WorldWideScience

Sample records for a_id252

  1. Dicty_cDB: SLH252 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLH252 (Link to dictyBase) - - - - SLH252F (Link to Original site) SLH2...52F 158 - - - - - - Show SLH252 Library SL (Link to library) Clone ID SLH252 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH2...52Q.Seq.d/ Representative seq. ID SLH252F (Link to Original site) R...epresentative DNA sequence >SLH252 (SLH252Q) /CSM/SL/SLH2-C/SLH252Q.Seq.d/ ACAGAATGGGTAAAGTACATGGTGGTTTGAATC

  2. Rotation and Morphology of Comet 252P/LINEAR

    Science.gov (United States)

    Woodney, Laura; Schambeau, Charles A.; Fernandez, Yanga R.

    2017-10-01

    Comet 252P/LINEAR had an incredibly close approach early in 2016 - minimum distance 0.036 AU on March 21 - that allowed detailed investigation of its behavior. Analysis of observations of the morphology of 252P have resulted in several possible rotational periods. Knight and Schleicher found that repetition of features in narrowband imaging from April 2016 indicated a period of 7.35 +/- 0.05 hr [1]. HST broadband data obtained by Li et al. in March and April partially fit the 7.35 hr period, but found 5.5 hr was a better fit for the April 4 r’ band data [2]. Given this discrepancy, additional observations may shed light on the true rotation state, and we present here the pieces of the puzzle obtained by our group.We observed 252P with the Kitt Peak National Observatory WIYN 0.9 m telescope on 7 nights: May 2 - 5 and June 6,8,9, 2016 using a Harris R filter. An oscillating jet is clearly visible in our data. While there is insufficient phase coverage to determine a best fit period from our data alone, we will present how our observations of the morphology fit the two proposed periods.[1] Knight, M.M and D.G. Schleicher. AAS, DPS Meeting #48, id.207.02, 2016 [2] Li, J.-Y. et al. AAS, DPS Meeting #48, id. 206.03, 2016.

  3. Californium-252: a remarkable versatile radioisotope

    International Nuclear Information System (INIS)

    Osborne-Lee, I.W.; Alexander, C.W.

    1995-01-01

    A product of the nuclear age, Californium-252 ( 252 Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, 252 Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of 252 Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the 252 Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, 252 Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of 252 Cf from ORNL is summarized herein

  4. Californium-252: a remarkable versatile radioisotope

    Energy Technology Data Exchange (ETDEWEB)

    Osborne-Lee, I.W.; Alexander, C.W.

    1995-10-10

    A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.

  5. 48 CFR 53.301-252 - Standard Form 252, Architect-Engineer Contract.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Standard Form 252, Architect-Engineer Contract. 53.301-252 Section 53.301-252 Federal Acquisition Regulations System FEDERAL..., Architect-Engineer Contract. EC01MY91.035 EC01MY91.036 ...

  6. A proposed HTTP service based IDS

    Directory of Open Access Journals (Sweden)

    Mohamed M. Abd-Eldayem

    2014-03-01

    Full Text Available The tremendous growth of the web-based applications has increased information security vulnerabilities over the Internet. Security administrators use Intrusion-Detection System (IDS to monitor network traffic and host activities to detect attacks against hosts and network resources. In this paper IDS based on Naïve Bayes classifier is analyzed. The main objective is to enhance IDS performance through preparing the training data set allowing to detect malicious connections that exploit the http service. Results of application are demonstrated and discussed. In the training phase of the proposed IDS, at first a feature selection technique based on Naïve Bayes classifier is used, this technique identifies the most important HTTP traffic features that can be used to detect HTTP attacks. In the testing and running phases proposed IDS classifies the network traffic based on the requested service, then based on the selected features Naïve Bayes classifier is used to analyze the HTTP service based traffic and identifies the HTTP normal connections and attacks. The performance of the IDS is measured through experiments using NSL-KDD data set. The results show that the detection rate of the IDS is about 99%, the false-positive rate is about 1%, and the false-negative rate is about 0.25%; therefore, proposed IDS holds the highest detection rate and the lowest false alarm compared with other leading IDS. In addition, the proposed IDS based on Naïve Bayes is used to classify network connections as a normal or attack. And it holds a high detection rate and a low false alarm.

  7. Id1 and Id3 expression is associated with increasing grade of prostate cancer: Id3 preferentially regulates CDKN1B

    International Nuclear Information System (INIS)

    Sharma, Pankaj; Patel, Divya; Chaudhary, Jaideep

    2012-01-01

    As transcriptional regulators of basic helix–oop–helix (bHLH) transcription and non-bHLH factors, the inhibitor of differentiation (Id1, Id2, Id3, and Id4) proteins play a critical role in coordinated regulation of cell growth, differentiation, tumorigenesis, and angiogenesis. Id1 regulates prostate cancer (PCa) cell proliferation, apoptosis, and androgen independence, but its clinical significance in PCa remains controversial. Moreover, there is lack of evidence on the expression of Id2 and Id3 in PCa progression. In this study we investigated the expression of Id2 and Id3 and reevaluated the expression of Id1 in PCa. We show that increased Id1 and Id3 protein expression is strongly associated with increasing grade of PCa. At the molecular level, we report that silencing either Id1 or Id3 attenuates cell cycle. Although structurally and mechanistically similar, our results show that both these proteins are noncompensatory at least in PCa progression. Moreover, through gene silencing approaches we show that Id1 and Id3 primarily attenuates CDKN1A (p21) and CDKN1B (p27), respectively. We also demonstrate that silencing Id3 alone significantly attenuates proliferation of PCa cells as compared with Id1. We propose that increased Id1 and Id3 expression attenuates all three cyclin-dependent kinase inhibitors (CDKN2B, -1A, and -1B) resulting in a more aggressive PCa phenotype

  8. SecurID

    CERN Multimedia

    Now called RSA SecurID, SecurID is a mechanism developed by Security Dynamics that allows two-factor authentication for a user on a network resource. It works on the principle of the unique password mode, based on a shared secret. Every sixty seconds, the component generates a new six-digit token on the screen. The latter comes from the current time (internal clock) and the seed (SecurID private key that is available on the component, and is also from the SecurID server). During an authentication request, the SecurID server will check the entered token by performing exactly the same calculation as that performed by your component. The server knows the two information required for this calculation: the current time and the seed of your component. Access is allowed if the token calculated by the server matches the token you specified.

  9. 15 CFR 25.2 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... head means the Secretary of the Department of Commerce, or designee. Benefit means, except as the... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Definitions. 25.2 Section 25.2 Commerce and Foreign Trade Office of the Secretary of Commerce PROGRAM Fraud Civil Remedies § 25.2...

  10. The Antibody Response of Pregnant Cameroonian Women to VAR2CSA ID1-ID2a, a Small Recombinant Protein Containing the CSA-Binding Site

    Science.gov (United States)

    Babakhanyan, Anna; Leke, Rose G. F.; Salanti, Ali; Bobbili, Naveen; Gwanmesia, Philomina; Leke, Robert J. I.; Quakyi, Isabella A.; Chen, John J.; Taylor, Diane Wallace

    2014-01-01

    In pregnant women, Plasmodium falciparum-infected erythrocytes expressing the VAR2CSA antigen bind to chondroitin sulfate A in the placenta causing placental malaria. The binding site of VAR2CSA is present in the ID1-ID2a region. This study sought to determine if pregnant Cameroonian women naturally acquire antibodies to ID1-ID2a and if antibodies to ID1-ID2a correlate with absence of placental malaria at delivery. Antibody levels to full-length VAR2CSA and ID1-ID2a were measured in plasma samples from 745 pregnant Cameroonian women, 144 Cameroonian men, and 66 US subjects. IgM levels and IgG avidity to ID1-ID2a were also determined. As expected, antibodies to ID1-ID2a were absent in US controls. Although pregnant Cameroonian women developed increasing levels of antibodies to full-length VAR2CSA during pregnancy, no increase in either IgM or IgG to ID1-ID2a was observed. Surprisingly, no differences in antibody levels to ID1-ID2a were detected between Cameroonian men and pregnant women. For example, in rural settings only 8–9% of males had antibodies to full-length VAR2CSA, but 90–96% had antibodies to ID1-ID2a. In addition, no significant difference in the avidity of IgG to ID1-ID2a was found between pregnant women and Cameroonian men, and no correlation between antibody levels at delivery and absence of placental malaria was found. Thus, the response to ID1-ID2a was not pregnancy specific, but predominantly against cross-reactivity epitopes, which may have been induced by other PfEMP1 antigens, malarial antigens, or microbes. Currently, ID1-ID2a is a leading vaccine candidate, since it binds to the CSA with the same affinity as the full-length molecule and elicits binding-inhibitory antibodies in animals. Further studies are needed to determine if the presence of naturally acquired cross-reactive antibodies in women living in malaria endemic countries will alter the response to ID1-ID2a following vaccination with ID1-ID2a. PMID:24505415

  11. The antibody response of pregnant Cameroonian women to VAR2CSA ID1-ID2a, a small recombinant protein containing the CSA-binding site.

    Directory of Open Access Journals (Sweden)

    Anna Babakhanyan

    Full Text Available In pregnant women, Plasmodium falciparum-infected erythrocytes expressing the VAR2CSA antigen bind to chondroitin sulfate A in the placenta causing placental malaria. The binding site of VAR2CSA is present in the ID1-ID2a region. This study sought to determine if pregnant Cameroonian women naturally acquire antibodies to ID1-ID2a and if antibodies to ID1-ID2a correlate with absence of placental malaria at delivery. Antibody levels to full-length VAR2CSA and ID1-ID2a were measured in plasma samples from 745 pregnant Cameroonian women, 144 Cameroonian men, and 66 US subjects. IgM levels and IgG avidity to ID1-ID2a were also determined. As expected, antibodies to ID1-ID2a were absent in US controls. Although pregnant Cameroonian women developed increasing levels of antibodies to full-length VAR2CSA during pregnancy, no increase in either IgM or IgG to ID1-ID2a was observed. Surprisingly, no differences in antibody levels to ID1-ID2a were detected between Cameroonian men and pregnant women. For example, in rural settings only 8-9% of males had antibodies to full-length VAR2CSA, but 90-96% had antibodies to ID1-ID2a. In addition, no significant difference in the avidity of IgG to ID1-ID2a was found between pregnant women and Cameroonian men, and no correlation between antibody levels at delivery and absence of placental malaria was found. Thus, the response to ID1-ID2a was not pregnancy specific, but predominantly against cross-reactivity epitopes, which may have been induced by other PfEMP1 antigens, malarial antigens, or microbes. Currently, ID1-ID2a is a leading vaccine candidate, since it binds to the CSA with the same affinity as the full-length molecule and elicits binding-inhibitory antibodies in animals. Further studies are needed to determine if the presence of naturally acquired cross-reactive antibodies in women living in malaria endemic countries will alter the response to ID1-ID2a following vaccination with ID1-ID2a.

  12. A survey of uses and users of 252Cf

    International Nuclear Information System (INIS)

    Bigelow, J.E.; Alexander, C.W.; King, L.J.; Knauer, J.B.; Notz, K.J.

    1989-01-01

    Californium-252, which is one of the transuranium-element isotopes being produced in the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL), has found many applications in service to industry and medicine. As a neutron source, 252 Cf is unique in providing a highly concentrated and extremely reliable neutron spectrum from a very small assembly. Over the past 22 years, 252 Cf has been applied with great success to cancer therapy, to neutron radiography of objects ranging from flowers to entire aircraft, to startup sources for nuclear reactors, to fission activation assay for quality control and safeguards of all commercial nuclear fuel, and to many other beneficial uses, some of which are now poised for further growth. The extensive exploitation of this highly specialized product has been made possible through 252 Sales/Loan programs sponsored by the US DOE Office of Nuclear Materials Production, initially at the Savannah River Laboratory and now at ORNL

  13. Californium-252 radiotherapy sources for interstitial afterloading

    International Nuclear Information System (INIS)

    Permar, P.H.; Walker, V.W.

    1976-01-01

    Californium-252 neutron sources for interstitial afterloading were developed to investigate the value of this radionuclide in cancer therapy. Californium-252 seed assemblies contain essentially point sources of 252 Cf permanently sealed on 1-cm centers within a flexible plastic tube. The seed assemblies are fabricated with remotely operated, specially designed machines. The fabrication process involves the production of a Pt-10 percent Ir-clad wire with a 252 Cf 2 O 3 -Pd cermet core. The wire is swaged and drawn to size, cut to length, and welded in a Pt-10 percent Ir capsule 0.8 mm in diameter and 6 mm long. Each seed capsule contains approximately 0.5 microgram of 252 Cf. Because the effective half-life of 252 Cf is 2.6 years, the seed assemblies are not disposable and must be reused until their activities have decreased to unsuitable levels. The flexible plastic components must therefore have sufficient resistance to radiation damage to survive the neutron-plus-gamma radiation from 252 Cf. On the basis of accelerated irradiation tests with a large 252 Cf source, a recently developed fluoropolymer, ''Tefzel'' (trademark of E. I. du Pont de Nemours and Company) has adequate radiation resistance for this application. Californium-252 seed assembly systems are loaned by the United States Energy Research and Development Administration for clinical investigations under a protocol of the Radiation Therapy Oncology Group, U.S. National Cancer Institute

  14. 7 CFR 3565.252 - Housing types.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Housing types. 3565.252 Section 3565.252 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, DEPARTMENT OF AGRICULTURE GUARANTEED RURAL RENTAL HOUSING PROGRAM Property Requirements § 3565.252 Housing types. The property may...

  15. 14 CFR 252.9 - Ventilation systems.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Ventilation systems. 252.9 Section 252.9... REGULATIONS SMOKING ABOARD AIRCRAFT § 252.9 Ventilation systems. Air carriers shall prohibit smoking whenever the ventilation system is not fully functioning. Fully functioning for this purpose means operating so...

  16. 7 CFR 252.3 - Administration.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 252.3 Section 252.3 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE... Administration. (a) Role of FNS. The Secretary will designate those commodities which will be available under the...

  17. Id-1 and Id-2 genes and products as markers of epithelial cancer

    Science.gov (United States)

    Desprez, Pierre-Yves [El Cerrito, CA; Campisi, Judith [Berkeley, CA

    2008-09-30

    A method for detection and prognosis of breast cancer and other types of cancer. The method comprises detecting expression, if any, for both an Id-1 and an Id-2 genes, or the ratio thereof, of gene products in samples of breast tissue obtained from a patient. When expressed, Id-1 gene is a prognostic indicator that breast cancer cells are invasive and metastatic, whereas Id-2 gene is a prognostic indicator that breast cancer cells are localized and noninvasive in the breast tissue.

  18. Neutron shielding for a 252 Cf source

    International Nuclear Information System (INIS)

    Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M.; Eduardo Gallego, Alfredo Lorente

    2006-01-01

    To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a 252 Cf isotopic neutron source. During calculations a detailed model for the 252 Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare 252 Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)

  19. K-252a, a novel microbial product, inhibits smooth muscle myosin light chain kinase

    International Nuclear Information System (INIS)

    Nakanishi, S.; Yamada, K.; Kase, H.; Nakamura, S.; Nonomura, Y.

    1988-01-01

    Effects of K-252a, purified from the culture broth of Nocardiopsis sp., on the activity of myosin (light chain kinase were investigated. 1) K-252a affected three characteristic properties of chicken gizzard myosin-B, natural actomyosin, to a similar degree: the Ca 2+ -dependent activity of ATPase, superprecipitation, and the phosphorylation of the myosin light chain. 2) K-252a inhibited the activities of the purified myosin light chain kinase and a Ca 2+ -independent form of the enzyme which was constructed by cross-linking of myosin light chain kinase and calmodulin using glutaraldehyde. The degrees of inhibition by 3 x 10 -6 M K-252a were 69 and 48% of the control activities with the purified enzyme and the cross-linked complex, respectively. Chlorpromazine (3 x 10 -4 M), a calmodulin antagonist, inhibited the native enzyme, but not the cross-linked one. These results suggested that K-252a inhibited myosin light chain kinase by direct interaction with the enzyme, whereas chlorpromazine suppressed the enzyme activation by interacting with calmodulin. 3) The inhibition by K-252a of the cross-linked kinase was affected by the concentration of ATP, a phosphate donor. The concentration causing 50% inhibition was two orders magnitude lowere in the presence of 100 μM ATP than in the presence of 2 mM ATP. 4) Kinetic analyses using [γ- 32 P]ATP indicated that the inhibitory mode of K-252a was competitive with respect to ATP. These results suggest that K-252a interacts at the ATP-binding domain of myosin light chain kinase

  20. 46 CFR 252.13 - Contract.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Contract. 252.13 Section 252.13 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION REGULATIONS AFFECTING SUBSIDIZED VESSELS AND OPERATORS OPERATING... Contract. Upon approval by the Board of an application for ODS, the applicant and the United States may...

  1. Californium-252 progress, report No. 7, April 1971

    Energy Technology Data Exchange (ETDEWEB)

    1971-12-31

    This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.

  2. 46 CFR 252.33 - Hull and machinery insurance.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Hull and machinery insurance. 252.33 Section 252.33... Subsidy Rates § 252.33 Hull and machinery insurance. (a) Subsidy items. The fair and reasonable net premium costs (including stamp taxes) of hull and machinery, increased value, excess general average...

  3. Pengalaman Komunikasi Pelanggan Zalora.co.id (Studi Fenomenologi Pelanggan Zalora.co.id)

    OpenAIRE

    Aji, Widya Andhika; Pradekso, Tandiyo; Ulfa, Nurist Surayya

    2013-01-01

    1PENGALAMAN KOMUNIKASI PELANGGAN ZALORA.CO.ID(Studi Fenomenologi Pelanggan Zalora.co.id)Oleh:Widya Andhika AjiFakultas Ilmu Sosial dan Ilmu PolitikUniversitas Diponegoro SemarangABSTRAKPenelitian ini bertujuan untuk menganalisis pengalaman komunikasi danpemahaman penerimaan konsumen terkait pesan komunikasi pemasaran dalamberbelanja di Zalora.co.id. Dengan menggunakan sampel pada lima informandan metode wawancara, dapat ditarik kesimpulan: Pelanggan Zalora.co.idmemiliki pengalaman komunikasi ...

  4. 48 CFR 252.217-7010 - Performance.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance. 252.217-7010... Clauses 252.217-7010 Performance. As prescribed in 217.7104(a), use the following clause: Performance (JUL..., scrap or other ship's material of the Government resulting from performance of the work as items of...

  5. Historical review of californium-252 discovery and development

    International Nuclear Information System (INIS)

    Stoddard, D.H.

    1985-01-01

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving 252 Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed

  6. 48 CFR 252.217-7009 - Default.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Default. 252.217-7009... Clauses 252.217-7009 Default. As prescribed in 217.7104(a), use the following clause: Default (DEC 1991... of default to the Contractor, terminate the whole or any part of a job order if the Contractor fails...

  7. 48 CFR 252.236-7000 - Modification proposals-price breakdown.

    Science.gov (United States)

    2010-10-01

    ...-price breakdown. 252.236-7000 Section 252.236-7000 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.236-7000 Modification proposals—price breakdown. As prescribed in 236.570(a), use the following clause: Modification Proposals—Price Breakdown (DEC 1991) (a) The...

  8. Neutron shielding for a {sup 252} Cf source

    Energy Technology Data Exchange (ETDEWEB)

    Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M. [Unidades Academicas de Estudios Nucleares e Ingenieria Electrica, Universidad Autonoma de Zacatecas, C. Cipres 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Eduardo Gallego, Alfredo Lorente [Depto. de Ingenieria Nuclear, ETS Ingenieros Industriales, Universidad Politecnica de Madrid, C. Jose Gutierrez Abascal 2, 28006 Madrid (Spain)]. e-mail: fermineutron@yahoo.com

    2006-07-01

    To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a {sup 252}Cf isotopic neutron source. During calculations a detailed model for the {sup 252}Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare {sup 252}Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)

  9. 48 CFR 252.231-7000 - Supplemental cost principles.

    Science.gov (United States)

    2010-10-01

    ... principles. 252.231-7000 Section 252.231-7000 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.231-7000 Supplemental cost principles. As prescribed in 231.100-70, use the following clause: Supplemental Cost Principles (DEC 1991) When the allowability of costs under...

  10. A pneumatic transfer system for special form 252Cf

    International Nuclear Information System (INIS)

    Gehrke, R.J.; Berry, S.M.; Grafwallner, E.G.; Hoggan, J.M.

    1996-09-01

    A pneumatic transfer system has been developed for use with series 100 Special Form 252 Cf. It was developed to reduce the exposure to personnel handling sources of 252 Cf with masses up to 150 microg by permitting remotely activated two-way transfer between the storage container and the irradiation position. The pneumatic transfer system also permits transfers for reproducible repetitive irradiation periods. In addition to the storage container equipped with quick-release fittings, the transfer system consists of an irradiation station, a control box with momentary contact switches to activate the air-pressure control valves and indicators to identify the location of the source, and connecting air hose and electrical wire. A source of 20 psig air and 110 volt electrical power are required for operation of the transfer system which can be easily moved and set up by one individual in 5 to 10 minutes. Tests have shown that rarely does a source become lodged in the transfer tubing, but two methods have been developed to handle incomplete transfers of the 252 Cf source. The first method consists of closing one air vent to allow a pressure impulse to propel the source to the opposite side. The second method applies to those 252 Cf capsules with a threaded or tapped end to which a small ferromagnetic piece can be attached; an incompletely transferred source in the transfer tube can then be guided to a position of safety by surrounding the transfer tubing containing the capsule with a horseshoe magnet attached to the end of a long pole

  11. 48 CFR 252.217-7002 - Offering property for exchange.

    Science.gov (United States)

    2010-10-01

    ... exchange. 252.217-7002 Section 252.217-7002 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.217-7002 Offering property for exchange. As prescribed in 217.7005, use the following provision: Offering Property for Exchange (DEC 1991) (a) The property described in item...

  12. Beam transport radiation shielding for branch lines 2-ID-B and 2-ID-C

    International Nuclear Information System (INIS)

    Feng, Y.P.; Lai, B.; McNulty, I.; Dejus, R.J.; Randall, K.J.; Yun, W.

    1995-01-01

    The x-ray radiation shielding requirements beyond the first optics enclosure have been considered for the beam transport of the 2-ID-B and 2-ID-C branch lines of Sector 2 (SRI-CAT) of the APS. The first three optical components (mirrors) of the 2-ID-B branch are contained within the shielded first optics enclosure. Calculations indicate that scattering of the primary synchrotron beam by beamline components outside the enclosure, such as apertures and monochromators, or by gas particles in case of vacuum failure is within safe limits for this branch. A standard 2.5-inch-diameter stainless steel pipe with 1/16-inch-thick walls provides adequate shielding to reduce the radiation dose equivalent rate to human tissue to below the maximum permissible limit of 0.25 mrem/hr. The 2-ID-C branch requires, between the first optics enclosure where only two mirrors are used and the housing for the third mirror, additional lead shielding (0.75 mm) and a minimum approach distance of 2.6 cm. A direct beam stop consisting of at least 4.5 mm of lead is also required immediately downstream of the third mirror for 2-ID-C. Finally, to stop the direct beam from escaping the experimental station, a beam stop consisting of at least 4-mm or 2.5-mm steel is required for the 2-ID-B or 2-ID-C branches, respectively. This final requirement can be met by the vacuum chambers used to house the experiments for both branch lines

  13. 48 CFR 252.217-7016 - Plant protection.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Plant protection. 252.217... Clauses 252.217-7016 Plant protection. As prescribed in 217.7104(a), use the following clause: Plant Protection (DEC 1991) (a) The Contractor shall provide, for the plant and work in process, reasonable...

  14. 46 CFR 252.31 - Wages of officers and crews.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Wages of officers and crews. 252.31 Section 252.31... Subsidy Rates § 252.31 Wages of officers and crews. (a) Definitions. When used in this part: (1) Base period. The first base period under the wage index systems, as provided in section 603 of the Act, is the...

  15. Teratogenic effect of Californium-252 irradiation in rats

    International Nuclear Information System (INIS)

    Satow, Yukio; Lee, Juing-Yi; Hori, Hiroshi; Okuda, Hiroe; Tsuchimoto, Shigeo; Sawada, Shozo; Yokoro, Kenjiro

    1989-01-01

    The teratogenicity of Californium-252 (Cf-252) irradiation which generates approximately 70% 2.3 MeV fast neutron and 30% gamma rays was evaluated. A single whole body exposure of Cf-252 at various doses was given to pregnant rats on day 8 or 9 of pregnancy, followed by microscopic autopsy of the fetuses at the terminal stage of pregnancy to search for external and internal malformations. For comparison, pregnant rats were irradiated with various doses of Cobalt-60 (Co-60) standard gamma rays at the same dose rate (1 rad/min.). The doses were 20-120 rad of Cf-252 and 80-220 rad of Co-60. Using frequency of radiation induced malformations observed on day 8 of pregnancy as an index, relative biological effectiveness (RBE) of 2.3-2.7 was obtained from the straight line obtained by modifying by the least squares method the frequency curves of malformed fetuses in total implants and in surviving fetuses. The types of malformations induced by Cf-252 and Co-60 irradiation were alike. Using fetal LD 50 as an index, 2.4 was obtained as RBE when irradiated on day 8 of pregnancy and 3.1 as that when irradiated on day 9. The results showed that Cf-252 had stronger a teratogenic effect than Co-60 gamma rays. (author)

  16. 48 CFR 252.237-7011 - Preparation history.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Preparation history. 252... Provisions And Clauses 252.237-7011 Preparation history. As prescribed in 237.7003(b), use the following clause: Preparation History (DEC 1991) For each body prepared, or for each casket handled in a group...

  17. 40 CFR 265.252 - Waste analysis.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Waste analysis. 265.252 Section 265... FACILITIES Waste Piles § 265.252 Waste analysis. In addition to the waste analyses required by § 265.13, the... in the pile to which it is to be added. The analysis conducted must be capable of differentiating...

  18. A brief review of revocable ID-based public key cryptosystem

    Directory of Open Access Journals (Sweden)

    Tsu-Yang Wu

    2016-03-01

    Full Text Available The design of ID-based cryptography has received much attention from researchers. However, how to revoke the misbehaviour/compromised user in ID-based public key cryptosystem becomes an important research issue. Recently, Tseng and Tsai proposed a novel public key cryptosystem called revocable ID-based public key cryptosystem (RIBE to solve the revocation problem. Later on, numerous research papers based on the Tseng-Tsai key RIBE were proposed. In this paper, we brief review Tseng and Tsai's RIBE. We hope this review can help the readers to understand the Tseng and Tsai's revocable ID-based public key cryptosystem.

  19. 48 CFR 252.235-7002 - Animal welfare.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Animal welfare. 252.235... Clauses 252.235-7002 Animal welfare. As prescribed in 235.072(a), use the following clause: Animal Welfare... animals only from dealers licensed by the Secretary of Agriculture under 7 U.S.C. 2133 and 9 CFR subpart A...

  20. 48 CFR 252.229-7001 - Tax relief.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax relief. 252.229-7001... Clauses 252.229-7001 Tax relief. As prescribed in 229.402-70(a), use the following clause: Tax Relief (JUN 1997) (a) Prices set forth in this contract are exclusive of all taxes and duties from which the United...

  1. 48 CFR 252.217-7001 - Surge option.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Surge option. 252.217-7001... Clauses 252.217-7001 Surge option. As prescribed in 217.208-70(b), use the following clause: Surge Option (AUG 1992) (a) General. The Government has the option to— (1) Increase the quantity of supplies or...

  2. Californium-252 interstitial implants in carcinoma of the tongue

    International Nuclear Information System (INIS)

    Vtyurin, B.M.; Ivanov, V.N.; Medvedev, V.S.; Galantseva, G.F.; Abdulkadyrov, S.A.; Ivanova, L.F.; Petrovskaya, G.A.; Plichko, V.I.

    1985-01-01

    A clinical study using 252 Cf sources in brachytherapy of tumors began in the Research Institute of Medical Radiology of the Academy of Medical Sciences of the USSR in 1973. 252 Cf afterloading cells were utilized by the method of simple afterloading. Dosimetry and radiation protection of medical personnel were developed. To substantiate optimal therapeutic doses of 252 Cf neutrons, a correlation of dose, time, and treatment volume factors with clinical results of 252 Cf interstitial implants in carcinoma of the tongue for 47 patients with a minimum follow-up period of 1 year was studied. Forty-nine interstitial implants have been performed. Seventeen patients received 252 Cf implants alone (Group I), 17 other patients received 252 Cf implants in combination with external radiation (Group II), and 15 patients were treated with interstitial implants for recurrent or residual tumors (Groups III). Complete regression of carcinoma of the tongue was obtained in 48 patients (98%). Thirteen patients (27%) developed radiation necrosis. The therapeutic dose of neutron radiation from 252 Cf sources in interstitial radiotherapy of primary tongue carcinomas (Group I) was found to be 7 to 9 Gy. Optimal therapeutic neutron dose in combined interstitial and external radiotherapy of primary tumors (Group II) was 5 to 6 Gy with an external radiation dose of 40 Gy. For recurrent and residual tumors (Group III), favorable results were obtained with tumor doses of 6.5 to 7 Gy

  3. 48 CFR 252.225-7025 - Restriction on acquisition of forgings.

    Science.gov (United States)

    2010-10-01

    ... of forgings. 252.225-7025 Section 252.225-7025 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.225-7025 Restriction on acquisition of forgings. As prescribed in 225.7102-4, use the following clause: Restriction on Acquisition of Forgings (DEC 2009) (a...

  4. 48 CFR 252.225-7031 - Secondary Arab boycott of Israel.

    Science.gov (United States)

    2010-10-01

    ... Israel. 252.225-7031 Section 252.225-7031 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.225-7031 Secondary Arab boycott of Israel. As prescribed in 225.7605, use the following provision: Secondary Arab Boycott of Israel (JUN 2005) (a) Definitions. As used in...

  5. Californium-252

    International Nuclear Information System (INIS)

    1975-01-01

    This meeting constituted the third phase of a project initiated by the Dosimetry Section of the IAEA in 1973. The first step, early in 1973, consisted of the development of a programme for the loan of Cf-252 sources to the Member States in support of education, training and some limited research. To date, 14 institutions in 13 Member States have participated in this loan programme. In August last year, the Agency published an instructional syllabus and laboratory manual authored by Professors Eric J. Hall and Harald H. Rossi of Columbia University (Californium-252 in Teaching and Research, Technical Reports Series No. 159). The appearance of this publication, including guidance on the design and construction of a storage and use facility, was the second phase of this programme aimed at providing some support to potential users in the fields of radiation biology and dosimetry. The objective of the programme's third phase - the convening of an Educational Seminar - was to provide a forum to bring together participants in the Agency's loan programme and experts in various scientific fields. Specifically, the Seminar consisted of a series of expert presentations in spectrometry, activation and prompt gamma analyses, on-stream analysis, dosimetry, health physics, radiology and radiotherapy. (author)

  6. Electron ID in ATLAS Run 2

    CERN Document Server

    Thais, Savannah Jennifer; The ATLAS collaboration

    2018-01-01

    Efficient and accurate electron identification is of critical importance to measuring many physics processes with leptons in the final state, including H->4l, dark vector boson searches, and various SUSY searches. This poster will describe the current status of the Likelihood driven Electron ID, highlighting the recent move from a MC driven ID to a data-driven ID. It will include the most recent identification efficiency and scale-factor measurements. Additionally, it will describe continued improvements for Run 2 electron ID, highlighting improvements in the low pt region and potential Machine Learning improvements.

  7. How to save distressed IDS-physician marriages: a case study.

    Science.gov (United States)

    Collins, H; Johnson, B A

    1998-04-01

    A hospital-driven IDS that encounters serious problems resulting from ownership of a physician practice should address those problems by focusing on three core areas: vision and leadership, effectiveness of operations, and physician compensation arrangements. If changes in these areas do not lead to improvements, the IDS may need to consider organizational restructuring. In one case study, a hospital-driven IDS faced the problem of owning a poorly performing MSO with a captive physician group. The IDS's governing board determined that the organization lacked effective communication with the physicians and that realization of the organization's vision would require greater physician involvement in organizational decision making. The organization is expected to undergo some corporate reorganization in which physicians will acquire an equity interest in the enterprise.

  8. Tinjauan Desain Website Kemlu.Go.Id

    OpenAIRE

    Danu Widhyatmoko

    2013-01-01

    Review of kemlu.go.id website design is a research report on Kemlu.go.id website design. Kemlu.go.id website aims to be the information gateway of Ministry of Foreign Affairs, and also as guidelines of foreign politic policies of Republic of Indonesia. The review had been accomplished by using analytical method based on the "Nine Essential Principles for Good Web Design" developed by Collis Ta'eed (2007). At the end of the article, several recommendations in developing kemlu.go.id website are...

  9. Tinjauan Desain Website Kemlu.Go.Id

    Directory of Open Access Journals (Sweden)

    Danu Widhyatmoko

    2013-04-01

    Full Text Available Review of kemlu.go.id website design is a research report on Kemlu.go.id website design. Kemlu.go.id website aims to be the information gateway of Ministry of Foreign Affairs, and also as guidelines of foreign politic policies of Republic of Indonesia. The review had been accomplished by using analytical method based on the "Nine Essential Principles for Good Web Design" developed by Collis Ta'eed (2007. At the end of the article, several recommendations in developing kemlu.go.id website are presented to create better appearance.  

  10. 48 CFR 252.229-7004 - Status of contractors as a direct contractor (Spain).

    Science.gov (United States)

    2010-10-01

    ... direct contractor (Spain). 252.229-7004 Section 252.229-7004 Federal Acquisition Regulations System... contractor (Spain). As prescribed in 229.402-70(d), use the following clause: Status of Contractor as a Director Contractor (Spain) (JUN 1997) (a) “Direct Contractor,” as used in this clause, means an individual...

  11. A Good IDS Response Protocol of MANET Containment Strategies

    Science.gov (United States)

    Cheng, Bo-Chao; Chen, Huan; Tseng, Ryh-Yuh

    Much recent research concentrates on designing an Intrusion Detection System (IDS) to detect the misbehaviors of the malicious node in MANET with ad-hoc and mobility natures. However, without rapid and appropriate IDS response mechanisms performing follow-up management services, even the best IDS cannot achieve the desired primary goal of the incident response. A competent containment strategy is needed to limit the extent of an attack in the Incident Response Life Cycle. Inspired by the T-cell mechanisms in the human immune system, we propose an efficient MANET IDS response protocol (T-SecAODV) that can rapidly and accurately disseminate alerts of the malicious node attacks to other nodes so as to modify their AODV routing tables to isolate the malicious nodes. Simulations are conducted by the network simulator (Qualnet), and the experiment results indicate that T-SecAODV is able to spread alerts steadily while greatly reduce faulty rumors under simultaneous multiple malicious node attacks.

  12. 48 CFR 252.227-7000 - Non-estoppel.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Non-estoppel. 252.227-7000... Clauses 252.227-7000 Non-estoppel. As prescribed at 227.7009-1, insert the following clause in patent releases, license agreements, and assignments: Non-Estoppel (OCT 1966) The Government reserves the right at...

  13. Survey of potential markets for devices using Californium-252

    International Nuclear Information System (INIS)

    Permar, P.H.

    1975-01-01

    Potential applications for devices or systems containing 252 Cf in the years from 1975 to 1980 are estimated. The estimated number of devices and associated business value were derived from a survey of 46 industrial, educational and governmental organizations conducted from Jan. to May, 1975. Applications for devices and systems based on 252 Cf are expected to increase by a factor of 7 in the 6-y period from 1975 to 1980. The annual business value of 252 Cf devices should increase from 1.5 million dollars in 1975 to 10.8 million dollars in 1980. The potential European market should be several times as large as the US market, based on actual sales of 252 Cf, which have been two to four times greater in Europe than in the US

  14. Id-1 and Id-2 genes and products as therapeutic targets for treatment of breast cancer and other types of carcinoma

    Science.gov (United States)

    Desprez, Pierre-Yves; Campisi, Judith

    2014-09-30

    A method for treatment and amelioration of breast, cervical, ovarian, endometrial, squamous cells, prostate cancer and melanoma in a patient comprising targeting Id-1 or Id-2 gene expression with a delivery vehicle comprising a product which modulates Id-1 or Id-2 expression.

  15. One ID Card for the Entire Campus.

    Science.gov (United States)

    Ridenour, David P.; Ferguson, Linda M.

    1986-01-01

    The implementation by Indiana State University of a machine-readable photo ID system for their food services prompted an investigation into the available alternatives and requirements for a more efficient all-University ID card system. The new ID system is described. (AUTHOR/MLW)

  16. Ternary-fragmentation-driving potential energies of 252Cf

    Science.gov (United States)

    Karthikraj, C.; Ren, Zhongzhou

    2017-12-01

    Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.

  17. Inhibitor of differentiation 4 (Id4) is a potential tumor suppressor in prostate cancer

    International Nuclear Information System (INIS)

    Carey, Jason PW; Asirvatham, Ananthi J; Galm, Oliver; Ghogomu, Tandeih A; Chaudhary, Jaideep

    2009-01-01

    Inhibitor of differentiation 4 (Id4), a member of the Id gene family is also a dominant negative regulator of basic helix loop helix (bHLH) transcription factors. Some of the functions of Id4 appear to be unique as compared to its other family members Id1, Id2 and Id3. Loss of Id4 gene expression in many cancers in association with promoter hypermethylation has led to the proposal that Id4 may act as a tumor suppressor. In this study we provide functional evidence that Id4 indeed acts as a tumor suppressor and is part of a cancer associated epigenetic re-programming. Data mining was used to demonstrate Id4 expression in prostate cancer. Methylation specific polymerase chain reaction (MSP) analysis was performed to understand molecular mechanisms associated with Id4 expression in prostate cancer cell lines. The effect of ectopic Id4 expression in DU145 cells was determined by cell cycle analysis (3H thymidine incorporation and FACS), expression of androgen receptor, p53 and cyclin dependent kinase inhibitors p27 and p21 by a combination of RT-PCR, real time-PCR, western blot and immuno-cytochemical analysis. Id4 expression was down-regulated in prostate cancer. Id4 expression was also down-regulated in prostate cancer line DU145 due to promoter hyper-methylation. Ectopic Id4 expression in DU145 prostate cancer cell line led to increased apoptosis and decreased cell proliferation due in part by an S-phase arrest. In addition to S-phase arrest, ectopic Id4 expression in PC3 cells also resulted in prolonged G2/M phase. At the molecular level these changes were associated with increased androgen receptor (AR), p21, p27 and p53 expression in DU145 cells. The results suggest that Id4 acts directly as a tumor suppressor by influencing a hierarchy of cellular processes at multiple levels that leads to a decreased cell proliferation and change in morphology that is possibly mediated through induction of previously silenced tumor suppressors

  18. 24 CFR 92.252 - Qualification as affordable housing: Rental housing.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Qualification as affordable housing: Rental housing. 92.252 Section 92.252 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development HOME INVESTMENT PARTNERSHIPS PROGRAM Project Requirements § 92.252...

  19. 48 CFR 252.235-7011 - Final scientific or technical report.

    Science.gov (United States)

    2010-10-01

    ... technical report. 252.235-7011 Section 252.235-7011 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.235-7011 Final scientific or technical report. As prescribed in 235.072(d), use the following clause: Final Scientific or Technical Report (NOV 2004) The Contractor...

  20. Application of californium-252 neutron sources for analytical chemistry

    International Nuclear Information System (INIS)

    Ishii, Daido

    1976-01-01

    The researches made for the application of Cf-252 neutron sources to analytical chemistry during the period from 1970 to 1974 including partly 1975 are reviewed. The first part is the introduction to the above. The second part deals with general review of symposia, publications and the like. Attention is directed to ERDA publishing the periodical ''Californium-252 Progress'' and to a study group of Cf-252 utilization held by Japanese Radioisotope Association in 1974. The third part deals with its application for radio activation analysis. The automated absolute activation analysis (AAAA) of Savannha River is briefly explained. The joint experiment of Savannha River operation office with New Brunswick laboratory is mentioned. Cf-252 radiation source was used for the non-destructive analysis of elements in river water. East neutrons of Cf-252 were used for the quantitative analysis of lead in paints. Many applications for industrial control processes have been reported. Attention is drawn to the application of Cf-252 neutron sources for the field search of neutral resources. For example, a logging sonde for searching uranium resources was developed. the fourth part deals with the application of the analysis with gamma ray by capturing neutrons. For example, a bore hole sonde and the process control analysis of sulfur in fuel utilized capture gamma ray. The prompt gamma ray by capturing neutrons may be used for the nondestructive analysis of enrivonment. (Iwakiri, K.)

  1. Use of californium-252 sources in Hungary for teaching and research

    International Nuclear Information System (INIS)

    Csikai, J.

    1976-01-01

    An activation facility was designed to accommodate up to 50 mg of 252 Cf; it contains at present a 500 μg source. The absolute values of thermal, epithermal and fast neutron fluxes were determined by the foil activation method using In, Dy, Au, Al and Fe detectors. Cross-sections averaged for unmoderated 252 Cf neutrons were determined for 22 different reactions for elements with atomic weights lying between A=27 and 204. The sensitivity for determination of Al, Ti, Cu, As, Sr, Mo, In, Cd, Ba, Au, Hg and Pb was calculated for NaI(Tl) and Ge(Li) detectors. Average (n,2n) cross-sections for 252 Cf spectrum were calculated for 49 nuclei lying between A=14 and 204. Angular distributions and cross-sections for the fragments from 252 Cf neutron-induced fission of 232 Th and 238 U were measured. Titanium in bauxite and manganese in aluminium alloys were determined with a 252 Cf source. The applicability of solid-state track detectors for neutron dosimetry, radiography and for the determination of fuel burn-up were investigated using 252 Cf neutron and fragment sources. Characteristics of a jumping spark counter for counting fission fragments were studied with 252 Cf sources. (author)

  2. 48 CFR 252.222-7002 - Compliance with local labor laws (overseas).

    Science.gov (United States)

    2010-10-01

    ... labor laws (overseas). 252.222-7002 Section 252.222-7002 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7002 Compliance with local labor laws (overseas). As prescribed in 222.7201(a), use the following clause: Compliance with Local Labor Laws (Overseas) (JUN 1997...

  3. 24 CFR 236.252 - First, second, and third mortgage insurance premiums.

    Science.gov (United States)

    2010-04-01

    ... insurance premiums. 236.252 Section 236.252 Housing and Urban Development Regulations Relating to Housing... insurance premiums. All of the provisions of § 207.252 of this chapter governing the first, second, and third mortgage insurance premiums shall apply to mortgages insured under this subpart, except: (a) Where...

  4. Californium-252 sales and loans at Oak Ridge National Laboratory

    International Nuclear Information System (INIS)

    King, L.J.

    1987-01-01

    The production and distribution in the United States of 252 Cf has recently been consolidated at the Oak Ridge National Laboratory (ORNL). The 252 Cf Industrial Sales/Loan Program and the 252 Cf University Load Program, which were formerly located at the Savannah River Plant (SRP), have been combined with the californium production and distribution activities of the Transuranium Element Production Program at ORNL. Californium-252 is sold to commercial users in the form of bulk californium oxide, palladium-californium alloy pellets, or alloy wires. Neutron source capsules, which are fabricated for loans to DOE or other US government agencies, are still available in all forms previously available. The consolidation of all 252 Cf distribution activities at the production site is expected to result in better service to users. In particular, customers for neutrons sources will be ale to select from a wider range of neutron source forms, including custom designs, through a single contact point

  5. Graphite moderated 252Cf source

    International Nuclear Information System (INIS)

    Sajo B, L.; Barros, H.; Greaves, E. D.; Vega C, H. R.

    2014-08-01

    The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a 252 Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the 252 Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)

  6. Inhibitor of differentiation 4 (Id4 is a potential tumor suppressor in prostate cancer

    Directory of Open Access Journals (Sweden)

    Carey Jason PW

    2009-06-01

    Full Text Available Abstract Background Inhibitor of differentiation 4 (Id4, a member of the Id gene family is also a dominant negative regulator of basic helix loop helix (bHLH transcription factors. Some of the functions of Id4 appear to be unique as compared to its other family members Id1, Id2 and Id3. Loss of Id4 gene expression in many cancers in association with promoter hypermethylation has led to the proposal that Id4 may act as a tumor suppressor. In this study we provide functional evidence that Id4 indeed acts as a tumor suppressor and is part of a cancer associated epigenetic re-programming. Methods Data mining was used to demonstrate Id4 expression in prostate cancer. Methylation specific polymerase chain reaction (MSP analysis was performed to understand molecular mechanisms associated with Id4 expression in prostate cancer cell lines. The effect of ectopic Id4 expression in DU145 cells was determined by cell cycle analysis (3H thymidine incorporation and FACS, expression of androgen receptor, p53 and cyclin dependent kinase inhibitors p27 and p21 by a combination of RT-PCR, real time-PCR, western blot and immuno-cytochemical analysis. Results Id4 expression was down-regulated in prostate cancer. Id4 expression was also down-regulated in prostate cancer line DU145 due to promoter hyper-methylation. Ectopic Id4 expression in DU145 prostate cancer cell line led to increased apoptosis and decreased cell proliferation due in part by an S-phase arrest. In addition to S-phase arrest, ectopic Id4 expression in PC3 cells also resulted in prolonged G2/M phase. At the molecular level these changes were associated with increased androgen receptor (AR, p21, p27 and p53 expression in DU145 cells. Conclusion The results suggest that Id4 acts directly as a tumor suppressor by influencing a hierarchy of cellular processes at multiple levels that leads to a decreased cell proliferation and change in morphology that is possibly mediated through induction of previously

  7. System control for the modulated 252Cf source ''Shuffler''

    International Nuclear Information System (INIS)

    Stephens, M.M.

    1975-06-01

    The design and theory of operation of the control chassis for a 252 Cf nondestructive assay system are described. This system repetitively transfers a 252 Cf source from the irradiation region to a shielded position before measuring the delayed neutrons. The design criteria for the system were: rapid movement and precise positioning of the 252 Cf source, precise positioning of the sample, and very accurate timing of the irradiate and count cycles. To achieve these results crystal oscillators were used for timing, and stepping motors were used to position the sample and the source. (U.S.)

  8. Laboratory-scale shielded cell for 252Cf

    International Nuclear Information System (INIS)

    Anderl, R.A.; Cargo, C.H.

    1979-01-01

    A shielded-cell facility for storing and handling remotely up to 2 milligram quantities of unencapsulated 252 Cf has been built in a radiochemistry laboratory at the Test Reactor Area of the Idaho National Engineering Laboratory. Unique features of this facility are its compact bulk radiation shield of borated gypsum and transfer lines which permit the transport of fission product activity from 252 Cf fission sources within the cell to a mass separator and to a fast radiochemistry system in nearby rooms

  9. A Contextual Model for Identity Management (IdM) Interfaces

    Science.gov (United States)

    Fuller, Nathaniel J.

    2014-01-01

    The usability of Identity Management (IdM) systems is highly dependent upon design that simplifies the processes of identification, authentication, and authorization. Recent findings reveal two critical problems that degrade IdM usability: (1) unfeasible techniques for managing various digital identifiers, and (2) ambiguous security interfaces.…

  10. Idékatalog Appetit på maden

    DEFF Research Database (Denmark)

    Jensen, Tenna; Jespersen, Astrid Pernille; Grønnow, Liv Cæcilie

    2015-01-01

    Idékataloget er en selvstændig publikation hørende til projekt Appetit på maden. Idékataloget er udviklet til brug i Københavns Kommune.......Idékataloget er en selvstændig publikation hørende til projekt Appetit på maden. Idékataloget er udviklet til brug i Københavns Kommune....

  11. 7 CFR 766.252 - Unauthorized assistance resulting from submission of false information.

    Science.gov (United States)

    2010-01-01

    ... false information. 766.252 Section 766.252 Agriculture Regulations of the Department of Agriculture... Unauthorized Assistance § 766.252 Unauthorized assistance resulting from submission of false information. A... behalf, submits information to the Agency that the borrower knows to be false. ...

  12. 46 CFR 252.23 - Financial and other reporting requirements.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Financial and other reporting requirements. 252.23... SERVICES Operation § 252.23 Financial and other reporting requirements. (a) Voyage report. The operator... total loss covered by a policy of insurance. (d) Financial statements. The operator shall submit, in...

  13. Prompt neutron spectrum of the spontaneous fission of californium-252

    International Nuclear Information System (INIS)

    Zamyatnin, Yu.S.; Kroshkin, N.I.; Korostylev, V.A.; Nefedov, V.N.; Ryazanov, D.K.; Starostov, B.I.; Semenov, A.F.

    1976-01-01

    The californium-252 spontaneous fission neutron spectrum was measured in the energy range of 0.01 to 10 MeV by the time-of-flight technique using various neutron detectors. The measurements of 252 Cf neutron spectrum at energies of 0.01 to 5 MeV were performed as a function of fission fragment kinetic energy. The mean neutron spectrum energy in the range of 0.7 to 10 MeV was found from the results of measurements. The irregularity in the 252 Cf neutron spectrum in the neutron energy range of less than 0.7 MeV compared to theoretical values is discussed. The mechanism of 252 Cf neutron emission is also discussed on the basis of neutron yield angle measurements. 12 references

  14. The antibody response of pregnant Cameroonian women to VAR2CSA ID1-ID2a, a small recombinant protein containing the CSA-binding site

    DEFF Research Database (Denmark)

    Babakhanyan, Anna; Leke, Rose G F; Salanti, Ali

    2014-01-01

    In pregnant women, Plasmodium falciparum-infected erythrocytes expressing the VAR2CSA antigen bind to chondroitin sulfate A in the placenta causing placental malaria. The binding site of VAR2CSA is present in the ID1-ID2a region. This study sought to determine if pregnant Cameroonian women natura...

  15. Evaluation of ID-PaGIA syphilis antibody test.

    Science.gov (United States)

    Naaber, Paul; Makoid, Ene; Aus, Anneli; Loivukene, Krista; Poder, Airi

    2009-01-01

    Laboratory diagnosis of syphilis is usually accomplished by serology. There are currently a large number of different commercial treponemal tests available that vary in format, sensitivity and specificity. To evaluate the ID-PaGIA Syphilis Antibody Test as an alternative to other specific treponemal tests for primary screening or confirmation of diagnosis. Serum samples from healthy adults (n = 100) were used for detection of specificity of ID-PaGIA. To evaluate sensitivity of ID-PaGIA serum samples (n = 101) from patients with confirmed or suspected syphilis were tested for syphilis antibodies with FTA-Abs IgM, ID-PaGIA, ELISA IgM and TPHA tests. No false-positive results were found with ID-PaGIA. Sensitivity of various treponemal tests was the following: FTA-Abs IgM: 95.5%, ID-PaGIA and ELISA IgM: 94%, and TPHA 75%. The positive and negative predictive values of ID-PaGIA were 100 and 89.5%, respectively. Compared with other treponemal tests ID-PaGIA has excellent sensitivity and specificity.

  16. 48 CFR 252.204-7001 - Commercial and Government Entity (CAGE) code reporting.

    Science.gov (United States)

    2010-10-01

    ... Entity (CAGE) code reporting. 252.204-7001 Section 252.204-7001 Federal Acquisition Regulations System... Entity (CAGE) Code Reporting (AUG 1999) (a) The offeror is requested to enter its CAGE code on its offer... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.204-7001 Commercial and Government Entity...

  17. 24 CFR 252.6 - Method of payment of mortgage insurance premiums.

    Science.gov (United States)

    2010-04-01

    ... insurance premiums. 252.6 Section 252.6 Housing and Urban Development Regulations Relating to Housing and..., AND BOARD AND CARE HOMES § 252.6 Method of payment of mortgage insurance premiums. The provisions of..., DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT...

  18. Facts about Infectious Diseases (ID)

    Science.gov (United States)

    ... an ID Specialist? Facts about ID Pocketcard Infectious diseases are caused by microscopic organisms that penetrate the body’s natural ... from diseases such as AIDS or treatment of diseases such as cancer, may allow ... of contaminated food or water, bites from vectors such as ticks or mosquitoes ...

  19. Californium-252 Program Equipment Evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2017-12-01

    To successfully continue the 252Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.

  20. Identification of Staphylococcus species and subspecies with the MicroScan Pos ID and Rapid Pos ID panel systems.

    Science.gov (United States)

    Kloos, W E; George, C G

    1991-01-01

    The accuracies of the MicroScan Pos ID and Rapid Pos ID panel systems (Baxter Diagnostic Inc., MicroScan Division, West Sacramento, Calif.) were compared with each other and with the accuracies of conventional methods for the identification of 25 Staphylococcus species and 4 subspecies. Conventional methods included those used in the original descriptions of species and subspecies and DNA-DNA hybridization. The Pos ID panel uses a battery of 18 tests, and the Rapid Pos ID panel uses a battery of 42 tests for the identification of Staphylococcus species. The Pos ID panel has modified conventional and chromogenic tests that can be read after 15 to 48 h of incubation; the Rapid Pos ID panel has tests that use fluorogenic substrates or fluorometric indicators, and test results can be read after 2 h of incubation in the autoSCAN-W/A. Results indicated that both MicroScan systems had a high degree of congruence (greater than or equal to 90%) with conventional methods for the species S. capitis, S. aureus, S. auricularis, S. saprophyticus, S. cohnii, S. arlettae, S. carnosus, S. lentus, and S. sciuri and, in particular, the subspecies S. capitis subsp. capitis and S. cohnii subsp. cohnii. The Rapid Pos ID panel system also had greater than or equal to 90% congruence with conventional methods for S. epidermidis, S. caprae, S. warneri subsp. 2, S. xylosus, S. kloosii, and S. caseolyticus. For both MicroScan systems, congruence with conventional methods was 80 to 90% for S. haemolyticus subsp. 1, S. equorum, S. intermedius, and S. hyicus; and in addition, with the Rapid Pos ID panel system congruence was 80 to 89% for S. capitis subsp. ureolyticus, S. warneri subsp. 1, S. hominis, S. cohnii subsp. urealyticum, and S. simulans. The MicroScan systems identified a lower percentage (50 to 75%) of strains of S. lugdunensis, S. gallinarum, S. schleiferi, and S. chromogenes, although the addition of specific tests to the systems might increase the accuracy of identification

  1. Determination of kinetics parameters using stochastic methods in a 252Cf system

    International Nuclear Information System (INIS)

    Difilippo, F.C.

    1988-01-01

    Safety analysis and control system design of nuclear systems require the knowledge of neutron kinetics related parameters like effective delayed neutron fraction, neutron lifetime, time between neutron generations and subcriticality margins. Many methods, deterministic and stochastic, are being used, some since the beginning of nuclear power, to measure these important parameters. The method based on the use of the 252 Cf neutron source has been under intense study at the Oak Ridge National Laboratory, both experimentally and theoretically, during the last years. The increasing demand for this isotope in industrial and medical applications and new designs of advanced high flux reactors to produce it make the isotope available as neutron source (only few micrograms are necessary). A thin layer of 252 Cf is deposited in one of the electrodes of a fission chamber which produces pulses each time the 252 Cf disintegrates via α or spontaneous fission decay; the smaller pulses associated with the α decay can be easily discriminated with the important result that we known the time when v/sub c/ neutrons are injected into the system (number of neutrons per fission of 252 Cf). Thus, a small (few cm 3 ) and nonintrusive device can be used as a random pulsed neutron source with known natural properties that do no depend on biases associated with more complex interrogating devices like accelerators. This paper presents a general formalism that relates the kinetics parameters with stochastic descriptors that naturally appear because of the random nature of the production and transport of neutrons

  2. Graphite moderated {sup 252}Cf source

    Energy Technology Data Exchange (ETDEWEB)

    Sajo B, L.; Barros, H.; Greaves, E. D. [Universidad Simon Bolivar, Nuclear Physics Laboratory, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of); Vega C, H. R., E-mail: fermineutron@yahoo.com [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)

    2014-08-15

    The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a {sup 252}Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the {sup 252}Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)

  3. Fabrication of californium-252 sources in the United Kingdom

    International Nuclear Information System (INIS)

    Ainsworth, A.; Brady, M.W.; Thornett, W.H.

    1975-01-01

    The advent of californium-252 in weighable quantities and at a reasonable price has caused some rethinking among neutron source suppliers. To explore this market the Radiochemical Center Ltd. has purchased 2 mg of californium-252, and subdivided this into a wide range of sources. To take advantage of its high specific neutron emission, a small double welded stainless steel capsule 7.8mm diameter x 10mm high was chosen for stock sources and this entailed the use of a microdispensing technique which had to be specially developed. The apparatus and procedure for subdividing milligram amounts of californium-252 are described. Some details of our experience in processing these one milligram shipments are given. 100 sources with activities from 200 microgram to 0.01 microgram have been produced. Losses have been small. Measurement of neutron spectra gamma spectra and dose rates from encapsulated sources has confirmed published data. Though it is early days, little industrial interest in californium-252 sources has been detected, most of the sources have so far been required for research into activation analysis and two examples of this are given. (U.S.)

  4. Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields

    International Nuclear Information System (INIS)

    Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik

    2001-01-01

    Calibration measurements were carried out on a probe designed to measure ambient dose equivalent in accordance with ICRP Pub 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diameter spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV. The instrument was used to measure the dose rate in four separate neutron fields: unmoderated 252 Cf, D 2 O-moderated 252 Cf, polyethylene-moderated 252 Cf, and WEP neutron howitzer with 252 Cf at its center. Dose equivalent measurements were performed at source-detector centerline distances from 50 to 200 cm. The ratio of air-scatter- and room-return-corrected ambient dose equivalent rates to ambient dose equivalent rates calculated with the code MCNP are tabulated

  5. Production, Distribution, and Applications of Californium-252 Neutron Sources

    International Nuclear Information System (INIS)

    Balo, P.A.; Knauer, J.B.; Martin, R.C.

    1999-01-01

    The radioisotope 252 Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10 11 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252 Cf to commercial reencapsulators domestically and internationally. Sealed 252 Cf sources are also available for loan to agencies and subcontractors of the U.S. government and to universities for educational, research, and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252 Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments, and irradiation of rice to induce genetic mutations

  6. A YOUNG ECLIPSING BINARY AND ITS LUMINOUS NEIGHBORS IN THE EMBEDDED STAR CLUSTER Sh 2-252E

    Energy Technology Data Exchange (ETDEWEB)

    Lester, Kathryn V.; Gies, Douglas R.; Guo, Zhao, E-mail: lester@chara.gsu.edu, E-mail: gies@chara.gsu.edu, E-mail: guo@chara.gsu.edu [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 5060, Atlanta, GA 30302-5060 (United States)

    2016-12-01

    We present a photometric and light curve analysis of an eccentric eclipsing binary in the K2 Campaign 0 field, which resides in Sh 2-252E, a young star cluster embedded in an H ii region. We describe a spectroscopic investigation of the three brightest stars in the crowded aperture to identify which is the binary system. We find that none of these stars are components of the eclipsing binary system, which must be one of the fainter nearby stars. These bright cluster members all have remarkable spectra: Sh 2-252a (EPIC 202062176) is a B0.5 V star with razor sharp absorption lines, Sh 2-252b is a Herbig A0 star with disk-like emission lines, and Sh 2-252c is a pre-main-sequence star with very red color.

  7. 48 CFR 252.222-7005 - Prohibition on use of nonimmigrant aliens-Guam.

    Science.gov (United States)

    2010-10-01

    ... nonimmigrant aliens-Guam. 252.222-7005 Section 252.222-7005 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7005 Prohibition on use of nonimmigrant aliens—Guam. As prescribed in 222.7302, use the following clause: Prohibition on Use of Nonimmigrant Aliens—Guam (SEP 1999...

  8. 24 CFR 207.252e - Method of payment of mortgage insurance premiums.

    Science.gov (United States)

    2010-04-01

    ... insurance premiums. 207.252e Section 207.252e Housing and Urban Development Regulations Relating to Housing... Premiums § 207.252e Method of payment of mortgage insurance premiums. In the cases that the Commissioner... mortgagees, that mortgage insurance premiums be remitted electronically. [63 FR 1303, Jan. 8, 1998] ...

  9. Radiography using californium-252 neutron sources

    International Nuclear Information System (INIS)

    Ray, J.W.

    1975-01-01

    The current status in the technology of neutron radiography using californium-252 neutron sources is summarized. Major emphasis is on thermal neutron radiography since it has the widest potential applicability at the present time. Attention is given to four major factors which affect the quality and useability of thermal neutron radiography: source neutron thermalization, neutron beam extraction geometry, neutron collimator dimensions, and neutron imaging methods. Each of these factors has a major effect on the quality of the radiographs which are obtained from a californium source neutron radiography system and the exposure times required to obtain the radiographs; radiograph quality and exposure time in turn affect the practicality of neutron radiography for specific nondestructive inspection applications. A brief discussion of fast neutron radiography using californium-252 neutron sources is also included. (U.S.)

  10. A new facility for non-destructive assay using a 252Cf source

    International Nuclear Information System (INIS)

    Stevanato, L.; Caldogno, M.; Dima, R.; Fabris, D.; Hao, Xin; Lunardon, M.; Moretto, S.; Nebbia, G.; Pesente, S.; Pino, F.; Sajo-Bohus, L.; Viesti, G.

    2013-01-01

    A new laboratory facility for non-destructive analysis (NDA) using a time-tagged 252 Cf source is presented. The system is designed to analyze samples having maximum size of about 20×25 cm 2 , the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. - Highlights: ► Tagged 252 Cf source setup. ► Material recognition and sample imaging with measurements of gamma ray and neutron transmission. ► Material identification via energy dependent neutron and gamma ray transmission measurements. ► Identification of layered material. ► Effects due to the sample thickness on the above identification techniques

  11. Analysis of geological material and especially ores by means of a 252Cf source

    International Nuclear Information System (INIS)

    Barrandon, J.N.; Borderie, B.; Melky, S.; Halfon, J.; Marce, A.

    1976-01-01

    Tests were made on the possibilities for analysis by 252 Cf activation in the earth sciences and mining research. The results obtained show that while 252 Cf activation can only resolve certain very specific geochemical research problems, it does allow the exact and rapid determination of numerous elements whose ores are of great economic importance such as fluorine, titanium, vanadium, manganese, copper, antimony, barium, and tungsten. The utilization of activation analysis methods in the earth sciences is not a recent phenomenon. It has generally been limited to the analysis of traces in relatively small volumes by means of irradiation in nuclear reactors. Traditional neutron sources were little used and were not very applicable. The development of 252 Cf isotopic sources emitting more intense neutron fluxes make it possible to consider carrying out more sensitive determinations without making use of a nuclear reactor. In addition, this technique can be adapted for in situ analysis in mines and mine borings. Our work which is centered upon the possibilities of instrumental laboratory analyses of geological materials through 252 Cf activation is oriented in two principal directions: the study of the experimental sensitivities of the various elements in different rocks with the usual compositions; and the study of the possibilities for routine ore analyses

  12. 27 CFR 25.252 - Records.

    Science.gov (United States)

    2010-04-01

    ... TREASURY LIQUORS BEER Removal of Brewer's Yeast and Other Articles § 25.252 Records. (a) Production. The brewer shall keep records of the production of malt syrup, wort, and other articles which are removed... of brewer's yeast, malt and other articles from the brewery. The record shall include the quantity...

  13. 48 CFR 252.225-7044 - Balance of Payments Program-Construction Material.

    Science.gov (United States)

    2010-10-01

    ... Program-Construction Material. 252.225-7044 Section 252.225-7044 Federal Acquisition Regulations System...—Construction Material. As prescribed in 225.7503(a), use the following clause: Balance of Payments Program—Construction Material (JAN 2009) (a) Definitions. As used in this clause— Commercially available off-the-shelf...

  14. 48 CFR 252.227-7012 - Patent license and release contract.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Patent license and release contract. 252.227-7012 Section 252.227-7012 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text...

  15. Increased Inhibitor of Differentiation 4 (Id4 Expression in Glioblastoma: A Tissue Microarray Study

    Directory of Open Access Journals (Sweden)

    Weifin Zeng, Elisabeth J. Rushing, Daniel P. Hartmann, Norio Azumi

    2010-01-01

    Full Text Available Background: The inhibitor of differentiation/DNA binding protein family (Id1-4 is involved in cell cycle control, tumorigenesis and angiogenesis through the negative regulation of helix-loop-helix transcription factors. Of these proteins, Id4 is known to play an important role in neural stem cell differentiation, and deregulation has been implicated in glial neoplasia. However, the expression and significance of Id4 in astrocytomas has not been fully addressed. Herein we report the differential expression of Id4 in astrocytomas of various grades using tissue microarrays (TMA and immunohistochemistry (IHC. Design: The GBM TMA was constructed from 53 archival cases at Georgetown University Hospital and a TMA with normal brain controls and grades II-III astrocytoma was obtained from Cybrdi (Rockville, MD. TMA sections were stained with Id4 antibody and the slides were scored according to the percentage of staining astrocytic nuclei (<9% -, 10-50% +, >51% ++. The Fisher Exact test was used to test for statistical significance. Results: Nuclear staining for Id4 was seen in 73.58% GBMs, 25% grade III, and 12.5% grade II astrocytomas; staining was absent in normal brain tissue. There was a statistically significant difference between GBM and grades II, III astrocytoma (p <0.01. Significant Id4 expression was not detected in normal brain. Conclusions: Our study confirms the frequent upregulation of Id4 expression in GBM, which lends support to its role in tumorigenesis, possibly in the transformation of low to high-grade astrocytoma (i.e. GBM. Further studies are warranted to determine the precise role of Id4 in glial neoplasia and its potential use in targeted therapy for GBM.

  16. Commissioning of the IDS Neutron Detector and $\\beta$-decay fast-timing studies at IDS

    CERN Document Server

    Piersa, Monika

    2016-01-01

    The following report describes my scientific activities performed during the Summer Student Programme at ISOLDE. The main part of my project was focused on commissioning the neutron detector dedicated to nuclear decay studies at ISOLDE Decay Station (IDS). I have participated in all the steps needed to make it operational for the IS609 experiment. In the testing phase, we obtained expected detector response and calibrations confirmed its successful commissioning. The detector was mounted in the desired geometry at IDS and used in measurements of the beta-delayed neutron emission of $^8$He. After completing aforementioned part of my project, I became familiar with the fast-timing method. This technique was applied at IDS in the IS610 experiment performed in June 2016 to explore the structure of neutron-rich $^{130-134}$Sn nuclei. Since the main part of my PhD studies will be the analysis of data collected in this experiment, the second part of my project was dedicated to acquiring knowledge about technical de...

  17. 24 CFR 207.252c - Premiums-mortgages insured pursuant to section 238(c) of the Act.

    Science.gov (United States)

    2010-04-01

    .... All of the provisions of §§ 207.252 and 207.252a governing mortgage insurance premiums shall apply to... insurance premiums due on such mortgages in accordance with §§ 207.252 and 207.252a shall be calculated on... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Premiums-mortgages insured pursuant...

  18. Promoter methylation-associated loss of ID4 expression is a marker of tumour recurrence in human breast cancer

    International Nuclear Information System (INIS)

    Noetzel, Erik; Veeck, Jürgen; Niederacher, Dieter; Galm, Oliver; Horn, Felicitas; Hartmann, Arndt; Knüchel, Ruth; Dahl, Edgar

    2008-01-01

    Inhibitor of DNA binding/Inhibitor of differentiation 4 (ID4) is a critical factor for cell proliferation and differentiation in normal vertebrate development. ID4 has regulative functions for differentiation and growth of the developing brain. The role of ID1, ID2 and ID3 are expected to be oncogenic due to their overexpression in pancreatic cancer and colorectal adenocarcinomas, respectively. Aside from these findings, loss of ID3 expression was demonstrated in ovarian cancer. The aim of the present study was to reveal the factual role of ID4 in carcinogenesis in more detail, since its role for the pathogenesis of human breast cancer has been discussed controversially, assigning both oncogenic and tumour suppressive functions. ID4 promoter methylation, ID4 mRNA expression and ID4 protein expression were analysed in primary human breast cancer specimens using methylation-specific PCR (MSP) (n=170), semiquantitative realtime RT-PCR (n=46) and immunhistochemistry (n=3), respectively. In order to demonstrate a functional association of ID4 promoter methylation with its gene silencing, we performed DNA demethylation analysis with four human breast cell lines using MSP and semiquantitative realtime RT-PCR. In addition, we performed correlations of ID4 promoter methylation with ID4 mRNA and ID4 protein expression in matched samples of breast tumour and corresponding normal tissue. We carried out statistical analyses in order to find correlations between ID4 promoter methylation and clinicopathological parameters. Frequent ID4 promoter methylation was observed in primary breast cancer samples (69%, 117/170). We found a tight correlation (P<0.0001) between ID4 promoter methylation and loss of ID4 expression in primary breast cancer 3 specimens. Demethylating treatment with breast cancer cell lines was associated with clear ID4 mRNA re-expression. Tumours with ID4 promoter methylation showed distinct loss of ID4 expression on both transcription and protein level

  19. 38 CFR 3.252 - Annual income; pension; Mexican border period and later war periods.

    Science.gov (United States)

    2010-07-01

    ...; Mexican border period and later war periods. 3.252 Section 3.252 Pensions, Bonuses, and Veterans' Relief... Dependency, Income and Estate § 3.252 Annual income; pension; Mexican border period and later war periods. (a) Annual income limitations; old-law pension. Where the right to old-law pension is payable under section...

  20. The status of low dose rate and future of high dose rate Cf-252 brachytherapy

    International Nuclear Information System (INIS)

    Rivard, M.J.; Wierzbicki, J.G.; Van den Heuvel, F.; Chuba, P.J.; Fontanesi, J.

    1997-12-01

    This work describes the current status of the US low dose rate (LDR) Cf-252 brachytherapy program. The efforts undertaken towards development of a high dose rate (HDR) remotely after loaded Cf-252 source, which can accommodate 1 mg or greater Cf-252, are also described. This HDR effort is a collaboration between Oak Ridge National Laboratory (ORNL), commercial remote after loader manufactures, the Gershenson Radiation Oncology Center (ROC), and Wayne State University. To achieve this goal, several advances in isotope chemistry and source preparation at ORNL must be achieved to yield a specific material source loading of greater than or equal 1 mg Cf-252 per mm3. Development work with both radioactive and non-radioactive stand-ins for Cf-252 have indicated the feasibility of fabricating such sources. As a result, the decreased catheter diameter and computer controlled source placement will permit additional sites (e.g. brain, breast, prostate, lung, parotid, etc.) to be treated effectively with Cf-252 sources. Additional work at the Radiochemical Engineering and Development Center (REDC) remains in source fabrication, after loader modification, and safe design. The current LDR Cf-252 Treatment Suite at the ROC is shielded and licensed to hold up to 1 mg of Cf-252. This was designed to maintain cumulative personnel exposure, both external to the room and in direct isotope handling, at less than 20 microSv/hr. However, cumulative exposure may be greatly decreased if a Cf-252 HDR unit is employed which would eliminate direct isotope handling and decrease treatment times from tilde 3 hours to an expected range of 3 to 15 minutes. Such a Cf-252 HDR source will also demonstrate improved dose distributions over current LDR treatments due to the ability to step the point-like source throughout the target volume and weight the dwell time accordingly

  1. Cyclin D1, Id1 and EMT in breast cancer

    International Nuclear Information System (INIS)

    Tobin, Nicholas P; Sims, Andrew H; Lundgren, Katja L; Lehn, Sophie; Landberg, Göran

    2011-01-01

    Cyclin D1 is a well-characterised cell cycle regulator with established oncogenic capabilities. Despite these properties, studies report contrasting links to tumour aggressiveness. It has previously been shown that silencing cyclin D1 increases the migratory capacity of MDA-MB-231 breast cancer cells with concomitant increase in 'inhibitor of differentiation 1' (ID1) gene expression. Id1 is known to be associated with more invasive features of cancer and with the epithelial-mesenchymal transition (EMT). Here, we sought to determine if the increase in cell motility following cyclin D1 silencing was mediated by Id1 and enhanced EMT-features. To further substantiate these findings we aimed to delineate the link between CCND1, ID1 and EMT, as well as clinical properties in primary breast cancer. Protein and gene expression of ID1, CCND1 and EMT markers were determined in MDA-MB-231 and ZR75 cells by western blot and qPCR. Cell migration and promoter occupancy were monitored by transwell and ChIP assays, respectively. Gene expression was analysed from publicly available datasets. The increase in cell migration following cyclin D1 silencing in MDA-MB-231 cells was abolished by Id1 siRNA treatment and we observed cyclin D1 occupancy of the Id1 promoter region. Moreover, ID1 and SNAI2 gene expression was increased following cyclin D1 knock-down, an effect reversed with Id1 siRNA treatment. Similar migratory and SNAI2 increases were noted for the ER-positive ZR75-1 cell line, but in an Id1-independent manner. In a meta-analysis of 1107 breast cancer samples, CCND1 low /ID1 high tumours displayed increased expression of EMT markers and were associated with reduced recurrence free survival. Finally, a greater percentage of CCND1 low /ID1 high tumours were found in the EMT-like 'claudin-low' subtype of breast cancer than in other subtypes. These results indicate that increased migration of MDA-MB-231 cells following cyclin D1 silencing can be mediated by Id

  2. RPD: Reusable Pseudo-Id Distribution for a Secure and Privacy Preserving VANET

    Directory of Open Access Journals (Sweden)

    Sulaiman Ashraph

    2013-08-01

    Full Text Available In any VANET, security and privacy are the two fundamental issues. Obtaining efficient security in vehicular communication is essential without compromising privacy-preserving mechanisms. Designing a suitable protocol for VANET by having these two issues in mind is challenging because efficiency, unlinkablity and traceability are the three qualities having contradictions between them. In this paper, we introduce an efficient Reusable Pseudo-id Distribution (RPD scheme. The Trusted Authority (TA designating the Road Side Units (RSUs to generate n reusable pseudo ids and distribute them to the On Board Units (OBUs on request characterizes the proposed protocol. RSUs issue the aggregated hashes of all its valid pseudo-ids along with a symmetric shared key and a particular pseudo-id to each vehicle that enters into its coverage range. Through this the certificates attached to the messages can be eliminated and thus resulting in a significantly reduced packet size. The same anonymous keys can then be re-distributed by the RSUs episodically to other vehicles. We analyze the proposed protocol extensively to demonstrate its merits and efficiency.

  3. 48 CFR 252.244-7000 - Subcontracts for Commercial Items and Commercial Components (DoD Contracts).

    Science.gov (United States)

    2010-10-01

    ... under this contract: (a) 252.225-7009 Restriction on Acquisition of Certain Articles Containing... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Subcontracts for Commercial Items and Commercial Components (DoD Contracts). 252.244-7000 Section 252.244-7000 Federal...

  4. Neutron Spectra, Fluence and Dose Rates from Bare and Moderated Cf-252 Sources

    Energy Technology Data Exchange (ETDEWEB)

    Radev, Radoslav P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-04-01

    A new, stronger 252Cf source (serial number SR-CF-3050-OR) was obtained from Oak Ridge National Laboratory (ORNL) in 2014 to supplement the existing 252Cf sources which had significantly decayed. A new instrument positioning track system was designed and installed by Hopewell Designs, Inc. in 2011. The neutron field from the new, stronger 252Cf source in the modified calibration environment needed to be characterized as well as the modified neutron fields produced by the new source and seven different neutron moderators. Comprehensive information about our 252Cf source, its origin, production, and isotopic content and decay characteristics needed to be compiled as well. This technical report is intended to address these issues.

  5. Demonstrating idAnimate : a multi-touch system for sketching and rapidly manipulating animations

    NARCIS (Netherlands)

    Quevedo Fernandez, Javier; Martens, J.B.O.S.

    2012-01-01

    This demonstration presents idAnimate, a multi-touch application for sketching animations. Thanks to the affordances provided by multitouch interfaces, idAnimate yields a novel, intuitive and easy to use animation technique named transformation-by-example, that allows users to author animations in

  6. Expression of Id2 in the Second Heart Field and Cardiac Defects in Id2 Knock-Out Mice

    NARCIS (Netherlands)

    Jongbloed, M. R. M.; Vicente-Steijn, R.; Douglas, Y. L.; Wisse, L. J.; Mori, K.; Yokota, Y.; Bartelings, M. M.; Schalij, M. J.; Mahtab, E. A.; Poelmann, R. E.; Gittenberger-De Groot, A. C.

    2011-01-01

    The inhibitor of differentiation Id2 is expressed in mesoderm of the second heart field, which contributes myocardial and mesenchymal cells to the primary heart tube. The role of Id2 in cardiac development is insufficiently known. Heart development was studied in sequential developmental stages in

  7. ID3 contributes to cerebrospinal fluid seeding and poor prognosis in medulloblastoma

    International Nuclear Information System (INIS)

    Phi, Ji Hoon; Choi, Seung Ah; Lim, Sang-Hee; Lee, Joongyub; Wang, Kyu-Chang; Park, Sung-Hye; Kim, Seung-Ki

    2013-01-01

    The inhibitor of differentiation (ID) genes have been implicated as promoters of tumor progression and metastasis in many human cancers. The current study investigated the expression and functional roles of ID genes in seeding and prognosis of medulloblastoma. ID gene expression was screened in human medulloblastoma tissues. Knockdown of ID3 gene was performed in medulloblastoma cells in vitro. The expression of metastasis-related genes after ID3 knockdown was assessed. The effect of ID3 knockdown on tumor seeding was observed in an animal model in vivo. The survival of medulloblastoma patients was plotted according to the ID3 expression levels. Significantly higher ID3 expression was observed in medulloblastoma with cerebrospinal fluid seeding than tumors without seeding. Knockdown of ID3 decreased proliferation, increased apoptosis, and suppressed the migration of D283 medulloblastoma cells in vitro. In a seeding model of medulloblastoma, ID3 knockdown in vivo with shRNA inhibited the growth of primary tumors, prevented the development of leptomeningeal seeding, and prolonged animal survival. High ID3 expression was associated with shorter survival of medulloblastoma patients, especially in Group 4 medulloblastomas. High ID3 expression is associated with medullolbastoma seeding and is a poor prognostic factor, especially in patients with Group 4 tumors. ID3 may represent the metastatic/ aggressive phenotype of a subgroup of medulloblastoma

  8. Monte Carlo simulation using MCNP4B for an optimal shielding design of a 252 Cf source

    International Nuclear Information System (INIS)

    Silva, Ademir X. da; Crispim, Verginia R.

    2001-01-01

    This study aim to investigate an optimum shielding design against neutrons and gamma-rays from a source of 252 Cf, using Monte Carlo simulation. The shielding materials studied were: borated polyethylene, borated-lead polyethylene and stainless steel. The Monte Carlo code MCNP, version 4B, was used to design shielding for 252 Cf based neutron irradiator systems. By normalizing the dose equivalent rate values presented to the neutron production rate of the source, the resulting calculations are independents of the intensity of actual 252 Cf source. The results shown what the total dose equivalent rates were reduced significantly by the shielding system optimization. (author)

  9. Radiation ulcers in patients with cancer of the torgue after 252Cf therapy

    International Nuclear Information System (INIS)

    Galantseva, G.F.; Guseva, L.I.; Plichko, V.I.

    1984-01-01

    Interstitial therapy with 252 Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with 252 Cf doesn't differ sufficiently from the course of radiation injuries, occurring after γ-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with 252 Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongUe ulcers after interstitial therapy with 252 Cf

  10. Id2 reinforces TH1 differentiation and inhibits E2A to repress TFH differentiation.

    Science.gov (United States)

    Shaw, Laura A; Bélanger, Simon; Omilusik, Kyla D; Cho, Sunglim; Scott-Browne, James P; Nance, J Philip; Goulding, John; Lasorella, Anna; Lu, Li-Fan; Crotty, Shane; Goldrath, Ananda W

    2016-07-01

    The differentiation of helper T cells into effector subsets is critical to host protection. Transcription factors of the E-protein and Id families are important arbiters of T cell development, but their role in the differentiation of the TH1 and TFH subsets of helper T cells is not well understood. Here, TH1 cells showed more robust Id2 expression than that of TFH cells, and depletion of Id2 via RNA-mediated interference increased the frequency of TFH cells. Furthermore, TH1 differentiation was blocked by Id2 deficiency, which led to E-protein-dependent accumulation of effector cells with mixed characteristics during viral infection and severely impaired the generation of TH1 cells following infection with Toxoplasma gondii. The TFH cell-defining transcriptional repressor Bcl6 bound the Id2 locus, which provides a mechanism for the bimodal Id2 expression and reciprocal development of TH1 cells and TFH cells.

  11. 48 CFR 252.245-7000 - Government-furnished mapping, charting, and geodesy property.

    Science.gov (United States)

    2010-10-01

    ... mapping, charting, and geodesy property. 252.245-7000 Section 252.245-7000 Federal Acquisition Regulations..., charting, and geodesy property. As prescribed in 245.107-70, use the following clause: Government-Furnished Mapping, Charting, and Geodesy Property (DEC 1991) (a) Definition—Mapping, charting, and geodesy (MC&G...

  12. 48 CFR 53.236-2 - Architect-engineer services (SF's 252 and 330).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Architect-engineer... ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS Prescription of Forms 53.236-2 Architect-engineer...-engineer and related services: (a) SF 252 (Rev. 10/83), Architect-Engineer Contract. SF 252 is prescribed...

  13. Epigenetic inactivation of inhibitor of differentiation 4 (Id4) correlates with prostate cancer

    International Nuclear Information System (INIS)

    Sharma, Pankaj; Chinaranagari, Swathi; Patel, Divya; Carey, Jason; Chaudhary, Jaideep

    2012-01-01

    The inhibitor of DNA-binding (Id) proteins, Id1–4 are negative regulators of basic helix-loop-helix (bHLH) transcription factors. As key regulators of cell cycle and differentiation, expression of Id proteins are increasingly observed in many cancers and associated with aggressiveness of the disease. Of all the four Id proteins, the expression of Id1, Id2, and to a lesser extent, Id3 in prostate cancer and the underlying molecular mechanism is relatively well known. On the contrary, our previous results demonstrated that Id4 acts as a potential tumor suppressor in prostate cancer. In the present study, we extend these observations and demonstrate that Id4 is down-regulated in prostate cancer due to promoter hypermethylation. We used prostate cancer tissue microarrays to investigate Id4 expression. Methylation specific PCR on bisulfite treated DNA was used to determine methylation status of Id4 promoter in laser capture micro-dissected normal, stroma and prostate cancer regions. High Id4 expression was observed in the normal prostate epithelial cells. In prostate cancer, a stage-dependent decrease in Id4 expression was observed with majority of high grade cancers showing no Id4 expression. Furthermore, Id4 expression progressively decreased in prostate cancer cell line LNCaP and with no expression in androgen-insensitive LNCaP-C81 cell line. Conversely, Id4 promoter hypermethylation increased in LNCaP-C81 cells suggesting epigenetic silencing. In prostate cancer samples, loss of Id4 expression was also associated with promoter hypermethylation. Our results demonstrate loss of Id4 expression in prostate cancer due to promoter hypermethylation. The data strongly support the role of Id4 as a tumor suppressor

  14. Achieving Payoffs from an Industry Cloud Ecosystem at BankID

    DEFF Research Database (Denmark)

    Eaton, Ben; Hallingby, Hanne Kristine; Nesse, Per-Jonny

    2014-01-01

    BankID is an industry cloud owned by Norwegian banks. It provides electronic identity, authentication and electronic signing capabilities for banking, merchant and government services. More than 60% of the population uses BankID services. As the broader ecosystem around BankID evolved, challenges......—arising from tensions between different parts of the ecosystem—had to be resolved. The four lessons learned from the BankID case will help others to build an industry cloud and establish a healthy ecosystem to service a broad user base....

  15. A 252Cf based nondestructive assay system for fissile material

    International Nuclear Information System (INIS)

    Menlove, H.O.; Crane, T.W.

    1978-01-01

    A modulated 252 Cf source assay system 'Shuffler' based on fast-or-thermal-neutron interrogation combined with delayed-neutron counting has been developed for the assay of fissile material. The 252 Cf neutron source is repetitively transferred from the interrogation position to a shielded position while the delayed neutrons are counted in a high efficiency 3 He neutron well-counter. For samples containing plutonium, this well-counter is also used in the passive coincidence mode to assay the effective 240 Pu content. The design of an optimized neutron tailoring assembly for fast-neutron interrogation using a Monte Carlo Neutron Computer Code is described. The Shuffler system has been applied to the assay of fuel pellets, inventory samples, irradiated fuel and plutonium mixed-oxide fuel. The system can assay samples with fissile contents from a few milligrams up to several kilograms using thermal-neutron interrogation for the low mass samples and fast-neutron interrogation for the high mass samples. Samples containing 235 U- 238 U, or 233 U-Th, or UO 2 -PuO 2 fuel mixtures have been assayed with the Shuffler system. (Auth.)

  16. A non-parametric peak calling algorithm for DamID-Seq.

    Directory of Open Access Journals (Sweden)

    Renhua Li

    Full Text Available Protein-DNA interactions play a significant role in gene regulation and expression. In order to identify transcription factor binding sites (TFBS of double sex (DSX-an important transcription factor in sex determination, we applied the DNA adenine methylation identification (DamID technology to the fat body tissue of Drosophila, followed by deep sequencing (DamID-Seq. One feature of DamID-Seq data is that induced adenine methylation signals are not assured to be symmetrically distributed at TFBS, which renders the existing peak calling algorithms for ChIP-Seq, including SPP and MACS, inappropriate for DamID-Seq data. This challenged us to develop a new algorithm for peak calling. A challenge in peaking calling based on sequence data is estimating the averaged behavior of background signals. We applied a bootstrap resampling method to short sequence reads in the control (Dam only. After data quality check and mapping reads to a reference genome, the peaking calling procedure compromises the following steps: 1 reads resampling; 2 reads scaling (normalization and computing signal-to-noise fold changes; 3 filtering; 4 Calling peaks based on a statistically significant threshold. This is a non-parametric method for peak calling (NPPC. We also used irreproducible discovery rate (IDR analysis, as well as ChIP-Seq data to compare the peaks called by the NPPC. We identified approximately 6,000 peaks for DSX, which point to 1,225 genes related to the fat body tissue difference between female and male Drosophila. Statistical evidence from IDR analysis indicated that these peaks are reproducible across biological replicates. In addition, these peaks are comparable to those identified by use of ChIP-Seq on S2 cells, in terms of peak number, location, and peaks width.

  17. A non-parametric peak calling algorithm for DamID-Seq.

    Science.gov (United States)

    Li, Renhua; Hempel, Leonie U; Jiang, Tingbo

    2015-01-01

    Protein-DNA interactions play a significant role in gene regulation and expression. In order to identify transcription factor binding sites (TFBS) of double sex (DSX)-an important transcription factor in sex determination, we applied the DNA adenine methylation identification (DamID) technology to the fat body tissue of Drosophila, followed by deep sequencing (DamID-Seq). One feature of DamID-Seq data is that induced adenine methylation signals are not assured to be symmetrically distributed at TFBS, which renders the existing peak calling algorithms for ChIP-Seq, including SPP and MACS, inappropriate for DamID-Seq data. This challenged us to develop a new algorithm for peak calling. A challenge in peaking calling based on sequence data is estimating the averaged behavior of background signals. We applied a bootstrap resampling method to short sequence reads in the control (Dam only). After data quality check and mapping reads to a reference genome, the peaking calling procedure compromises the following steps: 1) reads resampling; 2) reads scaling (normalization) and computing signal-to-noise fold changes; 3) filtering; 4) Calling peaks based on a statistically significant threshold. This is a non-parametric method for peak calling (NPPC). We also used irreproducible discovery rate (IDR) analysis, as well as ChIP-Seq data to compare the peaks called by the NPPC. We identified approximately 6,000 peaks for DSX, which point to 1,225 genes related to the fat body tissue difference between female and male Drosophila. Statistical evidence from IDR analysis indicated that these peaks are reproducible across biological replicates. In addition, these peaks are comparable to those identified by use of ChIP-Seq on S2 cells, in terms of peak number, location, and peaks width.

  18. Clinicopathological study of 252 jaw bone periapical lesions from a private pathology laboratory.

    Science.gov (United States)

    Lin, Hung-Pin; Chen, Hsin-Ming; Yu, Chuan-Hang; Kuo, Ru-Cheng; Kuo, Ying-Shiung; Wang, Yi-Ping

    2010-11-01

    Periapical lesions are common sequelae of pulp diseases. This retrospective study evaluated the clinical and histopathological features of periapical lesions sent to a private pathology laboratory by dentists in private clinics. Two hundred and fifty-two consecutive cases of periapical lesions were collected from September 2005 to October 2009. Clinical data and histopathological features of these periapical lesions were reviewed and analyzed. The 252 periapical lesions consisted of 128 periapical granulomas, 117 periapical cysts, and seven periapical scars. These 252 lesions were taken from 252 patients (92 men and 160 women; mean age = 43.6 years; range, 9-81 years). Of the 252 periapical lesions, 186 were found in the maxilla and 66 in the mandible. The most common site for periapical lesions was the maxillary anterior region (134 cases, including 73 granulomas, 54 cysts and 7 scars), and the most frequently involved tooth was the maxillary lateral incisor (64 cases, including 29 granulomas, 31 cysts and 4 scars). Of the 117 periapical cysts, 116 were lined by stratified squamous epithelium and one by mucoepidermoid epithelium. Hyaline bodies were discovered in the lining epithelium of four periapical cysts. Odontogenic epithelial rest, cholesterol cleft, foamy histiocytes, hemosiderin-laden macrophages, dystrophic calcification, foreign bodies, and bacterial clumps were found in five, three, nine, two, 28, 10 and one periapical granulomas, respectively, as well as in six, 11, eight, seven, 19, nine and eight periapical cysts, respectively. Granulomas and cysts were the two most common periapical lesions. Periapical lesions occurred more frequently in female patients and in those in their fourth to fifth decades. The most commonly affected site for periapical lesions was the maxillary anterior region, and the most frequently involved tooth was the maxillary lateral incisor. Copyright © 2010 Formosan Medical Association & Elsevier. Published by Elsevier B.V. All

  19. 50 CFR 14.252 - What definitions do I need to know?

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false What definitions do I need to know? 14.252... PLANTS IMPORTATION, EXPORTATION, AND TRANSPORTATION OF WILDLIFE Captive Wildlife Safety Act § 14.252 What... which any individual other than an authorized keeper or caregiver may potentially touch or otherwise...

  20. Undergraduate experiments using the neutron radiation from californium-252

    International Nuclear Information System (INIS)

    Rossel, J.; Golecki, I.

    1976-01-01

    Three experiments designed to demonstrate and measure several properties of the neutron radiation emitted by a 3μg 252 Cf source are described. The experiments constitute a special project carried out by a third-year undergraduate student at the Institute of Physics of the University of Neuchatel. The 252 Cf source is enclosed in a shield which allows a pencil of fast neutrons to pass through a central tube, while reducing the ambient radiation below the tolerance level. The shield consists of layers of borated paraffin wax, iron and cadmium. The first experiment uses an air-alcohol diffusion cloud chamber for the demonstration of tracks of recoil protons produced by the neutrons. Semi-quantitative measurements of track lengths give the correct order of magnitude of the proton energies. In the second experiment a liquid scintillator detector is used to scan the beam profile across the radiation shield enclosing the source. A pulse-shape-discrimination system discriminates between neutrons and gamma photons. The third experiment makes use of the nuclear emulsion technique to study the neutron energy distribution of 252 Cf. Preliminary results are compared with published values. (author)

  1. Determination of the average number of neutrons per fission event for californium-252

    International Nuclear Information System (INIS)

    Aleksandrov, B.M.; Belov, L.M.; Drapchinskij, L.V.

    1982-01-01

    By means of a separate determination of neutron yields and fission event rates, the value of #betta#-bar( 252 Cf) has been measured for a series of new high-purity sources. The improved quality of the source active layers has reduced the error in determining the fission rate to 0.35%. The value obtained for #betta#-bar( 252 Cf) is 3.747+-0.036. A description is given of the design and the parameters of a spherical manganese bath in which the work on refining the value of #betta#-bar( 252 Cf) will be continued. (author)

  2. Id1 represses osteoclast-dependent transcription and affects bone formation and hematopoiesis.

    Directory of Open Access Journals (Sweden)

    April S Chan

    2009-11-01

    Full Text Available The bone-bone marrow interface is an area of the bone marrow microenvironment in which both bone remodeling cells, osteoblasts and osteoclasts, and hematopoietic cells are anatomically juxtaposed. The close proximity of these cells naturally suggests that they interact with one another, but these interactions are just beginning to be characterized.An Id1(-/- mouse model was used to assess the role of Id1 in the bone marrow microenvironment. Micro-computed tomography and fracture tests showed that Id1(-/- mice have reduced bone mass and increased bone fragility, consistent with an osteoporotic phenotype. Osteoclastogenesis and pit formation assays revealed that loss of Id1 increased osteoclast differentiation and resorption activity, both in vivo and in vitro, suggesting a cell autonomous role for Id1 as a negative regulator of osteoclast differentiation. Examination by flow cytometry of the hematopoietic compartment of Id1(-/- mice showed an increase in myeloid differentiation. Additionally, we found increased expression of osteoclast genes, TRAP, Oscar, and CTSK in the Id1(-/- bone marrow microenvironment. Lastly, transplantation of wild-type bone marrow into Id1(-/- mice repressed TRAP, Oscar, and CTSK expression and activity and rescued the hematopoietic and bone phenotype in these mice.In conclusion, we demonstrate an osteoporotic phenotype in Id1(-/- mice and a mechanism for Id1 transcriptional control of osteoclast-associated genes. Our results identify Id1 as a principal player responsible for the dynamic cross-talk between bone and bone marrow hematopoietic cells.

  3. FlowIDS

    OpenAIRE

    Sabolčák, Peter

    2006-01-01

    FlowIDS is system which can detect some of the undesirable traffi c in computer networks (undesirable traffic could be also ie. virus activity or overloading of network) and mostly doing counteraction which are set by administrator. Information about data ows are provided by hardware of network infrastructure, eliminitaion of undesirable activity is done through changes in network hardware settings. Regarding the quantity of solution which are provided on market, I decided to focus on Cisco n...

  4. RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.

    Science.gov (United States)

    Brule, C E; Dean, K M; Grayhack, E J

    2016-01-01

    The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

  5. Design of a setup for {sup 252}Cf neutron source for storage and analysis purpose

    Energy Technology Data Exchange (ETDEWEB)

    Hei, Daqian [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Zhuang, Haocheng [Xi’an Middle School of Shanxi Province, Xi’an 710000 (China); Jia, Wenbao, E-mail: jiawenbao@163.com [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China); Cheng, Can; Jiang, Zhou; Wang, Hongtao [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Chen, Da [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China)

    2016-11-01

    {sup 252}Cf is a reliable isotopic neutron source and widely used in the prompt gamma ray neutron activation analysis (PGNAA) technique. A cylindrical barrel made by polymethyl methacrylate contained with the boric acid solution was designed for storage and application of a 5 μg {sup 252}Cf neutron source. The size of the setup was optimized with Monte Carlo code. The experiments were performed and the results showed the doses were reduced with the setup and less than the allowable limit. The intensity and collimating radius of the neutron beam could also be adjusted through different collimator.

  6. Aliénation et idéologie

    OpenAIRE

    Kanabus, Benoît; Popa, Délia

    2017-01-01

    Dès lors, on entend mieux la question sur laquelle se referment les mille pages du Marx : « La pensée de Marx nous place devant la question abyssale : qu’est-ce que la vie » ? Cette question peut être reposée à nouveaux frais à l’âge du capitalisme avancé, où, comme le notait Adorno, la vie est devenue « l’idéologie de sa propre absence ». La recherche d’un autre rapport à l’idéologie vient alors prendre le relais de la lutte anti-idéologique de la théorie critique. Cette recherche part du po...

  7. Radiation ulcers in patients with cancer of the tongue after /sup 252/Cf therapy

    Energy Technology Data Exchange (ETDEWEB)

    Galantseva, G.F.; Guseva, L.I.; Plichko, V.I. (Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii)

    1984-01-01

    Interstitial therapy with /sup 252/Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with /sup 252/Cf doesn't differ sufficiently from the course of radiation injuries, occurring after ..gamma..-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with /sup 252/Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongue ulcers after interstitial therapy with /sup 252/Cf.

  8. ID-pilet teeb Tallinnas võidukäiku / Anneli Lepp

    Index Scriptorium Estoniae

    Lepp, Anneli

    2006-01-01

    Vt. ka Postimees : na russkom jazõke 12. jaan. lk 3. Tallinna transpordiameti peaökonomisti Mart Moosuse sõnul moodustas ID-pilet 60,7% ühistranspordi piletituludest, Tartus oli vastav näitaja aga alla 1%. Tartut teenindava bussifirma AS Connex Eesti finantsjuht Tiina Telling peab suure erinevuse põhjuseks asjaolu, et Tallinnas on ID-pilet paberpiletist 40-88% soodsam, Tartus hinnavahe aga puudub või on lausa negatiivne ID-pileti kahjuks. Lisa: ID-pilet

  9. PERSONAL BRANDING PRABOWO SUBIANTO (ANALISIS ISI KUANTITATIF PERSONAL BRANDING PRABOWO SUBIANTO DI SITUS BERITA ONLINE REPUBLIKA.CO.ID DAN TEMPO.CO.ID TANGGAL 9 JUNI - 9 JULI 2014

    Directory of Open Access Journals (Sweden)

    Hendro Agus Prakoso

    2016-09-01

    berita kedua media tersebut. Frekuensi berita berjumlah 107 di Republika.co.id dan 51 berita di Tempo.co.id Ragam berita Republika.co.id didominasi konsep Spesialisasi sebesar 22,4% dari 107 berita, sedangkan pada Tempo.co.id didominasi konsep Nama baik sebesar 23,5% dari 51 berita. Sumber berita pada Republika.co.id mayoritas berasal dari Liputan langsung sebesar 42,9% dari 107 berita sedangkan pada Tempo.co.id mayoritas berasal dari Intelektual sebesar 54,9% dari 51 berita.

  10. Id2 reinforces TH1 cell differentiation and inhibits E2A to repress TFH cell differentiation

    Science.gov (United States)

    Shaw, Laura A.; Bélanger, Simon; Omilusik, Kyla D.; Cho, Sunglim; Scott-Browne, James P.; Nance, J. Philip; Goulding, John; Lasorella, Anna; Lu, Li-Fan; Crotty, Shane; Goldrath, Ananda W.

    2016-01-01

    Differentiation of T helper (TH) effector subsets is critical for host protection. E protein transcription factors and Id proteins are important arbiters of T cell development, but their role in differentiation of TH1 and TFH cells is not well understood. TH1 cells showed robust Id2 expression compared to TFH cells, and RNAi depletion of Id2 increased TFH cell frequencies. Further, TH1 cell differentiation was blocked by Id2 deficiency, leading to E protein-dependent accumulation of effector cells with mixed characteristics during viral infection and severely impaired generation of TH1 cells following Toxoplasma gondii infection. The TFH-defining transcriptional repressor Bcl6 bound the Id2 locus, providing a mechanism for the bimodal Id2 expression and reciprocal development of TH1 and TFH cell fates. PMID:27213691

  11. 48 CFR 252.237-7017 - Individual laundry.

    Science.gov (United States)

    2010-10-01

    ... clause: Individual Laundry (DEC 1991) (a) The Contractor shall provide laundry service under this... services. (c) Charges for individual laundry will be on a per unit bundle or a piece-rate basis. The... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Individual laundry. 252...

  12. People with ID as interviewers and co-researchers: experiences and reflection.

    NARCIS (Netherlands)

    Lieshout, H. van

    2012-01-01

    Aim: To share the experience of working with people with intellectual disabilities (ID) as interviewers in a qualitative study about community participation of people with ID. We reflect on two perspectives: the interviewers and the researchers. Method: Eighteen people with ID were interviewed by

  13. Relationship between major depressive disorder and ACE gene I/D polymorphism in a Turkish population

    Directory of Open Access Journals (Sweden)

    Sema Inanir

    2016-04-01

    Full Text Available Abstract Background Major depressive disorder (MDD is a complex disease and a significant health problem that is prevalent across the world. Angiotensin-converting enzyme (ACE has an important role in renin-angiotensin system (RAS and converts inactive angiotensin I to a potent vasopressor and aldosterone-stimulating peptide angiotensin II. Levels of ACE in plasma vary according to the insertion/deletion (I/D polymorphism of ACE gene. Objective The aim of the current study was to examine the influence ACE gene I/D variations on the risk of MDD. Methods In the present case-control study, we analyzed ACE I/D polymorphism in 346 MDD patients and 210 healthy subjects using polymerase chain reaction technique. Results Comparing the two groups, no significant difference was observed with regard to either genotype distributions or allele frequencies of the I/D polymorphism of ACE gene. Discussion Our findings suggest that the ACE I/D polymorphism is not associated with MDD in Turkish case-control study. Further studies are still needed.

  14. An online ID identification system for liquefied-gas cylinder plant

    Science.gov (United States)

    He, Jin; Ding, Zhenwen; Han, Lei; Zhang, Hao

    2017-11-01

    An automatic ID identification system for gas cylinders' online production was developed based on the production conditions and requirements of the Technical Committee for Standardization of Gas Cylinders. A cylinder ID image acquisition system was designed to improve the image contrast of ID regions on gas cylinders against the background. Then the ID digits region was located by the CNN template matching algorithm. Following that, an adaptive threshold method based on the analysis of local average grey value and standard deviation was proposed to overcome defects of non-uniform background in the segmentation results. To improve the single digit identification accuracy, two BP neural networks were trained respectively for the identification of all digits and the easily confusable digits. If the single digit was classified as one of confusable digits by the former BP neural network, it was further tested by the later one, and the later result was taken as the final identification result of this single digit. At last, the majority voting was adopted to decide the final identification result for the 6-digit cylinder ID. The developed system was installed on a production line of a liquefied-petroleum-gas cylinder plant and worked in parallel with the existing weighing step on the line. Through the field test, the correct identification rate for single ID digit was 94.73%, and none of the tested 2000 cylinder ID was misclassified through the majority voting.

  15. 48 CFR 252.225-7016 - Restriction on acquisition of ball and roller bearings.

    Science.gov (United States)

    2010-10-01

    ... of ball and roller bearings. 252.225-7016 Section 252.225-7016 Federal Acquisition Regulations System... and roller bearings. As prescribed in 225.7009-5, use the following clause: Restriction on Acquisition of Ball and Roller Bearings (MAR 2006) (a) Definitions. As used in this clause' (1) Bearing...

  16. 48 CFR 252.227-7026 - Deferred delivery of technical data or computer software.

    Science.gov (United States)

    2010-10-01

    ... technical data or computer software. 252.227-7026 Section 252.227-7026 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(a), use the following clause: Deferred Delivery of Technical Data or Computer Software (APR 1988) The Government shall have the right to require, at...

  17. Long-term effects of an intracavitary treatment with californium-252 on normal tissue

    International Nuclear Information System (INIS)

    Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

    1976-01-01

    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with 252 Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from 252 Cf and 7000 rad from 226 Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for 252 Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from 252 Cf and 5000 rad from 226 Ra

  18. Radionuclide 252Cf neutron source

    International Nuclear Information System (INIS)

    Kolevatov, Yu.I.; Trykov, L.A.

    1979-01-01

    Characteristics of radionuclide neutron sourses of 252 Cf base with the activity from 10 6 to 10 9 n/s have been investigated. Energetic distributions of neutrons and gamma-radiation have been presented. The results obtained have been compared with other data available. The hardness parameter of the neutron spectrum for the energy range from 3 to 15 MeV is 1.4 +- 0.02 MeV

  19. A functionally significant polymorphism in ID3 is associated with human coronary pathology.

    Directory of Open Access Journals (Sweden)

    Ani Manichaikul

    Full Text Available We previously identified association between the ID3 SNP rs11574 and carotid intima-media thickness in the Diabetes Heart Study, a predominantly White diabetic population. The nonsynonymous SNP rs11574 results in an amino acid substitution in the C-terminal region of ID3, attenuating the dominant negative function of ID3 as an inhibitor of basic HLH factor E12-mediated transcription. In the current investigation, we characterize the association between the functionally significant polymorphism in ID3, rs11574, with human coronary pathology.The Multi-Ethnic Study of Atherosclerosis (MESA is a longitudinal study of subclinical cardiovascular disease, including non-Hispanic White (n = 2,588, African American (n = 2,560 and Hispanic (n = 2,130 participants with data on coronary artery calcium (CAC. The Coronary Assessment in Virginia cohort (CAVA included 71 patients aged 30-80 years, undergoing a medically necessary cardiac catheterization and intravascular ultrasound (IVUS at the University of Virginia. ID3 SNP rs11574 risk allele was associated with the presence of CAC in MESA Whites (P = 0.017. In addition, the risk allele was associated with greater atheroma burden and stenosis in the CAVA cohort (P = 0.003, P = 0.04 respectively. The risk allele remained predictive of atheroma burden in multivariate analysis (Model 1: covariates age, gender, and LDL, regression coefficient = 9.578, SE = 3.657, p = 0.0110; Model 2: covariates Model 1, presence of hypertension, presence of diabetes, regression coefficient = 8.389, SE = 4.788, p = 0.0163.We present additional cohorts that demonstrate association of ID3 SNP rs11574 directly with human coronary artery pathology as measured by CAC and IVUS: one a multiethnic, relatively healthy population with low levels of diabetes and the second a predominantly White population with a higher incidence of T2DM referred for cardiac catheterization.

  20. Comparison of Perinatal Risk Factors Associated with Autism Spectrum Disorder (ASD), Intellectual Disability (ID), and Co-Occurring ASD and ID

    Science.gov (United States)

    Schieve, Laura A.; Clayton, Heather B.; Durkin, Maureen S.; Wingate, Martha S.; Drews-Botsch, Carolyn

    2015-01-01

    While studies report associations between perinatal outcomes and both autism spectrum disorder (ASD) and intellectual disability (ID), there has been little study of ASD with versus without co-occurring ID. We compared perinatal risk factors among 7547 children in the 2006-2010 Autism and Developmental Disability Monitoring Network classified as…

  1. 48 CFR 252.225-7045 - Balance of Payments Program-Construction Material Under Trade Agreements.

    Science.gov (United States)

    2010-10-01

    .... Designated country means— (1) A World Trade Organization Government Procurement Agreement (WTO GPA) country... another country, has been substantially transformed in a Free Trade Agreement country into a new and... Program-Construction Material Under Trade Agreements. 252.225-7045 Section 252.225-7045 Federal...

  2. Approaches for the generation of a covariance matrix for the Cf-252 fission-neutron spectrum

    International Nuclear Information System (INIS)

    Mannhart, W.

    1983-01-01

    After a brief retrospective glance is cast at the situation, the evaluation of the Cf-252 neutron spectrum with a complete covariance matrix based on the results of integral experiments is proposed. The different steps already taken in such an evaluation and work in progress are reviewed. It is shown that special attention should be given to the normalization of the neutron spectrum which must be reflected in the covariance matrix. The result of the least-squares adjustment procedure applied can easily be combined with the results of direct spectrum measurements and should be regarded as the first step in a new evaluation of the Cf-252 fission-neutron spectrum. (author)

  3. Californium Cf-252 for pelvic radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Maruyama, Y; Feola, J M; Tai, D; Wilson, L C; Van Nagell, J R; Yoneda, J

    1978-01-01

    Clinical data about therapy concerning tumors of the female gynecological cancers of the cervix, vagina and uterus are reviewed. Dosimetric, laboratory and radiobiological research data form the basis for an approach to such tumors using Cf-252 as a form of boost brachytherapy. Extreme personnel hazards are a real and important consideration and indicate that maximal containment and isolation procedures should be exercised in its use.

  4. Californium-252: isotope for modern radiotherapy of cervix, uterine and vaginal carcinomas

    International Nuclear Information System (INIS)

    Maruyama, J.; Beach, J.L.; Nagell, J.R. van

    1984-01-01

    Cf-252 is an isotope that can easily be afterloaded into available gynecological applicators and used for bulky cervix, uterus or vaginal cancer therapy. It is economical, time and cost effective in use, and can be applied to the therapy of many patients throughout the world. It is more effective for neutron therapy than machine fast neutron therapy and is the only form of neutron therapy producing consistent complication-free 5-year cure of advanced cancers currently available. Cf-252 is an isotope for modern gynecological tumor therapy for the future. Isodose curves for Cf-252 implants revealed dose distributions conforming well to tumor. (orig.) [de

  5. Supporting co-creation with software, the idSpace platform

    NARCIS (Netherlands)

    Van Rosmalen, Peter; Boon, Jo; Bitter-Rijpkema, Marlies; Sie, Rory; Sloep, Peter

    2014-01-01

    Innovation, in general, requires teamwork among specialist of different disciplines. The idSpace project developed ideas on how teams of collaborating innovators could best be supported. These ideas were embodied in a platform that the project developed. This idSpace platform allows its users to

  6. 46 CFR 252.40 - Payment of subsidy.

    Science.gov (United States)

    2010-10-01

    ... Payment and Billing Procedures § 252.40 Payment of subsidy. (a) Submission of voucher. At the close of each calendar month, the subsidized operator may submit a voucher, and include for payment in such... submit an initial voucher and include for payment in such voucher a percentage of the ODS payable for the...

  7. Picture This: How to Establish an Effective School ID Card Program

    Science.gov (United States)

    Finkelstein, David

    2013-01-01

    Most school districts do not have an ID card policy that everyone knows and follows, yet. many school districts are implementing ID card programs to address concerns about safety, efficiency, and convenience. A well-thought-out ID card program leads to greater security and smoother operations throughout the school and should thus be a priority.…

  8. DWH MC 252: Subsurface Oil Transport

    Science.gov (United States)

    Beegle-Krause, C. J.; Boyer, T.; Murray, D.

    2010-12-01

    Before reaching the ocean surface, the oil and gas released from the DWH MC 252 blowout at 1500 m moves as a buoyant plume until the trapping depth and plume transition point are reached (Zheng et al 2002). At the transition point, the oil droplets and bubbles move independently of each other, and rise at a rate related to their diameter. The oil density, droplet size distribution and currents primarily determine the distribution of the oil between: Large droplets that rise quickly and create a surface expression of the oil. Moderate size droplets that rise over the course of days, and so spread out quite differently than the surface oil, and commonly do not reach the surface in large enough quantities to create a surface sheen. These droplets separate in the currents, particularly in the strong current shear in upper 500 m currents. Very tiny droplets that rise very slowly, over the course or weeks to months, and may be removed by dissolution, biodegradation or marine snow before ever reaching the surface. Modeling and observations (Joint Analysis Group, 2010) confirm the presence of a deep layer of oil and gas between approximately 1100 and 1300 m over the release location and spreading out along the isopycnal surfaces. Later in the event, a small oxygen depression was a proxy for where oil and gas had been. The DWH MC252 well is located at intermediate depth in the Gulf of Mexico (GoM). The water mass is Antarctic Intermediate Water, which enters and exits the GoM through the Yucatan Straits. Surface influences, such as Loop Current Frontal Eddies (e.g. Berger et al 2000) can reach down to these depths, and alter the flow within De Soto Canyon. The water mass containing the deep layer of oil droplets changes depth within the GoM, but does not reach above a depth of about 900 m. There are no physical processes that could cause this deep layer of oil to reach the continental shelf or the Florida Straits. Observed and historical hydrographic data, observations

  9. IMI's CANCER-ID: Status of liquid biopsy standardization

    NARCIS (Netherlands)

    Pantel, Klaus; Terstappen, Leon W. M. M.; Baggiani, Barbara; Krahn, Thomas; Schlange, Thomas

    The CANCER-ID (www.cancer-id.eu) consortium was established in early 2015 with more than 30 partners as part of the Innovative Medicines Initiative (IMI), Europe's largest public-private partnership funded in equal parts by the European Union and the European Federation of Pharmaceutical Industries

  10. Security analysis for biometric data in ID documents

    NARCIS (Netherlands)

    Schimke, S.; Kiltz, S.; Vielhauer, C.; Kalker, A.A.C.M.

    2005-01-01

    In this paper we analyze chances and challenges with respect to the security of using biometrics in ID documents. We identify goals for ID documents, set by national and international authorities, and discuss the degree of security, which is obtainable with the inclusion of biometric into documents

  11. Knoto-ID: a tool to study the entanglement of open protein chains using the concept of knotoids.

    Science.gov (United States)

    Dorier, Julien; Goundaroulis, Dimos; Benedetti, Fabrizio; Stasiak, Andrzej

    2018-05-02

    The backbone of most proteins forms an open curve. To study their entanglement, a common strategy consists in searching for the presence of knots in their backbones using topological invariants. However, this approach requires to close the curve into a loop, which alters the geometry of curve. Knoto-ID allows evaluating the entanglement of open curves without the need to close them, using the recent concept of knotoids which is a generalization of the classical knot theory to open curves. Knoto-ID can analyse the global topology of the full chain as well as the local topology by exhaustively studying all subchains or only determining the knotted core. Knoto-ID permits to localize topologically non-trivial protein folds that are not detected by informatics tools detecting knotted protein folds. Knoto-ID is written in C ++ and includes R (www.R-project.org) scripts to generate plots of projections maps, fingerprint matrices and disk matrices. Knoto-ID is distributed under the GNU General Public License (GPL), version 2 or any later version and is available at https://github.com/sib-swiss/Knoto-ID. A binary distribution for Mac OS X, Linux and Windows with detailed user guide and examples can be obtained from https://www.vital-it.ch/software/Knoto-ID. julien.dorier@sib.swiss.

  12. A Neighborhood Condition for Fractional ID-[A, B]-Factor-Critical Graphs

    Directory of Open Access Journals (Sweden)

    Zhou Sizhong

    2016-05-01

    Full Text Available Let G be a graph of order n, and let a and b be two integers with 1 ≤ a ≤ b. Let h : E(G → [0, 1] be a function. If a ≤ ∑e∋x h(e ≤ b holds for any x ∈ V (G, then we call G[Fh] a fractional [a, b]-factor of G with indicator function h, where Fh = {e ∈ E(G : h(e > 0}. A graph G is fractional independent-set-deletable [a, b]-factor-critical (in short, fractional ID-[a, b]- factor-critical if G − I has a fractional [a, b]-factor for every independent set I of G. In this paper, it is proved that if for any two nonadjacent vertices x, y ∈ V (G, then G is fractional ID-[a, b]-factor-critical. Furthermore, it is shown that this result is best possible in some sense.

  13. Power spectral density measurements with 252Cf for a light water moderated research reactor

    International Nuclear Information System (INIS)

    King, W.T.; Mihalczo, J.T.

    1979-01-01

    A method of determining the reactivity of far subcritical systems from neutron noise power spectral density measurements with 252 Cf has previously been tested in fast reactor critical assemblies: a mockup of the Fast Flux Test Facility reactor and a uranium metal sphere. Calculations indicated that this measurement was feasible for a pressurized water reactor (PWR). In order to evaluate the ability to perform these measurements with moderated reactors which have long prompt neutron lifetimes, measurements were performed with a small plate-type research reactor whose neutron lifetime (57 microseconds) was about a factor of three longer than that of a PWR and approx. 50% longer than that of a boiling water reactor. The results of the first measurements of power spectral densities with 252 Cf for a water moderated reactor are presented

  14. 48 CFR 252.225-7023 - Preference for products or services from Iraq or Afghanistan.

    Science.gov (United States)

    2010-10-01

    ... services from Iraq or Afghanistan. 252.225-7023 Section 252.225-7023 Federal Acquisition Regulations System... from Iraq or Afghanistan. As prescribed in 225.7703-5(a), use the following provision: Requirement for Products or Services from Iraq or Afghanistan (APR 2010) (a) Definitions. Product from Iraq or Afghanistan...

  15. Guinea pig ID-like families of SINEs.

    Science.gov (United States)

    Kass, David H; Schaetz, Brian A; Beitler, Lindsey; Bonney, Kevin M; Jamison, Nicole; Wiesner, Cathy

    2009-05-01

    Previous studies have indicated a paucity of SINEs within the genomes of the guinea pig and nutria, representatives of the Hystricognathi suborder of rodents. More recent work has shown that the guinea pig genome contains a large number of B1 elements, expanding to various levels among different rodents. In this work we utilized A-B PCR and screened GenBank with sequences from isolated clones to identify potentially uncharacterized SINEs within the guinea pig genome, and identified numerous sequences with a high degree of similarity (>92%) specific to the guinea pig. The presence of A-tails and flanking direct repeats associated with these sequences supported the identification of a full-length SINE, with a consensus sequence notably distinct from other rodent SINEs. Although most similar to the ID SINE, it clearly was not derived from the known ID master gene (BC1), hence we refer to this element as guinea pig ID-like (GPIDL). Using the consensus to screen the guinea pig genomic database (Assembly CavPor2) with Ensembl BlastView, we estimated at least 100,000 copies, which contrasts markedly to just over 100 copies of ID elements. Additionally we provided evidence of recent integrations of GPIDL as two of seven analyzed conserved GPIDL-containing loci demonstrated presence/absence variants in Cavia porcellus and C. aperea. Using intra-IDL PCR and sequence analyses we also provide evidence that GPIDL is derived from a hystricognath-specific SINE family. These results demonstrate that this SINE family continues to contribute to the dynamics of genomes of hystricognath rodents.

  16. Optimization of in situ prompt gamma-ray analysis using a HPGe-252Cf probe

    International Nuclear Information System (INIS)

    Chien Chung; Jiunnhsing Chao

    1991-01-01

    Application of in situ measurements by the neutron-induced prompt gamma-ray activation analysis (PGAA) technique to geochemical analysis and mineral survey have been investigated. An in situ survey of water pollutants by PGAA techniques was first proposed in the authors' previous study, where a 2.7-μg 252 Cf neutron source used in connection with a gamma-ray detecting system to determine water pollutants was described. In this paper the authors describe a modified detection probe designed and constructed to look for the optimum conditions of various-intensity 252 Cf neutron sources in measurement of some elements in lake water. Detecting efficiencies at high-energy regions and detection limits for elements commonly found in polluted lakes were evaluated and predicted to investigate the potential application of the probe for in situ measurements

  17. 24 CFR 252.2 - GNMA right to assignment.

    Science.gov (United States)

    2010-04-01

    ... COINSURANCE OF MORTGAGES COVERING NURSING HOMES, INTERMEDIATE CARE FACILITIES, AND BOARD AND CARE HOMES § 252... section, in order to allow an appropriate endorsement and necessary changes in the Commissioner's records...

  18. La certificazione professionale I&D in Europa

    OpenAIRE

    Franco, Augusta

    2003-01-01

    The statement points out the activity of I&D European associations in the field of competences' certification, in ECIA federation's area as well as in the national one. In the statement there are references on history and outcomes of DECIDoc project; objectives and operative stages of CERTIDoc project, promoted by ECIA; and enterprises of I&D associations in France, Spain, Germany and Italy. Secondly, it is illustrated the activity of Italian librarians and archivists associatio...

  19. 48 CFR 252.225-7020 - Trade Agreements Certificate.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Trade Agreements... of Provisions And Clauses 252.225-7020 Trade Agreements Certificate. As prescribed in 225.1101(5), use the following provision: Trade Agreements Certificate (JAN 2005) (a) Definitions. Designated...

  20. The Self-Identity Protein IdsD Is Communicated between Cells in Swarming Proteus mirabilis Colonies.

    Science.gov (United States)

    Saak, Christina C; Gibbs, Karine A

    2016-12-15

    Proteus mirabilis is a social bacterium that is capable of self (kin) versus nonself recognition. Swarming colonies of this bacterium expand outward on surfaces to centimeter-scale distances due to the collective motility of individual cells. Colonies of genetically distinct populations remain separate, while those of identical populations merge. Ids proteins are essential for this recognition behavior. Two of these proteins, IdsD and IdsE, encode identity information for each strain. These two proteins bind in vitro in an allele-restrictive manner. IdsD-IdsE binding is correlated with the merging of populations, whereas a lack of binding is correlated with the separation of populations. Key questions remained about the in vivo interactions of IdsD and IdsE, specifically, whether IdsD and IdsE bind within single cells or whether IdsD-IdsE interactions occur across neighboring cells and, if so, which of the two proteins is exchanged. Here we demonstrate that IdsD must originate from another cell to communicate identity and that this nonresident IdsD interacts with IdsE resident in the recipient cell. Furthermore, we show that unbound IdsD in recipient cells does not cause cell death and instead appears to contribute to a restriction in the expansion radius of the swarming colony. We conclude that P. mirabilis communicates IdsD between neighboring cells for nonlethal kin recognition, which suggests that the Ids proteins constitute a type of cell-cell communication. We demonstrate that self (kin) versus nonself recognition in P. mirabilis entails the cell-cell communication of an identity-encoding protein that is exported from one cell and received by another. We further show that this intercellular exchange affects swarm colony expansion in a nonlethal manner, which adds social communication to the list of potential swarm-related regulatory factors. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  1. Phenotype abnormality: 252 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available lant flowering stage in environment of short day length regimen in environment of short day length regimen h... 252 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u758i delayed whole p

  2. Application of Sharī‘ah contracts in contemporary Islamic finance: A maqāṣid perspective

    Directory of Open Access Journals (Sweden)

    Younes Soualhi

    2015-12-01

    Full Text Available This research exposes the underlying maqāṣid embedded in Sharī‘ah contracts as applied in Islamic banking and finance. It addresses the problem of not observing maqāṣid in nominated and combined Sharī‘ah contracts as well as the problem of not sufficiently imbuing maqāṣid in products developed by Islamic financial institutions. As a benchmark of the maqāṣid of wealth, the research adopts Ibn ‘Āshūr’s classification of maqāṣid to evaluate the conformity of Sharī‘ah contracts to Maqāṣid al-Sharī‘ah namely, justice, circulation, transparency, and firmness. The study focuses on three markets related to the application of Sharī‘ah contracts, namely, banking, Islamic capital market, and takāful. The study concludes that, by and large, the application of Sharī‘ah contracts has observed Maqāṣid al-Sharī‘ah during its development and initial application stages of Islamic finance products; however, offering such products in the market has raised economic questions as to their viability and economic values. In addition, the malpractice of some Sharī‘ah contracts has long raised concerns as to the maqāṣid compliance of such products. The research recommends a de-sophistication of Islamic financial engineering to minimise the possibility of convergence with conventional finance. The research also emphasises product differentiation based on less complicated combined Sharī‘ah contracts.

  3. 48 CFR 252.225-7024 - Requirement for products or services from Iraq or Afghanistan.

    Science.gov (United States)

    2010-10-01

    ... or services from Iraq or Afghanistan. 252.225-7024 Section 252.225-7024 Federal Acquisition... products or services from Iraq or Afghanistan. As prescribed in 225.7703-5(b), use the following clause: Requirement for Products or Services From Iraq or Afghanistan (SEP 2008) (a) Definitions. As used in this...

  4. 48 CFR 252.235-7001 - Indemnification under 10 U.S.C. 2354-cost reimbursement.

    Science.gov (United States)

    2010-10-01

    ....S.C. 2354-cost reimbursement. 252.235-7001 Section 252.235-7001 Federal Acquisition Regulations.... 2354—cost reimbursement. As prescribed in 235.070-3, use the following clause: Indemnification Under 10 U.S.C. 2354—Cost Reimbursement (DEC 1991) (a) This clause provides for indemnification under 10 U.S...

  5. Best practices for the implementation of the REAL ID Act.

    Science.gov (United States)

    2015-10-01

    The REAL ID Act specifies the minimum standards that must be used to produce and issue drivers license and : identification cards that are REAL ID compliant. Beginning in 2020, if a person does not possess a form of : identification that meets REA...

  6. OpenID Connect as a security service in cloud-based medical imaging systems.

    Science.gov (United States)

    Ma, Weina; Sartipi, Kamran; Sharghigoorabi, Hassan; Koff, David; Bak, Peter

    2016-04-01

    The evolution of cloud computing is driving the next generation of medical imaging systems. However, privacy and security concerns have been consistently regarded as the major obstacles for adoption of cloud computing by healthcare domains. OpenID Connect, combining OpenID and OAuth together, is an emerging representational state transfer-based federated identity solution. It is one of the most adopted open standards to potentially become the de facto standard for securing cloud computing and mobile applications, which is also regarded as "Kerberos of cloud." We introduce OpenID Connect as an authentication and authorization service in cloud-based diagnostic imaging (DI) systems, and propose enhancements that allow for incorporating this technology within distributed enterprise environments. The objective of this study is to offer solutions for secure sharing of medical images among diagnostic imaging repository (DI-r) and heterogeneous picture archiving and communication systems (PACS) as well as Web-based and mobile clients in the cloud ecosystem. The main objective is to use OpenID Connect open-source single sign-on and authorization service and in a user-centric manner, while deploying DI-r and PACS to private or community clouds should provide equivalent security levels to traditional computing model.

  7. 48 CFR 252.227-7027 - Deferred ordering of technical data or computer software.

    Science.gov (United States)

    2010-10-01

    ... technical data or computer software. 252.227-7027 Section 252.227-7027 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(b), use the following clause: Deferred Ordering of Technical Data or Computer Software (APR 1988) In addition to technical data or computer software...

  8. 50 CFR 216.252 - Permissible methods of taking.

    Science.gov (United States)

    2010-10-01

    ... ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking Marine Mammals Incidental to Conducting Precision Strike Weapon Missions in the Gulf of Mexico § 216.252 Permissible methods of taking. (a) Under Letters of Authorization issued pursuant to...

  9. Interoperability for electronic ID

    OpenAIRE

    Zygadlo, Zuzanna

    2009-01-01

    Electronic Business, including eBanking, eCommerce and eGovernmental services, is today based on a large variety of security solutions, comprising electronic IDs provided by a broad community of Public Key Infrastructure (PKI) vendors. Significant differences in implementations of those solutions introduce a problem of lack of interoperability in electronic business, which have not yet been resolved by standardization and interoperability initiatives based on existing PKI trust models. It i...

  10. 48 CFR 252.247-7017 - Erroneous shipments.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Erroneous shipments. 252... SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of..., articles of personal property inadvertently packed with goods of other than the rightful owner. (2) Ensure...

  11. ID4 promotes AR expression and blocks tumorigenicity of PC3 prostate cancer cells

    International Nuclear Information System (INIS)

    Komaragiri, Shravan Kumar; Bostanthirige, Dhanushka H.; Morton, Derrick J.; Patel, Divya; Joshi, Jugal; Upadhyay, Sunil; Chaudhary, Jaideep

    2016-01-01

    Deregulation of tumor suppressor genes is associated with tumorigenesis and the development of cancer. In prostate cancer, ID4 is epigenetically silenced and acts as a tumor suppressor. In normal prostate epithelial cells, ID4 collaborates with androgen receptor (AR) and p53 to exert its tumor suppressor activity. Previous studies have shown that ID4 promotes tumor suppressive function of AR whereas loss of ID4 results in tumor promoter activity of AR. Previous study from our lab showed that ectopic ID4 expression in DU145 attenuates proliferation and promotes AR expression suggesting that ID4 dependent AR activity is tumor suppressive. In this study, we examined the effect of ectopic expression of ID4 on highly malignant prostate cancer cell, PC3. Here we show that stable overexpression of ID4 in PC3 cells leads to increased apoptosis and decreased cell proliferation and migration. In addition, in vivo studies showed a decrease in tumor size and volume of ID4 overexpressing PC3 cells, in nude mice. At the molecular level, these changes were associated with increased androgen receptor (AR), p21, and AR dependent FKBP51 expression. At the mechanistic level, ID4 may regulate the expression or function of AR through specific but yet unknown AR co-regulators that may determine the final outcome of AR function. - Highlights: • ID4 expression induces AR expression in PC3 cells, which generally lack AR. • ID4 expression increased apoptosis and decreased cell proliferation and invasion. • Overexpression of ID4 reduces tumor growth of subcutaneous xenografts in vivo. • ID4 induces p21 and FKBP51 expression- co-factors of AR tumor suppressor activity.

  12. ID4 promotes AR expression and blocks tumorigenicity of PC3 prostate cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Komaragiri, Shravan Kumar; Bostanthirige, Dhanushka H.; Morton, Derrick J.; Patel, Divya; Joshi, Jugal; Upadhyay, Sunil; Chaudhary, Jaideep, E-mail: jchaudhary@cau.edu

    2016-09-09

    Deregulation of tumor suppressor genes is associated with tumorigenesis and the development of cancer. In prostate cancer, ID4 is epigenetically silenced and acts as a tumor suppressor. In normal prostate epithelial cells, ID4 collaborates with androgen receptor (AR) and p53 to exert its tumor suppressor activity. Previous studies have shown that ID4 promotes tumor suppressive function of AR whereas loss of ID4 results in tumor promoter activity of AR. Previous study from our lab showed that ectopic ID4 expression in DU145 attenuates proliferation and promotes AR expression suggesting that ID4 dependent AR activity is tumor suppressive. In this study, we examined the effect of ectopic expression of ID4 on highly malignant prostate cancer cell, PC3. Here we show that stable overexpression of ID4 in PC3 cells leads to increased apoptosis and decreased cell proliferation and migration. In addition, in vivo studies showed a decrease in tumor size and volume of ID4 overexpressing PC3 cells, in nude mice. At the molecular level, these changes were associated with increased androgen receptor (AR), p21, and AR dependent FKBP51 expression. At the mechanistic level, ID4 may regulate the expression or function of AR through specific but yet unknown AR co-regulators that may determine the final outcome of AR function. - Highlights: • ID4 expression induces AR expression in PC3 cells, which generally lack AR. • ID4 expression increased apoptosis and decreased cell proliferation and invasion. • Overexpression of ID4 reduces tumor growth of subcutaneous xenografts in vivo. • ID4 induces p21 and FKBP51 expression- co-factors of AR tumor suppressor activity.

  13. Événement, idéologie et utopie

    Directory of Open Access Journals (Sweden)

    Jean-Luc AMALRIC

    2014-12-01

    Full Text Available RESUMEL’hypothèse que tente d’esquisser cet article est que l’idée ricœurienne d’une médiatisation dynamique des contradictions de l’imaginaire social présuppose une corrélation originaire de l’idéologie et de l’utopie qui ne peut elle-même être comprise qu’à partir de l’événement de l’institution d’un imaginaire social constituant. Dans un premier temps, l’article s’efforce de cerner ce qui fait la spécificité de la théorie ricœurienne de l’idéologie et de l’utopie comme « pratiques imaginatives », en soulignant à ce titre l’influence déterminante des thèses de Jacques Ellul sur l’idéologie. Puis, dans un second temps, il s’engage dans une analyse régressive qui conduit de la réappropriation ricœurienne de la conception dialectique de l’idéologie et de l’utopie exposée par Mannheim à l’idée d’un fondement événementiel de ces deux formes opposées de l’imaginaire social.Mots-Clés : Evénement, idéologie, utopie, Ellul, Mannheim. ABSTRACTThis paper attempts to sketch out the hypothesis that the Ricœurian conception of a dynamic mediatization of the contradictions of the social imaginary presupposes an original correlation between ideology and utopia, which can itself be understood only from the event that institutes a constitutive social imaginary. The first part of the paper marks out the specificity of the Ricœurian theory of ideology and utopia in terms of “imaginative practices”, underlining the determining influence of Jacques Ellul’s theses on ideology. The second part tries to develop a regressive argument, starting from the Ricœurian re-appropriation of Mannheim’s dialectical conception of ideology and utopia, and leading back to the idea of an event foundation for these two opposed forms of the social imaginary.Keywords : Event, Ideology, Utopia, Ellul, Mannheim   

  14. Proposed Californium-252 User Facility for Neutron Science at Oak Ridge National Laboratory

    International Nuclear Information System (INIS)

    Martin, R.C.; Laxson, R.R.; Knauer, J.B.

    1996-01-01

    The Radiochemical Engineering Development Center (REDC) at ORNL has petitioned to establish a Californium-252 User Facility for Neutron Science for academic, industrial, and governmental researchers. The REDC Californium Facility (CF) stores the national inventory of sealed 252 Cf neutron source for university and research loans. Within the CF, the 252 Cf storage pool and two uncontaminated hot cells currently in service for the Californium Program will form the physical basis for the User Facility. Relevant applications include dosimetry and experiments for neutron tumor therapy; fast and thermal neutron activation analysis of materials; experimental configurations for prompt gamma neutron activation analysis; neutron shielding and material damage studies; and hardness testing of radiation detectors, cameras, and electronics. A formal User Facility simplifies working arrangements and agreements between US DOE facilities, academia, and commercial interests

  15. CASK inhibits ECV304 cell growth and interacts with Id1

    International Nuclear Information System (INIS)

    Qi Jie; Su Yongyue; Sun Rongju; Zhang Fang; Luo Xiaofeng; Yang Zongcheng; Luo Xiangdong

    2005-01-01

    Calcium/calmodulin-dependent serine protein kinase (CASK) is generally known as a scaffold protein. Here we show that overexpression of CASK resulted in a reduced rate of cell growth, while inhibition of expression of endogenous CASK via RNA-mediated interference resulted in an increased rate of cell growth in ECV304 cells. To explore the molecular mechanism, we identified a novel CASK-interacting protein, inhibitor of differentiation 1 (Id1) with a yeast two-hybrid screening. Furthermore, endogenous CASK and Id1 proteins were co-precipitated from the lysates of ECV304 cells by immunoprecipitation. Mammalian two-hybrid protein-protein interaction assays indicated that CASK possessed a different binding activity for Id1 and its alternative splicing variant. It is known that Id proteins play important roles in regulation of cell proliferation and differentiation. Thus, we speculate that the regulation of cell growth mediated by CASK may be involved in Id1. Our findings indicate a novel function of CASK, the mechanism that remains to be further investigated

  16. ID card number detection algorithm based on convolutional neural network

    Science.gov (United States)

    Zhu, Jian; Ma, Hanjie; Feng, Jie; Dai, Leiyan

    2018-04-01

    In this paper, a new detection algorithm based on Convolutional Neural Network is presented in order to realize the fast and convenient ID information extraction in multiple scenarios. The algorithm uses the mobile device equipped with Android operating system to locate and extract the ID number; Use the special color distribution of the ID card, select the appropriate channel component; Use the image threshold segmentation, noise processing and morphological processing to take the binary processing for image; At the same time, the image rotation and projection method are used for horizontal correction when image was tilting; Finally, the single character is extracted by the projection method, and recognized by using Convolutional Neural Network. Through test shows that, A single ID number image from the extraction to the identification time is about 80ms, the accuracy rate is about 99%, It can be applied to the actual production and living environment.

  17. Determination of disintegration half-life of 252Cf

    International Nuclear Information System (INIS)

    Chen Keliang; Liu Guoxing; Wang Sufang; Zheng Jiwen

    1991-01-01

    The follow-up measurements have been made by using a Si(Au) detector with small solid angle geometry for α disintegration of 252 Cf. The measured half-life of disintegration is 2.638 ± 0.009 year. This value is in accordance with other previous results

  18. 48 CFR 252.237-7005 - Performance and delivery.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance and delivery... of Provisions And Clauses 252.237-7005 Performance and delivery. As prescribed in 237.7003(b), use the following clause: Performance and Delivery (DEC 1991) (a) The Contractor shall furnish the...

  19. RBE of Cf-252 neutrons as determined by its lethal, mutagenic, and cytogenetic effects on human cells

    International Nuclear Information System (INIS)

    Ban, Sadayuki

    1989-01-01

    To assess the biological effects of neutrons, a man-made spontaneously fissioning isotope, Cf-252, is useful as an experimental model to obtain basic biological data on mixed radiation of gamma-rays and neutrons. The paper describes the lethal effect of Cf-252 radiation on human skin fibroblasts, its lethal and mutagenic effect on HeLa MR cells, and the micronuclei inducing effect on human peripheral lymphocytes. Dose-survival responses of three fibroblast cell strains exposed to Cf-252 radiation are measured. Individual difference is larger than the experimental fluctuation. D 10 values of each strain are obtained from the linear model and linear-quadratic model. Though the dose rate of X-ray is higher than that of Cf-252 radiations, the mean value of RBE(n+γ) is simply obtained as 1.86+0.31 (RBE:relative biological effectiveness). RBE(n) of Cf-252 neutrons to high-dose-rate X-rays is 2.29. After X-ray irradiation, the survival curve of HeLa MR cells gives an extrapolation number of 3.6. It is 1.3 after Cf-252 irradiation. At 50% survival, RBE(n+γ) and RBE(n) are 2.05 and 2.6, respectively. At 10% survival they are 2.05 and 2.6. The mutation frequencies after X-ray irradiation showed a significant non-linear increase with dose. Those after Cf-252 irradiation increase linearly with dose. (N.K.)

  20. Regulation of Id2 expression in EL4 T lymphoma cells overexpressing growth hormone.

    Science.gov (United States)

    Weigent, Douglas A

    2009-01-01

    In previous studies, we have shown that overexpression of growth hormone (GH) in cells of the immune system upregulates proteins involved in cell growth and protects from apoptosis. Here, we report that overexpression of GH in EL4 T lymphoma cells (GHo) also significantly increased levels of the inhibitor of differentiation-2 (Id2). The increase in Id2 was suggested in both Id2 promoter luciferase assays and by Western analysis for Id2 protein. To identify the regulatory elements that mediate transcriptional activation by GH in the Id2 promoter, promoter deletion analysis was performed. Deletion analysis revealed that transactivation involved a 301-132bp region upstream to the Id2 transcriptional start site. The pattern in the human GHo Jurkat T lymphoma cell line paralleled that found in the mouse GHo EL4 T lymphoma cell line. Significantly less Id2 was detected in the nucleus of GHo EL4 T lymphoma cells compared to vector alone controls. Although serum increased the levels of Id2 in control vector alone cells, no difference was found in the total levels of Id2 in GHo EL4 T lymphoma cells treated with or without serum. The increase in Id2 expression in GHo EL4 T lymphoma cells measured by Id2 promoter luciferase expression and Western blot analysis was blocked by the overexpression of a dominant-negative mutant of STAT5. The results suggest that in EL4 T lymphoma cells overexpressing GH, there is an upregulation of Id2 protein that appears to involve STAT protein activity.

  1. Psychometrics and latent structure of the IDS and QIDS with young adult students.

    Science.gov (United States)

    González, David Andrés; Boals, Adriel; Jenkins, Sharon Rae; Schuler, Eric R; Taylor, Daniel

    2013-07-01

    Students and young adults have high rates of suicide and depression, thus are a population of interest. To date, there is no normative psychometric information on the IDS and QIDS in these populations. Furthermore, there is equivocal evidence on the factor structure and subscales of the IDS. Two samples of young adult students (ns=475 and 1681) were given multiple measures to test the psychometrics and dimensionality of the IDS and QIDS. The IDS, its subscales, and QIDS had acceptable internal consistencies (αs=.79-90) and favorable convergent and divergent validity correlations. A three-factor structure and two Rasch-derived subscales best fit the IDS. The samples were collected from one university, which may influence generalizability. The IDS and QIDS are desirable measures of depressive symptoms when studying young adult students. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. A Cross-Layer, Anomaly-Based IDS for WSN and MANET.

    Science.gov (United States)

    Amouri, Amar; Morgera, Salvatore D; Bencherif, Mohamed A; Manthena, Raju

    2018-02-22

    Intrusion detection system (IDS) design for mobile adhoc networks (MANET) is a crucial component for maintaining the integrity of the network. The need for rapid deployment of IDS capability with minimal data availability for training and testing is an important requirement of such systems, especially for MANETs deployed in highly dynamic scenarios, such as battlefields. This work proposes a two-level detection scheme for detecting malicious nodes in MANETs. The first level deploys dedicated sniffers working in promiscuous mode. Each sniffer utilizes a decision-tree-based classifier that generates quantities which we refer to as correctly classified instances (CCIs) every reporting time. In the second level, the CCIs are sent to an algorithmically run supernode that calculates quantities, which we refer to as the accumulated measure of fluctuation (AMoF) of the received CCIs for each node under test (NUT). A key concept that is used in this work is that the variability of the smaller size population which represents the number of malicious nodes in the network is greater than the variance of the larger size population which represents the number of normal nodes in the network. A linear regression process is then performed in parallel with the calculation of the AMoF for fitting purposes and to set a proper threshold based on the slope of the fitted lines. As a result, the malicious nodes are efficiently and effectively separated from the normal nodes. The proposed scheme is tested for various node velocities and power levels and shows promising detection performance even at low-power levels. The results presented also apply to wireless sensor networks (WSN) and represent a novel IDS scheme for such networks.

  3. 48 CFR 252.229-7005 - Tax exemptions (Spain).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax exemptions (Spain... of Provisions And Clauses 252.229-7005 Tax exemptions (Spain). As prescribed in 229.402-70(e), use the following clause: Tax Exemptions (Spain) (JUN 1997) (a) The Contractor represents that the...

  4. Energy and angular distributions of neutrons from 252Cf spontaneous fission

    International Nuclear Information System (INIS)

    Vasil'ev, Yu.A.; Sidorov, L.V.; Vasil'eva, N.K.

    1982-01-01

    Some results from a first series of measurements of energy and angular distributions of neutrons from 252 Cf spontaneous fission using a spectrometer with high neutron detection efficiency, i.e. a 4π neutron time-of-flight spectrometer, were already presented. Subsequently, a second series of measurements was performed using a more sophisticated technique. For this second series, we used a more intense 252 Cf layer (25,000 spontaneous fissions per second). The angular resolution was improved by a factor of 2-3 by combining the hexahedral counter modules, placed at the same angle with respect to the direction of motion of the fragments, in new panoramic counters. The neutron counters were calibrated against the average 252 Cf neutron spectrum at several positions of the axis of the fragment detector with respect to the neutron counters. In the spectrum measurements and calibration work, the scattered neutron background was not determined theoretically, as in the first series of measurements, but experimentally using four extra scintillation counters with scatter cones; the counters were set up at 60 deg., 80 deg., 100 deg., and 120 deg. to the direction of separation of the fragments

  5. A Phase I/II Protocol Using 252Cf for the Treatment of Cervical Carcinoma

    International Nuclear Information System (INIS)

    Anita Mahajan; Mark J. Rivard; Evelyn R. Nunez; David E. Wazer

    2000-01-01

    For this clinical study, external photon beam irradiation will be given in a standard fashion with intravenous cisplatinum (CDDP) every week as a radiosensitizing agent. We will incorporate 252 Cf as the brachytherapy source replacing 192 Ir, theoretically improving patient outcomes with its lack of cell cycle and oxygen dependence, and a therapeutic ratio possibly greater than unity. Local tumor control and control of systemic disease are potentially feasible using 252 Cf to initially debulk and destroy local bulky tumor with CDDP and X rays to enhance treatment efficacy and treat minimal microscopic and distant micrometastases. The initial 22 Cf dose will be 1 Gy per weekly fraction with 0.25-Gy increments toward a 2.5-Gy limit. Patients will be stratified according to their stage, toxicities and outcomes will be monitored closely, and the study will be halted if undo morbidities are noted

  6. Clarté des idées innées ?

    DEFF Research Database (Denmark)

    Schøsler, Jørn

    2013-01-01

    Der gives en analyse af begreberne 'evidens' og 'medfødte idéer' hos Descartes og Locke samt hos de franske oplysningsfilosoffer.......Der gives en analyse af begreberne 'evidens' og 'medfødte idéer' hos Descartes og Locke samt hos de franske oplysningsfilosoffer....

  7. Decorporation of 241Am and 252Cf by Ca-DTPA from rat, Syrian and Chinese hamster

    International Nuclear Information System (INIS)

    Seidel, A.

    1977-01-01

    Retention and mobilization by Ca-DTPA of 241 Am and 252 Cf from rats, Syrian and Chinese hamsters are compared. Previous observations of a much longer residence time of actinides in hamsters liver than in rat liver are confirmed. Identical dose-effect functions were obtained for skeleton of rats and Syrian hamsters whereas 252 Cf removal from Chinese hamster skeleton was lower. The mobilization of 241 Am was lower than that of 252 Cf. With regard to species differences, qualitatively similar results were obtained for 241 Am as for 252 Cf. The results will be discussed with regard to the reduction by DTPA treatment of radiation risk in animal species with different biological half times of actinides in their livers. In this connection, attention will be paid to the usefulness of long-term DTPA treatment

  8. REFORMASI PEMAHAMAN TEORI MAQᾹṢID SYARIAH Analisis Pendekatan Sistem Jasser Auda

    Directory of Open Access Journals (Sweden)

    Muhammad Iqbal Fasa

    2016-12-01

    Full Text Available This paper attempts to offer reform ideas Jasser Auda thought related reforms theoretical understanding of maqᾱṣid sharia. The systems approach is done by Auda critize the theory of classical maqᾱṣid more likely to hierarchical and narrow mindset. The classical maqᾱṣid pressure a point more on protection and preservation. Whereas the new maqᾱṣid theory emphasizes development (construction, development and rights (rights. Thus, Auda developed the concept of human development as the main target of maslahah (public interest. Auda offers the systems approach, namely: cognitive nature; interrelated; wholeness; openness; multi dimentionality and purposefulness. At the end of the discussion in this paper, the authors develop the idea of Jasser Auda by offering Sharia Maqᾱṣid concept in the context of Islamic Economics

  9. Ekspert : mobiil-ID kasutamine valimistel turvariske ei tekita / Holger Roonemaa

    Index Scriptorium Estoniae

    Roonemaa, Holger

    2008-01-01

    E-valimiste projektijuhi Taavi Martensi väitel pole põhjust kahelda mobiil-ID turvalisuses. Valimiskomisjoni esimehe Heiki Sibula meelest peaks m-ID kaarte välja andma kodakondsus- ja migratsiooniamet

  10. Time domain measurements for fast metal assemblies with /sup 252/Cf

    Energy Technology Data Exchange (ETDEWEB)

    Mihalczo, J T

    1975-06-01

    Time correlation measurements between the pulses from an ionization counter containing a /sup 252/Cf neutron source, which provided the initiators of fission chains in a neutron multiplying assembly and from sensors that detected particles from the fission chains are reviewed for fast uranium or plutonium metal assemblies. Comparisons are made between the correlated count rate from a /sup 252/Cf measurement and that from both one and two-detector Rossi-..cap alpha.. measurements. The assemblies studied were (1) unmoderated and polyethylene-moderated uranium (93 wt percent /sup 235/U) cylinders with masses from 12 to 160 kg; prompt neutron decay constants from 3 to 10/sup 3/ to 10/sup 8/ sec/sup -1/ and (2) unmoderated plutonium spheres and parts of spheres with plutonium masses from 2.2 to 16 kg with /sup 240/Pu contents of 4.5 to 20.1 at. percent. Measurements with a delayed critical uranium metal sphere determined the effective delayed neutron fraction and served as the basis for verification of the theory of the /sup 252/Cf measurement method in the time domain within a few per cent. (auth)

  11. Reactor production of 252Cf and transcurium isotopes

    International Nuclear Information System (INIS)

    Alexander, C.W.; Halperin, J.; Walker, R.L.; Bigelow, J.E.

    1990-01-01

    Berkelium, californium, einsteinium, and fermium are currently produced in the High Flux Isotope Reactor (HFIR) and recovered in the Radiochemical Engineering Development Center (REDC) at the Oak Ridge National Laboratory (ORNL). All the isotopes are used for research. In addition, 252 Cf, 253 Es, and 255 Fm have been considered or are used for industrial or medical applications. ORNL is the sole producer of these transcurium isotopes in the western world. A wide range of actinide samples were irradiated in special test assemblies at the Fast Flux Test Facility (FFTF) at Hanford, Washington. The purpose of the experiments was to evaluate the usefulness of the two-group flux model for transmutations in the special assemblies with an eventual goal of determining the feasibility of producing macro amounts of transcurium isotopes in the FFTF. Preliminary results from the production of 254g Es from 252 Cf will be discussed. 14 refs., 5 tabs

  12. Fresnel zone plate imaging of a 252Cf spontaneous fission source

    International Nuclear Information System (INIS)

    Stalker, K.T.; Hessel, K.R.

    1976-11-01

    The feasibility of coded aperture imaging for nuclear fuel motion monitoring is shown using Cf 252 spontaneous fission source. The theory of coded aperture imaging for Fresnel zone plate apertures is presented and design considerations for zone plate construction are discussed. Actual images are obtained which demonstrate a transverse resolution of 1.7 mm and a tomographic resolution of 1.5 millimeters. The capability of obtaining images through 12.7 mm of stainless steel is also shown

  13. 48 CFR 252.225-7026 - Acquisition Restricted to Products or Services from Iraq or Afghanistan.

    Science.gov (United States)

    2010-10-01

    ... Products or Services from Iraq or Afghanistan. 252.225-7026 Section 252.225-7026 Federal Acquisition... to Products or Services from Iraq or Afghanistan. As prescribed in 225.7703-5(c), use the following clause: Acquisition Restricted to Products or Services From Iraq or Afghanistan (APR 2010) (a...

  14. 48 CFR 252.225-7036 - Buy American Act-Free Trade Agreements-Balance of Payments Program.

    Science.gov (United States)

    2010-10-01

    ... Trade Agreements-Balance of Payments Program. 252.225-7036 Section 252.225-7036 Federal Acquisition... Trade Agreements—Balance of Payments Program. As prescribed in 225.1101(11)(i), use the following clause: Buy American Act—Free Trade Agreements—Balance of Payments Program (JUL 2009) (a) Definitions. As used...

  15. A Design-Based Research Case Study Documenting a Constructivist ID Process and Instructional Solution for a Cross-Cultural Workforce

    Science.gov (United States)

    Tracey, Monica W.; Unger, Kelly L.

    2012-01-01

    As the need for instructing a globalized workforce increases, instructional designers must embrace the constraints and the opportunities these projects provide in order to move the field of cross-cultural instructional design (ID) forward. Cross-cultural projects offer multiple avenues for growth in ID practice, overcoming cultural barriers, and a…

  16. Subcriticality determination by a new time-domain correlation experiment with a 252Cf neutron source

    International Nuclear Information System (INIS)

    Nishina, K.; Yamane, Y.; Ishiguro, S.; Miyoshi, Y.; Suzaki, T.; Kobayahi, I.

    1985-01-01

    As a candidate for the on-site subcriticality-monitoring method, a new time-domain correlation experiment is proposed. Hinted by the Cf-252 detector method of Mihalczo, three covariances are taken between the count of three detectors; namely an ionization chamber with Cf-252 coating, and two He-3 proportional counters. A ratio Q is formed from the three quantities such that it does not depend either on detector efficiencies or counting gate duration T, and then related to reactivity. A formulation is given deriving a theoretical expression for this Q, with the effect of higher spatial modes included. Experiments were carried out with a loading at Tank-type Critical Assembly of Japan Atomic Energy Research Institute, which is a slightly-enriched, and light-water moderated system. With fundamental mode approximation adopted in the data processing, reasonable agreements are observed between the present method and the reactivity scale that has been calibrated by water-level variety. The possibility of the present method is to be investigated further beyond the range of 7$ reported

  17. Id-1 is not expressed in the luminal epithelial cells of mammary glands

    International Nuclear Information System (INIS)

    Uehara, Norihisa; Chou, Yu-Chien; Galvez, Jose J; Candia, Paola de; Cardiff, Robert D; Benezra, Robert; Shyamala, Gopalan

    2003-01-01

    The family of inhibitor of differentiation/DNA binding (Id) proteins is known to regulate development in several tissues. One member of this gene family, Id-1, has been implicated in mammary development and carcinogenesis. Mammary glands contain various cell types, among which the luminal epithelial cells are primarily targeted for proliferation, differentiation and carcinogenesis. Therefore, to assess the precise significance of Id-1 in mammary biology and carcinogenesis, we examined its cellular localization in vivo using immunohistochemistry. Extracts of whole mammary glands from wild type and Id-1 null mutant mice, and tissue sections from paraffin-embedded mouse mammary glands from various developmental stages and normal human breast were subjected to immunoblot and immunohistochemical analyses, respectively. In both these procedures, an anti-Id-1 rabbit polyclonal antibody was used for detection of Id-1. In immunoblot analyses, using whole mammary gland extracts, Id-1 was detected. In immunohistochemical analyses, however, Id-1 was not detected in the luminal epithelial cells of mammary glands during any stage of development, but it was detected in vascular endothelial cells. Id-1 is not expressed in the luminal epithelial cells of mammary glands

  18. ID Barrel installed in cryostat

    CERN Multimedia

    Apsimon, R.; Romaniouk, A.

    Wednesday 23rd August was a memorable day for the Inner Detector community as they witnessed the transport and installation of the central part of the inner detector (ID-barrel) into the ATLAS detector. Many members of the collaboration gathered to witness this moment at Point 1. After years of design, construction and commissioning, the outer two detectors (TRT and SCT) of the ID barrel were moved from the SR1 cleanroom to the ATLAS cavern. The barrel was moved across the car park from building 2175 to SX1. Although only a journey of about 100 metres, this required weeks of planning and some degree of luck as far as the weather was concerned. Accelerometers were fitted to the barrel to provide real-time monitoring and no values greater than 0.1 g were recorded, fully satisfying the transport specification for this extremely precise and fragile detector. Muriel, despite her fear of heights, bravely volunteered to keep a close eye on the detector. Swapping cranes to cross the entire parking lot, while Mur...

  19. 48 CFR 252.237-7007 - Termination for default.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Termination for default... of Provisions And Clauses 252.237-7007 Termination for default. As prescribed in 237.7003(b), use the following clause: Termination for Default (DEC 1991) (a) This clause supplements and is in addition to the...

  20. 48 CFR 252.227-7005 - License term.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term. 252.227-7005..., DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And... referred to in the “License Grant” clause of this contract and any and all patents hereafter issued on...

  1. The Implications of the Excited Rotation of Comet 252P/2000 G1 (LINEAR)

    Science.gov (United States)

    Li, Jian-Yang; Samarasinha, Nalin H.; Kelley, Michael S. P.; Farnocchia, Davide; Mutchler, Max J.; Ren, Yanqiong; Lu, Xiaoping; Tholen, David J.; Lister, Tim; Micheli, Marco

    2018-01-01

    Jupiter Family comet (JFC) 252P/LINEAR had a close encounter to Earth on 2016 March 21. We imaged the comet with the Hubble Space Telescope Wide Field Camera 3 UVIS channel through the V- and r’-band filters spanning ~8 hours on 2016 April 4. The pixel scale of 2.7 km/pixel allowed us to study the structure of the cometary coma at scales of a few kilometers to a few hundred kilometers from the nucleus, a characteristic that is unique to our data. The dust coma of 252P showed a strong, well defined, narrow and nearly linear feature in the sunward direction, and its projected position angle moved about the nucleus for ~60 deg in 8 hours, consistent with an apparent periodicity of ~7.24 hours. On the other hand, the lightcurve measured in both V- and r’-band images from a 13 km radius aperture, after corrected for color term, showed a variability of >0.14 mag that is consistent with an apparent periodicity of ~5.4 hours or its multiples. We suggest that the two different periodicities derived from coma morphology and the lightcurve is a strong indication that the nucleus of 252P is in a non-principal axis (NPA) rotation, joining two other confirmed NPA rotators (1P/Halley and 103P/Hartley 2) and comets that are potentially in NPA rotational states (e.g., 2P/Encke). However, this apparition has been unusual for 252P. In the past three perihelion passages since discovery, the comet was very weakly active compared to other JFCs. Meteor evidence also exists that it probably has been very weakly active for a few hundred years. But in our data, we saw a very active comet in this 2016 apparition with an active fraction of 40% to >100%, representing an increase of 100x with respect to its recent past. Based on our observations, 252P has a small nucleus with a radius of ~0.3 km, which suggests that its rotational state could be relatively easily changed by torques caused by outgassing. Since the very weak outgassing in the past is not likely to change the rotational state

  2. idRHa+ProMod - Rail Hardening Control System

    International Nuclear Information System (INIS)

    Ferro, L

    2016-01-01

    idRHa+ProMod is the process control system developed by Primetals Technologies to foresee the thermo-mechanical evolution and micro-structural composition of rail steels subjected to slack quenching into idRHa+ Rail Hardening equipments in a simulation environment. This tool can be used both off-line or in-line, giving the user the chance to test and study the best cooling strategies or letting the automatic control system free to adjust the proper cooling recipe. Optimization criteria have been tailored in order to determine the best cooling conditions according to the metallurgical requirements imposed by the main rail standards and also taking into account the elastoplastic bending phenomena occurring during all stages of the head hardening process. The computational core of idRHa+ProMod is a thermal finite element procedure coupled with special algorithms developed to work out the main thermo-physical properties of steel, to predict the non-isothermal austenite decomposition into all the relevant phases and subsequently to evaluate the amount of latent heat of transformation released, the compound thermal expansion coefficient and the amount of plastic deformation in the material. Air mist and air blades boundary conditions have been carefully investigated by means of pilot plant tests aimed to study the jet impingement on rail surfaces and the cooling efficiency at all working conditions. Heat transfer coefficients have been further checked and adjusted directly on field during commissioning. idRHa+ is a trademark of Primetals Technologies Italy Srl (paper)

  3. idRHa+ProMod - Rail Hardening Control System

    Science.gov (United States)

    Ferro, L.

    2016-03-01

    idRHa+ProMod is the process control system developed by Primetals Technologies to foresee the thermo-mechanical evolution and micro-structural composition of rail steels subjected to slack quenching into idRHa+ Rail Hardening equipments in a simulation environment. This tool can be used both off-line or in-line, giving the user the chance to test and study the best cooling strategies or letting the automatic control system free to adjust the proper cooling recipe. Optimization criteria have been tailored in order to determine the best cooling conditions according to the metallurgical requirements imposed by the main rail standards and also taking into account the elastoplastic bending phenomena occurring during all stages of the head hardening process. The computational core of idRHa+ProMod is a thermal finite element procedure coupled with special algorithms developed to work out the main thermo-physical properties of steel, to predict the non-isothermal austenite decomposition into all the relevant phases and subsequently to evaluate the amount of latent heat of transformation released, the compound thermal expansion coefficient and the amount of plastic deformation in the material. Air mist and air blades boundary conditions have been carefully investigated by means of pilot plant tests aimed to study the jet impingement on rail surfaces and the cooling efficiency at all working conditions. Heat transfer coefficients have been further checked and adjusted directly on field during commissioning. idRHa+ is a trademark of Primetals Technologies Italy Srl

  4. Internal validation of the RapidHIT® ID system.

    Science.gov (United States)

    Wiley, Rachel; Sage, Kelly; LaRue, Bobby; Budowle, Bruce

    2017-11-01

    Traditionally, forensic DNA analysis has required highly skilled forensic geneticists in a dedicated laboratory to generate short tandem repeat (STR) profiles. STR profiles are routinely used either to associate or exclude potential donors of forensic biological evidence. The typing of forensic reference samples has become more demanding, especially with the requirement in some jurisdictions to DNA profile arrestees. The Rapid DNA (RDNA) platform, the RapidHIT ® ID (IntegenX ® , Pleasanton, CA), is a fully automated system capable of processing reference samples in approximately 90min with minimal human intervention. Thus, the RapidHIT ID instrument can be deployed to non-laboratory environments (e.g., booking stations) and run by trained atypical personnel such as law enforcement. In order to implement the RapidHIT ID platform, validation studies are needed to define the performance and limitations of the system. Internal validation studies were undertaken with four early-production RapidHIT ID units. Reliable and concordant STR profiles were obtained from reference buccal swabs. Throughout the study, no contamination was observed. The overall first-pass success rate with an "expert-like system" was 72%, which is comparable to another current RDNA platform commercially available. The system's second-pass success rate (involving manual interpretation on first-pass inconclusive results) increased to 90%. Inhibitors (i.e., coffee, smoking tobacco, and chewing tobacco) did not appear to affect typing by the instrument system; however, substrate (i.e., swab type) did impact typing success. Additionally, one desirable feature not available with other Rapid systems is that in the event of a system failed run, a swab can be recovered and subsequently re-analyzed in a new sample cartridge. Therefore, rarely should additional sampling or swab consumption be necessary. The RapidHIT ID system is a robust and reliable tool capable of generating complete STR profiles within

  5. Shielding experiments in different materials with 252Cf neutron spectra

    International Nuclear Information System (INIS)

    Sathian, Deepa; Marathe, P.K.; Pal, Rupali; Jayalakshmi, V.; Chourasiya, G.; Mayya, Y.S.

    2008-01-01

    Adequate shielding for neutron sources can be determined using analytical method or by actually measuring the attenuation for the target configuration. This paper describes the measurement of Half Value Thickness (HVT), Tenth Value Thickness (TVT), Σ values for four different shielding materials, using a standard 252 Cf neutron source and comparing with the values calculated using an empirical relationship. BF 3 based REM-counter is used for measurement of neutron dose equivalent, against different thickness of the shielding material. The experimental HVT and S values are in good agreement with the calculated values. From this study, it is concluded that, among the four materials studied, high density polyethylene (HDPE) is best suitable for the shielding of a 252 Cf neutron source. (author)

  6. Implementation of 252Cf-source-driven power spectrum density measurement system

    International Nuclear Information System (INIS)

    Ren Yong; Wei Biao; Feng Peng; Li Jiansheng; Ye Cenming

    2012-01-01

    The principle of 252 Cf-source-driven power spectrum density measurement method is introduced. A measurement system and platform is realized accordingly, which is a combination of hardware and software, for measuring nuclear parameters. The detection method of neutron pulses based on an ultra-high-speed data acquisition card (three channels, 1 GHz sampling rate, 1 ns synchronization) is described, and the data processing process and the power spectrum density algorithm on PC are designed. This 252 Cf-source-driven power spectrum density measurement system can effectively obtain the nuclear tag parameters of nuclear random processes, such as correlation function and power spectrum density. (authors)

  7. In situ prompt gamma-ray activation analysis of water pollutants using a shallow 252Cf-HPGe probe

    International Nuclear Information System (INIS)

    Chung Chien; Tseng Tzucheng

    1988-01-01

    A shallow 252 Cf-HPGe probe used for in situ prompt γ-ray activation of water pollutants is described. A 2.7 μg 252 Cf neutron source and a 10% HPGe detector are inserted into a waterproof stainless steel probe, which is designed to be submerged and recovered in field operation. A laboratory test is performed to obtain the neutron flux distribution and prompt γ-ray contribution to the HPGe detector counts from around the submerged probe. The concentrations of toxic cadmium and chlorine in water are determined in the prompt γ-ray spectrum. The detection limit of industrial pollutants and some improvements of the current design are discussed. (orig.)

  8. Id3 induces an Elk-1–caspase-8-dependent apoptotic pathway in squamous carcinoma cells

    International Nuclear Information System (INIS)

    Chen, You-Shin; Aubee, Joseph; DiVito, Kyle A; Zhou, Hengbo; Zhang, Weiyi; Chou, Fen-Pi; Simbulan-Rosenthal, Cynthia M; Rosenthal, Dean S

    2015-01-01

    Inhibitor of differentiation/DNA-binding (Id) proteins are helix–loop–helix (HLH) transcription factors. The Id protein family (Id1–Id4) mediates tissue homeostasis by regulating cellular processes including differentiation, proliferation, and apoptosis. Ids typically function as dominant negative HLH proteins, which bind other HLH proteins and sequester them away from DNA promoter regions. Previously, we have found that Id3 induced apoptosis in immortalized human keratinocytes upon UVB exposure, consistent with its role as a tumor suppressor. To investigate the role of Id3 in malignant squamous cell carcinoma (SCC) cells (A431), a tetracycline-regulated inducible system was used to induce Id3 in cell culture and mouse xenograft models. We found that upon Id3 induction, there was a decrease in cell number under low serum conditions, as well as in soft agar. Microarray, RT-PCR, immunoblot, siRNA, and inhibitor studies revealed that Id3 induced expression of Elk-1, an E-twenty-six (ETS)-domain transcription factor, inducing procaspase-8 expression and activation. Id3 deletion mutants revealed that 80 C-terminal amino acids, including the HLH, are important for Id3-induced apoptosis. In a mouse xenograft model, Id3 induction decreased tumor size by 30%. Using immunofluorescent analysis, we determined that the tumor size decrease was also mediated through apoptosis. Furthermore, we show that Id3 synergizes with 5-FU and cisplatin therapies for nonmelanoma skin cancer cells. Our studies have shown a molecular mechanism by which Id3 induces apoptosis in SCC, and this information can potentially be used to develop new treatments for SCC patients

  9. A new facility for non-destructive assay using a 252Cf source.

    Science.gov (United States)

    Stevanato, L; Caldogno, M; Dima, R; Fabris, D; Hao, Xin; Lunardon, M; Moretto, S; Nebbia, G; Pesente, S; Pino, F; Sajo-Bohus, L; Viesti, G

    2013-03-01

    A new laboratory facility for non-destructive analysis (NDA) using a time-tagged (252)Cf source is presented. The system is designed to analyze samples having maximum size of about 20 × 25 cm(2), the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Study of the shielding for spontaneous fission sources of Californium-252; Estudio de blindaje para fuentes de fision espontanea de Californio-252

    Energy Technology Data Exchange (ETDEWEB)

    Davila R, I

    1991-06-15

    A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)

  11. Bio-fortification and shelf-life extension of idli batter using curry leaves (Murraya koenigii).

    Science.gov (United States)

    Chelliah, R; Ramakrishnan, S R; Premkumar, D; Antony, U

    2016-06-01

    Among several traditional foods of India, idli is one of the most popular and commonly consumed steamed products. A new method of adding Murraya koenigii (curry leaves) to idli batter as a vehicle for fortification and extension of shelf-life has been developed. Dried curry leaves powder was incorporated with other ingredients like rice and dehusked black gram in different proportions to optimize the most palatable formulation. Rate of fermentation and microbial changes in the batter; nutritional qualities, texture and sensory properties of the prepared product were assessed. Incorporation of curry leaves powder (5 %) in idli batter increased the shelf-life and also increased the flavour, texture and appearance of the idli. The calcium content of the prepared idli was 10 times more than that of the control idli, while dietary fiber content increased by 18.6 %. Anti-microbial activity of the curry leaves in idli batter extended the shelf-life from 2 to 5 days when stored at 30 °C.

  12. To ID or Not to ID? Changes in Classification Rates of Intellectual Disability Using "DSM-5"

    Science.gov (United States)

    Papazoglou, Aimilia; Jacobson, Lisa A.; McCabe, Marie; Kaufmann, Walter; Zabel, T. Andrew

    2014-01-01

    The "Diagnostic and Statistical Manual of Mental Disorders-Fifth Edition" ("DSM-5") diagnostic criteria for intellectual disability (ID) include a change to the definition of adaptive impairment. New criteria require impairment in one adaptive domain rather than two or more skill areas. The authors examined the diagnostic…

  13. Clinical accuracy of a PLEX-ID flu device for simultaneous detection and identification of influenza viruses A and B.

    Science.gov (United States)

    Tang, Yi-Wei; Lowery, Kristin S; Valsamakis, Alexandra; Schaefer, Virginia C; Chappell, James D; White-Abell, Jill; Quinn, Criziel D; Li, Haijing; Washington, Cicely A; Cromwell, Jenna; Giamanco, Chantel M; Forman, Michael; Holden, Jeffery; Rothman, Richard E; Parker, Michelle L; Ortenberg, Elaine V; Zhang, Lei; Lin, Yea-Lin; Gaydos, Charlotte A

    2013-01-01

    Respiratory tract infections caused by influenza A and B viruses often present nonspecifically, and a rapid, high-throughput laboratory technique that can identify influenza viruses is clinically and epidemiologically desirable. The PLEX-ID Flu assay (Abbott Molecular Inc., Des Plaines, IL) incorporates multilocus PCR and electrospray ionization-mass spectrometry to detect and differentiate influenza A 2009 H1N1 (H1N1-p), seasonal H1N1 (H1N1-s), influenza A H3N2, and influenza B viruses in nasopharyngeal swab (NPS) specimens. The clinical performance characteristics of the PLEX-ID Flu assay in symptomatic patients were determined in this multicenter trial. A total of 2,617 prospectively and retrospectively collected NPS specimens from patients with influenza-like illness between February 2008 and 28 May 2010 were eligible for inclusion in the study. Each specimen was tested in parallel by the PLEX-ID Flu assay and by the Prodesse ProFLU+ assay (Prodesse Inc., Madison, WI), to detect influenza A and B viruses. Specimens testing positive for influenza A virus by ProFLU+ were subtyped as H1N1-p, H1N1-s, or H3N2 by using the ProFAST+ assay (Gen-Probe Prodesse Inc.). The reproducibility of the PLEX-ID Flu assay ranged from 98.3 to 100.0%, as determined by testing a nine-specimen panel at three clinical sites on each of 5 days. Positive percent agreements (PPAs) and negative percent agreements (NPAs) of the PLEX-ID Flu assay were 94.5% and 99.0% for influenza A virus and 96.0% and 99.9% for influenza B virus, respectively. For the influenza A virus subtyping characterization, the PLEX-ID Flu assay had PPAs and NPAs of 98.3% and 97.5% for H1N1-p, 88.6% and 100.0% for H1N1-s, and 98.0% and 99.9% for H3N2, respectively. The overall agreements between the PLEX-ID and Prodesse ProFLU+/ProFAST+ assays were 97.1 to 100.0%. Bidirectional Sanger sequencing analysis revealed that 87.5% of 96 discrepant results between the PLEX-ID Flu and ProFLU+/ProFAST+ assays were found upon

  14. Use of polyethylene pellets in the design and construction of a storage safe, a transport vessel and a portable shield for californium-252

    International Nuclear Information System (INIS)

    Sharma, S.

    1986-01-01

    A storage and shielding facility for 300 μg of Californium-252 sources was designed and constructed. Though the safe was in a permanent location, the fact that it consisted of a lead bucket surrounded by polyethylene pellets made it simple, movable and inexpensive. If need be, more quantities of Cf-252 could be added without altering the basic design and sacrificing the radiation protection guidelines. The measured radiation levels from 300 μg of stored Cf-252 in and around the storage vault were lower than the expected dose rates by a factor of 5. The measured radiation levels around the occupied environs of the facility were below the maximum permissible yearly dose of 500mrem for non-occupational workers. A transport vessel was designed and constructed to carry up to 50 μg of Californium-252 sources. It consisted of a standard 55 gallon steel drum on casters containing cylindrical lead shield surrounded by polyethylene pellets. The measured maximum surface dose rates on the drum and at one meter away were within the radiation protection guidelines and were less than the expected dose rates. A portable shield was designed and constructed to protect the body in afterloading operations and handling of the sources. It consisted of polyethylene pellets in an aluminum box and an attached 10 cm thick plexiglass eye shield. The simple design, with the ease of using polyethylene pellets can be extended to construct bedside shields

  15. 30 CFR 250.252 - What environmental monitoring information must accompany the DPP or DOCD?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What environmental monitoring information must accompany the DPP or DOCD? 250.252 Section 250.252 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT... incidental take of marine mammals as may be necessary under the MMPA. (c) Flower Garden Banks National Marine...

  16. A Plan to Optimize the Management of Weld ID SSN Numbering System for Nuclear Power Plants in Korea

    International Nuclear Information System (INIS)

    Yoo, Hyun Ju; Cho, Chan Hee; Kim, Jin Hoi; Park, Dong Min

    2016-01-01

    Summary Sheet Number(SSN) in the current LTP is an ID which means a weldment in a nuclear power plant. However, the SSN ID, which is unique on in a nuclear power plant, is not unique one if the weldments of entire nuclear power plant in Korea are treated in one system. Therefore, it is hard to manage the data during life time using the existing SSN ID system. It is also hard to configure the characteristics of weldment in mind because IDs implying Alloy600 and overlay weld do not exist in the existing SSN ID System. An optimized SSN numbering system managing weldments for the life time is introduced in this paper. Moreover, it is explained how to manage the SSN numbering system in the computer program system, too. The problem, which the weld is not harmoniously managed, would be solved provided adapting the new SSN ID introduced in this paper. A weld is managed during its life time from creation to extinction. The inquiry of inspection history of a concerned weld and the reference of statistics would be performed easily and rightly because the concerned weld can be accessed from anywhere connected to KHNP network such as KHNP headquater, plants and CRI

  17. NAA using Cf-252 after preconcentration

    International Nuclear Information System (INIS)

    Panyo, O.; Moebius, S.; Keller, C.

    1988-01-01

    Neutron activation analysis (NAA) with thermal neutron using Cf-252 sources was applied to elemental analysis of elements in water samples. A high-resolution Ge(Li) detector was employed for gamma-radiation detection. Both suspended particulate matter and liquid fraction were investigated after filtration. Preconcentration method by co-precipitation using iron (III) hydroxide and oxine were chosen for use. Elements which were considered to be able to detect in the present study are Al, As, Cl, K, Mg, Mn, Na, Sr, Ti, U, V and Zn

  18. 8 CFR 252.5 - Special procedures for deserters from Spanish or Greek ships of war.

    Science.gov (United States)

    2010-01-01

    ... Spanish or Greek ships of war. 252.5 Section 252.5 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY... Greek ships of war. (a) General. Under E.O. 11267 of January 19, 1966 (31 FR 807) and 28 CFR 0.109, and... a ship of war of that government, while in any port of the United States, and on proof by the...

  19. Idaho National Laboratory Supervisory Control and Data Acquisition Intrusion Detection System (SCADA IDS)

    Energy Technology Data Exchange (ETDEWEB)

    Jared Verba; Michael Milvich

    2008-05-01

    Current Intrusion Detection System (IDS) technology is not suited to be widely deployed inside a Supervisory, Control and Data Acquisition (SCADA) environment. Anomaly- and signature-based IDS technologies have developed methods to cover information technology-based networks activity and protocols effectively. However, these IDS technologies do not include the fine protocol granularity required to ensure network security inside an environment with weak protocols lacking authentication and encryption. By implementing a more specific and more intelligent packet inspection mechanism, tailored traffic flow analysis, and unique packet tampering detection, IDS technology developed specifically for SCADA environments can be deployed with confidence in detecting malicious activity.

  20. Efficacy of brachytherapy with californium-252 neutrons versus cesium-137 photons for eradication of bulky localized cervical cancer: single-institution study

    International Nuclear Information System (INIS)

    Maruyama, Y.; van Nagell, J.R.; Yoneda, J.; Donaldson, E.; Gallion, H.; Higgins, R.; Powell, D.; Turner, C.; Kryscio, R.

    1988-01-01

    A fast-neutron-emitting radioisotope, 252 Cf, is being tested in clinical trials of neutron brachytherapy for cervical cancer. The efficacy for histological eradication of bulky stage IB cervical tumors (mean diameter, approximately 6 cm) using combined radiation and surgery was studied in 65 patients treated with 137 Cs or 252 Cf before surgery during 1983-1986. Forty-four patients were treated with 137 Cs and 21 were treated with 252 Cf at equivalent doses of radiation. Fifteen of the 44 specimens (34%) were positive after 137Cs therapy. Only one of the 21 specimens was positive after 252 Cf therapy (P = .025), and that patient was treated in a delayed schedule 21 days after the start of external-beam irradiation rather than early in the course. 252 Cf therapy required a much lower radiation dose and shorter treatment time. The study compared tumor destruction of an identically staged human cervical tumor in situ by direct histological means, using 252 Cf neutron therapy or conventional photon therapy at an identical and equivalent dose adjusted by a relative biological effectiveness of 6.0 for 252 Cf

  1. 48 CFR 252.225-7041 - Correspondence in English.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Correspondence in English... of Provisions And Clauses 252.225-7041 Correspondence in English. As prescribed in 225.1103(2), use the following clause: Correspondence in English (JUN 1997) The Contractor shall ensure that all...

  2. 48 CFR 252.229-7002 - Customs exemptions (Germany).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Customs exemptions... of Provisions And Clauses 252.229-7002 Customs exemptions (Germany). As prescribed in 229.402-70(b), use the following clause: Customs Exemptions (Germany) (JUN 1997) Imported products required for the...

  3. Effective source size as related to 252Cf neutron radiography

    International Nuclear Information System (INIS)

    Wada, Nobuo; Enomoto, Shigemasa; Tachikawa, Noboru; Nojiri, Toshiaki.

    1977-01-01

    The effective source size in 252 Cf thermal neutron radiography, relating to its geometrical unsharpness in image formation, is experimentally studied. A neutron radiographic system consists of a 160 μg 252 Cf neutron source, water moderator and divergent cadmium lined collimator. Thermal neutron image detection is performed with using a LiF scintillator and a high speed X-ray film to employ direct exposure method. The modulation transfer function, used for describing image quality, is derived from radiographic image corresponding to a cadmium plate with sharp edge. The modulation transfer function for the system is expressed by the product of the function for both geometrical and inherent unsharpness, and allows isolation of geometrical unsharpness as related to the effective size of the thermal neutron source. It is found to be 80 -- 90% of the collimator inlet diameter. (auth.)

  4. Extending the Intermediate Data Structure (IDS for longitudinal historical databases to include geographic data

    Directory of Open Access Journals (Sweden)

    Finn Hedefalk

    2014-09-01

    Full Text Available The Intermediate Data Structure (IDS is a standardised database structure for longitudinal historical databases. Such a common structure facilitates data sharing and comparative research. In this study, we propose an extended version of IDS, named IDS-Geo, that also includes geographic data. The geographic data that will be stored in IDS-Geo are primarily buildings and/or property units, and the purpose of these geographic data is mainly to link individuals to places in space. When we want to assign such detailed spatial locations to individuals (in times before there were any detailed house addresses available, we often have to create tailored geographic datasets. In those cases, there are benefits of storing geographic data in the same structure as the demographic data. Moreover, we propose the export of data from IDS-Geo using an eXtensible Markup Language (XML Schema. IDS-Geo is implemented in a case study using historical property units, for the period 1804 to 1913, stored in a geographically extended version of the Scanian Economic Demographic Database (SEDD. To fit into the IDS-Geo data structure, we included an object lifeline representation of all of the property units (based on the snapshot time representation of single historical maps and poll-tax registers. The case study verifies that the IDS-Geo model is capable of handling geographic data that can be linked to demographic data.

  5. ACE I/D genotype, adiposity, and blood pressure in children

    Directory of Open Access Journals (Sweden)

    Rothschild Max

    2009-03-01

    Full Text Available Abstract Background Angiotensin converting enzyme (ACE is a possible candidate gene that may influence both body fatness and blood pressure. Although several genetic studies have been conducted in adults, relatively few studies have examined the contribution of potential candidate genes, and specifically ACE I/D, on adiposity and BP phenotypes in childhood. Such studies may prove insightful for the development of the obesity-hypertension phenotype early in life. The purpose of this study was to examine differences in body fatness and resting blood pressure (BP by ACE I/D genotype, and determine if the association between adiposity and BP varies by ACE I/D genotype in children. Methods 152 children (75 girls, 77 boys were assessed for body composition (% body fat using dual energy x-ray absorbtiometry and resting BP according to American Heart Association recommendations. Buccal cell samples were genotyped using newly developed PCR-RFLP tests for two SNPs (rs4341 and rs4343 in complete linkage disequilibrium with the ACE I/D polymorphism. Partial correlations were computed to assess the ociations between % body fat and BP in the total sample and by genotype. ANCOVA was used to examine differences in resting BP by ACE I/D genotype and fatness groups. Results Approximately 39% of youth were overfat based on % body fat (>30% fat in girls, 25% fat in boys. Body mass, body mass index, and fat-free mass were significantly higher in the ACE D-carriers compared to the II group (p Conclusion ACE D-carriers are heavier than ACE II children; however, BP did not differ by ACE I/D genotype but was adversely influenced in the overfat D-carriers. Further studies are warranted to investigate the genetics of fatness and BP phenotypes in children.

  6. Muon Identification performance: hadron mis-Id measurements and RPC Muon selections

    CERN Document Server

    CMS Collaboration

    2014-01-01

    Pion, kaon, proton mis-identification probabilities as muons have been measured for different Muon ID algorithms. Results from two independent analyses are presented. The performance of a new muon ID algorithm based on matching of inner tracks with hits in muon RPC chambers is also presented.

  7. Characteristics of polyethylene-moderated 252Cf neutron sources

    International Nuclear Information System (INIS)

    Alejnikov, V.E.; Beskrovnaya, L.G.; Florko, B.V.

    2000-01-01

    Polyethylene-moderated 252 Cf neutron sources were designed to produce neutron reference fields' spectra that simulate the spectra observed in the workplaces within nuclear reactors and accelerators. The paper describes the neutron sources and fields. Neutron spectra were calculated by Monte Carlo method and compared with experimental data

  8. Evaluation of the iPLEX(®) Sample ID Plus Panel designed for the Sequenom MassARRAY(®) system. A SNP typing assay developed for human identification and sample tracking based on the SNPforID panel

    DEFF Research Database (Denmark)

    Johansen, P; Andersen, J D; Børsting, Claus

    2013-01-01

    on the peak height and the signal to noise data exported from the TYPER 4.0 software. With the forensic analysis parameters, all inconsistencies were eliminated in reactions with ≥10ng DNA. However, the average call rate decreased to 69.9%. The iPLEX(®) Sample ID Plus Panel was tested on 10 degraded samples......Sequenom launched the first commercial SNP typing kit for human identification, named the iPLEX(®) Sample ID Plus Panel. The kit amplifies 47 of the 52 SNPs in the SNPforID panel, amelogenin and two Y-chromosome SNPs in one multiplex PCR. The SNPs were analyzed by single base extension (SBE......) and Matrix Assisted Laser Desorption/Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS). In this study, we evaluated the accuracy and sensitivity of the iPLEX(®) Sample ID Plus Panel by comparing the typing results of the iPLEX(®) Sample ID Plus Panel with those obtained with our ISO 17025 accredited...

  9. Health physics aspects of 252Cf

    International Nuclear Information System (INIS)

    Bhagwat, A.M.

    1974-01-01

    After briefly describing the methods of production, radioactive, chemical and biological properties of californium-252, its health physics aspects are reviewed in detail. Its external and internal radiation hazards can be minimised through control of radiation and contamination and proper shield design. Use of various shielding materials is evaluated. The following aspects are also discussed : (1) radiation detectors for neutrons and gamma radiation (2) personnel monitoring techniques (3) bioassay and (4) storage and transportation. (M.G.B.)

  10. 78 FR 65555 - Establishment of Class E Airspace; Salmon, ID

    Science.gov (United States)

    2013-11-01

    ...-0531; Airspace Docket No. 13-ANM-20] Establishment of Class E Airspace; Salmon, ID AGENCY: Federal... at the Salmon VHF Omni-Directional Radio Range/Distance Measuring Equipment (VOR/DME) navigation aid, Salmon, ID, to facilitate vectoring of Instrument Flight Rules (IFR) aircraft under control of Salt Lake...

  11. 48 CFR 252.227-7006 - License grant-running royalty.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License grant-running... of Provisions And Clauses 252.227-7006 License grant—running royalty. As prescribed at 227.7009-4(a...—Running Royalty (AUG 1984) (a) The Contractor hereby grants to the Government, as represented by the...

  12. 48 CFR 252.234-7002 - Earned Value Management System.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Earned Value Management... of Provisions And Clauses 252.234-7002 Earned Value Management System. As prescribed in 234.203(2), use the following clause: Earned Value Management System (APR 2008) (a) In the performance of this...

  13. Calculation of dose distribution for 252Cf fission neutron source in tissue equivalent phantoms using Monte Carlo method

    International Nuclear Information System (INIS)

    Ji Gang; Guo Yong; Luo Yisheng; Zhang Wenzhong

    2001-01-01

    Objective: To provide useful parameters for neutron radiotherapy, the author presents results of a Monte Carlo simulation study investigating the dosimetric characteristics of linear 252 Cf fission neutron sources. Methods: A 252 Cf fission source and tissue equivalent phantom were modeled. The dose of neutron and gamma radiations were calculated using Monte Carlo Code. Results: The dose of neutron and gamma at several positions for 252 Cf in the phantom made of equivalent materials to water, blood, muscle, skin, bone and lung were calculated. Conclusion: The results by Monte Carlo methods were compared with the data by measurement and references. According to the calculation, the method using water phantom to simulate local tissues such as muscle, blood and skin is reasonable for the calculation and measurements of dose distribution for 252 Cf

  14. OpenID connect as a security service in Cloud-based diagnostic imaging systems

    Science.gov (United States)

    Ma, Weina; Sartipi, Kamran; Sharghi, Hassan; Koff, David; Bak, Peter

    2015-03-01

    The evolution of cloud computing is driving the next generation of diagnostic imaging (DI) systems. Cloud-based DI systems are able to deliver better services to patients without constraining to their own physical facilities. However, privacy and security concerns have been consistently regarded as the major obstacle for adoption of cloud computing by healthcare domains. Furthermore, traditional computing models and interfaces employed by DI systems are not ready for accessing diagnostic images through mobile devices. RESTful is an ideal technology for provisioning both mobile services and cloud computing. OpenID Connect, combining OpenID and OAuth together, is an emerging REST-based federated identity solution. It is one of the most perspective open standards to potentially become the de-facto standard for securing cloud computing and mobile applications, which has ever been regarded as "Kerberos of Cloud". We introduce OpenID Connect as an identity and authentication service in cloud-based DI systems and propose enhancements that allow for incorporating this technology within distributed enterprise environment. The objective of this study is to offer solutions for secure radiology image sharing among DI-r (Diagnostic Imaging Repository) and heterogeneous PACS (Picture Archiving and Communication Systems) as well as mobile clients in the cloud ecosystem. Through using OpenID Connect as an open-source identity and authentication service, deploying DI-r and PACS to private or community clouds should obtain equivalent security level to traditional computing model.

  15. Evaluation of mass distribution data from 252Cf spontaneous fission

    International Nuclear Information System (INIS)

    Liu Tingjin

    2003-01-01

    The mass distribution data of 252 Cf spontaneous fission were evaluated based on 7 sets of available experimental data. The measured data were corrected for the standards and γ intensity used by using the new evaluated ones. The errors were made necessary adjusting. The evaluated experimental data were fitted with spline function without any restriction and with symmetric restriction. These two sets of fit data were recommended as reference data of the mass distribution of 252 Cf spontaneous fission. The errors of the recommended data were considerably reduced comparing with the measured ones. The light and heavy peaks are not completely symmetric. Also there are fine structures on the right side of the light peak at A=109-111 and left side of the heavy peak at A=137-139. These should be paid attention and studied further. (author)

  16. Neutron activation analysis detection limits using 252Cf sources

    International Nuclear Information System (INIS)

    DiPrete, D.P.; Sigg, R.A.

    2000-01-01

    The Savannah River Technology Center (SRTC) developed a neutron activation analysis (NAA) facility several decades ago using low-flux 252 Cf neutron sources. Through this time, the facility has addressed areas of applied interest in managing the Savannah River Site (SRS). Some applications are unique because of the site's operating history and its chemical-processing facilities. Because sensitivity needs for many applications are not severe, they can be accomplished using an ∼6-mg 252 Cf NAA facility. The SRTC 252 Cf facility continues to support applied research programs at SRTC as well as other SRS programs for environmental and waste management customers. Samples analyzed by NAA include organic compounds, metal alloys, sediments, site process solutions, and many other materials. Numerous radiochemical analyses also rely on the facility for production of short-lived tracers, yielding by activation of carriers and small-scale isotope production for separation methods testing. These applications are more fully reviewed in Ref. 1. Although the flux [approximately2 x 10 7 n/cm 2 ·s] is low relative to reactor facilities, more than 40 elements can be detected at low and sub-part-per-million levels. Detection limits provided by the facility are adequate for many analytical projects. Other multielement analysis methods, particularly inductively coupled plasma atomic emission and inductively coupled plasma mass spectrometry, can now provide sensitivities on dissolved samples that are often better than those available by NAA using low-flux isotopic sources. Because NAA allows analysis of bulk samples, (a) it is a more cost-effective choice when its sensitivity is adequate than methods that require digestion and (b) it eliminates uncertainties that can be introduced by digestion processes

  17. 48 CFR 252.227-7020 - Rights in special works.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in special works... of Provisions And Clauses 252.227-7020 Rights in special works. As prescribed in 227.7105-3, 227.7106(a) or 227.7205(a), use the following clause: Rights in Special Works (JUN 1995) (a) Applicability...

  18. VLM Tool for IDS Integration

    Directory of Open Access Journals (Sweden)

    Cǎtǎlin NAE

    2010-03-01

    Full Text Available This paper is dedicated to a very specific type of analysis tool (VLM - Vortex Lattice Method to be integrated in a IDS - Integrated Design System, tailored for the usage of small aircraft industry. The major interest is to have the possibility to simulate at very low computational costs a preliminary set of aerodynamic characteristics for basic aerodynamic global characteristics (Lift, Drag, Pitching Moment and aerodynamic derivatives for longitudinal and lateral-directional stability analysis. This work enables fast investigations of the influence of configuration changes in a very efficient computational environment. Using experimental data and/or CFD information for a specific calibration of VLM method, reliability of the analysis may me increased so that a first type (iteration zero aerodynamic evaluation of the preliminary 3D configuration is possible. The output of this tool is basic state aerodynamic and associated stability and control derivatives, as well as a complete set of information on specific loads on major airframe components.The major interest in using and validating this type of methods is coming from the possibility to integrate it as a tool in an IDS system for conceptual design phase, as considered for development for CESAR project (IP, UE FP6.

  19. 48 CFR 252.227-7033 - Rights in shop drawings.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in shop drawings... of Provisions And Clauses 252.227-7033 Rights in shop drawings. As prescribed in 227.7107-(1)(c), use the following clause: Rights in Shop Drawings (APR 1966) (a) Shop drawings for construction means...

  20. Efficient coding and detection of ultra-long IDs for visible light positioning systems.

    Science.gov (United States)

    Zhang, Hualong; Yang, Chuanchuan

    2018-05-14

    Visible light positioning (VLP) is a promising technique to complement Global Navigation Satellite System (GNSS) such as Global positioning system (GPS) and BeiDou Navigation Satellite System (BDS) which features the advantage of low-cost and high accuracy. The situation becomes even more crucial for indoor environments, where satellite signals are weak or even unavailable. For large-scale application of VLP, there would be a considerable number of Light emitting diode (LED) IDs, which bring forward the demand of long LED ID detection. In particular, to provision indoor localization globally, a convenient way is to program a unique ID into each LED during manufacture. This poses a big challenge for image sensors, such as the CMOS camera in everybody's hands since the long ID covers the span of multiple frames. In this paper, we investigate the detection of ultra-long ID using rolling shutter cameras. By analyzing the pattern of data loss in each frame, we proposed a novel coding technique to improve the efficiency of LED ID detection. We studied the performance of Reed-Solomon (RS) code in this system and designed a new coding method which considered the trade-off between performance and decoding complexity. Coding technique decreases the number of frames needed in data processing, significantly reduces the detection time, and improves the accuracy of detection. Numerical and experimental results show that the detected LED ID can be much longer with the coding technique. Besides, our proposed coding method is proved to achieve a performance close to that of RS code while the decoding complexity is much lower.

  1. Cf-252 based neutron radiography using real-time image processing system

    International Nuclear Information System (INIS)

    Mochiki, Koh-ichi; Koiso, Manabu; Yamaji, Akihiro; Iwata, Hideki; Kihara, Yoshitaka; Sano, Shigeru; Murata, Yutaka

    2001-01-01

    For compact Cf-252 based neutron radiography, a real-time image processing system by particle counting technique has been developed. The electronic imaging system consists of a supersensitive imaging camera, a real-time corrector, a real-time binary converter, a real-time calculator for centroid, a display monitor and a computer. Three types of accumulated NR image; ordinary, binary and centroid images, can be observed during a measurement. Accumulated NR images were taken by the centroid mode, the binary mode and ordinary mode using of Cf-252 neutron source and those images were compared. The centroid mode presented the sharpest image and its statistical characteristics followed the Poisson distribution, while the ordinary mode showed the smoothest image as the averaging effect by particle bright spots with distributed brightness was most dominant. (author)

  2. ACE insertion/deletion (I/D) polymorphism and diabetic nephropathy.

    Science.gov (United States)

    Rahimi, Zohreh

    2012-10-01

    Angiotensin converting enzyme (ACE) gene encodes ACE, a key component of renin angiotensin system (RAS), plays an important role in blood pressure homeostasis by generating the vasoconstrictor peptide angiotensin II. Directory of Open Access Journals (DOAJ), Google Scholar, Pubmed (NLM), LISTA (EBSCO) and Web of Science have been searched. The presence of ACE insertion/deletion (I/D) polymorphism affects the plasma level of ACE. ACE DD genotype is associated with the highest systemic and renal ACE levels compared with the lowest ACE activity in carriers of II genotype. In this review focus has been performed on the study of ACE I/D polymorphism in various populations and its influence on the risk of onset and progression of diabetic nephropathy. Also, association between ACE I/D polymorphism and response to ACE inhibitor and angiotensin II receptor antagonists will be reviewed. Further, synergistic effect of this polymorphism and variants of some genes on the risk of development of diabetic nephropathy will be discussed.

  3. ID.alistic: identificatie met een touch voor de patiënt

    NARCIS (Netherlands)

    M. Wilschut; M. Zijlmans; Dr. L.S.G.L Wauben

    2017-01-01

    ID.alistic is een conceptuele patiëntidentificatie methode (middels een vingerafdrukscanner), ter vervanging van het polsbandjessysteem van het Albert Schweitzer ziekenhuis (ASz) dialysecentrum. Dit onderzoek bepaalt de implementeerbaarheid van ID.alistic binnen het dialysecentrum door

  4. Overexpression of inhibitor of DNA-binding (ID)-1 protein related to angiogenesis in tumor advancement of ovarian cancers

    International Nuclear Information System (INIS)

    Maw, Min Khine; Fujimoto, Jiro; Tamaya, Teruhiko

    2009-01-01

    The inhibitor of DNA-binding (ID) has been involved in cell cycle regulation, apoptosis and angiogenesis. This prompted us to study ID functions in tumor advancement of ovarian cancers. Sixty patients underwent surgery for ovarian cancers. In ovarian cancers, the levels of ID-1, ID-2 and ID-3 mRNAs were determined by real-time reverse transcription-polymerase chain reaction. The histoscore with the localization of ID-1 was determined by immunohistochemistry. Patient prognosis was analyzed with a 36-month survival rate. Microvessel counts were determined by immunohistochemistry for CD34 and factor VIII-related antigen. ID-1 histoscores and mRNA levels both significantly (p < 0.001) increased in ovarian cancers according to clinical stage, regardless of histopathological type. Furthermore, 30 patients with high ID-1 expression had a lower survival rate (53%) compared to patients with low ID-1 expression (80%). ID-1 histoscores and mRNA levels significantly (p < 0.0001) correlated with microvessel counts in ovarian cancers. ID-1 increased in ovarian cancer cells during tumor progression. Moreover, ID-1 expression levels correlated with microvessel counts. Therefore, ID-1 might work on tumor advancement via angiogenesis and is considered to be a candidate for a prognostic indicator in ovarian cancers

  5. 48 CFR 252.216-7000 - Economic price adjustment-basic steel, aluminum, brass, bronze, or copper mill products.

    Science.gov (United States)

    2010-10-01

    ...-basic steel, aluminum, brass, bronze, or copper mill products. 252.216-7000 Section 252.216-7000 Federal... adjustment—basic steel, aluminum, brass, bronze, or copper mill products. As prescribed in 216.203-4-70(a... Mill Products (JUL 1997) (a) Definitions. As used in this clause— Established price means a price which...

  6. 48 CFR 252.228-7001 - Ground and flight risk.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Ground and flight risk... of Provisions And Clauses 252.228-7001 Ground and flight risk. As prescribed in 228.370(b), use the following clause: Ground and Flight Risk (JUN 2010) (a) Definitions. As used in this clause— (1) Aircraft...

  7. Neutron emission during acceleration of 252Cf fission fragments

    International Nuclear Information System (INIS)

    Batenkov, O.I.; Blinov, M.V.; Blinov, A.B.; Smirnov, S.N.

    1991-01-01

    We investigate neutron emission during acceleration of fission fragments in the process of spontaneous fission of 252 Cf. Experimental angular and energy distributions of neutrons are compared with the results of calculations of neutron evaporation during fragment acceleration. (author). 8 refs, 3 figs

  8. Toward operation of series IDs at BL43LXU of SPring-8

    Energy Technology Data Exchange (ETDEWEB)

    Baron, A. Q. R.; Tanaka, T.; Soutome, K.; Takao, M.; Nakamura, T.; Kobayashi, K.; Fujita, T.; Takahashi, S.; Aoyagi, H.; Shimosaki, Y.; Seike, T.; Uchiyama, H.; Ishikawa, D.; Chuang, T.-H.; Kimura, H.; Tanaka, H.; Kitamura, H.; Ishikawa, T. [SPring-8, 1-1-1 Kouto, Sayo, Hyogo, 679 (Japan)

    2016-07-27

    This paper discusses two issues relating to using 3 small gap insertion devices in series at BL43LXU of SPring-8 to make a uniquely powerful source in the 15-26 keV region of the x-ray spectrum. The issues discussed are (1) damage to the covers of the downstream IDs by radiation from the upstream IDs and (2) proper steering of the electron beam to get the best photon beam properties. After tests in several configurations, including one where an ID was run without an impedance-reducing cover, the damage issue was solved by installing a distributed absorber in the most downstream ID. The steering issues were mostly resolved by the introduction of appropriate corrector magnets and feedback. The paper is written from the viewpoint of an interested beamline scientist impressed with the cooperation of different groups to make a source for new science possible.

  9. 48 CFR 252.225-7035 - Buy American Act-Free Trade Agreements-Balance of Payments Program Certificate.

    Science.gov (United States)

    2010-10-01

    ... Trade Agreements-Balance of Payments Program Certificate. 252.225-7035 Section 252.225-7035 Federal... Trade Agreements—Balance of Payments Program Certificate. As prescribed in 225.1101(10), use the following provision: Buy American Act—Free Trade Agreements—Balance of Payments Program Certificate (DEC...

  10. Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

    Energy Technology Data Exchange (ETDEWEB)

    Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

    1976-01-01

    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

  11. Mapping of Id locus for dermal shank melanin in a Chinese ...

    Indian Academy of Sciences (India)

    JIGUO XU

    2017-12-08

    Dec 8, 2017 ... Information on the SNPs used for the association analysis. ID. Position (galGal3) .... using Bio-Rad Manager software, and the data were nor- malized to the ..... This work was supported by the High Technology Research.

  12. Vibrational measurements in 3-ID-B

    International Nuclear Information System (INIS)

    Sutter, J.; Alp, E.; Barraza, J.; Shu, D.

    1998-04-01

    The authors have undertaken a series of vibrational measurements in hutch 3-ID-B. Their motivation was to compare two different methods of mounting an interferometer for effectiveness in vibrational isolation and stability. In addition they were able to compare the stability of the optical table with and without its eight large bolts inserted

  13. Assessment of the neutron component in a neutron-gamma field of a californium-252 source

    International Nuclear Information System (INIS)

    Tetteh, G.K.

    1978-12-01

    Experiments have been performed to determine the percentages of the different components in the radiation field of californium-252 which has now some clinical applications. Using Rossi Chambers in conjunction with absorption investigations involving lead and aluminium thimbles, it is observed that the dose rates due to the different components are: neutrons 54%; gammas 30%; betas 16%

  14. FDIC Institution Directory (ID) -- Insured Insitution Download File

    Data.gov (United States)

    Federal Deposit Insurance Corporation — The FDIC's Institution Directory (ID) download file provides a list of all FDIC-insured institutions. The file includes demographic information related to the...

  15. 78 FR 8596 - Hartford Financial Services Group, Inc., Commercial/Actuarial/ Information Delivery Services (IDS...

    Science.gov (United States)

    2013-02-06

    ... Services Group, Inc., Commercial/Actuarial/ Information Delivery Services (IDS)/Corporate & Financial... workers and former workers of Hartford Financial Services Group, Inc., Commercial/Actuarial/Information Delivery Services (IDS)/Corporate & Financial Reporting group, Hartford, Connecticut (The Hartford-IDS...

  16. Wicked ID: Conceptual Framework for Considering Instructional Design as a Wicked Problem

    Directory of Open Access Journals (Sweden)

    Katrin Becker

    2007-02-01

    Full Text Available The process of instructional design has parallels in other design disciplines. Software design is one that has experienced intense attention in the last 30 or so years, and many lessons learned there can be applied to ID. Using software design as a springboard, this concept paper seeks to propose a new approach to ID. It suggests that instructional design is almost always a Wicked Problem. The connection is formed between Wicked Problems as first described by Rittel and Webber in 1973, and the models in and processes of instructional design. The areas of social planning, organizational management and software design all posses some accepted and tested approaches to the solution of Wicked Problems. These will be described, and how they can be applied to ID will be explained. Finally, this paper will propose a meta-model for ID and explain how it can be used in the current context. Résumé : Le processus de conception pédagogique a des similitudes avec d’autres disciplines. La conception de logiciels a fait l’objet d’une grande attention dans les trente dernières années et de nombreuses leçons tirées peuvent s’appliquer à la conception pédagogique. En se basant sur la conception de logiciels, cet article cherche à proposer une nouvelle méthode à la conception pédagogique. Il laisse entendre que la conception pédagogique constitue presque toujours un problème épineux. Le lien est formé entre les problèmes épineux tels que décrits par Rittel et Webber en 1973 et les modèles et processus de la conception pédagogique. Les secteurs de l’organisation sociale, de la gestion des organisations et de la conception de logiciels comptent des méthodes acceptées et validées à la résolution de problèmes épineux. Nous les décrirons et expliquerons comment ils peuvent servir à la conception pédagogique. Enfin, l’article proposera un meta-modèle de la conception pédagogique et expliquera comment il peut servir dans le

  17. Medical applications of californium-252

    International Nuclear Information System (INIS)

    Oliver, G.D. Jr.

    1975-01-01

    Primarily, californium-252 sources have been utilized in medicine for the treatment of neoplastic lesions. For five years, a coordinated effort between several cancer research institutions and national laboratories has developed the necessary physics, radiobiology, and engineering skills to establish an evaluation program for californium. Several more years of combined effort are required before it is known whether californium therapy is as good as or better than conventional therapy with sources like radium. Recently, development of diagnostic applications of californium in medicine has received attention. Studies comparing neutron decay activation analysis versus prompt capture gamma ray analysis are in progress. A hopeful application of prompt analysis with reasonable quantities (200 μg) of californium is the elemental analysis of bone in the human body. (U.S.)

  18. Wnt/β-catenin signaling changes C2C12 myoblast proliferation and differentiation by inducing Id3 expression

    International Nuclear Information System (INIS)

    Zhang, Long; Shi, Songting; Zhang, Juan; Zhou, Fangfang; Dijke, Peter ten

    2012-01-01

    Highlights: ► Expression of Id3 but not Id1 is induced by Wnt3a stimulation in C2C12 cells. ► Wnt3a induces Id3 expression via canonical Wnt/β-catenin pathway. ► Wnt3a-induced Id3 expression does not depend on BMP signaling activation. ► Induction of Id3 expression is critical determinant in Wnt3a-induced cell proliferation and differentiation. -- Abstract: Canonical Wnt signaling plays important roles in regulating cell proliferation and differentiation. In this study, we report that inhibitor of differentiation (Id)3 is a Wnt-inducible gene in mouse C2C12 myoblasts. Wnt3a induced Id3 expression in a β-catenin-dependent manner. Bone morphogenetic protein (BMP) also potently induced Id3 expression. However, Wnt-induced Id3 expression occurred independent of the BMP/Smad pathway. Functional studies showed that Id3 depletion in C2C12 cells impaired Wnt3a-induced cell proliferation and alkaline phosphatase activity, an early marker of osteoblast cells. Id3 depletion elevated myogenin induction during myogenic differentiation and partially impaired Wnt3a suppressed myogenin expression in C2C12 cells. These results suggest that Id3 is an important Wnt/β-catenin induced gene in myoblast cell fate determination.

  19. ID'ing innate and innate-like lymphoid cells.

    Science.gov (United States)

    Verykokakis, Mihalis; Zook, Erin C; Kee, Barbara L

    2014-09-01

    The immune system can be divided into innate and adaptive components that differ in their rate and mode of cellular activation, with innate immune cells being the first responders to invading pathogens. Recent advances in the identification and characterization of innate lymphoid cells have revealed reiterative developmental programs that result in cells with effector fates that parallel those of adaptive lymphoid cells and are tailored to effectively eliminate a broad spectrum of pathogenic challenges. However, activation of these cells can also be associated with pathologies such as autoimmune disease. One major distinction between innate and adaptive immune system cells is the constitutive expression of ID proteins in the former and inducible expression in the latter. ID proteins function as antagonists of the E protein transcription factors that play critical roles in lymphoid specification as well as B- and T-lymphocyte development. In this review, we examine the transcriptional mechanisms controlling the development of innate lymphocytes, including natural killer cells and the recently identified innate lymphoid cells (ILC1, ILC2, and ILC3), and innate-like lymphocytes, including natural killer T cells, with an emphasis on the known requirements for the ID proteins. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Identity Management ToolKit (IdM TK)

    Data.gov (United States)

    Department of Veterans Affairs — With the IdM TK, authorized users can search and view identity and exception information from the Administrative Data Repository (ADR). Specifically, users can view...

  1. Determination of local chromatin composition by CasID.

    Science.gov (United States)

    Schmidtmann, Elisabeth; Anton, Tobias; Rombaut, Pascaline; Herzog, Franz; Leonhardt, Heinrich

    2016-09-02

    Chromatin structure and function are determined by a plethora of proteins whose genome-wide distribution is typically assessed by immunoprecipitation (ChIP). Here, we developed a novel tool to investigate the local chromatin environment at specific DNA sequences. We combined the programmable DNA binding of dCas9 with the promiscuous biotin ligase BirA* (CasID) to biotinylate proteins in the direct vicinity of specific loci. Subsequent streptavidin-mediated precipitation and mass spectrometry identified both known and previously unknown chromatin factors associated with repetitive telomeric, major satellite and minor satellite DNA. With super-resolution microscopy, we confirmed the localization of the putative transcription factor ZNF512 at chromocenters. The versatility of CasID facilitates the systematic elucidation of functional protein complexes and locus-specific chromatin composition.

  2. A decade of user operation on the macromolecular crystallography MAD beamline ID14-4 at the ESRF

    International Nuclear Information System (INIS)

    McCarthy, Andrew A.; Brockhauser, Sandor; Nurizzo, Didier; Theveneau, Pascal; Mairs, Trevor; Spruce, Darren; Guijarro, Matias; Lesourd, Marc; Ravelli, Raimond B. G.; McSweeney, Sean

    2009-01-01

    The improvement of the X-ray beam quality achieved on ID14-4 by the installation of new X-ray optical elements is described. ID14-4 at the ESRF is the first tunable undulator-based macromolecular crystallography beamline that can celebrate a decade of user service. During this time ID14-4 has not only been instrumental in the determination of the structures of biologically important molecules but has also contributed significantly to the development of various instruments, novel data collection schemes and pioneering radiation damage studies on biological samples. Here, the evolution of ID14-4 over the last decade is presented, and some of the major improvements that were carried out in order to maintain its status as one of the most productive macromolecular crystallography beamlines are highlighted. The experimental hutch has been upgraded to accommodate a high-precision diffractometer, a sample changer and a large CCD detector. More recently, the optical hutch has been refurbished in order to improve the X-ray beam quality on ID14-4 and to incorporate the most modern and robust optical elements used at other ESRF beamlines. These new optical elements will be described and their effect on beam stability discussed. These studies may be useful in the design, construction and maintenance of future X-ray beamlines for macromolecular crystallography and indeed other applications, such as those planned for the ESRF upgrade

  3. Overestimation of the 25(OH)D serum concentration with the automated IDS EIA kit.

    Science.gov (United States)

    Cavalier, Etienne; Huberty, Véronique; Cormier, Catherine; Souberbielle, Jean-Claude

    2011-02-01

    We have recently observed an increasing number of patients presenting very high serum levels of 25-hydroxyvitamin D [25(OH)D] (> 150 ng/mL), which, in all cases, had been measured with the IDS EIA kit adapted on different "open" automated platforms. We performed a comparison between the IDS EIA kit adapted on two different "open"automated platforms and the DiaSorin RIA. We found a systematic bias (higher levels with the IDS EIA kit) for concentrations more than 50-60 ng/mL that was less obvious when the IDS EIA was used in its manual procedure. We thus suggest to use the IDS EIA kit in its manual procedure rather than to adapt it on an automated platform, and to interpret cautiously a 25(OH)D greater than 100 ng/mL with this kit. Copyright © 2011 American Society for Bone and Mineral Research.

  4. Peritoneal VEGF-A expression is regulated by TGF-β1 through an ID1 pathway in women with endometriosis.

    Science.gov (United States)

    Young, Vicky J; Ahmad, Syed F; Brown, Jeremy K; Duncan, W Colin; Horne, Andrew W

    2015-11-18

    VEGF-A, an angiogenic factor, is increased in the peritoneal fluid of women with endometriosis. The cytokine TGF-β1 is thought to play a role in the establishment of endometriosis lesions. Inhibitor of DNA binding (ID) proteins are transcriptional targets of TGF-β1 and ID1 has been implicated in VEGF-A regulation during tumor angiogenesis. Herein, we determined whether peritoneal expression of VEGF-A is regulated by TGF-β1 through the ID1 pathway in women with endometriosis. VEGF-A was measured in peritoneal fluid by ELISA (n = 16). VEGF-A and ID1 expression was examined in peritoneal biopsies (n = 13), and primary peritoneal and immortalized mesothelial cells (MeT5A) by immunohistochemistry, qRT-PCR and ELISA. VEGF-A was increased in peritoneal fluid from women with endometriosis and levels correlated with TGF-β1 concentrations (P peritoneal mesothelium and TGF-β1 increased VEGFA mRNA (P endometriosis and TGF-β1 increased concentrations of ID1 mRNA (P endometriosis, as an effector of TGFβ1 dependent upregulation of VEGF-A, and highlights a novel potential therapeutic target.

  5. A estabilização heterodoxa no brasil: idéias e redes políticas

    Directory of Open Access Journals (Sweden)

    Pio Carlos

    2001-01-01

    Full Text Available O artigo discute o papel das idéias e das "redes políticas" na explicação do conteúdo de políticas de estabilização no Brasil. As idéias heterodoxas dos economistas da Pontifícia Universidade Católica do Rio de Janeiro (PUC-RJ são apresentadas e comparadas ao conteúdo de dois programas de estabilização implementados no país: o Plano Cruzado (1986 e o Plano Real (desde 1993. Variáveis políticas são apontadas para explicar por que o segundo programa apresenta maior semelhança com as idéias originais dos economistas do que o primeiro, o que, segundo o autor, explica, em grande medida, seu maior êxito em reduzir a inflação.

  6. Security and Privacy Improvements for the Belgian eID Technology

    Science.gov (United States)

    Verhaeghe, Pieter; Lapon, Jorn; de Decker, Bart; Naessens, Vincent; Verslype, Kristof

    The Belgian Electronic Identity Card enables Belgian citizens to prove their identity digitally and to sign electronic documents. At the end of 2009, every Belgian citizen older than 12 years will have such an eID card. In the future, usage of the eID card may be mandatory. However, irresponsible use of the card may cause harm to individuals.

  7. 48 CFR 252.242-7004 - Material management and accounting system.

    Science.gov (United States)

    2010-10-01

    ... CLAUSES Text of Provisions And Clauses 252.242-7004 Material management and accounting system. As prescribed in 242.7204, use the following caluse: Material Management and Accounting System (JUL 2009) (a) Definitions. As used in this clause— (1) Material management and accounting system (MMAS) means the Contractor...

  8. Functional design criteria for project W-252, phase II liquid effluent treatment and disposal. Revision 2

    International Nuclear Information System (INIS)

    Hatch, C.E.

    1995-05-01

    This document is the Functional Design Criteria for Project W-252. Project W-252 provides the scope to provide BAT/AKART (best available technology...) to 200 Liquid Effluent Phase II streams (B-Plant). This revision (Rev. 2) incorporates a major descoping of the project. The descoping was done to reflect a combination of budget cutting measures allowed by a less stringent regulatory posture toward the Phase II streams

  9. 78 FR 25406 - Proposed Modification of Class E Airspace; Twin Falls, ID

    Science.gov (United States)

    2013-05-01

    ...) Global Positioning System (GPS) and the Instrument Landing System (ILS) or Localizer (LOC) standard... the earth. * * * * * ANM ID E5 Twin Falls, ID [Modified] Twin Falls Joslin Field-Magic Valley Regional...

  10. A new type-B cask design for transporting 252Cf

    International Nuclear Information System (INIS)

    Simmons, C.M.

    2000-01-01

    A project to design, certify, and build a new US Department of Energy (DOE) Type B container for transporting >5 mg of 252 Cf is more than halfway to completion. This project was necessitated by the fact that the existing Oak Ridge National Laboratory (ORNL) Type B containers were designed and built many years ago and thus do not have the records and supporting data that current regulations require. Once the new cask is available, it will replace the existing Type B containers. The cask design is driven by the unique properties of 252 Cf, which is a very intense spontaneous fission neutron source and necessitates a large amount of neutron shielding. The cask is designed to contain up to 60 mg of 252 Cf in the form of californium oxide or californium oxysulfate, in pellet, wire, or sintered material forms that are sealed inside small special-form capsules. The new cask will be capable of all modes of transport (land, sea, and air). The ORNL team, composed of technical and purchasing personnel and using rigorous selection criteria, chose NAC, International (NAC), as the subcontractor for the project. In January 1997, NAC started work on developing the conceptual design and performing the analyses. The original design concept was for a tungsten alloy gamma shield surrounded by two concentric shells of NS-4-FR neutron shield material. A visit to US Nuclear Regulatory Commission (NRC) regulators in November 1997 to present the conceptual design for their comments resulted in a design modification when the question of potential straight-line cracking in the NS-4-FR neutron shield material arose. NAC's modified design includes offset, wedgelike segments of the neutron shield material. The new geometry eliminates concerns about straight-line cracking but increases the weight of the packaging and makes the fabrication more complex. NAC has now completed the cask design and performed the analyses (shielding, structural, thermal, etc.) necessary to certify the cask. The cask

  11. Californium-252 Brachytherapy Combined With External-Beam Radiotherapy for Cervical Cancer: Long-Term Treatment Results

    International Nuclear Information System (INIS)

    Lei Xin; Qian Chengyuan; Qing Yi; Zhao Kewei; Yang Zhengzhou; Dai Nan; Zhong Zhaoyang; Tang Cheng; Li Zheng; Gu Xianqing; Zhou Qian; Feng Yan; Xiong Yanli; Shan Jinlu; Wang Dong

    2011-01-01

    Purpose: To observe, by retrospective analysis, the curative effects and complications due to californium-252 ( 252 Cf) neutron intracavitary brachytherapy (ICBT) combined with external-beam radiotherapy (EBRT) in the treatment of cervical cancer. Methods and Materials: From February 1999 to December 2007, 696 patients with cervical cancer (Stages IB to IIIB) were treated with 252 Cf-ICBT in combination of EBRT. Of all, 31 patients were at Stage IB, 104 at IIA, 363 at IIB, 64 at IIIA, and 134 at IIIB. Californium-252 ICBT was delivered at 7–12 Gy per insertion per week, with a total dose of 29–45 Gy to reference point A in three to five insertions. The whole pelvic cavity was treated with 8-MV X-ray external irradiation at 2 Gy per fraction, four times per week. After 16–38 Gy of external irradiation, the center of the whole pelvic field was blocked with a 4-cm-wide lead shield, with a total external irradiation dose of 44–56 Gy. The total treatment course was 5 to 6 weeks. Results: Overall survival rate at 3 and 5 years for all patients was 76.0% and 64.9%, respectively. Disease-free 3- and 5-year survival rates of patients were 71.2% and 58.4%, respectively. Late complications included vaginal contracture and adhesion, radiation proctitis, radiation cystitis, and inflammatory bowel, which accounted for 5.8%, 7.1%, 6.2%, and 4.9%, respectively. Univariate analysis results showed significant correlation of stage, age, histopathologic grade, and lymph node status with overall survival. Cox multiple regression analysis showed that the independent variables were stage, histopathologic grade, tumor size, and lymphatic metastasis in all patients. Conclusion: Results of this series suggest that the combined use of 252 Cf-ICBT with EBRT is an effective method for treatment of cervical cancer.

  12. 48 CFR 252.232-7005 - Reimbursement of subcontractor advance payments-DoD pilot mentor-protege program.

    Science.gov (United States)

    2010-10-01

    ... subcontractor advance payments-DoD pilot mentor-protege program. 252.232-7005 Section 252.232-7005 Federal... subcontractor advance payments—DoD pilot mentor-protege program. As prescribed in 232.412-70(c), use the following clause: Reimbursement of Subcontractor Advance Payments—DoD Pilot Mentor-Protege Program (SEP 2001...

  13. 78 FR 45478 - Proposed Establishment of Class E Airspace; Salmon, ID

    Science.gov (United States)

    2013-07-29

    ...-0531; Airspace Docket No. 13-ANM-20] Proposed Establishment of Class E Airspace; Salmon, ID AGENCY... action proposes to establish Class E airspace at the Salmon VHF Omni-Directional Radio Range/Distance Measuring Equipment (VOR/DME) navigation aid, Salmon, ID, to facilitate vectoring of Instrument Flight Rules...

  14. Separation of 248Cm (III) from 252Cf (III) and its use in time resolved fluorescence spectroscopic (TRFS) studies

    International Nuclear Information System (INIS)

    Murali, M.S.; Nair, A.G.C.; Gujar, R.B.; Jain, A.; Tomar, B.S.; Godbole, S.V.; Reddy, A.V.R.; Manchanda, V.K.

    2008-07-01

    The present report gives a description of the methodology for the separation of 248 Cm(III) from decayed 252 Cf (III) waste solution. The waste solution was first assayed for 252 Cf content by neutron counting using a neutron well coincidence counter. The sample was subjected to the chemical separation of 248 Cm (III) from 252 Cf (III) following anion and cation exchange chromatography. The alpha spectrum of the separated curium fraction showed peaks due to 246 Cm and 248 Cm while the corresponding alpha spectrum of californium fraction showed 249,250,251,252 Cf. The gamma ray abundances of 249 Cf were determined with respect to its gamma rays of 387 keV and the data agreed well with that in literature. Separated Cm(III) was further characterized by recording its time resolved fluorescence spectrum (TRFS) in aqueous medium. (author)

  15. The metalloid arsenite induces nuclear export of Id3 possibly via binding to the N-terminal cysteine residues

    International Nuclear Information System (INIS)

    Kurooka, Hisanori; Sugai, Manabu; Mori, Kentaro; Yokota, Yoshifumi

    2013-01-01

    Highlights: •Sodium arsenite induces cytoplasmic accumulation of Id3. •Arsenite binds to closely spaced N-terminal cysteine residues of Id3. •N-terminal cysteines are essential for arsenite-induced nuclear export of Id3. •Nuclear export of Id3 counteracts its transcriptional repression activity. -- Abstract: Ids are versatile transcriptional repressors that regulate cell proliferation and differentiation, and appropriate subcellular localization of the Id proteins is important for their functions. We previously identified distinct functional nuclear export signals (NESs) in Id1 and Id2, but no active NES has been reported in Id3. In this study, we found that treatment with the stress-inducing metalloid arsenite led to the accumulation of GFP-tagged Id3 in the cytoplasm. Cytoplasmic accumulation was impaired by a mutation in the Id3 NES-like sequence resembling the Id1 NES, located at the end of the HLH domain. It was also blocked by co-treatment with the CRM1-specific nuclear export inhibitor leptomycin B (LMB), but not with the inhibitors for mitogen-activated protein kinases (MAPKs). Importantly, we showed that the closely spaced N-terminal cysteine residues of Id3 interacted with the arsenic derivative phenylarsine oxide (PAO) and were essential for the arsenite-induced cytoplasmic accumulation, suggesting that arsenite induces the CRM1-dependent nuclear export of Id3 via binding to the N-terminal cysteines. Finally, we demonstrated that Id3 significantly repressed arsenite-stimulated transcription of the immediate-early gene Egr-1 and that this repression activity was inversely correlated with the arsenite-induced nuclear export. Our results imply that Id3 may be involved in the biological action of arsenite

  16. 48 CFR 252.228-7000 - Reimbursement for war-hazard losses.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reimbursement for war... CLAUSES Text of Provisions And Clauses 252.228-7000 Reimbursement for war-hazard losses. As prescribed in 228.370(a), use the following clause: Reimbursement for War-Hazard Losses (DEC 1991) (a) Costs for...

  17. 48 CFR 252.227-7007 - License term-running royalty.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term-running... of Provisions And Clauses 252.227-7007 License term—running royalty. As prescribed at 227.7009-4(b), insert the following clause in patent releases, license agreements, and assignments: License Term—Running...

  18. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    Science.gov (United States)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  19. Independence Day 2004 (ID04) / Raul Hindov

    Index Scriptorium Estoniae

    Hindov, Raul

    2004-01-01

    Ülevaade 20.-22. veebruarini 2004 toimunud kaugluurepatrullide rännaku ja sõdurioskuste kompleksõppusest ID04 (Independence Day 2004 - Iseseisvuspäev 2004), millel osales 25 patrullvõistlusteks valmistuvat meest ja naist

  20. On the validity of Ksub(Id)-measurements in instrumented impact tests

    International Nuclear Information System (INIS)

    Kalthoff, J.F.; Winkler, S.; Klemm, W.; Beinert, J.

    1979-01-01

    The influence of inertia effects in determining the dynamic fracture toughness Ksub(Id) by instrumented impact testing is investigated. Model experiments in the brittle fracture regime are carried out with precracked bend specimens machined from the epoxy resin Araldite B. As is usual in these tests, the loads at the tup of the impinging striker are recorded as a function of time during the impact process. For reference purposes, the dynamic fracture toughness value Ksub(Id)sup(m1) is derived from the measured maximum load utilizing static stress intensity factor formulas. In addition to this conventional procedure, the actual stress intensity factors are measured directly at the tip of the crack by means of the shadow optical method of caustics applied in combination with high speed photography. The critical value of these optically measured stress intensity factors (for onset of crack propagation), Ksub(Id)sup(opt), is the true dynamic fracture toughness. In the experiments, the specimen size and the impact velocity were varied. In accordance with expectations, it is found that the hammer load signal is not correlated with the actual crack tip stress intensity factor values by a simple proportionality. The conventionally determined Ksub(Id)sup(m1)-value overestimates the true dynamic fracture toughness Ksub(Id)sup(opt). This overestimation becomes larger for larger specimen sizes and larger impact velocities. The results demonstrate the dominating influence inertia effects can have on hammer load measurements and emphasize the importance of eliminating these effects in order to determine non-erroneous dynamic fracture toughness values. (orig.)

  1. Identification of an active ID-like group of SINEs in the mouse.

    Science.gov (United States)

    Kass, David H; Jamison, Nicole

    2007-09-01

    The mouse genome consists of five known families of SINEs: B1, B2, B4/RSINE, ID, and MIR. Using RT-PCR we identified a germ-line transcript that demonstrates 92.7% sequence identity to ID (excluding primer sequence), yet a BLAST search identified numerous matches of 100% sequence identity. We analyzed four of these elements for their presence in orthologous genes in strains and subspecies of Mus musculus as well as other species of Mus using a PCR-based assay. All four analyzed elements were identified either only in M. musculus or exclusively in both M. musculus and M. domesticus, indicative of recent integrations. In conjunction with the identification of transcripts, we present an active ID-like group of elements that is not derived from the proposed BC1 master gene of ID elements. A BLAST of the rat genome indicated that these elements were not in the rat. Therefore, this family of SINEs has recently evolved, and since it has thus far been observed mainly in M. musculus, we refer to this family as MMIDL.

  2. Termocoagulación facetaria lumbar: Experiencia en 252 pacientes Thermocoagulation of lumbar facet joints: Experience in 252 patients

    OpenAIRE

    J. E. Martínez-Suárez; L. Camblor; S. Salva; W. A. de Jongh

    2005-01-01

    Se presentan 252 pacientes con el diagnóstico de dolor lumbar facetario a los que se le realizó la técnica quirúrgica de termocoagulación percutánea de la faceta articular. Nuestro propósito principal fue aliviar el dolor en estos pacientes, evaluamos la eficacia de la técnica con un 74,7% de resultados quirúrgicos satisfactorios, así como la descripción de diferentes aspectos como: edad, sexo, causas y la topografía segmentaria del dolor.Two hundred fifty two patients with diagnosis of lumba...

  3. Cloning and shake flask expression of hrIDS- Like in Pichia pastoris ...

    African Journals Online (AJOL)

    The human Iduronate-2-sulfate sulfatase (hIDS-Like) was cloned into the methylotrophic yeast Pichia pastoris under the control of alcohol oxidase promoter (AOX1) and the -mating factor signal peptide (a-factor). Six clones were identified by PCR. Using clone IDS28, the enzyme was secreted into the culture medium, ...

  4. Association between ACE gene I/D polymorphism and clinical presentation and prognosis of sarcoidosis.

    Science.gov (United States)

    Alía, P; Mañá, J; Capdevila, O; Alvarez, A; Navarro, M A

    2005-01-01

    Serum angiotensin converting enzyme (SACE) concentration is considered a marker of sarcoidosis activity. This concentration is influenced by an insertion/deletion (I/D) polymorphism of the ACE gene, such that SACE levels follow the pattern DD>ID>II. The aim of our work was to study the relationship between I/D polymorphism and susceptibility to sarcoidosis, as well as the relation between this polymorphism and the clinical presentation and evolution of the disease in 177 sarcoidosis patients. A group of 104 individuals without sarcoidosis was included as control. Genotyping was done by a polymerase chain reaction (PCR) method, and SACE concentration at diagnosis was determined by a kinetic method. No differences were observed in genotype or allele distributions between patients and controls, nor between patients considering the type of presentation (Löfgren versus non-Löfgren) and evolution of the disease (acute versus chronic). As reported for healthy populations, SACE concentrations followed the pattern DD>ID>II in sarcoidosis patients, but significant differences between genotypes existed only in the Löfgren group (p = 0.003) and in acute patients (p = 0.02). SACE concentrations at diagnosis were lower in acute patients (p = 0.05) and in Löfgren's syndrome (p = 0.04), but this seemed to occur only in ID individuals (p = 0.02 and p = 0.01, respectively). No relation was thus found between I/D polymorphism and susceptibility to sarcoidosis, but ACE I/D genotyping may improve the assessment of disease activity, both at diagnosis and during the follow-up of treated and untreated patients.

  5. An enhanced dynamic ID-based authentication scheme for telecare medical information systems

    Directory of Open Access Journals (Sweden)

    Ankita Chaturvedi

    2017-01-01

    Full Text Available The authentication schemes for telecare medical information systems (TMIS try to ensure secure and authorized access. ID-based authentication schemes address secure communication, but privacy is not properly addressed. In recent times, dynamic ID-based remote user authentication schemes for TMIS have been presented to protect user’s privacy. The dynamic ID-based authentication schemes efficiently protect the user’s privacy. Unfortunately, most of the existing dynamic ID-based authentication schemes for TMIS ignore the input verifying condition. This makes login and password change phases inefficient. Inefficiency of the password change phase may lead to denial of service attack in the case of incorrect input in the password change phase. To overcome these weaknesses, we proposed a new dynamic ID-based authentication scheme using a smart card. The proposed scheme can quickly detect incorrect inputs which makes the login and password change phase efficient. We adopt the approach with the aim to protect privacy, and efficient login and password change phases. The proposed scheme also resists off-line password guessing attack and denial of service attack. We also demonstrate the validity of the proposed scheme by utilizing the widely-accepted BAN (Burrows, Abadi, and Needham logic. In addition, our scheme is comparable in terms of the communication and computational overheads with relevant schemes for TMIS.

  6. Zircaloy cladding ID/OD oxidation studies. Final report

    International Nuclear Information System (INIS)

    Westerman, R.E.; Hesson, G.M.

    1977-11-01

    The ID/OD oxide ratio that forms on Zircaloy tubing at temperatures relevant to postulated LOCA conditions was measured as a function of time, temperature, and distance from the rupture. The average ratio at the rupture position was less than unity, and decreased with decreasing test time and increasing distance from the point of rupture. The maximum observed ID/OD oxide ratio was 1.4. Ratios in excess of unity were typically found to be a consequence of the OD oxide being thinner than would have been anticipated from the nominal test conditions. Confirmatory data were also obtained on the isothermal oxidation kinetics of Zircaloy. These data are in good agreement with those obtained by other investigators and confirm the conservative nature of the Baker-Just equation that is required for use in licensing calculations

  7. Análisis de la colaboración entre las empresas biotecnológicas españolas con actividades de I+D y el sistema público de I+D

    Directory of Open Access Journals (Sweden)

    García-Carpintero, Esther

    2014-06-01

    Full Text Available The development and improvement of cooperation between the industrial sector and the public R&D system can produce competitive advantages for the companies. The present work describes experiences and perceptions of Spanish biotechnology companies in their collaboration with the public R&D system. Results show that almost all the biotechnological companies with R&D activities (93.6% have cooperated with the public R&D system. The main barriers found by the companies are the excess of bureaucracy and the slow response of public researchers. Results obtained also suggest the need to establish public policies and programmes to promote knowledge and technology transfer from public research centres to companies, with a special focus on encouraging researchers from the public R&D system and on improving how Technology Transfer Offices work.El desarrollo y la mejora de la cooperación entre el sector productivo y el sistema público de I+D puede generar un conjunto de ventajas competitivas para estas empresas. El presente trabajo describe las experiencias y percepciones de las empresas biotecnológicas españolas en su colaboración con el sistema público de I+D. Los resultados muestran que prácticamente la totalidad de empresas biotecnológicas españolas con actividades de I+D (un 93,6% han mantenido algún tipo de colaboración con el sistema público de I+D. Los principales obstáculos percibidos por estas empresas en su colaboración con el sistema público de I+D son el exceso de burocracia y la respuesta lenta de los investigadores. Los resultados obtenidos sugieren la conveniencia de establecer políticas y programas públicos para fomentar la transferencia de conocimiento y tecnología desde el sistema público de I+D a las empresas, fundamentalmente centrados en la necesidad de incentivar a los investigadores del sistema público de I+D y mejorar el funcionamiento de las Oficinas de Transferencia de Tecnología.

  8. miR-342 regulates BRCA1 expression through modulation of ID4 in breast cancer.

    Directory of Open Access Journals (Sweden)

    Elisabetta Crippa

    Full Text Available A miRNAs profiling on a group of familial and sporadic breast cancers showed that miRNA-342 was significantly associated with estrogen receptor (ER levels. To investigate at functional level the role of miR-342 in the pathogenesis of breast cancer, we focused our attention on its "in silico" predicted putative target gene ID4, a transcription factor of the helix-loop-helix protein family whose expression is inversely correlated with that of ER. ID4 is expressed in breast cancer and can negatively regulate BRCA1 expression. Our results showed an inverse correlation between ID4 and miR-342 as well as between ID4 and BRCA1 expression. We functionally validated the interaction between ID4 and miR-342 in a reporter Luciferase system. Based on these findings, we hypothesized that regulation of ID4 mediated by miR-342 could be involved in the pathogenesis of breast cancer by downregulating BRCA1 expression. We functionally demonstrated the interactions between miR-342, ID4 and BRCA1 in a model provided by ER-negative MDA-MB-231 breast cancer cell line that presented high levels of ID4. Overexpression of miR-342 in these cells reduced ID4 and increased BRCA1 expression, supporting a possible role of this mechanism in breast cancer. In the ER-positive MCF7 and in the BRCA1-mutant HCC1937 cell lines miR-342 over-expression only reduced ID4. In the cohort of patients we studied, a correlation between miR-342 and BRCA1 expression was found in the ER-negative cases. As ER-negative cases were mainly BRCA1-mutant, we speculate that the mechanism we demonstrated could be involved in the decreased expression of BRCA1 frequently observed in non BRCA1-mutant breast cancers and could be implicated as a causal factor in part of the familial cases grouped in the heterogeneous class of non BRCA1 or BRCA2-mutant cases (BRCAx. To validate this hypothesis, the study should be extended to a larger cohort of ER-negative cases, including those belonging to the BRCAx class.

  9. Interactive effects between Lymphotoxin α +252 polymorphism and habits of substance use on risk of hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Jung-Fa Tsai

    2017-07-01

    Full Text Available This case–control study aimed to assess the interactive effect between polymorphisms of lymphotoxin (LT α +252 and habitual substance use on risk of hepatocellular carcinoma (HCC. We enrolled 150 pairs of sex- and age-matched HCC patients and unrelated healthy controls. LTα genotypes were detected with polymerase-chain reaction and restrictive fragment length polymorphisms. Information about habits of substance use was obtained through personal interview. Multivariate analysis indicated that LTα +252 G/G genotypes [odds ratio (OR = 3.36], Hepatitis B surface antigen (OR = 16.68, antibodies to hepatitis C virus (OR = 34.88 and having at least two habits of substance use (OR = 2.50 were independent risk factors for HCC. There were additive interactions among LTα +252 G/G genotype, chronic viral hepatitis, and habit of each substance use. In conclusion: There are independent and additive interactions between LTα +252 G/G genotype, chronic viral hepatitis, and habits of substance use on risk of HCC.

  10. Monetizing a Meme: YouTube, Content ID, and the Harlem Shake

    Directory of Open Access Journals (Sweden)

    Michael Soha

    2016-01-01

    Full Text Available This article analyzes the creation, evolution, and monetization of the Harlem Shake meme on YouTube to explore contemporary implementation of copyright and understanding of authorship in regard to monetization of works with distributed authorship. This article has three main findings: first, we highlight the collection of digital labor that comprises the “Harlem Shake” meme, its rise in popularity, and the subsequent rise in popularity of Baauer, the composer of the song which forms the backbone of the meme; second, we examine how YouTube’s “new bargain” of Content ID, as a departure from the site’s origins creates coercive control mechanisms, shedding new light on the concept of and debate over “digital sharecropping.” Finally, we argue for a “Fair(er use” system by exploring how memes might be understood outside of the contemporary copyright system, rethinking the rights of users engaged in collective production. The article is significant in that it challenges the current distribution of Content ID payments solely to copyright holders in an attempt to rethink a system that acknowledges the creative labor of memetic phenomena and collective authorship.

  11. 48 CFR 252.227-7021 - Rights in data-existing works.

    Science.gov (United States)

    2010-10-01

    ... of Provisions And Clauses 252.227-7021 Rights in data—existing works. As prescribed at 227.7105-2(a), use the following clause: Rights in Data—Existing Works (MAR 1979) (a) The term works as used herein... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in data-existing...

  12. Shielding evaluation of a medical linear accelerator vault in preparation for installing a high-dose rate 252Cf remote after-loader

    International Nuclear Information System (INIS)

    Melhus, C. S.; Rivard, M. J.; KurKomelis, J.; Liddle, C. B.; Masse, F. X.

    2005-01-01

    In support of the effort to begin high-dose rate 252 Cf brachytherapy treatments at Tufts-New England Medical Center, the shielding capabilities of a clinical accelerator vault against the neutron and photon emissions from a 1.124 mg 252 Cf source were examined. Outside the clinical accelerator vault, the fast neutron dose equivalent rate was below the lower limit of detection of a CR-39 etched track detector and below 0.14 ± 0.02 μSv h -1 with a proportional counter, which is consistent, within the uncertainties, with natural background. The photon dose equivalent rate was also measured to be below background levels (0.1 μSv h -1 ) using an ionisation chamber and an optically stimulated luminescence dosemeter. A Monte Carlo simulation of neutron transport through the accelerator vault was performed to validate measured values and determine the thermal-energy to low-energy neutron component. Monte Carlo results showed that the dose equivalent rate from fast neutrons was reduced by a factor of 100,000 after attenuation through the vault wall, and the thermal-energy neutron dose equivalent rate would be an additional factor of 1000 below that of the fast neutrons. Based on these findings, the shielding installed in this facility is sufficient for the use of at least 5.0 mg of 252 Cf. (authors)

  13. A case control association study of ACE gene polymorphism (I/D) with hypertension in Punjabi population from Faisalabad, Pakistan.

    Science.gov (United States)

    Hussain, Misbah; Awan, Fazli Rabbi; Gujjar, Amna; Hafeez, Shakir; Islam, Mehboob

    2018-01-01

    Angiotensin converting enzyme (ACE) is a key component of renin angiotensin aldosterone system. It converts angiotensin I to angiotensin II. Insertion/deletion (I/D) polymorphism of ACE gene is found associated with several complications. However, its association with hypertension and related metabolic diseases is still controversial. So, the aim of the present study was to check this association for Punjabi population from Faisalabad, Pakistan. For this purpose, blood samples (patients = 100, controls = 48) were collected and several biochemical parameters were measured. Genotyping for ACE (I/D) polymorphism was performed by polymerase chain reaction (PCR) assay. ID genotype is found prevalent in the studied population as 41% in control subjects and 61% in patients. Furthermore, chi-square analysis showed significant (p = 0.005) difference for genotypic frequencies between both groups. One-way ANOVA for association of II, ID, and DD genotypes with anthropometric, clinical, and biochemical parameters showed that in patient group, DD genotype is significantly (p = 0.041) associated with systolic blood pressure (SBP). Moreover, ID genotype is found associated with the presence of cardiovascular diseases. This study concludes that DD genotype is strongly associated with higher SBP in hypertensive patients.

  14. The paradox of IDs: an account of an ethnographic experience in the US

    Directory of Open Access Journals (Sweden)

    Mariza Peirano

    2008-01-01

    Full Text Available In the modern world, IDs are indispensable objects, without which we cannot prove that we are who we say we are. We need material substantiation that attests to the authenticity of our self-identification. This paper is an account of an ethnographic experience about IDs and identification processes in the US, based on the examination of two events in which Eliot Spitzer, the New York State governor from January 2007 to March 2008, was a central figure. A comparison with the Brazilian scenario is present throughout the paper, and it ends by focusing on the ID theft phenomenon.

  15. Testing of ENDF/B cross section data in the Californium-252 neutron benchmark field

    International Nuclear Information System (INIS)

    Mannhart, W.

    1979-01-01

    The fission neutron field of 252 Cf presently represents one of the most well-known neutron benchmark fields. For 13 neutron reactions which are of importance in reactor metrology, measurements of spectrum-averaged cross sections, [sigma], performed in this neutron field were compared with calculated average cross sections. This comparison allows one to draw conclusions as to the quality of different sigma(E) data taken from ENDF/B-IV, from ENDF/B-V, and from recent experiments and used in the calculation of average cross sections. The comparison includes an uncertainty analysis regarding the different uncertainty contributions of [sigma], of sigma(E), and of the spectral distribution of 252 Cf fission neutrons. Additionally, in a few examples, sensitivity studies were carried out. The sensitivity of the spectrum-averaged cross sections to individual characteristics of the sigma(E) data, such as normalization factors or shifts in the energy scale, was investigated. Similarly, the sensitivity of [sigma] to the spectral distribution of 252 Cf was determined. 4 figures, 2 tables

  16. Implementasi Cell ID dan GPS dalam Pencarian Lokasi Fasilitas Kesehatan Terdekat

    Directory of Open Access Journals (Sweden)

    Fahmi Candra Permana

    2017-07-01

    Full Text Available Cell ID dan GPS merupakan layanan berbasis lokasi dan teknologi yang banyak membantu manusia dalam hal navigasi dan penemuan tempat-tempat yang bermanfaat di sekitarnya. Salah satu komponen utama dari teknologi ini dapat diterapkan pada telepon seluler. Dalam penelitian ini, dirancang sebuah aplikasi dengan memanfaatkan teknologi berdasar implementasi dari Cell ID dan GPS untuk mengetahui posisi user dan lokasi fasilitas kesehatan terdekat di sekitar user dan penggunaan JSON sebagai sarana untuk menyimpan database pada web. Aplikasi ini diimplementasikan pada telepon seluler dengan sistem operasi Android. Hasil dari penelitian ini menunjukkan bahwa Cell ID dan GPS dapat diimplementasikan dengan baik dengan memanfaatkan akses Internet dan Google Maps untuk mencari fasilitas kesehatan terdekat dan menggambarkan daerah sekitar user.

  17. Genetic characterization of Venezuelan equine encephalitis virus from Bolivia, Ecuador and Peru: identification of a new subtype ID lineage.

    Science.gov (United States)

    Aguilar, Patricia V; Adams, A Paige; Suárez, Victor; Beingolea, Luis; Vargas, Jorge; Manock, Stephen; Freire, Juan; Espinoza, Willan R; Felices, Vidal; Diaz, Ana; Liang, Xiaodong; Roca, Yelin; Weaver, Scott C; Kochel, Tadeusz J

    2009-09-15

    Venezuelan equine encephalitis virus (VEEV) has been responsible for hundreds of thousands of human and equine cases of severe disease in the Americas. A passive surveillance study was conducted in Peru, Bolivia and Ecuador to determine the arboviral etiology of febrile illness. Patients with suspected viral-associated, acute, undifferentiated febrile illness of Peru, and more recently (2005), in Madre de Dios, Peru. We performed phylogenetic analyses with VEEV from Bolivia, Ecuador and Peru and compared their relationships to strains from other parts of South America. We found that VEEV subtype ID Panama/Peru genotype is the predominant one circulating in Peru. We also demonstrated that VEEV subtype ID strains circulating in Ecuador belong to the Colombia/Venezuela genotype and VEEV from Madre de Dios, Peru and Cochabamba, Bolivia belong to a new ID genotype. In summary, we identified a new major lineage of enzootic VEEV subtype ID, information that could aid in the understanding of the emergence and evolution of VEEV in South America.

  18. Role of ID Proteins in BMP4 Inhibition of Profibrotic Effects of TGF-β2 in Human TM Cells.

    Science.gov (United States)

    Mody, Avani A; Wordinger, Robert J; Clark, Abbot F

    2017-02-01

    Increased expression of TGF-β2 in primary open-angle glaucoma (POAG) aqueous humor (AH) and trabecular meshwork (TM) causes deposition of extracellular matrix (ECM) in the TM and elevated IOP. Bone morphogenetic proteins (BMPs) regulate TGF-β2-induced ECM production. The underlying mechanism for BMP4 inhibition of TGF-β2-induced fibrosis remains undetermined. Bone morphogenic protein 4 induces inhibitor of DNA binding proteins (ID1, ID3), which suppress transcription factor activities to regulate gene expression. Our study will determine whether ID1and ID3 proteins are downstream targets of BMP4, which attenuates TGF-β2 induction of ECM proteins in TM cells. Primary human TM cells were treated with BMP4, and ID1 and ID3 mRNA, and protein expression was determined by quantitative PCR (Q-PCR) and Western immunoblotting. Intracellular ID1 and ID3 protein localization was studied by immunocytochemistry. Transformed human TM cells (GTM3 cells) were transfected with ID1 or ID3 expression vectors to determine their potential inhibitory effects on TGF-β2-induced fibronectin and plasminogen activator inhibitor-I (PAI-1) protein expression. Basal expression of ID1-3 was detected in primary human TM cells. Bone morphogenic protein 4 significantly induced early expression of ID1 and ID3 mRNA (P protein in primary TM cells, and a BMP receptor inhibitor blocked this induction. Overexpression of ID1 and ID3 significantly inhibited TGF-β2-induced expression of fibronectin and PAI-1 in TM cells (P protein 4 induced ID1 and ID3 expression suppresses TGF-β2 profibrotic activity in human TM cells. In the future, targeting specific regulators may control the TGF-β2 profibrotic effects on the TM, leading to disease modifying IOP lowering therapies.

  19. Id1 suppresses anti-tumour immune responses and promotes tumour progression by impairing myeloid cell maturation.

    Science.gov (United States)

    Papaspyridonos, Marianna; Matei, Irina; Huang, Yujie; do Rosario Andre, Maria; Brazier-Mitouart, Helene; Waite, Janelle C; Chan, April S; Kalter, Julie; Ramos, Ilyssa; Wu, Qi; Williams, Caitlin; Wolchok, Jedd D; Chapman, Paul B; Peinado, Hector; Anandasabapathy, Niroshana; Ocean, Allyson J; Kaplan, Rosandra N; Greenfield, Jeffrey P; Bromberg, Jacqueline; Skokos, Dimitris; Lyden, David

    2015-04-29

    A central mechanism of tumour progression and metastasis involves the generation of an immunosuppressive 'macroenvironment' mediated in part through tumour-secreted factors. Here we demonstrate that upregulation of the Inhibitor of Differentiation 1 (Id1), in response to tumour-derived factors, such as TGFβ, is responsible for the switch from dendritic cell (DC) differentiation to myeloid-derived suppressor cell expansion during tumour progression. Genetic inactivation of Id1 largely corrects the myeloid imbalance, whereas Id1 overexpression in the absence of tumour-derived factors re-creates it. Id1 overexpression leads to systemic immunosuppression by downregulation of key molecules involved in DC differentiation and suppression of CD8 T-cell proliferation, thus promoting primary tumour growth and metastatic progression. Furthermore, advanced melanoma patients have increased plasma TGFβ levels and express higher levels of ID1 in myeloid peripheral blood cells. This study reveals a critical role for Id1 in suppressing the anti-tumour immune response during tumour progression and metastasis.

  20. 48 CFR 252.225-7008 - Restriction on Acquisition of Specialty Metals.

    Science.gov (United States)

    2010-10-01

    ... CLAUSES Text of Provisions And Clauses 252.225-7008 Restriction on Acquisition of Specialty Metals. As... more of the following limits: Manganese, 1.65 percent; silicon, 0.60 percent; or copper, 0.60 percent...

  1. [Clinical Significance of ID4 Gene Mehtylation in Demethylation-Treated MDS Cell Line and 2 MDS Patients].

    Science.gov (United States)

    Kang, Hui-Yuan; Wang, Xin-Rong; Gao, Li; Wang, Wei; Li, Mian-Yang; Wang, Li-Li; Wang, Cheng-Bin; Yu, Li

    2015-04-01

    To evaluate significance of ID4 gene mehtylation in demethylating myelodysplastic syndrome(MDS) cell Line MUTZ1 and 2 patients with MDS. The methylation-specific PCR (MS-PCR) and reverse transcription-PCR (RT-PCR) were applied to identify the methylation status and gene expression of ID4 gene in MDS cell line MUTZ1, a patient with aplastic anemia(AA) and a donor with normal bone marrow (NBM). RT-PCR was applied to detect the ID4 gene expression status in MUTZ1 cell line treated with decitabine at 3 different concentrations. Then bisulfite sequencing PCR (BSP) was applied to detect ID4 gene methylation status in 2 MDS parients treated with decitabine. The MDS cell line MUTZ-1 displayed a complete methylation of ID4 gene promoter with little mRNA expression. Inversely, bone marrow of an AA patient and NBM showed complete unmethylation of this gene with intensity mRNA expression. With the increase of decitabine concentration, ID4 gene mRNA expression was more and more increased. After decitabine treatment, ID4 gene methylation-positive frequencies of both the 2 MDS patients were much more decreased than that of the first treatment. So, ID4 gene mRNA expression inhibited by promoter hypemethylation could be recovered by using demethylation medicine. ID4 as a new potential anti-oncogene suggests that its methylation may become a marker for selection and assessment of therapeutic schedules in patients with MDS.

  2. Study of the shielding for spontaneous fission sources of Californium-252

    International Nuclear Information System (INIS)

    Davila R, I.

    1991-06-01

    A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)

  3. 77 FR 68065 - Amendment of Class D and Class E Airspace; Lewiston, ID

    Science.gov (United States)

    2012-11-15

    ... Measuring Equipment (VOR/ DME), and the Lewiston-Nez Perce Instrument Landing System (ILS) Localizer... feet or more above the surface of the earth. * * * * * ANM ID E5 Lewiston, ID [Modified] Lewiston-Nez...

  4. The application of n-γ discrimination in 252Cf spontaneous neutron TOF spectra measurement

    International Nuclear Information System (INIS)

    Zhou Haojun; Zhang Yi; Li Jiansheng; Jin Yu; Wang Jie; Li Chunyuan

    2004-01-01

    The BC501 scintillator is used as a fast neutron detector. The effect that the pulse rise time method was used to discriminate γ from 252 Cf spontaneous neutron TOF spectra is studied in the experiment. A pulse rise time separation spectra of γ and 252 Cf spontaneous neuron upon 1 MeV is obtained, the n-γ separation function reaches to 4.6. When the result of pulse rise time separation coincides with the time-of-flight spectra in which the neutron energy is upon 0.5 MeV, 0.8 MeV and 1.0 MeV, comparing with the anticoincidence, γ was eliminated 99.90% at least. (authors)

  5. Suurnimed jäid müümata / Maria-Kristiina Soomre

    Index Scriptorium Estoniae

    Soomre, Maria-Kristiina, 1978-

    2001-01-01

    9. mai Christie' oksjonist, müümata jäänud Picasso, Degas', Cezanne'i tööd. 8. mai Sotheby oksjonist, kus edukalt müüdi töid S. J. Seegeri kogust, 3,85 miljoni dollari eest M. Beckmanni "Perseuse viimane katsumus". Sotheby kaasaegse kunsti oksjonil New Yorgis müüdi 5,6 miljoni dollari eest J. Koonsi skulptuur M. Jacksonist. Müümata jäid A. Warholi "Viis supipurki", A. Calderi 3 skulptuuri

  6. 78 FR 40382 - Modification of Class D and E Airspace; Twin Falls, ID

    Science.gov (United States)

    2013-07-05

    ... using the Navigation (RNAV) Global Positioning System (GPS) and the Instrument Landing System (ILS) or... or more above the surface of the earth. * * * * * ANM ID E5 Twin Falls, ID [Modified] Twin Falls...

  7. A californium-252 source for radiobiological studies at Hiroshima University

    International Nuclear Information System (INIS)

    Kato, Kazuo; Takeoka, Seiji; Kuroda, Tokue; Tsujimura, Tomotaka; Kawami, Masaharu; Hoshi, Masaharu; Sawada, Shozo

    1987-01-01

    A 1.93 Ci (3.6 mg) californium-252 source was installed in the radiation facility of the Research Institute for Nuclear Medicine and Biology, Hiroshima University. This source produces fission neutrons (8.7 x 10 9 n/s at the time of its installation), which are similar to neutron spectrum of the atomic bombs. It is useful for studying biological effects of fission neutrons and neutron dosimetry. An apparatus was dosigned to accomodate this source and to apply it to such studies. It has resulted in profitable fission neutron exposures, while suppressing scattered neutrons and secondary gamma rays. This apparatus incorporates many safety systems, including one which interlocks with all of doors and an elevator serving the exposure room, so as to prevent accidents involving users. (author)

  8. The Implementation of C-ID, R2D2 Model on Learning Reading Comprehension

    Science.gov (United States)

    Rayanto, Yudi Hari; Rusmawan, Putu Ngurah

    2016-01-01

    The purposes of this research are to find out, (1) whether C-ID, R2D2 model is effective to be implemented on learning Reading comprehension, (2) college students' activity during the implementation of C-ID, R2D2 model on learning Reading comprehension, and 3) college students' learning achievement during the implementation of C-ID, R2D2 model on…

  9. Anmeldung in ILIAS ohne Uni-Login-ID

    OpenAIRE

    Schanz, Nadja

    2016-01-01

    Gewusst wie...! Online-Tutorial der Universitätsbibliothek Tübingen. Erklärt die Anmeldung in Ilias zu Führungen ohne Uni-Login-ID Online Tutorial from university library tuebingen. teaches how to register in Ilias for courses and guided tours without university login

  10. 48 CFR 252.239-7016 - Telecommunications security equipment, devices, techniques, and services.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Telecommunications... SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.239-7016 Telecommunications... clause: Telecommunications Security Equipment, Devices, Techniques, and Services (DEC 1991) (a...

  11. Design, Construction, and Modeling of a 252Cf Neutron Irradiator

    Directory of Open Access Journals (Sweden)

    Blake C. Anderson

    2016-01-01

    Full Text Available Neutron production methods are an integral part of research and analysis for an array of applications. This paper examines methods of neutron production, and the advantages of constructing a radioisotopic neutron irradiator assembly using 252Cf. Characteristic neutron behavior and cost-benefit comparative analysis between alternative modes of neutron production are also examined. The irradiator is described from initial conception to the finished design. MCNP modeling shows a total neutron flux of 3 × 105 n/(cm2·s in the irradiation chamber for a 25 μg source. Measurements of the gamma-ray and neutron dose rates near the external surface of the irradiator assembly are 120 μGy/h and 30 μSv/h, respectively, during irradiation. At completion of the project, total material, and labor costs remained below $50,000.

  12. The treatable intellectual disability APP www.treatable-id.org: A digital tool to enhance diagnosis & care for rare diseases

    Directory of Open Access Journals (Sweden)

    van Karnebeek Clara D M

    2012-07-01

    Full Text Available Abstract Background Intellectual disability (ID is a devastating and frequent condition, affecting 2-3% of the population worldwide. Early recognition of treatable underlying conditions drastically improves health outcomes and decreases burdens to patients, families and society. Our systematic literature review identified 81 such inborn errors of metabolism, which present with ID as a prominent feature and are amenable to causal therapy. The WebAPP translates this knowledge of rare diseases into a diagnostic tool and information portal. Methods & results Freely available as a WebAPP via http://www.treatable-id.org and end 2012 via the APP store, this diagnostic tool is designed for all specialists evaluating children with global delay / ID and laboratory scientists. Information on the 81 diseases is presented in different ways with search functions: 15 biochemical categories, neurologic and non-neurologic signs & symptoms, diagnostic investigations (metabolic screening tests in blood and urine identify 65% of all IEM, therapies & effects on primary (IQ/developmental quotient and secondary outcomes, and available evidence For each rare condition a ‘disease page’ serves as an information portal with online access to specific genetics, biochemistry, phenotype, diagnostic tests and therapeutic options. As new knowledge and evidence is gained from expert input and PubMed searches this tool will be continually updated. The WebAPP is an integral part of a protocol prioritizing treatability in the work-up of every child with global delay / ID. A 3-year funded study will enable an evaluation of its effectiveness. Conclusions For rare diseases, a field for which financial and scientific resources are particularly scarce, knowledge translation challenges are abundant. With this WebAPP technology is capitalized to raise awareness for rare treatable diseases and their common presenting clinical feature of ID, with the potential to improve health outcomes

  13. The treatable intellectual disability APP www.treatable-id.org: A digital tool to enhance diagnosis & care for rare diseases

    Science.gov (United States)

    2012-01-01

    Background Intellectual disability (ID) is a devastating and frequent condition, affecting 2-3% of the population worldwide. Early recognition of treatable underlying conditions drastically improves health outcomes and decreases burdens to patients, families and society. Our systematic literature review identified 81 such inborn errors of metabolism, which present with ID as a prominent feature and are amenable to causal therapy. The WebAPP translates this knowledge of rare diseases into a diagnostic tool and information portal. Methods & results Freely available as a WebAPP via http://www.treatable-id.org and end 2012 via the APP store, this diagnostic tool is designed for all specialists evaluating children with global delay / ID and laboratory scientists. Information on the 81 diseases is presented in different ways with search functions: 15 biochemical categories, neurologic and non-neurologic signs & symptoms, diagnostic investigations (metabolic screening tests in blood and urine identify 65% of all IEM), therapies & effects on primary (IQ/developmental quotient) and secondary outcomes, and available evidence For each rare condition a ‘disease page’ serves as an information portal with online access to specific genetics, biochemistry, phenotype, diagnostic tests and therapeutic options. As new knowledge and evidence is gained from expert input and PubMed searches this tool will be continually updated. The WebAPP is an integral part of a protocol prioritizing treatability in the work-up of every child with global delay / ID. A 3-year funded study will enable an evaluation of its effectiveness. Conclusions For rare diseases, a field for which financial and scientific resources are particularly scarce, knowledge translation challenges are abundant. With this WebAPP technology is capitalized to raise awareness for rare treatable diseases and their common presenting clinical feature of ID, with the potential to improve health outcomes. This innovative digital

  14. Physical and biological dosimetries of Cf-252 radiation

    International Nuclear Information System (INIS)

    Yamashita, Hisao; Wada, Tadashi; Dokiya, Takushi; Hashimoto, Shozo

    1986-01-01

    Recently Cf-252 sources containing 300 μg have become available in a size identical to 1 Ci of Cs-137 and with the use of remotely controlled afterloading apparatus, safe therapy with little exposure to the therapist is now possible. Radiation leakage from the Cf-252 apparatus and from the treatment room was measured with REM-meter and it was possible to reduce the leakage from the treatment room to less than 1 mrem/h (gamma rays) and 0.5 mrem/h (neutrons). Measurement of fast neutrons was made with a twin chamber composed of a tissue equivalent ionization chamber and a carbon ionization chamber. The neutron dose in air and the absorbed dose in tissue equivalent water tank were measured, which showed that in air, neutrons were 70% and photons were 30% of dose. In water, greater distances from the source, neutrons attenuate and gamma rays increase in dose. The results of studies on the skin reaction of mice and sperm cleavage delay time of sea urchins indicated that the RBE ranges from 1.5 to 3.0 using the high dose rate system. Neutrons are remarkably affected by a time factor. With the use of high dose rate sources, the dose rate has become higher, but the overall time has been extended through dose fractionation and it was considered advisable to employ an RBE of 3-4 in these studies. (Auth.)

  15. Gamma-ray multiplicity measurement of the spontaneous fission decay of 252Cf in a segmented HPGe/BGO detector array

    Energy Technology Data Exchange (ETDEWEB)

    Bleuel, D L; Bernstein, L A; Burke, J T; Gibelin, J; Heffner, M D; Mintz, J; Norman, E B; Phair, L; Scielzo, N D; Sheets, S A; Snyderman, N J; Stoyer, M A; Wiedeking, M

    2008-04-23

    Coincident {gamma} rays from a {sup 252}Cf source were measured using an array of six segmented high-purity germanium (HPGe) Clover detectors each enclosed by 16 bismuth-germanate (BGO) detectors. The detectors were arranged in a cubic pattern around a 1 {micro}Ci {sup 252}Cf source to cover a large solid angle for {gamma}-ray measurement with a reasonable reconstruction of the multiplicity. Neutron multiplicity was determined in certain cases by identifying the prompt {gamma} rays from individual fission fragment pairs. Multiplicity distributions from previous experiments and theoretical models were convolved with the response function of the array and compared to the present results. These results suggest a {gamma}-ray multiplicity spectrum broader than previous measurements and models, and provide no evidence of correlation with neutron multiplicity.

  16. Combination of electron beam irradiation and thermal treatment to enhance the shelf-life of traditional Indian fermented food (Idli)

    International Nuclear Information System (INIS)

    Mulmule, Manoj D.; Shimmy, Shankar M.; Bambole, Vaishali; Jamdar, Sahayog N.; Rawat, K.P.; Sarma, K.S.S.

    2017-01-01

    Idli, a steam-cooked breakfast food item consumed in India, is famous as a staple food for its spongy texture and unique fermented taste. Idli preparation is a time consuming process; although instant Idli pre-mixes as powder or batter are available in the market, they do not have the distinctive taste and aroma similar to the Idli prepared at home. Hence ready-to-eat (RTE) form of this food is in demand. Therefore, an attempt was made to prepare RTE Idli bearing similar taste as home-cooked Idli with an extended shelf-life of up to two months at an ambient temperature using Electron Beam Irradiation (EBI) at dosages 2.5 kGy, 5 kGy and 7.5 kGy and combination processing comprised of EBI dosage at 2.5 kGy and thermal treatment (80 °C for 20 min). The treated Idli's were microbiologically and sensorially evaluated at storage periods of zero day, 14 days, 30 days and 60 days. Idli's irradiated at 7.5 kGy and subjected to combination processing at 2.5 kGy and thermal treatment were shelf-stable for 60 days. 2.5 kGy and 5 kGy radiation dosages alone were not sufficient to preserve Idli samples for more than 14 days. Undesirable change in sensory properties of Idli was observed at an EBI dosage of 7.5 kGy. Sensory properties of combination processed Idli's were found to undergo minor change over the storage period. The present work suggests that lowest radiation dosage in combination with thermal treatment could be useful to achieve the extended shelf-life without considerably impairing the organoleptic quality of Ready-to-Eat Idli. - Highlights: • Idli (traditional Indian fermented food) was prepared in ready-to-eat (RTE) form. • Ready-to-eat Idli was then subjected to combination processing comprised of lowest irradiation dosage of 2.5 kGy with mild heat treatment to extend its shelf life. • Increase in hardness and decrease in brightness of combination processed Idli was observed. • Combination processed Idli was microbiologically safe and

  17. Bacterial community shift in the coastal Gulf of Mexico salt-marsh sediment microcosm in vitro following exposure to the Mississippi Canyon Block 252 oil (MC252)

    KAUST Repository

    Koo, Hyunmin; Mojib, Nazia; Huang, Jonathan P.; Donahoe, Rona J.; Bej, Asim K.

    2014-01-01

    In this study, we examined the responses by the indigenous bacterial communities in salt-marsh sediment microcosms in vitro following treatment with Mississippi Canyon Block 252 oil (MC252). Microcosms were constructed of sediment and seawater collected from Bayou La Batre located in coastal Alabama on the Gulf of Mexico. We used an amplicon pyrosequencing approach on microcosm sediment metagenome targeting the V3–V5 region of the 16S rRNA gene. Overall, we identified a shift in the bacterial community in three distinct groups. The first group was the early responders (orders Pseudomonadales and Oceanospirillales within class Gammaproteobacteria), which increased their relative abundance within 2 weeks and were maintained 3 weeks after oil treatment. The second group was identified as early, but transient responders (order Rhodobacterales within class Alphaproteobacteria; class Epsilonproteobacteria), which increased their population by 2 weeks, but returned to the basal level 3 weeks after oil treatment. The third group was the late responders (order Clostridiales within phylum Firmicutes; order Methylococcales within class Gammaproteobacteria; and phylum Tenericutes), which only increased 3 weeks after oil treatment. Furthermore, we identified oil-sensitive bacterial taxa (order Chromatiales within class Gammaproteobacteria; order Syntrophobacterales within class Deltaproteobacteria), which decreased in their population after 2 weeks of oil treatment. Detection of alkane (alkB), catechol (C2,3DO) and biphenyl (bph) biodegradation genes by PCR, particularly in oil-treated sediment metacommunity DNA, delineates proliferation of the hydrocarbon degrading bacterial community. Overall, the indigenous bacterial communities in our salt-marsh sediment in vitro microcosm study responded rapidly and shifted towards members of the taxonomic groups that are capable of surviving in an MC252 oil-contaminated environment.

  18. Bacterial community shift in the coastal Gulf of Mexico salt-marsh sediment microcosm in vitro following exposure to the Mississippi Canyon Block 252 oil (MC252)

    KAUST Repository

    Koo, Hyunmin

    2014-07-10

    In this study, we examined the responses by the indigenous bacterial communities in salt-marsh sediment microcosms in vitro following treatment with Mississippi Canyon Block 252 oil (MC252). Microcosms were constructed of sediment and seawater collected from Bayou La Batre located in coastal Alabama on the Gulf of Mexico. We used an amplicon pyrosequencing approach on microcosm sediment metagenome targeting the V3–V5 region of the 16S rRNA gene. Overall, we identified a shift in the bacterial community in three distinct groups. The first group was the early responders (orders Pseudomonadales and Oceanospirillales within class Gammaproteobacteria), which increased their relative abundance within 2 weeks and were maintained 3 weeks after oil treatment. The second group was identified as early, but transient responders (order Rhodobacterales within class Alphaproteobacteria; class Epsilonproteobacteria), which increased their population by 2 weeks, but returned to the basal level 3 weeks after oil treatment. The third group was the late responders (order Clostridiales within phylum Firmicutes; order Methylococcales within class Gammaproteobacteria; and phylum Tenericutes), which only increased 3 weeks after oil treatment. Furthermore, we identified oil-sensitive bacterial taxa (order Chromatiales within class Gammaproteobacteria; order Syntrophobacterales within class Deltaproteobacteria), which decreased in their population after 2 weeks of oil treatment. Detection of alkane (alkB), catechol (C2,3DO) and biphenyl (bph) biodegradation genes by PCR, particularly in oil-treated sediment metacommunity DNA, delineates proliferation of the hydrocarbon degrading bacterial community. Overall, the indigenous bacterial communities in our salt-marsh sediment in vitro microcosm study responded rapidly and shifted towards members of the taxonomic groups that are capable of surviving in an MC252 oil-contaminated environment.

  19. Fraudulent ID using face morphs: Experiments on human and automatic recognition.

    Science.gov (United States)

    Robertson, David J; Kramer, Robin S S; Burton, A Mike

    2017-01-01

    Matching unfamiliar faces is known to be difficult, and this can give an opportunity to those engaged in identity fraud. Here we examine a relatively new form of fraud, the use of photo-ID containing a graphical morph between two faces. Such a document may look sufficiently like two people to serve as ID for both. We present two experiments with human viewers, and a third with a smartphone face recognition system. In Experiment 1, viewers were asked to match pairs of faces, without being warned that one of the pair could be a morph. They very commonly accepted a morphed face as a match. However, in Experiment 2, following very short training on morph detection, their acceptance rate fell considerably. Nevertheless, there remained large individual differences in people's ability to detect a morph. In Experiment 3 we show that a smartphone makes errors at a similar rate to 'trained' human viewers-i.e. accepting a small number of morphs as genuine ID. We discuss these results in reference to the use of face photos for security.

  20. VIPP-LD: A promising Video Feedback intervention program for parents with ID

    NARCIS (Netherlands)

    Hodes, M.W.; Kef, S.; Meppelder, H.M.; Schuengel, C.

    2012-01-01

    Aim: Parenting support has been shown to be of benefit to parents with intellectual disabilities (ID) on several outcomes; however, effects on parent-child interaction in the form of sensitive responsiveness and positive inductive discipline are still under debate. This study tested the effects of an

  1. Inhibitor of DNA binding 1 (Id1) induces differentiation and proliferation of mouse embryonic carcinoma P19CL6 cells

    International Nuclear Information System (INIS)

    Meng, Qingzhen; Jia, Zhuqing; Wang, Weiping; Li, Binhong; Ma, Kangtao; Zhou, Chunyan

    2011-01-01

    Highlights: → Id1 was upregulated during the cardiac differentiation process of P19CL6 cells. → Id1 upregulated expression of cardiac specific genes Gata4, α-MHC and ISL1. → Id1 promoted proliferation of P19CL6 cells. → Overexpression of Id1 increased activity of TOP flash. → Wnt3a or LiCl treatment promoted Id1 expression in P19CL6 cells. -- Abstract: The inhibitor of DNA binding (Id) family of genes encodes negative regulators of basic helix-loop-helix transcription factors and has been implicated in such diverse cellular processes as differentiation, proliferation, apoptosis and migration. Id knockout mouse embryos display multiple cardiac defects but the specific role of Id1 in cardiac differentiation is unclear. In the present study, we investigated the function of Id1 in DMSO-induced P19CL6 cells, a widely-accepted cell model of cardiac differentiation. We found that Id1 was upregulated during the cardiac differentiation of P19CL6 cells. The expression of cardiac specific marker genes, Gata4, α-MHC and ISL1, was upregulated in P19CL6 cells stably transfected with Id1 (P19CL6-Id1) during cardiac differentiation. The overexpression of Id1 reduced the number of cells in G1 phase and increased the cell population in G2, M and S phases, while knockdown of Id1 increased the number of cells in G1 phase from 48.6 ± 2.51% to 62.2 ± 1.52% at day 0 of cardiac induction, and from 52.5 ± 3.41% to 63.7 ± 1.02% at day 3 after cardiac induction, indicating that Id1 promoted proliferation of P19CL6 cells. Luciferase assays showed that the activity of TOP flash was higher in P19CL6-Id1 cells than wildtype P19CL6 cells, while Id1 expression was also upregulated in P19CL6 cells treated with Wnt3a or LiCl. This indicates that there may be positive feedback between Id1 and Wnt signaling which plays an important role in cardiac differentiation.

  2. Frequency spectrum analysis of 252Cf neutron source based on LabVIEW

    International Nuclear Information System (INIS)

    Mi Deling; Li Pengcheng

    2011-01-01

    The frequency spectrum analysis of 252 Cf Neutron source is an extremely important method in nuclear stochastic signal processing. Focused on the special '0' and '1' structure of neutron pulse series, this paper proposes a fast-correlation algorithm to improve the computational rate of the spectrum analysis system. And the multi-core processor technology is employed as well as multi-threaded programming techniques of LabVIEW to construct frequency spectrum analysis system of 252 Cf neutron source based on LabVIEW. It not only obtains the auto-correlation and cross correlation results, but also auto-power spectrum,cross-power spectrum and ratio of spectral density. The results show that: analysis tools based on LabVIEW improve the fast auto-correlation and cross correlation code operating efficiency about by 25% to 35%, also verify the feasibility of using LabVIEW for spectrum analysis. (authors)

  3. Automatic spent fuel ID number reader (I)

    International Nuclear Information System (INIS)

    Tanabe, S.; Kawamoto, H.; Fujimaki, K.; Kobe, A.

    1991-01-01

    An effective and efficient technique has been developed for facilitating identification works of LWR spent fuel stored in large scale spent fuel storage pools of such as processing plants. Experience shows that there are often difficulties in the implementation of operator's nuclear material accountancy and control works as well as safeguards inspections conducted on spent fuel assemblies stored in deep water pool. This paper reports that the technique is realized as an automatic spent fuel ID number reader system installed on fuel handling machine. The ID number reader system consists of an optical sub-system and an image processing sub-system. Thousands of spent fuel assemblies stored in under water open racks in each storage pool could be identified within relatively short time (e.g. within several hours) by using this combination. Various performance tests were carried out on image processing sub-system in 1990 using TV images obtained from different types of spent fuel assemblies stored in various storage pools of PWR and BWR power stations

  4. INAA using 252Cf neutron source at University of Pune

    International Nuclear Information System (INIS)

    Rajurkar, N.S.

    2006-01-01

    The review presents the work done over last two decades on Instrumental Neutron Activation Analysis (INAA) by our research group at University of Pune using 252 Cf spontaneous fission neutron source. The technique has been applied in different fields viz. numismatics, industry, agriculture, ayurveda, environmental and health sciences and diffusion studies. A brief discussion of the work is presented in this article. (author)

  5. 48 CFR 252.228-7006 - Compliance with Spanish laws and insurance.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Compliance with Spanish... CLAUSES Text of Provisions And Clauses 252.228-7006 Compliance with Spanish laws and insurance. As prescribed at 228.370(e), use the following clause: Compliance with Spanish Laws and Insurance (DEC 1998) (a...

  6. ACE Gene I/D Polymorphism and Obesity in 1,574 Patients with Type 2 Diabetes Mellitus.

    Science.gov (United States)

    Pan, Yan-Hong; Wang, Min; Huang, Yan-Mei; Wang, Ying-Hui; Chen, Yin-Ling; Geng, Li-Jun; Zhang, Xiao-Xi; Zhao, Hai-Lu

    2016-01-01

    Association between ACE gene I/D polymorphism and the risk of overweight/obesity remains controversial. We investigated the possible relationship between ACE gene I/D polymorphism and obesity in Chinese type 2 diabetes mellitus (T2DM) patients. In this study, obesity was defined as a body mass index (BMI) value ≥ 25 kg/m 2 and subjects were classified into 4 groups (lean, normal, overweight, and obese). PCR (polymerase chain reaction) was used to detect the ACE gene I/D polymorphism in T2DM patients. Metabolic measurements including blood glucose, lipid profile, and blood pressure were obtained. Frequencies of the ACE genotypes (DD, ID, and II) were not significant among the 4 groups of BMI-defined patients ( P = 0.679) while ACE II carriers showed higher systolic blood pressure (SBP) and pulse pressure (PP) (all P ACE gene I/D polymorphism with obesity is insignificant in Chinese patients with T2DM. SBP and PP might be higher in the ACE II carriers than in the DD and ID carriers.

  7. DeID – A Data Sharing Tool for Neuroimaging Studies

    Directory of Open Access Journals (Sweden)

    Xuebo eSong

    2015-09-01

    Full Text Available Funding institutions and researchers increasingly expect that data will be shared to increase scientific integrity and provide other scientists with the opportunity to use the data with novel methods that may advance understanding in a particular field of study. In practice, sharing human subject data can be complicated because data must be de-identified prior to sharing. Moreover, integrating varied data types collected in a study can be challenging and time consuming. For example, sharing data from structural imaging studies of a complex disorder requires the integration of imaging, demographic and/or behavioral data in a way that no subject identifiers are included in the de-identified dataset and with new subject labels or identification values that cannot be tracked back to the original ones. We have developed a Java program that users can use to remove identifying information in neuroimaging datasets, while still maintaining the association among different data types from the same subject for further studies. This software provides a series of user interaction wizards to allow users to select data variables to be de-identified, implements functions for auditing and validation of de-identified data, and enables the user to share the de-identified data in a single compressed package through various communication protocols, such as FTPS and SFTP. DeID runs with Windows, Linux, and Mac operating systems and its open architecture allows it to be easily adapted to support a broader array of data types, with the goal of facilitating data sharing. DeID can be obtained at http://www.nitrc.org/projects/deid.

  8. Fast neutron therapy with high intensity Cf-252 sources by remotely controlled afterloading and clinical experiences in the treatment of gynaecological cancers

    International Nuclear Information System (INIS)

    Yamashita, H.; Hashimoto, S.; Wada, M.; Dokiya, T.

    1986-01-01

    Cf-252 fast neutron therapy with high intensity Cf-252 sources was tested for the treatment of advanced gynaecological cancers using a remotely controlled afterloading machine designed by the author and manufactured by Toshiba. Using high intensity sources and short treatment times in a special treatment room, personnel or environment exposure to radiation was at a safe level, i.e. almost nil. During 1978-1983 18 stage III cases of cancer of the uterine cervix were treated with complete response in 78% and 44% 5 year survivals. The types of acute and delayed effects of Cf-252 were the same as Co-60 or Cs-137 but the rectum was found sensitive in this system of brachytherapy. A dose of 1,000-1,500 cGy/6-10 F in 10-22 days of Cf-252 radiation was tolerated and produced tumor cure

  9. Prompt neutron energy spectrum for the spontaneous fission of Cf-252

    International Nuclear Information System (INIS)

    Blinov, M.V.; Boykov, G.S.; Vitenko, V.A.

    1985-06-01

    The prompt neutron spectrum for the spontaneous fission of Cf-252 has been measured in 0.01-10 MeV region by the time-of-flight technique using a fast ionization chamber with U-235 layers as the neutron detector. Numerical data for the spectrum are presented, with an error file. (author)

  10. 48 CFR 252.227-7019 - Validation of asserted restrictions-Computer software.

    Science.gov (United States)

    2010-10-01

    ..., creates or implies privity of contract between the Government and the Contractor's subcontractors or... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.227-7019 Validation of asserted restrictions..., unless otherwise specifically indicated, the term “Contractor” means the Contractor and its...

  11. Association of ACE gene A2350G and I/D polymorphisms with essential hypertension in the northernmost province of China.

    Science.gov (United States)

    Sun, Feifei; He, Ning; Zhang, Keyong; Wu, Nan; Zhao, Jingbo; Qiu, Changchun

    2018-01-01

    Angiotensin converting enzyme (ACE) gene, as a strong candidate gene for essential hypertension(EH), has been extensively studied. In this study, we carried out a population-based case-control study to explore whether ACE gene I/D and A2350G polymorphisms could consider to be risk factors for EH. A total of 2040 subjeces were recruited from Chinese Han in this study, out of which 1010 were cases and 1030 were normotensive individuals. ACE gene A2350G and I/D polymorphisms were amplified by polymerase chain reaction (PCR) and A2350G polymorphism was detected after restriction enzyme digestion with BstuI. Besides, we choosed 10% samples randomly sequencing to verify the accuracy of results. Genotype and allele frequencies distribution of I/D and A2350G in EH and control groups were significantly different. After grouped by sex or age, there were still statistical significances for two polymorphisms. In dominant and recessive model of A2350G, we found significant differences between two groups, respectively. For ACE I/D polymorphism, we observed that the existence of dramatical difference in dominant model between two groups, while in recessive model, marginally significant difference was found. Among the four haplotypes composed by ACE gene A2350G and I/D, haplotype G-D reached the statistical significance in two groups, and exhibited to be a risk factor for the development of EH, whose P ACE gene A2350G and I/D polymorphisms were associated with increasing the risk of suffering from EH in the northernmost province of China individuals, with D allele and G allele individuals had a higher risk of EH(OR = 1.443, 95%CI = 1.273-1.636 and OR = 1.481, 95%CI = 1.303-1.684).

  12. ID-1 mass storage system for mainframe by using FDDI network

    International Nuclear Information System (INIS)

    Morita, Y.; Fujii, H.; Inoue, E.; Kodama, H. Manabe, A.; Miyamoto, A.; Nomachi, M.; Watase, Y.; Yasu, Y.

    1994-01-01

    The authors have developed an ID-1 mass storage system as a distributed data server for Fujitsu mainframe computers. The system consists of a SONY ID-1 recorder DIR-1000, a tape robot system DMS-24 and a SCSI-II interface DFC-1500, which are connected to Spar Station 10 with an FDDI interface. The maximum speed of 7.5 Mbytes/sec is achieved for data transfer between Sparc Station 10 memory and DIR-1000 with a buffer size of 1 Mbytes. The system has been used successfully since last October to migrate more than 1 Tbytes data

  13. Quantum mechanical/molecular mechanical calculated reactivity networks reveal how cytochrome P450cam and Its T252A mutant select their oxidation pathways.

    Science.gov (United States)

    Wang, Binju; Li, Chunsen; Dubey, Kshatresh Dutta; Shaik, Sason

    2015-06-17

    Quantum mechanical/molecular mechanical calculations address the longstanding-question of a "second oxidant" in P450 enzymes wherein the proton-shuttle, which leads to formation of the "primary-oxidant" Compound I (Cpd I), was severed by mutating the crucial residue (in P450cam: Threonine-252-to-Alanine, hence T252A). Investigating the oxidant candidates Cpd I, ferric hydroperoxide, and ferric hydrogen peroxide (Fe(III)(O2H2)), and their reactions, generates reactivity networks which enable us to rule out a "second oxidant" and at the same time identify an additional coupling pathway that is responsible for the epoxidation of 5-methylenylcamphor by the T252A mutant. In this "second-coupling pathway", the reaction starts with the Fe(III)(O2H2) intermediate, which transforms to Cpd I via a O-O homolysis/H-abstraction mechanism. The persistence of Fe(III)(O2H2) and its oxidative reactivity are shown to be determined by interplay of substrate and protein. The substrate 5-methylenylcamphor prevents H2O2 release, while the protein controls the Fe(III)(O2H2) conversion to Cpd I by nailing-through hydrogen-bonding interactions-the conformation of the HO(•) radical produced during O-O homolysis. This conformation prevents HO(•) attack on the porphyrin's meso position, as in heme oxygenase, and prefers H-abstraction from Fe(IV)OH thereby generating H2O + Cpd I. Cpd I then performs substrate oxidations. Camphor cannot prevent H2O2 release and hence the T252A mutant does not oxidize camphor. This "second pathway" transpires also during H2O2 shunting of the cycle of wild-type P450cam, where the additional hydrogen-bonding with Thr252 prevents H2O2 release, and contributes to a successful Cpd I formation. The present results lead to a revised catalytic cycle of Cytochrome P450cam.

  14. Cf-252 neutron brachytherapy: an advance for bulky localized cancer therapy

    International Nuclear Information System (INIS)

    Maruyama, Y.

    1984-01-01

    The physical and radiobiogical basis as well as the rationale for neutron brachytherapy, using Cf-252, in human cancer therapy is reviewed. Cf-252 brachytherapy represents an economical and effective form of neutron radiotherapy that is readily and safely applied clinically. It can be used anywhere in the world without unusual personnel, equipment or facilities, or prohibitive expenses or maintenance costs. Used on bulky head and neck, thoracic, abdominal, pelvic, brain and appendage cancers, it overcomes hypoxic radioresistance and produces remarkable rates of tumor clearance. It is easily combined with photon radiotherapy and in proper schedules and doses, it can control advanced but still localized regional cancers to produce tumor cure. It will clear the local manifestations of recurrent or metastatic tumors or advanced stages of primary tumors and therefore in conjunction with other adjuvant therapies offers much more effective tumor control and palliation than present conventional therapy. (Auth.)

  15. Combination of electron beam irradiation and thermal treatment to enhance the shelf-life of traditional Indian fermented food (Idli)

    Science.gov (United States)

    Mulmule, Manoj D.; Shimmy, Shankar M.; Bambole, Vaishali; Jamdar, Sahayog N.; Rawat, K. P.; Sarma, K. S. S.

    2017-02-01

    Idli, a steam-cooked breakfast food item consumed in India, is famous as a staple food for its spongy texture and unique fermented taste. Idli preparation is a time consuming process; although instant Idli pre-mixes as powder or batter are available in the market, they do not have the distinctive taste and aroma similar to the Idli prepared at home. Hence ready-to-eat (RTE) form of this food is in demand. Therefore, an attempt was made to prepare RTE Idli bearing similar taste as home-cooked Idli with an extended shelf-life of up to two months at an ambient temperature using Electron Beam Irradiation (EBI) at dosages 2.5 kGy, 5 kGy and 7.5 kGy and combination processing comprised of EBI dosage at 2.5 kGy and thermal treatment (80 °C for 20 min). The treated Idli's were microbiologically and sensorially evaluated at storage periods of zero day, 14 days, 30 days and 60 days. Idli's irradiated at 7.5 kGy and subjected to combination processing at 2.5 kGy and thermal treatment were shelf-stable for 60 days. 2.5 kGy and 5 kGy radiation dosages alone were not sufficient to preserve Idli samples for more than 14 days. Undesirable change in sensory properties of Idli was observed at an EBI dosage of 7.5 kGy. Sensory properties of combination processed Idli's were found to undergo minor change over the storage period. The present work suggests that lowest radiation dosage in combination with thermal treatment could be useful to achieve the extended shelf-life without considerably impairing the organoleptic quality of Ready-to-Eat Idli.

  16. The Inventory of Depressive Symptomatology Self Report (IDS-SR: Psychometric properties of the Indonesian version.

    Directory of Open Access Journals (Sweden)

    Retha Arjadi

    Full Text Available Depression screening and examination in Indonesia are highly challenging due to the disproportionately low number of mental health professionals in comparison to the Indonesian population. Self-report questionnaires on depression are cost-effective and time-efficient. The current study investigates the psychometric properties of the Indonesian Inventory of Depressive Symptomatology Self Report (IDS-SR.The participants were 904 Indonesians (aged 16-61; 50.2% female, recruited via an online survey using Qualtrics. Confirmatory factor analysis of the one-factor, three-factor, and four-factor model were explored. Convergent and divergent validity of the total score of the Indonesian IDS-SR and each factor were examined, as well as the Cronbach's Alpha reliability. In addition, an optimal cut-off score for the Indonesian IDS-SR was established using ROC curve analysis.The three-factor model of "cognitive/mood", "anxiety/arousal", and "sleep disturbance" was the best fit with the Indonesian IDS-SR data. Convergent and divergent validity were good. Cronbach's Alpha reliability was excellent for the total score, good for the factors "cognitive/mood" and "anxiety/arousal", but insufficient for the factor "sleep disturbance". The optimal cut-off score of the Indonesian IDS-SR was 14, with 87% sensitivity and 86% specificity.As a multifactorial instrument to measure depression that has good validity and reliability, the Indonesian IDS-SR can be used to assess depressive symptoms for the purpose of research and clinical practice. The optimal cut-off score of the Indonesian IDS-SR is in accordance with the internationally used cut-off score.

  17. Screening of Lactobacillus plantarum isolated from fermented idli ...

    African Journals Online (AJOL)

    Probiotics are defined as live microorganisms which when administered in adequate amounts confer a health benefit on the host. The objective of this study was to screen eight potential probiotic Lactobacillus plantarum strains from fermented idli batter using in vitro assays such as bile tolerance, acid tolerance, transit ...

  18. A new module in neural differentiation control: two microRNAs upregulated by retinoic acid, miR-9 and -103, target the differentiation inhibitor ID2.

    Directory of Open Access Journals (Sweden)

    Daniela Annibali

    Full Text Available The transcription factor ID2 is an important repressor of neural differentiation strongly implicated in nervous system cancers. MicroRNAs (miRNAs are increasingly involved in differentiation control and cancer development. Here we show that two miRNAs upregulated on differentiation of neuroblastoma cells--miR-9 and miR-103--restrain ID2 expression by directly targeting the coding sequence and 3' untranslated region of the ID2 encoding messenger RNA, respectively. Notably, the two miRNAs show an inverse correlation with ID2 during neuroblastoma cell differentiation induced by retinoic acid. Overexpression of miR-9 and miR-103 in neuroblastoma cells reduces proliferation and promotes differentiation, as it was shown to occur upon ID2 inhibition. Conversely, an ID2 mutant that cannot be targeted by either miRNA prevents retinoic acid-induced differentiation more efficient than wild-type ID2. These findings reveal a new regulatory module involving two microRNAs upregulated during neural differentiation that directly target expression of the key differentiation inhibitor ID2, suggesting that its alteration may be involved in neural cancer development.

  19. 48 CFR 252.227-7037 - Validation of restrictive markings on technical data.

    Science.gov (United States)

    2010-10-01

    .... However, this clause neither creates nor implies privity of contract between the Government and... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.227-7037 Validation of restrictive markings on... following clause: Validation of Restrictive Markings on Technical Data (SEP 1999) (a) Definitions. The terms...

  20. Simultaneous investigation of fission fragments and neutrons in 252Cf(s,f)

    International Nuclear Information System (INIS)

    Budtz-Joergensen, C.; Knitter, H.H.

    1986-01-01

    The gridded twin ion chamber developed at CBNM is used to measure the kinetic energy-, mass- and angular distributions of the fission fragments of 252 Cf in an advantageous 4π-geometry. Together with a neutron time-of-flight detector this experimental arrangement permits to measure the correlation between neutron emission, fragment angle, mass and energy in the spontaneous fission of 252 Cf. With the present experimental set-up a mass resolution for fission fragments of 0.5 a.m.u., an angular resolution of Δcosθ = 0.05 and a timing resolution of 0.7 ns FWHM were observed. Preliminary evaluations of the raw experimental data are presented for the fission fragment mass distribution, the average total kinetic energy and their variance as function of mass, the angular distribution between fragments and neutrons, the number of neutrons emitted per fragment as function of fragment mass, the average neutron emission energies as function of mass, and the prompt fission neutron spectrum averaged over all fragments. (author)

  1. Id-1 gene and gene products as therapeutic targets for treatment of breast cancer and other types of carcinoma

    Science.gov (United States)

    Desprez, Pierre-Yves; Campisi, Judith

    2014-08-19

    A method for treatment of breast cancer and other types of cancer. The method comprises targeting and modulating Id-1 gene expression, if any, for the Id-1 gene, or gene products in breast or other epithelial cancers in a patient by delivering products that modulate Id-1 gene expression. When expressed, Id-1 gene is a prognostic indicator that cancer cells are invasive and metastatic.

  2. A study on the association between Angiotensin-I converting enzyme I/D dimorphism and type-2 diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Chmaisse Hania

    2009-01-01

    Full Text Available Type-2 diabetes mellitus (T2DM is a chronic disorder characterized by a varying range of predominant insulin resistance with relative insulin deficiency, to predominant insulin secretory defect with or without insulin resistance. Familial clustering as well as epidemiological studies has shown that genetic factors play a role in the development and progression of the disease. Among the genetic factors found to be associated with development of T2DM is the angiotensin-I converting enzyme (ACE gene, which is located on chromosome 17q23. This study was conducted to study the association between ACE gene insertion/deletion (I/D polymorphism and T2DM in a Lebanese diabetic cohort. Fifty-one patients with T2DM and 40 control subjects from different parts of Lebanon underwent genotyping for the ACE I/D, which was performed by PCR using specific primers. Chi-square and analysis of variance (ANOVA were used for asso-ciation studies and to assess the differences in the values among the groups. The distribution of the genotypes in the patients was as follows: 15/51 (29.4% were homozygous for deletion allele (DD genotype, 24/51 (47.1% were heterozygous (ID genotype, and 12/51 (23.5% were homo-zygous for insertion allele (II genotype. Among the control subjects, 16/40 (40% were homo-zygous for deletion (DD genotype, 13/40 (32.5% were heterozygous (ID genotype, and 11/40 (27.5% were homozygous for insertion (II genotype. The prevalence of the D-allele in T2DM patients (52.9% was not significantly different from that in the controls (56.3%. Thus, ACE I/D dimorphism cannot be considered a risk factor for T2DM in the Lebanese population.

  3. Associations of ACE I/D, AGT M235T gene polymorphisms with pregnancy induced hypertension in Chinese population: a meta-analysis.

    Science.gov (United States)

    Zhu, Ming; Zhang, Jie; Nie, Shaofa; Yan, Weirong

    2012-09-01

    There have been many studies concerning the associations of angiotensin-converting enzyme (ACE) I/D, angiotensinogen (AGT) M235T polymorphisms with pregnancy induced hypertension (PIH) among Chinese populations. However, the results were inconsistent, prompting the necessity of meta-analysis. Studies published in English and Chinese were mainly searched in EMbase, PubMed and CBM up to January 2012. Twenty-three studies with 3,551 subjects for ACE I/D and seven studies with 1,296 subjects for AGT M235T were included. Significant associations were found between ACE I/D and PIH under dominant, recessive and allelic models. A separate analysis confined to preeclampsia suggested that ACE I/D was associated with preeclampsia under recessive model and allelic model, but not dominant model. Stratified analyses were conducted as meta-regression analysis indicated that the sample size of case group was a significant source of heterogeneity, which suggested no significant association between ACE I/D and PIH in the subgroup of more than 100 cases. Associations were found between AGT M235T and PIH under dominant genetic model (OR = 1.59; 95 %CI: 1.04-2.42), recessive genetic model (OR = 1.60; 95 %CI: 1.07-2.40), and allelic model (OR = 1.40; 95 %CI: 1.17-1.68). No publication bias was found in either meta-analysis. The present meta-analysis suggested significant associations between ACE I/D, AGT M235T and PIH in Chinese populations. However, no significant association was found between ACE I/D and PIH in the subgroup of more than 100 cases. Studies with larger sample sizes are necessary to investigate the associations between gene polymorphisms and PIH in Chinese populations.

  4. Determining {sup 252}Cf source strength by absolute passive neutron correlation counting

    Energy Technology Data Exchange (ETDEWEB)

    Croft, S. [Oak Ridge National Laboratory, Oak Ridge, TN 37831-6166 (United States); Henzlova, D., E-mail: henzlova@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

    2013-06-21

    Physically small, lightly encapsulated, radionuclide sources containing {sup 252}Cf are widely used for a vast variety of industrial, medical, educational and research applications requiring a convenient source of neutrons. For many quantitative applications, such as detector efficiency calibrations, the absolute strength of the neutron emission is needed. In this work we show how, by using a neutron multiplicity counter the neutron emission rate can be obtained with high accuracy. This provides an independent and alternative way to create reference sources in-house for laboratories such as ours engaged in international safeguards metrology. The method makes use of the unique and well known properties of the {sup 252}Cf spontaneous fission system and applies advanced neutron correlation counting methods. We lay out the foundation of the method and demonstrate it experimentally. We show that accuracy comparable to the best methods currently used by national bodies to certify neutron source strengths is possible.

  5. {sup 5}He ternary fission yields of {sup 252}Cf and {sup 235}U(n,f)

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, J. K. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Ramayya, A. V. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Hamilton, J. H. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Beyer, C. J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Kormicki, J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Zhang, X. Q. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Rodin, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Formichev, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Kliman, J. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Krupa, L. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation)] (and others)

    2000-04-01

    The relative {sup 4}He and {sup 5}He ternary fission yields were determined from a careful analysis of the energy distribution of {alpha} spectra from a new measurement with a {sup 252}Cf source and from published data on {sup 252}Cf and {sup 235}U(n,f). The kinetic energies of the {sup 5}He and {sup 4}He ternary particles were found to be approximately 11 and 16 MeV, respectively. {sup 5}He particles contribute 10-20 % to the total alpha yield with the remainder originating from {sup 4}He accompanied fission. (c) 2000 The American Physical Society.

  6. Drug evaluation: FavId, a patient-specific idiotypic vaccine for non-Hodgkin's lymphoma.

    Czech Academy of Sciences Publication Activity Database

    Reiniš, Milan

    2007-01-01

    Roč. 9, č. 3 (2007), s. 291-298 ISSN 1464-8431 Institutional research plan: CEZ:AV0Z50520514 Keywords : non-Hodgkin's lymphoma * lymphoma vaccine FavId Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.526, year: 2007

  7. 48 CFR 252.219-7003 - Small business subcontracting plan (DoD contracts).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Small business... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.219-7003 Small business subcontracting plan (DoD contracts). As prescribed in 219.708(b)(1)(A), use the following clause: Small Business...

  8. Didactical suggestion for a Dynamic Hybrid Intelligent e-Learning Environment (DHILE) applying the PENTHA ID Model

    Science.gov (United States)

    dall'Acqua, Luisa

    2011-08-01

    The teleology of our research is to propose a solution to the request of "innovative, creative teaching", proposing a methodology to educate creative Students in a society characterized by multiple reference points and hyper dynamic knowledge, continuously subject to reviews and discussions. We apply a multi-prospective Instructional Design Model (PENTHA ID Model), defined and developed by our research group, which adopts a hybrid pedagogical approach, consisting of elements of didactical connectivism intertwined with aspects of social constructivism and enactivism. The contribution proposes an e-course structure and approach, applying the theoretical design principles of the above mentioned ID Model, describing methods, techniques, technologies and assessment criteria for the definition of lesson modes in an e-course.

  9. The ubiquitin ligase ASB4 promotes trophoblast differentiation through the degradation of ID2.

    Directory of Open Access Journals (Sweden)

    W H Davin Townley-Tilson

    Full Text Available Vascularization of the placenta is a critical developmental process that ensures fetal viability. Although the vascular health of the placenta affects both maternal and fetal well being, relatively little is known about the early stages of placental vascular development. The ubiquitin ligase Ankyrin repeat, SOCS box-containing 4 (ASB4 promotes embryonic stem cell differentiation to vascular lineages and is highly expressed early in placental development. The transcriptional regulator Inhibitor of DNA binding 2 (ID2 negatively regulates vascular differentiation during development and is a target of many ubiquitin ligases. Due to their overlapping spatiotemporal expression pattern in the placenta and contrasting effects on vascular differentiation, we investigated whether ASB4 regulates ID2 through its ligase activity in the placenta and whether this activity mediates vascular differentiation. In mouse placentas, ASB4 expression is restricted to a subset of cells that express both stem cell and endothelial markers. Placentas that lack Asb4 display immature vascular patterning and retain expression of placental progenitor markers, including ID2 expression. Using JAR placental cells, we determined that ASB4 ubiquitinates and represses ID2 expression in a proteasome-dependent fashion. Expression of ASB4 in JAR cells and primary isolated trophoblast stem cells promotes the expression of differentiation markers. In functional endothelial co-culture assays, JAR cells ectopically expressing ASB4 increased endothelial cell turnover and stabilized endothelial tube formation, both of which are hallmarks of vascular differentiation within the placenta. Co-transfection of a degradation-resistant Id2 mutant with Asb4 inhibits both differentiation and functional responses. Lastly, deletion of Asb4 in mice induces a pathology that phenocopies human pre-eclampsia, including hypertension and proteinuria in late-stage pregnant females. These results indicate that

  10. Brachytherapy of carcinoma of vulva with 252Cf

    International Nuclear Information System (INIS)

    Spikalovas, V.; Sinkevicius, V.; Drulia, E.; Kurtinaitis, J.

    1996-01-01

    Thirty patients with carcinoma of vulva were treated with interstitial neutron radiotherapy with 252 Cf. Age of patients was from 32 to 83 years. Stage I was in I patient, stage II - in 12, stage III was in 10 patients. The diagnosis of vulvar cancer was made for the first time in 11 cases, 19 patients had recurrences after the initial treatment. Most of these patients also received external irradiation for cancer of vulva and bilateral inguinal sites with a single fraction dose of 2 Gy to a total dose 30-50 Gy. Enlarged inguinal lymph nodes were irradiated additionally to 60 Gy with reduced field of irradiation. When radiotherapy was used repeatedly interstitial brachytherapy comprised the major part of irradiation dose or the therapy was used alone delivering 35-55 iGy. We used 252 Cf sources with increased activity at the ends 20-30 mm long. A number of inserted sources varied from 2 to 10, irradiation dose rate from 20.3 to 236.7 cGy/h, time of irradiation from 10.2 to 12. hours, RBE from 4.6 to 6.33. Special template device made it possible to implant sources in strictly pre-set geometry. Analysis of survival of patients showed that 2 years survival was 66%, 3 years - 60%, and 5 years survival was 49%. In two cases necrotic epithelitis developed with following radiation ulcer which were cured in 3-4 months. Clinical data showed great effectiveness of interstitial neutron therapy having in mind that 19 patients were treated for recurrences of vulvar cancer after previuos treatment

  11. Rethinking Social Network Assessment for Students with Intellectual Disabilities (ID) in Postsecondary Education

    Science.gov (United States)

    Eisenman, Laura T.; Farley-Ripple, Elizabeth; Culnane, Mary; Freedman, Brian

    2013-01-01

    Social networks of persons with intellectual disabilities (ID) have been characterized as smaller and less diverse than those of typical peers. Advocates have focused on strengthening those social networks by expanding circles of social support, protection, and friendship. As young adults with ID experience increasing levels of community…

  12. Angiotensin-converting enzyme I/D polymorphism in chronic obstructive pulmonary disease

    Directory of Open Access Journals (Sweden)

    Pabst S

    2009-12-01

    Full Text Available Abstract Study objective The etiology of chronic obstructive lung disease (COPD is unclear. It is supposed to be the product of an exogenous antigenic stimulus, such as tobacco smoke, and an endogenous genetic susceptibility. The angiotensin-converting enzyme (ACE gene contains a polymorphism based on the presence (insertion [I] or absence (deletion [D] of a 287-bp nonsense domain, resulting in three different genotypes (II, ID and DD. The aim of the study was to find out whether the ACE gene polymorphism can determine the course of COPD. Patients and design We genotyped 152 Caucasian patients with COPD and 158 healthy controls for the ACE (I/D polymorphism. We divided the COPD group into one group of 64 patients with a stable course of disease, defined as less than three hospitalizations over the last three years due to COPD, and another group of 88 patients with an instable course with more than three hospitalizations. Results The I-allele was significantly associated with an increased risk for COPD in a dominant model (OR 1.67 (95% CI 1.00 to 2.78, p = 0.048, but not in a recessive or co-dominant model. Moreover, the I-allele of ACE (I/D was significantly increased in patients with a stable course of COPD (p = 0.012 compared with controls. In a dominant model (II/ID v DD we found an even stronger association between the I-allele and a stable course of COPD (OR 3.24 (95% CI 1.44 to 7.31, p = 0.003. Conclusion These data suggest that the presence of an ACE I-allele determines a stable course of COPD.

  13. The fast neutron emission spectrum of 252-Cf

    International Nuclear Information System (INIS)

    Bensch, F.

    1979-07-01

    The aim of this work was a new measurement of the neutron emission spectrum of 252-Cf neutron standard sources as the IAEA is offering to users. The main feature was the application of gas-filled proton-recoil spectrometers and no TOF technique. The special interest of this document was in the temperature parameter of the Maxwellian distribution and in its relative deviations. In this connection, special measurements with high energy resolution were carried out in a search for fine structure neutron groups, which have been observed in some TOF measurements, but could not be reproduced during this measurement

  14. 48 CFR 252.219-7004 - Small business subcontracting plan (test program).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Small business... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.219-7004 Small business subcontracting plan (test program). As prescribed in 219.708(b)(1)(B), use the following clause: Small Business...

  15. 78 FR 773 - Hartford Financial Services Group, Inc., Commercial/Actuarial/Information Delivery Services (IDS...

    Science.gov (United States)

    2013-01-04

    ... Services Group, Inc., Commercial/Actuarial/ Information Delivery Services (IDS)/Corporate & Financial... Assistance (TAA) applicable to workers and former workers of Hartford Financial Services Group, Inc., Commercial/ Actuarial/Information Delivery Services (IDS)/Corporate & Financial Reporting group, Hartford...

  16. Development of the neutron reference calibration field using a 252Cf standard source surrounded with PMMA moderators

    International Nuclear Information System (INIS)

    Yoshida, T.; Kanai, K.; Tsujimura, N.

    2002-01-01

    The authors developed the neutron reference calibration fields using a 252 Cf standard source surrounded with PMMA moderators at the Japan Nuclear Cycle Development (JNC), Tokai Works. The moderators are co-axial, hollow cylinders made of lead-contained PMMA with a thickness of 13.5, 35.0, 59.5 and 77.0mm, and the 252 Cf source is guided to the geometric center of moderators by the pneumatic system. These fields can provide the moderated neutron spectra very similar to those encountered around the globe-boxes of the fabrication process of MOX (PuO 2 -UO 2 mixed oxide) fuel. The neutron energy spectrum at the reference calibration point was evaluated from the calculations by MCNP4B and the measurements by the INS-type Bonner multi-sphere spectrometer and the hydrogen-filled proportional counters. The calculated neutron spectra were in good agreements with the measured ones. These fields were characterized in terms of the neutron fluence rate, spectral composition and ambient dose equivalent rate, and have served for the response-characterization of various neutron survey instruments

  17. Cross-cultural adaptation, reliability, and validation of the Korean version of the identification functional ankle instability (IdFAI).

    Science.gov (United States)

    Ko, Jupil; Rosen, Adam B; Brown, Cathleen N

    2017-09-12

    To cross-culturally adapt the Identification Functional Ankle Instability for use with Korean-speaking participants. The English version of the IdFAI was cross-culturally adapted into Korean based on the guidelines. The psychometric properties in the Korean version of the IdFAI were measured for test-retest reliability, internal consistency, criterion-related validity, discriminative validity, and measurement error 181 native Korean-speakers. Intra-class correlation coefficients (ICC 2,1 ) between the English and Korean versions of the IdFAI for test-retest reliability was 0.98 (standard error of measurement = 1.41). The Cronbach's alpha coefficient was 0.89 for the Korean versions of IdFAI. The Korean versions of the IdFAI had a strong correlation with the SF-36 (r s  = -0.69, p 10 was the optimal cutoff score to distinguish between the group memberships. The minimally detectable change of the Korean versions of the IdFAI score was 3.91. The Korean versions of the IdFAI have shown to be an excellent, reliable, and valid instrument. The Korean versions of the IdFAI can be utilized to assess the presence of Chronic Ankle Instability by researchers and clinicians working among Korean-speaking populations. Implications for rehabilitation The high recurrence rate of sprains may result into Chronic Ankle Instability (CAI). The Identification of Functional Ankle Instability Tool (IdFAI) has been validated and recommended to identify patients with Chronic Ankle Instability (CAI). The Korean version of the Identification of Functional Ankle Instability Tool (IdFAI) may be also recommend to researchers and clinicians for assessing the presence of Chronic Ankle Instability (CAI) in Korean-speaking population.

  18. Complement factor 5 (C5) p.A252T mutation is prevalent in, but not restricted to, sub-Saharan Africa: implications for the susceptibility to meningococcal disease.

    Science.gov (United States)

    Franco-Jarava, C; Comas, D; Orren, A; Hernández-González, M; Colobran, R

    2017-08-01

    Complement C5 deficiency (C5D) is a rare primary immunodeficiency associated with recurrent infections, particularly meningitis, by Neisseria species. To date, studies to elucidate the molecular basis of hereditary C5D have included fewer than 40 families, and most C5 mutations (13 of 17) have been found in single families. However, the recently described C5 p.A252T mutation is reported to be associated with approximately 7% of meningococcal disease cases in South Africa. This finding raises the question of whether the mutation may be prevalent in other parts of Africa or other continental regions. The aim of this study was to investigate the prevalence of C5 p.A252T in Africa and other regions and discuss the implications for prophylaxis against meningococcal disease. In total, 2710 samples from healthy donors within various populations worldwide were analysed by quantitative polymerase chain reaction (qPCR) assay to detect the C5 p.A252T mutation. Eleven samples were found to be heterozygous for p.A252T, and nine of these samples were from sub-Saharan African populations (allele frequency 0·94%). Interestingly, two other heterozygous samples were from individuals in populations outside Africa (Israel and Pakistan). These findings, together with data from genomic variation databases, indicate a 0·5-2% prevalence of the C5 p.A252T mutation in heterozygosity in sub-Saharan Africa. Therefore, this mutation may have a relevant role in meningococcal disease susceptibility in this geographical area. © 2017 British Society for Immunology.

  19. Le traitement de l’idéologie dans la sociologie de Luc Boltanski

    Directory of Open Access Journals (Sweden)

    David Vrydaghs

    2006-10-01

    Full Text Available IntroductionLe concept d’idéologie apparaît dans la sociologie de Luc Boltanski à partir du Nouvel Esprit du capitalisme, publié en 1999. L’auteur y revient dans La Condition fœtale, paru en 2004. On aurait donc pu se contenter de ces ouvrages pour examiner le traitement réservé à l’idéologie dans la sociologie de Luc Boltanski. On préférera pourtant revenir aux travaux antérieurs du sociologue, et ce pour deux raisons.D’abord parce que le concept d’idéologie tel qu’il est employé dans Le Nou...

  20. Evaluation of the Micro-ID system for the identification of Yersinia pestis.

    OpenAIRE

    Harrison, D N; Williams, J E

    1985-01-01

    One hundred isolates of Yersinia pestis identified by conventional means were tested by the Micro-ID system to assess its reliability for distinguishing Y. pestis from other members of the family Enterobacteriaceae. The Micro-ID system gave Y. pestis as a choice for the identification of 89 of these cultures, although not always as the first choice. Most nitrate-negative strains of Y. pestis keyed out with Yersinia pseudotuberculosis as first choice and Y. pestis as second or fourth choice.

  1. Group-ID based RFID Mutual Authentication

    Directory of Open Access Journals (Sweden)

    LEE, Y.

    2013-11-01

    Full Text Available For passive type RFID tags, EPCglobal Class 1 Generation-2 Revision is used widely as a de facto standard. As it was designed for low cost, it is quite vulnerable to security issues, such as privacy concerns. This paper presents a new RFID mutual authentication protocol, which is designed to be configured on EPC Gen2 platform and to meet various security requirements while providing efficiency using PRNG (Pseudo Random Number Generator. Group-ID is used to minimize the authentication time. Security analysis of the proposed protocol is discussed.

  2. Convenient method of simultaneously analyzing aluminum and magnesium in pharmaceutical dosage forms using californium-252 thermal neutron activation

    International Nuclear Information System (INIS)

    Landolt, R.R.; Hem, S.L.

    1983-01-01

    A commercial antacid suspension containing aluminum hydroxide and magnesium hydroxide products was used as a model sample to study the use of a californium-252 thermal neutron activation as a method for quantifying aluminum content as well as for the simultaneous assay of aluminum and magnesium. A 3.5-micrograms californium-252 source was used for the activation, and the induced aluminum-28 and magnesium-27 activity was simultaneously measured by sodium iodide crystal gamma-ray spectrometry using dual single-channel analyzers and scalers. The antacid suspension was contained in a chamber designed with the unique capability of serving as the container for counting the induced radioactivity in addition to being the irradiation chamber itself. This pilot study demonstrated that use of more intense californium-252 sources, which are commonly available, would provide a method that is competitive with the ethylenediaminetetraacetic acid titration method in precision and in other aspects as well

  3. 48 CFR 252.229-7009 - Relief from customs duty and value added tax on fuel (passenger vehicles) (United Kingdom).

    Science.gov (United States)

    2010-10-01

    ... and value added tax on fuel (passenger vehicles) (United Kingdom). 252.229-7009 Section 252.229-7009... Relief from customs duty and value added tax on fuel (passenger vehicles) (United Kingdom). As prescribed in 229.402-70(i), use the following clause: Relief from Customs Duty and Value Added Tax on Fuel...

  4. Understanding the different rotational behaviors of $^{252}$No and $^{254}$No in terms of high-order deformation

    CERN Document Server

    Liu, H L; Walker, P M

    2012-01-01

    Total Routhian surface calculations have been performed to investigate rapidly rotating transfermium nuclei, the heaviest nuclei accessible by detailed spectroscopy experiments. The observed fast alignment in $^{252}$No and slow alignment in $^{254}$No are well reproduced by the calculations incorporating high-order deformations. The different rotational behaviors of $^{252}$No and $^{254}$No can be understood for the first time in terms of $\\beta_6$ deformation that decreases the energies of the $\

  5. 48 CFR 252.229-7006 - Value added tax exclusion (United Kingdom).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Value added tax exclusion... CLAUSES Text of Provisions And Clauses 252.229-7006 Value added tax exclusion (United Kingdom). As prescribed in 229.402-70(f), use the following clause: Value Added Tax Exclusion (United Kingdom) (JUN 1997...

  6. Angiotensin-I converting enzyme gene and I/D polymorphism ...

    Indian Academy of Sciences (India)

    Angiotensin-I converting enzyme gene and I/D polymorphism distribution in the Greek population and a comparison with other European populations. Sekerli Eleni Katsanidis Dimitrios Papadopoulou Vaya Makedou Areti Vavatsi Norma Gatzola Magdalini. Research Note Volume 87 Issue 1 April 2008 pp 91-93 ...

  7. Development of the PARA-ID Program to Simulate a Unified Viscoplasticity Behaviour

    International Nuclear Information System (INIS)

    Koo, Gyeong Hoi

    2009-01-01

    The PARA-ID code is a general purpose computer simulation program for a nonlinear cyclic material behavior with and without viscous effects, which can simulate various constitutive models such as - Prager Model - Armstrong and Frederick Model - Chaboche 3-decomposed rule Model - Chaboche 4-decomposed rule Model - Ohno and Wang Model - Unified Chaboche Viscoplastic Model In this paper, the unified Chaboche viscoplasticity model is investigated with some examples of application for a cyclic hardening material of 316L

  8. Group Representation of the Prompt Fission Neutron Spectrum of {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Croft, S.; Miller, K. A. [Safeguards Science and Technology Group (N-1), Nuclear Nonproliferation Division, Los Alamos National Laboratory, Los Alamos(United States)

    2011-12-15

    We review the spectral representation used for the prompt fission neutron spectrum of 252Cf in the International Organization for Standardization document ISO 8529-1. We find corrections to Table A.2, the discrete group structure form, of this report are needed. We describe the approach to generating replacement values and provide a new tabulation.

  9. The helix-loop-helix protein id1 controls stem cell proliferation during regenerative neurogenesis in the adult zebrafish telencephalon.

    Science.gov (United States)

    Rodriguez Viales, Rebecca; Diotel, Nicolas; Ferg, Marco; Armant, Olivier; Eich, Julia; Alunni, Alessandro; März, Martin; Bally-Cuif, Laure; Rastegar, Sepand; Strähle, Uwe

    2015-03-01

    The teleost brain has the remarkable ability to generate new neurons and to repair injuries during adult life stages. Maintaining life-long neurogenesis requires careful management of neural stem cell pools. In a genome-wide expression screen for transcription regulators, the id1 gene, encoding a negative regulator of E-proteins, was found to be upregulated in response to injury. id1 expression was mapped to quiescent type I neural stem cells in the adult telencephalic stem cell niche. Gain and loss of id1 function in vivo demonstrated that Id1 promotes stem cell quiescence. The increased id1 expression observed in neural stem cells in response to injury appeared independent of inflammatory signals, suggesting multiple antagonistic pathways in the regulation of reactive neurogenesis. Together, we propose that Id1 acts to maintain the neural stem cell pool by counteracting neurogenesis-promoting signals. © 2014 AlphaMed Press.

  10. Enhancing privacy of users in eID schemes

    NARCIS (Netherlands)

    Shrishak, Kris; Erkin, Z.; Schaar, Remco

    2016-01-01

    In todays world transactions are increasingly being performed over the internetbut require identication of users as in face-to-face transactions. In order to facilitate eGovernance as well as other eCommerce services Electronic Identiation(eID) schemes, which intend to provide unique and reliable

  11. Molecular weight determination of bisbenzyl-isoquinoline alkaloids by 252Cf-plasma desorption mass spectrometer

    International Nuclear Information System (INIS)

    Kohno, Hiroyuki; Tatsunami, Shinobu; Hiroi, Tomoko; Kouyama, Hiroshi; Taniguchi, Masashi; Yago, Nagasumi; Nakamura, Iwao

    1995-01-01

    Bisbenzylisoquinoline alkaloids of Stephania cepharantha have been used for various clinical purposes and recently reevaluated as stimulators of interleukin secretion in tissues. We analyzed molecular stuctures of bisbenzylisoquinoline alkaloids by determining their molecular weights using the 252 Cf-plasma desorption mass spectrometry (PDMS). The spectra were accumulated for 500 000 fission events. The acceleration voltage used here was 15 kV. Samples were analyzed using nitrocellulose-coated sample targets. Of the 5 alkaloids studied here, cepharanthine gave a main peak of molecular weight of 606.1 for the theoretical molecular weight of 606.7. The other minor peaks were considered to be demethylated fragment ions. 252 Cf-PDMS should be quite useful in studying structure, metabolism and pharmacokinetics of various drugs with extremely low coefficients of variation. (author)

  12. Validation of IRDFF in 252Cf Standard and IRDF-2002 Reference Neutron Fields

    Directory of Open Access Journals (Sweden)

    Simakov Stanislav

    2016-01-01

    Full Text Available The results of validation of the latest release of International Reactor Dosimetry and Fusion File, IRDFF-1.03, in the standard 252Cf(s.f. and reference 235U(nth,f neutron benchmark fields are presented. The spectrum-averaged cross sections were shown to confirm IRDFF-1.03 in the 252Cf standard spontaneous fission spectrum; that was not the case for the current recommended spectra for 235U(nth,f. IRDFF was also validated in the spectra of the research reactor facilities ISNF, Sigma-Sigma and YAYOI, which are available in the IRDF-2002 collection. The ISNF facility was re-simulated to remove unphysical oscillations in the spectrum. IRDFF-1.03 was shown to reproduce reasonably well the spectrum-averaged data measured in these fields except for the case of YAYOI.

  13. Revocable ID-Based Signature with Short Size over Lattices

    Directory of Open Access Journals (Sweden)

    Ying-Hao Hung

    2017-01-01

    Full Text Available In the past, many ID-based signature (IBS schemes based on the integer factorization or discrete logarithm problems were proposed. With the progress on the development of quantum technology, IBS schemes mentioned above would become vulnerable. Recently, several IBS schemes over lattices were proposed to be secure against attacks in the quantum era. As conventional public-key settings, ID-based public-key settings have to offer a revocation mechanism to revoke misbehaving or malicious users. However, in the past, little work focuses on the revocation problem in the IBS schemes over lattices. In this article, we propose a new revocable IBS (RIBS scheme with short size over lattices. Based on the short integer solution (SIS assumption, we prove that the proposed RIBS scheme provides existential unforgeability against adaptive chosen-message attacks. As compared to the existing IBS schemes over lattices, our RIBS scheme has better performance in terms of signature size, signing key size, and the revocation mechanism with public channels.

  14. Study of biological effects of varying mixtures of Cf-252 and gamma radiation on the acute radiation syndromes: Relevance to clinical radiotherapy of radioresistant cancer

    International Nuclear Information System (INIS)

    Maruyama, Y.; Wierzbicki, J.; Feola, J.M.

    1993-01-01

    Data for the 30 day bone marrow syndrome (BM-50) and the 6-10 day gastrointestinal (GI-50) syndrome for a one and two fraction schedule and acute and low dose rate irradiation using pure and mixed Cf-252 and photon radiation are presented. The radiation of Cf-252 is a mixture of neutrons and gamma rays. Balb/c mice of both sexes were total body irradiated with acute Co-60, low dose rate Cs-137 and Cf-252 using a 1 x and 2 x schedule. For low linear energy transfer radiations of Co-60 or Cs-137 there was expected to be an increase in the dose to produce the gastrointestinal and bone marrow syndromes with minimal change for Cf-252 neutrons. The proportion of photons in the Cf-252 radiation field were further altered by mixing Cs-137 with the Cf-252 sources and mice were total body irradiated with different proportions of photons to determine the effect on the radiation syndromes. The effects of mixing Cf-252 neutrons with different proportions of photons on the syndromes was determined. There was increase in BM-50 and GI-50 doses with fractionated or low dose rate photon irradiations and the dose modifying factors were 1.3-1.4 for the GI syndrome and 1.2 for the bone marrow syndrome. For Cf-252 there was minimal fractionation effect for the GI-50 syndrome, which increased by 1.1 for x 1 vs. x 2 fractions; for the BM-50 syndrome it rose by a 1.1 factor. For LDR Cs-137 the dose for the GI-50 syndrome rose 2.2-fold. For mixed neutron-photon radiation of 0%, 15%, 35%, and 65% η/γ mixtures, the dose to produce the BM-50 and GI-50 endpoints dropped sharply from 0 to 35% neutrons and remained flat thereafter. For major tissues such as the bone marrow and GI tract, Cf-252 behaved as high linear energy transfer for mixtures of neutrons and gamma rays when the radiations were delivered simultaneously at the low dose rates studied. 35 refs., 3 figs., 2 tabs

  15. Identification and genetic analysis of Panama-genotype Venezuelan equine encephalitis virus subtype ID in Peru.

    Science.gov (United States)

    Oberste, M S; Weaver, S C; Watts, D M; Smith, J F

    1998-01-01

    Venezuelan equine encephalitis (VEE) virus was isolated in 1993, 1994, and 1995 from human cases of acute, undifferentiated, febrile illness in the Peruvian Amazon Basin. Two virus isolates were recovered in 1994 from Peruvian soldiers at a jungle outpost near Pantoja in northern Peru, and 10 isolates were obtained from military personnel and civilians in 1993-1995 in Iquitos, an urban center in northeastern Peru. The genetic relationship of these isolates to other VEE virus strains was determined by sequencing 856-867 nucleotide reverse transcription-polymerase chain reaction fragments derived from the PE2 glycoprotein gene. The sequences were compared with those of other VEE virus strains, including representatives of the IAB, IC, ID, IE, II, and IIIC subtypes. The two Pantoja isolates were most closely related to subtype IC and ID viruses previously isolated in Colombia and Venezuela, and to the ID viruses isolated during the 1970s in Iquitos. All of the recent Iquitos isolates were similar to one another, but they were more closely related to Panamanian ID strains than to isolates previously obtained in Iquitos, Peru, or in Colombia and Venezuela. The recent Iquitos VEE viral isolates were the first Panama-genotype VEE ID virus strains identified outside of the Republic of Panama.

  16. An evaluation of the spontaneous fission prompt neutron spectrum of 252Cf

    International Nuclear Information System (INIS)

    Bojkov, G.S.; Yurevich, V.I.

    1987-01-01

    An evaluation of the spontaneous fission prompt neutron spectrum of 252 Cf from 1 keV to 20 MeV is described. Variance-covariance matrices for a number of recent experimental data sets were constructed and used to evaluate the neutron spectrum following a Bayesian procedure. The evaluated spectrum is compared with various experimental and theoretical representations. (author)

  17. Ubiquitin-SUMO Circuitry Controls Activated Fanconi Anemia ID Complex Dosage in Response to DNA Damage

    DEFF Research Database (Denmark)

    Gibbs-Seymour, Ian; Oka, Yasuyoshi; Rajendra, Eeson

    2015-01-01

    We show that central components of the Fanconi anemia (FA) DNA repair pathway, the tumor suppressor proteins FANCI and FANCD2 (the ID complex), are SUMOylated in response to replication fork stalling. The ID complex is SUMOylated in a manner that depends on the ATR kinase, the FA ubiquitin ligase...

  18. Validating criticality calculations for spent fuel with 252Cf-source-driven noise measurements

    International Nuclear Information System (INIS)

    Mihalczo, J.T.; Krass, A.W.; Valentine, T.E.

    1992-01-01

    The 252 Cf-Source-driven noise analysis method can be used for measuring the subcritical neutron multiplication factor k of arrays of spent light water reactor (LWR) fuel. This type of measurement provides a parameter that is directly related to the criticality state of arrays of LWR fuel. Measurements of this parameter can verify the criticality safety margins of spent LWR fuel configurations and thus could be a means of obtaining the information to justify burnup credit for spent LWR transportation/storage casks. The practicality of a measurement depends on the ability to install the hardware required to perform the measurement. Source chambers containing the 252 Cf at the required source intensity for this application have been constructed and have operated successfully for ∼10 years and can be fabricated to fit into control rod guide tubes of PWR fuel elements. Fission counters especially developed for spent-fuel measurements are available that would allow measurements of a special 3 x 3 spent fuel array and a typical burnup credit rail cask with spent fuel in unborated water. Adding a moderator around these fission counters would allow measurements with the typical burnup credit rail cask with borated water and the special 3 x 3 array with borated water. The recent work of Ficaro on modifying the KENO Va code to calculate by the Monte Carlo method the time sequences of pulses at two detectors near a fissile assembly from the fission chain multiplication process, initiated by a 252 Cf source in the assembly allows a direct computer calculation of the noise analysis data from this measurement method

  19. Identification of clinical yeasts by Vitek MS system compared with API ID 32 C.

    Science.gov (United States)

    Durán-Valle, M Teresa; Sanz-Rodríguez, Nuria; Muñoz-Paraíso, Carmen; Almagro-Moltó, María; Gómez-Garcés, José Luis

    2014-05-01

    We performed a clinical evaluation of the Vitek MS matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS) system with the commercial database version 2.0 for rapid identification of medically important yeasts as compared with the conventional phenotypic method API ID 32 C. We tested 161 clinical isolates, nine isolates from culture collections and five reference strains. In case of discrepant results or no identification with one or both methods, molecular identification techniques were employed. Concordance between both methods was observed with 160/175 isolates (91.42%) and misidentifications by both systems occurred only when taxa were not included in the respective databases, i.e., one isolate of Candida etchellsii was identified as C. globosa by Vitek MS and two isolates of C. orthopsilosis were identified as C. parapsilosis by API ID 32 C. Vitek MS could not identify nine strains (5.14%) and API ID 32 C did not identify 13 (7.42%). Vitek MS was more reliable than API ID 32 C and reduced the time required for the identification of clinical isolates to only a few minutes.

  20. Dosimetric analysis of BNCT - Boron Neutron Capture Therapy - coupled to 252Cf brachytherapy

    International Nuclear Information System (INIS)

    Brandao, Samia F.; Campos, Tarcisio P.R.

    2009-01-01

    The incidence of brain tumors is increasing in world population; however, the treatments employed in this type of tumor have a high rate of failure and in some cases have been considered palliative, depending on histology and staging of tumor. Its necessary to achieve the control tumor dose without the spread irradiation cause damage in the brain, affecting patient neurological function. Stereotactic radiosurgery is a technique that achieves this; nevertheless, other techniques that can be used on the brain tumor control must be developed, in order to guarantee lower dose on health surroundings tissues other techniques must be developing. The 252 Cf brachytherapy applied to brain tumors has already been suggested, showing promising results in comparison to photon source, since the active source is placed into the tumor, providing greater dose deposition, while more distant regions are spared. BNCT - Boron Neutron Capture Therapy - is another technique that is in developing to brain tumors control, showing theoretical superiority on the rules of conventional treatments, due to a selective irradiation of neoplasics cells, after the patient receives a borate compound infusion and be subjected to a epithermal neutrons beam. This work presents dosimetric studies of the coupling techniques: BNCT with 252 Cf brachytherapy, conducted through computer simulation in MCNP5 code, using a precise and well discretized voxel model of human head, which was incorporated a representative Glioblastoma Multiform tumor. The dosimetric results from MCNP5 code were exported to SISCODES program, which generated isodose curves representing absorbed dose rate in the brain. Isodose curves, neutron fluency, and dose components from BNCT and 252 Cf brachytherapy are presented in this paper. (author)

  1. Replication and Comparison of the Newly Proposed ADOS-2, Module 4 Algorithm in ASD without ID: A Multi-Site Study

    Science.gov (United States)

    Pugliese, Cara E.; Kenworthy, Lauren; Bal, Vanessa Hus; Wallace, Gregory L.; Yerys, Benjamin E.; Maddox, Brenna B.; White, Susan W.; Popal, Haroon; Armour, Anna Chelsea; Miller, Judith; Herrington, John D.; Schultz, Robert T.; Martin, Alex; Anthony, Laura Gutermuth

    2015-01-01

    Recent updates have been proposed to the Autism Diagnostic Observation Schedule-2 Module 4 diagnostic algorithm. This new algorithm, however, has not yet been validated in an independent sample without intellectual disability (ID). This multi-site study compared the original and revised algorithms in individuals with ASD without ID. The revised…

  2. The Danish eID Case: Twenty years of Delay

    DEFF Research Database (Denmark)

    Hoff, Jens Villiam; Hoff, Frederik Villiam

    2010-01-01

    the technological, organizational and legal dimensions of eID in Denmark, and comparing these with a number of other European countries made it possible to explain this paradox. Thus, the three main reasons for the special route development has taken in Denmark seems to be concerns over privacy, lack...

  3. Dispersions and correlations of the distributions of products of 252Cf spontaneous fission

    International Nuclear Information System (INIS)

    Vidyakin, G.S.; Vyrodov, V.N.; Gurevich, I.I.; Kirillov, B.F.; Kozlov, Y.V.; Martem'yanov, V.P.; Sukhotin, S.V.; Tarasenkov, V.G.; Khakimov, S.K.

    1982-01-01

    We report the results of two experiments on study of the dispersions and correlations of the distributions of products of the spontaneous fission of 252 Cf. In each experiment about 10 8 fissions were recorded with simultaneous measurement of the number of neutrons produced and in one case the fragment kinetic energy and in the other case the energy of the prompt #betta# rays. The quantities obtained were the probabilities of production of a given number of neutrons per fission, the dispersions of the distributions of the number of neutrons produced and of the fragment kinetic energy, and the dependence of the average #betta#-ray energy and the average fragment kinetic energy on the number of neutrons produced. A calculation is made of the spectrum of the total energy carried away by fragments and neutrons, and its dispersion is determined. An estimate of the total energy release in the 252 Cf fission process is made

  4. Development of the neutron reference calibration field using a {sup 252}Cf standard source surrounded with PMMA moderators

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, T.; Kanai, K.; Tsujimura, N. [Japan Nuclear Cycle Development Institute, Ibaraki-ken (Japan)

    2002-07-01

    The authors developed the neutron reference calibration fields using a {sup 252} Cf standard source surrounded with PMMA moderators at the Japan Nuclear Cycle Development (JNC), Tokai Works. The moderators are co-axial, hollow cylinders made of lead-contained PMMA with a thickness of 13.5, 35.0, 59.5 and 77.0mm, and the {sup 252} Cf source is guided to the geometric center of moderators by the pneumatic system. These fields can provide the moderated neutron spectra very similar to those encountered around the globe-boxes of the fabrication process of MOX (PuO{sub 2}-UO{sub 2} mixed oxide) fuel. The neutron energy spectrum at the reference calibration point was evaluated from the calculations by MCNP4B and the measurements by the INS-type Bonner multi-sphere spectrometer and the hydrogen-filled proportional counters. The calculated neutron spectra were in good agreements with the measured ones. These fields were characterized in terms of the neutron fluence rate, spectral composition and ambient dose equivalent rate, and have served for the response-characterization of various neutron survey instruments.

  5. Relative biological effectiveness (R.B.E.) of Cf-252 vs. acute Co-60 and low dose rate Cs-137 irradiation by spleen weight loss

    International Nuclear Information System (INIS)

    Maruyama, Y.; Feola, J.M.; Magura, C.; Beach, J.L.

    1986-01-01

    R.B.E. of Cf-252 on lymphoid tissue was assessed by radiation study of spleen weight loss following acute Co-60, and low dose rate (L.D.R.) Cs-137 and Cf-252 irradiations. Acute Co-60 and L.D.R. Cs-137 dose-response followed two component exponential curves with a 1.3-fold greater effect of L.D.R. Cs-137 vs. acute Co-60 on the first slope and 1.9-fold greater effect for the 2nd slope. L.D.R. Cf-252 response was 1.3 x greater than acute Co-60 but was 1.0 vs. L.D.R. Cs-137 for the first slope indicating a similar effect of Cf-252 mixed neutron/gamma radiation to L.D.R. gamma radiation in producing spleen shrinkage. There was no effect of different sequences and schedules of mixing acute Co-60 with Cf-252 irradiation observed by endogenous CFU-S survival. The R.B.E. of 1.0 - 1.9 indicates that lymphohemopoietic in vivo, presumably well oxygenated, does not respond acutely or as sensitively as hypoxic tumor where R.B.E. is 5 - 7. (author)

  6. Towards fraud-proof ID documents using multiple data hiding technologies and biometrics

    Science.gov (United States)

    Picard, Justin; Vielhauer, Claus; Thorwirth, Niels

    2004-06-01

    Identity documents, such as ID cards, passports, and driver's licenses, contain textual information, a portrait of the legitimate holder, and eventually some other biometric characteristics such as a fingerprint or handwritten signature. As prices for digital imaging technologies fall, making them more widely available, we have seen an exponential increase in the ease and the number of counterfeiters that can effectively forge documents. Today, with only limited knowledge of technology and a small amount of money, a counterfeiter can effortlessly replace a photo or modify identity information on a legitimate document to the extent that it is very diffcult to differentiate from the original. This paper proposes a virtually fraud-proof ID document based on a combination of three different data hiding technologies: digital watermarking, 2-D bar codes, and Copy Detection Pattern, plus additional biometric protection. As will be shown, that combination of data hiding technologies protects the document against any forgery, in principle without any requirement for other security features. To prevent a genuine document to be used by an illegitimate user,biometric information is also covertly stored in the ID document, to be used for identification at the detector.

  7. Replication and Comparison of the Newly Proposed ADOS-2, Module 4 Algorithm in ASD without ID: A Multi-site Study

    OpenAIRE

    Pugliese, Cara E.; Kenworthy, Lauren; Bal, Vanessa Hus; Wallace, Gregory L; Yerys, Benjamin E; Maddox, Brenna B.; White, Susan W.; Popal, Haroon; Armour, Anna Chelsea; Miller, Judith; Herrington, John D.; Schultz, Robert T.; Martin, Alex; Anthony, Laura Gutermuth

    2015-01-01

    Recent updates have been proposed to the Autism Diagnostic Observation Schedule-2 Module 4 diagnostic algorithm. This new algorithm, however, has not yet been validated in an independent sample without intellectual disability (ID). This multi-site study compared the original and revised algorithms in individuals with ASD without ID. The revised algorithm demonstrated increased sensitivity, but lower specificity in the overall sample. Estimates were highest for females, individuals with a verb...

  8. 4π-spectrometer technique for measurements of secondary neutron average number in nuclear fission by 252Cf neutrons

    International Nuclear Information System (INIS)

    Vasil'ev, Yu.A.; Barashkov, Yu.A.; Golovanov, O.A.; Sidorov, L.V.

    1977-01-01

    A method for determining the average number of secondary neutrons anti ν produced in nuclear fission by the neutrons of the 252 Cf fission spectra by means of a 4π time-of-flight spectrometer is described. Layers of 252 Cf and an isotope studied are placed close to each other; if the isotope layer density is 1 mg/cm 2 probability of its fission is about 10 -5 per one spontaneous fission of californium. Fission fragments of 252 Cf and the isotope investigated have been detected by two surface-barrier counters with an efficiency close to 100%. The layers and the counters are situated in a measuring chamber placed in the center of the 4π time-of-flight spectrometer. The latter is utilized as a neutron counter because of its fast response. The method has been verified by carrying out measurements for 235 U and 239 Pu. A comparison of the experimental and calculated results shows that the method suggested can apply to determine the number of secondary neutrons in fission of isotopes that have not been investigated yet

  9. Inhibition of muscle-specific gene expression by Id3: requirement of the C-terminal region of the protein for stable expression and function.

    Science.gov (United States)

    Chen, B; Han, B H; Sun, X H; Lim, R W

    1997-01-15

    We have examined the role of an Id-like protein, Id3 (also known as HLH462), in the regulation of muscle-specific gene expression. Id proteins are believed to block expression of muscle-specific genes by preventing the dimerization between ubiquitous bHLH proteins (E proteins) and myogenic bHLH proteins such as MyoD. Consistent with its putative role as an inhibitor of differentiation, Id3 mRNA was detected in proliferating skeletal muscle cells, was further induced by basic fibroblast growth factor (bFGF) and was down-regulated in differentiated muscle cultures. Overexpression of Id3 efficiently inhibited the MyoD-mediated activation of the muscle-specific creatine kinase (MCK) reporter gene. Deletion analysis indicated that the C-terminal 15 amino acids of Id3 are critical for the full inhibitory activity while deleting up to 42 residues from the C-terminus of the related protein, Id2, did not affect its ability to inhibit the MCK reporter gene. Chimeric protein containing the N-terminal region of Id3 and the C-terminus of Id2 was also non-functional in transfected cells. In contrast, wild-type Id3, the C-terminal mutants, and the Id3/Id2 chimera could all interact with the E-protein E47in vitro. Additional studies indicated that truncation of the Id3 C-terminus might have adversely affected the expression level of the mutant proteins but the Id3/Id2 chimera was stably expressed. Taken together, our results revealed a more complex requirement for the expression and proper function of the Id family proteins than was hitherto expected.

  10. Id1 expression promotes peripheral CD4{sup +} T cell proliferation and survival upon TCR activation without co-stimulation

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Chen; Jin, Rong [Department of Immunology, Peking University Health Science Center, Beijing (China); Wang, Hong-Cheng [Oklahoma Medical Research Foundation, Oklahoma City, OK (United States); Tang, Hui; Liu, Yuan-Feng; Qian, Xiao-Ping; Sun, Xiu-Yuan; Ge, Qing [Department of Immunology, Peking University Health Science Center, Beijing (China); Sun, Xiao-Hong, E-mail: sunx@omrf.org [Oklahoma Medical Research Foundation, Oklahoma City, OK (United States); Zhang, Yu, E-mail: zhangyu007@bjmu.edu.cn [Department of Immunology, Peking University Health Science Center, Beijing (China)

    2013-06-21

    Highlights: •Id1 expression enables naïve T cell proliferation without anti-CD28 co-stimulation. •Id1 expression facilitates T cells survival when stimulated with anti-CD3. •Elevation of IL-2 production by Id1 contributes increased proliferation and survival. •Id1 potentiates NF-κB activation by anti-CD3 stimulation. -- Abstract: Although the role of E proteins in the thymocyte development is well documented, much less is known about their function in peripheral T cells. Here we demonstrated that CD4 promoter-driven transgenic expression of Id1, a naturally occurring dominant-negative inhibitor of E proteins, can substitute for the co-stimulatory signal delivered by CD28 to facilitate the proliferation and survival of naïve CD4{sup +} cells upon anti-CD3 stimulation. We next discovered that IL-2 production and NF-κB activity after anti-CD3 stimulation were significantly elevated in Id1-expressing cells, which may be, at least in part, responsible for the augmentation of their proliferation and survival. Taken together, results from this study suggest an important role of E and Id proteins in peripheral T cell activation. The ability of Id proteins to by-pass co-stimulatory signals to enable T cell activation has significant implications in regulating T cell immunity.

  11. 48 CFR 252.222-7004 - Compliance with Spanish social security laws and regulations.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Compliance with Spanish... PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.222-7004 Compliance with Spanish social... Spanish Social Security Laws and Regulations (JUN 1997) (a) The Contractor shall comply with all Spanish...

  12. The development and psychometric evaluation of the Internet Disorder Scale (IDS-15).

    Science.gov (United States)

    Pontes, Halley M; Griffiths, Mark D

    2017-01-01

    Previously published research suggests that improvement in the assessment of Internet addiction (IA) is paramount in advancing the field. However, little has been done to address inconsistencies in the assessment of IA using a more updated framework. The aim of the present study was to develop a new instrument to assess IA based on a modification of the nine Internet Gaming Disorder (IGD) criteria as suggested by the American Psychiatric Association in the latest (fifth) edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5), and to provide a taxonomy of the potential risk of IA risk among participants. A heterogeneous sample of Internet users (n=1105) was recruited online (61.3% males, mean age 33years). Construct validity of the new instrument - Internet Disorder Scale (IDS-15) - was assessed by means of factorial, convergent, and discriminant validity. Criterion-related validity and reliability were also investigated. Additionally, latent profile analysis (LPA) was carried out to differentiate and characterize Internet users based on their potential IA risk. The construct and criterion-related validity of the IDS-15 were both warranted. The IDS-15 proved to be a valid and reliable tool. Using the LPA, participants were classed as "low addiction risk" (n=183, 18.2%), "medium addiction risk" (n=456, 41.1%), and "high addiction risk" (n=455, 40.77%). Furthermore, key differences emerged among these classes in terms of age, relationship status, cigarette consumption, weekly Internet usage, age of Internet use initiation, and IDS-15 total scores. The present findings support the viability of using adapted IGD criteria as a framework to assess IA. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Development of neutron induced prompt γ-ray spectroscopy system using 252Cf

    International Nuclear Information System (INIS)

    Park, Yong-Joon; Song, Byung-Chul; Jee, Kwang-Yong

    2003-01-01

    For the design and set-up of neutron induced prompt γ-ray spectroscopy system using 252 Cf neutron source, the effects of shielding and moderator materials have been examined. The 252 Cf source being used for TLD badge calibration in Korea Atomic Energy Research Institute was utilized for this preliminary experiment. The γ-ray background and prompt γ-ray spectrum of the sample containing Cl were measured using HPGe (GMX 69% relative efficiency) located at the inside of the system connected to notebook PC at the outside of the system (about 20 meter distance). The background activities of neutron and γ-rays were measured with neutron survey meter as well as γ-ray survey meters, respectively and the system was designed to minimize the activities. Prompt γ-ray spectrum was measured using γ-γ coincident system for reduce the background and the continuum spectrum. The optimum system was designed and set up using the experimental data obtained

  14. ACE I/D polymorphism in Indian patients with hypertrophic cardiomyopathy and dilated cardiomyopathy

    DEFF Research Database (Denmark)

    Rai, Taranjit Singh; Dhandapany, Perundurai Subramaniam; Ahluwalia, Tarun Veer Singh

    2008-01-01

    The study was carried to determine the association of angiotensin converting enzyme (ACE) insertion/deletion (I/D) polymorphism with the risk of hypertrophic cardiomyopathy (HCM), dilated cardiomyopathy (DCM), and restrictive cardiomyopathy (RCM).......The study was carried to determine the association of angiotensin converting enzyme (ACE) insertion/deletion (I/D) polymorphism with the risk of hypertrophic cardiomyopathy (HCM), dilated cardiomyopathy (DCM), and restrictive cardiomyopathy (RCM)....

  15. Assessment of the relationship between ACE I/D gene polymorphism and renal allograft survival.

    Science.gov (United States)

    Yang, Chun-Hua; Lu, Yi; Chen, Xue-Xia; Xian, Wen-Feng; Tu, Wei-Feng; Li, Hong-Yan

    2015-12-01

    The relationship between the angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism and renal allograft survival after renal transplantation from the published reports are still debatable. This study was performed to evaluate the relationship between the ACE I/D gene polymorphism and renal allograft survival after renal transplantation using meta-analysis. Eligible studies were identified from PubMed and Cochrane Library on 1 November 2014, and eligible studies were recruited and synthesized using a meta-analysis methodology. Twelve investigations were included in this meta-analysis for the assessment of the relationship between the ACE I/D gene polymorphism and renal allograft survival. In this meta-analysis, the ACE I/D gene polymorphism was not associated with renal allograft survival after renal transplantation for overall populations, Caucasians, Brazilians and Africans. Interestingly, the ACE D allele and DD genotype were associated with renal allograft survival after renal transplantation in the Asian population. ACE D allele and DD genotype were associated with renal allograft survival after renal transplantation in the Asian population. However, more studies should be performed to confirm this association. © The Author(s) 2015.

  16. DD Genotype of ACE I/D Polymorphism Might Confer Protection against Dental Caries in Polish Children.

    Science.gov (United States)

    Olszowski, Tomasz; Adler, Grażyna; Janiszewska-Olszowska, Joanna; Safranow, Krzysztof; Chlubek, Dariusz

    2015-01-01

    The aim of the study was to examine the frequencies of the genotypes and alleles of ACE insertion/deletion (I/D) polymorphism and their association with dental caries in a sample of Polish children. The study subjects were 120 children with dental caries experience (cases) and 41 caries-free individuals (controls). The genotyping was performed using polymerase chain reaction. The genotype distributions of ACE I/D polymorphism were not statistically different between carious and control children. However, we found a borderline overrepresentation of the II + ID genotypes versus the DD genotype in the carious compared to the control group (69.2% and 51.2%, respectively, p = 0.057). Logistic regression analysis adjusted for age and sex revealed that I allele carriage was a significant predictor of dental caries susceptibility (OR = 2.14, 95% CI = 1.02-4.49, p = 0.041). In conclusion, the DD genotype of ACE I/D polymorphism might be protective against dental caries in Polish children. © 2015 S. Karger AG, Basel.

  17. Secure OpenID Authentication Model by Using Trusted Computing

    Directory of Open Access Journals (Sweden)

    E. Ghazizadeh

    2014-01-01

    Full Text Available The growth of Internet online services has been very quick in recent years. Each online service requires Internet users to create a new account to use the service. The problem can be seen when each user usually needs more than one service and, consequently, has numerous accounts. These numerous accounts have to be managed in a secure and simple way to be protected against identity theft. Single sign-on (SSO and OpenID have been used to decrease the complexity of managing numerous accounts required in the Internet identity environment. Trusted Platform Module (TPM and Trust Multitenancy are great trusted computing-based technologies to solve security concerns in the Internet identity environment. Since trust is one of the pillars of security in the cloud, this paper analyzes the existing cloud identity techniques in order to investigate their strengths and weaknesses. This paper proposes a model in which One Time Password (OTP, TPM, and OpenID are used to provide a solution against phishing as a common identity theft in cloud environment.

  18. Time-and-ID-Based Proxy Reencryption Scheme

    OpenAIRE

    Mtonga, Kambombo; Paul, Anand; Rho, Seungmin

    2014-01-01

    Time- and ID-based proxy reencryption scheme is proposed in this paper in which a type-based proxy reencryption enables the delegator to implement fine-grained policies with one key pair without any additional trust on the proxy. However, in some applications, the time within which the data was sampled or collected is very critical. In such applications, for example, healthcare and criminal investigations, the delegatee may be interested in only some of the messages with some types sampled wi...

  19. Correlation studies of neutron multiplicities in the 252Cf spontaneous fission

    International Nuclear Information System (INIS)

    Alkhazov, I.D.; Dmitriev, V.D.; Kovalenko, S.S.; Kuznetsov, A.V.; Malkin, L.Z.; Petrzhak, K.A.; Petrov, B.F.; Shpakov, V.I.

    1988-01-01

    Correlations between the numbers of neutrons emitted by the 252 Cf spontaneous fission fragments have been studied as a function of the fragment mass and total kinetic energy. Behaviour of the neutron number dispersions and covariances was studied for the region of symmetric fission. Parameters of the complementary fragment excitation energy distribution (mean values, dispersions, covariances) were determined. Various factors describing correlations between the complementary fragment excitation energies are considered

  20. Radikal konservativ idédebat og højreautoritær fascination i Danmark, ca. 1928-1940

    DEFF Research Database (Denmark)

    Holm, Adam

    1999-01-01

    Historie, Højreradikalisme, Konservatisme, Fascisme, Mellemkrigstid, Idéhistorie, Intellektuelle......Historie, Højreradikalisme, Konservatisme, Fascisme, Mellemkrigstid, Idéhistorie, Intellektuelle...

  1. Thermocoagulation of lumbar facet joints: Experience in 252 patients

    OpenAIRE

    Martínez-Suárez, J. E.; Camblor, L.; Salva, S.; Jongh, W. A. de

    2005-01-01

    Se presentan 252 pacientes con el diagnóstico de dolor lumbar facetario a los que se le realizó la técnica quirúrgica de termocoagulación percutánea de la faceta articular. Nuestro propósito principal fue aliviar el dolor en estos pacientes, evaluamos la eficacia de la técnica con un 74,7% de resultados quirúrgicos satisfactorios, así como la descripción de diferentes aspectos como: edad, sexo, causas y la topografía segmentaria del dolor. Two hundred fifty two patients with diagnosis of l...

  2. Mass spectrometry with ionization induced by 252Cf fission fragments

    International Nuclear Information System (INIS)

    Sysoev, A.A.; Artaev, V.B.

    1991-01-01

    The review deals with mass-spectrometry with ionization induced by 252 Cf fission fragments. Equipment and technique of the analysis, analytic possibilities of the method are considered. The method permits to determine molecular masses of large nonvolatile biological molecules. The method is practically nondestructive, it possesses a high resolution over the depth and surface, which permits to use it for the analysis of surface of semiconductors, dielectrics, catalysts, for the study of formation kinetics of complex unstable molecules on the surface

  3. Design of a thermal neutron field by 252Cf source for measurement of 10B concentrations in the blood samples for BNCT

    International Nuclear Information System (INIS)

    Naito, H.; Sakurai, Y.; Maruhashi, A.

    2006-01-01

    10 B concentrations in the blood samples for BNCT has been estimated due to amounts of prompt gamma rays from 10 B in the fields of thermal neutrons from a special guide tube attached to research reactor. A system using radioisotopes as the source of thermal neutron fields has advantages that are convenient and low cost because it doesn't need running of a reactor or an accelerator. The validity of 252 Cf as a neutron source for 10 B concentrations detection system was investigated. This system is composed of D 2 O moderator, Pb reflector/filter, C reflector, and LiF filter. A thermal neutron field with low background gamma-rays is obtained. A large source of 252 Cf is required to obtain a sufficient flux. (author)

  4. Sensitivity of various thermoluminescent, radiophotoluminescent and photographic detectors to neutrons emitted by a 252Cf source

    International Nuclear Information System (INIS)

    Spurny, Frantisek; Medioni, Roger; Chapuis, A.; Portal, Guy.

    1975-07-01

    The specific sensitivity of various thermoluminescent, radiophotoluminescent and photographic detectors to the neutron spectrum of a 252 Cf source was measured and the effect of the size and composition of the containers in which they might be put was investigated. PB33 radiophotoluminescent glasses, radiothermoluminescent alumina and calcium sulfate were less sensitive to fission neutrons whereas photographic emulsions were more sensitive. The former should be used for γ detection in mixed fields of photons and fission neutrons [fr

  5. Dosimetric evaluation of 252Cf beam for use in radiobiology studies at Hiroshima University

    International Nuclear Information System (INIS)

    Hoshi, M.; Takeoka, S.; Tsujimura, T.; Kuroda, T.; Kawami, M.; Sawada, S.

    1988-01-01

    This report provides reliable tissue kerma in free air data by characterising the 252 Cf irradiating system and by comparing three dosimetry methods, paired chambers (ICRU 1977, 1978), Fricke and thermoluminescence dosemeter. (author)

  6. Application of game theory for the interpretation of inventory differences (ID)

    International Nuclear Information System (INIS)

    Moglewer, S.

    1978-01-01

    In a study performed by the Test and Evaluation Branch, Division of Safeguards, at the U.S. Nuclear Regulatory Commission with contract assistance from Lawrence Berkeley Laboratory, the validity of the ID concept for estabilishing assurance concerning possible unauthorized diversion of SNM was examined. The evaluation methodology was based upon the theory of games and produced results that were quite different from those derived by classical statistical hypothesis testing. A model was developed based upon a decision maker's utilities and solved for generic facilities. Based upon the value of ID, obtained from each inventory, and specific for each facility, there is a best policy for estimating unauthorized deliberate diversion and establishing action limits (alarm thresholds). This paper presents the results of this study as applied to a generic facility

  7. Elevated endogenous expression of the dominant negative basic helix-loop-helix protein ID1 correlates with significant centrosome abnormalities in human tumor cells

    Directory of Open Access Journals (Sweden)

    Gutmann Anja

    2010-01-01

    Full Text Available Abstract Background ID proteins are dominant negative inhibitors of basic helix-loop-helix transcription factors that have multiple functions during development and cellular differentiation. Ectopic (over-expression of ID1 extends the lifespan of primary human epithelial cells. High expression levels of ID1 have been detected in multiple human malignancies, and in some have been correlated with unfavorable clinical prognosis. ID1 protein is localized at the centrosomes and forced (over-expression of ID1 results in errors during centrosome duplication. Results Here we analyzed the steady state expression levels of the four ID-proteins in 18 tumor cell lines and assessed the number of centrosome abnormalities. While expression of ID1, ID2, and ID3 was detected, we failed to detect protein expression of ID4. Expression of ID1 correlated with increased supernumerary centrosomes in most cell lines analyzed. Conclusions This is the first report that shows that not only ectopic expression in tissue culture but endogenous levels of ID1 modulate centrosome numbers. Thus, our findings support the hypothesis that ID1 interferes with centrosome homeostasis, most likely contributing to genomic instability and associated tumor aggressiveness.

  8. Development and Psychometric Properties of an Assessment for Persons with Intellectual Disability--The InterRAI ID

    Science.gov (United States)

    Martin, Lynn; Hirdes, John P.; Fries, Brant E.; Smith, Trevor F.

    2007-01-01

    This paper describes the development of the interRAI-Intellectual Disability (interRAI ID), a comprehensive instrument that assesses all key domains of interest to service providers relative to a person with an intellectual disability (ID). The authors report on the reliability and validity of embedded scales for cognition, self-care, aggression,…

  9. Aberrant Expression of ID2 protein and its correlation with EBV-LMP1 and P16(INK4A) in Classical Hodgkin Lymphoma in China

    International Nuclear Information System (INIS)

    Zhao, Po; Lu, Yali; Liu, Lin; Zhong, Mei

    2008-01-01

    The relationships between the expression of ID2, EBV-LMP1 and P16(INK4A) in Chinese classical Hodgkin lymphoma are unknown and need exploring. Samples of classical Hodgkin lymphoma from 60 Chinese patients were analyzed for the expression of ID2, EBV-LMP1 and p16(INK4A) proteins by immunohistochemistry. ID2 protein was expressed in 83.3% of this group of classical Hodgkin lymphoma, staining strongly in both cytoplasm and nucleus of the Hodgkin and Reed-Sternberg (HRS) cells. EBV-LMP1 and P16(INK4A) were overexpressed in 85.0% and 71.7% of Hodgkin lymphoma, respectively. EBV-LMP1 was noted in the cytoplasm, membrane and nucleus of HRS cells; P16(INK4A) was in the nucleus and cytoplasm. Microscopically, ID2, EBV-LMP1 and P16(INK4A) staining distinguished the HRS cells from the complex background of lymphocytes. ID2 was positively correlated with EBV-LMP1(P < 0.01), but P16(INK4A) was inversely related to EBV-LMP1 (P < 0.05). It is suggested that ID2, EBV-LMP1 and P16(INK4A) could play an important role in the evolution of classical Hodgkin lymphoma, and be considered as potential adjunct markers to identify HRS cells in diagnosis

  10. 47 CFR 51.807 - Arbitration and mediation of agreements by the Commission pursuant to section 252(e)(5) of the Act.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Arbitration and mediation of agreements by the Commission pursuant to section 252(e)(5) of the Act. 51.807 Section 51.807 Telecommunication FEDERAL... Implementation of Section 252 of the Act § 51.807 Arbitration and mediation of agreements by the Commission...

  11. Correlated spins of complementary fragment pairs in the spontaneous fission of 252Cf

    International Nuclear Information System (INIS)

    Smith, A. G.; Simpson, G. S.; Billowes, J.; Dagnall, P. J.; Durell, J. L.; Freeman, S. J.; Leddy, M.; Phillips, W. R.; Roach, A. A.; Smith, J. F.

    1999-01-01

    A study of the γ-ray decay of low-lying excited states in fragments produced in the spontaneous fission of 252 Cf has revealed a significant correlation between the angles of emission of the 2 1 + →0 1 + transitions of complementary fragment pairs. Calculations of the amount of dealignment that is needed to reproduce the measured a 2 values, and a comparison with the results of previous fragment-γ angular distribution measurements, suggests that at scission there may be significant population of m≠0 substates associated with the projection of the fragment spin vector on the fission axis. Fragments from the spontaneous fission of 248 Cm emit 2 1 + →0 1 + γ rays that show markedly reduced interfragment correlations, suggesting that either a larger role is played by the relative angular momentum of the fragments, or that the dealignment introduced by the neutron emission and statistical γ decay to the 2 1 + state is larger in 248 Cm than 252 Cf fission. (c) 1999 The American Physical Society

  12. The Use of Angiotensin-I Converting Enzyme I/D Genetic Polymorphism as a Biomarker of Athletic Performance in Humans

    Directory of Open Access Journals (Sweden)

    Maria Fernanda De Mello Costa

    2012-10-01

    Full Text Available Angiotensin II is a key regulator of blood pressure and cardiovascular function in mammals. The conversion of angiotensin into its active form is carried out by Angiotensin I-Converting Enzyme (ACE. The measurement of ACE concentration in plasma or serum, its enzymatic activity, and the correlation between an insertion/deletion (I/D genetic polymorphism of the ACE gene have been investigated as possible indicators of superior athletic performance in humans. In this context, other indicators of superior adaptation to exercise resulting in better athletic performance (such as ventricular hypertrophy, VO2 max, and competition results were mostly used to study the association between ACE I/D polymorphism and improved performance. Despite the fact that the existing literature presents little consensus, there is sufficient scientific evidence to warrant further investigation on the usage of ACE activity and the I/D ACE gene polymorphism as biomarkers of superior athletic performance in humans of specific ethnicities or in athletes involved in certain sports. In this sense, a biomarker would be a substance or genetic component that could be measured to provide a degree of certainty, or an indication, of the presence of a certain trait or characteristic that would be beneficial to the athlete’s performance. Difficulties in interpreting and comparing the results of scientific research on the topic arise from dissimilar protocols and variation in study design. This review aims to investigate the current literature on the use of ACE I/D polymorphism as a biomarker of performance in humans through the comparison of scientific publications.

  13. Angiotensin-converting enzyme gene I/D polymorphism in Pakistani ...

    African Journals Online (AJOL)

    hope&shola

    two were the cases of antiphospholipid syndrome. Parsa et al. (2002) conducted an association of 3 polymor- phisms in angiotensin-converting enzyme including I/D polymorphism and 2 polymorphisms were associated with systemic lupus erythematosus and Lupus Nephritis among non-Caucasians that includes Hispanic, ...

  14. Attachment quality of children with ID and its link to maternal sensitivity and structuring.

    Science.gov (United States)

    Feniger-Schaal, Rinat; Joels, Tirtsa

    2018-05-01

    Attachment theory produced a fertile field of research and clinical application. Although the topic of attachment of children with intellectual disability (ID) has received increasing research attention over the past 15 years, the empirical evidence is still limited. We applied theoretical and empirical knowledge of parenting typically developing children to examine the mother-child relationship in the ID population. The aim was to examine maternal sensitivity and structuring and its association with children's attachment classification and their disability. Forty preschool children (mean age 47.25, range 26-75 months) with non-specific ID and their mothers participated in the study. The mean developmental age was 25.92 months (SD = 10.89), The DQ mean score was 55.45 (SD = 17.28). We assessed children's quality of attachment using the SSP and maternal interactive behavior using the Emotional Availability Scales. Forty percent of children showed secure attachment, and 32.5% showed disorganized attachment. Attachment classifications correlated significantly with maternal sensitivity and maternal structuring but not with the child's cognitive disability. The results point to the importance of maternal interactive behavior for children with ID. Clinical implication may consider interventions aiming to enhance maternal sensitivity and structuring to improve children's quality of attachment. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Pätid võtsid varastatud ID-kaardiga kiirlaene / Põim Kama

    Index Scriptorium Estoniae

    Kama, Põim, 1985-

    2008-01-01

    ID-kaardi vargusega seotud pettusjuhtumist ning jaanuaris jõustunud rahapesu ja terrorismi rahastamise tõkestamise seaduse sättest, mis kohustab laenufirmasid esimese tehingu sooritamisel kliendiga silmast silma kohtuma. Lisatud: kiirlaenufirmad vilistavad seadusele

  16. Neutron dose rate for {sup 252} Cf AT source in medical applications

    Energy Technology Data Exchange (ETDEWEB)

    Paredes, L.; Balcazar, M. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico); Azorin, J. [UAM-I, 09340 Mexico D.F. (Mexico); Francois, J.L. [FI-UNAM, 04510 Mexico D.F. (Mexico)

    2006-07-01

    The AAPM TG-43 modified protocol was used for the calculation of the neutron dose rate of {sup 252}Cf sources for two tissue substitute materials, five normal tissues and six tumours. The {sup 252}Cf AT source model was simulated using the Monte Carlo MCNPX code in spherical geometry for the following factors: a) neutron air kerma strength conversion factor, b) dose rate constant, c) radial dose function, d) geometry factor, e) anisotropy function and f) neutron dose rate. The calculated dose rate in water at 1 cm and 90 degrees from the source long axis, using the Watt fission spectrum, was D{sub n}(r{sub 0}, {theta}{sub 0})= 1.9160 cGy/h-{mu}g. When this value is compared with Rivard et al. calculation using MCNP4B code, 1.8730 cGy/h-{mu}g, a difference of 2.30% is obtained. The results for the reference neutron dose rate in other media show how small variations in the elemental composition between the tissues and malignant tumours, produce variations in the neutron dose rate up to 12.25%. (Author)

  17. Telomere length is associated with ACE I/D polymorphism in hypertensive patients with left ventricular hypertrophy

    DEFF Research Database (Denmark)

    Fyhrquist, Frej; Eriksson, Anders; Saijonmaa, Outi

    2013-01-01

    INTRODUCTION: Short telomeres are often associated with cardiovascular risk factors and age-related diseases, while the angiotensin converting enzyme (ACE) gene insertion/deletion polymorphism (DD, ID, II) has shown such associations less consistently. We hypothesized that telomere length...... and association of telomere length with cardiovascular risk is affected by ACE (I/D) genotype. METHODS: We measured leucocyte telomere length (LTL) by Southern blot and analysed ACE I/D genotypes in 1249 subjects with hypertension and left ventricular hypertrophy (LVH). We examined interactions of ACE I...

  18. British military operation at Sheikh Sa‘id in the First World War

    Directory of Open Access Journals (Sweden)

    Abdol Rauh Yaccob

    2017-09-01

    Full Text Available It is a difficult task to measure the importance of South West Arabia to the Ottomans and the British prior to and during World War I. Early history of imperial expansion in the area which followed by constant conflicts and involved a considerable amount of diplomacy and intrigues with the natives may suggest that South West Arabia was considered as equally as important to other areas within the empire. However from the beginning of the 20th century South West Arabia was considered something of a backwater. It may also be observed that during the First World War the position of South West Arabia to these powers in relation to other war theatres remained practically the same except in the episodes of British action at Sheikh Said and the Ottomans advance at Lahej. The Indian authorities who believed that the Ottomans were contemplating a move to Sheikh Sa‘id with the aim of acting against British Perim with the telegraphic communication, convoys and shipping, only two miles away, took the opportunity of the movement of the troops through the Red Sea to attack the fort of Sheikh Sa‘id. The action was quickly taken before obtaining official approval from the Admiralty and the India Office in London. The action was taken due to the persistent reports of the Ottoman reinforcement with guns had been sent to Sheikh Sa‘id, further to take advantage of the presence of transports with troops for Egypt. Subsequently future military operations at Sheikh Sa‘id and the Red Sea appeared to dominate the discussions among the authorities at the India Office, the Admiralty, the Indian authorities and the Resident at Aden throughout the war without materializing any further military action.

  19. The importance of association between angiotensin-converting enzyme (ACE) Gene I/D polymorphism and diabetic peripheral neuropathy.

    Science.gov (United States)

    Inanir, Ahmet; Basol, Nursah; Karakus, Nevin; Yigit, Serbulent

    2013-11-10

    Diabetic peripheral neuropathy (DPN) is a microvascular complication of diabetes mellitus (DM) due to decreasing quality of life. In the present study, it is aimed to evaluate angiotensin-converting enzyme (ACE) Gene I/D polymorphism in Turkish population. Two hundred and thirty-five DPN patients and two hundred and eighty-one controls were enrolled in this study. Genomic DNA was isolated and genotyped using polymerase chain reaction (PCR) analyses for the ACE gene I/D polymorphism. Baseline characteristics of the DPN patients according to ACE genotypes were similar, except for history of hypertension. The frequency of II genotype was significantly higher in patients with positive history of hypertension than the patients with negative history of hypertension (p=0.013). DD genotype of I/D polymorphism was found to be a susceptibility factor for DPN in homozygous form (p=0.032). According to allele frequencies, D allele of I/D polymorphism was found to be a susceptibility factor for DPN (p=0.031). ACE gene I/D polymorphism may research in DM patients to determine genetic predisposition for DPN. It can be useful for taking early measures and avoiding DPN in a Turkish population. © 2013 Elsevier B.V. All rights reserved.

  20. 76 FR 46721 - Salmon-Challis National Forest, ID; Upper North Fork HFRA Ecosystem Restoration Project...

    Science.gov (United States)

    2011-08-03

    ...-Challis National Forest, ID; Upper North Fork HFRA Ecosystem Restoration Project Environmental Impact... improve the health of the ecosystem and reach the desired future condition. DATES: Comments concerning the... Ecosystem Restoration Project EIS, P.O. Box 180, 11 Casey Rd., North Fork, ID 83466. Comments may also be...

  1. idSpace Tooling and Training for collaborative distributed product innovation

    NARCIS (Netherlands)

    Rutjens, Marjo; Bitter-Rijpkema, Marlies; Grube, Pascal; Heider, Thomas

    2009-01-01

    Rutjens, M., Bitter-Rijpkema, M., Grube, P. P., & Heider, T. (2009). idSpace Tooling and Training for collaborative distributed product innovation. Workshop during the e-Learning Baltic conference. June, 17-19, 2009, Rostock, Germany.

  2. 252Cf-source-driven noise analysis measurements for characterization of concrete highly enriched uranium (HEU) storage vaults

    International Nuclear Information System (INIS)

    Valentine, T.E.; Mihalczo, J.T.

    1993-01-01

    The 252 Cf-source-driven noise analysis method has been used in measurements for subcritical configurations of fissile systems for a variety of applications. Measurements of 25 fissile systems have been performed with a wide variety of materials and configurations. This method has been applied to measurements for (1) initial fuel loading of reactors, (2) quality assurance of reactor fuel elements, (3) fuel preparation facilities, (4) fuel processing facilities, (5) fuel storage facilities, (6) zero-power testing of reactors, and (7) verification of calculational methods for assemblies with the neutron k 252 Cf source and commercially available detectors was feasible and to determine if the measurement could characterize the ability of the concrete to isolate the fissile material

  3. Genetic characterization of Venezuelan equine encephalitis virus from Bolivia, Ecuador and Peru: identification of a new subtype ID lineage.

    Directory of Open Access Journals (Sweden)

    Patricia V Aguilar

    2009-09-01

    Full Text Available Venezuelan equine encephalitis virus (VEEV has been responsible for hundreds of thousands of human and equine cases of severe disease in the Americas. A passive surveillance study was conducted in Peru, Bolivia and Ecuador to determine the arboviral etiology of febrile illness. Patients with suspected viral-associated, acute, undifferentiated febrile illness of <7 days duration were enrolled in the study and blood samples were obtained from each patient and assayed by virus isolation. Demographic and clinical information from each patient was also obtained at the time of voluntary enrollment. In 2005-2007, cases of Venezuelan equine encephalitis (VEE were diagnosed for the first time in residents of Bolivia; the patients did not report traveling, suggesting endemic circulation of VEEV in Bolivia. In 2001 and 2003, VEE cases were also identified in Ecuador. Since 1993, VEEV has been continuously isolated from patients in Loreto, Peru, and more recently (2005, in Madre de Dios, Peru. We performed phylogenetic analyses with VEEV from Bolivia, Ecuador and Peru and compared their relationships to strains from other parts of South America. We found that VEEV subtype ID Panama/Peru genotype is the predominant one circulating in Peru. We also demonstrated that VEEV subtype ID strains circulating in Ecuador belong to the Colombia/Venezuela genotype and VEEV from Madre de Dios, Peru and Cochabamba, Bolivia belong to a new ID genotype. In summary, we identified a new major lineage of enzootic VEEV subtype ID, information that could aid in the understanding of the emergence and evolution of VEEV in South America.

  4. Test and evaluation results of the 252Cf shuffler at the Savannah River Plant

    International Nuclear Information System (INIS)

    Crane, T.W.

    1981-03-01

    The 252 Cf Shuffler, a nondestructive assay instrument employing californium neutron source irradiation and delayed-neutron counting, was developed for measuring 235 U content of scrap and waste items generated at the Savannah River Plant (SRP) reactor fuel fabrication facility. The scrap and waste items include high-purity uranium-aluminum alloy ingots as well as pieces of castings, saw and lathe chips from machining operations, low-purity items such as oxides of uranium or uranium intermixed with flux materials found in recovery operations, and materials not recoverable at SRP such as floor sweepings or residues from the uranium scrap recovery operation. The uranium contains about 60% 235 U with the remaining isotopes being 236 U, 238 U, and 234 U in descending order. The test and evaluation at SRP concluded that the accuracy, safety, reliability, and ease of use made the 252 Cf Shuffler a suitable instrument for routine use in an industrial, production-oriented plant

  5. An Improved Dynamic ID-Based Remote User Authentication with Key Agreement Scheme

    Directory of Open Access Journals (Sweden)

    Juan Qu

    2013-01-01

    Full Text Available In recent years, several dynamic ID-based remote user authentication schemes have been proposed. In 2012, Wen and Li proposed a dynamic ID-based remote user authentication with key agreement scheme. They claimed that their scheme can resist impersonation attack and insider attack and provide anonymity for the users. However, we will show that Wen and Li's scheme cannot withstand insider attack and forward secrecy, does not provide anonymity for the users, and inefficiency for error password login. In this paper, we propose a novel ECC-based remote user authentication scheme which is immune to various known types of attack and is more secure and practical for mobile clients.

  6. Association of ACE Gene I/D polymorphism with migraine in Kashmiri population.

    Science.gov (United States)

    Wani, Irfan Yousuf; Sheikh, Saleem; Shah, Zafar Amin; Pandith, Arshid A; Wani, Mushtaq; Asimi, Ravouf; Wani, Maqbool; Sheikh, Shahnawaz; Mehraj, Iqra

    2016-01-01

    Migraine is a complex, recurrent headache disorder that is one of the most common complaints in neurology practice. The role of various genes in its pathogenesis is being studied. We did this study to see whether an association exists between ACE gene I/D polymorphism and migraine in our region. The study included 100 patients diagnosed with migraine and 121 healthy controls. The study subject were age and gender matched. The analysis was based on Polymerase Chain Reaction (PCR) and included following steps: DNA extraction from blood, PCR and Restriction Fragment Length Polymorphism (RFLP). Out of 100 cases, 69 were females and 31 were males. Fifty-seven were having migraine without aura and 43 had migraine with aura. 45 of the cases had II polymorphism, 40 had ID polymorphism and 15 had DD polymorphism in ACE gene. We were not able to find a statistically significant association between ACE gene I/D polymorphism with migraine. The reason for difference in results between our study and other studies could be because of different ethnicity in study populations. So a continuous research is needed in this regard in order to find the genes and different polymorphism that increase the susceptibility of Kashmiri population to migraine.

  7. ID based cryptography for secure cloud data storage

    OpenAIRE

    Kaaniche , Nesrine; Boudguiga , Aymen; Laurent , Maryline

    2013-01-01

    International audience; This paper addresses the security issues of storing sensitive data in a cloud storage service and the need for users to trust the commercial cloud providers. It proposes a cryptographic scheme for cloud storage, based on an original usage of ID-Based Cryptography. Our solution has several advantages. First, it provides secrecy for encrypted data which are stored in public servers. Second, it offers controlled data access and sharing among users, so that unauthorized us...

  8. Batf3 and Id2 have a synergistic effect on Irf8-directed classical CD8α+ dendritic cell development

    KAUST Repository

    Jaiswal, Hemant

    2013-11-13

    Dendritic cells (DCs) are heterogeneous cell populations represented by different subtypes, each varying in terms of gene expression patterns and specific functions. Recent studies identified transcription factors essential for the development of different DC subtypes, yet molecular mechanisms for the developmental program and functions remain poorly understood. In this study, we developed and characterized a mouse DC progenitor-like cell line, designated DC9, from Irf8-/- bone marrow cells as a model for DC development and function. Expression of Irf8 in DC9 cells led to plasmacytoid DCs and CD8α+ DC-like cells, with a concomitant increase in plasmacytoid DC- and CD8α+ DC-specific gene transcripts and induction of type I IFNs and IL12p40 following TLR ligand stimulation. Irf8 expression in DC9 cells led to an increase in Id2 and Batf3 transcript levels, transcription factors shown to be important for the development of CD8α+ DCs. We show that, without Irf8 , expression of Id2 and Batf3 was not sufficient for directing classical CD8α+ DC development. When coexpressed with Irf8, Batf3 and Id2 had a synergistic effect on classical CD8α+ DC development. We demonstrate that Irf8 is upstream of Batf3 and Id2 in the classical CD8α+ DC developmental program and define the hierarchical relationship of transcription factors important for classical CD8α+ DC development.

  9. Neutron gauging applications using a small 252Cf source

    International Nuclear Information System (INIS)

    Helf, S.

    1975-01-01

    The use of a small 252 Cf source, in the 3 to 4 μg range, for neutron gauging applications is described. Emphasis is placed on determination of low concentrations of moisture in homogeneous media, e.g., solvents, explosives, dried food products, etc. and on measurement of charge or fill weight of hydrogenous materials in sealed items, e.g., propellant in a cartridge case. Both moderation of fast neutrons and attenuation of thermalized neutrons have been explored for these applications. Parameters related to the attainment of optimum sensitivity for each method are discussed. Fast neutron moderation is superior for low level moisture measurement whereas thermal neutron attenuation is more sensitive for ''neutron weighing'' applications. Under optimum conditions, sensitivity for moisture measurement approaches 0.1 weight percent whereas ''neutron weighing'' can detect changes in hydrogeneous material content as little as a fraction of a gram. Examples are given for each technique. A number of different thermal neutron detectors are compared for neutron gauging measurements. A 6 LiI (Eu) scintillation detector is judged to be superior with regard to high thermal neutron detection efficiency and low fast neutron and gamma ray response. In this study, emphasis is placed on the use of simple, portable equipment easily adaptable to field or plant use and for on-line process or quality control. (U.S.)

  10. 48 CFR 252.225-7022 - Trade agreements certificate-inclusion of Iraqi end products.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Trade agreements... PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.225-7022 Trade agreements certificate—inclusion of Iraqi end products. As prescribed in 225.1101(7), use the following provision: Trade Agreements...

  11. Reliability of the Identification of Functional Ankle Instability (IdFAI) Scale Across Different Age Groups in Adults.

    Science.gov (United States)

    Gurav, Reshma S; Ganu, Sneha S; Panhale, Vrushali P

    2014-10-01

    Functional ankle instability (FAI) is the tendency of the foot to 'give way'. Identification of Functional Ankle Instability questionnaire (IdFAI) is a newly developed questionnaire to detect whether individuals meet the minimum criteria necessary for inclusion in an FAI population. However, the reliability of the questionnaire was studied only in a restricted age group. The purpose of this investigation was to examine the reliability of IdFAI across different age groups in adults. One hundred and twenty participants in the age group of 20-60 years consisting of 30 individuals in each age group were asked to complete the IdFAI on two occasions. Test-retest reliability was evaluated by intraclass correlation coefficient (ICC2,1). The study revealed that IdFAI has excellent test-retest reliability when studied across different age groups. The ICC2,1 in the age groups 20-30 years, 30-40 years, 40-50 years and 50-60 years was 0.978, 0.975, 0.961 and 0.922, respectively with Cronbach's alpha >0.9 in all the age groups. The IdFAI can accurately predict if an individual meets the minimum criterion for FAI across different age groups in adults. Thus, the questionnaire can be applied over different age groups in clinical and research set-ups.

  12. Comparison Of 252Cf Time Correlated Induced Fisssion With AmLi Induced Fission On Fresh MTR Research Reactor Fuel

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Jay Prakash [Los Alamos National Laboratory

    2017-03-30

    The effective application of international safeguards to research reactors requires verification of spent fuel as well as fresh fuel. To accomplish this goal various nondestructive and destructive assay techniques have been developed in the US and around the world. The Advanced Experimental Fuel Counter (AEFC) is a nondestructive assay (NDA) system developed at Los Alamos National Laboratory (LANL) combining both neutron and gamma measurement capabilities. Since spent fuel assemblies are stored in water, the system was designed to be watertight to facilitate underwater measurements by inspectors. The AEFC is comprised of six 3He detectors as well as a shielded and collimated ion chamber. The 3He detectors are used for active and passive neutron coincidence counting while the ion chamber is used for gross gamma counting. Active coincidence measurement data is used to measure residual fissile mass, whereas the passive coincidence measurement data along with passive gamma measurement can provide information about burnup, cooling time, and initial enrichment. In the past, most of the active interrogation systems along with the AEFC used an AmLi neutron interrogation source. Owing to the difficulty in obtaining an AmLi source, a 252Cf spontaneous fission (SF) source was used during a 2014 field trail in Uzbekistan as an alternative. In this study, experiments were performed to calibrate the AEFC instrument and compare use of the 252Cf spontaneous fission source and the AmLi (α,n) neutron emission source. The 252Cf source spontaneously emits bursts of time-correlated prompt fission neutrons that thermalize in the water and induce fission in the fuel assembly. The induced fission (IF) neutrons are also time correlated resulting in more correlated neutron detections inside the 3He detector, which helps reduce the statistical errors in doubles when using the 252Cf interrogation source instead of

  13. Quand l’idée fixe se met « à table »

    Directory of Open Access Journals (Sweden)

    Cécile de Bary

    2008-03-01

    Full Text Available Un livre de cuisine, comme A table de Claudian, édité en 1963, peut relever de la prose d’idées dans la mesure où son projet est sous-tendu par une idéologie très précise, qui seule lui donne sa cohérence. Si l’ethnocentrisme consiste à ne pas reconnaître à l’autre une culture, par exemple, ce livre apparaît comme ethnocentrique, puisqu’il a pour projet de départager les peuples qui savent et ceux qui ne savent pas. Il est encore réactionnaire, voué au rétablissement des savoir-faire des terroirs, contre les corruptions parisiennes en particulier. Dès lors, la présentation d’un plat est toujours susceptible de s’étendre ou de se faire discours, sous la poussée d’un lyrisme acrimonieux. Pour autant, il ne s’agit pas d’un faux livre de cuisine, d’un traité ou d’une « physiologie ». La recette est l’aboutissement logique de l’idée fixe. Elle est le lieu d’une bataille que l’argumentation sert, qu’elle met en scène et qu’elle prépare.

  14. ACE I/D Gene Polymorphism Can't Predict the Steroid Responsiveness in Asian Children with Idiopathic Nephrotic Syndrome: A Meta-Analysis

    Science.gov (United States)

    Su, Li-Na; Lei, Feng-Ying; Huang, Wei-Fang; Zhao, Yan-Jun

    2011-01-01

    Background The results from the published studies on the association between angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism and the treatment response to steroid in Asian children with idiopathic nephrotic syndrome (INS) is still conflicting. This meta-analysis was performed to evaluate the relation between ACE I/D gene polymorphism and treatment response to steroid in Asian children and to explore whether ACE D allele or DD genotype could become a predictive marker for steroid responsiveness. Methodology/Principal Findings Association studies were identified from the databases of PubMed, Embase, Cochrane Library and CBM-disc (China Biological Medicine Database) as of September 1, 2010, and eligible investigations were synthesized using meta-analysis method. Five investigations were identified for the analysis of association between ACE I/D gene polymorphism and steroid-resistant nephrotic syndrome (SRNS) risk in Asian children and seven studies were included to explore the relationship between ACE I/D gene polymorphism and steroid-sensitive nephrotic syndrome (SSNS) susceptibility. Five investigations were recruited to explore the difference of ACE I/D gene distribution between SRNS and SSNS. There was no a markedly association between D allele or DD genotype and SRNS susceptibility or SSNS risk, and the gene distribution differences of ACE between SRNS and SSNS were not statistically significant. II genotype might play a positive role against SRNS onset but not for SSNS (OR = 0.51, P = 0.02; OR = 0.95, P = 0.85; respectively), however, the result for the association of II genotype with SRNS risk was not stable. Conclusions/Significance Our results indicate that D allele or DD homozygous can't become a significant genetic molecular marker to predict the treatment response to steroid in Asian children with INS. PMID:21611163

  15. Regularities in dose field formation for fixation of 252Cf and 60Co sources on the same plane

    International Nuclear Information System (INIS)

    Ivanov, V.N.; Vtyurin, B.M.; Ivanova, L.F.; Kondzhariya, Yu.R.

    1983-01-01

    A computerized study was made of a change in the correlation between the sizes of an irradiated volume and the distribution of sources. Criteria have been established for the utilization of 252 Cf and 60 Co sources of different active length and design placed on the same plane. Reference dose rate and its derivatives have been chosen as the main parameters that characterize a dose field. A dosimetric analysis was performed using the data for an adsorbed dose of neutrons in the tissue, taking account of high RBE of 252 Cf fast neutrons that equals 6-7, and a slight change of the local RBE value near the source resulting from a change of the effective spectrum of neutrons in combination with the growth of a contribution of #betta#-radiation into the summary dose with the removal from the source. The irradiated volume was evaluated by introducing 3 linear parameters - length, thickness and width. It has been shown that the ratio of the length of an irradiated volume to the active length of 252 Cf sources with radionuclide regular linear density changes from 0.7 with the isodose value of 85% up to 0.97 with the isodose value of 60%. For 60 Co sources with a higher linear density of the radionuclide on the edges the lower limit of this value equals 1. Intervals of changes in the rest of parameters have also been defined. The results obtained are presented graphically. The results of the study are used for a dosimetric control of the clinical trials of 252 Cf and 60 Co sources in the treatment of patients with tumors of the tongue, oral cavity fundus, lip and other sites

  16. Rapid, autonomous analysis of He spectra I: Overview of the RadID program, user experience, and structure

    Energy Technology Data Exchange (ETDEWEB)

    Gosnell, Thomas B. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Chavez, Joseph R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Rowland, Mark S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Wong, James L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2014-02-26

    RadID is a new gamma-ray spectrum analysis program for rapid screening of HPGe gamma-ray data to reveal the presence of radionuclide signatures. It is an autonomous, rule-based heuristic system that can identify well over 200 radioactive sources with particular interest in uranium and plutonium characteristics. It executes in about one second. RadID does not require knowledge of the detector efficiency, the source-to-detector distance, or the geometry of the inspected radiation source—including any shielding. In this first of a three-document series we sketch the RadID program’s origin, its minimal requirements, the user experience, and the program operation.

  17. Use of false ID cards and other deceptive methods to purchase alcoholic beverages during high school.

    Science.gov (United States)

    Schwartz, R H; Farrow, J A; Banks, B; Giesel, A E

    1998-01-01

    Altered motor vehicle drivers's licenses or other falsified or counterfeit photo identification cards are widely and illegally used by teenagers to obtain beer and other alcohol beverages. We obtained information on the methods currently used by teenagers to purchase beer and wine by asking nine hundred teenagers, between 16-19 years old to complete a brief, confidential questionnaire. High school students most often obtained alcoholic beverages by requesting someone of legal age to purchase it for them. College students used borrowed, altered, or counterfeit identification (ID) more often than high school students. Photo IDs purchased through mail order from a magazine advertisement were used infrequently and when use was attempted, they were sometimes (25%) unsuccessful. Fifteen percent of high school students, 14% of college freshmen, and 24% of teenage drug abusers were able to purchase beer by the case with borrowed, altered, or fake ID. Suggestions to reduce sales of alcohol-containing beverages to minors include universal "carding" of prospective purchasers, use of two view or hologram photos on a drivers' license, requiring three different ID cards at the point of purchase, and penalties to stores that fail to make a good effort to identify underage customers.

  18. 77 FR 55800 - Foreign-Trade Zone 242-Boundary County, ID; Application for Subzone AREVA Enrichment Services...

    Science.gov (United States)

    2012-09-11

    ... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [B-68-2012] Foreign-Trade Zone 242--Boundary County, ID; Application for Subzone AREVA Enrichment Services, LLC; Bonneville County, ID An application... FTZ 242, requesting special-purpose subzone status for the facility of AREVA Enrichment Services, LLC...

  19. ASSOCIATION OF ACTN3 R577X AND ACE I/D POLYMORPHISMS IN BRAZILIANS WRESTLERS

    Directory of Open Access Journals (Sweden)

    Marcelo Romanovitch Ribas

    Full Text Available ABSTRACT Introduction: By associating genetics and sport, it is possible to identify subjects with greater capacity to adapt to training, and lower chances of injury. Objective: The investigation evaluated the genotypic and allelic distribution of ACTN3 R577X and ACE I/D polymorphisms in Brazilian high-performance athletes in wrestling and percussion combat sports. Methods: The study included 37 male athletes ranked from first to third place in world scenarios, divided into two groups: wrestling (23 wrestlers, being 11 of Judo, 4 of Greco-Roman style, 8 of Brazilian Jiu Jitsu, with mean age of 27.3 ± 6.9 years and percussion combat sports (14 athletes with a mean age of 25.7±4.4 years, being 6 of Karate, 3 of Muay Thai, 4 of Taekwondo, 1 Boxing. Genotyping of ACTN3 and ACE I/D polymorphisms was performed by polymerase chain reaction (PCR from the genomic DNA. Genotypic and allelic distributions were compared with control populations and athletes by Chi-square test and Fisher’s exact test; all analyzes considered p ≤ 0.05. Results: The genotypic distributions and allelic frequencies of ACTN3 RR=46%, RX=38% and XX=16%; R=65% and X=35%, and ACE I/D DD=47.7%, ID=34.3% and II=20%; D=62.9% and I=37.1% did not differ from the control population; however, when compared with wrestling athletes a significant difference was observed. Conclusion: These results suggest an association of ACTN3 R577X and ACE I/D genes with Brazilian high-performance wrestling athletes.

  20. On Eddy current examination (ECE) of Incoloy 800 SG tube using OD encircling and ID bobbin coil

    International Nuclear Information System (INIS)

    Kapoor, K.; Sunder Krishna, K.; Bakshu, S.A.

    2015-01-01

    The purpose of this paper is to present and compare the results of ECE carried out on steam generator tubes from OD side and ID side. During the manufacturing of the tubes Eddy current testing is being carried out using OD encircling probe as per ASTM E 571. Here the purpose of the test is to capture the manufacturing defects. The parameters of the test are optimized to achieve best sensitivity to this requirement. These tubes are then installed in the steam generator and once again ECE is carried out during installation (pre-service inspection-PSI) and during in-service inspection (ISI) by using ID bobbin coil. These tests are carried out as per ASME section V article 8 appendix 1. Here the purpose of the test is to detect wall thinning, dent, pits etc due to operation and to locate these defects (OD side or ID side). Here the operating parameters are optimized for phase separation of defects from OD and ID. These parameters are quite different from those used during the manufacturing ECE. Interpretation of the signals detected in PSI/ISI in must be done with care to correlate with defect indications detected during manufacturing. In the present study, tubes with certain manufacturing defects, detected with OD encircling test were subjected to ID bobbin coil examination. Also certain tubes with signal picked up during test from ID were examined by using the OD encircling probe. This comparison of the results provides a clear picture about the sensitivity and deficiency of the either type of test. (author)

  1. Causes of Mortality in Older People with Intellectual Disability: Results from the HA-ID Study

    Science.gov (United States)

    Oppewal, Alyt; Schoufour, Josje D.; van der Maarl, Hanne J. K.; Evenhuis, Heleen M.; Hilgenkamp, Thessa I. M.; Festen, Dederieke A.

    2018-01-01

    We aim to provide insight into the cause-specific mortality of older adults with intellectual disability (ID), with and without Down syndrome (DS), and compare this to the general population. Immediate and primary cause of death were collected through medical files of 1,050 older adults with ID, 5 years after the start of the Healthy Ageing and…

  2. The Mathematica package TopoID and its application to the Higgs boson production cross section

    Energy Technology Data Exchange (ETDEWEB)

    Hoff, Jens

    2016-07-15

    We present the Mathematica package TopoID which aims at the automation of several steps in multiloop calculations. The algorithm which lies at the very core of the package is described and illustrated with an example. The main features of TopoID are stated and some of them are briefly demonstrated for NLO or NNLO Higgs boson production.

  3. True ternary fission of 252Cf

    International Nuclear Information System (INIS)

    Vijayaraghavan, K.R.; Balasubramaniam, M.; Oertzen, W. von

    2014-01-01

    Splitting of heavy radioactive nucleus into three fragments is known as ternary fission. If the size of the fragments are almost equal it is referred to as true ternary fission. Recently, Yu. V. Pyatkov et al observed/reported the experimental observation of true ternary fission in 252 Cf. In this work, the possibilities of different true ternary fission modes of 252 Cf through potential energy surface (PES) calculations based on three cluster model (TCM) are discussed. In TCM a condition on the mass numbers of the fission fragments is implied as A 1 ≥ A 2 ≥ A 3 in order to avoid repetition of combinations. Due to this condition, the values of Z 3 vary from 0 to 36 and Z 2 vary from 16 to 51. Of the different pairs having similar (Z 2 , Z 3 ) with different potential energy, a pair possessing minimum potential energy is chosen. Thus identified favourable combinations are plotted. For the PES calculations the arrangement of the fragments is considered in the order of A 1 +A 2 +A 3 . i.e. the heavy and the lightest fragments are kept at the ends. It is seen that the deepest minimum in the PES occurs for Z 3 =2 labelled as (Z 2 ; 2) indicating He accompanied breakup as the most favourable one. Of which, the breakup with Z 2 around 46 to 48 is the least (shown by dashed (Z 1 = 50) and dotted (Z 1 = 52) lines indicating a constant Z 1 value). The other notable minima in the PES are labelled and they correspond to the (Z 2 , Z 3 ) pairs viz., (20, 20), (28, 20), (28, 28) and (32, 32). Of these four minima, the first three are associated with the magic numbers 20 and 28. For Z 3 =20, there are two minimums at (20,20) and (28,20) among them (28,20) is the lowest minimum through which the minimum-path passes, and it is the ternary decay observed by Yu. V. Pyatkov et al. The fourth minima is the most interesting due to the fact that it corresponds to true ternary fission mode with Z 2 =32, Z 3 =32 and Z 1 =34. The minimum potential energy path also goes through this true

  4. 48 CFR 252.229-7011 - Reporting of Foreign Taxes-U.S. Assistance Programs.

    Science.gov (United States)

    2010-10-01

    ... all value added taxes and customs duties imposed by the recipient country. This exemption is in... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reporting of Foreign Taxes... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.229-7011 Reporting of Foreign Taxes—U.S...

  5. A search for back-to-back e+e- pairs in the spontaneous-fission disintegration of 252Cf

    International Nuclear Information System (INIS)

    Tsunoda, T.; Nakamura, S.; Orito, S.; Minowa, M.

    1995-01-01

    A back-to-back electron-positron pair is searched for in spontaneous-fission disintegration of 252 Cf. The emission of such a pair, if observed, might be a manifestation of production and prompt decay of a heretofore unknown neutral particle. The emission rate of such a pair is found to be less than (2.5-5.5) . 10 -10 per fission at the 95% confidence level depending on the mass of the hypothetical particle which is between 40 and 200 MeV/c 2 . (orig.)

  6. Securing remote services by integrating SecurID strong authentication technology in EFDA-Federation infrastructure

    Energy Technology Data Exchange (ETDEWEB)

    Castro, R., E-mail: rodrigo.castro@visite.es [Asociacion EURATOM/CIEMAT para Fusion, Madrid (Spain); Barbato, P. [Consorzio RFX, Euratom ENEA Association, Corso Stati Uniti 4, 35127 Padova (Italy); Vega, J. [Asociacion EURATOM/CIEMAT para Fusion, Madrid (Spain); Taliercio, C. [Consorzio RFX, Euratom ENEA Association, Corso Stati Uniti 4, 35127 Padova (Italy)

    2011-10-15

    Remote participation facilities among fusion laboratories require access control solutions with two main objectives: to preserve the usability of the systems and to guaranty the required level of security for accessing to shared services. On one hand, this security solution has to be: single-sign-on, transparent for users, compatible with user mobility, and compatible with used client applications. On the other hand, it has to be compatible with shared services and resources among organisations, providing in each case the required access security level. EFDA-Federation is a security infrastructure that integrates a set of fusion laboratories and enables to share resources and services fulfilling the requirements previously described. In EFDA community, JET and RFX have security access policies to some of their services that require strong authentication mechanisms. In both cases, strong authentication is based on RSA SecurID tokens. This is a hardware device that is supplied to and generates a new password every minute. The job presents two main results. The first one is the integration of RSA SecurID into EFDA-Federation. Thanks to it, federated organisations are able to offer SecurID to their users as an alternative strong authentication mechanism, with the corresponding increase of security level. The second result is the development of a new access control mechanism based on port knocking techniques and its integration into EFDA-Federation. Additionally, a real application in RFX is presented and includes the integration of its SecurID infrastructure as federated authentication mechanism, and the application of the new access control mechanism to its MDSplus server.

  7. Securing remote services by integrating SecurID strong authentication technology in EFDA-Federation infrastructure

    International Nuclear Information System (INIS)

    Castro, R.; Barbato, P.; Vega, J.; Taliercio, C.

    2011-01-01

    Remote participation facilities among fusion laboratories require access control solutions with two main objectives: to preserve the usability of the systems and to guaranty the required level of security for accessing to shared services. On one hand, this security solution has to be: single-sign-on, transparent for users, compatible with user mobility, and compatible with used client applications. On the other hand, it has to be compatible with shared services and resources among organisations, providing in each case the required access security level. EFDA-Federation is a security infrastructure that integrates a set of fusion laboratories and enables to share resources and services fulfilling the requirements previously described. In EFDA community, JET and RFX have security access policies to some of their services that require strong authentication mechanisms. In both cases, strong authentication is based on RSA SecurID tokens. This is a hardware device that is supplied to and generates a new password every minute. The job presents two main results. The first one is the integration of RSA SecurID into EFDA-Federation. Thanks to it, federated organisations are able to offer SecurID to their users as an alternative strong authentication mechanism, with the corresponding increase of security level. The second result is the development of a new access control mechanism based on port knocking techniques and its integration into EFDA-Federation. Additionally, a real application in RFX is presented and includes the integration of its SecurID infrastructure as federated authentication mechanism, and the application of the new access control mechanism to its MDSplus server.

  8. Identification of new neutron-rich rare-earth nuclei produced in /sup 252/Cf spontaneous fission

    CERN Document Server

    Greenwood, R C; Gehrke, R J; Meikrantz, D H

    1981-01-01

    A program of systematic study of the decay properties of neutron-rich rare-earth nuclei with 30 s252/Cf spontaneous fission, is currently underway using the Idaho ESOL (Elemental Separation On Line) Facility. The chemistry system used for the rare-earth elemental separations consists of two high-performance chromatography columns connected in series and coupled to the /sup 252 /Cf fission source via a helium gas-jet transport arrangement. The time delay for separation and initiation of gamma -ray counting with results which have been obtained to date with this system include the identification of a number of new neutron-rich rare-earth isotopes including /sup 155/Pm (t/sub 1/2/=48+or-4 s) and /sup 163/Gd (t/sub 1 /2/=68+or-3 s), in addition to 5.51 min /sup 158/Sm which was identified in an earlier series of experiments. (11 refs).

  9. Gold nanoparticles synthesized by Geobacillus sp. strain ID17 a thermophilic bacterium isolated from Deception Island, Antarctica

    Science.gov (United States)

    2013-01-01

    Background The use of microorganisms in the synthesis of nanoparticles emerges as an eco-friendly and exciting approach, for production of nanoparticles due to its low energy requirement, environmental compatibility, reduced costs of manufacture, scalability, and nanoparticle stabilization compared with the chemical synthesis. Results The production of gold nanoparticles by the thermophilic bacterium Geobacillus sp. strain ID17 is reported in this study. Cells exposed to Au3+ turned from colourless into an intense purple colour. This change of colour indicates the accumulation of intracellular gold nanoparticles. Elemental analysis of particles composition was verified using TEM and EDX analysis. The intracellular localization and particles size were verified by TEM showing two different types of particles of predominant quasi-hexagonal shape with size ranging from 5–50 nm. The mayority of them were between 10‒20 nm in size. FT-IR was utilized to characterize the chemical surface of gold nanoparticles. This assay supports the idea of a protein type of compound on the surface of biosynthesized gold nanoparticles. Reductase activity involved in the synthesis of gold nanoparticles has been previously reported to be present in others microorganisms. This reduction using NADH as substrate was tested in ID17. Crude extracts of the microorganism could catalyze the NADH-dependent Au3+ reduction. Conclusions Our results strongly suggest that the biosynthesis of gold nanoparticles by ID17 is mediated by enzymes and NADH as a cofactor for this biological transformation. PMID:23919572

  10. Design of Distortion-Invariant Optical ID Tags for Remote Identification and Verification of Objects

    Science.gov (United States)

    Pérez-Cabré, Elisabet; Millán, María Sagrario; Javidi, Bahram

    Optical identification (ID) tags [1] have a promising future in a number of applications such as the surveillance of vehicles in transportation, control of restricted areas for homeland security, item tracking on conveyor belts or other industrial environment, etc. More specifically, passive optical ID tag [1] was introduced as an optical code containing a signature (that is, a characteristic image or other relevant information of the object), which permits its real-time remote detection and identification. Since their introduction in the literature [1], some contributions have been proposed to increase their usefulness and robustness. To increase security and avoid counterfeiting, the signature was introduced in the optical code as an encrypted function [2-5] following the double-phase encryption technique [6]. Moreover, the design of the optical ID tag was done in such a way that tolerance to variations in scale and rotation was achieved [2-5]. To do that, the encrypted information was multiplexed and distributed in the optical code following an appropriate topology. Further studies were carried out to analyze the influence of different sources of noise. In some proposals [5, 7], the designed ID tag consists of two optical codes where the complex-valued encrypted signature was separately introduced in two real-valued functions according to its magnitude and phase distributions. This solution was introduced to overcome some difficulties in the readout of complex values in outdoors environments. Recently, the fully phase encryption technique [8] has been proposed to increase noise robustness of the authentication system.

  11. [Comparison of Phoenix™ Yeast ID Panel and API® ID 32C commercial systems for the identification of Candida species isolated from clinical samples].

    Science.gov (United States)

    Gayibova, Ülkü; Dalyan Cılo, Burcu; Ağca, Harun; Ener, Beyza

    2014-07-01

    Opportunistic fungal pathogens are one of the important causes of nosocomial infections, and several different types of yeasts, especially Candida species are increasingly recovered from immunocompromised patients. Since many of the yeasts are resistant to the commonly used antifungal agents, the introduction of appropriate therapy depends on rapid and accurate identification. The aims of this study were to compare the commercial identification systems namely API® ID 32C (bioMerieux, France) and Phoenix™ Yeast ID Panel (Becton Dickinson Diagnostics, USA) for the identification of Candida species and to evaluate the effect of morphological findings in the identification process. A total of 211 yeast strains isolated from different clinical samples (111 urine, 34 blood/vascular catheter, 27 upper/lower respiratory tract, 16 abscess/pus, 13 throat/vagina swabs and 10 sterile body fluids) of 137 patients hospitalized in Uludag University Health and Research Center between October 2013 to January 2014, were included in the study. Samples were cultured on blood agar, chromogenic agar (CHROMagar Candida, BD, USA) and Saboraud's dextrose agar (SDA), and isolated yeast colonies were evaluated with germ tube test and morphological examination by microscopy on cornmeal/Tween-80 agar. The isolates were identified as well by two commercial systems according to the manufacturers' recommendations. Discrepant results between the systems were tried to be resolved by using morphological characteristics of the yeasts. Of the isolates 159 were identified identical by both of the systems, and the concordance between those systems were estimated as 75.4%. According to the concordant identification, the most frequently isolated species was C.albicans (44.1%) followed by C.tropicalis (9.9%), C.glabrata (9.5%), C.parapsilosis (8.5%) and C.kefyr (8.1%). The concordance rate was 81.7% in identification of frequently isolated species (C.albicans, C.tropicalis, C.parapsilosis, C.glabrata, C

  12. Angiotensin-converting enzyme gene I/D polymorphism in Pakistani ...

    African Journals Online (AJOL)

    The frequency of DD allele in SLE patients with lupus nephritis is 100%, Sjogren's syndrome 100%, Raynaud's phenomenon 88.88%, and with rheumatoid arthritis it is 78.94%. The frequency of ID allele in SLE patients with Raynaud's phenomenon is 5.55%, and with rheumatoid arthritis it is 10.52%. The frequency of II ...

  13. Migraine headaches among university students using id migraine test as a screening tool

    Directory of Open Access Journals (Sweden)

    Caylan Ayse

    2011-08-01

    Full Text Available Abstract Background Migraine is a significant health problem, especially for the young people, due to its frequency and accompanying morbidity, causing disability and loss of performance. In this study, our aim was to determine the prevalence of migraine headaches among university students in Edirne, a Turkish city. Methods In this cross-sectional and descriptive study, study population was composed of students registered to Trakya University in the academic year of 2008-2009. Out of these, 3694 of them accepted to participate. Participants who had two or more headaches in the last 3 months formed the headache group. Afterwards, two preliminary questions were applied to the headache group and participants with at least one affirmative response were asked to perform the validated ID-Migraine™ test. Results The mean age of 3694 students participated in the study was 19.23 ± 1.84 (17-39 years, with adolescents:adult ratio being 2.5:1. 1613 students (43.7% did have at least two headaches in the last three months. Migraine-type headache was detected in 266 subjects (7.2% based on the ID-Migraine™ test. Of the migraine group, 72 were male (27.1% and 194 were female (72.9%. There was no significant difference in migraine prevalence between adolescent and adult age groups. Conclusions With a prevalence similar to adults, primary care physicians should be aware of the probability of migraine headaches in university students in order to maintain a successful school performance.

  14. Le point de vue de la philosophie: L'entreprise idéologique

    OpenAIRE

    Pesqueux , Yvon

    2004-01-01

    Parler de l'entreprise conduit à questionner ce qui fonde le discours – scientifique ou médiatique – qui permette d'en parler. Et c'est bien en cela qu'il est nécessaire d'approfondir l'univers de l'idéologie et de la croyance qui est celui dans lequel modèle, image, métaphore et figure de l'entreprise plongent leurs racines dans la mesure où l'usage de ces notions, quand on les applique à l'entreprise, conduit à créer un monde qui soit cohérent avec ce qu'ils portent en eux. L'idéologie comm...

  15. Comparative dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for brain tumors

    Energy Technology Data Exchange (ETDEWEB)

    Brandao, Samia de Freitas, E-mail: samiabrandao@gmail.com [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear; Campos, Tarcisio Passos Ribeiro de [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)

    2013-06-15

    Objective: comparative analysis of dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for treatment of brain tumors. Materials and methods: simulations of intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT were performed with the MCNP5 code, modeling the treatment of a brain tumor on a voxel computational phantom representing a human head. Absorbed dose rates were converted into biologically weighted dose rates. Results: intracavitary balloon catheter brachytherapy with I-125 produced biologically weighted mean dose rates of 3.2E-11, 1.3E-10, 1.9E-11 and 6.9E-13 RBE.Gy.h{sup -1}.p{sup -1}.s, respectively, on the healthy tissue, on the balloon periphery and on the /{sub 1} and /{sub 2} tumor infiltration zones. On the other hand, Cf-252 brachytherapy combined with BNCT produced a biologically weighted mean dose rate of 5.2E-09, 2.3E-07, 8.7E-09 and 2.4E-09 RBE.Gy.h{sup -1}.p{sup -1}.s, respectively on the healthy tissue, on the target tumor and on the /{sub 1} and /{sub 2} infiltration zones. Conclusion: Cf-252 brachytherapy combined with BNCT delivered a selective irradiation to the target tumor and to infiltration zones, while intracavitary balloon catheter brachytherapy with I-125 delivered negligible doses on the tumor infiltration zones. (author)

  16. Comparative dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for brain tumors

    Directory of Open Access Journals (Sweden)

    Samia de Freitas Brandao

    2013-07-01

    Full Text Available Objective Comparative analysis of dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for treatment of brain tumors. Materials and Methods Simulations of intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT were performed with the MCNP5 code, modeling the treatment of a brain tumor on a voxel computational phantom representing a human head. Absorbed dose rates were converted into biologically weighted dose rates. Results Intracavitary balloon catheter brachytherapy with I-125 produced biologically weighted mean dose rates of 3.2E-11, 1.3E-10, 1.9E-11 and 6.9E-13 RBE.Gy.h-1.p-1.s, respectively, on the healthy tissue, on the balloon periphery and on the I 1 and I 2 tumor infiltration zones. On the other hand, Cf-252 brachytherapy combined with BNCT produced a biologically weighted mean dose rate of 5.2E-09, 2.3E-07, 8.7E-09 and 2.4E-09 RBE.Gy.h-1.p-1.s, respectively on the healthy tissue, on the target tumor and on the I 1 and I 2 infiltration zones. Conclusion Cf-252 brachytherapy combined with BNCT delivered a selective irradiation to the target tumor and to infiltration zones, while intracavitary balloon catheter brachytherapy with I-125 delivered negligible doses on the tumor infiltration zones.

  17. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to very low calorie diets (VLCDs) and reduction in body weight (ID 1410), reduction in the sense of hunger (ID 1411), reduction in body fat mass while maintaining lean

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to very low calorie diets (VLCDs) and reduction in body weight, reduction in the sense of hunger, reduction in body fat mass while maintaining lean body mass, reduction of post-prandial glycaemic responses, and maintenance of normal blood lipid profile. The scientific substantiation...... that whereas the diet that is the subject of the claim, very low calorie diet, is sufficiently characterised in relation to the following claimed effects: reduction in body weight (ID 1410), reduction in the sense of hunger (ID 1411), and reduction in body fat mass while maintaining lean body mass (ID 1412...... that formula foods for use in very low calorie diets should contain. The Panel concludes that a cause and effect relationship cannot be established between the consumption of a very low calorie diet and reduction of post-prandial glycaemic responses (ID 1414) and maintenance of normal blood lipid profile (ID...

  18. Differential expression of ID4 and its association with TP53 mutation, SOX2, SOX4 and OCT-4 expression levels.

    Directory of Open Access Journals (Sweden)

    Thais Fernanda de Almeida Galatro

    Full Text Available Inhibitor of DNA Binding 4 (ID4 is a member of the helix-loop-helix ID family of transcription factors, mostly present in the central nervous system during embryonic development, that has been associated with TP53 mutation and activation of SOX2. Along with other transcription factors, ID4 has been implicated in the tumorigenic process of astrocytomas, contributing to cell dedifferentiation, proliferation and chemoresistance. In this study, we aimed to characterize the ID4 expression pattern in human diffusely infiltrative astrocytomas of World Health Organization (WHO grades II to IV of malignancy (AGII-AGIV; to correlate its expression level to that of SOX2, SOX4, OCT-4 and NANOG, along with TP53 mutational status; and to correlate the results with the clinical end-point of overall survival among glioblastoma patients. Quantitative real time PCR (qRT-PCR was performed in 130 samples of astrocytomas for relative expression, showing up-regulation of all transcription factors in tumor cases. Positive correlation was found when comparing ID4 relative expression of infiltrative astrocytomas with SOX2 (r = 0.50; p<0.005, SOX4 (r = 0.43; p<0.005 and OCT-4 (r = 0.39; p<0.05. The results from TP53 coding exon analysis allowed comparisons between wild-type and mutated status only in AGII cases, demonstrating significantly higher levels of ID4, SOX2 and SOX4 in mutated cases (p<0.05. This pattern was maintained in secondary GBM and further confirmed by immunohistochemistry, suggesting a role for ID4, SOX2 and SOX4 in early astrocytoma tumorigenesis. Combined hyperexpression of ID4, SOX4 and OCT-4 conferred a much lower (6 months median survival than did hypoexpression (18 months. Because both ID4 alone and a complex of SOX4 and OCT-4 activate SOX2 transcription, it is possible that multiple activation of SOX2 impair the prognosis of GBM patients. These observational results of associated expression of ID4 with SOX4 and OCT-4 may be used as a

  19. Abscesso pulmonar de aspiração: análise de 252 casos consecutivos estudados de 1968 a 2004 Lung abscess: analysis of 252 consecutive cases diagnosed between 1968 and 2004

    Directory of Open Access Journals (Sweden)

    José da Silva Moreira

    2006-04-01

    Full Text Available OBJETIVO: Apresentar a experiência de um serviço especializado em doenças respiratórias no manejo de casos de abscesso pulmonar de aspiração. MÉTODOS: Descrevem-se aspectos diagnósticos e resultados terapêuticos de 252 casos consecutivos de pacientes com abscesso de pulmão, hospitalizados de 1968 a 2004. RESULTADOS: Dos 252 casos, 209 ocorreram em homens e 43 em mulheres, com média de idade de 41,4 anos. Eram alcoolistas 70,2% dos pacientes. Tosse, expectoração, febre e comprometimento do estado geral ocorreram em mais de 97% dos casos, 64% tinham dor torácica, 30,2% hipocratismo digital, 82,5% apresentavam dentes em mau estado de conservação, 78,6% tiveram episódio de perda de consciência e 67,5% apresentavam odor fétido de secreções broncopulmonares. Em 85,3% dos casos as lesões localizavam-se nos segmentos posterior de lobo superior ou superior de lobo inferior, 96,8% delas unilateralmente. Em 24 pacientes houve associação de empiema pleural (9,5%. Flora mista foi identificada em secreções broncopulmonares ou pleurais em 182 pacientes (72,2 %. Todos os doentes foram inicialmente tratados com antibióticos (principalmente penicilina ou clindamicina e 98,4 % deles foram submetidos à drenagem postural. Procedimentos cirúrgicos foram efetuados em 52 (20,6% pacientes (24 drenagens de empiema, 22 ressecções pulmonares e 6 pneumostomias. Cura foi obtida em 242 pacientes (96,0% e 10 faleceram (4,0%. CONCLUSÃO: O abscesso pulmonar de aspiração ocorreu predominantemente em indivíduos adultos masculinos com doença dentária e episódio antecedente de perda de consciência (especialmente por alcoolismo. A maioria dos pacientes foi tratada clinicamente (antibióticos e drenagem postural. Um quinto deles submeteu-se a algum procedimento cirúrgico.OBJECTIVE: To relate the experience of the staff at a health care facility specializing in the management of patients with aspiration lung abscess. METHODS: Diagnostic aspects

  20. The effect of adjuvants on the immune response induced by a DBL4e-ID4 VAR2CSA based Plasmodium falciparum vaccine against placental malaria

    DEFF Research Database (Denmark)

    Pinto, V V; Salanti, A; Joergensen, L M

    2012-01-01

    720, Alhydrogel(®) and CAF01. Antibodies induced against DBL4¿-ID4 in combination with these adjuvants inhibited parasite binding to CSA from 82% to 99%. Although, different epitope recognition patterns were obtained for the different formulations, all adjuvant combinations induced strong Th1 and Th2......¿-ID4 to induce binding-inhibitory antibodies when formulated with adjuvants approved for human use. We have characterized the immune response of DBL4¿-ID4 in combination with Freund's complete and incomplete adjuvant and with three adjuvants currently being used in clinical trials: Montanide(®) ISA...... type responses, resulting in IgG with similar binding strength, with to the DBL4¿-ID4 antigen. These results demonstrate that the DBL4¿-ID4 antigen is highly immunogenic and that binding inhibitory antibodies are induced when formulated with any of the tested adjuvants....

  1. Otherness in interior identity: a reflection about the Freudian concepts of unconscious, superego, and id.

    Science.gov (United States)

    Moreira, Jacqueline de Oliveira

    2008-11-01

    Theoretical, psychoanalytical constructs referring to the unconscious, the superego, and id, enjoy an autonomy within the I. As such, this study contemplates the discussion of these foreign entities that inhabit the interior of the I, producing an effect of foreignness. In the first section, I will develop a reflection on the state of foreignness of the unconscious. I will begin with an analogy used by Freud, which addresses the thesis of universality of consciousness with the psychoanalytical thesis of the subconscience within the I. Affirmation of consciousness in the other may be used analogously for affirm the idea of another inhabiting our own being. I shall continue, seeking to understand how the process of unconscious repression produces the effect of foreignness. The idea of a moral censor present in the entity of the superego constitutes the theme of the second section. The superego follows the principle of otherness in its constitution and in its effects on the I. Finally, a reflection on the dimension of otherness in the Id seems urgent to me, as with this concept, Freud radicalized in the idea of the foreign as the origin of the subject.

  2. Student ID Cards: What You Should Know About Them

    Science.gov (United States)

    Hoffman, Jonathan; McGuire, Agnes C.

    1973-01-01

    Discusses the usefulness of photo ID cards for school security purposes, library control, student activities, and bus transportation control. Examines ways in which card costs can be reduced and the pros and cons of producing the cards at the school or of letting the work out. Problems involving card abuse and student rights are also considered.…

  3. The Id, Ego and Super-Ego in "Pride and Prejudice"

    Science.gov (United States)

    Liang, Yamin

    2011-01-01

    This paper mainly analyses the the id, ego, and super-ego which exists in the main character Elizabeth from several aspects, such as her pursuit for love, her prejudice towards Mr. Darcy, and the changes in her attitudes towards Wickham. This analysis helps readers appreciate this masterpiece from a different aspect which is related to the…

  4. Predicting Students’ Performance using Modified ID3 Algorithm

    OpenAIRE

    Ramanathan L; Saksham Dhanda; Suresh Kumar D

    2013-01-01

    The ability to predict performance of students is very crucial in our present education system. We can use data mining concepts for this purpose. ID3 algorithm is one of the famous algorithms present today to generate decision trees. But this algorithm has a shortcoming that it is inclined to attributes with many values. So , this research aims to overcome this shortcoming of the algorithm by using gain ratio(instead of information gain) as well as by giving weights to each attribute at every...

  5. RFID and Auto-ID in planning and logistics

    CERN Document Server

    Jones, Erick C

    2011-01-01

    As RFID technology is becoming increasingly popular, the need has arisen to address the challenges and approaches to successful implementation. RFID and Auto-ID in Planning and Logistics: A Practical Guide for Military UID Applications presents the concepts for students, military personnel and contractors, and corporate managers to learn about RFID and other automatic information capture technologies, and their integration into planning and logistics functions. The text includes comparisons of RFID with technologies such as bar codes, satellite tags, and global positioning systems and provides

  6. Self-Reporting Tool On Pain in People with Intellectual Disabilities (STOP-ID!): A Usability Study

    NARCIS (Netherlands)

    de Knegt, N.C.; Lobbezoo, F.; Schuengel, C.; Evenhuis, H.M.; Scherder, E.J.A.

    2016-01-01

    The use of the Self-reporting Tool On Pain in people with Intellectual Disabilities (STOP-ID!), an online application developed by the authors to aid in the self-reporting of pain, was evaluated in 40 adults with Down syndrome. Comprehension of the use of the tool (the ability to recognize

  7. 76 FR 43196 - Implementation of the Truth in Caller ID Act

    Science.gov (United States)

    2011-07-20

    ... National Network to End Domestic Violence (NNEDV) that the term ``harm'' is a broad concept that... evolution of technology, and the consequences of spoofing ANI and pseudo-ANI, we find that the delivery of... ID spoofing to protect victims of domestic violence. According to NNEDV, a verification requirement...

  8. Fabrication of 50-mg 252Cf neutron sources for the FDA [Food and Drug Administration] activation analysis facility

    International Nuclear Information System (INIS)

    Bigelow, J.E.; Cagle, E.B.; Knauer, J.B.

    1987-01-01

    The Transuranium Processing Plant (TPP) at ORNL has been requested by the Food and Drug Administration (FDA) to furnish 200 mg of 252 Cf for use in their new activation analysis facility. This paper discusses the procedure to be employed in fabricating the californium into four neutron sources, each containing a nominal 50-mg of 252 Cf. The ORNL Model LSD (Large, Stainless steel, Doubly encapsulated) neutron source consists of a 6.33-mm-diam aluminum pellet doubly encapsulated in Type 304L stainless steel. The pellet is comprised of an aluminum tube holding Cf 2 O 2 SO 4 microspheres confined by pressed aluminum powder. The microspheres are prepared in a separate vessel and then transferred into the specially designed aluminum tube prior to pressing

  9. Underground Storage Tank Integrated Demonstration (UST-ID)

    International Nuclear Information System (INIS)

    1994-02-01

    The DOE complex currently has 332 underground storage tanks (USTs) that have been used to process and store radioactive and chemical mixed waste generated from weapon materials production. Very little of the over 100 million gallons of high-level and low-level radioactive liquid waste has been treated and disposed of in final form. Two waste storage tank design types are prevalent across the DOE complex: single-shell wall and double-shell wall designs. They are made of stainless steel, concrete, and concrete with carbon steel liners, and their capacities vary from 5000 gallons (19 m 3 ) to 10 6 gallons (3785 m 3 ). The tanks have an overburden layer of soil ranging from a few feet to tens of feet. Responding to the need for remediation of tank waste, driven by Federal Facility Compliance Agreements (FFCAs) at all participating sites, the Underground Storage Tank Integrated Demonstration (UST-ID) Program was created by the US DOE Office of Technology Development in February 1991. Its mission is to focus the development, testing, and evaluation of remediation technologies within a system architecture to characterize, retrieve, treat to concentrate, and dispose of radioactive waste stored in USTs at DOE facilities. The ultimate goal is to provide safe and cost-effective solutions that are acceptable to the public and the regulators. The UST-ID has focused on five DOE locations: the Hanford Site, which is the host site, in Richland, Washington; the Fernald Site in Fernald, Ohio; the Idaho National Engineering Laboratory near Idaho Falls, Idaho; the Oak Ridge Reservation in Oak Ridge, Tennessee, and the Savannah River Site in Savannah River, South Carolina

  10. ORCID Integration: Services to Create and Use ORCID IDs at KAUST

    KAUST Repository

    Grenz, Daryl M.

    2015-06-09

    As ORCID IDs become accepted as a global standard, the potential benefits to researchers and institutions of making use of them are multiplying. At King Abdullah University of Science and Technology (KAUST) we adopted the first institutional open access policy in the Arab region in June 2014 and are integrating with ORCID as part of services to researchers that improve the preservation and dissemination of their research. We started by using ORCID IDs to identify authors in our institutional repository. Our next step was to join ORCID as an institutional member and then set up a plan to support our faculty, researchers and students in the creation and use of ORCID identifiers. This presentation will look at the choices made and lessons learned during this process, focusing on the tools we developed to interact with the ORCID member API and the ways in which introducing ORCID has complemented other repository initiatives, such as the implementation of our institutional open access policy.

  11. 77 FR 55813 - Transition of DOE-ID Public Reading Room

    Science.gov (United States)

    2012-09-11

    ... to the INL Research Library at 1776 Science Center Drive, Idaho Falls, ID 83401, beginning September 1, 2012. Access to documents will also be electronically accessible through the World Wide Web. For direction in accessing documents electronically through the World Wide Web, please refer to the Idaho...

  12. High energy {gamma} emission in the spontaneous fission of {sup 252}Cf; Emission {gamma} de grande energie dans la fission spontanee de {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires, Bordeaux-1 Univ., 33 Gradignan (France); Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Thiesen, Ch. [Dept. d`Astrophysique, de la Physique des Particules, de la Physique Nucleaire et de l`Instrumentation Associee, CEA Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Belier, G.; Meot, M.V. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [Inst.de Physique Nucleaire, Lyon-1 Univ., 69 - Villeurbanne (France)

    1997-06-01

    The prompt {gamma} emission in the spontaneous fission of {sup 252}Cf is characterized by an energy spectrum which extends up to 20 MeV. It was established that the spectrum presents in the neighbourhood of symmetric fission an intensity bump in the 3-8 MeV {gamma} energy interval. The origin of this phenomenon is still not well understood, so that it was found interesting to carry out new measurements. The spectrum of the {gamma} rays emitted in spontaneous fission of {sup 252}Cf has been measurement in the EUROGAM II multidetector using photovoltaic cells to detect fragments. The aim of the experiment was to investigate the {gamma} yield enhancement which appears for mass fragment ratio near 132/120. This enhancement was found to be composed of two peaks located at 4 MeV and 5.5 MeV respectively. The results obtained confirm the intensity bound in the 3-8 MeV region but this augmentation reaches the maximum when the heavy fragment is near the mass 132. Beyond mass 140 the phenomenon diminish and the {gamma} spectrum regains the behaviour expected for a statistic emission. The additional structure at 5.5 MeV does not vary with excitation energy while the excitation function of the 4 MeV structure is more structured and presents a maximum when the excitation energy is near 8 MeV. It is likely that all or part of this observed phenomenon is due to a particular excitation mode of this isotope associated for instance with a low energy dipole resonance. A theoretical study of this collective effect is under way 3 refs.

  13. Id4 functions downstream of Bmp signaling to restrict TCF function in endocardial cells during atrioventricular valve development.

    Science.gov (United States)

    Ahuja, Suchit; Dogra, Deepika; Stainier, Didier Y R; Reischauer, Sven

    2016-04-01

    The atrioventricular canal (AVC) connects the atrial and ventricular chambers of the heart and its formation is critical for the development of the cardiac valves, chamber septation and formation of the cardiac conduction system. Consequently, problems in AVC formation can lead to congenital defects ranging from cardiac arrhythmia to incomplete cardiac septation. While our knowledge about early heart tube formation is relatively comprehensive, much remains to be investigated about the genes that regulate AVC formation. Here we identify a new role for the basic helix-loop-helix factor Id4 in zebrafish AVC valve development and function. id4 is first expressed in the AVC endocardium and later becomes more highly expressed in the atrial chamber. TALEN induced inactivation of id4 causes retrograde blood flow at the AV canal under heat induced stress conditions, indicating defects in AV valve function. At the molecular level, we found that id4 inactivation causes misexpression of several genes important for AVC and AV valve formation including bmp4 and spp1. We further show that id4 appears to control the number of endocardial cells that contribute to the AV valves by regulating Wnt signaling in the developing AVC endocardium. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Heat transfer through He II in a 9.6 m long 35 mm ID tube

    International Nuclear Information System (INIS)

    Caspi, S.; Schafer, R.V.

    1984-07-01

    The limiting heat flux at the onset of He I was measured in a 9.6 m long tube of 35 mm ID at a bath temperature between 1.8 K and T/sub lambda/ and a pressure of 1 atm. The measured limiting heat flux during axial heating is 50% more than end heating at the same bath temperature. Both cases agrees with the Gorter-Mellink mutual friction theory

  15. Investigation of the far asymmetric region in 252Cf(sf)

    International Nuclear Information System (INIS)

    Hambsch, F.-J.; Oberstedt, S.

    1997-01-01

    A twin Frisch-gridded ionization chamber has been used to measure the fission fragment mass, kinetic-energy and angular correlations for 252 Cf(sf). In total 2.5 x 10 8 events were collected. The focus was in the far asymmetric mass region, where enhancements in the yield had been found earlier. It could be shown, that these findings are due to false events, coming from either close geometries not properly taking into account the angular-dependent energy loss in the sample and backing, from a too large angular cone selected in case of studies employing ionization chambers, or even from poor target qualities. (orig.)

  16. Trajectory calculations for the ternary cold fission of 252Cf

    International Nuclear Information System (INIS)

    Misicu, S.

    1998-01-01

    We compute the final kinetic energies of the fragments emitted in the light charged particle accompanied by cold fission of 252 Cf taking into account the deformation and the finite-size effects of the fragments and integrating the equations of motion for a three-body system subjected only to Coulomb forces. The initial conditions for the trajectory calculations were derived in the framework of a deformed cluster model which includes also the effect due to the absorbative nuclear part. Although the distributions of initial kinetic energies are rather broad we show that in cold fission the initial conditions can be better determined than in the usual spontaneous fission

  17. An absolute measurement of 252Cf prompt fission neutron spectrum at low energy range

    International Nuclear Information System (INIS)

    Lajtai, A.; Dyachenko, P.P.; Kutzaeva, L.S.; Kononov, V.N.; Androsenko, P.A.; Androsenko, A.A.

    1983-01-01

    Prompt neutron energy spectrum at low energies (25 keV 252 Cf spontaneous fission has been measured with a time-of-flight technique on a 30 cm flight-path. Ionization chamber and lithium-glass were used as fission fragment and neutron detectors, respectively. Lithium glasses of NE-912 (containing 6 Li) and of NE-913 (containing 7 Li) 45 mm in diameter and 9.5 mm in thickness have been employed alternatively, for the registration of fission neutrons and gammas. For the correct determination of the multiscattering effects - the main difficulty of the low energy neutron spectrum measurements - a special geometry for the neutron detector was used. Special attention was paid also to the determination of the absolute efficiency of the neutron detector. The real response function of the spectrometer was determined by a Monte-Carlo calculation. The scattering material content of the ionization chamber containing a 252 Cf source was minimized. As a result of this measurement a prompt fission neutron spectrum of Maxwell type with a T=1.42 MeV parameter was obtained at this low energy range. We did not find any neutron excess or irregularities over the Maxwellian. (author)

  18. Association between RAS Gene Polymorphisms (ACE I/D, AGT M235T and Henoch-Schönlein Purpura in a Turkish Population

    Directory of Open Access Journals (Sweden)

    Sinem Nalbantoglu

    2013-01-01

    Full Text Available Henoch-Schönlein purpura (HSP is a small-vessel vasculitis of autoimmune hypersensitivity, and renin-angiotensin system (RAS regulates vascular homeostasis and inflammation with activation of cytokine release. Thus, we aimed to investigate the association between HSP and ACE I/D and AGT M235T polymorphisms. Genotyping was determined by allele specific PCR and PCR-RFLP. We obtained a significant difference in genotype distribution (p = 0.003 and allele frequencies (p 0.05 and allele frequencies (p > 0.05 of the AGT M235T polymorphism. Risk assessment showed significant risk for HSP in the subjects both with the ID + DD genotype (p = 0.019, OR: 2.288, 95% CI: 1.136–4.609 and D allele (OR: D vs. I: 2.0528, 95% CI: 1.3632–3.0912, p = 0.001 while no significant risk was obtained for HSP in the subjects both with the MT + TT genotype (p = 0.312, OR: 1.3905, 95% CI: 0.7326–2.6391 and T allele (OR: T vs. M: 1.065, 95% CI: 0.729–1.557, p = 0.743. Furthermore, when patients were stratified by the presence of certain systemic complications of HSP, no significant association was detected with ACE I/D, and AGT M235T polymorphisms. Our findings suggest that ACE I/D polymorphism is significantly associated with HSP susceptibility.

  19. Limited concordance between teachers, parents and healthcare professionals on the presence of chronic diseases in ID-adolescents

    NARCIS (Netherlands)

    Oeseburg, B.; Jansen, D. E. M. C.; Reijneveld, S. A.; Dijkstra, G. J.; Groothoff, J. W.

    2010-01-01

    Evidence on teachers' knowledge about somatic and mental chronic diseases among ID-adolescent compared to the knowledge parents and healthcare professionals have, is limited. The aim of this study is: (1) to assess the knowledge of teachers on the presence of chronic diseases in ID-adolescents; (2)

  20. Comparison of the optimized conditions for genotyping of ACE ID ...

    African Journals Online (AJOL)

    ACE ID polymorphism is inevitable for genetic epidemiology of several cardiovascular and non cardiovascular diseases due to its direct influence on ACE activity level. In the present work, conditions were optimized for its analysis using conventional and direct blood PCR (DB PCR). Blood samples from nine normotensive ...

  1. Bmps and id2a act upstream of Twist1 to restrict ectomesenchyme potential of the cranial neural crest.

    Directory of Open Access Journals (Sweden)

    Ankita Das

    Full Text Available Cranial neural crest cells (CNCCs have the remarkable capacity to generate both the non-ectomesenchyme derivatives of the peripheral nervous system and the ectomesenchyme precursors of the vertebrate head skeleton, yet how these divergent lineages are specified is not well understood. Whereas studies in mouse have indicated that the Twist1 transcription factor is important for ectomesenchyme development, its role and regulation during CNCC lineage decisions have remained unclear. Here we show that two Twist1 genes play an essential role in promoting ectomesenchyme at the expense of non-ectomesenchyme gene expression in zebrafish. Twist1 does so by promoting Fgf signaling, as well as potentially directly activating fli1a expression through a conserved ectomesenchyme-specific enhancer. We also show that Id2a restricts Twist1 activity to the ectomesenchyme lineage, with Bmp activity preferentially inducing id2a expression in non-ectomesenchyme precursors. We therefore propose that the ventral migration of CNCCs away from a source of Bmps in the dorsal ectoderm promotes ectomesenchyme development by relieving Id2a-dependent repression of Twist1 function. Together our model shows how the integration of Bmp inhibition at its origin and Fgf activation along its migratory route would confer temporal and spatial specificity to the generation of ectomesenchyme from the neural crest.

  2. Automatic ID heat load generation in ANSYS code

    International Nuclear Information System (INIS)

    Wang, Zhibi.

    1992-01-01

    Detailed power density profiles are critical in the execution of a thermal analysis using a finite element (FE) code such as ANSYS. Unfortunately, as yet there is no easy way to directly input the precise power profiles into ANSYS. A straight-forward way to do this is to hand-calculate the power of each node or element and then type the data into the code. Every time a change is made to the FE model, the data must be recalculated and reentered. One way to solve this problem is to generate a set of discrete data, using another code such as PHOTON2, and curve-fit the data. Using curve-fitted formulae has several disadvantages. It is time consuming because of the need to run a second code for generation of the data, curve-fitting, and doing the data check, etc. Additionally, because there is no generality for different beamlines or different parameters, the above work must be repeated for each case. And, errors in the power profiles due to curve-fitting result in errors in the analysis. To solve the problem once and for all and with the capability to apply to any insertion device (ID), a program for ED power profile was written in ANSYS Parametric Design Language (APDL). This program is implemented as an ANSYS command with input parameters of peak magnetic field, deflection parameter, length of ID, and distance from the source. Once the command is issued, all the heat load will be automatically generated by the code

  3. Quantitative Detection of ID4 Gene Aberrant Methylation in the Differentiation of Myelodysplastic Syndrome from Aplastic Anemia

    Directory of Open Access Journals (Sweden)

    Mian-Yang Li

    2015-01-01

    Full Text Available Background: The diagnosis of myelodysplastic syndrome (MDS, especially hypoplastic MDS, and MDS with low blast counts or normal karyotype may be problematic. This study characterized ID4 gene methylation in patients with MDS and aplastic anemia (AA. Methods: The methylation status of ID4 was analyzed by bisulfite sequencing polymerase chain reaction (PCR and quantitative real-time methylation-specific PCR (MethyLight PCR in 100 patients with MDS and 31 patients with AA. Results: The MDS group had a higher ID4 gene methylation positivity rate (22.22% and higher methylation levels (0.21 [0-3.79] than the AA group (P < 0.05. Furthermore, there were significant differences between the hypoplastic MDS and AA groups, the MDS with low blast count and the AA groups, and the MDS with normal karyotype and the AA groups. The combination of genetic and epigenetic markers was used in much more patients with MDS (62.5% [35/56] than the use of genetic markers only (51.79% [29/56]. Conclusions: These results showed that the detection of ID4 methylation positivity rates and levels could be a useful biomarker for MDS diagnosis.

  4. Evaluation of Association of ADRA2A rs553668 and ACE I/D Gene Polymorphisms with Obesity Traits in the Setapak Population, Malaysia.

    Science.gov (United States)

    Shunmugam, Vicneswari; Say, Yee-How

    2016-02-01

    α-adrenergic receptor 2A (ADRA2A) and angiotensin-converting enzyme (ACE) genes have been variably associated with obesity and its related phenotypes in different populations worldwide. This cross-sectional study aims to investigate the association of adrenergic receptor α2A (ADRA2A) rs553668 and angiotensin-converting enzyme (ACE) I/D single nucleotide polymorphisms (SNPs) with obesity traits (body mass index-BMI; waist-hip ratio-WHR; total body fat percentage - TBF) in a Malaysian population. Demographic and clinical variables were initially collected from 230 subjects via convenience sampling among residents and workers in Setapak, Malaysia, but in the end only 214 multi-ethnic Malaysians (99 males; 45 Malays, 116 ethnic Chinese, and 53 ethnic Indians) were available for statistical analysis. Genotyping was performed by polymerase chain reaction using DNA extracted from mouthwash samples. The overall minor allele frequencies (MAFs) for ADRA2A rs553668 and ACE I/D were 0.55 and 0.56, respectively. Allele distribution of ACE I/D was significantly associated with ethnicity and WHR class. Logistic regression analysis showed that subjects with the ACE II genotype and I allele were, respectively, 2.15 and 1.55 times more likely to be centrally obese, but when adjusted for age and ethnicity, this association was abolished. Covariate analysis controlling for age, gender, and ethnicity also showed similar results, where subjects carrying the II genotype or I allele did not have significantly higher WHR. Combinatory genotype and allele analysis for ADRA2A rs553668 and ACE I/D showed that subjects with both ADRA2A rs553668 GG and ACE I/D II genotypes had significant lowest WHR compared to other genotype combinations. The ACE II genotype might be a protective factor against central adiposity risk among the Malaysian population when in combination with the ADRA2A rs553668 GG genotype.

  5. In situ x-ray fluorescence and californium-252 neutron activation analysis for marine and terrestrial mineral exploration

    International Nuclear Information System (INIS)

    Wogman, N.A.

    1976-12-01

    Instrumentation has been designed for in situ analysis of marine and terrestrial minerals using the techniques of x-ray fluorescence and neutron activation analysis. The energy-dispersive x-ray fluorescence analyzer allows more than 20 elements to be quantitatively measured at the 10 ppM level in water depths to 300 m. The analyzer consists of a solid cryogen-cooled Si(Li) detector, a 50 mCi 109 Cd or 57 Co excitation source, and an analyzer-computer system for data storage and manipulation. The neutron activation analysis, which is designed to measure up to 30 elements at parts per hundred to ppM levels, utilizes the man-made element 252 Cf as its neutron activation source. The resulting radioelements which emit characteristic gamma radiation are then analyzed in situ during 2- to 200-s counting intervals with Ge(Li) or NaI(T1) detector systems. An extension of this latter technique, which uses a 252 Cf- 235 U fueled subcritical multiplier, is also being studied. The subcritical facility allows the neutrons from the 252 Cf source to be multiplied, thus providing greater neutron flux. Details of these in situ analysis systems, actual in situ spectra, and recorded data are discussed with respect to the detection of minerals at their varying concentration levels. The system response of each illustrates its usefulness for various rapid environmental mineral exploration studies. These techniques can be utilized on terrestrial surfaces and marine or fresh water sediments. 5 figures, 2 tables

  6. Interacting mechanism of ID3 HLH domain towards E2A/E12 transcription factor – An Insight through molecular dynamics and docking approach

    Directory of Open Access Journals (Sweden)

    Nishith Saurav Topno

    2016-03-01

    Full Text Available Inhibitor of DNA binding protein 3 (ID3 has long been characterized as an oncogene that implicates its functional role through its Helix–Loop–Helix (HLH domain upon protein–protein interaction. An insight into the dimerization brought by this domain helps in identifying the key residues that favor the mechanism behind it. Molecular dynamics (MD simulations were performed for the HLH proteins ID3 and Transcription factor E2-alpha (E2A/E12 and their ensemble complex (ID3-E2A/E12 to gather information about the HLH domain region and its role in the interaction process. Further evaluation of the results by Principal Component Analysis (PCA and Free Energy Landscape (FEL helped in revealing residues of E2A/E12: Lys570, Ala595, Val598, and Ile599 and ID3: Glu53, Gln63, and Gln66 buried in their HLH motifs imparting key roles in dimerization process. Furthermore the T-pad analysis results helped in identifying the key fluctuations and conformational transitions using the intrinsic properties of the residues present in the domain region of the proteins thus specifying their crucial role towards molecular recognition. The study provides an insight into the interacting mechanism of the ID3-E2A/E12 complex and maps the structural transitions arising in the essential conformational space indicating the key structural changes within the helical regions of the motif. It thereby describes how the internal dynamics of the proteins might regulate their intrinsic structural features and its subsequent functionality.

  7. Application of modular neutron spectrometer to measure neutron spectra from fission of 252Cf

    International Nuclear Information System (INIS)

    Szeflinski, Z.; Osuch, S.; Popkiewicz, M.; Wilhelmi, Z.; Zelazny, Z.

    1996-01-01

    The neutron spectrometer MONA (Modular Neutron Array) and its test has been described. The spectrometers consist of eight BC-501A liquid scintillator detectors of BICRON which allow one to distinguish between the pulses from gamma quanta and neutrons using pulse shape discrimination (PSD) method. The electronic equipment for the PSD and the test result using the 252 Cf radioactive source are presented

  8. An ID-based Blind Signature Scheme from Bilinear Pairings

    OpenAIRE

    B.Umaprasada Rao; K.A.Ajmath

    2010-01-01

    Blind signatures, introduced by Chaum, allow a user to obtain a signature on a message without revealing any thing about the message to the signer. Blind signatures play on important role in plenty of applications such as e-voting, e-cash system where anonymity is of great concern. Identity based(ID-based) public key cryptography can be a good alternative for certified based public key setting, especially when efficient key management and moderate security are required. In this paper, we prop...

  9. Vanillin improves scopolamine‑induced memory impairment through restoration of ID1 expression in the mouse hippocampus.

    Science.gov (United States)

    Lee, Jae-Chul; Kim, In Hye; Cho, Jeong Hwi; Lee, Tae-Kyeong; Park, Joon Ha; Ahn, Ji Hyeon; Shin, Bich Na; Yan, Bing Chun; Kim, Jong-Dai; Jeon, Yong Hwan; Lee, Young Joo; Won, Moo-Ho; Kang, Il Jun

    2018-03-01

    4-Hydroxy-3-methoxybenzaldehyde (vanillin), contained in a number of species of plant, has been reported to display beneficial effects against brain injuries. In the present study, the impact of vanillin on scopolamine‑induced alterations in cognition and the expression of DNA binding protein inhibitor ID‑1 (ID1), one of the inhibitors of DNA binding/differentiation proteins that regulate gene transcription, in the mouse hippocampus. Mice were treated with 1 mg/kg scopolamine with or without 40 mg/kg vanillin once daily for 4 weeks. Scopolamine‑induced cognitive impairment was observed from 1 week and was deemed to be severe 4 weeks following the administration of scopolamine. However, treatment with vanillin in scopolamine‑treated mice markedly attenuated cognitive impairment 4 weeks following treatment with scopolamine. ID1‑immunoreactive cells were revealed in the hippocampus of vehicle‑treated mice, and were hardly detected 4 weeks following treatment with scopolamine. However, treatment with vanillin in scopolamine‑treated mice markedly restored ID1‑immunoreactive cells and expression 4 weeks subsequent to treatment. The results of the present study suggested that vanillin may be beneficial for cognitive impairment, by preventing the reduction of ID1 expression which may be associated with cognitive impairment.

  10. Protective effects of ID331 Triticum monococcum gliadin on in vitro models of the intestinal epithelium.

    Science.gov (United States)

    Iacomino, Giuseppe; Di Stasio, Luigia; Fierro, Olga; Picariello, Gianluca; Venezia, Antonella; Gazza, Laura; Ferranti, Pasquale; Mamone, Gianfranco

    2016-12-01

    A growing interest in developing new strategies for preventing coeliac disease has motivated efforts to identify cereals with null or reduced toxicity. In the current study, we investigate the biological effects of ID331 Triticum monococcum gliadin-derived peptides in human Caco-2 intestinal epithelial cells. Triticum aestivum gliadin derived peptides were employed as a positive control. The effects on epithelial permeability, zonulin release, viability, and cytoskeleton reorganization were investigated. Our findings confirmed that ID331 gliadin did not enhance permeability and did not induce zonulin release, cytotoxicity or cytoskeleton reorganization of Caco-2 cell monolayers. We also demonstrated that ID331 ω-gliadin and its derived peptide ω(105-123) exerted a protective action, mitigating the injury of Triticum aestivum gliadin on cell viability and cytoskeleton reorganization. These results may represent a new opportunity for the future development of innovative strategies to reduce gluten toxicity in the diet of patients with gluten intolerance. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Marked induction of the helix-loop-helix protein Id3 promotes the gammadelta T cell fate and renders their functional maturation Notch independent

    DEFF Research Database (Denmark)

    Lauritsen, Jens Peter Holst; Wong, Gladys W; Lee, Sang-Yun

    2009-01-01

    )-inhibitor of DNA binding 3 (Id3) pathway plays a defining role in this process. In particular, Id3 expression served to regulate adoption of the gammadelta fate. Moreover, Id3 was both necessary and sufficient to enable gammadelta-lineage cells to differentiate independently of Notch signaling and become competent...

  12. Robust Fourier Watermarking for ID Images on Smart Card Plastic Supports

    Directory of Open Access Journals (Sweden)

    RIAD, R.

    2016-11-01

    Full Text Available Security checking can be improved by watermarking identity (ID images printed on smart cards plastic supports. The major challenge is resistance to attacks: printing the images on the plastic cards, durability and other attacks then scanning the image from the plastic card. In this work, a robust watermarking technique is presented in this context. It is composed of three main mechanisms. The first is a watermarking algorithm based on the Fourier transform to cope with global geometric distortions. The second comprises a filter that reduces image blurring. The third attenuates color degradations. Experiments on 400 ID images show that the Wiener filter strongly improves the detection rate and outperforms competitive algorithms (blind deconvolution and unsharp filter. Color corrections also enhance the watermarking score. The whole scheme has a high efficiency and a low computational cost. It makes it compatible with the desired industrial constraints, i.e. the watermark is to be invisible, the error rate must be lower than 1%, and the detection of the mark should be fast and simple for the user.

  13. ACE (I/D polymorphism and response to treatment in coronary artery disease: a comprehensive database and meta-analysis involving study quality evaluation

    Directory of Open Access Journals (Sweden)

    Kitsios Georgios

    2009-06-01

    Full Text Available Abstract Background The role of angiotensin-converting enzyme (ACE gene insertion/deletion (I/D polymorphism in modifying the response to treatment modalities in coronary artery disease is controversial. Methods PubMed was searched and a database of 58 studies with detailed information regarding ACE I/D polymorphism and response to treatment in coronary artery disease was created. Eligible studies were synthesized using meta-analysis methods, including cumulative meta-analysis. Heterogeneity and study quality issues were explored. Results Forty studies involved invasive treatments (coronary angioplasty or coronary artery by-pass grafting and 18 used conservative treatment options (including anti-hypertensive drugs, lipid lowering therapy and cardiac rehabilitation procedures. Clinical outcomes were investigated by 11 studies, while 47 studies focused on surrogate endpoints. The most studied outcome was the restenosis following coronary angioplasty (34 studies. Heterogeneity among studies (p ACE I/D polymorphism on the response to treatment for the rest outcomes (coronary events, endothelial dysfunction, left ventricular remodeling, progression/regression of atherosclerosis, individual studies showed significance; however, results were discrepant and inconsistent. Conclusion In view of available evidence, genetic testing of ACE I/D polymorphism prior to clinical decision making is not currently justified. The relation between ACE genetic variation and response to treatment in CAD remains an unresolved issue. The results of long-term and properly designed prospective studies hold the promise for pharmacogenetically tailored therapy in CAD.

  14. MALDI-TOF MS is more accurate than VITEK II ANC card and API Rapid ID 32 A system for the identification of Clostridium species.

    Science.gov (United States)

    Kim, Young Jin; Kim, Si Hyun; Park, Hyun-Jung; Park, Hae-Geun; Park, Dongchul; Song, Sae Am; Lee, Hee Joo; Yong, Dongeun; Choi, Jun Yong; Kook, Joong-Ki; Kim, Hye Ran; Shin, Jeong Hwan

    2016-08-01

    All 50 Clostridium difficile strains were definitely identified by Vitek2 system, Rapid ID 32A system, and MALDI-TOF. For 18 non-difficile Clostridium strains, the identification results were correct in 0, 2, and 17 strains by Vitek2, Rapid ID 32A, and MALDI-TOF, respectively. MALDI-TOF could be used as the primary tool for identification of Clostridium species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. MetaboID: a graphical user interface package for assignment of 1H NMR spectra of bodyfluids and tissues.

    Science.gov (United States)

    MacKinnon, Neil; Somashekar, Bagganahalli S; Tripathi, Pratima; Ge, Wencheng; Rajendiran, Thekkelnaycke M; Chinnaiyan, Arul M; Ramamoorthy, Ayyalusamy

    2013-01-01

    Nuclear magnetic resonance based measurements of small molecule mixtures continues to be confronted with the challenge of spectral assignment. While multi-dimensional experiments are capable of addressing this challenge, the imposed time constraint becomes prohibitive, particularly with the large sample sets commonly encountered in metabolomic studies. Thus, one-dimensional spectral assignment is routinely performed, guided by two-dimensional experiments on a selected sample subset; however, a publicly available graphical interface for aiding in this process is currently unavailable. We have collected spectral information for 360 unique compounds from publicly available databases including chemical shift lists and authentic full resolution spectra, supplemented with spectral information for 25 compounds collected in-house at a proton NMR frequency of 900 MHz. This library serves as the basis for MetaboID, a Matlab-based user interface designed to aid in the one-dimensional spectral assignment process. The tools of MetaboID were built to guide resonance assignment in order of increasing confidence, starting from cursory compound searches based on chemical shift positions to analysis of authentic spike experiments. Together, these tools streamline the often repetitive task of spectral assignment. The overarching goal of the integrated toolbox of MetaboID is to centralize the one dimensional spectral assignment process, from providing access to large chemical shift libraries to providing a straightforward, intuitive means of spectral comparison. Such a toolbox is expected to be attractive to both experienced and new metabolomic researchers as well as general complex mixture analysts. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Shielding of radiation fields generated by 252Cf in a concrete maze. Part 2 -- Simulation

    International Nuclear Information System (INIS)

    Fasso, A.; Ipe, N.E.; Reyna, A.

    1998-03-01

    A streaming experiment performed in a concrete maze of shape and size typical of a radiotherapy room was simulated with the Monte Carlo program FLUKA. The purpose of the calculation was to test the performance of the code in the low energy neutron range, and at the same time to provide additional information which could help in optimizing shielding of medical facilities. Instrument responses were calculated at different maze locations for several experimental configurations and were compared with measurements. In addition, neutron and gamma fluence, ambient dose equivalent and effective dose were calculated at the same positions. Both sources used in the experiment, namely a bare 252 Cf source and one shielded by a tungsten shell 5 cm thick, were considered in the simulation

  17. The magnetic properties of oxide spinel Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} solid solutions

    Energy Technology Data Exchange (ETDEWEB)

    Masrour, R., E-mail: rachidmasrour@hotmail.com [Laboratory of Materials, Processes, Environment and Quality, Cady Ayyed University, National School of Applied Sciences, Sidi bouzid, Safi (Morocco); LMPHE, Faculte des Sciences, Universite Mohamed V, Rabat (Morocco); Hamedoun, M. [Institute for Nanomaterials and Nanotechnologies, MaScIR, Rabat (Morocco); Academie Hassan II des Sciences et Techniques, Rabat (Morocco); Benyoussef, A. [LMPHE, Faculte des Sciences, Universite Mohamed V, Rabat (Morocco); Institute for Nanomaterials and Nanotechnologies, MaScIR, Rabat (Morocco); Academie Hassan II des Sciences et Techniques, Rabat (Morocco)

    2012-04-01

    The exchange interactions (J{sub BB} and J{sub AB} are the intra and the inter-sublattice exchange interactions between neighbouring spins, respectively) are obtained by using the general expressions of canting angle and critical temperature obtained by mean field theory of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4}. The expression of magnetic energy of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} is obtained for different spin configurations and dilution x. The saturation magnetisation of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} is obtained with different values of dilution x. The magnetic phase diagram of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} materials is obtained by high temperature series expansions (HTSEs). The critical exponent associated with the magnetic susceptibility of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} is deduced.

  18. Measuring symptoms of post-traumatic stress disorder in people with intellectual disabilities: the development and psychometric properties of the Impact of Event Scale-Intellectual Disabilities (IES-IDs).

    Science.gov (United States)

    Hall, James C; Jobson, Laura; Langdon, Peter E

    2014-09-01

    The aims of the study were to (1) revise the Impact of Event Scale-Revised for use with people with intellectual disabilities (IDs), creating the Impact of Event Scale-Intellectual Disabilities (IES-IDs), (2) assess the reliability of the IES-IDs, and (3) compare the IES-IDs to an existing measure trauma-related symptomatology, namely the Lancaster and Northgate Trauma Scale (LANTS), along with measures of anxiety and depression. Forty adults with IDs who had experienced at least one traumatic event were recruited and completed the IES-IDs and the LANTS on two occasions, separated by 2 weeks. Participants also completed the Glasgow Depression Scale and the Glasgow Anxiety Scale, along with the Trauma Information Form which was used to collect information about trauma history. Fifteen per cent of the sample had encountered five or more traumatic events. The IES-IDs and the LANTS had good to excellent internal consistency and test-retest reliability. Both measures correlated with self-report measures of depression and anxiety, although the strength of this correlation was greater with the LANTS. There was a significant positive correlation between trauma frequency and the IES-IDs, while trauma frequency did not correlate with the LANTS. Both the IES-IDs and the LANTS appear to have good reliability. There is a lack of well-developed questionnaires that can be used to assess symptoms of post-traumatic stress disorder (PTSD) in people with intellectual disabilities. The Impact of Event Scale-Revised was augmented creating the Impact of Event Scale-Intellectual Disabilities (IES-IDs). The IES-IDs was shown to have good psychometric properties. The IES-IDs was compared to the Lancaster and Northgate Trauma Scale (LANTS), but the LANTS did not correlate with trauma frequency. However, this study had a small sample size, and a much larger study is needed to examine the factor structure of both the IES-IDs and the LANTS. Future studies should attempt to recruit people with

  19. ID2 mediates the transforming growth factor-β1-induced Warburg-like effect seen in the peritoneum of women with endometriosis.

    Science.gov (United States)

    Young, Vicky J; Ahmad, Syed F; Brown, Jeremy K; Duncan, W Colin; Horne, Andrew W

    2016-09-01

    Is inhibitor of DNA-binding protein 2 (ID2) a mediator of the transforming growth factor (TGF)-β1-induced Warburg-like effect seen in the peritoneum of women with endometriosis? The TGF-β1-induced changes in the metabolic phenotype of peritoneal mesothelial cells from women with endometriosis are mediated through the ID2 pathway. TGF-β1 induces the metabolic conversion of glucose to lactate via aerobic glycolysis (the 'Warburg effect') in the peritoneum of women with endometriosis, through increased expression of the transcription factor hypoxia inducible factor α (HIF-1α). ID proteins are transcriptional targets of TGF-β1. Expression of ID2 was investigated in luteal phase peritoneal biopsies from women with regular menstrual cycles, with and without endometriosis (n = 8-10 each group) by quantitative RT-PCR (qRT-PCR) and immunohistochemistry. ID2 mRNA expression in primary human peritoneal mesothelial cells (HPMC) and immortalized mesothelial cells (MeT-5A) was assessed by qRT-PCR (n = 6). The effects of TGF-β1 and ID2 siRNA on HIF-1α mRNA expression and lactate secretion was assessed using qRT-PCR and a colorimetric lactate assay. ID2 is localized to peritoneal mesothelial and stromal cells of women with and without endometriosis. ID2 mRNA expression is lower in peritoneum adjacent to the endometriosis lesions compared to distal sites (P endometriosis. None. This work was funded by a Wellbeing of Women research grant (R42533) awarded to A.W.H., J.K.B. and W.C.D.; and an MRC Centre Grant G1002033. V.J.Y. received grant support from Federation of Women Graduates (134225) and a PhD studentship from the College of Medicine and Veterinary Medicine at the University of Edinburgh. There are no competing interests to declare. © The Author 2016. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. 252Cf-source-driven neutron noise analysis method

    International Nuclear Information System (INIS)

    Mihalczo, J.T.; King, W.T.; Blakeman, E.D.

    1985-01-01

    The 252 Cf-source-driven neutron noise analysis method has been tested in a a wide variety of experiments that have indicated the broad range of applicability of the method. The neutron multiplication factor, k/sub eff/ has been satisfactorily determined for a variety of materials including uranium metal, light water reactor fuel pins, fissile solutions, fuel plates in water, and interacting cylinders. For a uranyl nitrate solution tank which is typical of a fuel processing or reprocessing plant, the k/sub eff/ values were satisfactorily determined for values between 0.92 and 0.5 using a simple point kinetics interpretation of the experimental data. The short measurement times, in several cases as low as 1 min, have shown that the development of this method can lead to a practical subcriticality monitor for many in-plant applications. The further development of the method will require experiments and the development of theoretical methods to predict the experimental observables

Some links on this page may take you to non-federal websites. Their policies may differ from this site.