
Sample records for a2-desulfoferrodoxin operon enzymes


    NARCIS (Netherlands)



    During autotrophic growth of Xanthobacter flavus, energy derived from the oxidation of hydrogen methanol or formate is used to drive the assimilation of CO2 via the Calvin cycle. The genes encoding the Calvin cycle enzymes are organized in the cbb operon, which is expressed only during autotrophic

  2. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases. (United States)

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh


    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  3. Expression, purification and functional characterization of AmiA of acetamidase operon of Mycobacterium smegmatis. (United States)

    Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha


    Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.

  4. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Directory of Open Access Journals (Sweden)

    Juliana Teixeira de Magalhães


    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  5. The cell wall and cell division gene cluster in the Mra operon of Pseudomonas aeruginosa: cloning, production, and purification of active enzymes. (United States)

    Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M


    We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.

  6. Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

    Directory of Open Access Journals (Sweden)

    Qinna Cui

    Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

  7. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.


    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  8. Structural characterization of the Salmonella typhimurium LT2 umu operon

    International Nuclear Information System (INIS)

    Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.


    The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

  9. Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01. (United States)

    Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia


    To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

  10. The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

    International Nuclear Information System (INIS)

    Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.


    Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

  11. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.


    Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

  12. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120 (United States)

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter


    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

  13. The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae. (United States)

    Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio


    Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

  14. Sequence analysis and identification of the pyrKDbF operon from Lactococcus lactis including a novel gene, pyrK, involved in pyrimidine biosynthesis

    DEFF Research Database (Denmark)

    Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin


    Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...


    NARCIS (Netherlands)


    Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

  16. A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon. (United States)

    Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann


    The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

  17. Stochastic simulations of the tetracycline operon (United States)


    Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

  18. Stochastic simulations of the tetracycline operon

    Directory of Open Access Journals (Sweden)

    Kaznessis Yiannis N


    Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

  19. Detecting uber-operons in prokaryotic genomes. (United States)

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying


    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database:, the first of its kind.

  20. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Directory of Open Access Journals (Sweden)

    Lindblad Peter


    Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

  1. A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

    Directory of Open Access Journals (Sweden)

    Enrico eMuhr


    Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

  2. Evidence against the selfish operon theory. (United States)

    Pál, Csaba; Hurst, Laurence D


    According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

  3. REMap: Operon Map of M. tuberculosis (United States)

    Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu


    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

  4. ProOpDB: Prokaryotic Operon DataBase. (United States)

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique


    The Prokaryotic Operon DataBase (ProOpDB, constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  5. Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon. (United States)

    Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio


    The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

  6. The relative value of operon predictions

    NARCIS (Netherlands)

    Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

    For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

  7. Cyanobacterial flv4-2 Operon-Encoded Proteins Optimize Light Harvesting and Charge Separation in Photosystem II. (United States)

    Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert


    Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  8. Transcriptome dynamics-based operon prediction in prokaryotes. (United States)

    Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario


    Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

  9. Problem-Solving Test: Tryptophan Operon Mutants (United States)

    Szeberenyi, Jozsef


    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  10. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Directory of Open Access Journals (Sweden)

    Gogarten J Peter


    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  11. Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides. (United States)

    Narang, Atul; Oehler, Stefan


    The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

  12. Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli. (United States)

    de Oliveira, Rafael R; Nicholson, Wayne L


    To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

  13. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands. (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin


    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  14. Solving a discrete model of the lac operon using Z3 (United States)

    Gutierrez, Natalia A.


    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  15. The conserved nhaAR operon is drastically divergent between B2 and non-B2 Escherichia coli and is involved in extra-intestinal virulence. (United States)

    Lescat, Mathilde; Reibel, Florence; Pintard, Coralie; Dion, Sara; Glodt, Jérémy; Gateau, Cecile; Launay, Adrien; Ledda, Alice; Cruveiller, Stephane; Cruvellier, Stephane; Tourret, Jérôme; Tenaillon, Olivier


    The Escherichia coli species is divided in phylogenetic groups that differ in their virulence and commensal distribution. Strains belonging to the B2 group are involved in extra-intestinal pathologies but also appear to be more prevalent as commensals among human occidental populations. To investigate the genetic specificities of B2 sub-group, we used 128 sequenced genomes and identified genes of the core genome that showed marked difference between B2 and non-B2 genomes. We focused on the gene and its surrounding region with the strongest divergence between B2 and non-B2, the antiporter gene nhaA. This gene is part of the nhaAR operon, which is in the core genome but flanked by mobile regions, and is involved in growth at high pH and high sodium concentrations. Consistently, we found that a panel of non-B2 strains grew faster than B2 at high pH and high sodium concentrations. However, we could not identify differences in expression of the nhaAR operon using fluorescence reporter plasmids. Furthermore, the operon deletion had no differential impact between B2 and non-B2 strains, and did not result in a fitness modification in a murine model of gut colonization. Nevertheless, sequence analysis and experiments in a murine model of septicemia revealed that recombination in nhaA among B2 strains was observed in strains with low virulence. Finally, nhaA and nhaAR operon deletions drastically decreased virulence in one B2 strain. This effect of nhaAR deletion appeared to be stronger than deletion of all pathogenicity islands. Thus, a population genetic approach allowed us to identify an operon in the core genome without strong effect in commensalism but with an important role in extra-intestinal virulence, a landmark of the B2 strains.

  16. Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector. (United States)

    Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong


    During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

  17. The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

    NARCIS (Netherlands)

    Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.


    The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

  18. Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1. (United States)

    da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A


    One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

  19. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S


    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

  20. CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Marasco Rosangela


    Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

  1. Induction of the Nitrate Assimilation nirA Operon and Protein-Protein Interactions in the Maturation of Nitrate and Nitrite Reductases in the Cyanobacterium Anabaena sp. Strain PCC 7120. (United States)

    Frías, José E; Flores, Enrique


    Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria

  2. Overexpression of Enterococcus faecalis elr operon protects from phagocytosis. (United States)

    Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale


    Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

  3. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy


    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  4. Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    April M Sapp

    Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and

  5. Metazoan operons accelerate recovery from growth arrested states (United States)

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.


    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  6. Deletion of the budBAC operon in Klebsiella pneumoniae to understand the physiological role of 2,3-butanediol biosynthesis. (United States)

    Jeong, Daun; Yang, Jeongmo; Lee, Soojin; Kim, Borim; Um, Youngsoon; Kim, Youngrok; Ha, Kyoung-Su; Lee, Jinwon


    Klebsiella pneumoniae is known to produce 2,3-butanediol (2,3-BDO), a valuable chemical. In K. pneumoniae, the 2,3-BDO operon (budBAC) is involved in the production of 2,3-BDO. To observe the physiological role of the 2,3-BDO operon in a mixed acid fermentation, we constructed a budBAC-deleted strain (SGSB109). The production of extracellular metabolites, CO2 emission, carbon distribution, and NADH/NAD(+) balance of SGSB109 were compared with the parent strain (SGSB100). When comparing the carbon distribution at 15 hr, four significant differences were observed: in 2,3-BDO biosynthesis, lactate and acetate production (lactate and acetate production increased 2.3-fold and 4.1-fold in SGSB109 compared to SGSB100), CO2 emission (higher in SGSB100), and carbon substrate uptake (higher in SGSB100). Previous studies on the inactivation of the 2,3-BDO operon were focused on the increase of 1,3-propanediol production. Few studies have been done observing the role of 2,3-BDO biosynthesis. This study provides a prime insight into the role of 2,3-BDO biosynthesis of K. pneumoniae.

  7. The pyrimidine operon pyrRPB-carA from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Schallert, J.; Andersen, Birgit


    The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

  8. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing. (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L


    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  9. Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Jensen, Peter Ruhdal


    control on glycolysis and growth rate but high negative control on formate production. We find that PFK and PK have zero control on glycolysis and growth rate at the wildtype enzyme level but both enzymes exert strong positive control on the glycolytic flux at reduced activities. PK has high positive...... coefficient increased towards 3. Increased las expression resulted in a slight decrease in the glycolytic flux. At the wildtype level the control was close to zero on both glycolysis and the pyruvate branches. The sum of control coefficients for the three enzymes individually was comparable to the control...... coefficient found for the entire operon; the strong positive control by PK almost cancels out the negative control by LDH on formate production. The analysis suggests that co-regulation of PFK and PK provides a very efficient way to regulate glycolysis, and co-regulating PK and LDH allows the cells...

  10. Dissecting the Photoprotective Mechanism Encoded by the flv4-2 Operon: a Distinct Contribution of Sll0218 in Photosystem II Stabilization. (United States)

    Bersanini, Luca; Allahverdiyeva, Yagut; Battchikova, Natalia; Heinz, Steffen; Lespinasse, Maija; Ruohisto, Essi; Mustila, Henna; Nickelsen, Jörg; Vass, Imre; Aro, Eva-Mari


    In Synechocystis sp. PCC 6803, the flv4-2 operon encodes the flavodiiron proteins Flv2 and Flv4 together with a small protein, Sll0218, providing photoprotection for Photosystem II (PSII). Here, the distinct roles of Flv2/Flv4 and Sll0218 were addressed, using a number of flv4-2 operon mutants. In the ∆sll0218 mutant, the presence of Flv2/Flv4 rescued PSII functionality as compared with ∆sll0218-flv2, where neither Sll0218 nor the Flv2/Flv4 heterodimer are expressed. Nevertheless, both the ∆sll0218 and ∆sll0218-flv2 mutants demonstrated deficiency in accumulation of PSII proteins suggesting a role for Sll0218 in PSII stabilization, which was further supported by photoinhibition experiments. Moreover, the accumulation of PSII assembly intermediates occurred in Sll0218-lacking mutants. The YFP-tagged Sll0218 protein localized in a few spots per cell at the external side of the thylakoid membrane, and biochemical membrane fractionation revealed clear enrichment of Sll0218 in the PratA-defined membranes, where the early biogenesis steps of PSII occur. Further, the characteristic antenna uncoupling feature of the ∆flv4-2 operon mutants is shown to be related to PSII destabilization in the absence of Sll0218. It is concluded that the Flv2/Flv4 heterodimer supports PSII functionality, while the Sll0218 protein assists PSII assembly and stabilization, including optimization of light harvesting. © 2016 The Authors. Plant, Cell & Enviroment Published by John Wiley & Sons Ltd.

  11. Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis. (United States)

    Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef


    Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

  12. UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

    International Nuclear Information System (INIS)

    Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.


    UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

  13. An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling. (United States)

    Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M


    The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

  14. Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents. (United States)

    Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon


    Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

  15. An insight into the regulation of mce4 operon of Mycobacterium tuberculosis. (United States)

    Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula


    The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  17. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon (United States)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.


    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  18. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  19. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Directory of Open Access Journals (Sweden)

    Dharmesh Harwani


    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  20. Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm. (United States)

    Harwani, Dharmesh


    Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

  1. Teaching the Big Ideas of Biology with Operon Models (United States)

    Cooper, Robert A.


    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  2. Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants. (United States)

    Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan


    Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

  3. The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli. (United States)

    Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A


    HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

  4. Sequence and features of the tryptophan operon of Vibrio parahemolyticus. (United States)

    Crawford, I P; Han, C Y; Silverman, M


    The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

  5. Functional analysis of the pediocin operon of Pediococcus acidilactici PAC1.0 : PedB is the immunity protein and PedD is the precursor processing enzyme

    NARCIS (Netherlands)

    Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.

    The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises

  6. Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa. (United States)

    Chowdhury, Nilkanta; Bagchi, Angshuman


    Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

  7. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes. (United States)

    Lawrence, J


    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  8. Definition of a second Bacillus subtilis pur regulon comprising the pur and xpt-pbuX operons plus pbuG, nupG (yxjA), and pbuE (ydhL)

    DEFF Research Database (Denmark)

    Johansen, L.E.; Nygaard, P.; Lassen, C.


    In Bacillus subtilis expression of genes or operons encoding enzymes and other proteins involved in purine synthesis is affected by purine bases and nucleosides in the growth medium. The genes belonging to the PurR regulon (purR, purA, glyA, guaC, pbuO, pbuG, and the pur, yqhZ-folD, and xpt...

  9. Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

    NARCIS (Netherlands)

    Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena


    Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

  10. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.


    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  11. Assembly and multiple gene expression of thermophilic enzymes in Escherichia coli for in vitro metabolic engineering. (United States)

    Ninh, Pham Huynh; Honda, Kohsuke; Sakai, Takaaki; Okano, Kenji; Ohtake, Hisao


    In vitro reconstitution of an artificial metabolic pathway is an emerging approach for the biocatalytic production of industrial chemicals. However, several enzymes have to be separately prepared (and purified) for the construction of an in vitro metabolic pathway, thereby limiting the practical applicability of this approach. In this study, genes encoding the nine thermophilic enzymes involved in a non-ATP-forming chimeric glycolytic pathway were assembled in an artificial operon and co-expressed in a single recombinant Escherichia coli strain. Gene expression levels of the thermophilic enzymes were controlled by their sequential order in the artificial operon. The specific activities of the recombinant enzymes in the cell-free extract of the multiple-gene-expression E. coli were 5.0-1,370 times higher than those in an enzyme cocktail prepared from a mixture of single-gene-expression strains, in each of which a single one of the nine thermophilic enzymes was overproduced. Heat treatment of a crude extract of the multiple-gene-expression cells led to the denaturation of indigenous proteins and one-step preparation of an in vitro synthetic pathway comprising only a limited number of thermotolerant enzymes. Coupling this in vitro pathway with other thermophilic enzymes including the H2 O-forming NADH oxidase or the malate/lactate dehydrogenase facilitated one-pot conversion of glucose to pyruvate or lactate, respectively. © 2014 Wiley Periodicals, Inc.

  12. A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis. (United States)

    Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo


    The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

  13. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.


    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  14. REMap: Operon map of M. tuberculosis based on RNA sequence data. (United States)

    Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu


    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization (United States)

    Ray, J. Christian J; Igoshin, Oleg A.


    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

  16. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)


    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  17. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon (United States)

    Goh, Yong Jun; Klaenhammer, Todd R


    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  18. Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change† (United States)

    Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.


    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  19. Ancient origin of the tryptophan operon and the dynamics of evolutionary change. (United States)

    Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A


    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  20. Evolution and Biophysics of the Escherichia coli lac Operon (United States)

    Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor


    To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

  1. The antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 prevents premature expression of the flv4-2 operon upon shift in inorganic carbon supply. (United States)

    Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R; Aro, Eva-Mari


    The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (C(i)), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the Q(B) site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by C(i) limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in C(i) conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon.

  2. The Antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 Prevents Premature Expression of the flv4-2 Operon upon Shift in Inorganic Carbon Supply* (United States)

    Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari


    The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963

  3. Rapid customised operon assembly by yeast recombinational cloning. (United States)

    Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R


    We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

  4. Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis. (United States)

    García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L


    Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  5. The pvc operon regulates the expression of the Pseudomonas aeruginosa fimbrial chaperone/usher pathway (cup genes.

    Directory of Open Access Journals (Sweden)

    Uzma Qaisar

    Full Text Available The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators.

  6. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization (United States)

    Igoshin, Oleg


    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  7. Expression of the N2 fixation gene operon of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21. (United States)

    Zhang, Lihong; Liu, Xiaomeng; Li, Xinxin; Chen, Sanfeng


    To investigate the transcription and translation and nitrogenase activity of the nine N2-fixing-gene (nif) operon (nifBHDKENXhesAnifX) of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21 under different conditions. The Paenibacillus nif operon under the control of the T7 promoter is significantly transcribed and effectively translated in E. coli BL21 when grown in medium containing organic N compounds (yeast extract and Tryptone) or NH4+ by using RT-PCR and Western blot analysis. Transcription and translation of foreign nif genes in E. coli are not inhibited by environmental organic or inorganic N compounds or O2. However, contrary to transcription and translation, nitrogenase activity is 4% lower in the recombinant E. coli 78-32 compared to the native Paenibacillus sp. WLY78. The Paenibacillus nif operon under the control of T7 promoter enables E. coli BL21 to synthesize active nitrogenase. This study shows how the nif gene operon can be transferred to non-N2-fixing bacteria or to eukaryotic organelles.

  8. Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans. (United States)

    Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti


    The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

  9. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae. (United States)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P


    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  10. Expression of a humanized viral 2A-mediated lux operon efficiently generates autonomous bioluminescence in human cells.

    Directory of Open Access Journals (Sweden)

    Tingting Xu

    Full Text Available Expression of autonomous bioluminescence from human cells was previously reported to be impossible, suggesting that all bioluminescent-based mammalian reporter systems must therefore require application of a potentially influential chemical substrate. While this was disproven when the bacterial luciferase (lux cassette was demonstrated to function in a human cell, its expression required multiple genetic constructs, was functional in only a single cell type, and generated a significantly reduced signal compared to substrate-requiring systems. Here we investigate the use of a humanized, viral 2A-linked lux genetic architecture for the efficient introduction of an autobioluminescent phenotype across a variety of human cell lines.The lux cassette was codon optimized and assembled into a synthetic human expression operon using viral 2A elements as linker regions. Human kidney, breast cancer, and colorectal cancer cell lines were both transiently and stably transfected with the humanized operon and the resulting autobioluminescent phenotype was evaluated using common imaging instrumentation. Autobioluminescent cells were screened for cytotoxic effects resulting from lux expression and their utility as bioreporters was evaluated through the demonstration of repeated monitoring of single populations over a prolonged period using both a modified E-SCREEN assay for estrogen detection and a classical cytotoxic compound detection assay for the antibiotic Zeocin. Furthermore, the use of self-directed bioluminescent initiation in response to target detection was assessed to determine its amenability towards deployment as fully autonomous sensors. In all cases, bioluminescent measurements were supported with traditional genetic and transcriptomic evaluations.Our results demonstrate that the viral 2A-linked, humanized lux genetic architecture successfully produced autobioluminescent phenotypes in all cell lines tested without the induction of cytotoxicity

  11. vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

    DEFF Research Database (Denmark)

    Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria


    We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

  12. CONDOP: an R package for CONdition-Dependent Operon Predictions. (United States)

    Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario


    The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  13. The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus. (United States)

    Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan


    Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

  14. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus (United States)

    Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.


    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

  15. Induction of the gap-pgk operon encoding glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase of Xanthobacter flavus requires the LysR-type transcriptional activator CbbR

    NARCIS (Netherlands)

    Meijer, W.G; van den Bergh, E.R E; Smith, L.M

    In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence

  16. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal


    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  17. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten


    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  18. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes. (United States)

    Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L


    Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  19. The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory (United States)

    Stefanski, Katherine M.

    A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

  20. Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production (United States)


    Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

  1. A combination of luxR1 and luxR2 genes activates Pr-promoters of psychrophilic Aliivibrio logei lux-operon independently of chaperonin GroEL/ES and protease Lon at high concentrations of autoinducer. (United States)

    Konopleva, Maria N; Khrulnova, Svetlana A; Baranova, Ancha; Ekimov, Leonid V; Bazhenov, Sergey V; Goryanin, Ignatiy I; Manukhov, Ilya V


    Lux-operon of psychrophilic bacteria Aliivibrio logei contains two copies of luxR and is regulated by Type I quorum sensing (QS). Activation of lux-operon of psychrophilic bacteria A. logei by LuxR1 requires about 100 times higher concentrations of autoinducer (AI) than the activation by LuxR2. On the other hand, LuxR1 does not require GroEL/ES chaperonin for its folding and cannot be degraded by protease Lon, while LuxR2 sensitive to Lon and requires GroEL/ES. Here we show that at 10(-5) - 10(-4)М concentrations of AI a combination of luxR1 and luxR2 products is capable of activating the Pr-promoters of A. logei lux-operon in Escherichia coli independently of GroEL/ES and protease Lon. The presence of LuxR1 assists LuxR2 in gro(-) cells when AI was added at high concentration, while at low concentration of AI in a cell LuxR1 decreases the LuxR2 activity. These observations may be explained by the formation of LuxR1/LuxR2 heterodimers that act in complex with AI independently from GroEL/ES and protease Lon. This study expands current understanding of QS regulation in A. logei as it implies cooperative regulation of lux-operon by LuxR1 and LuxR2 proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. The Dimerization Domain in DapE Enzymes Is required for Catalysis


    Nocek, Boguslaw; Starus, Anna; Makowska-Grzyska, Magdalena; Gutierrez, Blanca; Sanchez, Stephen; Jedrzejczak, Robert; Mack, Jamey C.; Olsen, Kenneth W.; Joachimiak, Andrzej; Holz, Richard C.


    The emergence of antibiotic-resistant bacterial strains underscores the importance of identifying new drug targets and developing new antimicrobial compounds. Lysine and meso-diaminopimelic acid are essential for protein production and bacterial peptidoglycan cell wall remodeling and are synthesized in bacteria by enzymes encoded within dap operon. Therefore dap enzymes may serve as excellent targets for developing a new class of antimicrobial agents. The dapE-encoded N-succinyl-L,L-diaminopi...

  3. Structure of Escherichia coli RutC, a member of the YjgF family and putative aminoacrylate peracid reductase of the rut operon

    International Nuclear Information System (INIS)

    Knapik, Aleksandra Alicja; Petkowski, Janusz Jurand; Otwinowski, Zbyszek; Cymborowski, Marcin Tadeusz; Cooper, David Robert; Chruszcz, Maksymilian; Krajewska, Wanda Małgorzata; Minor, Wladek


    The structure of the putative aminoacrylate peracid reductase RutC of the rut operon, a member of the YjgF family, is reported. RutC is the third enzyme in the Escherichia coli rut pathway of uracil degradation. RutC belongs to the highly conserved YjgF family of proteins. The structure of the RutC protein was determined and refined to 1.95 Å resolution. The crystal belonged to space group P2 1 2 1 2 and contained six molecules in the asymmetric unit. The structure was solved by SAD phasing and was refined to an R work of 19.3% (R free = 21.7%). The final model revealed that this protein has a Bacillus chorismate mutase-like fold and forms a homotrimer with a hydrophobic cavity in the center of the structure and ligand-binding clefts between two subunits. A likely function for RutC is the reduction of peroxy-aminoacrylate to aminoacrylate as a part of a detoxification process

  4. Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

    International Nuclear Information System (INIS)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.


    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

  5. Expression of Each Cistron in the gal Operon Can Be Regulated by Transcription Termination and Generation of a galK-Specific mRNA, mK2 (United States)

    Wang, Xun; Ji, Sang Chun; Yun, Sang Hoon; Jeon, Heung Jin; Kim, Si Wouk


    The gal operon of Escherichia coli has 4 cistrons, galE, galT, galK, and galM. In our previous report (H. J. Lee, H. J. Jeon, S. C. Ji, S. H. Yun, H. M. Lim, J. Mol. Biol. 378:318–327, 2008), we identified 6 different mRNA species, mE1, mE2, mT1, mK1, mK2, and mM1, in the gal operon and mapped these mRNAs. The mRNA map suggests a gradient of gene expression known as natural polarity. In this study, we investigated how the mRNAs are generated to understand the cause of natural polarity. Results indicated that mE1, mT1, mK1, and mM1, whose 3′ ends are located at the end of each cistron, are generated by transcription termination. Since each transcription termination is operating with a certain frequency and those 4 mRNAs have 5′ ends at the transcription initiation site(s), these transcription terminations are the basic cause of natural polarity. Transcription terminations at galE-galT and galT-galK junctions, making mE1 and mT1, are Rho dependent. However, the terminations to make mK1 and mM1 are partially Rho dependent. The 5′ ends of mK2 are generated by an endonucleolytic cleavage of a pre-mK2 by RNase P, and the 3′ ends are generated by Rho termination 260 nucleotides before the end of the operon. The 5′ portion of pre-mK2 is likely to become mE2. These results also suggested that galK expression could be regulated through mK2 production independent from natural polarity. PMID:24794565

  6. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon


    Goh, Yong Jun; Klaenhammer, Todd R


    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  7. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.


    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  8. Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli. (United States)

    Kim, Moonjeong; Kim, Kwang-Sun


    The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail:

  9. A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars. (United States)

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor


    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Operon Gene Order Is Optimized for Ordered Protein Complex Assembly (United States)

    Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.


    Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

  11. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P


    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  12. The post-transcriptional operon

    DEFF Research Database (Denmark)

    Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik


    model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

  13. The CodY-dependent clhAB2 operon is involved in cell shape, chaining and autolysis in Bacillus cereus ATCC 14579. (United States)

    Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier


    The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.

  14. Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.


    Stewart, V; Yanofsky, C


    We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

  15. Cop-like operon: Structure and organization in species of the Lactobacillale order

    Directory of Open Access Journals (Sweden)



    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  16. Elucidation of Operon Structures across Closely Related Bacterial Genomes (United States)

    Li, Guojun


    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  17. An Automated Pipeline for Engineering Many-Enzyme Pathways: Computational Sequence Design, Pathway Expression-Flux Mapping, and Scalable Pathway Optimization. (United States)

    Halper, Sean M; Cetnar, Daniel P; Salis, Howard M


    Engineering many-enzyme metabolic pathways suffers from the design curse of dimensionality. There are an astronomical number of synonymous DNA sequence choices, though relatively few will express an evolutionary robust, maximally productive pathway without metabolic bottlenecks. To solve this challenge, we have developed an integrated, automated computational-experimental pipeline that identifies a pathway's optimal DNA sequence without high-throughput screening or many cycles of design-build-test. The first step applies our Operon Calculator algorithm to design a host-specific evolutionary robust bacterial operon sequence with maximally tunable enzyme expression levels. The second step applies our RBS Library Calculator algorithm to systematically vary enzyme expression levels with the smallest-sized library. After characterizing a small number of constructed pathway variants, measurements are supplied to our Pathway Map Calculator algorithm, which then parameterizes a kinetic metabolic model that ultimately predicts the pathway's optimal enzyme expression levels and DNA sequences. Altogether, our algorithms provide the ability to efficiently map the pathway's sequence-expression-activity space and predict DNA sequences with desired metabolic fluxes. Here, we provide a step-by-step guide to applying the Pathway Optimization Pipeline on a desired multi-enzyme pathway in a bacterial host.

  18. Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads (United States)

    Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.


    Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

  19. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna


    When a liquid culture of Serratia spp. reaches the last part of the logarithmic phase of growth it induces the synthesis of several extracellular hydrolytic enzymes. In this communication we show that synthesis and secretion of the extracellular phospholipase is coupled to expression of flagella....... Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...

  20. HosA, a MarR Family Transcriptional Regulator, Represses Nonoxidative Hydroxyarylic Acid Decarboxylase Operon and Is Modulated by 4-Hydroxybenzoic Acid. (United States)

    Roy, Ajit; Ranjan, Akash


    Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.

  1. Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS. (United States)

    Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh


    Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

  2. The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202. (United States)

    Boyd, D A; Mulvey, M R


    To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

  3. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome. (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki


    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  4. An operon encoding three glycolytic enzymes in Lactobacillus delbrueckii subsp. bulgaricus: glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase and triosephosphate isomerase. (United States)

    Branny, P; de la Torre, F; Garel, J R


    The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.

  5. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma


    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  6. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail:, E-mail: [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)


    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  7. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

  8. Dynamics and bistability in a reduced model of the lac operon (United States)

    Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.


    It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

  9. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe


    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

  10. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis. (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong


    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

  11. Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Atlung, Tove


    The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

  12. RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon. (United States)

    Pérez-Oseguera, Angeles; Cevallos, Miguel A


    Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa. (United States)

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia


    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  14. Regulation of the rhaEWRBMA Operon Involved in l-Rhamnose Catabolism through Two Transcriptional Factors, RhaR and CcpA, in Bacillus subtilis. (United States)

    Hirooka, Kazutake; Kodoi, Yusuke; Satomura, Takenori; Fujita, Yasutaro


    The Bacillus subtilis rhaEWRBMA (formerly yuxG-yulBCDE) operon consists of four genes encoding enzymes for l-rhamnose catabolism and the rhaR gene encoding a DeoR-type transcriptional regulator. DNase I footprinting analysis showed that the RhaR protein specifically binds to the regulatory region upstream of the rhaEW gene, in which two imperfect direct repeats are included. Gel retardation analysis revealed that the direct repeat farther upstream is essential for the high-affinity binding of RhaR and that the DNA binding of RhaR was effectively inhibited by L-rhamnulose-1-phosphate, an intermediate of L-rhamnose catabolism. Moreover, it was demonstrated that the CcpA/P-Ser-HPr complex, primarily governing the carbon catabolite control in B. subtilis, binds to the catabolite-responsive element, which overlaps the RhaR binding site. In vivo analysis of the rhaEW promoter-lacZ fusion in the background of ccpA deletion showed that the L-rhamnose-responsive induction of the rhaEW promoter was negated by the disruption of rhaA or rhaB but not rhaEW or rhaM, whereas rhaR disruption resulted in constitutive rhaEW promoter activity. These in vitro and in vivo results clearly indicate that RhaR represses the operon by binding to the operator site, which is detached by L-rhamnulose-1-phosphate formed from L-rhamnose through a sequence of isomerization by RhaA and phosphorylation by RhaB, leading to the derepression of the operon. In addition, the lacZ reporter analysis using the strains with or without the ccpA deletion under the background of rhaR disruption supported the involvement of CcpA in the carbon catabolite repression of the operon. Since L-rhamnose is a component of various plant-derived compounds, it is a potential carbon source for plant-associating bacteria. Moreover, it is suggested that L-rhamnose catabolism plays a significant role in some bacteria-plant interactions, e.g., invasion of plant pathogens and nodulation of rhizobia. Despite the physiological

  15. Gene content and organization of a 281-kbp contig from the genome of the extremely thermophilic archaeon, Sulfolobus solfataricus P2

    NARCIS (Netherlands)

    Charlebois, R.; Confalonieri, F.; Curtis, B.; Doolittle, W.F.; Duguet, M.; Erauso, G.; Faguy, D.; Gaasterland, T.; Garrett, R.A.; Gordon, P.; Kozera, C.; Medina, N.; Oost, van der J.; Peng, X.; Ragan, M.; She, Q.; Singh, R.K.


    The sequence of a 281-kbp contig from the crenarchaeote Sulfolobus solfataricus P2 was determined and analysed. Notable features in this region include 29 ribosomal protein genes, 12 tRNA genes (four of which contain archaeal-type introns), operons encoding enzymes of histidine biosynthesis,

  16. Prevalence of transcription promoters within archaeal operons and coding sequences. (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S


    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  17. Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance. (United States)

    Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan


    One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

  18. Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress. (United States)

    Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula


    The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

  19. clpC operon regulates cell architecture and sporulation in Bacillus anthracis. (United States)

    Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra


    The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli. (United States)

    Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito


    Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  1. Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

    Directory of Open Access Journals (Sweden)

    T Sabari Sankar


    Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

  2. A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport (United States)

    Chopra, Paras; Bender, Andreas

    The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [].

  3. Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

    International Nuclear Information System (INIS)

    Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.


    The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

  4. Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus. (United States)

    Cortes, Teresa; Cox, Robert Ashley


    Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

  5. Structural insights into RipC, a putative citrate lyase β subunit from a Yersinia pestis virulence operon

    International Nuclear Information System (INIS)

    Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.


    Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein

  6. Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis. (United States)

    Ray, Sujay; Banerjee, Arundhati


    Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.

  7. Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

    DEFF Research Database (Denmark)

    Danielsen, S; Kilstrup, M; Barilla, K


    . A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

  8. High levels of bioplastic are produced in fertile transplastomic tobacco plants engineered with a synthetic operon for the production of polyhydroxybutyrate. (United States)

    Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P; Snell, Kristi D


    An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5' end by the host plant's psbA coding sequence and at the 3' end by the host plant's 3' psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated.

  9. Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

    Directory of Open Access Journals (Sweden)

    Jan Ewald


    Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

  10. Modular Ligation Extension of Guide RNA Operons (LEGO) for Multiplexed dCas9 Regulation of Metabolic Pathways in Saccharomyces cerevisiae. (United States)

    Deaner, Matthew; Holzman, Allison; Alper, Hal S


    Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon (United States)

    Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.


    Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575

  12. Treponema pallidum 3-Phosphoglycerate Mutase Is a Heat-Labile Enzyme That May Limit the Maximum Growth Temperature for the Spirochete (United States)

    Benoit, Stéphane; Posey, James E.; Chenoweth, Matthew R.; Gherardini, Frank C.


    In the causative agent of syphilis, Treponema pallidum, the gene encoding 3-phosphoglycerate mutase, gpm, is part of a six-gene operon (tro operon) that is regulated by the Mn-dependent repressor TroR. Since substrate-level phosphorylation via the Embden-Meyerhof pathway is the principal way to generate ATP in T. pallidum and Gpm is a key enzyme in this pathway, Mn could exert a regulatory effect on central metabolism in this bacterium. To study this, T. pallidum gpm was cloned, Gpm was purified from Escherichia coli, and antiserum against the recombinant protein was raised. Immunoblots indicated that Gpm was expressed in freshly extracted infective T. pallidum. Enzyme assays indicated that Gpm did not require Mn2+ while 2,3-diphosphoglycerate (DPG) was required for maximum activity. Consistent with these observations, Mn did not copurify with Gpm. The purified Gpm was stable for more than 4 h at 25°C, retained only 50% activity after incubation for 20 min at 34°C or 10 min at 37°C, and was completely inactive after 10 min at 42°C. The temperature effect was attenuated when 1 mM DPG was added to the assay mixture. The recombinant Gpm from pSLB2 complemented E. coli strain PL225 (gpm) and restored growth on minimal glucose medium in a temperature-dependent manner. Increasing the temperature of cultures of E. coli PL225 harboring pSLB2 from 34 to 42°C resulted in a 7- to 11-h period in which no growth occurred (compared to wild-type E. coli). These data suggest that biochemical properties of Gpm could be one contributing factor to the heat sensitivity of T. pallidum. PMID:11466272

  13. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid. (United States)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P


    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

  14. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG

    Directory of Open Access Journals (Sweden)

    Orlando Díaz-Hernández


    Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  15. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG. (United States)

    Díaz-Hernández, Orlando; Santillán, Moisés


    In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  16. Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Sun Yuan


    Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

  17. Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains. (United States)

    Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W


    Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail:

  18. A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates. (United States)

    Kim, Dae Hun; Ko, Kwan Soo


    To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Daptomycin Tolerance in the Staphylococcus aureus pitA6 Mutant Is Due to Upregulation of the dlt Operon. (United States)

    Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich


    Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  20. Decreases in average bacterial community rRNA operon copy number during succession. (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R


    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  1. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna


    . Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

  2. Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae. (United States)

    Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao


    The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  3. Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

    Czech Academy of Sciences Publication Activity Database

    Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav


    Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

  4. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.


    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  5. Eucaryotic operon genes can define highly conserved syntenies

    Czech Academy of Sciences Publication Activity Database

    Trachtulec, Zdeněk


    Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

  6. Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility. (United States)

    Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M


    Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

  7. The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution. (United States)

    Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús


    Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

  8. The flagellar master operon flhDC is a pleiotropic regulator involved in motility and virulence of the fish pathogen Yersinia ruckeri (United States)

    Aims: To investigate the function of the master flagellar operon flhDC in the fish pathogen Yersinia ruckeri and compare the effect of flhD mutation to a naturally occurring mutation causing loss-of-motility in emergent biotype 2 (BT2) strains. Methods and Results: In this study isogenic Y. ruckeri ...

  9. An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola. (United States)

    Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J


    Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  10. Functional characterization of a cadmium resistance operon in Staphylococcus aureus ATCC12600: CadC does not function as a repressor. (United States)

    Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander


    Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus. (United States)

    Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O


    Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail:

  12. stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells. (United States)

    Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C


    Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

  13. Inter-genomic displacement via lateral gene transfer of bacterial trp operons in an overall context of vertical genealogy

    Directory of Open Access Journals (Sweden)

    Keyhani Nemat O


    Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered

  14. Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem (United States)

    Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria


    The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the

  15. Carotenoid biosynthesis in bacteria: In vitro studies of a crt/bch transcription factor from Rhodobacter capsulatus and carotenoid enzymes from Erwinia herbicola

    Energy Technology Data Exchange (ETDEWEB)

    O' Brien, D.A.


    A putative transcription factor in Rhodobactor capsulatus which binds upstream of the crt and bch pigment biosynthesis operons and appears to play a role in the adaptation of the organism from the aerobic to the anaerobic-photosynthetic growth mode was characterized. Chapter 2 describes the identification of this factor through an in vitro mobility shift assay, as well as the determination of its binding properties and sequence specificity. Chapter 3 focuses on the isolation of this factor. Biochemistry of later carotenoid biosynthesis enzymes derived from the non-photosynthetic bacterium, Erwinia herbicola. Chapter 4 describes the separate overexpression and in vitro analysis of two enzymes involved in the main sequence of the carotenoid biosynthesis pathway, lycopene cyclase and 5-carotene hydroxylase. Chapter 5 examines the overexpression and enzymology of functionally active zeaxanthin glucosyltransferase, an enzyme which carries out a more unusual transformation, converting a carotenoid into its more hydrophilic mono- and diglucoside derivatives. In addition, amino acid homology with other glucosyltransferases suggests a putative binding site for the UDP-activated glucose substrate.

  16. Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.


    Chung, T; Resnik, E; Stueland, C; LaPorte, D C


    Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

  17. Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

    Directory of Open Access Journals (Sweden)

    Potrich D.P.


    Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

  18. Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia. (United States)

    Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R


    Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

  19. Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria


    Riyanti, Eny Ida; Rogers, Peter L


    Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

  20. High Levels of Bioplastic Are Produced in Fertile Transplastomic Tobacco Plants Engineered with a Synthetic Operon for the Production of Polyhydroxybutyrate1[C][OA (United States)

    Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P.; Snell, Kristi D.


    An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5′ end by the host plant’s psbA coding sequence and at the 3′ end by the host plant’s 3′ psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated. PMID:21325565

  1. SOS-like induction in Bacillus subtilis: induction of the RecA protein analog and a damage-inducible operon by DNA damage in Rec+ and DNA repair-deficient strains

    International Nuclear Information System (INIS)

    Lovett, C.M. Jr.; Love, P.E.; Yasbin, R.E.; Roberts, J.W.


    We quantitated the induction of the Bacillus subtilis Rec protein (the analog of Escherichia coli RecA protein) and the B. subtilis din-22 operon (representative of a set of DNA damage-inducible operons in B. subtilis) following DNA damage in Rec+ and DNA repair-deficient strains. After exposure to mitomycin C or UV irradiation, each of four distinct rec (recA1, recB2, recE4, and recM13) mutations reduced to the same extent the rates of both Rec protein induction (determined by densitometric scanning of immunoblot transfers) and din-22 operon induction (determined by assaying beta-galactosidase activity in din-22::Tn917-lacZ fusion strains). The induction deficiencies in recA1 and recE4 strains were partially complemented by the E. coli RecA protein, which was expressed on a plasmid in B. subtilis; the E. coli RecA protein had no effect on either induction event in Rec+, recB2, or recM13 strains. These results suggest that (i) the expression of both the B. subtilis Rec protein and the din-22 operon share a common regulatory component, (ii) the recA1 and recE4 mutations affect the regulation and/or activity of the B. subtilis Rec protein, and (iii) an SOS regulatory system like the E. coli system is highly conserved in B. subtilis. We also showed that the basal level of B. subtilis Rec protein is about 4,500 molecules per cell and that maximum induction by DNA damage causes an approximately fivefold increase in the rate of Rec protein accumulation

  2. A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number (United States)

    Tadmor, Arbel


    In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.

  3. Prediction of DtxR regulon: Identification of binding sites and operons controlled by Diphtheria toxin repressor in Corynebacterium diphtheriae

    Directory of Open Access Journals (Sweden)

    Hasnain Seyed


    Full Text Available Abstract Background The diphtheria toxin repressor, DtxR, of Corynebacterium diphtheriae has been shown to be an iron-activated transcription regulator that controls not only the expression of diphtheria toxin but also of iron uptake genes. This study aims to identify putative binding sites and operons controlled by DtxR to understand the role of DtxR in patho-physiology of Corynebacterium diphtheriae. Result Positional Shannon relative entropy method was used to build the DtxR-binding site recognition profile and the later was used to identify putative regulatory sites of DtxR within C. diphtheriae genome. In addition, DtxR-regulated operons were also identified taking into account the predicted DtxR regulatory sites and genome annotation. Few of the predicted motifs were experimentally validated by electrophoretic mobility shift assay. The analysis identifies motifs upstream to the novel iron-regulated genes that code for Formamidopyrimidine-DNA glycosylase (FpG, an enzyme involved in DNA-repair and starvation inducible DNA-binding protein (Dps which is involved in iron storage and oxidative stress defense. In addition, we have found the DtxR motifs upstream to the genes that code for sortase which catalyzes anchoring of host-interacting proteins to the cell wall of pathogenic bacteria and the proteins of secretory system which could be involved in translocation of various iron-regulated virulence factors including diphtheria toxin. Conclusions We have used an in silico approach to identify the putative binding sites and genes controlled by DtxR in Corynebacterium diphtheriae. Our analysis shows that DtxR could provide a molecular link between Fe+2-induced Fenton's reaction and protection of DNA from oxidative damage. DtxR-regulated Dps prevents lethal combination of Fe+2 and H2O2 and also protects DNA by nonspecific DNA-binding. In addition DtxR could play an important role in host interaction and virulence by regulating the levels of sortase

  4. Enzymes in CO2 Capture

    DEFF Research Database (Denmark)

    Fosbøl, Philip Loldrup; Gladis, Arne; Thomsen, Kaj

    The enzyme Carbonic Anhydrase (CA) can accelerate the absorption rate of CO2 into aqueous solutions by several-fold. It exist in almost all living organisms and catalyses different important processes like CO2 transport, respiration and the acid-base balances. A new technology in the field...... of carbon capture is the application of enzymes for acceleration of typically slow ternary amines or inorganic carbonates. There is a hidden potential to revive currently infeasible amines which have an interesting low energy consumption for regeneration but too slow kinetics for viable CO2 capture. The aim...... of this work is to discuss the measurements of kinetic properties for CA promoted CO2 capture solvent systems. The development of a rate-based model for enzymes will be discussed showing the principles of implementation and the results on using a well-known ternary amine for CO2 capture. Conclusions...

  5. Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli. (United States)

    Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira


    Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  6. Awakening sleeping beauty: production of propionic acid in Escherichia coli through the sbm operon requires the activity of a methylmalonyl-CoA epimerase. (United States)

    Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban


    Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway

  7. Degs and degu operon from Bacillus-brevis: a combination that enhances the production of commercially valuable enzymes

    CSIR Research Space (South Africa)

    Louw, M


    Full Text Available A novel method has been developed for increasing the production of commercially valuable enzymes, such as proteases, beta-glucanases, alpha-amylases and levansucrase. It is dependent on two genes cloned from Bacillus brevis, expressed on a multicopy...

  8. Sequence analysis of the Legionella micdadei groELS operon

    DEFF Research Database (Denmark)

    Hindersson, P; Høiby, N; Bangsborg, Jette Marie


    shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

  9. Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus. (United States)

    Sahukhal, Gyan S; Elasri, Mohamed O


    Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

  10. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)


    [Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

  11. Genes and pathways for CO2 fixation in the obligate, chemolithoautotrophic acidophile, Acidithiobacillus ferrooxidans, Carbon fixation in A. ferrooxidans

    Directory of Open Access Journals (Sweden)

    Esparza Mario


    Full Text Available Abstract Background Acidithiobacillus ferrooxidans is chemolithoautotrophic γ-proteobacterium that thrives at extremely low pH (pH 1-2. Although a substantial amount of information is available regarding CO2 uptake and fixation in a variety of facultative autotrophs, less is known about the processes in obligate autotrophs, especially those living in extremely acidic conditions, prompting the present study. Results Four gene clusters (termed cbb1-4 in the A. ferrooxidans genome are predicted to encode enzymes and structural proteins involved in carbon assimilation via the Calvin-Benson-Bassham (CBB cycle including form I of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO, EC and the CO2-concentrating carboxysomes. RT-PCR experiments demonstrated that each gene cluster is a single transcriptional unit and thus is an operon. Operon cbb1 is divergently transcribed from a gene, cbbR, encoding the LysR-type transcriptional regulator CbbR that has been shown in many organisms to regulate the expression of RubisCO genes. Sigma70-like -10 and -35 promoter boxes and potential CbbR-binding sites (T-N11-A/TNA-N7TNA were predicted in the upstream regions of the four operons. Electrophoretic mobility shift assays (EMSAs confirmed that purified CbbR is able to bind to the upstream regions of the cbb1, cbb2 and cbb3 operons, demonstrating that the predicted CbbR-binding sites are functional in vitro. However, CbbR failed to bind the upstream region of the cbb4 operon that contains cbbP, encoding phosphoribulokinase (EC Thus, other factors not present in the assay may be required for binding or the region lacks a functional CbbR-binding site. The cbb3 operon contains genes predicted to encode anthranilate synthase components I and II, catalyzing the formation of anthranilate and pyruvate from chorismate. This suggests a novel regulatory connection between CO2 fixation and tryptophan biosynthesis. The presence of a form II Rubis

  12. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Hiraku Takada

    Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

  13. Increased dipicolinic acid production with an enhanced spoVF operon in Bacillus subtilis and medium optimization. (United States)

    Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya


    Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.

  14. Molecular evidence for the coordination of nitrogen and carbon metabolisms, revealed by a study on the transcriptional regulation of the agl3EFG operon that encodes a putative carbohydrate transporter in Streptomyces coelicolor. (United States)

    Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin


    In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  16. Salmonella enterica Typhimurium fljBA operon stability: implications regarding the origin of Salmonella enterica I 4,[5],12:i:. (United States)

    Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M


    Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.

  17. Purification and crystallization of Phd, the antitoxin of the phd/doc operon

    International Nuclear Information System (INIS)

    Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy


    The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein

  18. Characterization of the Leptospira interrogans S10-spc-alpha operon

    NARCIS (Netherlands)

    Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.


    A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

  19. Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides. (United States)

    Dixit, R; Trivedi, P K; Nath, P; Sane, P V


    Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

  20. A phospho-sugar binding domain homologous to NagB enzymes regulates the activity of the central glycolytic genes repressor. (United States)

    Doan, Thierry; Martin, Laetitia; Zorrilla, Silvia; Chaix, Denis; Aymerich, Stéphane; Labesse, Gilles; Declerck, Nathalie


    CggR belongs to the SorC family of bacterial transcriptional regulators which control the expression of genes and operons involved in carbohydrate catabolism. CggR was first identified in Bacillus subtilis where it represses the gapA operon encoding the five enzymes that catalyze the central part of glycolysis. Here we present a structure/function study demonstrating that the C-terminal region of CggR regulates the DNA binding activity of this repressor in response to binding of a phosphorylated sugar. Molecular modeling of CggR revealed a winged-helix DNA-binding motif followed by a C-terminal domain presenting weak but significant homology with glucosamine-6-phosphate deaminases from the NagB family. In silico ligand screening suggested that the CggR C-terminal domain would bind preferentially bi-phosphorylated compounds, in agreement with previous studies that proposed fructuose-1,6-biphosphate (FBP) as the inducer metabolite. In vitro, FBP was the only sugar compound capable of interfering with CggR cooperative binding to DNA. FBP was also found to protect CggR against trypsin degradation at two arginine residues predicted to reside in a mobile loop forming the active site lid of the NagB enzymes. Replacement of residues predicted to interact with FBP led to mutant CggR with altered repressor activity in vivo but retaining their structural integrity and DNA binding activity in vitro. Interestingly, some of the mutant repressors responded with different specificity towards mono- and di-phospho-fructosides. Based on these results, we propose that the activity of the CggR-like repressors is controlled by a phospho-sugar binding (PSB) domain presenting structural and functional homology with NagB enzymes. (c) 2008 Wiley-Liss, Inc.

  1. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš


    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  2. OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

    Directory of Open Access Journals (Sweden)

    Arkin Adam P


    Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at

  3. Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli. (United States)

    Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E


    An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

  4. Loop 7 of E2 enzymes

    DEFF Research Database (Denmark)

    Papaleo, Elena; Casiraghi, Nicola; Arrigoni, Alberto


    The ubiquitin (Ub) system controls almost every aspect of eukaryotic cell biology. Protein ubiquitination depends on the sequential action of three classes of enzymes (E1, E2 and E3). E2 Ub-conjugating enzymes have a central role in the ubiquitination pathway, interacting with both E1 and E3...

  5. Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages. (United States)

    Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D


    Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

  6. Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2. (United States)

    Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen

    The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  7. High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

    NARCIS (Netherlands)

    Berendsen, Erwin M; Koning, Rosella A; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P; Wells-Bennik, Marjon H J


    Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA(2mob), present on a Tn1546

  8. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C


    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  9. Transcript analysis of the extended hyp-operon in the cyanobacteria Nostoc sp. strain PCC 7120 and Nostoc punctiforme ATCC 29133 (United States)


    Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to

  10. Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

    Directory of Open Access Journals (Sweden)

    Terezinha Knöbl


    Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

  11. Characterization of Runella slithyformis HD-Pnk, a bifunctional DNA/RNA end-healing enzyme composed of an N-terminal 2',3' -phosphoesterase HD domain and a C-terminal 5' -OH polynucleotide kinase domain. (United States)

    Munir, Annum; Shuman, Stewart


    5' and 3' end healing are key steps in nucleic acid break repair in which 5' -OH ends are phosphorylated by a polynucleotide kinase and 3' -PO 4 or 2',3' -cyclic-PO 4 ends are hydrolyzed by a phosphoesterase to generate the 5' -PO 4 and 3' -OH termini required for sealing by classic polynucleotide ligases. End healing and sealing enzymes are present in diverse bacterial taxa, often organized as modular units within a single multifunctional polypeptide or as subunits of a repair complex. Here we identify and characterize Runella slithyformis HD-Pnk as a novel bifunctional end-healing enzyme composed of an N-terminal 2',3' -phosphoesterase HD domain and a C-terminal 5' -OH polynucleotide kinase P-loop domain. HD-Pnk phosphorylates 5' -OH polynucleotides (9-mers or longer) in the presence of magnesium and any NTP donor. HD-Pnk dephosphorylates RNA 2',3' -cyclic phosphate, RNA 3' -phosphate, RNA 2' -phosphate, and DNA 3' -phosphate ends in the presence of a transition metal cofactor, which can be nickel, copper or cobalt. HD-Pnkp homologs are present in genera from eleven bacterial phyla and are often encoded in an operon with a putative ATP-dependent polynucleotide ligase. The present study provides insights to the diversity of nucleic acid repair strategies via the characterization of Runella slithyformis HD-Pnkp as the exemplar of a novel clade of dual 5' and 3' end-healing enzymes that phosphorylate 5' -OH termini and dephosphorylate 2',3' -cyclic-PO 4 , 3' -PO 4 , and 2' -PO 4 ends. The distinctive feature of HD-Pnk is its domain composition: a fusion of an N-terminal HD phosphohydrolase module to a C-terminal P-loop polynucleotide kinase module. Homologs of Runella HD-Pnk with the same domain composition, domain order, and similar polypeptide size are distributed widely among genera from eleven bacterial phyla. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes. (United States)

    Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko


    Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva. (United States)

    Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato


    Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

  14. Cloning and identification of Group 1 mrp operon encoding a novel monovalent cation/proton antiporter system from the moderate halophile Halomonas zhaodongensis. (United States)

    Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan


    The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.

  15. Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm. (United States)

    Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M


    Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

  16. Nanoarmored Enzymes for Organic Enzymology: Synthesis and Characterization of Poly(2-Alkyloxazoline)-Enzyme Conjugates. (United States)

    Leurs, Melanie; Tiller, Joerg C


    The properties of enzymes can be altered significantly by modification with polymers. Numerous different methods are known to obtain such polymer-enzyme conjugates (PECs). However, there is no universal method to render enzymes into PECs that are fully soluble in organic solvents. Here, we present a method, which achieves such high degree of modification of proteins that the majority of modified enzymes will be soluble in organic solvents. This is achieved by preparing poly(2-alkyloxazoline)s (POx) with an NH 2 end group and coupling this functional polymer via pyromellitic acid dianhydride onto the amino groups of the respective protein. The resulting PECs are capable of serving as surfactants for unmodified proteins, rendering the whole mixture organosoluble. Depending on the nature of the POx and the molecular weight and the nature of the enzyme, the PECs are soluble in chloroform or even toluene. Another advantage of this method is that the poly(2-alkyloxazoline) can be activated with the coupling agent and used for the enzyme conjugation without further purification. The POx-enzyme conjugates generated by this modification strategy show modulated catalytic activity in both, aqueous and organic, systems. © 2017 Elsevier Inc. All rights reserved.

  17. The dimerization domain in DapE enzymes is required for catalysis.

    Directory of Open Access Journals (Sweden)

    Boguslaw Nocek

    Full Text Available The emergence of antibiotic-resistant bacterial strains underscores the importance of identifying new drug targets and developing new antimicrobial compounds. Lysine and meso-diaminopimelic acid are essential for protein production and bacterial peptidoglycan cell wall remodeling and are synthesized in bacteria by enzymes encoded within dap operon. Therefore dap enzymes may serve as excellent targets for developing a new class of antimicrobial agents. The dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE converts N-succinyl-L,L-diaminopimelic acid to L,L-diaminopimelic acid and succinate. The enzyme is composed of catalytic and dimerization domains, and belongs to the M20 peptidase family. To understand the specific role of each domain of the enzyme we engineered dimerization domain deletion mutants of DapEs from Haemophilus influenzae and Vibrio cholerae, and characterized these proteins structurally and biochemically. No activity was observed for all deletion mutants. Structural comparisons of wild-type, inactive monomeric DapE enzymes with other M20 peptidases suggest that the dimerization domain is essential for DapE enzymatic activity. Structural analysis and molecular dynamics simulations indicate that removal of the dimerization domain increased the flexibility of a conserved active site loop that may provide critical interactions with the substrate.

  18. The dimerization domain in DapE enzymes is required for catalysis. (United States)

    Nocek, Boguslaw; Starus, Anna; Makowska-Grzyska, Magdalena; Gutierrez, Blanca; Sanchez, Stephen; Jedrzejczak, Robert; Mack, Jamey C; Olsen, Kenneth W; Joachimiak, Andrzej; Holz, Richard C


    The emergence of antibiotic-resistant bacterial strains underscores the importance of identifying new drug targets and developing new antimicrobial compounds. Lysine and meso-diaminopimelic acid are essential for protein production and bacterial peptidoglycan cell wall remodeling and are synthesized in bacteria by enzymes encoded within dap operon. Therefore dap enzymes may serve as excellent targets for developing a new class of antimicrobial agents. The dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) converts N-succinyl-L,L-diaminopimelic acid to L,L-diaminopimelic acid and succinate. The enzyme is composed of catalytic and dimerization domains, and belongs to the M20 peptidase family. To understand the specific role of each domain of the enzyme we engineered dimerization domain deletion mutants of DapEs from Haemophilus influenzae and Vibrio cholerae, and characterized these proteins structurally and biochemically. No activity was observed for all deletion mutants. Structural comparisons of wild-type, inactive monomeric DapE enzymes with other M20 peptidases suggest that the dimerization domain is essential for DapE enzymatic activity. Structural analysis and molecular dynamics simulations indicate that removal of the dimerization domain increased the flexibility of a conserved active site loop that may provide critical interactions with the substrate.

  19. Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

    Directory of Open Access Journals (Sweden)

    Mariana Noelia Viale


    Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

  20. The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces. (United States)

    Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo


    The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

  1. Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels

    DEFF Research Database (Denmark)

    Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence


    Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...

  2. Multidrug-Resistant CTX-M-(15, 9, 2)- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance). (United States)

    Andrade, Leonardo N; Siqueira, Thiago E S; Martinez, Roberto; Darini, Ana Lucia C


    Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes ( sil operon: silE, silS, silR, silC, silF, silB, silA , and silP ) and acquired extended-spectrum cephalosporin and carbapenem resistance genes ( bla CTX-M and bla KPC ) in Enterobacter cloacae Complex (EcC) ( n = 27) and Enterobacter aerogenes ( n = 8) isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump) and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump), arsB (arsenite-efflux pump), terF (tellurite resistance protein), and merA (mercuric reductase) were also investigated. Outstandingly, 21/27 (78%) EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA -positive EcC isolates. Interestingly, 8/20 (40%) E. hormaechei and 5/6 (83%) E. asburiae co-harbored silA/pcoD genes and bla CTX-M-(15,2,or9) and/or bla KPC-2 genes. Frequent occurrences of arsB, terF , and merA genes were detected, especially in silA/pcoD -positive, multidrug-resistant (MDR) and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  3. Multidrug-Resistant CTX-M-(15, 9, 2- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance

    Directory of Open Access Journals (Sweden)

    Leonardo N. Andrade


    Full Text Available Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes (sil operon: silE, silS, silR, silC, silF, silB, silA, and silP and acquired extended-spectrum cephalosporin and carbapenem resistance genes (blaCTX−M and blaKPC in Enterobacter cloacae Complex (EcC (n = 27 and Enterobacter aerogenes (n = 8 isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump, arsB (arsenite-efflux pump, terF (tellurite resistance protein, and merA (mercuric reductase were also investigated. Outstandingly, 21/27 (78% EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA-positive EcC isolates. Interestingly, 8/20 (40% E. hormaechei and 5/6 (83% E. asburiae co-harbored silA/pcoD genes and blaCTX−M−(15,2,or9 and/or blaKPC−2 genes. Frequent occurrences of arsB, terF, and merA genes were detected, especially in silA/pcoD-positive, multidrug-resistant (MDR and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  4. The effect of stochasticity on the lac operon: an evolutionary perspective.

    Directory of Open Access Journals (Sweden)

    Milan van Hoek


    Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

  5. Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.


    Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W


    CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

  6. Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways. (United States)

    Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A


    The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and

  7. Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade

    Czech Academy of Sciences Publication Activity Database

    Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav


    Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015

  8. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi. (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F


    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  9. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis (United States)

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel


    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

  10. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis. (United States)

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent


    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  11. Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri. (United States)

    Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong


    The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

  12. Characterization of Runella slithyformis HD-Pnk, a Bifunctional DNA/RNA End-Healing Enzyme Composed of an N-Terminal 2′,3′-Phosphoesterase HD Domain and a C-Terminal 5′-OH Polynucleotide Kinase Domain (United States)

    Munir, Annum


    ABSTRACT 5′- and 3′-end-healing reactions are key steps in nucleic acid break repair in which 5′-OH ends are phosphorylated by a polynucleotide kinase (Pnk) and 3′-PO4 or 2′,3′-cyclic-PO4 ends are hydrolyzed by a phosphoesterase to generate the 5′-PO4 and 3′-OH termini required for sealing by classic polynucleotide ligases. End-healing and sealing enzymes are present in diverse bacterial taxa, often organized as modular units within a single multifunctional polypeptide or as subunits of a repair complex. Here we identify and characterize Runella slithyformis HD-Pnk as a novel bifunctional end-healing enzyme composed of an N-terminal 2′,3′-phosphoesterase HD domain and a C-terminal 5′-OH polynucleotide kinase P-loop domain. HD-Pnk phosphorylates 5′-OH polynucleotides (9-mers or longer) in the presence of magnesium and any nucleoside triphosphate donor. HD-Pnk dephosphorylates RNA 2′,3′-cyclic phosphate, RNA 3′-phosphate, RNA 2′-phosphate, and DNA 3′-phosphate ends in the presence of a transition metal cofactor, which can be nickel, copper, or cobalt. HD-Pnk homologs are present in genera from 11 bacterial phyla and are often encoded in an operon with a putative ATP-dependent polynucleotide ligase. IMPORTANCE The present study provides insights regarding the diversity of nucleic acid repair strategies via the characterization of Runella slithyformis HD-Pnk as the exemplar of a novel clade of dual 5′- and 3′-end-healing enzymes that phosphorylate 5′-OH termini and dephosphorylate 2′,3′-cyclic-PO4, 3′-PO4, and 2′-PO4 ends. The distinctive feature of HD-Pnk is its domain composition, i.e., a fusion of an N-terminal HD phosphohydrolase module and a C-terminal P-loop polynucleotide kinase module. Homologs of Runella HD-Pnk with the same domain composition, same domain order, and similar polypeptide sizes are distributed widely among genera from 11 bacterial phyla. PMID:27895092

  13. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C


    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  14. Genome analysis of the freshwater planktonic Vulcanococcus limneticus sp. nov. reveals horizontal transfer of nitrogenase operon and alternative pathways of nitrogen utilization. (United States)

    Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana


    Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for

  15. The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

    DEFF Research Database (Denmark)

    Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal


    The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

  16. Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus. (United States)

    Marincola, Gabriella; Wolz, Christiane


    In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. BrEPS: a flexible and automatic protocol to compute enzyme-specific sequence profiles for functional annotation

    Directory of Open Access Journals (Sweden)

    Schomburg D


    Full Text Available Abstract Background Models for the simulation of metabolic networks require the accurate prediction of enzyme function. Based on a genomic sequence, enzymatic functions of gene products are today mainly predicted by sequence database searching and operon analysis. Other methods can support these techniques: We have developed an automatic method "BrEPS" that creates highly specific sequence patterns for the functional annotation of enzymes. Results The enzymes in the UniprotKB are identified and their sequences compared against each other with BLAST. The enzymes are then clustered into a number of trees, where each tree node is associated with a set of EC-numbers. The enzyme sequences in the tree nodes are aligned with ClustalW. The conserved columns of the resulting multiple alignments are used to construct sequence patterns. In the last step, we verify the quality of the patterns by computing their specificity. Patterns with low specificity are omitted and recomputed further down in the tree. The final high-quality patterns can be used for functional annotation. We ran our protocol on a recent Swiss-Prot release and show statistics, as well as a comparison to PRIAM, a probabilistic method that is also specialized on the functional annotation of enzymes. We determine the amount of true positive annotations for five common microorganisms with data from BRENDA and AMENDA serving as standard of truth. BrEPS is almost on par with PRIAM, a fact which we discuss in the context of five manually investigated cases. Conclusions Our protocol computes highly specific sequence patterns that can be used to support the functional annotation of enzymes. The main advantages of our method are that it is automatic and unsupervised, and quite fast once the patterns are evaluated. The results show that BrEPS can be a valuable addition to the reconstruction of metabolic networks.

  18. Identification and Characterization of EctR1, a New Transcriptional Regulator of the Ectoine Biosynthesis Genes in the Halotolerant Methanotroph Methylomicrobium alcaliphilum 20Z▿ †


    Mustakhimov, Ildar I.; Reshetnikov, Alexander S.; Glukhov, Anatoly S.; Khmelenina, Valentina N.; Kalyuzhnaya, Marina G.; Trotsenko, Yuri A.


    Genes encoding key enzymes of the ectoine biosynthesis pathway in the halotolerant obligate methanotroph Methylomicrobium alcaliphilum 20Z have been shown to be organized into an ectABC-ask operon. Transcription of the ect operon is initiated from two promoters, ectAp1 and ectAp2 (ectAp1p2), similar to the σ70-dependent promoters of Escherichia coli. Upstream of the gene cluster, an open reading frame (ectR1) encoding a MarR-like transcriptional regulator was identified. Investigation of the ...

  19. Biofilm plasmids with a rhamnose operon are widely distributed determinants of the 'swim-or-stick' lifestyle in roseobacters. (United States)

    Michael, Victoria; Frank, Oliver; Bartling, Pascal; Scheuner, Carmen; Göker, Markus; Brinkmann, Henner; Petersen, Jörn


    Alphaproteobacteria of the metabolically versatile Roseobacter group (Rhodobacteraceae) are abundant in marine ecosystems and represent dominant primary colonizers of submerged surfaces. Motility and attachment are the prerequisite for the characteristic 'swim-or-stick' lifestyle of many representatives such as Phaeobacter inhibens DSM 17395. It has recently been shown that plasmid curing of its 65-kb RepA-I-type replicon with >20 genes for exopolysaccharide biosynthesis including a rhamnose operon results in nearly complete loss of motility and biofilm formation. The current study is based on the assumption that homologous biofilm plasmids are widely distributed. We analyzed 33 roseobacters that represent the phylogenetic diversity of this lineage and documented attachment as well as swimming motility for 60% of the strains. All strong biofilm formers were also motile, which is in agreement with the proposed mechanism of surface attachment. We established transposon mutants for the four genes of the rhamnose operon from P. inhibens and proved its crucial role in biofilm formation. In the Roseobacter group, two-thirds of the predicted biofilm plasmids represent the RepA-I type and their physiological role was experimentally validated via plasmid curing for four additional strains. Horizontal transfer of these replicons was documented by a comparison of the RepA-I phylogeny with the species tree. A gene content analysis of 35 RepA-I plasmids revealed a core set of genes, including the rhamnose operon and a specific ABC transporter for polysaccharide export. Taken together, our data show that RepA-I-type biofilm plasmids are essential for the sessile mode of life in the majority of cultivated roseobacters.

  20. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Christiansen, Gunna; Molin, S


    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

  1. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli. (United States)

    Zhu, Y; Lin, E C


    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

  2. Discovery of new enzymes and metabolic pathways using structure and genome context (United States)

    Zhao, Suwen; Kumar, Ritesh; Sakai, Ayano; Vetting, Matthew W.; Wood, B. McKay; Brown, Shoshana; Bonanno, Jeffery B.; Hillerich, Brandan S.; Seidel, Ronald D.; Babbitt, Patricia C.; Almo, Steven C.; Sweedler, Jonathan V.; Gerlt, John A.; Cronan, John E.; Jacobson, Matthew P.


    Assigning valid functions to proteins identified in genome projects is challenging, with over-prediction and database annotation errors major concerns1. We, and others2, are developing computation-guided strategies for functional discovery using “metabolite docking” to experimentally derived3 or homology-based4 three-dimensional structures. Bacterial metabolic pathways often are encoded by “genome neighborhoods” (gene clusters and/or operons), which can provide important clues for functional assignment. We recently demonstrated the synergy of docking and pathway context by “predicting” the intermediates in the glycolytic pathway in E. coli5. Metabolite docking to multiple binding proteins/enzymes in the same pathway increases the reliability of in silico predictions of substrate specificities because the pathway intermediates are structurally similar. We report that structure-guided approaches for predicting the substrate specificities of several enzymes encoded by a bacterial gene cluster allowed i) the correct prediction of the in vitro activity of a structurally characterized enzyme of unknown function (PDB 2PMQ), 2-epimerization of trans-4-hydroxy-L-proline betaine (tHyp-B) and cis-4-hydroxy-D-proline betaine (cHyp-B), and ii) the correct identification of the catabolic pathway in which Hyp-B 2-epimerase participates. The substrate-liganded pose predicted by virtual library screening (docking) was confirmed experimentally. The enzymatic activities in the predicted pathway were confirmed by in vitro assays and genetic analyses; the intermediates were identified by metabolomics; and repression of the genes encoding the pathway by high salt was established by transcriptomics, confirming the osmolyte role of tHyp-B. This study establishes the utility of structure-guide functional predictions to enable the discovery of new metabolic pathways. PMID:24056934

  3. Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway

    DEFF Research Database (Denmark)

    Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.


    Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...

  4. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus. (United States)

    Osipiuk, J; Joachimiak, A


    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  5. Isolation of the phe-operon from G. stearothermophilus comprising the phenol degradative meta-pathway genes and a novel transcriptional regulator

    Directory of Open Access Journals (Sweden)

    Reiss Monika


    Full Text Available Abstract Background Geobacillus stearothermophilus is able to utilize phenol as a sole carbon source. A DNA fragment encoding a phenol hydroxylase catalyzing the first step in the meta-pathway has been isolated previously. Based on these findings a PCR-based DNA walk was performed initially to isolate a catechol 2,3-dioxygenase for biosensoric applications but was continued to elucidate the organisation of the genes encoding the proteins for the metabolization of phenol. Results A 20.2 kb DNA fragment was isolated as a result of the DNA walk. Fifteen open reading frames residing on a low-copy megaplasmid were identified. Eleven genes are co-transcribed in one polycistronic mRNA as shown by reverse transcription-PCR. Ten genes encode proteins, that are directly linked with the meta-cleavage pathway. The deduced amino acid sequences display similarities to a two-component phenol hydroxylase, a catechol 2,3-dioxygenase, a 4-oxalocrotonate tautomerase, a 2-oxopent-4-dienoate hydratase, a 4-oxalocrotonate decarboxylase, a 4-hydroxy-2-oxovalerate aldolase, an acetaldehyde dehydrogenase, a plant-type ferredoxin involved in the reactivation of extradiol dioxygenases and a novel regulatory protein. The only enzymes missing for the complete mineralization of phenol are a 2-hydroxymuconic acid-6-semialdehyde hydrolase and/or 2-hydroxymuconic acid-6-semialdehyde dehydrogenase. Conclusion Research on the bacterial degradation of aromatic compounds on a sub-cellular level has been more intensively studied in gram-negative organisms than in gram-positive bacteria. Especially regulatory mechanisms in gram-positive (thermophilic prokaryotes remain mostly unknown. We isolated the first complete sequence of an operon from a thermophilic bacterium encoding the meta-pathway genes and analyzed the genetic organization. Moreover, the first transcriptional regulator of the phenol metabolism in gram-positive bacteria was identified. This is a first step to elucidate

  6. Pseudomonas fluorescens ATCC 13525 Containing an Artificial Oxalate Operon and Vitreoscilla Hemoglobin Secretes Oxalic Acid and Solubilizes Rock Phosphate in Acidic Alfisols (United States)

    Archana, G.; Naresh Kumar, G.


    Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2) transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2) containing artificial oxalate operon (plac-FpOAR-oah) and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp) secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil. PMID:24705024

  7. Pseudomonas fluorescens ATCC 13525 containing an artificial oxalate operon and Vitreoscilla hemoglobin secretes oxalic acid and solubilizes rock phosphate in acidic alfisols.

    Directory of Open Access Journals (Sweden)

    Kavita Yadav

    Full Text Available Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah, Fomitopsis plaustris oxalate transporter (FpOAR and Vitreoscilla hemoglobin (vgb in various combinations. Pf (pKCN2 transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4 secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2 transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2 containing artificial oxalate operon (plac-FpOAR-oah and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil.

  8. The Cry Toxin Operon of Clostridium bifermentans subsp. malaysia Is Highly Toxic to Aedes Larval Mosquitoes (United States)

    Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim


    The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432

  9. Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model (United States)

    Cao, Xin; Song, Yongli; Zhang, Tonghua

    In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.

  10. Imbalance between pulmonary angiotensin-converting enzyme and angiotensin-converting enzyme 2 activity in acute respiratory distress syndrome

    NARCIS (Netherlands)

    Wösten-van Asperen, Roelie M.; Bos, Albert P.; Bem, Reinout A.; Dierdorp, Barbara S.; Dekker, Tamara; van Goor, Harry; Kamilic, Jelena; van der Loos, Chris M.; van den Berg, Elske; Bruijn, Martijn; van Woensel, Job B.; Lutter, René


    Angiotensin-converting enzyme and its effector peptide angiotensin II have been implicated in the pathogenesis of acute respiratory distress syndrome. Recently, angiotensin-converting enzyme 2 was identified as the counter-regulatory enzyme of angiotensin-converting enzyme that converts angiotensin

  11. Imbalance between pulmonary angiotensin-converting enzyme and angiotensin-converting enzyme 2 activity in acute respiratory distress syndrome

    NARCIS (Netherlands)

    Wosten-van Asperen, Roelie M.; Bos, Albert; Bem, Reinout A.; Dierdorp, Barbara S.; Dekker, Tamara; van Goor, Harry; Kamilic, Jelena; van der Loos, Chris M.; van den Berg, Elske; Bruijn, Martijn; van Woensel, Job B.; Lutter, Rene


    Objective: Angiotensin-converting enzyme and its effector peptide angiotensin II have been implicated in the pathogenesis of acute respiratory distress syndrome. Recently, angiotensin-converting enzyme 2 was identified as the counter-regulatory enzyme of angiotensin-converting enzyme that converts

  12. Rapid identification of sequences for orphan enzymes to power accurate protein annotation.

    Directory of Open Access Journals (Sweden)

    Kevin R Ramkissoon

    Full Text Available The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the "back catalog" of enzymology--"orphan enzymes," those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC database alone. In this study, we demonstrate how this orphan enzyme "back catalog" is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology's "back catalog" another powerful tool to drive accurate genome annotation.

  13. Rapid Identification of Sequences for Orphan Enzymes to Power Accurate Protein Annotation (United States)

    Ojha, Sunil; Watson, Douglas S.; Bomar, Martha G.; Galande, Amit K.; Shearer, Alexander G.


    The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the “back catalog” of enzymology – “orphan enzymes,” those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC) database alone. In this study, we demonstrate how this orphan enzyme “back catalog” is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis) to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology’s “back catalog” another powerful tool to drive accurate genome annotation. PMID:24386392

  14. CysB-dependent upregulation of the Salmonella Typhimurium cysJIH operon in response to antimicrobial compounds that induce oxidative stress. (United States)

    Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando


    It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. recA mediated spontaneous deletions of the icaADBC operon of clinical Staphylococcus epidermidis isolates : a new mechanism of phenotypic variations

    NARCIS (Netherlands)

    Nuryastuti, Titik; van der Mei, Henny C.; Busscher, Henk J.; Kuijer, Roel; Aman, Abu T.; Krom, Bastiaan P.

    Phenotypic variation of Staphylococcus epidermidis involving the slime related ica operon results in heterogeneity in surface characteristics of individual bacteria in axenic cultures. Five clinical S. epidermidis isolates demonstrated phenotypic variation, i.e. both black and red colonies on Congo

  16. The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis


    Ahn, Sang-Joon; Burne, Robert A.


    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...

  17. Homology models guide discovery of diverse enzyme specificities among dipeptide epimerases in the enolase superfamily (United States)

    Lukk, Tiit; Sakai, Ayano; Kalyanaraman, Chakrapani; Brown, Shoshana D.; Imker, Heidi J.; Song, Ling; Fedorov, Alexander A.; Fedorov, Elena V.; Toro, Rafael; Hillerich, Brandan; Seidel, Ronald; Patskovsky, Yury; Vetting, Matthew W.; Nair, Satish K.; Babbitt, Patricia C.; Almo, Steven C.; Gerlt, John A.; Jacobson, Matthew P.


    The rapid advance in genome sequencing presents substantial challenges for protein functional assignment, with half or more of new protein sequences inferred from these genomes having uncertain assignments. The assignment of enzyme function in functionally diverse superfamilies represents a particular challenge, which we address through a combination of computational predictions, enzymology, and structural biology. Here we describe the results of a focused investigation of a group of enzymes in the enolase superfamily that are involved in epimerizing dipeptides. The first members of this group to be functionally characterized were Ala-Glu epimerases in Eschericiha coli and Bacillus subtilis, based on the operon context and enzymological studies; these enzymes are presumed to be involved in peptidoglycan recycling. We have subsequently studied more than 65 related enzymes by computational methods, including homology modeling and metabolite docking, which suggested that many would have divergent specificities;, i.e., they are likely to have different (unknown) biological roles. In addition to the Ala-Phe epimerase specificity reported previously, we describe the prediction and experimental verification of: (i) a new group of presumed Ala-Glu epimerases; (ii) several enzymes with specificity for hydrophobic dipeptides, including one from Cytophaga hutchinsonii that epimerizes D-Ala-D-Ala; and (iii) a small group of enzymes that epimerize cationic dipeptides. Crystal structures for certain of these enzymes further elucidate the structural basis of the specificities. The results highlight the potential of computational methods to guide experimental characterization of enzymes in an automated, large-scale fashion. PMID:22392983

  18. The TorR High-Affinity Binding Site Plays a Key Role in Both torR Autoregulation and torCAD Operon Expression in Escherichia coli


    Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent


    In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...

  19. Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity. (United States)

    Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T


    Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

  20. An ArsR/SmtB family member is involved in the regulation by arsenic of the arsenite oxidase operon in Thiomonas arsenitoxydans. (United States)

    Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine


    The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance. (United States)

    Ghosh, Semanti; Bagchi, Angshuman


    Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

  2. Prescription patterns of enzyme-containing products in South Africa over a 2-year period

    Directory of Open Access Journals (Sweden)

    Ilse Truter


    Full Text Available Enzymes are traded in five categories, namely medical (intervention, diagnostic (detection and quantification, molecular biology, biofuel and industrial. Therapeutic enzymes have been investigated for different uses, for example, for the treatment of genetic disorders, blood clotting disorders, cancer and infectious diseases and for burn debridement. No studies on the prescription of enzyme-containing products in South Africa could be found. Enzymes are classified in the Monthly Index of Medical Specialities under digestants, enzymes and fibrinolytics. The primary aim of this study was to investigate the prescription patterns and cost of enzyme-containing products in South Africa. A private health-care medicines claims database for 2010 and 2011 of approximately 4.5 million records was analysed retrospectively. Enzyme-containing products constituted a small percentage of medical insurance claims (only 0.02% of approximately 4.5 million claims for products and procedures, yet they were relatively expensive. A total of 906 products was prescribed at a cost of almost ZAR2 million over the 2 years. Hyaluronidase was the most frequently prescribed (60.04%, followed by pancreatin-containing products (34.66%. Pancreatin (lipase/ protease/amylase is primarily used in the management of pancreatic exocrine insufficiency. The average cost per hyaluronidase prescription paid by the medical insurance schemes was ZAR280. Other enzyme-containing products prescribed were imiglucerase, alteplase and tenecteplase. Imiglucerase was overall the most expensive. Alteplase, tenecteplase and streptokinase are antithrombotic enzymes that are used in the treatment of acute myocardial infarction or ischaemic stroke. Streptokinase, regarded as the most affordable antithrombotic enzyme, was not prescribed during the period under study. With the growing opportunities for enzymes for therapeutics, the use of enzyme-containing products which are comparatively expensive require

  3. Mutation of a Broadly Conserved Operon (RL3499-RL3502) from Rhizobium leguminosarum Biovar viciae Causes Defects in Cell Morphology and Envelope Integrity▿† (United States)

    Vanderlinde, Elizabeth M.; Magnus, Samantha A.; Tambalo, Dinah D.; Koval, Susan F.; Yost, Christopher K.


    The bacterial cell envelope is of critical importance to the function and survival of the cell; it acts as a barrier against harmful toxins while allowing the flow of nutrients into the cell. It also serves as a point of physical contact between a bacterial cell and its host. Hence, the cell envelope of Rhizobium leguminosarum is critical to cell survival under both free-living and symbiotic conditions. Transposon mutagenesis of R. leguminosarum strain 3841 followed by a screen to isolate mutants with defective cell envelopes led to the identification of a novel conserved operon (RL3499-RL3502) consisting of a putative moxR-like AAA+ ATPase, a hypothetical protein with a domain of unknown function (designated domain of unknown function 58), and two hypothetical transmembrane proteins. Mutation of genes within this operon resulted in increased sensitivity to membrane-disruptive agents such as detergents, hydrophobic antibiotics, and alkaline pH. On minimal media, the mutants retain their rod shape but are roughly 3 times larger than the wild type. On media containing glycine or peptides such as yeast extract, the mutants form large, distorted spheres and are incapable of sustained growth under these culture conditions. Expression of the operon is maximal during the stationary phase of growth and is reduced in a chvG mutant, indicating a role for this sensor kinase in regulation of the operon. Our findings provide the first functional insight into these genes of unknown function, suggesting a possible role in cell envelope development in Rhizobium leguminosarum. Given the broad conservation of these genes among the Alphaproteobacteria, the results of this study may also provide insight into the physiological role of these genes in other Alphaproteobacteria, including the animal pathogen Brucella. PMID:21357485

  4. Expression, crystallization and preliminary diffraction studies of the Pseudomonas putida cytochrome P450cam operon repressor CamR

    International Nuclear Information System (INIS)

    Maenaka, Katsumi; Fukushi, Kouji; Aramaki, Hironori; Shirakihara, Yasuo


    The P. putida cytochrome P450cam operon repressor CamR has been expressed in E. coli and crystallized in space group P2 1 2 1 2. The Pseudomonas putida cam repressor (CamR) is a homodimeric protein that binds to the camO DNA operator to inhibit the transcription of the cytochrome P450cam operon camDCAB. CamR has two functional domains: a regulatory domain and a DNA-binding domain. The binding of the inducer d-camphor to the regulatory domain renders the DNA-binding domain unable to bind camO. Native CamR and its selenomethionyl derivative have been overproduced in Escherichia coli and purified. Native CamR was crystallized under the following conditions: (i) 12–14% PEG 4000, 50 mM Na PIPES, 0.1 M KCl, 1% glycerol pH 7.3 at 288 K with and without camphor and (ii) 1.6 M P i , 50 mM Na PIPES, 2 mM camphor pH 6.7 at 278 K. The selenomethionyl derivative CamR did not crystallize under either of these conditions, but did crystallize using 12.5% PEG MME 550, 25 mM Na PIPES, 2.5 mM MgCl 2 pH 7.3 at 298 K. Preliminary X-ray diffraction studies revealed the space group to be orthorhombic (P2 1 2 1 2), with unit-cell parameters a = 48.0, b = 73.3, c = 105.7 Å. Native and selenomethionyl derivative data sets were collected to 3 Å resolution at SPring-8 and the Photon Factory

  5. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures. (United States)

    Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L


    Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  6. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Directory of Open Access Journals (Sweden)

    Kathleen Jwanoswki

    Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  7. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH. (United States)

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi


    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  8. An operon from Lactobacillus helveticus composed of a proline iminopeptidase gene (pepI) and two genes coding for putative members of the ABC transporter family of proteins. (United States)

    Varmanen, P; Rantanen, T; Palva, A


    A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.

  9. Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

    NARCIS (Netherlands)

    Nouwen, N; Driessen, AJM


    Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

  10. Dynamic in vivo mutations within the ica operon during persistence of Staphylococcus aureus in the airways of cystic fibrosis patients.

    Directory of Open Access Journals (Sweden)

    Bianca Schwartbeck


    Full Text Available Cystic fibrosis (CF is associated with chronic bacterial airway infections leading to lung insufficiency and decreased life expectancy. Staphylococcus aureus is one of the most prevalent pathogens isolated from the airways of CF patients. Mucoid colony morphology has been described for Pseudomonas aeruginosa, the most common pathogen in CF, but not for S. aureus. From the airways of 8 of 313 CF patients (2.5% mucoid S. aureus isolates (n = 115 were cultured with a mean persistence of 29 months (range 1 month, 126 months. In contrast to non-mucoid S. aureus, mucoid isolates were strong biofilm formers. The upstream region of the ica operon, which encodes the proteins responsible for the synthesis of the polysaccharide intercellular adhesin (PIA, of mucoid isolates was sequenced. Spa-types of mucoid and non-mucoid strains were identical, but differed between patients. Mucoid isolates carried a 5 bp deletion in the intergenic region between icaR and icaA. During long-term persistence, from two patients subsequent non-mucoid isolates (n = 12 with 5 bp deletions were cultured, which did not produce biofilm. Sequencing of the entire ica operon identified compensatory mutations in various ica-genes including icaA (n = 7, icaD (n = 3 and icaC (n = 2. Six sequential isolates of each of these two patients with non-mucoid and mucoid phenotypes were subjected to whole genome sequencing revealing a very close relationship of the individual patient's isolates. Transformation of strains with vectors expressing the respective wild-type genes restored mucoidy. In contrast to the non-mucoid phenotype, mucoid strains were protected against neutrophilic killing and survived better under starvation conditions. In conclusion, the special conditions present in CF airways seem to facilitate ongoing mutations in the ica operon during S. aureus persistence.

  11. Use of the Operon Structure of the C. elegans Genome as a Tool to Identify Functionally Related Proteins

    Directory of Open Access Journals (Sweden)

    Silvia Dossena


    Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.

  12. Deregulation of the arginine deiminase (arc) operon in penicillin-tolerant mutants of Streptococcus gordonii. (United States)

    Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P


    Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.

  13. Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica. (United States)

    Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard


    Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

  14. Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia. (United States)

    Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène


    Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.

  15. The Small Protein HemP Is a Transcriptional Activator for the Hemin Uptake Operon in Burkholderia multivorans ATCC 17616. (United States)

    Sato, Takuya; Nonoyama, Shouta; Kimura, Akane; Nagata, Yuji; Ohtsubo, Yoshiyuki; Tsuda, Masataka


    Iron and heme play very important roles in various metabolic functions in bacteria, and their intracellular homeostasis is maintained because high concentrations of free forms of these molecules greatly facilitate the Fenton reaction-mediated production of large amounts of reactive oxygen species that severely damage various biomolecules. The ferric uptake regulator (Fur) from Burkholderia multivorans ATCC 17616 is an iron-responsive global transcriptional regulator, and its fur deletant exhibits pleiotropic phenotypes. In this study, we found that the phenotypes of the fur deletant were suppressed by an additional mutation in hemP The transcription of hemP was negatively regulated by Fur under iron-replete conditions and was constitutive in the fur deletant. Growth of a hemP deletant was severely impaired in a medium containing hemin as the sole iron source, demonstrating the important role of HemP in hemin utilization. HemP was required as a transcriptional activator that specifically binds the promoter-containing region upstream of a Fur-repressive hmuRSTUV operon, which encodes the proteins for hemin uptake. A hmuR deletant was still able to grow using hemin as the sole iron source, albeit at a rate clearly lower than that of the wild-type strain. These results strongly suggested (i) the involvement of HmuR in hemin uptake and (ii) the presence in ATCC 17616 of at least part of other unknown hemin uptake systems whose expression depends on the HemP function. Our in vitro analysis also indicated high-affinity binding of HemP to hemin, and such a property might modulate transcriptional activation of the hmu operon. IMPORTANCE Although the hmuRSTUV genes for the utilization of hemin as a sole iron source have been identified in a few Burkholderia strains, the regulatory expression of these genes has remained unknown. Our analysis in this study using B. multivorans ATCC 17616 showed that its HemP protein is required for expression of the hmuRSTUV operon, and the

  16. X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus. (United States)

    Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S


    A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA

  17. Ribosomal protein L10(L12)4 autoregulates expression of the Bacillus subtilis rplJL operon by a transcription attenuation mechanism. (United States)

    Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul


    Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

    NARCIS (Netherlands)

    Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.


    Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

  19. Roles of Human CYP2A6 and Monkey CYP2A24 and 2A26 Cytochrome P450 Enzymes in the Oxidation of 2,5,2',5'-Tetrachlorobiphenyl. (United States)

    Shimada, Tsutomu; Kakimoto, Kensaku; Takenaka, Shigeo; Koga, Nobuyuki; Uehara, Shotaro; Murayama, Norie; Yamazaki, Hiroshi; Kim, Donghak; Guengerich, F Peter; Komori, Masayuki


    2,5,2',5'-Tetrachlorobiphenyl (TCB) induced type I binding spectra with cytochrome P450 (P450) 2A6 and 2A13, with K s values of 9.4 and 0.51 µM, respectively. However, CYP2A6 oxidized 2,5,2',5'-TCB to form 4-hydroxylated products at a much higher rate (∼1.0 minute -1 ) than CYP2A13 (∼0.02 minute -1 ) based on analysis by liquid chromatography-tandem mass spectrometry. Formation of 4-hydroxy-2,5,2',5'-TCB by CYP2A6 was greater than that of 3-hydroxy-2,5,2',5'-TCB and three other hydroxylated products. Several human P450 enzymes, including CYP1A1, 1A2, 1B1, 2B6, 2D6, 2E1, 2C9, and 3A4, did not show any detectable activities in oxidizing 2,5,2',5'-TCB. Cynomolgus monkey CYP2A24, which shows 95% amino acid identity to human CYP2A6, catalyzed 4-hydroxylation of 2,5,2',5'-TCB at a higher rate (∼0.3 minute -1 ) than CYP2A26 (93% identity to CYP2A6, ∼0.13 minute -1 ) and CYP2A23 (94% identity to CYP2A13, ∼0.008 minute -1 ). None of these human and monkey CYP2A enzymes were catalytically active in oxidizing other TCB congeners, such as 2,4,3',4'-, 3,4,3',4'-, and 3,5,3',5'-TCB. Molecular docking analysis suggested that there are different orientations of interaction of 2,5,2',5'-TCB with the active sites (over the heme) of human and monkey CYP2A enzymes, and that ligand interaction energies (U values) of bound protein-ligand complexes show structural relationships of interaction of TCBs and other ligands with active sites of CYP2A enzymes. Catalytic differences in human and monkey CYP2A enzymes in the oxidation of 2,5,2',5'-TCB are suggested to be due to amino acid changes at substrate recognition sites, i.e., V110L, I209S, I300F, V365M, S369G, and R372H, based on the comparison of primary sequences. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  20. Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

    Directory of Open Access Journals (Sweden)

    Johanna Rintahaka

    Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we

  1. Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis. (United States)

    Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar


    A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided

  2. Generation of monoclonal antibodies against peptidylarginine deiminase 2 (PAD2) and development of a PAD2-specific enzyme-linked immunosorbent assay

    DEFF Research Database (Denmark)

    Damgaard, Dres; Palarasah, Yaseelan; Skjødt, Karsten


    The enzyme peptidylarginine deiminase 2 (PAD2) has been associated with inflammatory diseases, such as rheumatoid arthritis and neurodegenerative diseases including multiple sclerosis. To investigate the association of various diseases with extracellular PAD2, we raised monoclonal antibodies (m......Abs) against rabbit PAD2 and evaluated their cross-reactivity with human PAD2 by indirect enzyme-linked immunosorbent assay (ELISA), western blotting and immunohistological staining of inflamed synovial tissue. Moreover, we established a sandwich ELISA detecting human PAD2, based on two different monoclonal...... diseases....

  3. RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus. (United States)

    Lei, Mei G; Lee, Chia Y


    Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation

  4. Enzymatic, immunological and phylogenetic characterization of Brucella suis urease

    Directory of Open Access Journals (Sweden)

    Sriranganathan Nammalwar


    Full Text Available Abstract Background The sequenced genomes of the Brucella spp. have two urease operons, ure-1 and ure-2, but there is evidence that only one is responsible for encoding an active urease. The present work describes the purification and the enzymatic and phylogenomic characterization of urease from Brucella suis strain 1330. Additionally, the urease reactivity of sera from patients diagnosed with brucellosis was examined. Results Urease encoded by the ure-1 operon of Brucella suis strain 1330 was purified to homogeneity using ion exchange and hydrophobic interaction chromatographies. The urease was purified 51-fold with a recovery of 12% of the enzyme activity and 0.24% of the total protein. The enzyme had an isoelectric point of 5, and showed optimal activity at pH 7.0 and 28–35°C. The purified enzyme exhibited a Michaelis-Menten saturation kinetics with a Km of 5.60 ± 0.69 mM. Hydroxyurea and thiourea are competitive inhibitors of the enzyme with Ki of 1.04 ± 0.31 mM and 26.12 ± 2.30 mM, respectively. Acetohydroxamic acid also inhibits the enzyme in a competitive way. The molecular weight estimated for the native enzyme was between 130–135 kDa by gel filtration chromatography and 157 ± 7 kDa using 5–10% polyacrylamide gradient non-denaturing gel. Only three subunits in SDS-PAGE were identified: two small subunits of 14,000 Da and 15,500 Da, and a major subunit of 66,000 Da. The amino terminal sequence of the purified large subunit corresponded to the predicted amino acid sequence encoded by ureC1. The UreC1 subunit was recognized by sera from patients with acute and chronic brucellosis. By phylogenetic and cluster structure analyses, ureC1 was related to the ureC typically present in the Rhizobiales; in contrast, the ureC2 encoded in the ure-2 operon is more related to distant species. Conclusion We have for the first time purified and characterized an active urease from B. suis. The enzyme was characterized at the kinetic

  5. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman


    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  6. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

    Directory of Open Access Journals (Sweden)

    Cataldi Angel A


    Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

  7. Functional validation of putative toxin-antitoxin genes from the Gram-positive pathogen Streptococcus pneumoniae: phd-doc is the fourth bona-fide operon. (United States)

    Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel


    Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.

  8. Identification and functional analysis of the L-ascorbate-specific enzyme II complex of the phosphotransferase system in Streptococcus mutans. (United States)

    Wu, Xinyu; Hou, Jin; Chen, Xiaodan; Chen, Xuan; Zhao, Wanghong


    Streptococcus mutans is the primary etiological agent of human dental caries. It can metabolize a wide variety of carbohydrates and produce large amounts of organic acids that cause enamel demineralization. Phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS) plays an important role in carbohydrates uptake of S. mutans. The ptxA and ptxB genes in S. mutans encode putative enzyme IIA and enzyme IIB of the L-ascorbate-specific PTS. The aim of this study was to analyze the function of these proteins and understand the transcriptional regulatory mechanism. ptxA (-), ptxB (-), as well as ptxA (-) , ptxB (-) double-deletion mutants all had more extended lag phase and lower growth yield than wild-type strain UA159 when grown in the medium using L-ascorbate as the sole carbon source. Acid production and acid killing assays showed that the absence of the ptxA and ptxB genes resulted in a reduction in the capacity for acidogenesis, and all three mutant strains did not survive an acid shock. According to biofilm and extracellular polysaccharides (EPS) formation analysis, all the mutant strains formed much less prolific biofilms with small amounts of EPS than wild-type UA159 when using L-ascorbate as the sole carbon source. Moreover, PCR analysis and quantitative real-time PCR revealed that sgaT, ptxA, ptxB, SMU.273, SMU.274 and SMU.275 appear to be parts of the same operon. The transcription levels of these genes were all elevated in the presence of L-ascorbate, and the expression of ptxA gene decreased significantly once ptxB gene was knockout. The ptxA and ptxB genes are involved in the growth, aciduricity, acidogenesis, and formation of biofilms and EPS of S. mutans when L-ascorbate is the sole carbon source. In addition, the expression of ptxA is regulated by ptxB. ptxA, ptxB, and the upstream gene sgaT, the downstream genes SMU.273, SMU.274 and SMU.275 appear to be parts of the same operon, and L-ascorbate is a potential inducer of the operon.

  9. Chromosomal insertion of the entire Escherichia coli lactose operon, into two strains of Pseudomonas, using a modified mini-Tn5 delivery system

    DEFF Research Database (Denmark)

    Hansen, L. H.; Sørensen, S. J.; Jensen, Lars Bogø


    A 12-kb PstI fragment including the entire E. coli lactose operon (lacIPOZYA) was inserted in one copy into the chromosome of Pseudomonas putida, Pseudomonas fluorescens and an E. coli strain with lac(-) phenotype. This was made possible by improvements of an already existing mini-Tn5 transposon...... flanked by NotI sites needed in the mini-Tn5 delivery system; (b) the generation of E. coli nonlysogenic strains expressing the pi protein thus being capable of maintaining and delivering R6K-based mini-Tn5 vectors to other E. coli strains; (c) the successful insertion of the E. coli lactose operon...... into the P. fluorescens chromosome giving P. fluorescens the ability to grow on lactose; (d) evidence from Southern blotting that contradicts the assumption that the mini-Tn5 delivery system always creates one-copy inserts. These improvements allow insertion of large DNA fragments encoding highly expressed...

  10. Fitness Effects of Network Non-Linearity Induced by Gene Expression Noise (United States)

    Ray, Christian; Cooper, Tim; Balazsi, Gabor


    In the non-equilibrium dynamics of growing microbial cells, metabolic enzymes can create non-linearities in metabolite concentration because of non-linear degradation (utilization): an enzyme can saturate in the process of metabolite utilization. Increasing metabolite production past the saturation point then results in an ultrasensitive metabolite response. If the production rate of a metabolite depends on a second enzyme or other protein-mediated process, uncorrelated gene expression noise can thus cause transient metabolite concentration bursts. Such bursts are physiologically unnecessary and may represent a source of selection against the ultrasensitive switch, especially if the fluctuating metabolic intermediate is toxic. Selection may therefore favor correlated gene expression fluctuations for enzymes in the same pathway, such as by same-operon membership in bacteria. Using a modified experimental lac operon system, we are undertaking a combined theoretical-experimental approach to demonstrate that (i) the lac operon has an implicit ultrasensitive switch that we predict is avoided by gene expression correlations induced by same-operon membership; (ii) bacterial growth rates are sensitive to crossing the ultrasensitive threshold. Our results suggest that correlations in intrinsic gene expression noise are exploited by evolution to ameliorate the detrimental effects of nonlinearities in metabolite concentrations.

  11. Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression. (United States)

    Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin


    The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

  12. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Directory of Open Access Journals (Sweden)

    Løvdal Irene S


    Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.

  13. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores (United States)


    Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404

  14. The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis. (United States)

    Ahn, Sang-Joon; Burne, Robert A


    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.

  15. Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis. (United States)

    Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S


    The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

  16. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    NARCIS (Netherlands)

    Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.


    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted

  17. Experiment K-6-21. Effect of microgravity on 1) metabolic enzymes of type 1 and type 2 muscle fibers and on 2) metabolic enzymes, neutransmitter amino acids, and neurotransmitter associated enzymes in motor and somatosensory cerebral cortex. Part 1: Metabolic enzymes of individual muscle fibers; part 2: metabolic enzymes of hippocampus and spinal cord (United States)

    Lowry, O.; Mcdougal, D., Jr.; Nemeth, Patti M.; Maggie, M.-Y. Chi; Pusateri, M.; Carter, J.; Manchester, J.; Norris, Beverly; Krasnov, I.


    The individual fibers of any individual muscle vary greatly in enzyme composition, a fact which is obscured when enzyme levels of a whole muscle are measured. The purpose of this study was therefore to assess the changes due to weightless on the enzyme patterns composed by the individual fibers within the flight muscles. In spite of the limitation in numbers of muscles examined, it is apparent that: (1) that the size of individual fibers (i.e., their dry weight) was reduced about a third, (2) that this loss in dry mass was accompanied by changes in the eight enzymes studied, and (3) that these changes were different for the two muscles, and different for the two enzyme groups. In the soleus muscle the absolute amounts of the three enzymes of oxidative metabolism decreased about in proportion to the dry weight loss, so that their concentration in the atrophic fibers was almost unchanged. In contrast, there was little loss among the four enzymes of glycogenolysis - glycolysis so that their concentrations were substantially increased in the atrophic fibers. In the TA muscle, these seven enzymes were affected in just the opposite direction. There appeared to be no absolute loss among the oxidative enzymes, whereas the glycogenolytic enzymes were reduced by nearly half, so that the concentrations of the first metabolic group were increased within the atrophic fibers and the concentrations of the second group were only marginally decreased. The behavior of hexokinase was exceptional in that it did not decrease in absolute terms in either type of muscle and probably increased as much as 50 percent in soleus. Thus, their was a large increase in concentration of this enzyme in the atrophied fibers of both muscles. Another clear-cut finding was the large increase in the range of activities of the glycolytic enzymes among individual fibers of TA muscles. This was due to the emergence of TA fibers with activities for enzymes of this group extending down to levels as low as

  18. fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon. (United States)

    Khun, H H; Deved, V; Wong, H; Lee, B C


    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

  19. Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA

    DEFF Research Database (Denmark)

    Poulsen, Peter; Jensen, Kaj Frank


    We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...

  20. Biomolecular Mechanisms of Mercury Transfers and Transformations by Proteins of the Mer Operon (United States)

    Miller, S. M.; Hong, B.; Nauss, R.; Momany, C.; Summers, A. O.; Feng, X.; Harwood, I.; Stroud, R.


    Aerobic bacteria exhibiting resistance to the toxic effects of Hg(II) and organomercurials [RHg(I), e.g. MeHg(I)] and are widely found in both pristine and mercury contaminated environments. Resistance, afforded by a plasmid- or transposon-associated mer operon, involves an unusual pathway where Hg(II) and organomercurials [RHg(I)] undergo facilitated entry into the bacterial cytoplasm via an integral membrane transport protein (MerT) and are then "detoxified" by the concerted effort of two enzymes, organomercurial lyase (MerB), which catalyzes dealkylation (i.e., demethylation) of RHg(I) to Hg(II) and a hydrocarbon, and mercuric ion reductase (MerA), which catalyzes reduction of Hg(II) to Hg(0) as the ultimate detoxification for the organism. With a widespread distribution, these bacterial transformations play a significant role in the fate of mercury in the environment. Our focus is on elucidation of the molecular mechanisms for the transport and catalytic transformations of RHg(I) and Hg(II) by these proteins and the factors that influence the overall efficiency of the process. Current efforts are focused primarily on elucidating details of RHg(I) binding and dealkylation by MerB as well as the mechanism for transfer of the Hg(II) product to MerA. Key findings include the demonstration of a non-cysteine residue as essential for the catalytic activity and demonstration that direct transfer of Hg(II) to MerA proceeds more rapidly and more completely than transfer to small MW thiols such as cysteines or glutathione. Reuslts of these studies as well as an overview of our current understanding of the whole system will be presented.

  1. Prevalence of abnormal plasma liver enzymes in older people with Type 2 diabetes. (United States)

    Morling, J R; Strachan, M W J; Hayes, P C; Butcher, I; Frier, B M; Reynolds, R M; Price, J F


    To determine the prevalence and distribution of abnormal plasma liver enzymes in a representative sample of older adults with Type 2 diabetes. Plasma concentrations of alanine aminotransferase, aspartate aminotransferase and γ-glutamyltransferase were measured in a randomly selected, population-based cohort of 1066 men and women aged 60-75 years with Type 2 diabetes (the Edinburgh Type 2 Diabetes Study). Overall, 29.1% (95% CI 26.1-31.8) of patients had one or more plasma liver enzymes above the upper limit of the normal reference range. Only 10.1% of these patients had a prior history of liver disease and a further 12.4% reported alcohol intake above recommended limits. Alanine aminotransferase was the most commonly raised liver enzyme (23.1% of patients). The prevalence of abnormal liver enzymes was significantly higher in men (odds ratio 1.40, 95% CI 1.07-1.83), in the youngest 5-year age band (odds ratio 2.02, 95% CI 1.44-2.84), in patients with diabetes duration enzyme abnormality. The prevalence of elevated liver enzymes in people with Type 2 diabetes is high, with only modest variation between clinically defined patient groups. Further research is required to determine the prognostic value of raised, routinely measured liver enzymes to inform decisions on appropriate follow-up investigations. © 2011 The Authors. Diabetic Medicine © 2011 Diabetes UK.

  2. Legionella dumoffii Tex-KL Mutated in an Operon Homologous to traC-traD is Defective in Epithelial Cell Invasion. (United States)

    Qin, Tian; Ken-Ichiro, Iida; Ren, Hong Yu; Zhou, Hai Jian; Yoshida, Shin-Ichi


    To understand the mechanism of invasion by Legionella dumoffii. The L. dumoffii strain Tex-KL was mutated using the Tn903 derivative, Tn903dIIlacZ. After screening 799 transposon insertion mutants, we isolated one defective mutant. We then constructed the gene-disrupted mutant, KL16, and studied its invasion of and intracellular growth in HeLa and A549 cells, and in A/J mice survival experiments. The structure of traC-traD operon was analyzed by RT-PCR. The transposon insertion was in a gene homologous to Salmonella typhi traC, which is required for the assembly of F pilin into the mature F pilus structure and for conjugal DNA transmission. Results from RT-PCR suggested that the traC-traD region formed an operon. We found that when the traC gene was disrupted, invasion and intracellular growth of L. dumoffii Tex-KL were impaired in human epithelial cells. When mice were infected by intranasal inoculation with a traC deficient mutant, their survival significantly increased when compared to mice infected with the wild-type strain.. Our results indicated that the traC-traD operon is required for the invasion and intracellular growth abilities of L. dumoffii Tex-KL in epithelial cells. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  3. Biochemical characterization of Arabidopsis thaliana starch branching enzyme 2.2 reveals an enzymatic positive cooperativity. (United States)

    Wychowski, A; Bompard, C; Grimaud, F; Potocki-Véronèse, G; D'Hulst, C; Wattebled, F; Roussel, X


    Starch Branching Enzymes (SBE) catalyze the formation of α(1 → 6) branching points on starch polymers: amylopectin and amylose. SBEs are classified in two groups named type 1 and 2. Both types are present in the entire plant kingdom except in some species such as Arabidopsis thaliana that expresses two type 2 SBEs: BE2.1 and BE2.2. The present work describes in vitro enzymatic characterization of the recombinant BE2.2. The function of recombinant BE2.2 was characterized in vitro using spectrophotometry assay, native PAGE and HPAEC-PAD analysis. Size Exclusion Chromatography separation and SAXS experiments were used to identify the oligomeric state and for structural analysis of this enzyme. Optimal pH and temperature for BE2.2 activity were determined to be pH 7 and 25 °C. A glucosyl donor of at least 12 residues is required for BE2.2 activity. The reaction results in the transfer in an α(1 → 6) position of a glucan preferentially composed of 6 glucosyl units. In addition, BE2.2, which has been shown to be monomeric in absence of substrate, is able to adopt different active forms in presence of branched substrates, which affect the kinetic parameters. BE2.2 has substrate specificity similar to those of the other type-2 BEs. We propose that the different conformations of the enzyme displaying more or less affinity toward its substrates would explain the adjustment of the kinetic data to the Hill equation. This work describes the enzymatic parameters of Arabidopsis BE2.2. It reveals for the first time conformational changes for a branching enzyme, leading to a positive cooperative binding process of this enzyme. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  4. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

    Directory of Open Access Journals (Sweden)

    Astha Agarwal


    Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

  5. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development. (United States)

    Rajagopalan, Ramya; Kroos, Lee


    Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

  6. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions


    Burbank, Lindsey P.; Van Horn, Christopher R.


    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

  7. Isolation of a solventogenic Clostridium sp. strain: fermentation of glycerol to n-butanol, analysis of the bcs operon region and its potential regulatory elements. (United States)

    Panitz, J C; Zverlov, V V; Pham, V T T; Stürzl, S; Schieder, D; Schwarz, W H


    A new solventogenic bacterium, strain GT6, was isolated from standing water sediment. 16S-rRNA gene analysis revealed that GT6 belongs to the heterogeneous Clostridium tetanomorphum group of bacteria exhibiting 99% sequence identity with C. tetanomorphum 4474(T). GT6 can utilize a wide range of carbohydrate substrates including glucose, fructose, maltose, xylose and glycerol to produce mainly n-butanol without any acetone. Additional products of GT6 metabolism were ethanol, butyric acid, acetic acid, and trace amounts of 1,3-propanediol. Medium and substrate composition, and culture conditions such as pH and temperature influenced product formation. The major fermentation product from glycerol was n-butanol with a final concentration of up to 11.5 g/L. 3% (v/v) glycerol lead to a total solvent concentration of 14 g/L within 72 h. Growth was not inhibited by glycerol concentrations as high as 15% (v/v). The solventogenesis genes crt, bcd, etfA/B and hbd composing the bcs (butyryl-CoA synthesis) operon of C. tetanomorphum GT6 were sequenced. They occur in a genomic arrangement identical to those in other solventogenic clostridia. Furthermore, the sequence of a potential regulator gene highly similar to that of the NADH-sensing Rex family of regulatory genes was found upstream of the bcs operon. Potential binding sites for Rex have been identified in the promoter region of the bcs operon of solvent producing clostridia as well as upstream of other genes involved in NADH oxidation. This indicates a fundamental role of Rex in the regulation of fermentation products in anaerobic, and especially in solventogenic bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

  8. Evidence of mercury trapping in biofilm-EPS and mer operon-based volatilization of inorganic mercury in a marine bacterium Bacillus cereus BW-201B. (United States)

    Dash, Hirak R; Basu, Subham; Das, Surajit


    Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.

  9. Pseudomonas fluorescens ATCC 13525 Containing an Artificial Oxalate Operon and Vitreoscilla Hemoglobin Secretes Oxalic Acid and Solubilizes Rock Phosphate in Acidic Alfisols


    Yadav, Kavita; Kumar, Chanchal; Archana, G.; Naresh Kumar, G.


    Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) s...

  10. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans (United States)

    Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.


    ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans

  11. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans. (United States)

    Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G


    In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop

  12. Correlation of secretory phospholipase-A2 activity and fatty acids in cerebrospinal fluid with liver enzymes tests

    Directory of Open Access Journals (Sweden)

    Sepideh Ghodoosifar


    Full Text Available Introduction: The aim was to determine whether secretory phospholipase-A2 (sPLA2 activity and fatty acids in cerebrospinal fluid (CSF are correlated with liver enzymes tests. Methods: CSF and serum samples were collected from 49 patients (age 18-65 as part of routine diagnostic testing. Along with serum liver enzymes aspartate aminotransferase (AST, alanine aminotransferase (ALT and alkaline phosphatase (ALP, the fatty acid composition of CSF was measured by gas liquid chromatography. CSF enzyme activities of sPLA2 were measured using the standard assay with diheptanoyl thio-phosphatidylcholin as substrate. Results: The saturated fatty acids (SFAs including palmitic acid and stearic acid were positively, and the unsaturated fatty acids including oleic acid and linoleic acid were negatively correlated with liver enzymes tests. In regression analysis with adjustment for body mass index (BMI, the elevated liver enzymes tests were positively associated with activity of sPLA2 (β > 0.31, P 0.38, P < 0.010 and negatively with total monounsaturated fatty acids (MUFAs (β < -0.40, P < 0.001 contents of CSF. Conclusion: CSF activity of sPLA2 and fatty acids may be linked to peripheral markers of liver function, suggesting an indirect impact of central fatty acids on hepatocytes function and metabolism.

  13. Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression

    Directory of Open Access Journals (Sweden)

    Ziqing eDeng


    Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

  14. The MetaCyc database of metabolic pathways and enzymes and the BioCyc collection of pathway/genome databases (United States)

    Caspi, Ron; Altman, Tomer; Dale, Joseph M.; Dreher, Kate; Fulcher, Carol A.; Gilham, Fred; Kaipa, Pallavi; Karthikeyan, Athikkattuvalasu S.; Kothari, Anamika; Krummenacker, Markus; Latendresse, Mario; Mueller, Lukas A.; Paley, Suzanne; Popescu, Liviu; Pujar, Anuradha; Shearer, Alexander G.; Zhang, Peifen; Karp, Peter D.


    The MetaCyc database ( is a comprehensive and freely accessible resource for metabolic pathways and enzymes from all domains of life. The pathways in MetaCyc are experimentally determined, small-molecule metabolic pathways and are curated from the primary scientific literature. With more than 1400 pathways, MetaCyc is the largest collection of metabolic pathways currently available. Pathways reactions are linked to one or more well-characterized enzymes, and both pathways and enzymes are annotated with reviews, evidence codes, and literature citations. BioCyc ( is a collection of more than 500 organism-specific Pathway/Genome Databases (PGDBs). Each BioCyc PGDB contains the full genome and predicted metabolic network of one organism. The network, which is predicted by the Pathway Tools software using MetaCyc as a reference, consists of metabolites, enzymes, reactions and metabolic pathways. BioCyc PGDBs also contain additional features, such as predicted operons, transport systems, and pathway hole-fillers. The BioCyc Web site offers several tools for the analysis of the PGDBs, including Omics Viewers that enable visualization of omics datasets on two different genome-scale diagrams and tools for comparative analysis. The BioCyc PGDBs generated by SRI are offered for adoption by any party interested in curation of metabolic, regulatory, and genome-related information about an organism. PMID:19850718

  15. The LysR-type transcriptional regulator CbbR controlling autotrophic CO2 fixation by Xanthobacter flavus is an NADPH sensor

    NARCIS (Netherlands)

    van Keulen, G; Girbal, L; van den Bergh, E.R E; Dijkhuizen, L.; Meijer, W.G

    Autotrophic growth of Xanthobacter flavus is dependent on the fixation of carbon dioxide via the Calvin cycle and on the oxidation of simple organic and inorganic compounds to provide the cell with energy. Maximal induction of the cbb and gap-pgk operons encoding enzymes of the Calvin cycle occurs

  16. Metabolic enzyme expression highlights a key role for MTHFD2 and the mitochondrial folate pathway in cancer (United States)

    Nilsson, Roland; Jain, Mohit; Madhusudhan, Nikhil; Sheppard, Nina Gustafsson; Strittmatter, Laura; Kampf, Caroline; Huang, Jenny; Asplund, Anna; Mootha, Vamsi K.


    Metabolic remodeling is now widely regarded as a hallmark of cancer, but it is not clear whether individual metabolic strategies are frequently exploited by many tumours. Here we compare messenger RNA profiles of 1,454 metabolic enzymes across 1,981 tumours spanning 19 cancer types to identify enzymes that are consistently differentially expressed. Our meta-analysis recovers established targets of some of the most widely used chemotherapeutics, including dihydrofolate reductase, thymidylate synthase and ribonucleotide reductase, while also spotlighting new enzymes, such as the mitochondrial proline biosynthetic enzyme PYCR1. The highest scoring pathway is mitochondrial one-carbon metabolism and is centred on MTHFD2. MTHFD2 RNA and protein are markedly elevated in many cancers and correlated with poor survival in breast cancer. MTHFD2 is expressed in the developing embryo, but is absent in most healthy adult tissues, even those that are proliferating. Our study highlights the importance of mitochondrial compartmentalization of one-carbon metabolism in cancer and raises important therapeutic hypotheses.

  17. Structural insights into conserved L-arabinose metabolic enzymes reveal the substrate binding site of a thermophilic L-arabinose isomerase. (United States)

    Lee, Yong-Jik; Lee, Sang-Jae; Kim, Seong-Bo; Lee, Sang Jun; Lee, Sung Haeng; Lee, Dong-Woo


    Structural genomics demonstrates that despite low levels of structural similarity of proteins comprising a metabolic pathway, their substrate binding regions are likely to be conserved. Herein based on the 3D-structures of the α/β-fold proteins involved in the ara operon, we attempted to predict the substrate binding residues of thermophilic Geobacillus stearothermophilus L-arabinose isomerase (GSAI) with no 3D-structure available. Comparison of the structures of L-arabinose catabolic enzymes revealed a conserved feature to form the substrate-binding modules, which can be extended to predict the substrate binding site of GSAI (i.e., D195, E261 and E333). Moreover, these data implicated that proteins in the l-arabinose metabolic pathway might retain their substrate binding niches as the modular structure through conserved molecular evolution even with totally different structural scaffolds. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  18. Influence of 2. 45 GHz microwave radiation on enzyme activity

    Energy Technology Data Exchange (ETDEWEB)

    Galvin, M J; Parks, D L; McRee, D I


    The in vitro activity of acetylcholinesterase and creatine phosphokinase was determined during in vitro exposure to 2.45 GHz microwave radiation. The enzyme activities were examined during exposure to microwave radiation at specific absorption rates (SAR) of 1, 10, 50, and 100 mW/g. These specific absorption rates had no effect on the activity of either enzyme when the temperature of the control and exposed samples were similar. These data demonstrate that the activity of these two enzymes is not affected by microwave radiation at the SARs and frequency employed in this study.

  19. Using fusions with luxAB from Vibrio harveyi MAV to quantify induction and catabolite repression of the xyl operon in Staphylococcus carnosus TM300. (United States)

    Sizemore, C; Geissdörfer, W; Hillen, W


    The luxA,B genes from the Gram-negative marine bacterium Vibrio harveyi MAV were used in Staphylococcus carnosus TM300 as a reporter system for regulated expression of xylose utilization. The luciferase genes were fused to the xyl operon from Staphylococcus xylosus C2a. Expression of bioluminescence was induced through addition of xylose and repressed in the presence of glucose. A method to quantitate bioluminescence directly from the culture is described.

  20. Analysis of the multimer resolution system encoded by the parCBA operon of broad-host-range plasmid RP4

    DEFF Research Database (Denmark)

    Eberl, Leo; Sternberg, Claus; Givskov, Michael Christian


    specific sites situated in the promoter region of the parCBA operon. The two ParA proteins that are produced as a result of independent translation initiation at two different start codons within the same open reading frame were overexpressed in Escherichia coli and partially purified. Both forms...

  1. Modular Organization of the NusA- and NusG-Stimulated RNA Polymerase Pause Signal That Participates in the Bacillus subtilis trp Operon Attenuation Mechanism. (United States)

    Mondal, Smarajit; Yakhnin, Alexander V; Babitzke, Paul


    The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism in which tryptophan-activated TRAP binds to the nascent transcript and blocks the formation of an antiterminator structure such that the formation of an overlapping intrinsic terminator causes termination in the 5' untranslated region (5' UTR). In the absence of bound TRAP, the antiterminator forms and transcription continues into the trp genes. RNA polymerase pauses at positions U107 and U144 in the 5' UTR. The general transcription elongation factors NusA and NusG stimulate pausing at both positions. NusG-stimulated pausing at U144 requires sequence-specific contacts with a T tract in the nontemplate DNA (ntDNA) strand within the paused transcription bubble. Pausing at U144 participates in a trpE translation repression mechanism. Since U107 just precedes the critical overlap between the antiterminator and terminator structures, pausing at this position is thought to participate in attenuation. Here we carried out in vitro pausing and termination experiments to identify components of the U107 pause signal and to determine whether pausing affects the termination efficiency in the 5' UTR. We determined that the U107 and U144 pause signals are organized in a modular fashion containing distinct RNA hairpin, U-tract, and T-tract components. NusA-stimulated pausing was affected by hairpin strength and the U-tract sequence, whereas NusG-stimulated pausing was affected by hairpin strength and the T-tract sequence. We also determined that pausing at U107 results in increased TRAP-dependent termination in the 5' UTR, implying that NusA- and NusG-stimulated pausing participates in the trp operon attenuation mechanism by providing additional time for TRAP binding. IMPORTANCE The expression of several bacterial operons is controlled by regulated termination in the 5' untranslated region (5' UTR). Transcription attenuation is defined as situations in which the binding of a regulatory

  2. UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon

    International Nuclear Information System (INIS)

    Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.


    Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs

  3. A High-Throughput (HTS) Assay for Enzyme Reaction Phenotyping in Human Recombinant P450 Enzymes Using LC-MS/MS. (United States)

    Li, Xiaofeng; Suhar, Tom; Glass, Lateca; Rajaraman, Ganesh


    Enzyme reaction phenotyping is employed extensively during the early stages of drug discovery to identify the enzymes responsible for the metabolism of new chemical entities (NCEs). Early identification of metabolic pathways facilitates prediction of potential drug-drug interactions associated with enzyme polymorphism, induction, or inhibition, and aids in the design of clinical trials. Incubation of NCEs with human recombinant enzymes is a popular method for such work because of the specificity, simplicity, and high-throughput nature of this approach for phenotyping studies. The availability of a relative abundance factor and calculated intersystem extrapolation factor for the expressed recombinant enzymes facilitates easy scaling of in vitro data, enabling in vitro-in vivo extrapolation. Described in this unit is a high-throughput screen for identifying enzymes involved in the metabolism of NCEs. Emphasis is placed on the analysis of the human recombinant enzymes CYP1A2, CYP2C8, CYP2C9, CYP2C19, CYP2D6, CYP2B6, and CYP3A4, including the calculation of the intrinsic clearance for each. Copyright © 2014 John Wiley & Sons, Inc. All rights reserved.

  4. AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration. (United States)

    Linares, Daniel M; Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; de Jong, Anne; Kuipers, Oscar P; Fernandez, Maria; Alvarez, Miguel A


    Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. Photobiodegradation of chlorinated water pollutants by a combined TiO2-polyaniline-enzyme catalytic system (United States)

    Campanella, Luigi; Crescentini, G.; Militerno, S.


    The removal of xenobiotic compounds, such as chlorophenols and pesticides, from municipal and industrial wastewaters is an important task because of the toxicity and the tendency to bioaccumulation of these compounds. Among the several methods proposed, photodegradation catalyzed by suspended inorganic semiconductors (i.e. TiO2) has lately received wide attention because this process is fast, leads to non-toxic final products and shows a high degradation efficiency. In this work, the results obtained in the photodegradation of monochlorophenols using a new catalyst, made of TiO2 and polyaniline both immobilized on a polyvinylchloride (PVC) membrane, in presence (and in absence) of an enzyme are presented. Different enzymes have been tested by adding 5, 10 or 15 U/mL to 50 mL of aqueous solution (1 multiplied by 10-4 mol/L) of o-chloro-phenol containing the catalytic membrane. The samples were irradiated using a QUV panel accelerated weathering tester, which simulates very well the solar radiation up to lambda equals 400 nm and HPLC was used to measure the variation of the compound's concentration with the time. While some enzymes (i.e., peroxidase) do not improve the photodegradation process since they do not survive under the irradiation conditions used, some of them show marked effect both in terms of rate degradation and time required to reach the total degradation of the compound examined. For example, the addition of Laccase reduces the 100% degradation time from 35 hrs to about 20 hrs. Attempts to immobilize the enzyme on the catalytic membrane (by adsorption) have been carried out and the performance of the catalyst with non-immobilized and immobilized enzyme has been studied.

  6. Role of the Escherichia coli glnALG operon in regulation of ammonium transport

    International Nuclear Information System (INIS)

    Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.


    Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt


    NARCIS (Netherlands)



    In addition to the soluble lytic transglycosylase, a murein-metabolizing enzyme with a molecular mass of 70 kDa (Slt70), Escherichia coli possesses a second lytic transglycosylase, which has been described as a membrane-bound lytic transglycosylase (Mlt; 35 kDa; EC 3.2.1.-). The mlt gene, which

  8. First glycoside hydrolase family 2 enzymes from Thermus antranikianii and Thermus brockianus with β-glucosidase activity

    Directory of Open Access Journals (Sweden)

    Carola eSchröder


    Full Text Available Two genes tagh2 and tbgh2 coding for enzymes with hydrolytic activity towards esculin were identified from the extreme thermophilic, aerobic bacteria Thermus antranikianii (Ta and T. brockianus (Tb. Shortened conserved domains predicted a membership of the enzymes of glycoside hydrolase (GH family 2. At present, β-galactosidase activity is found frequently in GH family 2 but β-glucosidase activity has not been reported in this family before. The enzymes TaGH2 and TbGH2 preferred hydrolysis of nitrophenol-linked β-D-glucopyranosides with specific activities of 3,966 U/mg and 660 U/mg, respectively. Residual activities of 40 % (TaGH2 and 51 % (TbGH2 towards 4-NP-β-D-galactopyranoside were observed. Furthermore, TaGH2 hydrolyzed cellobiose. TbGH2, however, showed no activity on cellobiose or lactose. The enzymes exhibited highest activity at 95 °C (TaGH2 and 90 °C (TbGH2 at pH 6.5. Both enzymes were extremely thermostable and thermal activation up to 250 % was observed at temperatures between 50 and 60 °C. Accordingly, the first thermoactive glycoside hydrolase family 2 enzymes with β glucosidase activity have been identified and characterized. The hydrolysis of cellobiose is a unique property of TaGH2 when compared to the enzymes of GH family 2.

  9. A new factor from enteric bacteria of rats amplifying induction of liver enzyme by glucocorticoid. Pt. 2

    International Nuclear Information System (INIS)

    Kido, Hiroshi; Higashi, Takao; Katanuma, Nobuhiko


    1) An amplifier of the action of glucocorticoid was purified from Proteus mirabilis as described previously. It was found that it amplified the induction of liver tyrosine aminotransferase by dexamethasone markedly with doses of dexamethasone that caused minimal enzyme induction, but had little effect with doses that caused maximal induction. Thus the amplification may represent a saving of glucocorticoid. The amplification of enzyme activity was brought about by increase in amount of enzyme. 2) The amplification was observed when the amplifier was administered before or with dexamethasone, but not when it was given 2 h after dexamethasone. These results and the finding that actinomycin D inhibited the amplification indicate that the amplifier does not act on the translational level of enzyme induction. 3) It was found that the amplifier increased both incorporation of [ 3 H]dexamethasone into the cytosol and binding of [ 3 H]dexamethasone to cytosol protein and that it decreased decay of the [ 3 H]dexamethasone protein complex. (orig.) [de

  10. Specific DNA Binding of a Potential Transcriptional Regulator, Inosine 5′-Monophosphate Dehydrogenase-Related Protein VII, to the Promoter Region of a Methyl Coenzyme M Reductase I-Encoding Operon Retrieved from Methanothermobacter thermautotrophicus Strain ΔH▿


    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi


    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus ΔH are expressed in response to H2 availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cul...

  11. Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

    Directory of Open Access Journals (Sweden)

    Altenbuchner Josef


    Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

  12. DICER-ARGONAUTE2 complex in continuous fluorogenic assays of RNA interference enzymes.

    Directory of Open Access Journals (Sweden)

    Mark A Bernard

    Full Text Available Mechanistic studies of RNA processing in the RNA-Induced Silencing Complex (RISC have been hindered by lack of methods for continuous monitoring of enzymatic activity. "Quencherless" fluorogenic substrates of RNAi enzymes enable continuous monitoring of enzymatic reactions for detailed kinetics studies. Recombinant RISC enzymes cleave the fluorogenic substrates targeting human thymidylate synthase (TYMS and hypoxia-inducible factor 1-α subunit (HIF1A. Using fluorogenic dsRNA DICER substrates and fluorogenic siRNA, DICER+ARGONAUTE2 mixtures exhibit synergistic enzymatic activity relative to either enzyme alone, and addition of TRBP does not enhance the apparent activity. Titration of AGO2 and DICER in enzyme assays suggests that AGO2 and DICER form a functional high-affinity complex in equimolar ratio. DICER and DICER+AGO2 exhibit Michaelis-Menten kinetics with DICER substrates. However, AGO2 cannot process the fluorogenic siRNA without DICER enzyme, suggesting that AGO2 cannot self-load siRNA into its active site. The DICER+AGO2 combination processes the fluorogenic siRNA substrate (Km=74 nM with substrate inhibition kinetics (Ki=105 nM, demonstrating experimentally that siRNA binds two different sites that affect Dicing and AGO2-loading reactions in RISC. This result suggests that siRNA (product of DICER bound in the active site of DICER may undergo direct transfer (as AGO2 substrate to the active site of AGO2 in the DICER+AGO2 complex. Competitive substrate assays indicate that DICER+AGO2 cleavage of fluorogenic siRNA is specific, since unlabeled siRNA and DICER substrates serve as competing substrates that cause a concentration-dependent decrease in fluorescent rates. Competitive substrate assays of a series of DICER substrates in vitro were correlated with cell-based assays of HIF1A mRNA knockdown (log-log slope=0.29, suggesting that improved DICER substrate designs with 10-fold greater processing by the DICER+AGO2 complex can provide a

  13. Identification of a umuDC locus in Salmonella typhimurium LT2

    International Nuclear Information System (INIS)

    Smith, C.M.; Eisenstadt, E.


    The umuDC operon of Escherichia coli is required for efficient mutagenesis by UV light and many other DNA-damaging agents. The existence of a umuDC analog in Salmonella typhimurium has been questioned. With DNA probes to the E. coli umuD and umuC genes, we detected, by Southern blot hybridization, sequences similar to both of these genes in S. typhimurium LT2. We also confirmed that the presence of cloned E. coli umuD enhances the UV mutability and resistance of S. typhimurium. Our data strongly suggest that S. typhimurium contains a functional umuDC operon

  14. Proteomic pleiotropy of OpgGH, an operon necessary for efficient growth of Salmonella enterica serovar Typhimurium under low-osmotic conditions (United States)

    Salmonella enterica, a bacterial, food-borne pathogen of humans, can contaminate raw fruits and vegetables. Causing much public concern, the bacteria can survive in water used to wash produce. The ability to survive the low-osmolarity of the wash waters is attributed to the OpgGH operon that leads...

  15. A short history of RubisCO: the rise and fall (?) of Nature's predominant CO2 fixing enzyme. (United States)

    Erb, Tobias J; Zarzycki, Jan


    Ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) is arguably one of the most abundant proteins in the biosphere and a key enzyme in the global carbon cycle. Although RubisCO has been intensively studied, its evolutionary origins and rise as Nature's most dominant carbon dioxide (CO 2 )-fixing enzyme still remain in the dark. In this review we will bring together biochemical, structural, physiological, microbiological, as well as phylogenetic data to speculate on the evolutionary roots of the CO 2 -fixation reaction of RubisCO, the emergence of RubisCO-based autotrophic CO 2 -fixation in the context of the Calvin-Benson-Bassham cycle, and the further evolution of RubisCO into the 'RubisCOsome', a complex of various proteins assembling and interacting with the enzyme to improve its operational capacity (functionality) under different biological and environmental conditions. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Changes in wetting properties of silica surface treated with DPPC in the presence of phospholipase A{sub 2} enzyme

    Energy Technology Data Exchange (ETDEWEB)

    Wiacek, Agnieszka Ewa, E-mail: [Department of Interfacial Phenomena, Faculty of Chemistry, Maria Curie-Sklodowska University, 20031 Lublin (Poland)


    Wetting properties of silica plates contacted with dipalmitoylphosphatidylcholine (DPPC) or DPPC/enzyme (phospholipase PLA{sub 2}) in NaCl solution were determined by thin layer wicking and with a help of Washburn equation. The wicking experiments were performed both for bare plates and the silica plates precontacted overnight with the probe liquid saturated vapors the silica plates, as well as untreated and DPPC (or DPPC/enzyme) treated. Adsorption of DPPC on original silica plates increases a bit hydrophobic character of silica surface in such a way that hydrocarbon chains are directed outwards and the polar part towards the silica surface. However, after the enzyme action the products of DPPC hydrolysis by PLA{sub 2} (palmitic acid and lysophosphatidylcholine) increase again hydrophilic character of silica surface (an increase in acid-base interactions, {gamma}{sub s}{sup AB}). The changes of silica surface wettability are evidently dependent on the time of enzyme contacting with DPPC in NaCl solution. Although, the changes of total surface free energy of silica after treatment with DPPC/enzyme solution are minor about 2-6 mJ/m{sup 2}, the changes of the electron-donor ({gamma}{sub s}{sup -}) and Lifshitz-van der Waals ({gamma}{sub s}{sup LW}) component of the surface free energy are noticeable. Despite, these results are somehow preliminary, it seems that thin layer wicking method is an interesting tool for investigation of the effect of adsorbed DPPC on hydrophobicity/hydrophilicity of silica surface and influence of enzyme PLA{sub 2} action.

  17. The Bacillus subtilis GntR family repressor YtrA responds to cell wall antibiotics. (United States)

    Salzberg, Letal I; Luo, Yun; Hachmann, Anna-Barbara; Mascher, Thorsten; Helmann, John D


    The transglycosylation step of cell wall synthesis is a prime antibiotic target because it is essential and specific to bacteria. Two antibiotics, ramoplanin and moenomycin, target this step by binding to the substrate lipid II and the transglycosylase enzyme, respectively. Here, we compare the ramoplanin and moenomycin stimulons in the Gram-positive model organism Bacillus subtilis. Ramoplanin strongly induces the LiaRS two-component regulatory system, while moenomycin almost exclusively induces genes that are part of the regulon of the extracytoplasmic function (ECF) σ factor σ(M). Ramoplanin additionally induces the ytrABCDEF and ywoBCD operons, which are not part of a previously characterized antibiotic-responsive regulon. Cluster analysis reveals that these two operons are selectively induced by a subset of cell wall antibiotics that inhibit lipid II function or recycling. Repression of both operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front of ywoB. These results suggest that YtrA is an additional regulator of cell envelope stress responses.

  18. lac operon induction in Escherichia coli: Systematic comparison of IPTG and TMG induction and influence of the transacetylase LacA. (United States)

    Marbach, Anja; Bettenbrock, Katja


    Most commonly used expression systems in bacteria are based on the Escherichia coli lac promoter. Furthermore, lac operon elements are used today in systems and synthetic biology. In the majority of the cases the gratuitous inducers IPTG or TMG are used. Here we report a systematic comparison of lac promoter induction by TMG and IPTG which focuses on the aspects inducer uptake, population heterogeneity and a potential influence of the transacetylase, LacA. We provide induction curves in E. coli LJ110 and in isogenic lacY and lacA mutant strains and we show that both inducers are substrates of the lactose permease at low inducer concentrations but can also enter cells independently of lactose permease if present at higher concentrations. Using a gfp reporter strain we compared TMG and IPTG induction at single cell level and showed that bimodal induction with IPTG occurred at approximately ten-fold lower concentrations than with TMG. Furthermore, we observed that lac operon induction is influenced by the transacetylase, LacA. By comparing two Plac-gfp reporter strains with and without a lacA deletion we could show that in the lacA(+) strain the fluorescence level decreased after few hours while the fluorescence further increased in the lacA(-) strain. The results indicate that through the activity of LacA the IPTG concentration can be reduced below an inducing threshold concentration-an influence that should be considered if low inducer amounts are used. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Enzyme alterations in mediastine during and after radiotherapy. 2

    International Nuclear Information System (INIS)

    Alheit, H.D.; Alheit, C.; Herrmann, T.


    Results are presented estimating the serum activity of transaminases (ASAT and ALAT) in 72 patients after mediastinal irradiation. During and after mediastinal irradiation both enzymes showed essentially a parallel reaction. One day after irradiation a decrease of enzymes in patients who were irradiated with high single dosis (5 Gy) was observed, while patients irradiated with low or middle single dosis showed an increase of enzyme activity. A different temporal enzyme reaction is discussed to be the cause for this reaction in dependence on the applied single dose so that in patients with high single doses an initial enzyme increase caused by the radiation insult has changed into a following decrease under the starting level at the first control 24 hours later. Because patients without mediastinal tumors react in the same manner, the normal tissue surrounding the tumor is discussed to be the original place of enzyme secretion. Up to the end of irradiation a decrease of enzymes was observed in patients with high single dose or with high total dose (60 Gy) which is interpreted as an enzyme deficiency in tissue in consequence of destruction in formation places. In patients with middle total and low single doses an enzyme increase is registered with a still sufficient restoration capacity of the tissue discussed to be the cause of it. An enzyme increase, observed from the end of irradiation to the control date 3 to 6 months after irradiation, is mainly caused by a tumor progression (increased rate of liver metastases, especially in bronchial carcinoma) and can still be intensified by occurrence of pulmonal or cardiac radioreactions. (author)

  20. Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae. (United States)

    Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S


    Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

  1. The Bacillus subtilis GntR Family Repressor YtrA Responds to Cell Wall Antibiotics▿§ (United States)

    Salzberg, Letal I.; Luo, Yun; Hachmann, Anna-Barbara; Mascher, Thorsten; Helmann, John D.


    The transglycosylation step of cell wall synthesis is a prime antibiotic target because it is essential and specific to bacteria. Two antibiotics, ramoplanin and moenomycin, target this step by binding to the substrate lipid II and the transglycosylase enzyme, respectively. Here, we compare the ramoplanin and moenomycin stimulons in the Gram-positive model organism Bacillus subtilis. Ramoplanin strongly induces the LiaRS two-component regulatory system, while moenomycin almost exclusively induces genes that are part of the regulon of the extracytoplasmic function (ECF) σ factor σM. Ramoplanin additionally induces the ytrABCDEF and ywoBCD operons, which are not part of a previously characterized antibiotic-responsive regulon. Cluster analysis reveals that these two operons are selectively induced by a subset of cell wall antibiotics that inhibit lipid II function or recycling. Repression of both operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front of ywoB. These results suggest that YtrA is an additional regulator of cell envelope stress responses. PMID:21856850

  2. Sex difference in induction of hepatic CYP2B and CYP3A subfamily enzymes by nicardipine and nifedipine in rats

    International Nuclear Information System (INIS)

    Konno, Yoshihiro; Sekimoto, Masashi; Nemoto, Kiyomitsu; Degawa, Masakuni


    Male and female of F344 rats were treated per os with nicardipine (Nic) and nifedipine (Nif), and changes in the levels of mRNA and protein of hepatic cytochrome P450 (P450) enzymes, CYP2B1, CYP2B2, CYP3A1, CYP3A2, CYP3A9, and CYP3A18 were examined. Furthermore, hepatic microsomal activities for pentoxyresorufin O-dealkylation (PROD) and nifedipine oxidation, which are mainly mediated by CYP2B and CYP3A subfamily enzymes, respectively, were measured. Analyses of RT-PCR and Western blotting revealed that Nic and Nif induced predominantly CYP3A and CYP2B enzymes, respectively. As for the gene activation of CYP2B enzymes, especially CYP2B1, Nif showed high capacity in both sexes of rats, whereas Nic did a definite capacity in the males but little in the females. Gene activations of CYP3A1, CYP3A2, and CYP3A18 by Nic occurred in both sexes of rats, although that of CYP3A9 did only in the male rats. Although gene activations of CYP3A1 and CYP3A2 by Nif were observed in both sexes of rats, a slight activation of the CYP3A9 gene occurred only in female rats, and the CYP3A18 gene activation, in neither male nor female rats. Thus, changes in levels of the mRNA or protein of CYP2B and CYP3A enzymes, especially CYP2B1 and CYP3A2, were closely correlated with those in hepatic PROD and nifedipine oxidation activities, respectively. The present findings demonstrate for the first time the sex difference in the Nic- and Nif-mediated induction of hepatic P450 enzymes in rats and further indicate that Nic and Nif show different specificities and sex dependencies in the induction of hepatic P450 enzymes

  3. Catalase, a remarkable enzyme: targeting the oldest antioxidant enzyme to find a new cancer treatment approach. (United States)

    Glorieux, Christophe; Calderon, Pedro Buc


    This review is centered on the antioxidant enzyme catalase and will present different aspects of this particular protein. Among them: historical discovery, biological functions, types of catalases and recent data with regard to molecular mechanisms regulating its expression. The main goal is to understand the biological consequences of chronic exposure of cells to hydrogen peroxide leading to cellular adaptation. Such issues are of the utmost importance with potential therapeutic extrapolation for various pathologies. Catalase is a key enzyme in the metabolism of H2O2 and reactive nitrogen species, and its expression and localization is markedly altered in tumors. The molecular mechanisms regulating the expression of catalase, the oldest known and first discovered antioxidant enzyme, are not completely elucidated. As cancer cells are characterized by an increased production of reactive oxygen species (ROS) and a rather altered expression of antioxidant enzymes, these characteristics represent an advantage in terms of cell proliferation. Meanwhile, they render cancer cells particularly sensitive to an oxidant insult. In this context, targeting the redox status of cancer cells by modulating catalase expression is emerging as a novel approach to potentiate chemotherapy.

  4. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus. (United States)

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok


    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  5. Variation in antiviral 2',5'-oligoadenylate synthetase (2'5'AS) enzyme activity is controlled by a single-nucleotide polymorphism at a splice-acceptor site in the OAS1 gene

    DEFF Research Database (Denmark)

    Bonnevie-Nielsen, Vagn; Field, L Leigh; Lu, Shao


    It is likely that human genetic differences mediate susceptibility to viral infection and virus-triggered disorders. OAS genes encoding the antiviral enzyme 2',5'-oligoadenylate synthetase (2'5'AS) are critical components of the innate immune response to viruses. This enzyme uses adenosine......=.0044), but not spousal pairs, suggesting strong genetic control of basal activity. We next analyzed association between basal activity and 15 markers across the OAS gene cluster. Significant association was detected at multiple markers, the strongest being at an A/G single-nucleotide polymorphism...... at the exon 7 splice-acceptor site (AG or AA) of the OAS1 gene. At this unusual polymorphism, allele G had a higher gene frequency in persons with high enzyme activity than in those with low enzyme activity (0.44 vs. 0.20; P=3 x 10(-11)). Enzyme activity varied in a dose-dependent manner across the GG, GA...

  6. Spore Heat Activation Requirements and Germination Responses Correlate with Sequences of Germinant Receptors and with the Presence of a Specific spoVA2mob Operon in Foodborne Strains of Bacillus subtilis. (United States)

    Krawczyk, Antonina O; de Jong, Anne; Omony, Jimmy; Holsappel, Siger; Wells-Bennik, Marjon H J; Kuipers, Oscar P; Eijlander, Robyn T


    Spore heat resistance, germination, and outgrowth are problematic bacterial properties compromising food safety and quality. Large interstrain variation in these properties makes prediction and control of spore behavior challenging. High-level heat resistance and slow germination of spores of some natural Bacillus subtilis isolates, encountered in foods, have been attributed to the occurrence of the spoVA 2mob operon carried on the Tn 1546 transposon. In this study, we further investigate the correlation between the presence of this operon in high-level-heat-resistant spores and their germination efficiencies before and after exposure to various sublethal heat treatments (heat activation, or HA), which are known to significantly improve spore responses to nutrient germinants. We show that high-level-heat-resistant spores harboring spoVA 2mob required higher HA temperatures for efficient germination than spores lacking spoVA 2mob The optimal spore HA requirements additionally depended on the nutrients used to trigger germination, l-alanine (l-Ala), or a mixture of l-asparagine, d-glucose, d-fructose, and K + (AGFK). The distinct HA requirements of these two spore germination pathways are likely related to differences in properties of specific germinant receptors. Moreover, spores that germinated inefficiently in AGFK contained specific changes in sequences of the GerB and GerK germinant receptors, which are involved in this germination response. In contrast, no relation was found between transcription levels of main germination genes and spore germination phenotypes. The findings presented in this study have great implications for practices in the food industry, where heat treatments are commonly used to inactivate pathogenic and spoilage microbes, including bacterial spore formers. IMPORTANCE This study describes a strong variation in spore germination capacities and requirements for a heat activation treatment, i.e., an exposure to sublethal heat that increases

  7. A new amperometric enzyme electrode for alcohol determination. (United States)

    Gülce, H; Gülce, A; Kavanoz, M; Coşkun, H; Yildiz, A


    A new enzyme electrode for the determination of alcohols was developed by immobilizing alcohol oxidase in polvinylferrocenium matrix coated on a Pt electrode surface. The amperometric response due to the electrooxidation of enzymatically generated H(2)O(2) was measured at a constant potential of +0.70 V versus SCE. The effects of substrate, buffer and enzyme concentrations, pH and temperature on the response of the electrode were investigated. The optimum pH was found to be pH 8.0 at 30 degrees C. The steady-state current of this enzyme electrode was reproducible within +/-5.0% of the relative error. The sensitivity of the enzyme electrode decreased in the following order: methanol>ethanol>n-butanol>benzyl alcohol. The linear response was observed up to 3.7 mM for methanol, 3.0 mM for ethanol, 6.2 mM for n-butanol, and 5.2 mM for benzyl alcohol. The apparent Michaelis-Menten constant (K(Mapp)) value and the activation energy, E(a), of this immobilized enzyme system were found to be 5.78 mM and 38.07 kJ/mol for methanol, respectively.

  8. Effect of inhibition of microsomal Ca(2+)-ATPase on cytoplasmic calcium and enzyme secretion in pancreatic acini. (United States)

    Metz, D C; Pradhan, T K; Mrozinski, J E; Jensen, R T; Turner, R J; Patto, R J; Gardner, J D


    We used thapsigargin (TG), 2,5-di-tert-butyl-1,4-benzohydroquinone (BHQ) and cyclopiazonic acid (CPA), each of which inhibits microsomal Ca(2+)-ATPase, to evaluate the effects of this inhibition on cytoplasmic free calcium ([Ca2+]i) and secretagogue-stimulated enzyme secretion in rat pancreatic acini. Using single-cell microspectrofluorimetry of fura-2-loaded acini we found that all three agents caused a sustained increase in [Ca2+]i by mobilizing calcium from inositol-(1,4,5)-trisphosphate-sensitive intracellular calcium stores and by promoting influx of extracellular calcium. Concentrations of all three agents that increased [Ca2+]i potentiated the stimulation of enzyme secretion caused by secretagogues that activate adenylate cyclase but inhibited the stimulation of enzyme secretion caused by secretagogues that activate phospholipase C. With BHQ, potentiation of adenylate cyclase-mediated enzyme secretion occurred immediately whereas inhibition of phospholipase C-mediated enzyme secretion occurred only after several min of incubation. In addition, the effects of BHQ and CPA on both [Ca2+]i and secretagogue-stimulated enzyme secretion were reversed completely by washing whereas the actions of TG could not be reversed by washing. Concentrations of BHQ in excess of those that caused maximal changes in [Ca2+]i inhibited all modes of stimulated enzyme secretion by a mechanism that was apparently unrelated to changes in [Ca2+]i. Finally, in contrast to the findings with TG and BHQ, CPA inhibited bombesin-stimulated enzyme secretion over a range of concentrations that was at least 10-fold lower than the range of concentrations over which CPA potentiated VIP-stimulated enzyme secretion.

  9. A Bayesian method for identifying missing enzymes in predicted metabolic pathway databases

    Directory of Open Access Journals (Sweden)

    Karp Peter D


    Full Text Available Abstract Background The PathoLogic program constructs Pathway/Genome databases by using a genome's annotation to predict the set of metabolic pathways present in an organism. PathoLogic determines the set of reactions composing those pathways from the enzymes annotated in the organism's genome. Most annotation efforts fail to assign function to 40–60% of sequences. In addition, large numbers of sequences may have non-specific annotations (e.g., thiolase family protein. Pathway holes occur when a genome appears to lack the enzymes needed to catalyze reactions in a pathway. If a protein has not been assigned a specific function during the annotation process, any reaction catalyzed by that protein will appear as a missing enzyme or pathway hole in a Pathway/Genome database. Results We have developed a method that efficiently combines homology and pathway-based evidence to identify candidates for filling pathway holes in Pathway/Genome databases. Our program not only identifies potential candidate sequences for pathway holes, but combines data from multiple, heterogeneous sources to assess the likelihood that a candidate has the required function. Our algorithm emulates the manual sequence annotation process, considering not only evidence from homology searches, but also considering evidence from genomic context (i.e., is the gene part of an operon? and functional context (e.g., are there functionally-related genes nearby in the genome? to determine the posterior belief that a candidate has the required function. The method can be applied across an entire metabolic pathway network and is generally applicable to any pathway database. The program uses a set of sequences encoding the required activity in other genomes to identify candidate proteins in the genome of interest, and then evaluates each candidate by using a simple Bayes classifier to determine the probability that the candidate has the desired function. We achieved 71% precision at a

  10. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin


    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  11. The Transcriptional Repressor, MtrR, of the mtrCDE Efflux Pump Operon of Neisseria gonorrhoeae Can Also Serve as an Activator of “off Target” Gene (glnE Expression

    Directory of Open Access Journals (Sweden)

    Paul J. T. Johnson


    Full Text Available MtrR is a well-characterized repressor of the Neisseria gonorrhoeae mtrCDE efflux pump operon. However, results from a previous transcriptional profiling study suggested that MtrR also represses or activates expression of at least sixty genes outside of the mtr locus. Evidence that MtrR can directly repress so-called “off target” genes has previously been reported; in particular, MtrR was shown to directly repress glnA, which encodes glutamine synthetase. In contrast, evidence for the ability of MtrR to directly activate expression of gonococcal genes has been lacking; herein, we provide such evidence. We now report that MtrR has the ability to directly activate expression of glnE, which encodes the dual functional adenyltransferase/deadenylase enzyme GlnE that modifies GlnA resulting in regulation of its role in glutamine biosynthesis. With its capacity to repress expression of glnA, the results presented herein emphasize the diverse and often opposing regulatory properties of MtrR that likely contributes to the overall physiology and metabolism of N. gonorrhoeae.

  12. Biosynthesis of quinoxaline antibiotics: Purification and characterization of the quinoxaline-2-carboxylic acid activating enzyme from Streptomyces triostinicus

    International Nuclear Information System (INIS)

    Glund, K.; Schlumbohm, W.; Bapat, M.; Keller, U.


    A quinoxaline-2-carboxylic acid activating enzyme was purified to homogeneity from triostin-producing Streptomyces triostinicus. It could also be purified from quinomycin-producing Streptomyces echinatus. Triostins and quinomycins are peptide lactones that contain quinoxaline-2-carboxylic acid as chromophoric moiety. The enzyme catalyzes the ATP-pyrophosphate exchange reaction dependent on quinoxaline-2-carboxylic acid and the formation of the corresponding adenylate. Besides quinoxaline-2-carboxylic acid, the enzyme also catalyzes the formation of adenylates from quinoline-2-carboxylic acid and thieno[3,2-b]pyridine-5-carboxylic acid. No adenylates were seen from quinoline-3-carboxylic acid, quinoline-4-carboxylic acid, pyridine-2-carboxylic acid, and 2-pyrazinecarboxylic acid. Previous work revealed that quinoline-2-carboxylic acid and thieno[3,2-b]pyridine-5-carboxylic acid became efficiently incorporated into the corresponding quinoxaline antibiotic analogues in vivo. Together with the data described here, this suggests that the enzyme is part of the quinoxaline antibiotics synthesizing enzyme system. The enzyme displays a native molecular weight of 42,000, whereas in its denatured form it is a polypeptide of Mr 52,000-53,000. It resembles in its behavior actinomycin synthetase I, the chromophore activating enzyme involved in actinomycin biosynthesis

  13. Tissue Expressions of Soluble Human Epoxide Hydrolase-2 Enzyme in Patients with Temporal Lobe Epilepsy. (United States)

    Ahmedov, Merdin Lyutviev; Kemerdere, Rahsan; Baran, Oguz; Inal, Berrin Bercik; Gumus, Alper; Coskun, Cihan; Yeni, Seher Naz; Eren, Bulent; Uzan, Mustafa; Tanriverdi, Taner


    We sought to simply demonstrate how levels of soluble human epoxide hydrolase-2 show changes in both temporal the cortex and hippocampal complex in patients with temporal lobe epilepsy. A total of 20 patients underwent anterior temporal lobe resection due to temporal lobe epilepsy. The control group comprised 15 people who died in traffic accidents or by falling from a height, and their autopsy findings were included. Adequately sized temporal cortex and hippocampal samples were removed from each patient during surgery, and the same anatomic structures were removed from the control subjects during the autopsy procedures. Each sample was stored at -80°C as rapidly as possible until the enzyme assay. The temporal cortex in the epilepsy patients had a significantly higher enzyme level than did the temporal cortex of the control group (P = 0.03). Correlation analysis showed that as the enzyme level increases in the temporal cortex, it also increases in the hippocampal complex (r 2  = 0.06, P = 0.00001). More important, enzyme tissue levels showed positive correlations with seizure frequency in both the temporal cortex and hippocampal complex in patients (r 2  = 0.7, P = 0.00001 and r 2  = 0.4, P = 0.003, respectively). The duration of epilepsy was also positively correlated with the hippocampal enzyme level (r 2  = 0.06, P = 0.00001). Soluble human epoxy hydrolase enzyme-2 is increased in both lateral and medial temporal tissues in temporal lobe epilepsy. Further studies should be conducted as inhibition of this enzyme has resulted in a significant decrease in or stopping of seizures and attenuated neuroinflammation in experimental epilepsy models in the current literature. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. EseE of Edwardsiella tarda Augments Secretion of Translocon Protein EseC and Expression of the escC-eseE Operon. (United States)

    Yi, Jia; Xiao, Shui Bing; Zeng, Zhi Xiong; Lu, Jin Fang; Liu, Lu Yi; Laghari, Zubair Ahmed; Nie, Pin; Yu, Hong Bing; Xie, Hai Xia


    Edwardsiella tarda is an important Gram-negative pathogen that employs a type III secretion system (T3SS) to deliver effectors into host cells to facilitate bacterial survival and replication. These effectors are translocated into host cells through a translocon complex composed of three secreted proteins, namely, EseB, EseC, and EseD. The secretion of EseB and EseD requires a chaperone protein called EscC, whereas the secretion of EseC requires the chaperone EscA. In this study, we identified a novel protein (EseE) that also regulates the secretion of EseC. An eseE deletion mutant secreted much less EseC into supernatants, accompanied by increased EseC levels within bacterial cells. We also demonstrated that EseE interacted directly with EseC in a pulldown assay. Interestingly, EseC, EseE, and EscA were able to form a ternary complex, as revealed by pulldown and gel filtration assays. Of particular importance, the deletion of eseE resulted in decreased levels of EseB and EseD proteins in both the bacterial pellet and supernatant fraction. Furthermore, real-time PCR assays showed that EseE positively regulated the transcription of the translocon operon escC-eseE, comprising escC, eseB, escA, eseC, eseD, and eseE These effects of EseE on the translocon components/operon appeared to have a functional consequence, since the ΔeseE strain was outcompeted by wild-type E. tarda in a mixed infection in blue gourami fish. Collectively, our results demonstrate that EseE not only functions as a chaperone for EseC but also acts as a positive regulator controlling the expression of the translocon operon escC-eseE, thus contributing to the pathogenesis of E. tarda in fish. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. A competitive enzyme linked immunosorbent assay for the ...

    African Journals Online (AJOL)

    A competitive enzyme linked immunosorbent assay for the determination of diminazene residues in animal tissues. ... After six washes with buffer, enzyme activity was determined by adding tetramethyl-benzidine and hydrogen peroxide as substrate. The assay detection limits for diminazene were 2.4 ng/g in muscle, 2.5 ...

  16. The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA. (United States)

    Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U


    Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

  17. Albumin stimulates the activity of the human UDP-glucuronosyltransferases 1A7, 1A8, 1A10, 2A1 and 2B15, but the effects are enzyme and substrate dependent. (United States)

    Manevski, Nenad; Troberg, Johanna; Svaluto-Moreolo, Paolo; Dziedzic, Klaudyna; Yli-Kauhaluoma, Jari; Finel, Moshe


    Human UDP-glucuronosyltransferases (UGTs) are important enzymes in metabolic elimination of endo- and xenobiotics. It was recently shown that addition of fatty acid free bovine serum albumin (BSA) significantly enhances in vitro activities of UGTs, a limiting factor in in vitro-in vivo extrapolation. Nevertheless, since only few human UGT enzymes were tested for this phenomenon, we have now performed detailed enzyme kinetic analysis on the BSA effects in six previously untested UGTs, using 2-4 suitable substrates for each enzyme. We also examined some of the previously tested UGTs, but using additional substrates and a lower BSA concentration, only 0.1%. The latter concentration allows the use of important but more lipophilic substrates, such as estradiol and 17-epiestradiol. In five newly tested UGTs, 1A7, 1A8, 1A10, 2A1, and 2B15, the addition of BSA enhanced, to a different degree, the in vitro activity by either decreasing reaction's K(m), increasing its V(max), or both. In contrast, the activities of UGT2B17, another previously untested enzyme, were almost unaffected. The results of the assays with the previously tested UGTs, 1A1, 1A6, 2B4, and 2B7, were similar to the published BSA only as far as the BSA effects on the reactions' K(m) are concerned. In the cases of V(max) values, however, our results differ significantly from the previously published ones, at least with some of the substrates. Hence, the magnitude of the BSA effects appears to be substrate dependent, especially with respect to V(max) increases. Additionally, the BSA effects may be UGT subfamily dependent since K(m) decreases were observed in members of subfamilies 1A, 2A and 2B, whereas large V(max) increases were only found in several UGT1A members. The results shed new light on the complexity of the BSA effects on the activity and enzyme kinetics of the human UGTs.

  18. Albumin stimulates the activity of the human UDP-glucuronosyltransferases 1A7, 1A8, 1A10, 2A1 and 2B15, but the effects are enzyme and substrate dependent.

    Directory of Open Access Journals (Sweden)

    Nenad Manevski

    Full Text Available Human UDP-glucuronosyltransferases (UGTs are important enzymes in metabolic elimination of endo- and xenobiotics. It was recently shown that addition of fatty acid free bovine serum albumin (BSA significantly enhances in vitro activities of UGTs, a limiting factor in in vitro-in vivo extrapolation. Nevertheless, since only few human UGT enzymes were tested for this phenomenon, we have now performed detailed enzyme kinetic analysis on the BSA effects in six previously untested UGTs, using 2-4 suitable substrates for each enzyme. We also examined some of the previously tested UGTs, but using additional substrates and a lower BSA concentration, only 0.1%. The latter concentration allows the use of important but more lipophilic substrates, such as estradiol and 17-epiestradiol. In five newly tested UGTs, 1A7, 1A8, 1A10, 2A1, and 2B15, the addition of BSA enhanced, to a different degree, the in vitro activity by either decreasing reaction's K(m, increasing its V(max, or both. In contrast, the activities of UGT2B17, another previously untested enzyme, were almost unaffected. The results of the assays with the previously tested UGTs, 1A1, 1A6, 2B4, and 2B7, were similar to the published BSA only as far as the BSA effects on the reactions' K(m are concerned. In the cases of V(max values, however, our results differ significantly from the previously published ones, at least with some of the substrates. Hence, the magnitude of the BSA effects appears to be substrate dependent, especially with respect to V(max increases. Additionally, the BSA effects may be UGT subfamily dependent since K(m decreases were observed in members of subfamilies 1A, 2A and 2B, whereas large V(max increases were only found in several UGT1A members. The results shed new light on the complexity of the BSA effects on the activity and enzyme kinetics of the human UGTs.

  19. Upscaling of enzyme enhanced CO2 capture

    DEFF Research Database (Denmark)

    Gladis, Arne Berthold

    Fossil fuels are the backbone of the energy generation in the coming decades for USA, China, India and Europe, hence high greenhouse gas emissions are expected in future. Carbon capture and storage technology (CCS) is the only technology that can mitigate greenhouse gas emissions from fossil fuel...... the mass transfer of CO2 with slow-capturing but energetically favorable solvents can open up a variety of new process options for this technology. The ubiquitous enzyme carbonic anhydrase (CA), which enhances the mass transfer of CO2 in the lungs by catalyzing the reversible hydration of CO2, is one very...... enhanced CO2 capture technology by identifying the potentials and limitations in lab and in pilot scale and benchmarking the process against proven technologies. The main goal was to derive a realistic process model for technical size absorbers with a wide range of validity incorporating a mechanistic...

  20. Photosynthesis in Flaveria brownii, a C(4)-Like Species: Leaf Anatomy, Characteristics of CO(2) Exchange, Compartmentation of Photosynthetic Enzymes, and Metabolism of CO(2). (United States)

    Cheng, S H; Moore, B D; Edwards, G E; Ku, M S


    Light microscopic examination of leaf cross-sections showed that Flaveria brownii A. M. Powell exhibits Kranz anatomy, in which distinct, chloroplast-containing bundle sheath cells are surrounded by two types of mesophyll cells. Smaller mesophyll cells containing many chloroplasts are arranged around the bundle sheath cells. Larger, spongy mesophyll cells, having fewer chloroplasts, are located between the smaller mesophyll cells and the epidermis. F. brownii has very low CO(2) compensation points at different O(2) levels, which is typical of C(4) plants, yet it does show about 4% inhibition of net photosynthesis by 21% O(2) at 30 degrees C. Protoplasts of the three photosynthetic leaf cell types were isolated according to relative differences in their buoyant densities. On a chlorophyll basis, the activities of phosphoenolpyruvate carboxylase and pyruvate, Pi dikinase (carboxylation phase of C(4) pathway) were highest in the larger mesophyll protoplasts, intermediate in the smaller mesophyll protoplasts, and lowest, but still present, in the bundle sheath protoplasts. In contrast, activities of ribulose 1,5-bisphosphate carboxylase, other C(3) cycle enzymes, and NADP-malic enzyme showed a reverse gradation, although there were significant activities of these enzymes in mesophyll cells. As indicated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the banding pattern of certain polypeptides of the total soluble proteins from the three cell types also supported the distribution pattern obtained by activity assays of these enzymes. Analysis of initial (14)C products in whole leaves and extrapolation of pulse-labeling curves to zero time indicated that about 80% of the CO(2) is fixed into C(4) acids (malate and aspartate), whereas about 20% of the CO(2) directly enters the C(3) cycle. This is consistent with the high activity of enzymes for CO(2) fixation by the C(4) pathway and the substantial activity of enzymes of the C(3) cycle in the mesophyll cells

  1. A NodD-like protein activates transcription of genes involved with naringenin degradation in a flavonoid-dependent manner in Herbaspirillum seropedicae. (United States)

    Wassem, R; Marin, A M; Daddaoua, A; Monteiro, R A; Chubatsu, L S; Ramos, J L; Deakin, W J; Broughton, W J; Pedrosa, F O; Souza, E M


    Herbaspirillum seropedicae is an associative, endophytic non-nodulating diazotrophic bacterium that colonises several grasses. An ORF encoding a LysR-type transcriptional regulator, very similar to NodD proteins of rhizobia, was identified in its genome. This nodD-like gene, named fdeR, is divergently transcribed from an operon encoding enzymes involved in flavonoid degradation (fde operon). Apigenin, chrysin, luteolin and naringenin strongly induce transcription of the fde operon, but not that of the fdeR, in an FdeR-dependent manner. The intergenic region between fdeR and fdeA contains several generic LysR consensus sequences (T-N 11 -A) and we propose a binding site for FdeR, which is conserved in other bacteria. DNase I foot-printing revealed that the interaction with the FdeR binding site is modified by the four flavonoids that stimulate transcription of the fde operon. Moreover, FdeR binds naringenin and chrysin as shown by isothermal titration calorimetry. Interestingly, FdeR also binds in vitro to the nod-box from the nodABC operon of Rhizobium sp. NGR234 and is able to activate its transcription in vivo. These results show that FdeR exhibits two features of rhizobial NodD proteins: nod-box recognition and flavonoid-dependent transcription activation, but its role in H. seropedicae and related organisms seems to have evolved to control flavonoid metabolism. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  2. Role of an Essential Acyl Coenzyme A Carboxylase in the Primary and Secondary Metabolism of Streptomyces coelicolor A3(2) (United States)

    Rodríguez, E.; Banchio, C.; Diacovich, L.; Bibb, M. J.; Gramajo, H.


    Two genes, accB and accE, that form part of the same operon, were cloned from Streptomyces coelicolor A3(2). AccB is homologous to the carboxyl transferase domain of several propionyl coezyme A (CoA) carboxylases and acyl-CoA carboxylases (ACCases) of actinomycete origin, while AccE shows no significant homology to any known protein. Expression of accB and accE in Escherichia coli and subsequent in vitro reconstitution of enzyme activity in the presence of the biotinylated protein AccA1 or AccA2 confirmed that AccB was the carboxyl transferase subunit of an ACCase. The additional presence of AccE considerably enhanced the activity of the enzyme complex, suggesting that this small polypeptide is a functional component of the ACCase. The impossibility of obtaining an accB null mutant and the thiostrepton growth dependency of a tipAp accB conditional mutant confirmed that AccB is essential for S. coelicolor viability. Normal growth phenotype in the absence of the inducer was restored in the conditional mutant by the addition of exogenous long-chain fatty acids in the medium, indicating that the inducer-dependent phenotype was specifically related to a conditional block in fatty acid biosynthesis. Thus, AccB, together with AccA2, which is also an essential protein (E. Rodriguez and H. Gramajo, Microbiology 143:3109–3119, 1999), are the most likely components of an ACCase whose main physiological role is the synthesis of malonyl-CoA, the first committed step of fatty acid synthesis. Although normal growth of the conditional mutant was restored by fatty acids, the cultures did not produce actinorhodin or undecylprodigiosin, suggesting a direct participation of this enzyme complex in the supply of malonyl-CoA for the synthesis of these secondary metabolites. PMID:11526020

  3. XRN2 Autoregulation and Control of Polycistronic Gene Expresssion in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Takashi S Miki


    Full Text Available XRN2 is a conserved 5'→3' exoribonuclease that complexes with proteins that contain XRN2-binding domains (XTBDs. In Caenorhabditis elegans (C. elegans, the XTBD-protein PAXT-1 stabilizes XRN2 to retain its activity. XRN2 activity is also promoted by 3'(2',5'-bisphosphate nucleotidase 1 (BPNT1 through hydrolysis of an endogenous XRN inhibitor 3'-phosphoadenosine-5'-phosphate (PAP. Here, we find through unbiased screening that loss of bpnt-1 function suppresses lethality caused by paxt-1 deletion. This unexpected finding is explained by XRN2 autoregulation, which occurs through repression of a cryptic promoter activity and destabilization of the xrn-2 transcript. De-repression appears to be triggered such that more robust XRN2 perturbation, by elimination of both PAXT-1 and BPNT1, is less detrimental to worm viability than absence of PAXT-1 alone. Indeed, we find that two distinct XRN2 repression mechanisms are alleviated at different thresholds of XRN2 inactivation. Like more than 15% of C. elegans genes, xrn-2 occurs in an operon, and we identify additional operons under its control, consistent with a broader function of XRN2 in polycistronic gene regulation. Regulation occurs through intercistronic regions that link genes in an operon, but a part of the mechanisms may allow XRN2 to operate on monocistronic genes in organisms lacking operons.

  4. Production of 2-deoxyribose 5-phosphate from fructose to demonstrate a potential of artificial bio-synthetic pathway using thermophilic enzymes. (United States)

    Honda, Kohsuke; Maya, Shohei; Omasa, Takeshi; Hirota, Ryuichi; Kuroda, Akio; Ohtake, Hisao


    Six thermophilic enzymes from Thermus thermophilus were used to construct an 'artificial bio-synthetic pathway' for the production of 2-deoxyribose 5-phosphate from fructose. By a simple operation using six recombinant Escherichia coli strains producing the thermophilic enzymes, respectively, fructose was converted to 2-deoxyribose 5-phosphate with a molar yield of 55%. Copyright 2010 Elsevier B.V. All rights reserved.

  5. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions. (United States)

    Burbank, Lindsey P; Van Horn, Christopher R


    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

  6. Participation of the arcRACME protein in self-activation of the arc operon located in the arginine catabolism mobile element in pandemic clone USA300. (United States)

    Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier


    Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.

  7. Enzymic resolution of 2-substituted cyclohexanols through lipase-mediated esterification

    Czech Academy of Sciences Publication Activity Database

    Wimmer, Zdeněk; Skouridou, V.; Zarevúcka, Marie; Šaman, David; Kolisis, F. N.


    Roč. 15, - (2004), s. 3911-3917 ISSN 0957-4166 R&D Projects: GA MŠk ME 692 Institutional research plan: CEZ:AV0Z4055905 Keywords : enzymic resolution * 2-substituted cyclohexanols * lipase -mediated esterification Subject RIV: CC - Organic Chemistry Impact factor: 2.386, year: 2004

  8. Exploring Lactobacillus reuteri DSM20016 as a biocatalyst for transformation of longer chain 1,2-diols: Limits with microcompartment. (United States)

    Chen, Lu; Hatti-Kaul, Rajni


    Lactobacillus reuteri metabolises glycerol efficiently to form 3-hydroxypropionic acid (3-HP) and 1,3-propanediol (1,3PDO) by the same mechanism as that for 1,2-propanediol (1,2PDO) conversion to propionic acid and propanol via its propanediol utilization (pdu) pathway. Pdu enzymes are encoded by the pdu-operon, which also contain genes encoding the shell proteins of the microcompartment housing the metabolic pathway. In this work the selectivity and kinetics of the reactions catalysed by L. reuteri DSM20016 Pdu enzymes glycerol dehydratase (GDH), 1,3-propanediol oxidoreductase (PduQ) and coenzyme-A acylating propionaldehyde dehydrogenase (PduP), produced recombinantly, was investigated against corresponding substrates of different chain lengths. Glycerol dehydratase exhibited activity against C2-C4 polyols, with the highest activity against glycerol and 1,2-propanediol (1,2-PDO). A double mutant of the pduC gene of GDH (PduC-S302A/Q337A) was constructed that displayed lowered activity against glycerol and 1,2PDO but extended the substrate range upto C6-diol. The best substrate for both PduQ and PduP was 3-hydroxypropanal (3HPA), although PduP exhibited nearly 10-fold higher specific activity. The enzymes also showed some activity against C3-C10 aliphatic aldehydes, with PduP having higher relative activity. Subsequently, transformation of polyols using whole cells of L. reuteri containing the wild type- and mutated GDH, respectively, confirmed the reduced activity of the mutant against glycerol and 1,2PDO, but its activity against longer substrates was negligible. In contrast, recombinant Escherichia coli BL21(DE3) cells harboring the GDH variant converted diols with up to C6 carbon chain length to their respective aldehydes, suggesting that the protein shell of the microcompartment in L. reuteri posed a barrier to the passage of longer chain substrate.

  9. Purification and Characterization of Alkaline-Thermostable Protease Enzyme from Pitaya (Hylocereus polyrhizus Waste: A Potential Low Cost of the Enzyme

    Directory of Open Access Journals (Sweden)

    Mehrnoush Amid


    Full Text Available The thermoalkaline protease enzyme from pitaya (Hylocereus polyrhizus waste was purified by a factor of 221.2 with 71.3% recovery using ammonium sulphate precipitation, gel filtration, and cation exchange chromatography. Gel filtration chromatography together with sodium dodecyl sulphate gel electrophoresis (SDS-PAGE revealed that the enzyme is monomeric with a molecular weight of 26.7 kDa. The apparent Km and Vmax of the protease were 2.8 mg/mL and 31.20 u/min, respectively. The optimum pH and temperature were 8.0 and 70°C. The enzyme was highly active and stable over a wide pH range (from pH 3.0 to pH 11.0 with the optimum activity at pH 8.0. The protease has broad specificity toward azocasein, casein, hemoglobin, and gelatine. Activity of the enzyme was inhibited by Fe2+ and Zn2+, while protease activity was increased in the presence of Ca2+ and Mg2+ and Cu2+ by factors of 125%, 110%, and 105%, respectively. The alkaline protease showed extreme stability toward surfactants and oxidizing agent. The purified protease exhibited extreme stability in the presence of organic solvents and inhibitors. In addition, the enzyme was relativity stable toward organic solvents and chelating agents, such as ethylenediaminetetraacetic acid (EDTA. The enzyme, derived from pitaya peel, possesses unique characteristics and could be used in various industrial and biotechnological applications.

  10. Structure of the phosphotransferase domain of the bifunctional aminoglycoside-resistance enzyme AAC(6')-Ie-APH(2'')-Ia. (United States)

    Smith, Clyde A; Toth, Marta; Bhattacharya, Monolekha; Frase, Hilary; Vakulenko, Sergei B


    The bifunctional acetyltransferase(6')-Ie-phosphotransferase(2'')-Ia [AAC(6')-Ie-APH(2'')-Ia] is the most important aminoglycoside-resistance enzyme in Gram-positive bacteria, conferring resistance to almost all known aminoglycoside antibiotics in clinical use. Owing to its importance, this enzyme has been the focus of intensive research since its isolation in the mid-1980s but, despite much effort, structural details of AAC(6')-Ie-APH(2'')-Ia have remained elusive. The structure of the Mg2GDP complex of the APH(2'')-Ia domain of the bifunctional enzyme has now been determined at 2.3 Å resolution. The structure of APH(2'')-Ia is reminiscent of the structures of other aminoglycoside phosphotransferases, having a two-domain architecture with the nucleotide-binding site located at the junction of the two domains. Unlike the previously characterized APH(2'')-IIa and APH(2'')-IVa enzymes, which are capable of utilizing both ATP and GTP as the phosphate donors, APH(2'')-Ia uses GTP exclusively in the phosphorylation of the aminoglycoside antibiotics, and in this regard closely resembles the GTP-dependent APH(2'')-IIIa enzyme. In APH(2'')-Ia this GTP selectivity is governed by the presence of a `gatekeeper' residue, Tyr100, the side chain of which projects into the active site and effectively blocks access to the adenine-binding template. Mutation of this tyrosine residue to a less bulky phenylalanine provides better access for ATP to the NTP-binding template and converts APH(2'')-Ia into a dual-specificity enzyme.

  11. The davDT operon of Pseudomonas putida, involved in lysine catabolism, is induced in response to the pathway intermediate delta-aminovaleric acid

    DEFF Research Database (Denmark)

    Revelles, O.; Espinosa-Urgel, M.; Molin, Søren


    -aminovaleric acid and then further degraded to glutaric acid via the action of the davDT gene products. We show that the davDT genes form an operon transcribed from a single sigma(70)-dependent promoter. The relatively high level of basal expression from the davD promoter increased about fourfold in response...

  12. Human cytochrome-P450 enzymes metabolize N-(2-methoxyphenyl)hydroxylamine, a metabolite of the carcinogens o-anisidine and o-nitroanisole, thereby dictating its genotoxicity. (United States)

    Naiman, Karel; Martínková, Markéta; Schmeiser, Heinz H; Frei, Eva; Stiborová, Marie


    N-(2-Methoxyphenyl)hydroxylamine is a component in the human metabolism of two industrial and environmental pollutants and bladder carcinogens, viz. 2-methoxyaniline (o-anisidine) and 2-methoxynitrobenzene (o-nitroanisole), and it is responsible for their genotoxicity. Besides its capability to form three deoxyguanosine adducts in DNA, N-(2-methoxyphenyl)-hydroxylamine is also further metabolized by hepatic microsomal enzymes. To investigate its metabolism by human hepatic microsomes and to identify the major microsomal enzymes involved in this process are the aims of this study. N-(2-Methoxyphenyl)hydroxylamine is metabolized by human hepatic microsomes predominantly to o-anisidine, one of the parent carcinogens from which N-(2-methoxyphenyl)hydroxylamine is formed, while o-aminophenol and two N-(2-methoxyphenyl)hydroxylamine metabolites, whose exact structures have not been identified as yet, are minor products. Selective inhibitors of microsomal CYPs, NADPH:CYP reductase and NADH:cytochrome-b(5) reductase were used to characterize human liver microsomal enzymes reducing N-(2-methoxyphenyl)hydroxylamine to o-anisidine. Based on these studies, we attribute the main activity for this metabolic step in human liver to CYP3A4, 2E1 and 2C (more than 90%). The enzymes CYP2D6 and 2A6 also partake in this N-(2-methoxyphenyl)hydroxylamine metabolism in human liver, but only to ∼6%. Among the human recombinant CYP enzymes tested in this study, human CYP2E1, followed by CYP3A4, 1A2, 2B6 and 2D6, were the most efficient enzymes metabolizing N-(2-methoxyphenyl)hydroxylamine to o-anisidine. The results found in this study indicate that genotoxicity of N-(2-methoxyphenyl)hydroxylamine is dictated by its spontaneous decomposition to nitrenium/carbenium ions generating DNA adducts, and by its susceptibility to metabolism by CYP enzymes. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Functions, Evolution, and Application of the Supramolecular Machines of Hg Detoxification

    Energy Technology Data Exchange (ETDEWEB)

    Miller, Susan M.


    The bacterial mercury resistance (mer) operon functions in Hg biogeochemistry and bioremediation by converting reactive inorganic [Hg(II)] and organic [RHg(I)] mercurials to relatively inert monoatomic mercury vapor, Hg(0). Its genes regulate expression (MerR, MerD, MerOP), import Hg(II) (MerT, MerP, and MerC), and demethylate (MerB) and reduce (MerA) mercurials. We focus on how these components interact with each other and with the host cell to allow cells to survive and detoxify Hg compounds. Understanding how this ubiquitous detoxification system fits into the biology and ecology of its bacterial host is essential to guide interventions that support and enhance Hg remediation. At a more basic level, studies of interactions between the metal ion trafficking proteins in this pathway provide insights into general mechanisms used by proteins in pathways involved in trafficking of other metal ions in cells of all types of organisms, including pathways for essential metal ions such as Cu and Zn and other toxic metal ions such as Cd. In this project we focused on investigations of proteins from mer operons found in gamma-proteobacteria with specific objectives to use biophysical and biochemical approaches to detect and define (1) interactions between the structural components of the key detoxifying mer operon enzyme, mercuric ion reductase (MerA), (2) interactions between the components of MerA and the other mer operon enzyme, organomercurial lyase (MerB), and (3) to investigate the structure and interactions of integral membrane transport proteins, MerT and MerC, with MerA.

  14. Biochemical and Structural Characterization of WlbA from Bordetella pertussis and Chromobacterium violaceum: Enzymes Required for the Biosynthesis of 2,3-Diacetamido-2,3-dideoxy-d-mannuronic Acid

    Energy Technology Data Exchange (ETDEWEB)

    Thoden, James B.; Holden, Hazel M. (UW)


    The unusual sugar 2,3-diacetamido-2,3-dideoxy-d-mannuronic acid, or ManNAc3NAcA, has been observed in the lipopolysaccharides of both pathogenic and nonpathogenic Gram-negative bacteria. It is added to the lipopolysaccharides of these organisms by glycosyltransferases that use as substrates UDP-ManNAc3NAcA. Five enzymes are ultimately required for the biosynthesis of UDP-ManNAc3NAcA starting from UDP-N-acetylglucosamine. The second enzyme in the pathway, encoded by the wlba gene and referred to as WlbA, catalyzes the NAD-dependent oxidation of the C-3' hydroxyl group of the UDP-linked sugar. Here we describe a combined structural and functional investigation of the WlbA enzymes from Bordetella pertussis and Chromobacterium violaceum. For this investigation, ternary structures were determined in the presence of NAD(H) and substrate to 2.13 and 1.5 {angstrom} resolution, respectively. Both of the enzymes display octameric quaternary structures with their active sites positioned far apart. The octamers can be envisioned as tetramers of dimers. Kinetic studies demonstrate that the reaction mechanisms for these enzymes are sequential and that they do not require {alpha}-ketoglutarate for activity. These results are in sharp contrast to those recently reported for the WlbA enzymes from Pseudomonas aeruginosa and Thermus thermophilus, which function via ping-pong mechanisms that involve {alpha}-ketoglutarate. Taken together, the results reported here demonstrate that there are two distinct families of WlbA enzymes, which differ with respect to amino acid sequences, quaternary structures, active site architectures, and kinetic mechanisms.

  15. Production, purification and characterization of fibrinolytic enzyme from Serratia sp. KG-2-1 using optimized media. (United States)

    Taneja, Kapila; Bajaj, Bijender Kumar; Kumar, Sandeep; Dilbaghi, Neeraj


    Intravascular thrombosis is one of the major causes of variety of cardiovascular disorders leading to high mortality worldwide. Fibrinolytic enzymes from microbial sources possess ability to dissolve these clots and help to circumvent these problems in more efficient and safer way. In the present study, fibrinolytic protease with higher fibrinolytic activity than plasmin was obtained from Serratia sp. KG-2-1 isolated from garbage dump soil. Response surface methodology was used to study the interactive effect of concentration of maltose, yeast extract + peptone (1:1), incubation time, and pH on enzyme production and biomass. Maximum enzyme production was achieved at 33 °C after 24 h at neutral pH in media containing 1.5% Maltose, 4.0% yeast extract + peptone and other trace elements resulting in 1.82 folds increased production. The enzyme was purified from crude extract using ammonium sulfate precipitation and DEAE-Sephadex chromatography resulting in 12.9 fold purification with 14.9% yield. The purified enzyme belongs to metalloprotease class and had optimal activity in conditions similar to physiological environment with temperature optima of 40 °C and pH optima of 8. The enzyme was found to be stable in various solvents and its activity was enhanced in presence of Na + , K + , Ba 2+ , Cu 2+ , Mn 2+ , Hg 2+ but inhibited by Ca 2+ and Fe 3+ . Hence, the obtained enzyme may be used as potential therapeutic agent in combating various thrombolytic disorders.

  16. Alkaline thermostable pectinase enzyme from Aspergillus niger strain MCAS2 isolated from Manaslu Conservation Area, Gorkha, Nepal. (United States)

    Khatri, Bhim Prakash; Bhattarai, Tribikram; Shrestha, Sangita; Maharjan, Jyoti


    Pectinase enzymes are one of the commercially important enzymes having great potential in various industries especially in food industry. Pectinases accounts for 25 % of global food enzymes produced and their market is increasing day by day. Therefore, the exploration of microorganism with novel characteristics has always been the focus of the research. Microorganism dwelling in unique habitat may possess unique characteristics. As such, a pectinase producing fungus Aspergillus niger strain MCAS2 was isolated from soil of Manaslu Conservation Area (MCA), Gorkha, Nepal. The optimum production of pectinase enzyme was observed at 48 h of fermentation. The pectinase enzyme was partially purified by cold acetone treatment followed by Sephadex G-75 gel filtration chromatography. The partially purified enzyme exhibited maximum activity 60 U/mg which was almost 8.5-fold higher than the crude pectinase. The approximate molecular weight of the enzyme was found to be 66 kDa as observed from SDS-PAGE. The pectinase enzyme was active at broad range of temperature (30-70 °C) and pH (6.2-9.2). Optimum temperature and pH of the pectinase enzyme were 50 °C and 8.2 respectively. The enzyme was stable up to 70 °C and about 82 % of pectinase activity was still observed at 100 °C. The thermostable and alkaline nature of this pectinase can meet the demand of various industrial processes like paper and pulp industry, in textile industry, fruit juice industry, plant tissue maceration and wastewater treatment. In addition, the effect of different metal ions on pectinase activity was also studied.

  17. H2A-DUBbing the mammalian epigenome: expanding frontiers for histone H2A deubiquitinating enzymes in cell biology and physiology. (United States)

    Belle, Jad I; Nijnik, Anastasia


    Posttranslational modifications of histone H2A through the attachment of ubiquitin or poly-ubiquitin conjugates are common in mammalian genomes and play an important role in the regulation of chromatin structure, gene expression, and DNA repair. Histone H2A deubiquitinases (H2A-DUBs) are a group of structurally diverse enzymes that catalyze the removal ubiquitin from histone H2A. In this review we provide a concise summary of the mechanisms that mediate histone H2A ubiquitination in mammalian cells, and review our current knowledge of mammalian H2A-DUBs, their biochemical activities, and recent developments in our understanding of their functions in mammalian physiology. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Characterization of oil-palm trunk residue degradation enzymes derived from the isolated fungus, Penicillium rolfsii c3-2(1) IBRL. (United States)

    Lee, Kok Chang; Arai, Takamitsu; Ibrahim, Darah; Deng, Lan; Murata, Yoshinori; Mori, Yutaka; Kosugi, Akihiko


    This study characterizes crude enzymes derived from Penicillium rolfsii c3-2(1) IBRL, a mesophilic fungus isolated from the local soil of Malaysia. Prior to enzyme activity evaluation, P. rolfsii c3-2(1) IBRL was inoculated into a broth medium containing oil-palm trunk residues for the preparation of crude enzymes. Oil-palm trunk residues were optimally hydrolysed at pH5.0 and 50°C. P. rolfsii c3-2(1) IBRL-derived crude enzymes displayed higher thermal stability compared with the commercial enzymes, Celluclast 1.5 L and Acellerase 1500. Moreover, the hydrolysing activities of the P. rolfsii c3-2(1) IBRL-derived crude enzymes (xylan, arabinan, and laminarin) were superior compared to that of Celluclast 1.5 L and Acellerase 1500, and exhibit 2- to 3-fold and 3- to 4-fold higher oil-palm trunk residues-hydrolysing specific activity, respectively. This higher hydrolysis efficiency may be attributed to the weak 'lignin-binding' ability of the P. rolfsii c3-2(1) IBRL-derived enzymes compared to the commercial enzymes.

  19. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens. (United States)

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J


    The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and

  20. Effect of irradiation on immobilized enzymes compared with that on enzymes in solution

    International Nuclear Information System (INIS)

    Schachinger, L.; Schippel, C.; Altmann, E.; Diepold, B.; Yang, C.; Jaenike, M.; Hochhaeuser, E.


    Glucose oxidase and catalase were immobilized by attaching them to nylon fibers that had been treated with triethyloxonium-tetrafluoroborate, diaminohexane and glutaraldialdehyde according to Morris, Campell and Hornby (1975). This method assures that the enzymes are bound to a side chain of the polyamide structure. Enzyme activity (as measured by the O 2 -uptake and by microcalorimetry) was found to be unchanged after 2 years. The apparent Ksub(m)-constants of the immobilized enzymes with glucose were the same as those for enzymes in solution. GOD and catalase immobilized in poly(acrylamide) gel had the same Ksub(m)-value. Despite the high stability during storage, the radiation induced inactivation of enzymes immobilized on gel or chromosorb, an inorganic carrier, was of the same order of magnitude as that of the dissolved enzymes. The enzymes bound to nylon fibers showed a higher radiation sensitivity. This might have been caused by an additional attack on the binding site of the carrier. (orig.)

  1. Studies on non-steroidal inhibitors of aromatase enzyme; 4-(aryl/heteroaryl)-2-(pyrimidin-2-yl)thiazole derivatives. (United States)

    Sahin, Zafer; Ertas, Merve; Berk, Barkın; Biltekin, Sevde Nur; Yurttas, Leyla; Demirayak, Seref


    Steroidal and non-steroidal aromatase inhibitors target the suppression of estrogen biosynthesis in the treatment of breast cancer. Researchers have increasingly focused on developing non-steroidal derivatives for their potential clinical use avoiding steroidal side-effects. Non-steroidal derivatives generally have planar aromatic structures attached to the azole ring system. One part of this ring system comprises functional groups that inhibit aromatization through the coordination of the haem group of the aromatase enzyme. Replacement of the triazole ring system and development of aromatic/cyclic structures of the side chain can increase selectivity over aromatase enzyme inhibition. In this study, 4-(aryl/heteroaryl)-2-(pyrimidin-2-yl)thiazole derivatives were synthesized and physical analyses and structural determination studies were performed. The IC 50 values were determined by a fluorescence-based aromatase inhibition assay and compound 1 (4-(2-hydroxyphenyl)-2-(pyrimidine-2-yl)thiazole) were found potent inhibitor of enzyme (IC 50 :0.42 nM). Then, their antiproliferative activity over MCF-7 and HEK-293 cell lines was evaluated using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Compounds 1, 7, 8, 13, 15, 18, 21 were active against MCF-7 breast cancer cells. Lastly, a series of docking experiments were undertaken to analyze the crystal structure of human placental aromatase and identify the possible interactions between the most active structure and the active site. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Exploiting rRNA operon copy number to investigate bacterial reproductive strategies. (United States)

    Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M


    The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .

  3. An Amperometric Biosensor for the Determination of Bacterial Sepsis Biomarker, Secretory Phospholipase Group 2-IIA Using a Tri-Enzyme System

    Directory of Open Access Journals (Sweden)

    Nik Nurhanan Nik Mansor


    Full Text Available A tri-enzyme system consisting of choline kinase/choline oxidase/horseradish peroxidase was used in the rapid and specific determination of the biomarker for bacterial sepsis infection, secretory phospholipase Group 2-IIA (sPLA2-IIA. These enzymes were individually immobilized onto the acrylic microspheres via succinimide groups for the preparation of an electrochemical biosensor. The reaction of sPLA2-IIA with its substrate initiated a cascading enzymatic reaction in the tri-enzyme system that led to the final production of hydrogen peroxide, which presence was indicated by the redox characteristics of potassium ferricyanide, K3Fe(CN6. An amperometric biosensor based on enzyme conjugated acrylic microspheres and gold nanoparticles composite coated onto a carbon-paste screen printed electrode (SPE was fabricated and the current measurement was performed at a low potential of 0.20 V. This enzymatic biosensor gave a linear range 0.01–100 ng/mL (R2 = 0.98304 with a detection limit recorded at 5 × 10−3 ng/mL towards sPLA2-IIA. Moreover, the biosensor showed good reproducibility (relative standard deviation (RSD of 3.04% (n = 5. The biosensor response was reliable up to 25 days of storage at 4 °C. Analysis of human serum samples for sPLA2-IIA indicated that the biosensor has potential for rapid bacterial sepsis diagnosis in hospital emergency department.

  4. Integration Host Factor (IHF binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121

    Directory of Open Access Journals (Sweden)

    Álvarez-Morales Ariel


    Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.

  5. Metagenomics as a Tool for Enzyme Discovery: Hydrolytic Enzymes from Marine-Related Metagenomes. (United States)

    Popovic, Ana; Tchigvintsev, Anatoly; Tran, Hai; Chernikova, Tatyana N; Golyshina, Olga V; Yakimov, Michail M; Golyshin, Peter N; Yakunin, Alexander F


    This chapter discusses metagenomics and its application for enzyme discovery, with a focus on hydrolytic enzymes from marine metagenomic libraries. With less than one percent of culturable microorganisms in the environment, metagenomics, or the collective study of community genetics, has opened up a rich pool of uncharacterized metabolic pathways, enzymes, and adaptations. This great untapped pool of genes provides the particularly exciting potential to mine for new biochemical activities or novel enzymes with activities tailored to peculiar sets of environmental conditions. Metagenomes also represent a huge reservoir of novel enzymes for applications in biocatalysis, biofuels, and bioremediation. Here we present the results of enzyme discovery for four enzyme activities, of particular industrial or environmental interest, including esterase/lipase, glycosyl hydrolase, protease and dehalogenase.

  6. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage. (United States)

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar


    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Phage lytic enzymes: a history. (United States)

    Trudil, David


    There are many recent studies regarding the efficacy of bacteriophage-related lytic enzymes: the enzymes of 'bacteria-eaters' or viruses that infect bacteria. By degrading the cell wall of the targeted bacteria, these lytic enzymes have been shown to efficiently lyse Gram-positive bacteria without affecting normal flora and non-related bacteria. Recent studies have suggested approaches for lysing Gram-negative bacteria as well (Briersa Y, et al., 2014). These enzymes include: phage-lysozyme, endolysin, lysozyme, lysin, phage lysin, phage lytic enzymes, phageassociated enzymes, enzybiotics, muralysin, muramidase, virolysin and designations such as Ply, PAE and others. Bacteriophages are viruses that kill bacteria, do not contribute to antimicrobial resistance, are easy to develop, inexpensive to manufacture and safe for humans, animals and the environment. The current focus on lytic enzymes has been on their use as anti-infectives in humans and more recently in agricultural research models. The initial translational application of lytic enzymes, however, was not associated with treating or preventing a specific disease but rather as an extraction method to be incorporated in a rapid bacterial detection assay (Bernstein D, 1997).The current review traces the translational history of phage lytic enzymes-from their initial discovery in 1986 for the rapid detection of group A streptococcus in clinical specimens to evolving applications in the detection and prevention of disease in humans and in agriculture.

  8. Characterization of the biotin uptake system encoded by the biotin-inducible bioYMN operon of Corynebacterium glutamicum (United States)


    Background The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. Results By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. Conclusions The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation. PMID:22243621

  9. Characterization of the biotin uptake system encoded by the biotin-inducible bioYMN operon of Corynebacterium glutamicum. (United States)

    Schneider, Jens; Peters-Wendisch, Petra; Stansen, K Corinna; Götker, Susanne; Maximow, Stanislav; Krämer, Reinhard; Wendisch, Volker F


    The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation.

  10. Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA (United States)

    Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.


    DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576

  11. Thermostabilization of desulfurization enzymes from Rhodococcos sp. IGTS8. Final technical report

    Energy Technology Data Exchange (ETDEWEB)

    John J. Kilbane II


    The objective of this project was to develop thermophilic cultures capable of expressing the desulfurization (dsz) operon of Rhodococcus sp. IGTS8. The approaches taken in this project included the development of plasmid and integrative expression vectors that function well in Thermus thermophilus, the cloning of Rhodococcus dsz genes in Thermus expression vectors, and the isolation of bacterial cultures that express the dsz operon at thermophilic temperatures. This project has resulted in the development of plasmid and integrative expression vectors for use in T. thermophilus. The dsz genes have been expressed at moderately thermophilic temperatures (52 C) in Mycobacterium phlei and at temperatures as high as 72 C in T. thermophilus. The tools and methods developed in this project will be generally useful for the expression of heterologous genes in Thermus. Key developments in the project have been the isolation of a Mycobacterium phlei culture capable of expressing the desulfurization operon at 52 C, development of plasmid and integrative expression vectors for Thermus thermophilus, and the development of a host-vector system based on the malate dehydrogenase gene that allows plasmids to be stably maintained in T. thermophilus and provides a convenient reporter gene for the accurate quantification of gene expression. Publications have been prepared regarding each of these topics; these preprints are included.

  12. In Vitro Optimization of Enzymes Involved in Precorrin-2 Synthesis Using Response Surface Methodology. (United States)

    Fang, Huan; Dong, Huina; Cai, Tao; Zheng, Ping; Li, Haixing; Zhang, Dawei; Sun, Jibin


    In order to maximize the production of biologically-derived chemicals, kinetic analyses are first necessary for predicting the role of enzyme components and coordinating enzymes in the same reaction system. Precorrin-2 is a key precursor of cobalamin and siroheme synthesis. In this study, we sought to optimize the concentrations of several molecules involved in precorrin-2 synthesis in vitro: porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UROS), and S-adenosyl-l-methionine-dependent urogen III methyltransferase (SUMT). Response surface methodology was applied to develop a kinetic model designed to maximize precorrin-2 productivity. The optimal molar ratios of PBGS, PBGD, UROS, and SUMT were found to be approximately 1:7:7:34, respectively. Maximum precorrin-2 production was achieved at 0.1966 ± 0.0028 μM/min, agreeing with the kinetic model's predicted value of 0.1950 μM/min. The optimal concentrations of the cofactor S-adenosyl-L-methionine (SAM) and substrate 5-aminolevulinic acid (ALA) were also determined to be 200 μM and 5 mM, respectively, in a tandem-enzyme assay. By optimizing the relative concentrations of these enzymes, we were able to minimize the effects of substrate inhibition and feedback inhibition by S-adenosylhomocysteine on SUMT and thereby increase the production of precorrin-2 by approximately five-fold. These results demonstrate the effectiveness of kinetic modeling via response surface methodology for maximizing the production of biologically-derived chemicals.

  13. Uch2/Uch37 is the major deubiquitinating enzyme associated with the 26S proteasome in fission yeast

    DEFF Research Database (Denmark)

    Stone, Miranda; Hartmann-Petersen, Rasmus; Seeger, Michael


    . Some deubiquitinating enzymes are associated with the 26S proteasome contributing to and regulating the particle's activity. Here, we characterise fission yeast Uch2 and Ubp6, two proteasome associated deubiquitinating enzymes. The human orthologues of these enzymes are known as Uch37 and Usp14......, respectively. We report that the subunit Uch2/Uch37 is the major deubiquitinating enzyme associated with the fission yeast 26S proteasome. In contrast, the activity of Ubp6 appears to play a more regulatory and/or structural role involving the proteasome subunits Mts1/Rpn9, Mts2/Rpt2 and Mts3/Rpn12, as Ubp6...... becomes essential when activity of these subunits is compromised by conditional mutations. Finally, when the genes encoding Uch2/Uch37 and Ubp6 are disrupted, the cells are viable without showing obvious signs of impaired ubiquitin-dependent proteolysis, indicating that other deubiquitinating enzymes may...

  14. Insight on specificity of uracil permeases of the NAT/NCS2 family from analysis of the transporter encoded in the pyrimidine utilization operon of Escherichia coli. (United States)

    Botou, Maria; Lazou, Panayiota; Papakostas, Konstantinos; Lambrinidis, George; Evangelidis, Thomas; Mikros, Emmanuel; Frillingos, Stathis


    The uracil permease UraA of Escherichia coli is a structurally known prototype for the ubiquitous Nucleobase-Ascorbate Transporter (NAT) or Nucleobase-Cation Symporter-2 (NCS2) family and represents a well-defined subgroup of bacterial homologs that remain functionally unstudied. Here, we analyze four of these homologs, including RutG of E. coli which shares 35% identity with UraA and is encoded in the catabolic rut (pyrimidine utilization) operon. Using amplified expression in E. coli K-12, we show that RutG is a high-affinity permease for uracil, thymine and, at low efficiency, xanthine and recognizes also 5-fluorouracil and oxypurinol. In contrast, UraA and the homologs from Acinetobacter calcoaceticus and Aeromonas veronii are permeases specific for uracil and 5-fluorouracil. Molecular docking indicates that thymine is hindered from binding to UraA by a highly conserved Phe residue which is absent in RutG. Site-directed replacement of this Phe with Ala in the three uracil-specific homologs allows high-affinity recognition and/or transport of thymine, emulating the RutG profile. Furthermore, all RutG orthologs from enterobacteria retain an Ala at this position, implying that they can use both uracil and thymine and, possibly, xanthine as substrates and provide the bacterial cell with a range of catabolizable nucleobases. © 2018 John Wiley & Sons Ltd.

  15. Analysis of gene order data supports vertical inheritance of the leukotoxin operon and genome rearrangements in the 5' flanking region in genus Mannheimia

    DEFF Research Database (Denmark)

    Larsen, Jesper; Kuhnert, Peter; Frey, Joachim


    subclades, thus reaffirming the hypothesis of vertical inheritance of the leukotoxin operon. The presence of individual 5' flanking regions in M. haemolytica + M. glucosida and M. granulomatis reflects later genome rearrangements within each subclade. The evolution of the novel 5' flanking region in M...

  16. In vitro modulatory effects of Terminalia arjuna, arjunic acid, arjunetin and arjungenin on CYP3A4, CYP2D6 and CYP2C9 enzyme activity in human liver microsomes

    Directory of Open Access Journals (Sweden)

    Alice Varghese


    Full Text Available Terminalia arjuna is a tree having an extensive medicinal potential in cardiovascular disorders. Triterpenoids are mainly responsible for cardiovascular properties. Alcoholic and aqueous bark extracts of T. arjuna, arjunic acid, arjunetin and arjungenin were evaluated for their potential to inhibit CYP3A4, CYP2D6 and CYP2C9 enzymes in human liver microsomes. We have demonstrated that alcoholic and aqueous bark extract of T. arjuna showed potent inhibition of all three enzymes in human liver microsomes with IC50 values less than 50 μg/mL. Arjunic acid, arjunetin and arjungenin did not show significant inhibition of CYP enzymes in human liver microsomes. Enzyme kinetics studies suggested that the extracts of arjuna showed reversible non-competitive inhibition of all the three enzymes in human liver microsomes. Our findings suggest strongly that arjuna extracts significantly inhibit the activity of CYP3A4, CYP2D6 and CYP2C9 enzymes, which is likely to cause clinically significant drug–drug interactions mediated via inhibition of the major CYP isozymes.

  17. Nonencapsulated or nontypeable Haemophilus influenzae are more likely than their encapsulated or serotypeable counterparts to have mutations in their fucose operon. (United States)

    Shuel, Michelle L; Karlowsky, Kathleen E; Law, Dennis K S; Tsang, Raymond S W


    Population biology of Haemophilus influenzae can be studied by multilocus sequence typing (MLST), and isolates are assigned sequence types (STs) based on nucleotide sequence variations in seven housekeeping genes, including fucK. However, the ST cannot be assigned if one of the housekeeping genes is absent or cannot be detected by the current protocol. Occasionally, strains of H. influenzae have been reported to lack the fucK gene. In this study, we examined the prevalence of this mutation among our collection of H. influenzae isolates. Of the 704 isolates studied, including 282 encapsulated and 422 nonencapsulated isolates, nine were not typeable by MLST owing to failure to detect the fucK gene. All nine fucK-negative isolates were nonencapsulated and belonged to various biotypes. DNA sequencing of the fucose operon region confirmed complete deletion of genes in the operon in seven of the nine isolates, while in the remaining two isolates, some of the genes were found intact or in parts. The significance of these findings is discussed.

  18. Associated liver enzymes with hyperlipidemic profile in type 2 diabetes patients. (United States)

    Al-Jameil, Noura; Khan, Farah A; Arjumand, Sadia; Khan, Mohammad F; Tabassum, Hajera


    Type 2 diabetes mellitus (T2DM) is characterized by hyperglycemia and is associated with dyslipidemia and disturbed liver function. Aim of the present work is to assess the liver enzymes and to find its association with hyperlipidemic profile in T2DM. Total of 157 subjects were studied and divided into two groups; diabetes (n=81) and non-diabetes (n=76). Various biochemical parameters like fasting glucose, post prandial glucose, HbA1c, total cholesterol (TC), triglycerides (Tg), high density lipoprotein cholesterol (HDL-C), alanine amino transferase (ALT), aspartate amino transferase (AST) and gamma-glutamyl transferase (GGT) were analyzed by ROCHE module Cobas 6000 (C501 & C601) analyzer, kits were procured by ROCHE diagnostics. Low density lipoprotein cholesterol (LDL-C) was estimated by Freidwald's formula. Statistical analysis was performed by applying student t test and Pearson's correlation coefficient, at 0.0001 and 0.05 level of significance, respectively. All the glycemic control parameters, lipid profile parameters except HDL-C and liver enzymes were found increased in diabetes group and significantly differ from non-diabetes group (p>0.0001). ALT showed significant positive correlation with fasting glucose, post prandial glucose, HbA1c, TC, Tg, LDL-C and GGT at p>0.05. AST showed very weak relation with all parameters while GGT was positively associated with fasting glucose, post prandial glucose, HbA1c, TC, Tg, LDL-C and ALT at p>0.05. In conclusion, T2DM incline to elevate liver enzymes, especially ALT and GGT were of significance. Routine screening of ALT and GGT in T2DM patients may assists early detection of liver abnormalities and to arrest the progress of disease.

  19. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna


    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...

  20. Arabidopsis thaliana Contains Both Ni2+ and Zn2+ Dependent Glyoxalase I Enzymes and Ectopic Expression of the Latter Contributes More towards Abiotic Stress Tolerance in E. coli.

    Directory of Open Access Journals (Sweden)

    Muskan Jain

    Full Text Available The glyoxalase pathway is ubiquitously found in all the organisms ranging from prokaryotes to eukaryotes. It acts as a major pathway for detoxification of methylglyoxal (MG, which deleteriously affects the biological system in stress conditions. The first important enzyme of this system is Glyoxalase I (GLYI. It is a metalloenzyme which requires divalent metal ions for its activity. This divalent metal ion can be either Zn2+ as found in most of eukaryotes or Ni2+ as seen in prokaryotes. In the present study, we have found three active GLYI enzymes (AtGLYI2, AtGLYI3 and AtGLYI6 belonging to different metal activation classes coexisting in Arabidopsis thaliana. These enzymes have been found to efficiently complement the GLYI yeast mutants. These three enzymes have been characterized in terms of their activity, metal dependency, kinetic parameters and their role in conferring tolerance to multiple abiotic stresses in E. coli and yeast. AtGLYI2 was found to be Zn2+ dependent whereas AtGLYI3 and AtGLYI6 were Ni2+ dependent. Enzyme activity of Zn2+ dependent enzyme, AtGLYI2, was observed to be exceptionally high (~250-670 fold as compared to Ni2+ dependent enzymes, AtGLYI3 and AtGLYI6. The activity of these GLYI enzymes correlated well to their role in stress tolerance. Heterologous expression of these enzymes in E. coli led to better tolerance against various stress conditions. This is the first report of a higher eukaryotic species having multiple active GLYI enzymes belonging to different metal activation classes.

  1. A Model Study on the Possible Effects of an External Electrical Field on Enzymes Having Dinuclear Iron Cluster [2Fe-2S

    Directory of Open Access Journals (Sweden)

    Lemi Türker


    Full Text Available Hydrogenases which catalyze the H22H+ + 2e− reaction are metalloenzymes that can be divided into two classes, the NiFe and Fe enzymes, on the basis of their metal content. Iron-sulfur clusters [2Fe-2S] and [4Fe-4S] are common in ironhydrogenases. In the present model study, [2Fe-2S] cluster has been considered to visualize the effect of external electric field on various quantum chemical properties of it. In the model, all the cysteinyl residues are in the amide form. The PM3 type semiempirical calculations have been performed for the geometry optimization of the model structure in the absence and presence of the external field. Then, single point DFT calculations (B3LYP/6-31+G(d have been carried out. Depending on the direction of the field, the chemical reactivity of the model enzyme varies which suggests that an external electric field could, under proper conditions, improve the enzymatic hydrogen production.

  2. Development of a commercial enzymes system for lignocellulosic biomass saccharification

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Manoj


    DSM Innovation Inc., in its four year effort was able to evaluate and develop its in-house DSM fungal cellulolytic enzymes system to reach enzyme efficiency mandates set by DoE Biomass program MYPP goals. DSM enzyme cocktail is uniquely active at high temperature and acidic pH, offering many benefits and product differentiation in 2G bioethanol production. Under this project, strain and process development, ratio optimization of enzymes, protein and genetic engineering has led to multitudes of improvement in productivity and efficiency making development of a commercial enzyme system for lignocellulosic biomass saccharification viable. DSM is continuing further improvement by additional biodiversity screening, protein engineering and overexpression of enzymes to continue to further lower the cost of enzymes for saccharification of biomass.

  3. Angiotensin-Converting Enzymes Play a Dominant Role in Fertility

    Directory of Open Access Journals (Sweden)

    Fan Jin


    Full Text Available According to the World Health Organization, infertility, associated with metabolic syndrome, has become a global issue with a 10%–20% incidence worldwide. An accumulating body of evidence has shown that the renin–angiotensin system is involved in the fertility problems observed in some populations. Moreover, alterations in the expression of angiotensin-converting enzyme-1, angiotensin-converting enzyme-2, and angiotensin-converting enzyme-3 might be one of the most important mechanisms underlying both female and male infertility. However, as a pseudogene in humans, further studies are needed to explore whether the abnormal angiotensin-converting enzyme-3 gene could result in the problems of human reproduction. In this review, the relationship between angiotensin-converting enzymes and fertile ability is summarized, and a new procedure for the treatment of infertility is discussed.

  4. HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria. (United States)

    Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong


    Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358

    International Nuclear Information System (INIS)

    Griffin, H.G.; Foster, T.J.; Silver, S.; Misra, T.K.


    The broad-spectrum mercurial-resistance plasmid pDU1358 was analyzed by cloning the resistance determinants and preparing a physical and genetic map of a 45-kilobase (kb) region of the plasmid that contains two separate mercurial-resistance operons that mapped about 20 kb apart. One encoded narrow-spectrum mercurial resistance to Hg 2+ and a few organomercurials; the other specified broad-spectrum resistance to phenylmercury and additional organomercurials. Each determinant governed mercurial transport functions. Southern DNA x DNA hybridization experiments using gene-specific probes from the plasmid R100 mer operon indicated close homology with the R100 deteminant. The 2153 base pairs of the promoter-distal part of the broad-spectrum Hg 2+ -resistance operon of pDU1358 were sequenced. This region included the 3'-terminal part of the merA gene, merD, unidentified reading frame URF1, and a part of URF2 homologous to previously sequenced determinants of plasmid R100. Between the merA and merD genes, an open reading frame encoding a 212 amino acid polypeptide was identified as the merB gene that determines the enzyme organomercurial lyase that cleaves the C-Hg bond of phenylmercury

  6. Direct Electron Transfer of Enzymes in a Biologically Assembled Conductive Nanomesh Enzyme Platform. (United States)

    Lee, Seung-Woo; Lee, Ki-Young; Song, Yong-Won; Choi, Won Kook; Chang, Joonyeon; Yi, Hyunjung


    Nondestructive assembly of a nanostructured enzyme platform is developed in combination of the specific biomolecular attraction and electrostatic coupling for highly efficient direct electron transfer (DET) of enzymes with unprecedented applicability and versatility. The biologically assembled conductive nanomesh enzyme platform enables DET-based flexible integrated biosensors and DET of eight different enzyme with various catalytic activities. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Effects of long-term elevated CO2 on N2-fixing, denitrifying and nitrifying enzyme activities in forest soils under Pinus sylvestriformis in Changbai Mountain

    Institute of Scientific and Technical Information of China (English)

    ZHENG Jun-Qiang; HAN Shi-Jie; REN Fei-Rong; ZHOU Yu-Mei; ZHANG Yan


    A study was conducted to determine the effects of elevated CO2 on soil N process at Changbai Mountain in Jilin Province,northeastern China (42o24'N,128o06'E,and 738 m elevation).A randomized complete block design of ambient and elevated CO2 was established in an open-top chamber facility in the spring of 1999.Changpai Scotch pine (Pinus sylvestris var.sylvestriformis seeds were sowed in May,1999 and CO2 fumigation treatments began after seeds germination.In each year,the exposure started at the end of April and stopped at the end of October.Soil samples were collected in June and August 2006 and in June 2007,and soil nitrifying,denitrifying and N2-fixing enzyme activities were measured.Results show that soil nitrifying enzyme activities (NEA) in the 5-10 cm soil layer were significantly increased at elevated CO2 by 30.3% in June 2006,by 30.9% in August 2006 and by 11.3% in June 2007.Soil denitrifying enzyme activities (DEA) were significantly decreased by elevated CO2 treatment in June 2006 (P < 0.012) and August 2006 (P < 0.005) samplings in our study; no significant difference was detected in June 2007,and no significant changes in N2-fixing enzyme activity were found.This study suggests that elevated CO2 can alter soil nitrifying enzyme and denitrifying enzyme activities.

  8. Radiolabelling of glycosylated MFE-23::CPG2 fusion protein (MFECP1) with 99mTc for quantitation of tumour antibody-enzyme localisation in antibody-directed enzyme pro-drug therapy (ADEPT). (United States)

    Francis, R J; Mather, S J; Chester, K; Sharma, S K; Bhatia, J; Pedley, R B; Waibel, R; Green, A J; Begent, R H J


    MFECP1 is a glycosylated recombinant fusion protein composed of MFE-23, a high-affinity anti-carcinoembryonic antigen (CEA) single chain Fv (scFv), fused to the enzyme carboxypeptidase G2 (CPG2), and has been constructed for use in antibody-directed enzyme pro-drug therapy (ADEPT). Radiolabelling of glycosylated MFECP1 with technetium-99m was developed for the purpose of determining tumour localisation of MFECP1 in a phase I ADEPT clinical study. The method used was 99mTc-carbonyl [99mTc(H2O)3(CO)3]+ (abbreviated to TcCO) mediated labelling of 99mTc to the hexahistidine (His) tag of MFECP1. MFECP1 fusion protein was labelled with TcCO under a variety of conditions, and this was shown to be a relatively simple and robust method. Tissue biodistribution was assessed in a CEA-expressing LS174T (human colon carcinoma) nude mouse xenograft model. Tissues were taken at 1, 4 and 6 h for assessment of distribution of radioactivity and for measurement of CPG2 enzyme levels. The amount of radioactivity retained by the tumour proved to be an accurate estimation of actual measured enzyme activity, indicating that this radiolabelling method does not appear to damage the antibody-antigen binding or the enzyme activity of MFECP1. However, correlation between CPG2 enzyme activity and measured radioactivity in liver, spleen and kidney was poor, indicating retention of radioactivity in non-tumour sites but loss of enzyme activity. The high retention of technetium radioisotope in normal tissues may limit the clinical applicability of this radiolabelling method for MFECP1; however, these results suggest that this technique does have applicability for measuring the biodistribution of His-tagged recombinant proteins.

  9. Radiolabelling of glycosylated MFE-23::CPG2 fusion protein (MFECP1) with 99mTc for quantitation of tumour antibody-enzyme localisation in antibody-directed enzyme pro-drug therapy (ADEPT)

    International Nuclear Information System (INIS)

    Francis, R.J.; Chester, K.; Sharma, S.K.; Bhatia, J.; Pedley, R.B.; Green, A.J.; Begent, R.H.J.; Mather, S.J.; Waibel, R.


    MFECP1 is a glycosylated recombinant fusion protein composed of MFE-23, a high-affinity anti-carcinoembryonic antigen (CEA) single chain Fv (scFv), fused to the enzyme carboxypeptidase G2 (CPG2), and has been constructed for use in antibody-directed enzyme pro-drug therapy (ADEPT). Radiolabelling of glycosylated MFECP1 with technetium-99m was developed for the purpose of determining tumour localisation of MFECP1 in a phase I ADEPT clinical study. The method used was 99m Tc-carbonyl [ 99m Tc(H 2 O) 3 (CO) 3 ] + (abbreviated to TcCO) mediated labelling of 99m Tc to the hexahistidine (His) tag of MFECP1. MFECP1 fusion protein was labelled with TcCO under a variety of conditions, and this was shown to be a relatively simple and robust method. Tissue biodistribution was assessed in a CEA-expressing LS174T (human colon carcinoma) nude mouse xenograft model. Tissues were taken at 1, 4 and 6 h for assessment of distribution of radioactivity and for measurement of CPG2 enzyme levels. The amount of radioactivity retained by the tumour proved to be an accurate estimation of actual measured enzyme activity, indicating that this radiolabelling method does not appear to damage the antibody-antigen binding or the enzyme activity of MFECP1. However, correlation between CPG2 enzyme activity and measured radioactivity in liver, spleen and kidney was poor, indicating retention of radioactivity in non-tumour sites but loss of enzyme activity. The high retention of technetium radioisotope in normal tissues may limit the clinical applicability of this radiolabelling method for MFECP1; however, these results suggest that this technique does have applicability for measuring the biodistribution of His-tagged recombinant proteins. (orig.)

  10. Highly efficient enzyme encapsulation in a protein nanocage: towards enzyme catalysis in a cellular nanocompartment mimic (United States)

    Schoonen, Lise; Nolte, Roeland J. M.; van Hest, Jan C. M.


    The study of enzyme behavior in small nanocompartments is crucial for the understanding of biocatalytic processes in the cellular environment. We have developed an enzymatic conjugation strategy to attach a model enzyme to the interior of a cowpea chlorotic mottle virus capsid. It is shown that with this methodology high encapsulation efficiencies can be achieved. Additionally, we demonstrate that the encapsulation does not affect the enzyme performance in terms of a decreased activity or a hampered substrate diffusion. Finally, it is shown that the encapsulated enzymes are protected against proteases. We believe that our strategy can be used to study enzyme kinetics in an environment that approaches physiological conditions.The study of enzyme behavior in small nanocompartments is crucial for the understanding of biocatalytic processes in the cellular environment. We have developed an enzymatic conjugation strategy to attach a model enzyme to the interior of a cowpea chlorotic mottle virus capsid. It is shown that with this methodology high encapsulation efficiencies can be achieved. Additionally, we demonstrate that the encapsulation does not affect the enzyme performance in terms of a decreased activity or a hampered substrate diffusion. Finally, it is shown that the encapsulated enzymes are protected against proteases. We believe that our strategy can be used to study enzyme kinetics in an environment that approaches physiological conditions. Electronic supplementary information (ESI) available: Experimental procedures for the cloning, expression, and purification of all proteins, as well as supplementary figures and calculations. See DOI: 10.1039/c6nr04181g

  11. Cellular Ubc2/Rad6 E2 ubiquitin-conjugating enzyme facilitates tombusvirus replication in yeast and plants

    International Nuclear Information System (INIS)

    Imura, Yoshiyuki; Molho, Melissa; Chuang, Chingkai; Nagy, Peter D.


    Mono- and multi-ubiquitination alters the functions and subcellular localization of many cellular and viral proteins. Viruses can co-opt or actively manipulate the ubiquitin network to support viral processes or suppress innate immunity. Using yeast (Saccharomyces cerevisiae) model host, we show that the yeast Rad6p (radiation sensitive 6) E2 ubiquitin-conjugating enzyme and its plant ortholog, AtUbc2, interact with two tombusviral replication proteins and these E2 ubiquitin-conjugating enzymes could be co-purified with the tombusvirus replicase. We demonstrate that TBSV RNA replication and the mono- and bi-ubiquitination level of p33 is decreased in rad6Δ yeast. However, plasmid-based expression of AtUbc2p could complement both defects in rad6Δ yeast. Knockdown of UBC2 expression in plants also decreases tombusvirus accumulation and reduces symptom severity, suggesting that Ubc2p is critical for virus replication in plants. We provide evidence that Rad6p is involved in promoting the subversion of Vps23p and Vps4p ESCRT proteins for viral replicase complex assembly. - Highlights: • Tombusvirus p33 replication protein interacts with cellular RAD6/Ubc2 E2 enzymes. • Deletion of RAD6 reduces tombusvirus replication in yeast. • Silencing of UBC2 in plants inhibits tombusvirus replication. • Mono- and bi-ubiquitination of p33 replication protein in yeast and in vitro. • Rad6p promotes the recruitment of cellular ESCRT proteins into the tombusvirus replicase

  12. Cellular Ubc2/Rad6 E2 ubiquitin-conjugating enzyme facilitates tombusvirus replication in yeast and plants

    Energy Technology Data Exchange (ETDEWEB)

    Imura, Yoshiyuki, E-mail:; Molho, Melissa; Chuang, Chingkai; Nagy, Peter D., E-mail:


    Mono- and multi-ubiquitination alters the functions and subcellular localization of many cellular and viral proteins. Viruses can co-opt or actively manipulate the ubiquitin network to support viral processes or suppress innate immunity. Using yeast (Saccharomyces cerevisiae) model host, we show that the yeast Rad6p (radiation sensitive 6) E2 ubiquitin-conjugating enzyme and its plant ortholog, AtUbc2, interact with two tombusviral replication proteins and these E2 ubiquitin-conjugating enzymes could be co-purified with the tombusvirus replicase. We demonstrate that TBSV RNA replication and the mono- and bi-ubiquitination level of p33 is decreased in rad6Δ yeast. However, plasmid-based expression of AtUbc2p could complement both defects in rad6Δ yeast. Knockdown of UBC2 expression in plants also decreases tombusvirus accumulation and reduces symptom severity, suggesting that Ubc2p is critical for virus replication in plants. We provide evidence that Rad6p is involved in promoting the subversion of Vps23p and Vps4p ESCRT proteins for viral replicase complex assembly. - Highlights: • Tombusvirus p33 replication protein interacts with cellular RAD6/Ubc2 E2 enzymes. • Deletion of RAD6 reduces tombusvirus replication in yeast. • Silencing of UBC2 in plants inhibits tombusvirus replication. • Mono- and bi-ubiquitination of p33 replication protein in yeast and in vitro. • Rad6p promotes the recruitment of cellular ESCRT proteins into the tombusvirus replicase.

  13. Stabilization of enzymes in ionic liquids via modification of enzyme charge. (United States)

    Nordwald, Erik M; Kaar, Joel L


    Due to the propensity of ionic liquids (ILs) to inactivate enzymes, the development of strategies to improve enzyme utility in these solvents is critical to fully exploit ILs for biocatalysis. We have developed a strategy to broadly improve enzyme utility in ILs based on elucidating the effect of charge modifications on the function of enzymes in IL environments. Results of stability studies in aqueous-IL mixtures indicated a clear connection between the ratio of enzyme-containing positive-to-negative sites and enzyme stability in ILs. Stability studies of the effect of [BMIM][Cl] and [EMIM][EtSO4 ] on chymotrypsin specifically found an optimum ratio of positively-charged amine-to-negatively-charged acid groups (0.39). At this ratio, the half-life of chymotrypsin was increased 1.6- and 4.3-fold relative to wild-type chymotrypsin in [BMIM][Cl] and [EMIM][EtSO4 ], respectively. The half-lives of lipase and papain were similarly increased as much as 4.0 and 2.4-fold, respectively, in [BMIM][Cl] by modifying the ratio of positive-to-negative sites of each enzyme. More generally, the results of stability studies found that modifications that reduce the ratio of enzyme-containing positive-to-negative sites improve enzyme stability in ILs. Understanding the impact of charge modification on enzyme stability in ILs may ultimately be exploited to rationally engineer enzymes for improved function in IL environments. Copyright © 2013 Wiley Periodicals, Inc.

  14. Monooxygenase, a novel beta-cypermethrin degrading enzyme from Streptomyces sp.

    Directory of Open Access Journals (Sweden)

    Shaohua Chen

    Full Text Available The widely used insecticide beta-cypermethrin has become a public concern because of its environmental contamination and toxic effects on mammals. In this study, a novel beta-cypermethrin degrading enzyme designated as CMO was purified to apparent homogeneity from a Streptomyces sp. isolate capable of utilizing beta-cypermethrin as a growth substrate. The native enzyme showed a monomeric structure with a molecular mass of 41 kDa and pI of 5.4. The enzyme exhibited the maximal activity at pH 7.5 and 30°C. It was fairly stable in the pH range from 6.5-8.5 and at temperatures below 10°C. The enzyme activity was significantly stimulated by Fe(2+, but strongly inhibited by Ag(+, Al(3+, and Cu(2+. The enzyme catalyzed the degradation of beta-cypermethrin to form five products via hydroxylation and diaryl cleavage. A novel beta-cypermethrin detoxification pathway was proposed based on analysis of these products. The purified enzyme was identified as a monooxygenase by matrix-assisted laser desorption/ionization time-of-flight/time-of-flight mass spectrometry analysis (MALDI-TOF-MS and N-terminal protein sequencing. Given that all the characterized pyrethroid-degrading enzymes are the members of hydrolase family, CMO represents the first pyrethroid-degrading monooxygenase identified from environmental microorganisms. Taken together, our findings depict a novel pyrethroid degradation mechanism and indicate that the purified enzyme may be a promising candidate for detoxification of beta-cypermethrin and environmental protection.

  15. Brucella abortus ure2 region contains an acid-activated urea transporter and a nickel transport system

    Directory of Open Access Journals (Sweden)

    García-Lobo Juan M


    Full Text Available Abstract Background Urease is a virulence factor that plays a role in the resistance of Brucella to low pH conditions, both in vivo and in vitro. Brucella contains two separate urease gene clusters, ure1 and ure2. Although only ure1 codes for an active urease, ure2 is also transcribed, but its contribution to Brucella biology is unknown. Results Re-examination of the ure2 locus showed that the operon includes five genes downstream of ureABCEFGDT that are orthologs to a nikKMLQO cluster encoding an ECF-type transport system for nickel. ureT and nikO mutants were constructed and analyzed for urease activity and acid resistance. A non-polar ureT mutant was unaffected in urease activity at neutral pH but showed a significantly decreased activity at acidic pH. It also showed a decreased survival rate to pH 2 at low concentration of urea when compared to the wild type. The nikO mutant had decreased urease activity and acid resistance at all urea concentrations tested, and this phenotype could be reverted by the addition of nickel to the growth medium. Conclusions Based on these results, we concluded that the operon ure2 codes for an acid-activated urea transporter and a nickel transporter necessary for the maximal activity of the urease whose structural subunits are encoded exclusively by the genes in the ure1 operon.

  16. Activation and thermostabilization effects of cyclic 2, 3-diphosphoglycerate on enzymes from the hyperthermophilic Methanopyrus kandleri. (United States)

    Shima, S; Hérault, D A; Berkessel, A; Thauer, R K


    Enzymes involved in methane formation from carbon dioxide and dihydrogen in Methanopyrus kandleri require high concentrations (> 1 M) of lyotropic salts such as K2HPO4/KH2PO4 or (NH4)2SO4 for activity and for thermostability. The requirement correlates with high intracellular concentrations of cyclic 2,3-diphosphoglycerate (cDPG; approximately 1 M) in this hyperthermophilic organism. We report here on the effects of potassium cDPG on the activity and thermostability of the two methanogenic enzymes cyclohydrolase and formyltransferase and show that at cDPG concentrations prevailing in the cells the investigated enzymes are highly active and completely thermostable. At molar concentrations also the potassium salts of phosphate and of 2,3-bisphosphoglycerate, the biosynthetic precursor of cDPG, were found to confer activity and thermostability to the enzymes. Thermodynamic arguments are discussed as to why cDPG, rather than these salts, is present in high concentrations in the cells of Mp. kandleri.

  17. Structural and Functional Models of Non-Heme Iron Enzymes : A Study of the 2-His-1-Carboxylate Facial Triad Structural Motif

    NARCIS (Netherlands)

    Bruijnincx, P.C.A.


    The structural and functional modeling of a specific group of non-heme iron enzymes by the synthesis of small synthetic analogues is the topic of this thesis. The group of non-heme iron enzymes with the 2-His-1-carboxylate facial triad has recently been established as a common platform for the

  18. Isolation of a tyrosine-activating enzyme from baker's yeast

    NARCIS (Netherlands)

    Ven, A.M. van de; Koningsberger, V.V.; Overbeek, J.Th.G.


    The extracts of ether-CO2-frozen baker's yeast contain enzymes that catalyze the ATP-linked amino acid activation by way of pyrophosphate elimination. From the extract a tyrosine-activating enzyme could be isolated, which, judging from ultracentrifugation and electrophoretic data, was about 70% pure

  19. Continuous enzyme reactions with immobilized enzyme tubes prepared by radiation cast-polymerization

    International Nuclear Information System (INIS)

    Kumakura, Minoru; Kaetsu, Isao


    Immobilized glucose oxidase tubes were prepared by radiation cast-polymerization of 2-hydroxyethyl methacrylate and tetraethyleneglycol diacrylate monomer at low temperatures. The immobilized enzyme tubes which were spirally set in a water bath were used as reactor, in which the enzyme activity varied with tube size and flow rate of the substrate. The conversion yield of the substrate in continuous enzyme reaction was about 80%. (author)

  20. Class IIa bacteriocin resistance in Enterococcus faecalis V583: The mannose PTS operon mediates global transcriptional responses

    Directory of Open Access Journals (Sweden)

    Opsata Mona


    Full Text Available Abstract Background The class IIa bacteriocin, pediocin PA-1, has clear potential as food preservative and in the medical field to be used against Gram negative pathogen species as Enterococcus faecalis and Listeria monocytogenes. Resistance towards class IIa bacteriocins appear in laboratory and characterization of these phenotypes is important for their application. To gain insight into bacteriocin resistance we studied mutants of E. faecalis V583 resistant to pediocin PA-1 by use of transcriptomic analyses. Results Mutants of E. faecalis V583 resistant to pediocin PA-1 were isolated, and their gene expression profiles were analyzed and compared to the wild type using whole-genome microarray. Significantly altered transcription was detected from about 200 genes; most of them encoding proteins involved in energy metabolism and transport. Glycolytic genes were down-regulated in the mutants, but most of the genes showing differential expression were up-regulated. The data indicate that the mutants were relieved from glucose repression and putative catabolic responsive elements (cre could be identified in the upstream regions of 70% of the differentially expressed genes. Bacteriocin resistance was caused by reduced expression of the mpt operon encoding the mannose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS, and the same transcriptional changes were seen in a mptD-inactivated mutant. This mutant also had decreased transcription of the whole mpt operon, showing that the PTS is involved in its own transcriptional regulation. Conclusion Our data confirm the important role of mannose PTS in class IIa bacteriocin sensitivity and we demonstrate its importance involving global carbon catabolite control.

  1. Enzymes as modular catalysts for redox half-reactions in H2-powered chemical synthesis: from biology to technology. (United States)

    Reeve, Holly A; Ash, Philip A; Park, HyunSeo; Huang, Ailun; Posidias, Michalis; Tomlinson, Chloe; Lenz, Oliver; Vincent, Kylie A


    The present study considers the ways in which redox enzyme modules are coupled in living cells for linking reductive and oxidative half-reactions, and then reviews examples in which this concept can be exploited technologically in applications of coupled enzyme pairs. We discuss many examples in which enzymes are interfaced with electronically conductive particles to build up heterogeneous catalytic systems in an approach which could be termed synthetic biochemistry We focus on reactions involving the H + /H 2 redox couple catalysed by NiFe hydrogenase moieties in conjunction with other biocatalysed reactions to assemble systems directed towards synthesis of specialised chemicals, chemical building blocks or bio-derived fuel molecules. We review our work in which this approach is applied in designing enzyme-modified particles for H 2 -driven recycling of the nicotinamide cofactor NADH to provide a clean cofactor source for applications of NADH-dependent enzymes in chemical synthesis, presenting a combination of published and new work on these systems. We also consider related photobiocatalytic approaches for light-driven production of chemicals or H 2 as a fuel. We emphasise the techniques available for understanding detailed catalytic properties of the enzymes responsible for individual redox half-reactions, and the importance of a fundamental understanding of the enzyme characteristics in enabling effective applications of redox biocatalysis. © 2017 The Author(s).

  2. Screening of Missense SNPs in Coding Regions of COX-2 as a Key Enzyme Involved in Cancer

    Directory of Open Access Journals (Sweden)

    Sodabeh Jahanbakhsh-Godehkahriz


    Full Text Available Background & Objectives: Non-synonymous single nucleotide polymorphism (nsSNPs which results in disruption of protein function are used as markers in linkage and association of human proteins that might be involved in diseases and cancers .   Methods: To study the functional effect of nsSNP in cyclooxygenase-2 (COX2 amino acids, the nucleotide sequences encoding COX-2 gene in cancers were extracted from the NCBI (gi|223941909 data bank (283 cases and analyzed by SIFT, I-Mutant 2.0, SNP and GO, PANTHER and FASTSNP servers. These servers involve programs that predict the effects of amino acid substitution on protein function, stability and missense .   Results: COX-2 is an essential enzyme for the production of pro-inflammatory prostaglandins which are relevant to cancer development and progression. The substitutions in some positions such as R228H and S428A of COX-2 in most of cancers linked to reformed protein function through disruption in enzyme active site.   Conclusion: Amino acid substitutions as a consequence of COX-2 nsSNPs have important role in human disease. Substitutions which are located in catalytic domain are important for the enzymatic function of COX-2 and associated with higher expression of COX-2.

  3. Respiratory arsenate reductase as a bidirectional enzyme (United States)

    Richey, C.; Chovanec, P.; Hoeft, S.E.; Oremland, R.S.; Basu, P.; Stolz, J.F.


    The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe–S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

  4. The enzymes of biotin dependent CO2 metabolism: What structures reveal about their reaction mechanisms (United States)

    Waldrop, Grover L; Holden, Hazel M; Maurice, Martin St


    Biotin is the major cofactor involved in carbon dioxide metabolism. Indeed, biotin-dependent enzymes are ubiquitous in nature and are involved in a myriad of metabolic processes including fatty acid synthesis and gluconeogenesis. The cofactor, itself, is composed of a ureido ring, a tetrahydrothiophene ring, and a valeric acid side chain. It is the ureido ring that functions as the CO2 carrier. A complete understanding of biotin-dependent enzymes is critically important for translational research in light of the fact that some of these enzymes serve as targets for anti-obesity agents, antibiotics, and herbicides. Prior to 1990, however, there was a dearth of information regarding the molecular architectures of biotin-dependent enzymes. In recent years there has been an explosion in the number of three-dimensional structures reported for these proteins. Here we review our current understanding of the structures and functions of biotin-dependent enzymes. In addition, we provide a critical analysis of what these structures have and have not revealed about biotin-dependent catalysis. PMID:22969052

  5. Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression (United States)

    Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet


    Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450

  6. Erythrocyte enzymes in groups of Rattus norvegicus with genetic differences in 2,3-diphosphoglycerate levels. (United States)

    Noble, N A; Tanaka, K R


    1. A major locus with two alleles is responsible for large differences in erythrocyte 2,3-diphosphoglycerate (DPG) levels in Rattus norvegicus. Blood from homozygous High-DPG, homozygous Low-DPG and heterozygous animals was used to measure blood indices and red cell enzyme activities. 2. Significant differences between groups were found in DPG levels, white blood cell counts and hemoglobin levels. 3. The results suggest that none of the red cell enzymes assayed is structurally or quantitatively different in the three groups.

  7. Isolation and characterization of mutant strains of Escherichia coli altered in H2 metabolism

    International Nuclear Information System (INIS)

    Lee, J.H.; Patel, P.; Sankar, P.; Shanmugam, K.T.


    A positive selection procedure is described for the isolation of hydrogenase-defective mutant strains of Escherichia coli. Mutant strains isolated by this procedure can be divided into two major classes. Class II mutants produced hydrogenase activity (determined by using a tritium-exchange assay) and formate hydrogenlyase activity but lacked the ability to reduce benzyl viologen or fumarate with H 2 as the electron donor. Class I mutants failed to produce active hydrogenase and hydrogenase-dependent activities. All the mutant strains produced detectable levels of formate dehydrogenase-1 and -2 and fumarate reductase. The mutation in class I mutants mapped near 65 min of the E. coli chromosome, whereas the mutation in class II mutants mapped between srl and cys operons (58 and 59 min, respectively) in the genome. The class II Hyd mutants can be further subdivided into two groups (hydA and hydB) based on the cotransduction characteristics with cys and srl. These results indicate that there are two hyd operons and one hup operon in the E. coli chromosome. The two hyd operons are needed for the production of active hydrogenase, and all three are essential for hydrogen-dependent growth of the cell

  8. 2-Hexadecynoic acid inhibits plasmodial FAS-II enzymes and arrests erythrocytic and liver stage Plasmodium infections. (United States)

    Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H; Brun, Reto; Carballeira, Néstor M


    Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of Plasmodium yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC(50) value 6.6 μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC(50) value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescence analysis (IC(50) 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory activity against the PfFAS-II enzymes PfFabI and PfFabZ with IC(50) values of 0.38 and 0.58 μg/ml (IC(50) control drugs 14 and 30 ng/ml), respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC(50) values 3.7-31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC(50) 20.2 μg/ml), and Leishmania donovani (IC(50) values 4.1-13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature, and calculated pharmacokinetic properties suggests that 2-HDA could be a useful compound to

  9. 2-Hexadecynoic Acid Inhibits Plasmodial FAS-II Enzymes and Arrest Erythrocytic and Liver Stage Plasmodium Infections (United States)

    Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L.; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H.; Brun, Reto; Carballeira, Néstor M.


    Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of P. yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC50 value 6.6. μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC50 value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescense analysis (IC50 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory against the PfFAS-II enzymes PfFabI and PfFabZ with IC50 values of 0.38 and 0.58 μg/ml (IC50 control drugs 14 and 30 ng/ml) respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC50 values 3.7–31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC50 20.2 μg/ml), and Leishmania donovani (IC50 values 4.1–13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature and calculated pharmacokinetic properties suggest that 2-HDA could be a useful compound to study the interaction of fatty

  10. Non-homologous isofunctional enzymes: a systematic analysis of alternative solutions in enzyme evolution. (United States)

    Omelchenko, Marina V; Galperin, Michael Y; Wolf, Yuri I; Koonin, Eugene V


    Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress. These results indicate that at least some of the non-homologous isofunctional enzymes were recruited relatively recently from enzyme families that are active against related substrates and are sufficiently flexible to accommodate changes in substrate specificity.

  11. A phylogenetic analysis of normal modes evolution in enzymes and its relationship to enzyme function. (United States)

    Lai, Jason; Jin, Jing; Kubelka, Jan; Liberles, David A


    Since the dynamic nature of protein structures is essential for enzymatic function, it is expected that functional evolution can be inferred from the changes in protein dynamics. However, dynamics can also diverge neutrally with sequence substitution between enzymes without changes of function. In this study, a phylogenetic approach is implemented to explore the relationship between enzyme dynamics and function through evolutionary history. Protein dynamics are described by normal mode analysis based on a simplified harmonic potential force field applied to the reduced C(α) representation of the protein structure while enzymatic function is described by Enzyme Commission numbers. Similarity of the binding pocket dynamics at each branch of the protein family's phylogeny was analyzed in two ways: (1) explicitly by quantifying the normal mode overlap calculated for the reconstructed ancestral proteins at each end and (2) implicitly using a diffusion model to obtain the reconstructed lineage-specific changes in the normal modes. Both explicit and implicit ancestral reconstruction identified generally faster rates of change in dynamics compared with the expected change from neutral evolution at the branches of potential functional divergences for the α-amylase, D-isomer-specific 2-hydroxyacid dehydrogenase, and copper-containing amine oxidase protein families. Normal mode analysis added additional information over just comparing the RMSD of static structures. However, the branch-specific changes were not statistically significant compared to background function-independent neutral rates of change of dynamic properties and blind application of the analysis would not enable prediction of changes in enzyme specificity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. [Characterization of a malic enzyme isoform V from Mucor circinelloides]. (United States)

    Zhang, Yingtong; Chen, Haiqin; Song, Yuanda; Zhang, Hao; Chen, Yongquan; Chen, Wei


    We aimed at characterizing a malic enzyme isoform V from Mucor circinelloides. me1 gene encoding malic enzyme isoform V was amplified and cloned into expression vector pET28a. High-purity recombinant protein BLME1 was obtained by affinity chromatography using. Ni-NTA column and characterized subsequently. The optimum conditions were pH at 8.0 and temperature at 33 degrees C. Under optimum conditions, BLME1 activity achieved 92.8 U/mg. The K(m) for L-malate and NADP+ were 0.74960 ± 0.06120 mmol/L and 0.22070 ± 0.01810 mmol/L, the V(max) for L-malate and NADP+ were 72.820 ± 1.077 U/mg and 86.110 ± 1.665 U/mg, respectively. In addition, ions played important roles in BLME1 activity; several ions such as Mn2+, Mg2+, Co2+, Ni2+ could activate BLME1, whereas Ca2+, Cu2+ could be used as inhibitors. Additionally, the metabolic intermediates such as oxaloacetic acid and α-ketoglutaric acid inhibited the activity of BLME1, whereas succinic acid activated it. A malic enzyme isoform V from Mucor circinelloides was characterized, providing the references for further studies on this enzyme.

  13. Interaction between chitosan and its related enzymes: A review. (United States)

    Shinya, Shoko; Fukamizo, Tamo


    Chitosan-related enzymes including chitosanases, exo-β-glucosaminidases, and enzymes having chitosan-binding modules recognize ligands through electrostatic interactions between the acidic amino acids in proteins and amino groups of chitosan polysaccharides. However, in GH8 chitosanases, several aromatic residues are also involved in substrate recognition through stacking interactions, and these enzymes consequently hydrolyze β-1,4-glucan as well as chitosan. The binding grooves of these chitosanases are extended and opened at both ends of the grooves, so that the enzymes can clamp a long chitosan polysaccharide. The association/dissociation of positively charged glucosamine residues to/from the binding pocket of a GH2 exo-β-glucosaminidase controls the p K a of the catalytic acid, thereby maintaining the high catalytic potency of the enzyme. In contrast to chitosanases, chitosan-binding modules only accommodate a couple of glucosamine residues, predominantly recognizing the non-reducing end glucosamine residue of chitosan by electrostatic interactions and a hydrogen-bonding network. These structural findings on chitosan-related enzymes may contribute to future applications for the efficient conversion of the chitin/chitosan biomass. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. The human gastric pathogen Helicobacter pylori has a potential acetone carboxylase that enhances its ability to colonize mice

    Directory of Open Access Journals (Sweden)

    Weinberg Michael V


    Full Text Available Abstract Background Helicobacter pylori colonizes the human stomach and is the etiological agent of peptic ulcer disease. All three H. pylori strains that have been sequenced to date contain a potential operon whose products share homology with the subunits of acetone carboxylase (encoded by acxABC from Xanthobacter autotrophicus strain Py2 and Rhodobacter capsulatus strain B10. Acetone carboxylase catalyzes the conversion of acetone to acetoacetate. Genes upstream of the putative acxABC operon encode enzymes that convert acetoacetate to acetoacetyl-CoA, which is metabolized further to generate two molecules of acetyl-CoA. Results To determine if the H. pylori acxABC operon has a role in host colonization the acxB homolog in the mouse-adapted H. pylori SS1 strain was inactivated with a chloramphenicol-resistance (cat cassette. In mouse colonization studies the numbers of H. pylori recovered from mice inoculated with the acxB:cat mutant were generally one to two orders of magnitude lower than those recovered from mice inoculated with the parental strain. A statistical analysis of the data using a Wilcoxin Rank test indicated the differences in the numbers of H. pylori isolated from mice inoculated with the two strains were significant at the 99% confidence level. Levels of acetone associated with gastric tissue removed from uninfected mice were measured and found to range from 10–110 μmols per gram wet weight tissue. Conclusion The colonization defect of the acxB:cat mutant suggests a role for the acxABC operon in survival of the bacterium in the stomach. Products of the H. pylori acxABC operon may function primarily in acetone utilization or may catalyze a related reaction that is important for survival or growth in the host. H. pylori encounters significant levels of acetone in the stomach which it could use as a potential electron donor for microaerobic respiration.

  15. Purification and Characterisation of a Fibrinolytic Enzyme from Rhizopus micro sporus var. tuberosus

    Directory of Open Access Journals (Sweden)

    Shuli Zhang


    Full Text Available Extracellular fibrinolytic enzyme from Rhizopus microsporus var. tuberosus was purified and characterised. The microorganism was isolated in a distillery from daqu, a fermentative agent used in the production of Chinese liquor and vinegar at diff erent temperatures. The fibrinolytic enzyme was partially purifi ed by ammonium sulphate precipitation, dialysis, DEAE Sepharose® Fast Flow ion exchange chromatography and Sephadex G-75 gel filtration chromatography. The molecular mass of the fi brinolytic enzyme was estimated to be 24.5 kDa by SDS-PAGE. The purified enzyme showed optimal activity at pH=7.0 and 37 °C by fibrin plate method. It showed stronger resistance to the inhibition by trypsin and was stable at 37 °C retaining 96.1 % residual activity aft er 4 h of incubation. The fibrinolytic activity of the enzyme was enhanced by Na+, Ca2+, Mg2+ and Mn2+. Conversely, Zn2+ and Cu2+ partly inhibited enzymatic activity. Using fibrin plate method, we found that the enzyme not only degrades fibrin directly, but also activates plasminogen into plasmin to degrade fibrin. The results indicate that the pure enzyme has a potential in dissolving blood clot, and the possibility for application in the treatment of thrombosis.

  16. Enzyme activity assay of glycoprotein enzymes based on a boronate affinity molecularly imprinted 96-well microplate. (United States)

    Bi, Xiaodong; Liu, Zhen


    Enzyme activity assay is an important method in clinical diagnostics. However, conventional enzyme activity assay suffers from apparent interference from the sample matrix. Herein, we present a new format of enzyme activity assay that can effectively eliminate the effects of the sample matrix. The key is a 96-well microplate modified with molecularly imprinted polymer (MIP) prepared according to a newly proposed method called boronate affinity-based oriented surface imprinting. Alkaline phosphatase (ALP), a glycoprotein enzyme that has been routinely used as an indicator for several diseases in clinical tests, was taken as a representative target enzyme. The prepared MIP exhibited strong affinity toward the template enzyme (with a dissociation constant of 10(-10) M) as well as superb tolerance for interference. Thus, the enzyme molecules in a complicated sample matrix could be specifically captured and cleaned up