridization between Oryza sativa cv. Dalixiang and the wild rice species Oryza meyeriana. Inoculation with a range of strains of Xanthomonas oryzae pv. oryzae showed that Y73 had inherited a high level of resistance to rice bacterial blight (BB from its wild parent. An F2 population of 7125 individuals was constructed from the cross between Y73 and a BB-susceptible cultivar IR24. After testing 615 SSR and STS markers covering the 12 rice chromosomes, 186 markers were selected that showed polymorphism between Y73 and IR24. Molecular markers linked to the BB resistance genes in Y73 were scanned using the F2 population and the polymorphic markers. The SSR marker RM128 on chromosome 1, the STS marker R03D159 on chromosome 3 and the STS marker R05D104 on chromosome 5 were found to be linked to the rice BB resistance genes in Y73.

  14. The chemical heritage of Aspergillus flavus in A. oryzae RIB 40

    DEFF Research Database (Denmark)

    Rank, Christian; Klejnstrup, Marie Louise; Petersen, Lene Maj;

    capable of producing aflatoxin. These species can be perceived as ecotypes. We have analyzed A. oryzae RIB40 and found that the chemical potential could be enhanced significantly under certain conditions. Delicate analysis of their metabolic profiles allow for chemical insight on the transcription level...

  15. Synthesis of quarternary ammonium salts with dithiocarbamate moiety and their antifungal activities against Helminthosporium oryzae

    Indian Academy of Sciences (India)

    Mandeep Singh; Anita Garg; Anjali Sidhu; Vineet Kumar

    2013-05-01

    Quaternary ammonium salts containing dithiocarbamate moiety were synthesized and evaluated for their antifungal activities against Helminthosporium oryzae. All the synthesized compounds showed moderate to promising fungitoxicity against the test. Some of the synthesized compounds inflicted antifungal activity greater than the standard fungicide.

  16. Identification of a RAPD marker linked to a blast resistance gene in Oryza sativa L.

    Institute of Scientific and Technical Information of China (English)

    LUJun; ZHUANGJieyun; LINHongxuan; ZHENGKangle

    1994-01-01

    Marker-aided selection has received more attention in recent years. This relies on the exploitation of close linkage between molecular markers and target gene(s). We report here a randomly amplified polymorphic DNA (RAID) marker tightly linked to the blast resistance gene Pi-11(t) derived from Hongjiaozhan, which confers the resistante to race ZBI of Pyricularia oryzae Car.

  17. Identification and characterization of a novel gene encoding the NBS1 protein in Pyricularia oryzae.

    Science.gov (United States)

    Narukawa-Nara, Megumi; Sasaki, Kengo; Ishii, Akira; Baba, Kouhei; Amano, Kanako; Kuroki, Misa; Saitoh, Ken-ichiro; Kamakura, Takashi

    2015-01-01

    The ascomycete Pyricularia oryzae (teleomorph: Magnaporthe oryzae) causes one of the most serious diseases known as rice blast. The Nijmegen breakage syndrome protein (NBS1) is essential for DNA repair; thus, we studied the P. oryzae NBS1 homolog (PoNBS1). A PoNBS1 null mutant exhibited high sensitivity to DNA damage-inducing agents. The mutant also exhibited the retarded hyphal growth, and induced abnormal conidial germination and shape, but showed normal appressorium formation. The phenotypes of the null mutant were complemented by introducing the cDNA of PoNBS1 driven by a TrpC promoter of Aspergillus nidulans. In addition, the null mutant similarly complemented with the PoNBS1 cDNA lacking the FHA domain that had a normal phenotype except for hyphal growth. These results suggest that PoNBS1 is involved in DNA repair and normal development in P. oryzae. Moreover, the FHA domain of PoNBS1 participates in normal hyphal growth. PMID:25774746

  18. Polyol accumulation by Aspergillus oryzae at low water activity in solid-state fermentation

    NARCIS (Netherlands)

    Ruijter, G.J.G.; Visser, J.; Rinzema, A.

    2004-01-01

    Polyol accumulation and metabolism were examined in Aspergillus oryzae cultured on whole wheat grains or on wheat dough as a model for solid-state culture. In solid-state fermentation (SSF), water activity (a(w)) is typically low resulting in osmotic stress. In addition to a high level of mannitol,

  19. Production of Ammonium Lactate by Fed-batch Fermentation of Rhizopus oryzae from Corncob Hydrolysate

    Institute of Scientific and Technical Information of China (English)

    BAI Dong-mei; LI Shi-zhong; LIN Fang-qian

    2004-01-01

    L- (+)-Lactic acid production from corncob hydrolysate as a cheap carbohydrate source by fed-batch fermentation of Rhizopus oryzae HZS6 was studied. After 96 h of fermentation in a 5 L fermentor, the final concentration of ammonium L-(+)-lactate, average productivity(based on initial xylose concentration) and max(+)-lactate was 98.8%.

  20. Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection

    Directory of Open Access Journals (Sweden)

    Yiming Wang

    2014-12-01

    Full Text Available Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L. in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10 by RT-PCR, and phytoalexins (sakuranetin and momilactone A with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05 in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack.

  1. A New Eudesmane Sesquiterpene from Nigrospora oryzae, an Endophytic Fungus of Aquilaria sinensis

    Directory of Open Access Journals (Sweden)

    Dongli Li

    2014-07-01

    Full Text Available A new eudesmane-type sesquiterpene, 11 -hydroxy capitulatin B (1 , along with a known related sesquiterpene, capitulatin B (2, was isolated from the endophytic fungus Nigrospora oryzae A8 from Aquilaria sinensis, the only plant resource for agarwood production in China. This research demonstrates that the endophytic fungi from A. sinensis might play a role in the formation of agarwood.

  2. Kinetic properties of Rhizopus oryzae RPG1 endo-polygalacturonase hydrolyzing galacturonic acid oligomers

    Science.gov (United States)

    Future fuel and specialty chemical production will benefit from the use of agricultural biomass. Efficient and effective use of agricultural biomass requires conversion to simple sugars by chemical pre-treatments and enzymes into simple sugars. Rhizopus oryzae, a filamentous fungus, makes enzymes ca...

  3. Measurement and analysis on optical characteristics of Aspergillus oryzae spores in infrared band

    Science.gov (United States)

    Li, Le; Hu, Yihua; Gu, Youlin; Chen, Wei; Xu, Shilong; Zhao, Xinying

    2015-10-01

    Spore is an important part of bioaerosols. The optical characteristics of spore is a crucial parameter for study on bioaerosols. The reflection within the waveband of 2.5 to15μm were measured by squash method. Based on the measured data, Complex refractive index of Aspergillus oryzae spores within the waveband of 3 to 5μm and 8 to 14 μm were calculated by using Krames-Kronig (K-K) relationship. Then,the mass extinction coefficient of Aspergillus oryzae spores within the waveband of 3 to 5μm and 8 to 14μm were obtained by utilizing Mie scattering theory, and the results were analyzed and discussed. The average mass extinction coefficient of Aspergillus oryzae spores is 0.51 m2/g in the range of 3 to 5μm and 0.48m2/g in the range of 8 to 14μm. Compared with common inorganic compounds, Aspergillus oryzae spores possesses a good extinction performance in infrared band.

  4. Natural variation of rice blast resistant gene Pi-ta in Oryza species

    Science.gov (United States)

    The Pi-ta gene in rice is a putative NBS type cytoplasmic receptor conferring resistance to races of Magnaporthe oryzae in a gene-for-gene manner. A Functional Nucleotide Polymorphism (FNP) change resulting in an amino acid substitution of Alanine to Serine at position 918 (nucleotide G to T at posi...

  5. INTERESTERIFICATION OF MILK-FAT WITH OLEIC-ACID CATALYZED BY IMMOBILIZED RHIZOPUS-ORYZAE LIPASE

    NARCIS (Netherlands)

    OBA, T; WITHOLT, B

    1994-01-01

    Milk fat was interesterified with oleic acid by catalysis of an immobilized lipase in a microaqueous two-phase system. A commercial lipase from Rhizopus oryzae and a controlled pore glass carrier were selected for preparation of an immobilized lipase. The prepared immobilized lipase showed a Michael

  6. Morphological characterization of recombinant strains of Aspergillus oryzae producing alpha-amylase during batch cultivations

    DEFF Research Database (Denmark)

    Spohr, Anders Bendsen; Carlsen, Morten; Nielsen, Jens Bredal;

    1997-01-01

    Three alpha-amylase producing strains of Aspergillus oryzae used for recombinant protein production have been studied with respect to growth and protein production. By comparing the three strains with respect to morphology and protein production it is shown that a morphological mutant with a more...... dense mycelium is more efficient in producing alpha-amylase....

  7. Metabolic engineering of the morphology of Aspergillus oryzae by altering chitin synthesis

    DEFF Research Database (Denmark)

    Muller, C.; Mcintyre, Mhairi; Hansen, Kim;

    2002-01-01

    Morphology and alpha-amylase production during submerged cultivation were examined in a wild-type strain (A1560) and in strains of Aspergillus oryzae in which chitin synthase B (chsB) and chitin synthesis myosin A (csmA) have been disrupted (ChsB/G and CM101). In a flowthrough cell, the growth of...

  8. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  9. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  10. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  11. Biochemical changes in the leaves of wheat plants infected by Pyricularia oryzae.

    Science.gov (United States)

    Debona, Daniel; Rodrigues, Fabrício Ávila; Rios, Jonas Alberto; Nascimento, Kelly Juliane Telles

    2012-12-01

    Blast, caused by the fungus Pyricularia oryzae, is a major disease of the wheat crop in the Brazilian Cerrado and represents a potential threat to world wheat production. However, information about the wheat-P. oryzae interaction is still limited. In this work, the activities of the enzymes superoxide dismutase (SOD), catalase (CAT), peroxidase (POX), glutathione-S-transferase (GST), ascorbate peroxidase (APX), glutathione reductase (GR), and glutathione peroxidase (GPX) and the concentrations of superoxide (O₂(-)), hydrogen peroxide (H₂O₂), and malondialdehyde (MDA) as well as the electrolyte leakage (EL) were studied in wheat plants 'BR 18' and 'BRS 229', which are susceptible and partially resistant, respectively, to leaf blast at the vegetative growth stage, during the infection process of P. oryzae. The blast severity in BRS 229 was 50% lower than in BR 18 at 96 h after inoculation (hai). The activities of SOD, POX, APX, and GST increased for both cultivars in the inoculated plants compared with noninoculated plants and the increases were more pronounced for BRS 229 than for BR 18 at 96 hai. The GR and CAT activities only increased in inoculated plants from BRS 229 at 96 hai. For BR 18, the GR activity was not influenced by plant inoculation, and the CAT activity was lower in inoculated plants. The GPX activity only increased in inoculated plants from BR 18 at 48 and 72 hai. The P. oryzae infection increased the O₂(-), H₂O₂, and MDA concentrations and EL. However, the greater increases of the SOD, POX, APX, GST, GR, and CAT activities for BRS 229 compared with BR 18 contributed to the lower O₂(-), H₂O₂, and MDA concentrations and EL verified in the former. These results show that a more efficient antioxidative system in the removal of excess of reactive oxygen species generated during the infection process of P. oryzae limits the cellular damage caused by the fungus, thus contributing to greater wheat resistance to blast. PMID:22913412

  12. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  13. AA, vacuum tank for stochastic precooling

    CERN Multimedia

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  14. AA, mating of BST magnet halves

    CERN Multimedia

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  15. Methodical characterization of rice ( Oryza sativa bran oil from Pakistan

    Directory of Open Access Journals (Sweden)

    Mahmood, Zahid

    2005-06-01

    Full Text Available The hexane-extracted oil content of four varieties of rice (Oryza sativa viz. Super Kernel, 386, 385 and Basmati, bran was ranged 14.70-19.10 %. Other physical and chemical parameters of the extracted oils were as follow: Iodine value 112.40, 109.80, 105.1 and 103.70; refractive index ( 40 °C 1.4650, 1.4680, 1.4657 and 1.4660; density ( 40 °C 0.919, 0.913, 0.909 and 0.911; saponification value 183, 177, 186 and 190; unsaponifiable matter 6.15, 5.60, 4.98 and 5.40 % respectively. Tocopherols ( α, γ and δ in the oils were: 284.00, 175.12, 180.42, 300.06; 83.40, 98.70, 120.70, 90.60; 75.16, 57.20, 39.32, 83.00 mg/kg respectively. The contents of tocotrienols ( α, γ and δ in the oils were: 120.30, 106.00, 95.20, 135.74; 196.00, 125.00, 210.0, 276.41; 72.50, 20.00, 39.30, 64.00 mg/kg respectively. The amount of γ - Oryzanol in the investigated oils was ranged 415.12-802.05 The induction periods (Rancimat, 20 L/h, 120 °C of the crude oils were 6.81, 5.99, 6.39 and 7.40 h respectively. The major sterol fractions of the oils consisted of campesterol ranged (10.10-19.20%, stigmasterol (14.00-19.28 %, b -sitosterol (49.30-58.20 %, and D5 ,avenasterol (8.14-13.05 %. The investigated varieties ( Super Kernel, 386, 385 and Basmati of rice bran oil were found to contain high levels of oleic acid 42.67, 38.59, 40.68 and 36.78 % followed by linoleic and palmitic acids 31.58, 33.80, 28.70, 30.51 and 17.00, 14.88, 19.63, 20.00 % respectively. The contents of myristic, stearic and arachidic acids was 1.50, 2.02, 4.28, 1.00; 2.64, 2.87, 4.02, 7.48; and 1.28, 3.00, 1.00, 1.00 % respectively. A number of parameters of the investigated rice bran oils indigenous to Pakistan were comparable to those of typical rice bran and some other vegetable oils, reported in the literature. The results of the present analysis as compared with those of different vegetable oils demonstrated rice bran to be a potential oil source and thus could be useful

  16. EValuation of the thixoformability of AA7004 and AA7075 alloys

    Directory of Open Access Journals (Sweden)

    Eugenio José Zoqui

    2010-09-01

    Full Text Available This study involved a complete evaluation of the thixoformability of AA7004 and AA7075 alloys, from their microstructural characterization to their viscous behavior. The alloys were subjected to globularization heat treatments for 0, 30, 90 and 210 seconds in two conditions of solid fractions, 45 and 60%, and to viscosity assays under the same conditions. Heat treatments promote the globularization of primary phase particles; hence, the best viscosity results were achieved for alloys with low solid fractions heat-treated for 210 seconds. Alloys AA7004 and AA7075 showed an apparent viscosity of 10(4 to 10(5 (Pa.s. The behavior of materials in this range is similar to that of molten glass and they show high formability. However, the AA7075 alloy showed a better performance than the AA7004 due to the smaller size of its primary particles and original grains, their lower growth during reheating, and depending on the condition, their viscosity of 10(4 Pa.s, which is extremely low for thixoforming standards.

  17. Processing and Optimization of Dissimilar Friction Stir Welding of AA 2219 and AA 7039 Alloys

    Science.gov (United States)

    Venkateswarlu, D.; Nageswara rao, P.; Mahapatra, M. M.; Harsha, S. P.; Mandal, N. R.

    2015-12-01

    The present paper discusses the optimization of dissimilar friction stir welding of AA 2219 and AA 7039 alloys with respect to tool design issues including microstructural study of weld. The optimized ultimate tensile strength was ~280 MPa, and % elongation was ~11.5. It was observed that the extent of tool shoulder flat surface and tool rotational speed influenced the weld quality significantly. A mathematical model was also developed using response surface regression analysis to predict the effects of tool geometry and process variables on dissimilar AA 2219 and AA 7039 alloys welds. The microstructure evolution and mechanical properties were investigated by employing electron backscatter diffraction technique, Vickers microhardness, and tensile testing, respectively. The microstructural observations indicated that the grain size obtained at advancing side (AA 2219 alloy side) was much finer compared to the retreating side (AA 7039 alloy side). Hardness distribution in the stir zone was inhomogeneous, which might be due to inadequate mixing of weld zone material. The hardness values observed at the weld zone were lower than that in the base materials.

  18. Genetic and physical mapping of AvrPi7, a novel avirulence gene of Magnaporthe oryzae using physical position-ready markers

    Institute of Scientific and Technical Information of China (English)

    FENG ShuJie; WANG Ling; MA JunHong; LIN Fei; PAN QingHua

    2007-01-01

    Rice blast, caused by the fungal pathogen Magnaporthe oryzae, is one of the most devastating crop diseases worldwide. The avirulence gene corresponding to rice blast resistance gene Pi7 in field isolate CHL346 was inherited as a single gene, designated AvrPi7, in a segregating population consisting of 189 ascospore progenies derived from a cross between field isolates CHL346 and CHL42. In order to determine the chromosomal location of the AvrPi7 locus, a total of 121 simple sequence repeat (SSR) markers were developed based on the whole-genome sequence of reference isolate 70-15 of M. oryzae.Linkage analysis of the locus with these SSR markers showed that eight SSR markers on chromosome1 were linked to the locus, among which the closest flanking markers MS1-9 and MS1-15 were 3.2 and 16.4 cM from the locus, respectively. For fine mapping, additional PCR-based makers including eight SSR markers and three candidate avirulence gene (CAG) markers were developed in the region flanking both markers. The AvrPi7 locus was genetically delimited within a 1.6-cM region flanked by markers MS1-21 and MS1-22, and co-segregated with the marker CAG2. To construct a physical map of the AvrPi7 locus, molecular markers linked to the Avr gene were mapped on the supercontigs of the reference isolate 70-15 through bioinformation analysis (BIA). Consequently, the AvrPi7 locus was delimited to a 75-kb interval flanked by markers MS1-21 and MS1-22 based on the reference sequence.Merodiploids observed in this study are also discussed.

  19. Dicty_cDB: FC-AA11 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  20. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  1. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  2. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  3. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  4. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  5. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  6. Dicty_cDB: FC-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  7. Dicty_cDB: FC-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  8. Transcriptome profiling of the intoxication response of Tenebrio molitor larvae to Bacillus thuringiensis Cry3Aa protoxin.

    Directory of Open Access Journals (Sweden)

    Brenda Oppert

    Full Text Available Bacillus thuringiensis (Bt crystal (Cry proteins are effective against a select number of insect pests, but improvements are needed to increase efficacy and decrease time to mortality for coleopteran pests. To gain insight into the Bt intoxication process in Coleoptera, we performed RNA-Seq on cDNA generated from the guts of Tenebrio molitor larvae that consumed either a control diet or a diet containing Cry3Aa protoxin. Approximately 134,090 and 124,287 sequence reads from the control and Cry3Aa-treated groups were assembled into 1,318 and 1,140 contigs, respectively. Enrichment analyses indicated that functions associated with mitochondrial respiration, signalling, maintenance of cell structure, membrane integrity, protein recycling/synthesis, and glycosyl hydrolases were significantly increased in Cry3Aa-treated larvae, whereas functions associated with many metabolic processes were reduced, especially glycolysis, tricarboxylic acid cycle, and fatty acid synthesis. Microarray analysis was used to evaluate temporal changes in gene expression after 6, 12 or 24 h of Cry3Aa exposure. Overall, microarray analysis indicated that transcripts related to allergens, chitin-binding proteins, glycosyl hydrolases, and tubulins were induced, and those related to immunity and metabolism were repressed in Cry3Aa-intoxicated larvae. The 24 h microarray data validated most of the RNA-Seq data. Of the three intoxication intervals, larvae demonstrated more differential expression of transcripts after 12 h exposure to Cry3Aa. Gene expression examined by three different methods in control vs. Cry3Aa-treated larvae at the 24 h time point indicated that transcripts encoding proteins with chitin-binding domain 3 were the most differentially expressed in Cry3Aa-intoxicated larvae. Overall, the data suggest that T. molitor larvae mount a complex response to Cry3Aa during the initial 24 h of intoxication. Data from this study represent the largest genetic sequence

  9. Identification of a Rice stripe necrosis virus resistance locus and yield component QTLs using Oryza sativa × O. glaberrima introgression lines

    Directory of Open Access Journals (Sweden)

    Prado Gustavo

    2010-01-01

    Full Text Available Abstract Background Developing new population types based on interspecific introgressions has been suggested by several authors to facilitate the discovery of novel allelic sources for traits of agronomic importance. Chromosome segment substitution lines from interspecific crosses represent a powerful and useful genetic resource for QTL detection and breeding programs. Results We built a set of 64 chromosome segment substitution lines carrying contiguous chromosomal segments of African rice Oryza glaberrima MG12 (acc. IRGC103544 in the genetic background of Oryza sativa ssp. tropical japonica (cv. Caiapó. Well-distributed simple-sequence repeats markers were used to characterize the introgression events. Average size of the substituted chromosomal segments in the substitution lines was about 10 cM and covered the whole donor genome, except for small regions on chromosome 2 and 4. Proportions of recurrent and donor genome in the substitution lines were 87.59% and 7.64%, respectively. The remaining 4.78% corresponded to heterozygotes and missing data. Strong segregation distortion was found on chromosomes 3 and 6, indicating the presence of interspecific sterility genes. To illustrate the advantages and the power of quantitative trait loci (QTL detection using substitution lines, a QTL detection was performed for scored traits. Transgressive segregation was observed for several traits measured in the population. Fourteen QTLs for plant height, tiller number per plant, panicle length, sterility percentage, 1000-grain weight and grain yield were located on chromosomes 1, 3, 4, 6 and 9. Furthermore, a highly significant QTL controlling resistance to the Rice stripe necrosis virus was located between SSR markers RM202-RM26406 (44.5-44.8 cM on chromosome 11. Conclusions Development and phenotyping of CSSL libraries with entire genome coverage represents a useful strategy for QTL discovery. Mapping of the RSNV locus represents the first identification

  10. Comparative sequence analysis of the Ghd7 orthologous regions revealed movement of Ghd7 in the grass genomes.

    Directory of Open Access Journals (Sweden)

    Lu Yang

    Full Text Available Ghd7 is an important rice gene that has a major effect on several agronomic traits, including yield. To reveal the origin of Ghd7 and sequence evolution of this locus, we performed a comparative sequence analysis of the Ghd7 orthologous regions from ten diploid Oryza species, Brachypodium distachyon, sorghum and maize. Sequence analysis demonstrated high gene collinearity across the genus Oryza and a disruption of collinearity among non-Oryza species. In particular, Ghd7 was not present in orthologous positions except in Oryza species. The Ghd7 regions were found to have low gene densities and high contents of repetitive elements, and that the sizes of orthologous regions varied tremendously. The large transposable element contents resulted in a high frequency of pseudogenization and gene movement events surrounding the Ghd7 loci. Annotation information and cytological experiments have indicated that Ghd7 is a heterochromatic gene. Ghd7 orthologs were identified in B. distachyon, sorghum and maize by phylogenetic analysis; however, the positions of orthologous genes differed dramatically as a consequence of gene movements in grasses. Rather, we identified sequence remnants of gene movement of Ghd7 mediated by illegitimate recombination in the B. distachyon genome.

  11. Over-expression of gluconic acid in Aspergillus oryzae RP-21 mutants generated by a random mutagenesis approach

    OpenAIRE

    Raksha, Sunhare; Srinivasan, Sharmila; Prasant, Garima; Prabu, Rajagopalan

    2012-01-01

    Random mutagenesis with N-methyl-N′ nitro-N-nitrosoguanidine (NTG) was used to mutate Aspergillus oryzae RP-21 to develop high gluconic acid-producing mutants. Forty mutant colonies (designated as A. oryzae strains RP-NTG-01 to RP-NTG-40) screened for gluconic acid, glucose dehydrogenase and glucose oxidase production using a 12-well plate method showed that 17 strains (positive mutants) produced high concentrations of these three products, whereas 12 strains (negative mutants) showed low con...

  12. Antifungal Activity of Colistin against Mucorales Species In Vitro and in a Murine Model of Rhizopus oryzae Pulmonary Infection▿

    OpenAIRE

    Ben-Ami, Ronen; Lewis, Russell E.; Tarrand, Jeffrey; Leventakos, Konstantinos; Kontoyiannis, Dimitrios P.

    2009-01-01

    In immunosuppressed hosts, mucormycosis is a life-threatening infection with few treatment options. We studied the activity of colistin (polymyxin E) against Mucorales species in vitro and in a murine model of pulmonary Rhizopus oryzae infection. Colistin exhibited fungicidal activity in vitro against Mucorales spores and mycelia. At the colistin MIC, initial R. oryzae hyphal damage was followed by rapid regrowth; however, regrowth was prevented by combining colistin with a subinhibitory conc...

  13. Purification, characterization and antiproliferative activity of l-asparaginase from Aspergillus oryzae CCT 3940 with no glutaminase activity

    Directory of Open Access Journals (Sweden)

    Fernanda Furlan Gonçalves Dias

    2016-09-01

    Conclusions: The sensitivity of the cells lines to purified l-asparaginase from A. oryzae CCT 3940 appeared to be concentration dependent affording a more significant decrease in cell growth than that observed for the commercial l-asparaginase from Escherichia coli. The l-asparaginase from A. oryzae CCT 3940 has a high potential for pharmaceutical exploitation in the treatment of leukemia.

  14. A MAP kinase gene, BMK1, is required for conidiation and pathogenicity in the rice leaf spot pathogen Bipolaris oryzae.

    Science.gov (United States)

    Moriwaki, Akihiro; Kihara, Junichi; Mori, Chie; Arase, Sakae

    2007-01-01

    We isolated and characterized BMK1, a gene encoding a mitogen-activated protein kinase (MAPK), from the rice leaf spot pathogen Bipolaris oryzae. The deduced amino acid sequence showed significant homology with Fus3/Kss1 MAPK homologues from other phytopathogenic fungi. The BMK1 disruptants showed impaired hyphal growth, no conidial production, and loss of virulence against rice leaves, indicating that the BMK1 is essential for conidiation and pathogenicity in B. oryzae. PMID:16546358

  15. Uji Antagonisme Jamur Endofit Dari Tanaman Padi Terhadap Cercospora oryzae Miyake dan Curvularia lunata (Wakk) Boed. di Laboratorium

    OpenAIRE

    Manurung, Ida Rumia

    2015-01-01

    Ida Rumia Manurung. 2014. “Antagonism Test Between Endophytic Fungi From Rice Against Cercospora oryzae Miyake and Curvularia lunata (Wakk) Boed. in Laboratory”, supervised by Mukhtar Iskandar Pinem and Lahmuddin Lubis. This research aimed to know antagonism ability of endophytic fungi to control C. oryzae and C. lunata in laboratory. This research was held at Plant Disease Laboratory, Agroecotechnology Program Study, Faculty of Agriculture, University of Sumatera Utara with ...

  16. 水稻和拟南芥中几丁质酶的分析%Chitinases in Oryza sativa ssp. japonica and Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    许凤华; 范成明; 何月秋

    2007-01-01

    Chitinases (EC3.2.1.14), found in a wide range of organisms, catalyze the hydrolysis of chitin and play a major role in defense mechanisms against fungal pathogens. The alignment and typical domains were analyzed using basic local alignment search tool (BLAST) and simple modular architecture research tool (SMART), respectively. On the basis of the annotations of rice (Oryza sativa L.) and Arabidopsis genomic sequences and using the bio-software SignalP3.0, TMHMM2.0, TargetPl.1, and big-Pi Predictor, 25 out of 37 and 16 out of 24 open reading frames (ORFs) with chitinase activity from rice and Arabidopsis, respectively, were predicted to have signal peptides (SPs), which have an average of 24.8 amino acids at the N-terminal region. Some of the chitinases were secreted extracellularly, whereas some were located in the vacuole. The phylogenic relationship was analyzed with 61 ORFs and 25 known chitinases and they were classified into 6 clusters using Clustal X and MEGA3.1. This classification is not completely consistent when compared with the traditional system that classifies the chitinases into 7 classes. The frequency of distribution of amino acid residues was distinct in different clusters. The contents of alanine, glycine, serine, and leucine were very high in each cluster, whereas the contents of methionine, histidine, tryptophan, and cysteine were lower than 20%. Each cluster had distinct amino acid characteristics. Alanine, valine, leucine, cysteine, serine, and lysine were rich in Clusters Ⅰ to Ⅵ, respectively.%几丁质酶(EC3.2.1.14)是一种降解几丁质的糖苷酶,广泛存在于各种生物体中,并在植物中对病原真菌起重要抗性作用.首先通过BLAST在GenBank中对其同源性进行搜索,用SMART分析其结构.基于水稻和拟南芥的基因组注释,借助4个生物学软件(SignalP3.0,TMHMM2.0,TargetP1.1 and big-Pi Predictor),分析了水稻所有37条和拟南芥所有24条几丁质酶序列,发现有些几丁质酶都分

  17. Tc1-like transposable elements in plant genomes

    Science.gov (United States)

    2014-01-01

    Background The Tc1/mariner superfamily of transposable elements (TEs) is widespread in animal genomes. Mariner-like elements, which bear a DDD triad catalytic motif, have been identified in a wide range of flowering plant species. However, as the founding member of the superfamily, Tc1-like elements that bear a DD34E triad catalytic motif are only known to unikonts (animals, fungi, and Entamoeba). Results Here we report the identification of Tc1-like elements (TLEs) in plant genomes. These elements bear the four terminal nucleotides and the characteristic DD34E triad motif of Tc1 element. The two TLE families (PpTc1, PpTc2) identified in the moss (Physcomitrella patens) genome contain highly similar copies. Multiple copies of PpTc1 are actively transcribed and the transcripts encode intact full length transposase coding sequences. TLEs are also found in angiosperm genome sequence databases of rice (Oryza sativa), dwarf birch (Betula nana), cabbage (Brassica rapa), hemp (Cannabis sativa), barley (Hordium valgare), lettuce (Lactuta sativa), poplar (Populus trichocarpa), pear (Pyrus x bretschneideri), and wheat (Triticum urartu). Conclusions This study extends the occurrence of TLEs to the plant phylum. The elements in the moss genome have amplified recently and may still be capable of transposition. The TLEs are also present in angiosperm genomes, but apparently much less abundant than in moss. PMID:24926322

  18. Insular organization of gene space in grass genomes.

    Directory of Open Access Journals (Sweden)

    Andrea Gottlieb

    Full Text Available Wheat and maize genes were hypothesized to be clustered into islands but the hypothesis was not statistically tested. The hypothesis is statistically tested here in four grass species differing in genome size, Brachypodium distachyon, Oryza sativa, Sorghum bicolor, and Aegilops tauschii. Density functions obtained under a model where gene locations follow a homogeneous Poisson process and thus are not clustered are compared with a model-free situation quantified through a non-parametric density estimate. A simple homogeneous Poisson model for gene locations is not rejected for the small O. sativa and B. distachyon genomes, indicating that genes are distributed largely uniformly in those species, but is rejected for the larger S. bicolor and Ae. tauschii genomes, providing evidence for clustering of genes into islands. It is proposed to call the gene islands "gene insulae" to distinguish them from other types of gene clustering that have been proposed. An average S. bicolor and Ae. tauschii insula is estimated to contain 3.7 and 3.9 genes with an average intergenic distance within an insula of 2.1 and 16.5 kb, respectively. Inter-insular distances are greater than 8 and 81 kb and average 15.1 and 205 kb, in S. bicolor and Ae. tauschii, respectively. A greater gene density observed in the distal regions of the Ae. tauschii chromosomes is shown to be primarily caused by shortening of inter-insular distances. The comparison of the four grass genomes suggests that gene locations are largely a function of a homogeneous Poisson process in small genomes. Nonrandom insertions of LTR retroelements during genome expansion creates gene insulae, which become less dense and further apart with the increase in genome size. High concordance in relative lengths of orthologous intergenic distances among the investigated genomes including the maize genome suggests functional constraints on gene distribution in the grass genomes.

  19. Comparative study on the antifungal activity of hydroalcoholic extract of Iranian Propolis and Royal jelly against Rhizopus oryzae

    Directory of Open Access Journals (Sweden)

    Moghim Hassan

    2015-07-01

    Full Text Available Introduction: Mucormycosis is an opportunistic fungal infection. Rhizopus oryzae is major cause of mucormycosis in humans. This disease is the most common form of the acute fungal infection with rapid progress. Iranian Propolis extract and Royal jelly are honey bee products which have been used by human over the past centuries in traditional medicine. In this study the effects of Iranian Propolis and Royal jelly were investigated against Rhizopus oryzae and Candida albicans. Methods: The used method in this study was microdilution. To perform it, the prepared dilutions of Royal jelly and alcoholic extract of Iranian Propolis were added to tubes containing Sabouraud dextrose broth culture media except to control group and then Rhizopus oryzae suspension was added to all microtubes. In the next stage, microtubes were maintained in incubator at 25oC for 48 hours and then 10 ml of the content of each microtube was transferred to Sabouraud dextrose agar media. The minimum inhibitory concentration (MIC and minimum fungicidal concentration (MFC of the agents were calculated. Results: In this study, the MIC and MFC of Iranian Propolis alcoholic extract on Rhizopus oryzae were respectively 0.1 and 0.25 mg/ml and the MFC of Royal jelly on Rhizopus oryzae were respectively 100 ± 34 and 133 ± 46 mg/ml. Conclusion: The results indicate that Propolis might be used as an ideal combination for the treatment of fungal infections like Rhizopus oryzae. However, clinical studies are needed to confirm the effects of these drugs.

  20. NCBI nr-aa BLAST: CBRC-OSAT-07-0001 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OSAT-07-0001 ref|NP_001064403.1| Os10g0348600 [Oryza sativa (japonica cultivar...-group)] gb|AAM74420.1|AC123594_3 Hypothetical protein [Oryza sativa (japonica cultivar-group)] gb|AAN05362....1| Unknown protein [Oryza sativa (japonica cultivar-group)] gb|AAP53188.1| expressed protein [Oryza sativa (japonica cultiva...r-group)] dbj|BAF26317.1| Os10g0348600 [Oryza sativa (japonica cultiva...r-group)] gb|EAZ15766.1| hypothetical protein OsJ_029975 [Oryza sativa (japonica cultivar-group)] NP_001064403.1 0.0 61% ...

  1. NCBI nr-aa BLAST: CBRC-OSAT-06-0003 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OSAT-06-0003 ref|NP_001056631.1| Os06g0119100 [Oryza sativa (japonica cultivar...-group)] dbj|BAD68563.1| unknown protein [Oryza sativa (japonica cultivar-group)] dbj|BAD68369.1| unknown protein [Oryza sativa... (japonica cultivar-group)] dbj|BAF18545.1| Os06g0119100 [Oryza sativa (japonica cultivar...-group)] gb|EAY99430.1| hypothetical protein OsI_020663 [Oryza sativa (indica cultiva...r-group)] gb|EAZ35629.1| hypothetical protein OsJ_019112 [Oryza sativa (japonica cultivar-group)] NP_001056631.1 0.0 100% ...

  2. NCBI nr-aa BLAST: CBRC-OSAT-04-0058 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OSAT-04-0058 ref|NP_001054248.1| Os04g0675500 [Oryza sativa (japonica cultivar...-group)] emb|CAE03245.2| OSJNBa0018M05.20 [Oryza sativa (japonica cultivar-group)] emb|CAJ86104.1| H0103C06.8 [Oryza sativa... (indica cultivar-group)] dbj|BAF16162.1| Os04g0675500 [Oryza sativa (japonica cultivar-group...)] gb|EAY96032.1| hypothetical protein OsI_017265 [Oryza sativa (indica cultivar-...group)] gb|EAZ32398.1| hypothetical protein OsJ_015881 [Oryza sativa (japonica cultivar-group)] NP_001054248.1 1e-162 100% ...

  3. NCBI nr-aa BLAST: CBRC-OSAT-06-0012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OSAT-06-0012 ref|NP_001057075.1| Os06g0201200 [Oryza sativa (japonica cultivar...-group)] dbj|BAD35589.1| unknown protein [Oryza sativa (japonica cultivar-group)] dbj|BAD36659.1| unknown protein [Oryza sativa... (japonica cultivar-group)] dbj|BAF18989.1| Os06g0201200 [Oryza sativa (japonica cultivar...-group)] gb|EAZ00057.1| hypothetical protein OsI_021289 [Oryza sativa (indica cultiva...r-group)] gb|EAZ36177.1| hypothetical protein OsJ_019660 [Oryza sativa (japonica cultivar-group)] NP_001057075.1 3e-12 41% ...

  4. Endogenous florendoviruses are major components of plant genomes and hallmarks of virus evolution.

    Science.gov (United States)

    Geering, Andrew D W; Maumus, Florian; Copetti, Dario; Choisne, Nathalie; Zwickl, Derrick J; Zytnicki, Matthias; McTaggart, Alistair R; Scalabrin, Simone; Vezzulli, Silvia; Wing, Rod A; Quesneville, Hadi; Teycheney, Pierre-Yves

    2014-01-01

    The extent and importance of endogenous viral elements have been extensively described in animals but are much less well understood in plants. Here we describe a new genus of Caulimoviridae called 'Florendovirus', members of which have colonized the genomes of a large diversity of flowering plants, sometimes at very high copy numbers (>0.5% total genome content). The genome invasion of Oryza is dated to over 1.8 million years ago (MYA) but phylogeographic evidence points to an even older age of 20-34 MYA for this virus group. Some appear to have had a bipartite genome organization, a unique characteristic among viral retroelements. In Vitis vinifera, 9% of the endogenous florendovirus loci are located within introns and therefore may influence host gene expression. The frequent colocation of endogenous florendovirus loci with TA simple sequence repeats, which are associated with chromosome fragility, suggests sequence capture during repair of double-stranded DNA breaks. PMID:25381880

  5. Microstructure analysis of aluminum extrusion: grain size distribution in AA6060, AA6082 and AA7075 alloys

    Energy Technology Data Exchange (ETDEWEB)

    Schikorra, M.; Tekkaya, A. E. [Institute of Forming Technology and Lightweight Construction, Dortmund (Germany); Donate, L.; Iomesani, L. [University of Bologna, Bologna (Italy)

    2007-10-15

    Microstructure and material flow of aluminum alloys have a significant influence on the mechanical properties and surface quality. In extrusion of aluminum billets at high temperatures the microstructure is dependent on the alloy and the forming and temperature history. A prediction of grain size and precipitation is of increasing importance in order to design the process by adjustment of parameters such as punch speed, temperatures, and quenching. To give references for microstructure prediction based on material flow, and with it strain and strain rate history, this paper deals with the microstructure during the extrusion process of AA6060, AA6082, and AA7075 alloys. Billets have been partly extruded to axisymmetric round profiles and the microstructure of the press rests consisting of the billet rests in container and die has been considered. Furthermore, these rests have been analyzed to show the material flow, dynamic and static recrystallization based on macro etchings and visible microstructure under different conditions, e.g. as in the area of high strain rate near the container wall, or in dead zones. To allow an accurate simulation of the extrusion process, punch force and temperature conditions during the tests have been measured and are presented in this paper, too.

  6. Transgenerational inheritance of modified DNA methylation patterns and enhanced tolerance induced by heavy metal stress in rice (Oryza sativa L..

    Directory of Open Access Journals (Sweden)

    Xiufang Ou

    Full Text Available BACKGROUND: DNA methylation is sensitive and responsive to stressful environmental conditions. Nonetheless, the extent to which condition-induced somatic methylation modifications can impose transgenerational effects remains to be fully understood. Even less is known about the biological relevance of the induced epigenetic changes for potentially altered well-being of the organismal progenies regarding adaptation to the specific condition their progenitors experienced. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed DNA methylation pattern by gel-blotting at genomic loci representing transposable elements and protein-coding genes in leaf-tissue of heavy metal-treated rice (Oryza sativa plants (S0, and its three successive organismal generations. We assessed expression of putative genes involved in establishing and/or maintaining DNA methylation patterns by reverse transcription (RT-PCR. We measured growth of the stressed plants and their unstressed progenies vs. the control plants. We found (1 relative to control, DNA methylation patterns were modified in leaf-tissue of the immediately treated plants, and the modifications were exclusively confined to CHG hypomethylation; (2 the CHG-demethylated states were heritable via both maternal and paternal germline, albeit often accompanying further hypomethylation; (3 altered expression of genes encoding for DNA methyltransferases, DNA glycosylase and SWI/SNF chromatin remodeling factor (DDM1 were induced by the stress; (4 progenies of the stressed plants exhibited enhanced tolerance to the same stress their progenitor experienced, and this transgenerational inheritance of the effect of condition accompanying heritability of modified methylation patterns. CONCLUSIONS/SIGNIFICANCE: Our findings suggest that stressful environmental condition can produce transgenerational epigenetic modifications. Progenies of stressed plants may develop enhanced adaptability to the condition, and this acquired trait is

  7. Association Mapping for Drought Tolerance of Rice (Oryza sativa L.) at Vegetative Stage

    Institute of Scientific and Technical Information of China (English)

    Yulong XIAO; Chuanyuan YU; Jianguo LEI; Quirino D; DELA CRUZ; Jonalyn M.YABES; Dindo A.TABANAo

    2012-01-01

    [Objective] This study aimed to identify possible quantitative trait loci (QTL) for vegetative drought tolerance traits of rice (Oryza sativa L.). [Method] A total of 184 rice genotypes were field screened and 156 SSR markers randomly distributed at each 3 Mb bin were used through genome-wide scanning method and association analysis to detect QTLs for vegetative drought tolerance traits leaf rolling (LER), leaf drying (LED) and drought recovery rate (DRR). [Result] The experimental rice geno- types showed varied response under vegetative drought, LER, LED and DRR were highly correlated. Population structure was detected at K=3 and K=7, certain extent of admixture existed in the experimental rice genotypes, relative kinship of the rice genotypes ranged from 0 to 0.924 5. Significant linkage disequilibrium among SSR markers was detected. Sixteen SSR markers have been detected to be associated with vegetative drought tolerance traits, four for LER, eight for LED and four for DDR. Most of the markers were associated with more than one trait, indicating a single mechanism might involve in expression of several related traits, i.e. osmotic adjustment. RM107 (Chr.9) was associated with all the three traits and fell exactly within or closely nearby to previous reported regions, was a major QTL for vegeta- tive drought tolerance, RM477 (Chr.8) was significantly associated with DRR and ex- tremely significantly associated with LER was probably another major QTL for vege- tative drought tolerance. [Conclusion] Association mapping is a very effective method for describing complex traits like drought tolerance.

  8. Absorption spectra of AA-stacked graphite

    Energy Technology Data Exchange (ETDEWEB)

    Chiu, C W; Lee, S H; Chen, S C; Lin, M F [Department of Physics, National Cheng Kung University, Taiwan (China); Shyu, F L, E-mail: fl.shyu@msa.hinet.ne, E-mail: mflin@mail.ncku.edu.t [Department of Physics, ROC Military Academy, 830 Kaohsiung, Taiwan (China)

    2010-08-15

    AA-stacked graphite shows strong anisotropy in geometric structures and velocity matrix elements. However, the absorption spectra are isotropic for the polarization vector on the graphene plane. The spectra exhibit one prominent plateau at middle energy and one shoulder structure at lower energy. These structures directly reflect the unique geometric and band structures and provide sufficient information for experimental fitting of the intralayer and interlayer atomic interactions. On the other hand, monolayer graphene shows a sharp absorption peak but no shoulder structure; AA-stacked bilayer graphene has two absorption peaks at middle energy and abruptly vanishes at lower energy. Furthermore, the isotropic features are expected to exist in other graphene-related systems. The calculated results and the predicted atomic interactions could be verified by optical measurements.

  9. Physiological characterization of the high malic acid-producing Aspergillus oryzae strain 2103a-68

    DEFF Research Database (Denmark)

    Knuf, Christoph; Nookaew, Intawat; Remmers, Ilse;

    2014-01-01

    chemical, microbial production requires organisms that sustain high rates, yields, and titers. Aspergillus oryzae is mainly known as an industrial enzyme producer, but it was also shown that it has a very competitive natural production capacity for malic acid. Recently, an engineered A. oryzae strain, 2103......Malic acid is a C4 dicarboxylic acid that is currently mainly used in the food and beverages industry as an acidulant. Because of the versatility of the group of C4 dicarboxylic acids, the chemical industry has a growing interest in this chemical compound. As malic acid will be considered as a bulk......a-68, was presented which overexpressed pyruvate carboxylase, malate dehydrogenase, and a malic acid transporter. In this work, we report a detailed characterization of this strain including detailed rates and yields under malic acid production conditions. Furthermore, transcript levels of the genes...

  10. Biological Control of Rice Blast (Magnaporthe oryzae by use of Streptomyces sindeneusis isolate 263 in Greenhouse

    Directory of Open Access Journals (Sweden)

    M. E. Zarandi

    2009-01-01

    Full Text Available Soil Actinomycetes particularly Streptomyces spp. have antagonistic activity against wide range of plant pathogens. In the recent decades they have attracted high interests as biocontrol agents. In search for finding such principles, in vitro suppression of Magnaporthe oryzae the causal agent of rice blast disease was studied by use of Streptomyces sindeneusis isolate 263 in greenhouse. Spray of rice seedling-leaves with of mixed spore suspension of the pathogen and S. sindeneusis isolate 263 resulted in strong inhibition of the pathogen and suppression of leaf symptoms. Propagation of the antagonist crude sap was performed in aqueous cultures and bioactivity was monitored in shaked cultures. Ongoing goals of this research include isolation, characterization and identification of the active metabolites and future goals include identification of active genes for use in development of recombinant DNAs in transgenic rice varieties bearing elevated resistance to infections by M. oryzae.

  11. Rmg8, a New Gene for Resistance to Triticum Isolates of Pyricularia oryzae in Hexaploid Wheat.

    Science.gov (United States)

    Anh, Vu Lan; Anh, Nguyen Tuan; Tagle, Analiza Grubanzo; Vy, Trinh Thi Phuong; Inoue, Yoshihiro; Takumi, Shigeo; Chuma, Izumi; Tosa, Yukio

    2015-12-01

    Blast, caused by Pyricularia oryzae, is one of the major diseases of wheat in South America. We identified a new gene for resistance to Triticum isolates of P. oryzae in common wheat 'S-615', and designated it "resistance to Magnaporthe grisea 8" (Rmg8). Rmg8 was assigned to chromosome 2B through molecular mapping with simple-sequence repeat markers. To identify an avirulence gene corresponding to Rmg8, Triticum isolate Br48 (avirulent on S-615) was crossed with 200R29 (virulent on S-615), an F1 progeny derived from a cross between an Eleusine isolate (MZ5-1-6) and Br48. Segregation analysis of their progeny revealed that avirulence of Br48 on S-615 was conditioned by a single gene, which was designated AVR-Rmg8. AVR-Rmg8 was closely linked to AVR-Rmg7, which corresponded to Rmg7 located on chromosome 2A of tetraploid wheat. PMID:26555672

  12. Mitotic stopwatch for the blast fungus Magnaporthe oryzae during invasion of rice cells.

    Science.gov (United States)

    Jones, Kiersun; Jenkinson, Cory B; Borges Araújo, Maíra; Zhu, Jie; Kim, Rebecca Y; Kim, Dong Won; Khang, Chang Hyun

    2016-08-01

    To study nuclear dynamics of Magnaporthe oryzae, we developed a novel mitotic reporter strain with GFP-NLS (localized in nuclei during interphase but in the cytoplasm during mitosis) and H1-tdTomato (localized in nuclei throughout the cell cycle). Time-lapse confocal microscopy of the reporter strain during host cell invasion provided several new insights into nuclear division and migration in M. oryzae: (i) mitosis lasts about 5min; (ii) mitosis is semi-closed; (iii) septal pores are closed during mitosis; and (iv) a nucleus exhibits extreme constriction (approximately from 2μm to 0.5μm), elongation (over 5μm), and long migration (over 16μm). Our observations raise new questions about mechanisms controlling the mitotic dynamics, and the answers to these questions may result in new means to prevent fungal proliferation without negatively affecting the host cell cycle. PMID:27321562

  13. Investigating the biology of plant infection by the rice blast fungus Magnaporthe oryzae.

    Science.gov (United States)

    Martin-Urdiroz, Magdalena; Oses-Ruiz, Miriam; Ryder, Lauren S; Talbot, Nicholas J

    2016-05-01

    The rice blast fungus, Magnaporthe oryzae, is responsible for the most serious disease of rice and is a continuing threat to ensuring global food security. The fungus has also, however, emerged as a model experimental organism for understanding plant infection processes by pathogenic fungi. This is largely due to its amenability to both classical and molecular genetics, coupled with the efforts of a very large international research community. This review, which is based on a plenary presentation at the 28th Fungal Genetics Conference in Asilomar, California in March 2015, describes recent progress in understanding how M. oryzae uses specialised cell called appressoria to bring about plant infection and the underlying biology of this developmental process. We also review how the fungus is then able to proliferate within rice tissue, deploying effector proteins to facilitate its spread by suppressing plant immunity and promoting growth and development of the fungus.

  14. Gene Expression Proifling Related to Hyphal Growth in a Temperature- Sensitive Mutant ofMagnaporthe oryzae

    Institute of Scientific and Technical Information of China (English)

    LI Xue-song; XU Fei; WANG Hong-kai; and LIN Fu-cheng

    2013-01-01

    The rice blast, caused by fungusMagnaporthe oryzae, is a major constraint to the world food security. Hyphal growth is the foundation of fungal development and proliferation of fungi. To investigate genes involved in hyphal growth of this fungus, digital gene expression tag proifling was used to compare a previously generated temperature-sensitive mutant which defect at hyphae growth and reduction on pathogenicity, with its related wildtype strain. 416 genes were detected as differential expression, 178 of which were speciifcally expressed in Guy-11 but down-regulated expression in the mutant. Functional classiifcation analysis revealed the phenotype mutation may be mainly caused by a defection in translational and vacuole-related processes. The results and the protocol used will improve our knowledge on morphogenesis and promote the further study onM. oryzae pathogenesis.

  15. AA, inner conductor of a magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  16. Research in development: the approach of AAS

    OpenAIRE

    Dugan, P.; Apgar, M.; Douthwaite, B.

    2013-01-01

    The CGIAR Research Program on Aquatic Agricultural Systems (AAS) is pursuing a Research in Development approach that emphasizes the importance of embedding research in the development context. Reflecting this emphasis the six elements of this approach are a commitment to people and place, participatory action research, gender transformative research, learning and networking, partnerships, and capacity building. It is through the careful pursuit of these six elements that we believe that the p...

  17. First circulating beam in the AA

    CERN Multimedia

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  18. AA Prototype-Quadrupole on Measurement Stand

    CERN Multimedia

    1979-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although rather short (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built at CERN in 1978. Here we see it on its test stand, with a measurement coil inserted, Brian Pincott taking readings.

  19. AA, assembly of wide bending magnet

    CERN Multimedia

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  20. AA Prototype-Quadrupole on Measurement Stand

    CERN Multimedia

    1978-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although not very long (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built in 1978. Here we see it on its test stand, with Ray Brown positioning the measurement coil.

  1. Introducing the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Gurton, S.; Fienberg, R. T.; Fraknoi, A.; Prather, E. E.

    2013-04-01

    Newly established by the American Astronomical Society (AAS), the Astronomy Ambassadors program is designed to support early-career AAS members with training in resources and techniques for effective outreach to students and/or the public. A pilot Astronomy Ambassadors workshop will be held at the January 2013 AAS meeting. Workshop participants will learn to communicate effectively with public and school audiences; find outreach opportunities and establish ongoing partnerships with local schools, science centers, museums, parks, and/or community centers; reach audiences with personal stories, hands-on activities, and jargon-free language; identify strategies and techniques to improve their presentation skills; gain access to a menu of outreach resources that work in a variety of settings; and become part of an active community of astronomers who do outreach. Applications are welcome from advanced undergraduates (those doing research and committed to continuing in astronomy), graduate students, and postdocs and new faculty in their first two years after receipt of the PhD. We especially encourage applications from members of groups that are presently underrepresented in science.

  2. AAS Publishing News: Astronomical Software Citation Workshop

    Science.gov (United States)

    Kohler, Susanna

    2015-07-01

    Do you write code for your research? Use astronomical software? Do you wish there were a better way of citing, sharing, archiving, or discovering software for astronomy research? You're not alone! In April 2015, AAS's publishing team joined other leaders in the astronomical software community in a meeting funded by the Sloan Foundation, with the purpose of discussing these issues and potential solutions. In attendance were representatives from academic astronomy, publishing, libraries, for-profit software sharing platforms, telescope facilities, and grantmaking institutions. The goal of the group was to establish “protocols, policies, and platforms for astronomical software citation, sharing, and archiving,” in the hopes of encouraging a set of normalized standards across the field. The AAS is now collaborating with leaders at GitHub to write grant proposals for a project to develop strategies for software discoverability and citation, in astronomy and beyond. If this topic interests you, you can find more details in this document released by the group after the meeting: http://astronomy-software-index.github.io/2015-workshop/ The group hopes to move this project forward with input and support from the broader community. Please share the above document, discuss it on social media using the hashtag #astroware (so that your conversations can be found!), or send private comments to julie.steffen@aas.org.

  3. Directional Fermentation of Aspergillus Oryzae%米曲霉的定向发酵

    Institute of Scientific and Technical Information of China (English)

    杨秋明; 肖安风; 杨远帆; 蔡慧农

    2011-01-01

    Aspergillus oryzae is a common-used fungus for proteinase production. In this paper, the metabolic kinetics of multi-enzyme in Aspergillus oryzae fermentation was investigated when the strain was cultured with fish protein ( fish meal) as nitrogen source. To study the change of proteinase activity during fermentation, Folin method and ninhydrin colorimetric method were adopted to measure enzyme activity, formaldehyde titration method was adopted to determine the concentration of amino nitrogen, and SDS-PAGE gel-electrophoresis was adopted to measure the molecular weight of the production from hydrolyzing casein and liquid substrate. Compared with fed-batch, more kinds of proteases and higher enzyme activity were obtained in the batch fermentation of Aspergillus oryzae. This result is useful for carrying out further studies on Aspergillus oryzae to produce new characteristic proteinase.%用鱼蛋白(鱼粉)为氮源培养米曲霉,取样分析培养物的蛋白酶活力、氨基酸态氮含量、分子量及用培养物为酶源水解酪蛋白后的分子量变化.通过对比,研究了米曲霉在分批和补糖2种发酵条件下分泌蛋白酶及菌体生长的特点.结果表明:在用鱼蛋白为氮源培养米曲霉的过程中,米曲霉产生了多种不同的蛋白酶,蛋白酶的活力与种类随培养时间而变化,分批发酵的总酶活力比补糖发酵时的总酶活力强.

  4. A New Sesquiterpene from Caragana intermediia and Its Anti-Pyricularia oryzae P-2b Activity

    Institute of Scientific and Technical Information of China (English)

    SUN Zhi-Hua; HU Chang-Qi; WANG Jin-Yi

    2008-01-01

    A new aromadendrane-type sesquiterpene,(-)-alloaromadendrane-4β,10β-diol(1),has been isolated from the aerial part of Caragana intermediia,the structure of which was established by spectroscopic methods,including X-ray analysis that provided its relative stereochemistry.Bioassay showed that 1 possessed anti-Pyricularia oryzae P-2b activity with an MIC(minimum inhibitory concentration)value of 10μg/mL.

  5. Tanggap Pertumbuhan dan Produksi Padi (Oryza sativa L.) Varietas Ciherang Terhadap Pemberian Pupuk Organik

    OpenAIRE

    Sari, Vira Irma

    2011-01-01

    VIRA IRMA SARI. Response of Growth and Production of Rice (Oryza sativa L.) Variety Ciherang to The Application of Organic Fertilizer. Scarcity of inorganic fertilizer and the negative effect caused by inorganic fertilizer continuing to make organic fertilizer as a solution to overcome these problems. The availability of organic fertilizers is expected that the farmers can get the optimal production and profit, because the organic fertilizer is cheaper and easy ...

  6. Ehd4 encodes a novel and Oryza-genus-specific regulator of photoperiodic flowering in rice.

    Directory of Open Access Journals (Sweden)

    He Gao

    Full Text Available Land plants have evolved increasingly complex regulatory modes of their flowering time (or heading date in crops. Rice (Oryza sativa L. is a short-day plant that flowers more rapidly in short-day but delays under long-day conditions. Previous studies have shown that the CO-FT module initially identified in long-day plants (Arabidopsis is evolutionary conserved in short-day plants (Hd1-Hd3a in rice. However, in rice, there is a unique Ehd1-dependent flowering pathway that is Hd1-independent. Here, we report isolation and characterization of a positive regulator of Ehd1, Early heading date 4 (Ehd4. ehd4 mutants showed a never flowering phenotype under natural long-day conditions. Map-based cloning revealed that Ehd4 encodes a novel CCCH-type zinc finger protein, which is localized to the nucleus and is able to bind to nucleic acids in vitro and transactivate transcription in yeast, suggesting that it likely functions as a transcriptional regulator. Ehd4 expression is most active in young leaves with a diurnal expression pattern similar to that of Ehd1 under both short-day and long-day conditions. We show that Ehd4 up-regulates the expression of the "florigen" genes Hd3a and RFT1 through Ehd1, but it acts independently of other known Ehd1 regulators. Strikingly, Ehd4 is highly conserved in the Oryza genus including wild and cultivated rice, but has no homologs in other species, suggesting that Ehd4 is originated along with the diversification of the Oryza genus from the grass family during evolution. We conclude that Ehd4 is a novel Oryza-genus-specific regulator of Ehd1, and it plays an essential role in photoperiodic control of flowering time in rice.

  7. Application of EST Data of Siderophore Regulation Protein-like Gene of Aspergillus oryzae RIB40

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Objective: To acquire the new clear color phenotype of Aspergillus oryzae b y th e antisense strategy of siderophore regulation protein (SREP)-like gene. Method s: Construct the cDNA library of Aspergillus oryzae RIB40 and amplify the fr agme nt ac7336f from the every EST clone, which had high homology with SREP gene of o ther species, then construct the eukaryotic expression vector with SREP-like ge ne using antisense strategy. Results: The sequence of this SREP-like gene was a cquired, the vector was successfully constructed. Conclusion: The deduced amino acid sequence of SREP-like gene of Aspergillus oryzae indicated that there is t he high homology with those of SREP genes of Penicillium chrysogenum, Neur ospora crassa and Schizosaccharomyces pombe.%目的:通过反义RNA技术获取稻属曲霉(Aspergillus oryzae)新的表现型.方法:应用BLAST网络服务对稻属曲霉EST数据进行同源性比较,PCR扩增与其它种属铁配体调节蛋白基因(SREP)具有高度同源性的ac7336f片段并反向插入pUSA真核表达载体.结果:测得铁配体调节蛋白类似基因的序列,完成反义表达载体构建.结论:由铁配体调节蛋白类似基因的DNA序列推出的氨基酸序列与Penicillium chrysogenum, Neurospora crassa和Schizosaccharomyces pombe等种属铁配体调节蛋白基因的氨基酸序列具有高度同源性.

  8. Untersuchungen zur Bedeutung von Histidinkinasen in Magnaporthe oryzae und zum Wirkmechanismus des Fungizids Fludioxonil

    OpenAIRE

    Jacob, Stefan

    2014-01-01

    Das aus wissenschaftlicher und ökonomischer Sicht wichtigste Pflanzenpathogen M. oryzae entwickelte im Laufe der Evolution konservierte aber auch einzigartige Mechanismen zur Signaltransduktion. Das Erforschen dieser Mechanismen und Prozesse ist essenziell für das Verständnis von Differenzierungsprozessen bei der Pathogen-Wirt-Interaktion.rnIm ersten Teil der vorliegenden Arbeit wurde der Signalweg zur Osmoregulation, der „High Osmolarity Glycerol“ (HOG)-Signalweg, erstmals anhand physiologis...

  9. Purification and characterization of a thermostable hypothetical xylanase from Aspergillus oryzae HML366.

    Science.gov (United States)

    He, Haiyan; Qin, Yongling; Li, Nan; Chen, Guiguang; Liang, Zhiqun

    2015-03-01

    In the current study, fermentation broth of Aspergillus oryzae HML366 in sugar cane bagasse was subjected to ultrafiltration and ion exchange chromatography, and two xylanases, XynH1 and XynH2, were purified. Time-of-flight mass spectrometry coupled with SDS-PAGE analysis revealed that XynH1 is identical to the hypothetical A. oryzae RIB40 protein XP_001826985.1, with a molecular weight of 33.671 kDa. Likewise, XynH2 was identified as xylanase XynF1 with a molecular weight of 35.402 kDa. Sequence analysis indicated that XynH1 belongs to glycosyl hydrolases family 10. The specific activity of XynH1 was measured at 476.9 U/mg. Optimal xylanase activity was observed at pH 6.0, and enzyme remained active within pH 4.0-10.0 and at a temperature below 70 °C. Mg(2+), Mn(2+), Ca(2+), and K(+) enhanced the XynH1 xylanase activity to 146, 122, 114, and 108%, respectively. XynH1 hydrolyzed Birchwood xylan and Larchwood xylan effectively. The K m and V max of XynH1 values determined were 1.16 mM and 336 μmol/min/mg with Birchwood xylan as the substrate. A. oryzae HML366 xylanase XynH1 showed superior heat and pH tolerance, therefore may have significant applications in paper and biofuel industries. These studies constitute the first investigation of the xylanase activities of the hypothetical protein XP_001826985.1 form A. oryzae. PMID:25604952

  10. A mediterranean japonica rice (Oryza sativa) cultivar improvement through anther culture.

    OpenAIRE

    Serrat, X.; Cardona, M.; Gil, J; Brito, A. M.; Moysset Agustí, Lluïsa; Nogués Mestres, Salvador; Lalanne, E.

    2014-01-01

    Certified seed producers systematically select and propagate registered varieties year after year in order to maintain their uniformity and the original registered cultivar traits. However, natural mutations, spontaneous breeding between varieties and alien grain contamination can introduce undesir- able variability. NRVC 980385 is a temperate japonica rice cultivar (Oryza sativa ssp. japonica) first regis- tered in Spain in 2002. In 2005 certification tests detected a plot differing from the...

  11. Produksi bioethanol dari jerami padi (Oryza sativa) melalui hidrolisis asan dan fermentasi dengan Saccharomyces cerevisiae

    OpenAIRE

    SRI KUSUMASTUTI HAYUNINGTYAS; SUNARTO; SITI LUSI ARUM SARI

    2014-01-01

    Hayuningtyas SK, Sunarto, Sari SLA. 2013. The production of bioethanol from rice straw (Oryza sativa) by acid hydrolysis and fermentation with Saccharomyces cerevisiae. Bioteknologi 11: 1-4. Bioethanol is one of the alternative fuels that are considered more environmentally friendly. Bioethanol can be obtained from material that contains cellulose, such as rice straw. This study aimed to determine the optimum fermentation time to product bioethanol from rice straw hydrolysis and measured of b...

  12. Heterologous Expression of AtWRKY57 Confers Drought Tolerance in Oryza sativa

    OpenAIRE

    Jiang, Yanjuan; Qiu, Yuping; Hu, Yanru; Yu, Diqiu

    2016-01-01

    Drought stress is a severe environmental factor that greatly restricts plant distribution and crop production. Recently, we have found that overexpressing AtWRKY57 enhanced drought tolerance in Arabidopsis thaliana. In this study, we further reported that the Arabidopsis WRKY57 transcription factor was able to confer drought tolerance to transgenic rice (Oryza sativa) plants. The enhanced drought tolerance of transgenic rice was resulted from the lower water loss rates, cell death, malondiald...

  13. ALIMENTARY PREFERENCE OF SITOPHILUS ORYZAE (COLEOPTERA: CURCULIONIDAE TO BRANDS OF COMMERCIAL RICE FROM PERU

    Directory of Open Access Journals (Sweden)

    Velez-Azañero, Armando

    2013-07-01

    Full Text Available Between February and April 2012 were evaluated the feeding preferences of S. oryzae on four brands of commercial rice from Peru: criollo rendidor®, Chulucanas®, Costeño® and Samán®. It was found that the "rice weevil" showed a food preference for costeño brand. However, oviposition levels were variable, with a larger population of adults in the Saman® brand.

  14. Physiological changes promoted by a strobilurin fungicide in the rice-Bipolaris oryzae interaction.

    Science.gov (United States)

    Debona, D; Nascimento, K J T; Gomes, J G O; Aucique-Perez, C E; Rodrigues, F A

    2016-06-01

    Strobilurins are among the most important fungicides that are used for plant disease control worldwide. In addition to their fungicide effect, strobilurins can also improve crop physiology. Nonetheless, the impact of azoxystrobin (Az), the main marketed strobilurin, on rice physiology is still unknown. Detailed gas exchange measurements and chlorophyll a fluorescence analysis were used to examine the Az effects on the photosynthetic performance of rice plants (cultivar Metica-1) either challenged or not with Bipolaris oryzae, the causal agent of brown spot. Az impaired carbon (C) fixation in the non-inoculated plants in a manner that was not related to photochemical or biochemical limitations, but rather to decreased stomatal conductance that limited the CO2 influx into the mesophyll cells. The photosynthesis of rice plants that were not sprayed with Az dramatically decreased upon B. oryzae infection, which was chiefly governed by photochemical and biochemical limitations. The energy surplus that was caused by limited C fixation in the rice plants that were treated with Az and inoculated with B. oryzae was thermally and effectively dissipated until 72h after inoculation. In Az absence, however, this mechanism was not sufficient to prevent chronic photoinhibition to photosynthesis. The inoculated plants were not able to fully capture and exploit the collected light energy, but these constraints were greatly limited in the presence of Az. In conclusion, Az impaired the photosynthetic performance of non-infected plants by diffusive constraints, but prevented, to a greater extent, the damage to the photosynthetic apparatus during the infection process of B. oryzae. PMID:27155478

  15. Amylolytic enzyme production byRhizopus oryzae grown on agricultural commodities.

    Science.gov (United States)

    Yu, R C; Hang, Y D

    1990-03-01

    The amylolytic enzyme production byRhizopus oryzae NRRL 395 grown on different agricultural commodities was datermined. The mould produced much higher enzyme activity from barley, corn, bats, and rice than from cassava. The optimal temperature for enzyme production was 30°C. Neutralization with CaCO3 greatly enhanced the rate of enzyme production. Nitrogen supplementation of cassava resulted in higher enzyme yields.

  16. Sensitivity of APSIM/ORYZA model due to estimation errors in solar radiation

    OpenAIRE

    Alexandre Bryan Heinemann; Pepijn A.J. van Oort; Diogo Simões Fernandes; Aline de Holanda Nunes Maia

    2012-01-01

    Crop models are ideally suited to quantify existing climatic risks. However, they require historic climate data as input. While daily temperature and rainfall data are often available, the lack of observed solar radiation (Rs) data severely limits site-specific crop modelling. The objective of this study was to estimate Rs based on air temperature solar radiation models and to quantify the propagation of errors in simulated radiation on several APSIM/ORYZA crop model seasonal outputs, yield, ...

  17. Control of brown spot pathogen of rice (Bipolaris oryzae) using some phenolic antioxidants

    Science.gov (United States)

    Shabana, Y.M.; Abdel-Fattah, G.M.; Ismail, A.E.; Rashad, Y.M.

    2008-01-01

    Bipolaris oryzae is the causal agent of rice brown spot disease and is responsible for significant economic losses. In order to control this disease, three phenolic antioxidants were tested (salicylic acid, benzoic acid and hydroquinone). The antifungal activity of the tested substances were investigated against B. oryzae at different concentrations in vitro, as well as the efficacy of their exogenous application in controlling rice brown spot disease under field conditions. In vitro, benzoic acid or salicylic acid at 9 mM completely inhibited the growth of B. oryzae. Under field conditions, spraying of benzoic acid at 20 mM led to a significant reduction in disease severity (DS) and disease incidence (DI) on the plant leaves, in addition to a significant increase in the grain yield and its components. Some biochemical responses were also detected, where the application of the previous treatment led to a significant increase in the total photosynthetic pigments (chlorophyll a and b and carotenoids) in rice leaves and in the total carbohydrate and protein contents of the yielded grains. PMID:24031243

  18. Expression of an alpha-galactosidase from Saccharomyces cerevisiae in Aspergillus awamori and Aspergillus oryzae.

    Science.gov (United States)

    Murphy, R A; Power, R F G

    2002-02-01

    A gene encoding alpha-galactosidase activity was isolated by polymerase chain reaction (PCR) from Saccharomyces cerevisiae NCYC686 and separately placed under the control of transcriptional elements regulating alpha-amylase expression in Aspergillus oryzae and glucoamylase expression in A. awamori. Following transformation of both A. oryzae and A. awamori with their respective expression vectors, induction of heterologous alpha-galactosidase from positively selected clones was effected through the addition of soluble starch (10% wt/vol) to the growth medium. Upon induction in A. oryzae, a transcriptional instability resulted in degradation of mRNA encoding heterologous alpha-galactosidase, thus preventing expression of the active enzyme. The use of a gene fusion strategy in A. awamori overcame this instability and resulted in stable expression of S. cerevisiae alpha-galactosidase. Subsequent to initial (shake flask) experiments, a series of scale-up and optimisation studies led to heterologous expression of the recombinant enzyme in batch fermentation at 51 U mg(-1) total extracellular protein. This was higher than previously published works, which reported extracellular levels of heterologous alpha-galactosidase up to 38 U mg(-1) total protein. Analysis of crude extracts of the fermentation medium revealed significant differences between the activity parameters reported previously in the literature for this enzyme and those observed here. The recombinant enzyme exhibited thermostability properties not previously reported for S. cerevisiae alpha-galactosidase, a trait which would make it suitable for use in processes requiring high temperatures. PMID:12074058

  19. Autophagy-associated alpha-arrestin signaling is required for conidiogenous cell development in Magnaporthe oryzae

    Science.gov (United States)

    Dong, Bo; Xu, Xiaojin; Chen, Guoqing; Zhang, Dandan; Tang, Mingzhi; Xu, Fei; Liu, Xiaohong; Wang, Hua; Zhou, Bo

    2016-01-01

    Conidiation patterning is evolutionarily complex and mechanism concerning conidiogenous cell differentiation remains largely unknown. Magnaporthe oryzae conidiates in a sympodial way and uses its conidia to infect host and disseminate blast disease. Arrestins are multifunctional proteins that modulate receptor down-regulation and scaffold components of intracellular trafficking routes. We here report an alpha-arrestin that regulates patterns of conidiation and contributes to pathogenicity in M. oryzae. We show that disruption of ARRDC1 generates mutants which produce conidia in an acropetal array and ARRDC1 significantly affects expression profile of CCA1, a virulence-related transcription factor required for conidiogenous cell differentiation. Although germ tubes normally develop appressoria, penetration peg formation is dramatically impaired and Δarrdc1 mutants are mostly nonpathogenic. Fluorescent analysis indicates that EGFP-ARRDC1 puncta are well colocalized with DsRed2-Atg8, and this distribution profile could not be altered in Δatg9 mutants, suggesting ARRDC1 enters into autophagic flux before autophagosome maturation. We propose that M. oryzae employs ARRDC1 to regulate specific receptors in response to conidiation-related signals for conidiogenous cell differentiation and utilize autophagosomes for desensitization of conidiogenous receptor, which transmits extracellular signal to the downstream elements of transcription factors. Our investigation extends novel significance of autophagy-associated alpha-arrestin signaling to fungal parasites. PMID:27498554

  20. A Pid3 allele from rice cultivar Gumei2 confers resistance to Magnaporthe oryzae

    Institute of Scientific and Technical Information of China (English)

    Jie Chen; Yongfeng Shi; Wenzheng Liu; Rongyao Chai; Yaping Fu; Jieyun Zhuang; Jianli Wu

    2011-01-01

    Rice blast, caused by Magnaporthe oryzae, is one of the most devastating diseases. Using map-based strategy and in silico approach we isolated a new rice (Oryza sativa L.) blast resistance allele of Pid3, designated Pi25, from a stable blast resistance cultivar Gumei2. Overexpression analysis and complementation test showed that Pi25 conferred blast resistance to M. oryzae isolate js001-20. Sequence analysis showed that Pi25 was an intronless gene of 2772 nucleotides with single nucleotide substitution in comparison to Pid3 at the nucleotide position 459 and predicatively encoded a typical coiled coil-nucleotide binding site-leucine rich repeat (CC--NBS--LRR) protein of 924 amino acid residuals with 100% identity to Pid3 putative protein. The susceptible allele pi25 in Nipponbare contained a nonsense mutation at the nucleotide position 2209 resulting in a truncated protein with 736 amino acid residuals. In addition, 14 nucleotide substitutions resulting in 10 amino acid substitutions were identified between Pi25 and pi25 upstream the premature stop codon in the susceptible allele. Although the mechanism of Pi25/Pid3-mediated resistance needs to be further investigated, the isolation of the allele would facilitate the utilization of Pi25/Pid3 in rice blast resistance breeding program via transgenic approach and marker assisted selection.

  1. Insecticidal and oviposition deterrent properties of some spices against coleopteran beetle, Sitophilus oryzae.

    Science.gov (United States)

    Devi, Kalpana C; Devi, Sumithra S

    2013-06-01

    Eighteen spices were screened for their insecticidal potential and antiovipositional properties against the rice weevil- Sitophilus oryzae-a serious insect pest of stored food grains. The bioefficacy of the powders and hexane extracts of selected spices were determined by assessing the toxicity, effect on F1 progeny, contact toxicity, persistence and seed viability. Responses varied with the spices, dosage and exposure time. Powders of mace and pepper, at 1% level were highly effective resulting in total mortality of S. oryzae by one week followed by nutmeg and clove with 100% mortality and cinnamon and star anise with 90% mortality at 5% concentration. These spices also completely inhibited F1 progeny. The hexane extracts of these spices at 1,000 ppm showed insecticidal activity, with pepper extract recording 100% mortality by 5 days. S. oryzae was susceptible to clove oil resulting in 92% mortality. Mortality was 51.63% in nutmeg, 66.6% in cinnamon, and 79.8% in case of mace and star anise. Hexane extracts of star anise, cinnamon and clove at 0.59 μl/cm(2) on filter paper discs induced 100% mortality by 72 h. These spices offered protection to wheat up to 9 months without affecting seed germination thereby showing promise as grain protectants. PMID:24425960

  2. The Production of Biodiesel from Cottonseed Oil Using Rhizopus oryzae Whole Cell Biocatalysts

    Science.gov (United States)

    Athalye, Sneha Kishor

    Biodiesel is an environmentally friendly alternative to fossil fuels which have become increasingly expensive in recent times. An alternate approach to alkaline biodiesel production is needed as catalyst miscibility with the glycerol by-product, generation of large amounts of waste water, and saponification of the feedstock are major disadvantages associated with the process. Lipases are water soluble enzymes which act as catalysts in many lipid based reactions. Reuse of lipases can significantly reduce cost of enzymatic biodiesel production; however retention of lipolytic activity still remains a challenge. Use of microbial cells immobilized on various surfaces like sponge, foam and plastics as biocatalysts instead of extracted enzyme could help overcome this problem. A novel, rigid biomass support with high surface area made from recyclable polyethylene (Bioblok(TM)) was used in this study. Several fungal and bacterial species have been reported to possess appreciable levels of lipase activity. The biomass production and immobilization as well as lipase activity of three different species; Candida rugosa (ATCC #38772), Aspergillus oryzae (ATCC #58299), and Rhizopus oryzae (ATTC #34612) were tested. C. rugosa did not attach well to the support particles while A.oryzae had lower biomass accumulation of 6.1 g (dry cell wt)/L compared to 11.8 g (dry cell wt)/L for R.oryzae. Hence Rhizopus oryzae, fungal specie with cell surface bound lipase was selected for the current study. The study investigated the influence of media composition and growth time of the R.oryzae whole cell biocatalysts, immobilized on the BSPs, for FAME production from cottonseed oil. R.oryzae BSPs grown in basal media supplemented with 1% (w/v) of glucose or oil or both for 48 h, 72 h or 90 h were used in a 36 h transesterification reaction with cottonseed oil and methanol. BSPs grown in both glucose and oil supplemented medium for 72 h had the highest conversion of 22.4% (wt/wt) and a biomass

  3. Identiifcation and Genetic Analysis of a Novel Rice Spotted-Leaf Mutant with Broad-Spectrum Resistance to Xanthomonas oryzae pv. oryzae

    Institute of Scientific and Technical Information of China (English)

    SHEN Hai-chao; SHI Yong-feng; FENG Bao-hua; WANG Hui-mei; XU Xia; HUANG Qi-na; LÜ Xiang-guang; WU Jian-li

    2014-01-01

    A spotted-leaf mutant of rice HM143 was isolated from an EMS-induced IR64 mutant bank. Brown lesions randomly distributed on leaf blades were observed about 3 wk after sowing. The symptom lasted for the whole plant growth duration. Histochemical analysis indicated that cell death occurred in and around the site of necrotic lesions accompanied with accumulation of hydrogen hyperoxide. Agronomic traits were largely similar to the wild type IR64 except seed setting rate and 1 000-grain weight which were signiifcantly decreased in the mutant. Disease resistance of the mutant to multiple races of Xanthomonas oryzae pv. oryzae was signiifcantly enhanced. Genetic analysis showed that the mutation was controlled by a single recessive gene, tentatively termed splHM143. In addition, using molecular markers and 1 023 mutant type individuals from an F2 segregating population derived from the cross HM143/R9308, the spotted-leaf gene was ifnally delimited to an interval of 149 kb between markers XX25 and ID40 on the long arm of chromosome 4. splHM143 is likely a novel rice spotted-leaf gene since no other similar genes have been identiifed near the chromosomal region.

  4. Diversity of bacteriophages infecting Xanthomonas oryzae pv. oryzae in paddy fields and its potential to control bacterial leaf blight of rice.

    Science.gov (United States)

    Chae, Jong-Chan; Hung, Nguyen Bao; Yu, Sang-Mi; Lee, Ha Kyung; Lee, Yong Hoon

    2014-06-28

    Bacterial leaf blight (BLB) caused by Xanthomonas oryzae pv. oryzae (Xoo) is a very serious disease in rice-growing regions of the world. In spite of their economic importance, there are no effective ways of protecting rice plants from this disease. Bacteriophages infecting Xoo affect the population dynamics of the pathogen and consequently the occurrence of the disease. In this study, we investigated the diversity, host range, and infectivity of Xoo phages, and their use as a bicontrol agent on BLB was tested. Among the 34 phages that were isolated from floodwater in paddy fields, 29 belonged to the Myoviridae family, which suggests that the dominant phage in the ecosystem was Myoviridae. The isolated phages were classified into two groups based on plaque size produced on the lawn of Xoo. In general, there was a negative relationship between plaque size and host range, and interestingly the phages having a narrow host range had low efficiency of infectivity. The deduced protein sequence analysis of htf genes indicated that the gene was not a determinant of host specificity. Although the difference in host range and infectivity depending on morphotype needs to be addressed, the results revealed deeper understanding of the interaction between the phages and Xoo strains in floodwater and damp soil environments. The phage mixtures reduced the occurrence of BLB when they were treated with skim milk. The results indicate that the Xoo phages could be used as an alternative control method to increase the control efficacy and reduce the use of agrochemicals.

  5. Characterization and Genetic Analysis of a Novel Rice Spotted-leaf Mutant HM47 with Broad-spectrum Resistance to Xanthomonas oryzae pv.oryzae(F)

    Institute of Scientific and Technical Information of China (English)

    Bao-Hua Feng; Yang Yang; Yong-Feng Shi; Hai-Chao Shen; Hui-Mei Wang; Qi-Na Huang; Xia Xu

    2013-01-01

    A stable inherited rice spotted-leaf mutant HM47 derived from an EMS-induced IR64 mutant bank was identified.The mutant expressed hypersensitive response (HR)-like symptoms throughout its whole life from the first leaf to the flag leaf,without pathogen invasion.Initiation of the lesions was induced by light under natural summer field conditions.Expression of pathogenesis-related genes including PAL,PO-C1,POX22.3 and PBZ1 was enhanced significantly in association with cell death and accumulation of H2O2 at and around the site of lesions in the mutant in contrast to that in the wild-type (WT).Disease reaction to Xanthomonas oryzae pv.oryzae from the Philippines and China showed that HM47 is a broad-spectrum disease-resistant mutant with enhanced resistance to multiple races of bacterial blight pathogens tested.An F2 progeny test showed that bacterial blight resistance to race HB-17 was cosegregated with the expression of lesions.Genetic analysis indicated that the spotted-leaf trait was controlled by a single recessive gene,tentatively named splHM47,flanked by two insertion/deletion markers in a region of approximately 74 kb on the long arm of chromosome 4.Ten open reading frames are predicted,and all of them are expressed proteins.Isolation and validation of the putative genes are currently underway.

  6. Comparison between ARB and CARB processes on an AA5754/AA6061 composite

    Science.gov (United States)

    Verstraete, K.; Helbert, A.-L.; Brisset, F.; Baudin, T.

    2014-08-01

    The present work aims to compare two processes: Accumulative Roll Bonding and Cross Accumulative Roll Bonding (CARB). Both processes consist in the repetition of rolling but the second technique adds a 90° rotation of the sheet around its normal direction between each rolling. Microstructure, mechanical properties and texture were compared for both processes on an AA5754/AA6061 composite. As a result a thinner and less elongated microstructure was obtained in the CARB process leading to an isotropy and an improvement of the mechanical properties. Besides, the texture was characterized by the rotated Cube component for both processes but for CARB it is of less strength.

  7. Transgenic Expression of the Recombinant Phytase in Rice (Oryza sativa)

    Institute of Scientific and Technical Information of China (English)

    LIU Qiao-quan; LI Qian-feng; JIANG Li; ZHANG Da-jiang; WANG Hong-mei; GU Ming-hong; YAO Quan-hong

    2006-01-01

    In most of the cereal crop, phytic acid is the main storage form of phosphorus, which can decrease the bioavailability of phosphate. Transgenic expression of phytase is regarded as an efficient way to release phosphate from phytate in transgenic plants.In this study, a plant expression vector, containing the recombinant phytase gene driven by the maize ubiquitin (Ubi) promoter was constructed and introduced into an elite rice variety via Agrobacterium-mediated transformation. During the experiment, a total of 15 independent transgenic rice lines were regenerated. The results of PCR and Southern blot indicated that the target gene was integrated into the genome of transgenic rice plants. Moreover, the RT-PCR analysis of total RNAs extracted from the immature seeds of several transgenic lines showed that the recombinant phytase gene could be normally expressed. The inorganic phosphorus content, both in the mature seeds and the leaf was significantly higher in the transgenic plants than in the untransformed wild type.

  8. Simon van der Meer in the AA Control Room

    CERN Multimedia

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  9. Whole-Plant Dynamic System of Nitrogen Use for Vegetative Growth and Grain Filling in Rice Plants (Oryza sativa L.) as Revealed through the Production of 350 Grains from a Germinated Seed Over 150 Days: A Review and Synthesis.

    Science.gov (United States)

    Yoneyama, Tadakatsu; Tanno, Fumio; Tatsumi, Jiro; Mae, Tadahiko

    2016-01-01

    A single germinated rice (Oryza sativa L) seed can produce 350 grains with the sequential development of 15 leaves on the main stem and 7-10 leaves on four productive tillers (forming five panicles in total), using nitrogen (N) taken up from the environment over a 150-day growing season. Nitrogen travels from uptake sites to the grain through growing organ-directed cycling among sequentially developed organs. Over the past 40 years, the dynamic system for N allocation during vegetative growth and grain filling has been elucidated through studies on N and (15)N transport as well as enzymes and transporters involved. In this review, we synthesize the information obtained in these studies along the following main points: (1) During vegetative growth before grain-filling, about half of the total N in the growing organs, including young leaves, tillers, root tips and differentiating panicles is supplied via phloem from mature source organs such as leaves and roots, after turnover and remobilization of proteins, whereas the other half is newly taken up and supplied via xylem, with an efficient xylem-to-phloem transfer at stem nodes. Thus, the growth of new organs depends equally on both N sources. (2) A large fraction (as much as 80%) of the grain N is derived largely from mature organs such as leaves and stems by degradation, including the autophagy pathway of chloroplast proteins (e.g., Rubisco). (3) Mobilized proteinogenic amino acids (AA), including arginine, lysine, proline and valine, are derived mainly from protein degradation, with AA transporters playing a role in transferring these AAs across cell membranes of source and sink organs, and enabling their efficient reutilization in the latter. On the other hand, AAs such as glutamine, glutamic acid, γ-amino butyric acid, aspartic acid, and alanine are produced by assimilation of newly taken up N by roots and and transported via xylem and phloem. The formation of 350 filled grains over 50 days during the

  10. Listeria Genomics

    Science.gov (United States)

    Cabanes, Didier; Sousa, Sandra; Cossart, Pascale

    The opportunistic intracellular foodborne pathogen Listeria monocytogenes has become a paradigm for the study of host-pathogen interactions and bacterial adaptation to mammalian hosts. Analysis of L. monocytogenes infection has provided considerable insight into how bacteria invade cells, move intracellularly, and disseminate in tissues, as well as tools to address fundamental processes in cell biology. Moreover, the vast amount of knowledge that has been gathered through in-depth comparative genomic analyses and in vivo studies makes L. monocytogenes one of the most well-studied bacterial pathogens. This chapter provides an overview of progress in the exploration of genomic, transcriptomic, and proteomic data in Listeria spp. to understand genome evolution and diversity, as well as physiological aspects of metabolism used by bacteria when growing in diverse environments, in particular in infected hosts.

  11. Dicty_cDB: FC-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA22Q.Seq.d/ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  12. Dicty_cDB: FC-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA15Q.Se...q.d/ Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  13. Dicty_cDB: FC-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA17Q.Seq.d/ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  14. Dicty_cDB: FC-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA05Q.Se...q.d/ Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  15. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...23Q.Seq.d/ Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  16. Dicty_cDB: FC-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA21Q.Seq.d/ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  17. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...22Q.Seq.d/ Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  18. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...06Q.Seq.d/ Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  19. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...18Q.Seq.d/ Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  20. Dicty_cDB: FC-AA16 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA16Q.Se...q.d/ Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  1. Cytological aspects of incompatible and compatible interactions between rice, wheat and the blast pathogen Pyricularia oryzae

    Directory of Open Access Journals (Sweden)

    Leonardo Araujo

    2016-04-01

    Full Text Available ABSTRACT Blast, caused by the fungus Pyricularia oryzae, is an important disease affecting rice and wheat yield worldwide. This study investigated the cytological aspects of incompatible (non-host resistance and compatible (host resistance rice- (R_Po and wheat- (W_Po Pyricularia oryzae isolate interactions. Inoculations of rice and wheat with the R_Po and W_Po isolates of P. oryzae, respectively, were expected to be compatible interactions (host resistance, whereas inoculations of rice and wheat with the W_Po and R_Po isolates of P. oryzae, respectively, were considered to be incompatible interactions (non-host resistance. For the compatible interactions (rice-R_Po and wheat-W_Po, fungal hyphae penetrated and colonized the epidermal cells and also invaded many neighboring cells. By contrast, in the case of the incompatible interactions (rice-W_Po and wheat-R_Po, fungal hyphae were not able to penetrate nor colonize the epidermal cells, but when penetration did occur, the hyphae were restricted to the first-invaded epidermal cell. The frequency of appressorial sites exhibiting infection hyphae within the epidermal cell underlying an appressorium was greater in the case of the compatible interactions. By contrast, unsuccessful penetrations with cytoplasmic granulation occurred with high frequency in the incompatible wheat-R_Po and rice-W_Po interactions and the number of necrotic epidermal cells underlying the appressorium was low for the rice-W_Po interaction as well as for the wheat- R_Po interaction, where no symptoms of necrosis were exhibited. However, the opposite was observed for the compatible interactions. The present study presents cytological features associated with incompatible and compatible rice- and wheat-P. oryzae interactions that may be useful to studies involving variability, coevolution, diagnosis, and regulation of quarantine or even in a rice or wheat breeding program whose aim is to transfer genes involved in non

  2. Cephalopod genomics

    DEFF Research Database (Denmark)

    Albertin, Caroline B.; Bonnaud, Laure; Brown, C. Titus;

    2012-01-01

    The Cephalopod Sequencing Consortium (CephSeq Consortium) was established at a NESCent Catalysis Group Meeting, ``Paths to Cephalopod Genomics-Strategies, Choices, Organization,'' held in Durham, North Carolina, USA on May 24-27, 2012. Twenty-eight participants representing nine countries (Austria...... active in sequencing, assembling and annotating genomes, agreed on a set of cephalopod species of particular importance for initial sequencing and developed strategies and an organization (CephSeq Consortium) to promote this sequencing. The conclusions and recommendations of this meeting are described...

  3. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  4. Amended final report on the safety assessment of Oryza Sativa (rice) Bran Oil, Oryza Sativa (rice) Germ Oil, Rice Bran Acid,Oryza Sativa (rice) Bran Wax, Hydrogenated Rice Bran Wax, Oryza Sativa (rice)Bran Extract, Oryza Sativa (rice) Extract, Oryza Sativa (rice) Germ Powder, Oryza Sativa (rice) Starch, Oryza Sativa (rice) Bran, Hydrolyzed Rice Bran Extract, Hydrolyzed Rice Bran Protein, Hydrolyzed Rice Extract, and Hydrolyzed Rice Protein.

    Science.gov (United States)

    2006-01-01

    This report addresses the safety of cosmetic ingredients derived from rice, Oryza sativa. Oils, Fatty Acids, and Waxes: Rice Bran Oil functions in cosmetics as a conditioning agent--occlusive in 39 formulations across a wide range of product types. Rice Germ Oil is a skin-conditioning agent--occlusive in six formulations in only four product categories. Rice Bran Acid is described as a surfactant-cleansing agent, but was not in current use. Rice Bran Wax is a skin-conditioning agent--occlusive in eight formulations in five product categories. Industry did not directly report any use of Rice Bran Wax. Hydrogenated Rice Bran Wax is a binder, skin-conditioning agent--occlusive, and viscosity-increasing agent--nonaqueous in 11 formulations in six product categories. Rice Bran Oil had an oral LD50 of > 5 g/kg in white rats and Rice Wax had an oral LD50 of > 24 g/kg in male mice. A three-generation oral dosing study reported no toxic or teratologic effects in albino rats fed 10% Rice Bran Oil compared to a control group fed Peanut Oil. Undiluted Rice Bran Oil, Rice Germ Oil, and Hydrogenated Rice Bran Wax were not irritants in animal skin tests. Rice Bran Oil was not a sensitizer. Rice Bran Oil, Rice Germ Oil, Rice Wax, and Hydrogenated Rice Bran Wax were negative in ocular toxicity assays. A mixture of Rice Bran Oil and Rice Germ Oil had a ultraviolet (UV) absorption maximum at 315 nm, but was not phototoxic in a dermal exposure assay. Rice Bran Oil was negative in an Ames assay, and a component, gamma-oryzanol, was negative in bacterial and mammalian mutagenicity assays. Rice oils, fatty acids, and waxes were, at most, mildly irritating in clinical studies. Extracts: Rice Bran Extract is used in six formulations in four product categories. Rice Extract is a hair-conditioning agent, but was not in current use. Hydrolyzed Rice Extract is used in four formulations and current concentration of use data were provided for other uses. Hydrolyzed Rice Bran Extract, described

  5. Complete genome sequence of bean rugose mosaic virus, genus Comovirus.

    Science.gov (United States)

    Picoli, M H S; Garcia, A; Barboza, A A L; de Souto, Eliezer Rodrigues; Almeida, A M R

    2016-06-01

    Since the first report in Costa Rica in 1971, bean rugose mosaic virus (BRMV) has been found in Colombia, El Salvador, Guatemala and Brazil. In this study, the complete genome sequence of a soybean isolate of BRMV from Paraná State, Brazil, was determined. The BRMV genome consists of two polyadenylated RNAs. RNA1 is 5909 nucleotides long and encodes a single polypeptide of 1856 amino acids (aa), with an estimated molecular weight of 210 kDa. The RNA1 polyprotein contains the polypeptides for viral replication and proteolytic processing. RNA2 is 3644 nucleotides long and codes for a single polypeptide of 1097 aa, containing the movement and coat proteins. This is the first complete genome sequence of BRMV. When compared with available aa sequences of comoviruses, the highest identities of BRMV coat proteins and proteinase polymerase were 57.5 and 58 %, respectively. These were below the 75 and 80 % identity limits, respectively, established for species demarcation in the genus. This confirms that BRMV is a member of a distinct species in the genus Comovirus.

  6. A novel genomic alteration of LSAMP associates with aggressive prostate cancer in African American men

    Directory of Open Access Journals (Sweden)

    Gyorgy Petrovics

    2015-12-01

    Full Text Available Evaluation of cancer genomes in global context is of great interest in light of changing ethnic distribution of the world population. We focused our study on men of African ancestry because of their disproportionately higher rate of prostate cancer (CaP incidence and mortality. We present a systematic whole genome analyses, revealing alterations that differentiate African American (AA and Caucasian American (CA CaP genomes. We discovered a recurrent deletion on chromosome 3q13.31 centering on the LSAMP locus that was prevalent in tumors from AA men (cumulative analyses of 435 patients: whole genome sequence, 14; FISH evaluations, 101; and SNP array, 320 patients. Notably, carriers of this deletion experienced more rapid disease progression. In contrast, PTEN and ERG common driver alterations in CaP were significantly lower in AA prostate tumors compared to prostate tumors from CA. Moreover, the frequency of inter-chromosomal rearrangements was significantly higher in AA than CA tumors. These findings reveal differentially distributed somatic mutations in CaP across ancestral groups, which have implications for precision medicine strategies.

  7. Aspergillus oryzae-Saccharomyces cerevisiae Consortium Allows Bio-Hybrid Fuel Cell to Run on Complex Carbohydrates.

    Science.gov (United States)

    Jahnke, Justin P; Hoyt, Thomas; LeFors, Hannah M; Sumner, James J; Mackie, David M

    2016-01-01

    Consortia of Aspergillus oryzae and Saccharomyces cerevisiae are examined for their abilities to turn complex carbohydrates into ethanol. To understand the interactions between microorganisms in consortia, Fourier-transform infrared spectroscopy is used to follow the concentrations of various metabolites such as sugars (e.g., glucose, maltose), longer chain carbohydrates, and ethanol to optimize consortia conditions for the production of ethanol. It is shown that with proper design A. oryzae can digest food waste simulants into soluble sugars that S. cerevisiae can ferment into ethanol. Depending on the substrate and conditions used, concentrations of 13% ethanol were achieved in 10 days. It is further shown that a direct alcohol fuel cell (FC) can be coupled with these A. oryzae-enabled S. cerevisiae fermentations using a reverse osmosis membrane. This "bio-hybrid FC" continually extracted ethanol from an ongoing consortium, enhancing ethanol production and allowing the bio-hybrid FC to run for at least one week. Obtained bio-hybrid FC currents were comparable to those from pure ethanol-water mixtures, using the same FC. The A. oryzae-S. cerevisiae consortium, coupled to a bio-hybrid FC, converted food waste simulants into electricity without any pre- or post-processing. PMID:27681904

  8. Interesterification of butter fat by partially purified extracellular lipases from Pseudomonas putida, Aspergillus niger and Rhizopus oryzae.

    Science.gov (United States)

    Pabai, F; Kermasha, S; Morin, A

    1995-11-01

    Three extracellular lipases were produced by batch fermentation of Pseudomonas putida ATCC 795, Aspergillus niger CBS 131.52 and Rhizopus oryzae ATCC 34612 during the late phase of growth, at 72, 96 and 96 h, respectively. The lipases were partially purified by (NH4)2SO4 fractionation. The lipase of P. putida was optimal at pH 8.0 whereas those from A. niger and R. oryzae were optimal at pH 7.5. The A. niger lipase had the lowest V max value (0.51×10(-3) U/min) and R. oryzae the highest (1.86×10(-3) U/min). The K m values for P. putida, A. niger and R. oryzae lipases were 1.18, 0.97, and 0.98 mg/ml, respectively. Native PAGE of the partially-purified lipase extracts showed two to four major bands. The interesterification of butter fat by A. niger lipase decreased the water activity as well as the hydrolytic activity. The A. niger lipase had the highest interesterification yield value (26%) and the R. oryzae lipase the lowest (4%). In addition, A. niger lipase exhibited the highest decrease (17%) in long-chain hypercholesterolemic fatty acids (C12:0, C14:0 and C16:0) at the sn-2-position; the P. putida lipase demonstrated the least favourable changes in specificity at the same position. PMID:24415019

  9. Ancient genomics

    DEFF Research Database (Denmark)

    Der Sarkissian, Clio; Allentoft, Morten Erik; Avila Arcos, Maria del Carmen;

    2015-01-01

    , archaic hominins, ancient pathogens and megafaunal species. Those have revealed important functional and phenotypic information, as well as unexpected adaptation, migration and admixture patterns. As such, the field of aDNA has entered the new era of genomics and has provided valuable information when...

  10. Herbarium genomics

    DEFF Research Database (Denmark)

    Bakker, Freek T.; Lei, Di; Yu, Jiaying;

    2016-01-01

    Herbarium genomics is proving promising as next-generation sequencing approaches are well suited to deal with the usually fragmented nature of archival DNA. We show that routine assembly of partial plastome sequences from herbarium specimens is feasible, from total DNA extracts and with specimens...

  11. Study on Fabrication of AA4032/AA6069 Cladding Billet Using Direct Chill Casting Process

    Science.gov (United States)

    Han, Xing; Zhang, Haitao; Shao, Bo; Li, Lei; Liu, Xuan; Cui, Jianzhong

    2016-04-01

    AA4032/AA6069 cladding billet in size of φ130 mm/φ110 mm was prepared by the modified direct chill casting process, and the parametric effect on casting performance was investigated using numerical simulation. Microstructures, elements distribution, and mechanical properties of the bonding interface were examined. The results show that metallurgical bonding interface can be obtained with the optimal parameters: the casting speed of 130 to 140 mm/min, the internal liquid level height of 50 to 60 mm, and the contact height of 40 to 50 mm. The metallurgical bonding interface is free of any discontinuities due to the fact that the alloying elements diffused across the interface and formed Ni-containing phase. Tensile strength of the cladding billet reaches 225.3 MPa, and the fracture position was located in AA6069 side, suggesting that the interface bonding strength is higher than the strength of AA6069. The interfacial shearing strength is 159.3 MPa, indicating excellent metallurgical bonding.

  12. Cloning and Sequence Analysis Promoter of Pollen Profilin Gene in Rece (Oryza sativa.L)%水稻花粉Profilin基因启动子的克隆及序列分析

    Institute of Scientific and Technical Information of China (English)

    袁烁; 徐莺; 颜纺; 叶秋; 陈放

    2002-01-01

    作者使用两次染色体步移(Genome walking)法,从籼稻(Oryza sativa subsp.indica)IR36中克隆到长度为569bp的花粉proiflin基因的启动子片段,并进行了全序列测定和分析.结果表明:在该段序列中含有3个TATA box,3个CAAT box和2个G -box.通过EPD(The Eukaryotic Promoter Database)的比较发现,序列的+2~-71区域与番茄(Lycopersicon esculentum)花粉特异基因LAT52,向日葵(Helianthus annuus)花药特异基因SF2启动子关键序列的同源性为50%左右.

  13. Genome cartography: charting the apicomplexan genome.

    Science.gov (United States)

    Kissinger, Jessica C; DeBarry, Jeremy

    2011-08-01

    Genes reside in particular genomic contexts that can be mapped at many levels. Historically, 'genetic maps' were used primarily to locate genes. Recent technological advances in the determination of genome sequences have made the analysis and comparison of whole genomes possible and increasingly tractable. What do we see if we shift our focus from gene content (the 'inventory' of genes contained within a genome) to the composition and organization of a genome? This review examines what has been learned about the evolution of the apicomplexan genome as well as the significance and impact of genomic location on our understanding of the eukaryotic genome and parasite biology.

  14. AAS Special Session: Policy Making in Astronomy

    Science.gov (United States)

    Cardelli, J. A.; Massa, D.

    1995-12-01

    The professional astronomical community today is more diverse than at any time in its history. Individuals participating in creative research programs can be found in a wide range of positions. This type of diversity, which mixes research, education, and service (e.g. contract) work, represents the strength of contemporary astronomy. While recognizing the unavoidable reductions in funding and restructuring of organizations like NASA, it is imperative that the significance of the current diversity be considered during these processes. Creative ideas are one of the cornerstones of quality research, and they can originate anywhere. Consequently, it is essential that adequate research resources remain available for free and open competition by all astronomers. Our goal in this session is to bring together officials from the AAS, NASA, and the NSF to discuss how the policy and decision making process operates and whether it should be changed to better serve the general needs of the professional astronomical community. Examples of the issues we believe are important include: In establishing new policy, how can the needs of the average research astronomer be better addressed? How could input from such astronomers be provided to those who craft NASA/NSF policy? How can/should the AAS serve as an interface between policy/decision making bodies and its membership? Should the AAS membership become more actively/effectively involved in the decision making process and, if so, how? More information on this session and related issues can be found at the Association of Research Astronomers Home Page: http://www.phy.vill.edu/astro/faculty/ara/ara_home.htm

  15. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  16. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  17. Characterizing virulence phenotypes among U.S. isolates of Pyricularia oryzae using IRRI NILs, U.S. germplasm, and NERICA lines

    Science.gov (United States)

    Rice blast disease, caused by Pyricularia oryzae, (not Magnaporthea? ) is a major constraint to rice yield in most rice production areas, including the Southeast U.S. In continued efforts to evaluate the effectiveness of resistance genes, a collection of U.S. isolates of P. oryzae were evaluated for...

  18. AA, Inner Conductor of Magnetic Horn

    CERN Multimedia

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  19. Wooden Model of Wide AA Bending Magnet

    CERN Multimedia

    1978-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets: BLG, long and narrow; BST, short and wide). A wide one had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. A wooden model was build in 1978, to gain dimensional experience. Here, Peter Zettwoch, one of the largest men at CERN at that time, is putting a hand in the mouth of the wooden BST monster.

  20. Atlas of Vega: 3850 -- 6860 \\AA

    CERN Document Server

    Kim, Hyun-Sook; Valyavin, G; Lee, Byeong-Cheol; Shimansky, V; Galazutdinov, G A

    2009-01-01

    We present a high resolving power ($\\lambda$ / $\\Delta\\lambda$ = 90,000) and high signal-to-noise ratio ($\\sim$700) spectral atlas of Vega covering the 3850 -- 6860 \\AA wavelength range. The atlas is a result of averaging of spectra recorded with the aid of the echelle spectrograph BOES fed by the 1.8-m telescope at Bohyunsan observatory (Korea). The atlas is provided only in machine-readable form (electronic data file) and will be available in the SIMBAD database upon publication.