WorldWideScience

Sample records for 8-oxoguanine dna glycosylase

  1. Functional characterization of 8-oxoguanine DNA glycosylase of Trypanosoma cruzi.

    Directory of Open Access Journals (Sweden)

    Carolina Furtado

    Full Text Available The oxidative lesion 8-oxoguanine (8-oxoG is removed during base excision repair by the 8-oxoguanine DNA glycosylase 1 (Ogg1. This lesion can erroneously pair with adenine, and the excision of this damaged base by Ogg1 enables the insertion of a guanine and prevents DNA mutation. In this report, we identified and characterized Ogg1 from the protozoan parasite Trypanosoma cruzi (TcOgg1, the causative agent of Chagas disease. Like most living organisms, T. cruzi is susceptible to oxidative stress, hence DNA repair is essential for its survival and improvement of infection. We verified that the TcOGG1 gene encodes an 8-oxoG DNA glycosylase by complementing an Ogg1-defective Saccharomyces cerevisiae strain. Heterologous expression of TcOGG1 reestablished the mutation frequency of the yeast mutant ogg1(-/- (CD138 to wild type levels. We also demonstrate that the overexpression of TcOGG1 increases T. cruzi sensitivity to hydrogen peroxide (H(2O(2. Analysis of DNA lesions using quantitative PCR suggests that the increased susceptibility to H(2O(2 of TcOGG1-overexpressor could be a consequence of uncoupled BER in abasic sites and/or strand breaks generated after TcOgg1 removes 8-oxoG, which are not rapidly repaired by the subsequent BER enzymes. This hypothesis is supported by the observation that TcOGG1-overexpressors have reduced levels of 8-oxoG both in the nucleus and in the parasite mitochondrion. The localization of TcOgg1 was examined in parasite transfected with a TcOgg1-GFP fusion, which confirmed that this enzyme is in both organelles. Taken together, our data indicate that T. cruzi has a functional Ogg1 ortholog that participates in nuclear and mitochondrial BER.

  2. The Role of 8-Oxoguanine DNA Glycosylase-1 in Inflammation

    Directory of Open Access Journals (Sweden)

    Xueqing Ba

    2014-09-01

    Full Text Available Many, if not all, environmental pollutants/chemicals and infectious agents increase intracellular levels of reactive oxygen species (ROS at the site of exposure. ROS not only function as intracellular signaling entities, but also induce damage to cellular molecules including DNA. Among the several dozen ROS-induced DNA base lesions generated in the genome, 8-oxo-7,8-dihydroguanine (8-oxoG is one of the most abundant because of guanine’s lowest redox potential among DNA bases. In mammalian cells, 8-oxoG is repaired by the 8-oxoguanine DNA glycosylase-1 (OGG1-initiated DNA base excision repair pathway (OGG1–BER. Accumulation of 8-oxoG in DNA has traditionally been associated with mutagenesis, as well as various human diseases and aging processes, while the free 8-oxoG base in body fluids is one of the best biomarkers of ongoing pathophysiological processes. In this review, we discuss the biological significance of the 8-oxoG base and particularly the role of OGG1–BER in the activation of small GTPases and changes in gene expression, including those that regulate pro-inflammatory chemokines/cytokines and cause inflammation.

  3. Synthetic Routes to N-9 Alkylated 8-Oxoguanines; Weak Inhibitors of the Human DNA Glycosylase OGG1

    Directory of Open Access Journals (Sweden)

    Tushar R. Mahajan

    2015-09-01

    Full Text Available The human 8-oxoguanine DNA glycosylase OGG1 is involved in base excision repair (BER, one of several DNA repair mechanisms that may counteract the effects of chemo- and radiation therapy for the treatment of cancer. We envisage that potent inhibitors of OGG1 may be found among the 9-alkyl-8-oxoguanines. Thus we explored synthetic routes to 8-oxoguanines and examined these as OGG1 inhibitors. The best reaction sequence started from 6-chloroguanine and involved N-9 alkylation, C-8 bromination, and finally simultaneous hydrolysis of both halides. Bromination before N-alkylation should only be considered when the N-substituent is not compatible with bromination conditions. The 8-oxoguanines were found to be weak inhibitors of OGG1. 6-Chloro-8-oxopurines, byproducts in the hydrolysis of 2,6-halopurines, turned out to be slightly better inhibitors than the corresponding 8-oxoguanines.

  4. Exercise improves import of 8-oxoguanine DNA glycosylase into the mitochondrial matrix of skeletal muscle and enhances the relative activity

    OpenAIRE

    Radak, Zsolt; Atalay, Mustafa; Jakus, Judit; Boldogh, István; Davies, Kelvin; Goto, Sataro

    2008-01-01

    Exercise has been shown to modify the level/activity of the DNA damage repair enzyme 8-oxoguanine-DNA glycosylase (OGG1) in skeletal muscle. We have studied the impact of regular physical training (8 weeks of swimming) and detraining (8 weeks of rest after an 8-week training session) on the activity of OGG1 in the nucleus and mitochondria as well as its targeting to the mitochondrial matrix in skeletal muscle. Neither exercise training nor detraining altered the overall levels of reactive spe...

  5. Triphlorethol-A from Ecklonia cava Up-Regulates the Oxidant Sensitive 8-Oxoguanine DNA Glycosylase 1

    Directory of Open Access Journals (Sweden)

    Ki Cheon Kim

    2014-10-01

    Full Text Available This study investigated the protective mechanisms of triphlorethol-A, isolated from Ecklonia cava, against oxidative stress-induced DNA base damage, especially 8-oxoguanine (8-oxoG, in Chinese hamster lung fibroblast V79-4 cells. 8-Oxoguanine DNA glycosylase-1 (OGG1 plays an important role in the removal of 8-oxoG during the cellular response to DNA base damage. Triphlorethol-A significantly decreased the levels of 8-oxoG induced by H2O2, and this correlated with increases in OGG1 mRNA and OGG1 protein levels. Furthermore, siOGG1-transfected cell attenuated the protective effect of triphlorethol-A against H2O2 treatment. Nuclear factor erythroid 2–related factor 2 (Nrf2 is a transcription factor for OGG1, and Nrf2 combines with small Maf proteins in the nucleus to bind to antioxidant response elements (ARE in the upstream promoter region of the OGG1 gene. Triphlorethol-A restored the expression of nuclear Nrf2, small Maf protein, and the Nrf2-Maf complex, all of which were reduced by oxidative stress. Furthermore, triphlorethol-A increased Nrf2 binding to ARE sequences and the resulting OGG1 promoter activity, both of which were also reduced by oxidative stress. The levels of the phosphorylated forms of Akt kinase, downstream of phosphatidylinositol 3-kinase (PI3K, and Erk, which are regulators of OGG1, were sharply decreased by oxidative stress, but these decreases were prevented by triphlorethol-A. Specific PI3K, Akt, and Erk inhibitors abolished the cytoprotective effects of triphlorethol-A, suggesting that OGG1 induction by triphlorethol-A involves the PI3K/Akt and Erk pathways. Taken together, these data indicate that by activating the DNA repair system, triphlorethol-A exerts protective effects against DNA base damage induced by oxidative stress.

  6. Cadmium exposure down-regulates 8-oxoguanine DNA glycosylase expression in rat lung and alveolar epithelial cells

    International Nuclear Information System (INIS)

    The current study tested the hypothesis that the pulmonary carcinogenic potential of cadmium (Cd) is related to its ability to inhibit the expression (mRNA and protein) and activity of 8-oxoguanine-DNA glycosylase (OGG1), a base excision repair (BER) enzyme that functions to preferentially excise pre-mutagenic 7,8-dihydro-8-oxoguanine (8-oxoG) from DNA. We demonstrate that a single Cd aerosol exposure of adult male Lewis rats causes time- and dose-dependent down-regulation in the pulmonary levels of rOGG1 mRNA and OGG1 protein, quantified by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assays and western analyses, respectively. Immunohistochemical studies confirmed that Cd inhalation reduces the relative amount of OGG1 in lungs of exposed animals without altering its over-all distribution within the lung, which appears to be more prominent within the alveolar epithelium. In agreement with our in vivo studies, we show that OGG1 expression is also attenuated in alveolar epithelial cell cultures exposed to CdCl2 either acutely or by repeated passaging in Cd-containing medium. The effects caused by Cd were observed in cells that show no loss in viability, as assessed by colony forming ability, the MTT assay, and propidium iodide membrane permeability studies. Nuclear extracts prepared from Cd-treated cells also exhibit a reduction in the ability to nick a synthetic oligonucleotide containing 8-oxoG. We conclude from these studies that Cd causes suppression of OGG1 in the lung and that this mechanism may, in part, play a role in the Cd carcinogenic process

  7. Mitochondrial-targeted DNA repair enzyme 8-oxoguanine DNA glycosylase 1 protects against ventilator-induced lung injury in intact mice

    OpenAIRE

    Hashizume, Masahiro; Mouner, Marc; Joshua M. Chouteau; Gorodnya, Olena M.; Ruchko, Mykhaylo V.; Potter, Barry J.; Wilson, Glenn L.; Gillespie, Mark N.; Parker, James C.

    2012-01-01

    This study tested the hypothesis that oxidative mitochondrial-targeted DNA (mtDNA) damage triggered ventilator-induced lung injury (VILI). Control mice and mice infused with a fusion protein targeting the DNA repair enzyme, 8-oxoguanine-DNA glycosylase 1 (OGG1) to mitochondria were mechanically ventilated with a range of peak inflation pressures (PIP) for specified durations. In minimal VILI (1 h at 40 cmH2O PIP), lung total extravascular albumin space increased 2.8-fold even though neither l...

  8. Age-dependent changes in 8-oxoguanine-DNA-glycosylase activity is modulated by adaptive responses to physical exercise in human skeletal muscle

    OpenAIRE

    Radak, Zsolt; Bori, Zoltan; Koltai, Erika; Fatouros, Ioannis G.; JAMURTAS, ATHANASIOS Z.; Douroudos, Ioannis I.; Terzis, Gerasimos; Michalis G. Nikolaidis; Chatzinikolaou, Athanasios; Sovatzidis, Apostolos; Kumagai, Shuzo; Naito, Hisahi; Boldogh, Istvan

    2011-01-01

    8-Oxo-7,8 dihydroguanine (8-oxoG) accumulates in the genome over time and is believed to contribute to the development of aging characteristics of skeletal muscle and various aging-related diseases. Here, we show a significantly increased level of intrahelical 8-oxoG and 8-oxoguanine DNA glycosylase (OGG1) expression in aged human skeletal muscle compared to that of young individuals. In response to exercise, the 8-oxoG level was found to be lastingly elevated in sedentary young and old subje...

  9. The levels of 7,8-dihydrodeoxyguanosine (8-oxoG) and 8-oxoguanine DNA glycosylase 1 (OGG1) - A potential diagnostic biomarkers of Alzheimer's disease.

    Science.gov (United States)

    Sliwinska, Agnieszka; Kwiatkowski, Dominik; Czarny, Piotr; Toma, Monika; Wigner, Paulina; Drzewoski, Jozef; Fabianowska-Majewska, Krystyna; Szemraj, Janusz; Maes, Michael; Galecki, Piotr; Sliwinski, Tomasz

    2016-09-15

    Evidence indicates that oxidative stress contributes to neuronal cell death in Alzheimer's disease (AD). Increased oxidative DNA damage l, as measured with 8-oxoguanine (8-oxoG), and reduced capacity of proteins responsible for removing of DNA damage, including 8-oxoguanine DNA glycosylase 1 (OGG1), were detected in brains of AD patients. In the present study we assessed peripheral blood biomarkers of oxidative DNA damage, i.e. 8- oxoG and OGG1, in AD diagnosis, by comparing their levels between the patients and the controls. Our study was performed on DNA and serum isolated from peripheral blood taken from 100 AD patients and 110 controls. For 8-oxoG ELISA was employed. The OGG1 level was determined using ELISA and Western blot technique. Levels of 8-oxoG were significantly higher in DNA of AD patients. Both ELISA and Western blot showed decreased levels of OGG1 in serum of AD patients. Our results show that oxidative DNA damage biomarkers detected in peripheral tissue could reflect the changes occurring in the brain of patients with AD. These results also suggest that peripheral blood samples may be useful to measure oxidative stress biomarkers in AD. PMID:27538622

  10. Mitochondrial-targeted DNA repair enzyme 8-oxoguanine DNA glycosylase 1 protects against ventilator-induced lung injury in intact mice.

    Science.gov (United States)

    Hashizume, Masahiro; Mouner, Marc; Chouteau, Joshua M; Gorodnya, Olena M; Ruchko, Mykhaylo V; Potter, Barry J; Wilson, Glenn L; Gillespie, Mark N; Parker, James C

    2013-02-15

    This study tested the hypothesis that oxidative mitochondrial-targeted DNA (mtDNA) damage triggered ventilator-induced lung injury (VILI). Control mice and mice infused with a fusion protein targeting the DNA repair enzyme, 8-oxoguanine-DNA glycosylase 1 (OGG1) to mitochondria were mechanically ventilated with a range of peak inflation pressures (PIP) for specified durations. In minimal VILI (1 h at 40 cmH(2)O PIP), lung total extravascular albumin space increased 2.8-fold even though neither lung wet/dry (W/D) weight ratios nor bronchoalveolar lavage (BAL) macrophage inflammatory protein (MIP)-2 or IL-6 failed to differ from nonventilated or low PIP controls. This increase in albumin space was attenuated by OGG1. Moderately severe VILI (2 h at 40 cmH(2)O PIP) produced a 25-fold increase in total extravascular albumin space, a 60% increase in W/D weight ratio and marked increases in BAL MIP-2 and IL-6, accompanied by oxidative mitochondrial DNA damage, as well as decreases in the total tissue glutathione (GSH) and GSH/GSSH ratio compared with nonventilated lungs. All of these injury indices were attenuated in OGG1-treated mice. At the highest level of VILI (2 h at 50 cmH(2)O PIP), OGG1 failed to protect against massive lung edema and BAL cytokines or against depletion of the tissue GSH pool. Interestingly, whereas untreated mice died before completing the 2-h protocol, OGG1-treated mice lived for the duration of observation. Thus mitochondrially targeted OGG1 prevented VILI over a range of ventilation times and pressures and enhanced survival in the most severely injured group. These findings support the concept that oxidative mtDNA damage caused by high PIP triggers induction of acute lung inflammation and injury.

  11. Exercise-Induced Neuroprotection of Hippocampus in APP/PS1 Transgenic Mice via Upregulation of Mitochondrial 8-Oxoguanine DNA Glycosylase

    Directory of Open Access Journals (Sweden)

    Hai Bo

    2014-01-01

    Full Text Available Improving mitochondrial function has been proposed as a reasonable therapeutic strategy to reduce amyloid-β (Aβ load and to modify the progression of Alzheimer’s disease (AD. However, the relationship between mitochondrial adaptation and brain neuroprotection caused by physical exercise in AD is poorly understood. This study was undertaken to investigate the effects of long-term treadmill exercise on mitochondrial 8-oxoguanine DNA glycosylase-1 (OGG1 level, mtDNA oxidative damage, and mitochondrial function in the hippocampus of APP/PS1 transgenic mouse model of AD. In the present study, twenty weeks of treadmill training significantly improved the cognitive function and reduced the expression of Aβ-42 in APP/PS1 transgenic (Tg mice. Training also ameliorated mitochondrial respiratory function by increasing the complexes I, and IV and ATP synthase activities, whereas it attenuated ROS generation and mtDNA oxidative damage in Tg mice. Furthermore, the impaired mitochondrial antioxidant enzymes and mitochondrial OGG1 activities seen in Tg mice were restored with training. Acetylation level of mitochondrial OGG1 and MnSOD was markedly suppressed in Tg mice after exercise training, in parallel with increased level of SIRT3. These findings suggest that exercise training could increase mtDNA repair capacity in the mouse hippocampus, which in turn would result in protection against AD-related mitochondrial dysfunction and phenotypic deterioration.

  12. 8-Oxoguanine DNA glycosylase 1 (ogg1) maintains the function of cardiac progenitor cells during heart formation in zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Lifeng [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China); Zhou, Yong [Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200025 (China); Yu, Shanhe [Shanghai Institute of Hematology, RuiJin Hospital, Shanghai Jiao Tong University, School of Medicine, Shanghai 200025 (China); Ji, Guixiang [Nanjing Institute of Environmental Sciences/Key Laboratory of Pesticide Environmental Assessment and Pollution Control, Ministry of Environmental Protection, Nanjing 210042 (China); Wang, Lei [Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200025 (China); Liu, Wei [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China); Gu, Aihua, E-mail: aihuagu@njmu.edu.cn [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China)

    2013-11-15

    Genomic damage may devastate the potential of progenitor cells and consequently impair early organogenesis. We found that ogg1, a key enzyme initiating the base-excision repair, was enriched in the embryonic heart in zebrafish. So far, little is known about DNA repair in cardiogenesis. Here, we addressed the critical role of ogg1 in cardiogenesis for the first time. ogg1 mainly expressed in the anterior lateral plate mesoderm (ALPM), the primary heart tube, and subsequently the embryonic myocardium by in situ hybridisation. Loss of ogg1 resulted in severe cardiac morphogenesis and functional abnormalities, including the short heart length, arrhythmia, decreased cardiomyocytes and nkx2.5{sup +} cardiac progenitor cells. Moreover, the increased apoptosis and repressed proliferation of progenitor cells caused by ogg1 deficiency might contribute to the heart phenotype. The microarray analysis showed that the expression of genes involved in embryonic heart tube morphogenesis and heart structure were significantly changed due to the lack of ogg1. Among those, foxh1 is an important partner of ogg1 in the cardiac development in response to DNA damage. Our work demonstrates the requirement of ogg1 in cardiac progenitors and heart development in zebrafish. These findings may be helpful for understanding the aetiology of congenital cardiac deficits. - Highlights: • A key DNA repair enzyme ogg1 is expressed in the embryonic heart in zebrafish. • We found that ogg1 is essential for normal cardiac morphogenesis in zebrafish. • The production of embryonic cardiomyocytes requires appropriate ogg1 expression. • Ogg1 critically regulated proliferation of cardiac progenitor cells in zebrafish. • foxh1 is a partner of ogg1 in the cardiac development in response to DNA damage.

  13. Repair of 8-oxodeoxyguanosine lesions in mitochondrial DNA depends on the oxoguanine DNA glycosylase (OGG1) gene and 8- oxoguanine accumulates in the mitochondrial DNA of OGG1- defective mice

    DEFF Research Database (Denmark)

    Souza-Pinto, N.C.; Eide, L.; Hogue, B.A.;

    2001-01-01

    Mitochondria are not only the major site for generation of reactive oxygen species, but also one of the main targets of oxidative damage. One of the major products of DNA oxidation, 8-oxodeoxyguanosine (8-oxodC), accumulates in mitochondrial DNA (mtDNA) at levels three times higher than in nuclear...

  14. Nuclear Magnetic Resonance Solution Structure of DNA Featuring Clustered 2'-Deoxyribonolactone and 8-Oxoguanine Lesions.

    Science.gov (United States)

    Zálešák, Jan; Constant, Jean-François; Jourdan, Muriel

    2016-07-19

    Ionizing radiation, free radicals, and reactive oxygen species produce hundreds of different DNA lesions. Clustered lesions are typical for ionizing radiation. They compromise the efficiency of the base excision repair (BER) pathway, and as a consequence, they are much more toxic and mutagenic than isolated lesions. Despite their biological relevance, e.g., in cancer radiotherapy and accidental exposure, they are not very well studied from a structural point of view, and while insights provided by structural studies contribute to the understanding of the repair process, only three nuclear magnetic resonance (NMR) studies of DNA containing clusters of lesions were reported. Herein, we report the first NMR solution structure of two DNAs containing a bistranded cluster with the 2'-deoxyribonolactone and 8-oxoguanine lesions. Both DNA duplexes feature a 2'-deoxyribonolactone site in the middle of the sequence of one strand and differ by the relative position of the 8-oxoguanine, staggered 3' or 5' side on the complementary strand at a three-nucleotide distance. Depending on its relative position, the repair of the 8-oxoguanine lesion by the base excision repair protein Fpg is either almost complete or inhibited. We found that the structures of the two DNAs containing a bistranded cluster of two lesions are similar and do not deviate very much from the standard B-form. As no obvious structural deformations were observed between the two duplexes, we concluded that the differences in Fpg activity are not due to differences in their global conformation. PMID:27322640

  15. Efficiency, specificity and DNA polymerase-dependence of translesion replication across the oxidative DNA lesion 8-oxoguanine in human cells

    International Nuclear Information System (INIS)

    The oxidation product of guanine, 8-oxoguanine, is a major lesion formed in DNA by intracellular metabolism, ionizing radiation, and tobacco smoke. Using a recently developed method for the quantitative analysis of translesion replication, we have studied the bypass of 8-oxoguanine in vivo by transfecting human cells with a gapped plasmid carrying a site-specific 8-oxoguanine in the ssDNA region. The efficiency of bypass in the human large-cell lung carcinoma cell line H1299 was 80%, and it was similar when assayed in the presence of aphidicolin, an inhibitor of DNA polymerases α, δ and ε. A similar extent of bypass was observed also in XP-V cells, defective in pol η, both in the absence and presence of aphidicolin. DNA sequence analysis indicated that the major nucleotide inserted opposite the 8-oxoguanine was the correct nucleotide C, both in H1299 cells (81%) and in XP-V cells (77%). The major mutagenic event was the insertion of an A, both in H1299 and XP-V cells, and it occurred at a frequency of 16-17%, significantly higher than previously reported. Interestingly, the misinsertion frequency of A opposite 8-oxoguanine was decreased in XP-V cells in the presence of aphidicolin, and misinsertion of G was observed. This modulation of the mutagenic specificity at 8-oxoguanine is consistent with the notion that while not essential for the bypass reaction, pol η and pol δ, when present, are involved in bypass of 8-oxoguanine in vivo

  16. Computational study of recognition of DNA damages and their repair. 8-oxoguanine oxidative DNA damage with repair enzyme hOGG1

    International Nuclear Information System (INIS)

    The molecular dynamics (MD) simulations of DNA mutagenic oxidative lesion - 7,8-dihydro-8-oxoguanine (8-oxoG), single and complexed with the repair enzyme - human oxoguanine glycosylase 1 (hOGG1) were performed for 1 nanosecond (ns) in order to determine structural changes at the DNA molecule and to describe a dynamical process of DNA-enzyme complex formation. The molecule of 8-oxoG was inserted into central part of B-DNA 15-mer d(GCGTCCA'8-oxoG'GTCTACC)2 replacing the native guanine 8. In the case of simulation of single DNA molecule the broken hydrogen bonds resulting in locally collapsed B-DNA structure were observed at the lesion site. In addition the adenine on the complementary strand (separated from 8-oxoG by 1 base pair) was flipped-out of the DNA double helix. In the case of simulation of DNA and repair enzyme hOGG1, the DNA-enzyme complex was formed after 500 picoseconds of MD that lasted stable until the simulation was terminated at 1 ns. The complex was represented by the overlapping Van der Waals surfaces of DNA and enzyme molecules. The N-terminus of arginine 324 was located close to the phosphodiester bond of nucleotide with 8-oxoG enabling chemical reactions between amino acid and lesion. Phosphodiester bond at C5' of 8-oxoG was at the position close to the N-terminus of arginine 324. The water mediated hydrogen bonds network was formed in each contact area between DNA and enzyme further enhancing the stability of complex. In the background simulation of the identical molecular system with the native DNA, neither the complex nor the water mediated hydrogen bond network were observed. (author)

  17. [Uracil-DNA glycosylases].

    Science.gov (United States)

    Pytel, Dariusz; Słupianek, Artur; Ksiazek, Dominika; Skórski, Tomasz; Błasiak, Janusz

    2008-01-01

    Uracil is one of four nitrogen bases, most frequently found in normal RNA. Uracyl can be found also in DNA as a result of enzymatic or non-enzymatic deamination of cytosine as well as misincorporation of dUMP instead of dTMP during DNA replication. Uracil from DNA can be removed by DNA repair enzymes with apirymidine site as an intermediate. However, if uracil is not removed from DNA a pair C:G in parental DNA can be changed into a T:A pair in the daughter DNA molecule. Therefore, uracil in DNA may lead to a mutation. Uracil in DNA, similarly to thymine, forms energetically most favorable hydrogen bonds with adenine, therefore uracil does not change the coding properties of DNA. Uracil in DNA is recognized by uracil DNA glycosylase (UDGs), which initiates DNA base excision repair, leading to removing of uracil from DNA and replacing it by thymine or cytosine, when arose as a result of cytosine deamination. Eukaryotes have at least four nuclear UDGs: UNG2, SMUG1, TDG i MBD4, while UNG1 operates in the mitochondrium. UNG2 is involved in DNA repair associated with DNA replication and interacts with PCNA and RPA proteins. Uracil can also be an intermediate product in the process of antigen-dependent antibody diversification in B lymphocytes. Enzymatic deamination of viral DNA by host cells can be a defense mechanism against viral infection, including HIV-1. UNG2, MBD4 and TDG glycosylases may cooperate with mismatch repair proteins and TDG can be involved in nucleotide excision repair system.

  18. Different organization of base excision repair of uracil in DNA in nuclei and mitochondria and selective upregulation of mitochondrial uracil-DNA glycosylase after oxidative stress

    DEFF Research Database (Denmark)

    Akbari, M; Otterlei, M; Pena Diaz, Javier;

    2007-01-01

    1 (UNG1), nuclear uracil-DNA glycosylase 2 (UNG2) and endonuclease III-like 1 protein (NTH1) collectively remove most oxidized pyrimidines, while 8-oxoguanine-DNA glycosylase 1 (OGG1) removes oxidized purines. Although uracil is the main substrate of uracil-DNA glycosylases UNG1 and UNG2...... of multi-protein BER complexes in nuclei and mitochondria. Extracts from nuclei and mitochondria were both proficient in complete uracil-BER in vitro. BER assays with immunoprecipitates demonstrated that UNG2-EYFP, but not UNG1-EYFP, formed complexes that carried out complete BER. Although apurinic...

  19. Deletion of Ogg1 DNA glycosylase results in telomere base damage and length alteration in yeast

    OpenAIRE

    LU, Jian; Liu, Yie

    2009-01-01

    Telomeres consist of short guanine-rich repeats. Guanine can be oxidized to 8-oxo-7,8-dihydroguanine (8-oxoG) and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG). 8-oxoguanine DNA glycosylase (Ogg1) repairs these oxidative guanine lesions through the base excision repair (BER) pathway. Here we show that in Saccharomyces cerevisiae ablation of Ogg1p leads to an increase in oxidized guanine level in telomeric DNA. The ogg1 deletion (ogg1Δ) strain shows telomere lengthening that is dependent...

  20. The R46Q, R131Q and R154H Polymorphs of Human DNA Glycosylase/β-Lyase hOgg1 Severely Distort the Active Site and DNA Recognition Site but do not Cause Unfolding†

    OpenAIRE

    Anderson, Peter C.; Daggett, Valerie

    2009-01-01

    Reactive oxygen species can cause widespread cellular damage, including base alterations and strand breaks in DNA. An array of DNA-repair enzymes constitutes an essential part of the line of defense that cells use against oxidative damage to the genome. A DNA glycosylase/β-lyase enzyme, Ogg1, scavenges the genome for 8-oxoguanine, a major mutagenic DNA adduct induced by reactive oxygen species, and catalyzes its excision and subsequent cleavage of the DNA phosphate backbone. Several polymorph...

  1. A new technique for the quantitative assessment of 8-oxoguanine in nuclear DNA as a marker of oxidative stress. Application to dystrophin-deficient DMD skeletal muscles.

    Science.gov (United States)

    Nakae, Yoshiko; Stoward, Peter J; Bespalov, Ivan A; Melamede, Robert J; Wallace, Susan S

    2005-09-01

    This is the first report on the development of an immunohistochemical technique, combined with quantitative image analysis, for the assessment of oxidative stress quantitatively in nuclear DNA in situ, and its application to measure DNA damage in Duchenne muscular dystrophic (DMD) muscles. Three sequential staining procedures for cell nuclei, a cell marker, and a product of oxidative DNA damage, 8-oxoguanine (8-oxoG), were performed. First, the nuclei in muscle sections were stained with Neutral Red followed by the capture of their images with an image analysis system used for absorbance measurements. Second, the same sections were then immunostained for laminin in basement membranes as the cell marker. Next, the sections were treated with 2 N HCl to remove the bound Neutral Red and to denature tissue DNA. Third, the sections were immunostained for 8-oxoG in DNA, using diaminobenzidine (DAB) to reveal the antibody complex. This was followed by capture of the images of the immunostained sections as previously. The absorbances at 451.2 nm of bound Neutral Red and DAB polymer oxides, the final product of 8-oxoG immunostaining, were measured in the same myonuclei in the sections. Analysis of these absorbances permitted indices of the 8-oxoG content, independent of the nuclear densities, to be determined in nuclear DNA in single myofibres and myosatellite cells surrounded by basement membranes. We found that the mean index for the myonuclei in biceps brachii muscles of 2- to 7-year-old patients was 14% higher than that in age-matched normal controls. This finding of the increased oxidative stress in the myonuclei in young DMD muscles agrees with the previous reports of increased oxidative stress in the cytoplasm in the DMD myofibres and myosatellite cells. The present technique for the quantitative assessment of oxidative stress in nuclear DNA in situ is applicable not only in biomedical research but also in the development of effective drugs for degenerative diseases

  2. Evidence that OGG1 glycosylase protects neurons against oxidative DNA damage and cell death under ischemic conditions

    DEFF Research Database (Denmark)

    Liu, Dong; Croteau, Deborah L; Souza-Pinto, Nadja;

    2011-01-01

    to ischemic and oxidative stress. After exposure of cultured neurons to oxidative and metabolic stress levels of OGG1 in the nucleus were elevated and mitochondria exhibited fragmentation and increased levels of the mitochondrial fission protein dynamin-related protein 1 (Drp1) and reduced membrane potential......7,8-Dihydro-8-oxoguanine DNA glycosylase (OGG1) is a major DNA glycosylase involved in base-excision repair (BER) of oxidative DNA damage to nuclear and mitochondrial DNA (mtDNA). We used OGG1-deficient (OGG1(-/-)) mice to examine the possible roles of OGG1 in the vulnerability of neurons....... Cortical neurons isolated from OGG1(-/-) mice were more vulnerable to oxidative insults than were OGG1(+/+) neurons, and OGG1(-/-) mice developed larger cortical infarcts and behavioral deficits after permanent middle cerebral artery occlusion compared with OGG1(+/+) mice. Accumulations of oxidative DNA...

  3. Active destabilization of base pairs by a DNA glycosylase wedge initiates damage recognition

    Science.gov (United States)

    Kuznetsov, Nikita A.; Bergonzo, Christina; Campbell, Arthur J.; Li, Haoquan; Mechetin, Grigory V.; de los Santos, Carlos; Grollman, Arthur P.; Fedorova, Olga S.; Zharkov, Dmitry O.; Simmerling, Carlos

    2015-01-01

    Formamidopyrimidine-DNA glycosylase (Fpg) excises 8-oxoguanine (oxoG) from DNA but ignores normal guanine. We combined molecular dynamics simulation and stopped-flow kinetics with fluorescence detection to track the events in the recognition of oxoG by Fpg and its mutants with a key phenylalanine residue, which intercalates next to the damaged base, changed to either alanine (F110A) or fluorescent reporter tryptophan (F110W). Guanine was sampled by Fpg, as evident from the F110W stopped-flow traces, but less extensively than oxoG. The wedgeless F110A enzyme could bend DNA but failed to proceed further in oxoG recognition. Modeling of the base eversion with energy decomposition suggested that the wedge destabilizes the intrahelical base primarily through buckling both surrounding base pairs. Replacement of oxoG with abasic (AP) site rescued the activity, and calculations suggested that wedge insertion is not required for AP site destabilization and eversion. Our results suggest that Fpg, and possibly other DNA glycosylases, convert part of the binding energy into active destabilization of their substrates, using the energy differences between normal and damaged bases for fast substrate discrimination. PMID:25520195

  4. Oxidized dNTPs and the OGG1 and MUTYH DNA glycosylases combine to induce CAG/CTG repeat instability.

    Science.gov (United States)

    Cilli, Piera; Ventura, Ilenia; Minoprio, Anna; Meccia, Ettore; Martire, Alberto; Wilson, Samuel H; Bignami, Margherita; Mazzei, Filomena

    2016-06-20

    DNA trinucleotide repeat (TNR) expansion underlies several neurodegenerative disorders including Huntington's disease (HD). Accumulation of oxidized DNA bases and their inefficient processing by base excision repair (BER) are among the factors suggested to contribute to TNR expansion. In this study, we have examined whether oxidation of the purine dNTPs in the dNTP pool provides a source of DNA damage that promotes TNR expansion. We demonstrate that during BER of 8-oxoguanine (8-oxodG) in TNR sequences, DNA polymerase β (POL β) can incorporate 8-oxodGMP with the formation of 8-oxodG:C and 8-oxodG:A mispairs. Their processing by the OGG1 and MUTYH DNA glycosylases generates closely spaced incisions on opposite DNA strands that are permissive for TNR expansion. Evidence in HD model R6/2 mice indicates that these DNA glycosylases are present in brain areas affected by neurodegeneration. Consistent with prevailing oxidative stress, the same brain areas contained increased DNA 8-oxodG levels and expression of the p53-inducible ribonucleotide reductase. Our in vitro and in vivo data support a model where an oxidized dNTPs pool together with aberrant BER processing contribute to TNR expansion in non-replicating cells. PMID:26980281

  5. MUTYH DNA glycosylase: the rationale for removing undamaged bases from the DNA

    Directory of Open Access Journals (Sweden)

    Enni eMarkkanen

    2013-02-01

    Full Text Available Maintenance of genetic stability is crucial for all organisms in order to avoid the onset of deleterious diseases such as cancer. One of the many proveniences of DNA base damage in mammalian cells is oxidative stress, arising from a variety of endogenous and exogenous sources, generating highly mutagenic oxidative DNA lesions. One of the best characterized oxidative DNA lesion is 7,8-dihydro-8-oxoguanine (8-oxo-G, which can give rise to base substitution mutations (also known as point mutations. This mutagenicity is due to the miscoding potential of 8-oxo-G that instructs most DNA polymerases (pols to preferentially insert an Adenine (A opposite 8-oxo-G instead of the appropriate Cytosine (C. If left unrepaired, such A:8-oxo-G mispairs can give rise to CG->AT transversion mutations. A:8-oxo-G mispairs are proficiently recognized by the MutY glycosylase homologue (MUTYH. MUTYH can remove the mispaired A from an A:8-oxo-G, giving way to the canonical base excision repair (BER that ultimately restores undamaged Guanine (G. The importance of this MUTYH-initiated pathway is illustrated by the fact that biallelic mutations in the MUTYH gene are associated with a hereditary colorectal cancer syndrome termed MUTYH-associated polyposis (MAP. In this review, we will focus on MUTYH, from its discovery to the most recent data regarding its cellular roles and interaction partners. We discuss the involvement of the MUTYH protein in the A:8-oxo-G BER pathway acting together with pol , the pol that can faithfully incorporate C opposite 8-oxo-G and thus bypass this lesion in a correct manner. We also outline the current knowledge about the regulation of MUTYH itself and the A:8-oxo-G repair pathway by posttranslational modifications (PTM. Finally, to achieve a clearer overview of the literature, we will briefly touch on the rather confusing MUTYH nomenclature. In short, MUTYH is a unique DNA glycosylase that catalyzes the excision of an undamaged base from

  6. A base-excision DNA-repair protein finds intrahelical lesion bases by fast sliding in contact with DNA

    NARCIS (Netherlands)

    Blainey, Paul C.; Oijen, Antoine M. van; Banerjee, Anirban; Verdine, Gregory L.; Xie, X. Sunney; Hippel, Peter H. von

    2006-01-01

    A central mystery in the function of site-specific DNA-binding proteins is the detailed mechanism for rapid location and binding of target sites in DNA. Human oxoguanine DNA glycosylase 1 (hOgg1), for example, must search out rare 8-oxoguanine lesions to prevent transversion mutations arising from o

  7. Influence of the OGG1 Ser326Cys polymorphism on oxidatively damaged DNA and repair activity

    DEFF Research Database (Denmark)

    Jensen, Annie; Løhr, Mille; Eriksen, Louise;

    2012-01-01

    Oxidatively damaged DNA base lesions are considered to be mainly repaired by 8-oxoguanine DNA glycosylase (OGG1) mediated pathways. We investigated the effect of the OGG1 Ser326Cys polymorphism on the level and repair of oxidatively damaged DNA in mononuclear blood cells (MNBC) by means of the co...

  8. Inhibition of DNA glycosylases via small molecule purine analogs.

    Directory of Open Access Journals (Sweden)

    Aaron C Jacobs

    Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

  9. UVA radiation is highly mutagenic in cells that are unable to repair 7,8-dihydro-8-oxoguanine in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kozmin, S; Slezak, G; Reynaud-Angelin, A; Elie, C; de Rycke, Y; Boiteux, S; Sage, E

    2005-09-20

    UVA (320-400 nm) radiation constitutes >90% of the environmentally relevant solar UV radiation, and it has been proposed to have a role in skin cancer and aging. Because of the popularity of UVA tanning beds and prolonged periods of sunbathing, the potential deleterious effect of UVA has emerged as a source of concern for public health. Although generally accepted, the impact of DNA damage on the cytotoxic, mutagenic, and carcinogenic effect of UVA radiation remains unclear. In the present study, we investigated the sensitivity of a panel of yeast mutants affected in the processing of DNA damage to the lethal and mutagenic effect of UVA radiation. The data show that none of the major DNA repair pathways, such as base excision repair, nucleotide excision repair, homologous recombination, and postreplication repair, efficiently protect yeast from the lethal action of UVA radiation. In contrast, the results show that the Ogg1 DNA glycosylase efficiently prevents UVA-induced mutagenesis, suggesting the formation of oxidized guanine residues. Furthermore, sequence analysis of UVA-induced canavanine-resistant mutations reveals a bias in favor of GC-->TA events when compared with spontaneous or H(2)O(2)-, UVC-, and gamma-ray- induced canavanine-resistant mutations in the WT strain. Taken together, our data point out a major role of oxidative DNA damage, mostly 7,8-dihydro-8-oxoguanine, in the genotoxicity of UVA radiation in the yeast Saccharomyces cerevisiae. Therefore, the capacity of skin cells to repair 7,8-dihydro-8-oxoguanine may be a key parameter in the mutagenic and carcinogenic effect of UVA radiation in humans.

  10. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA glyc

  11. Sequence-dependent Structural Variation in DNA Undergoing Intrahelical Inspection by the DNA glycosylase MutM

    Energy Technology Data Exchange (ETDEWEB)

    Sung, Rou-Jia; Zhang, Michael; Qi, Yan; Verdine, Gregory L. (Harvard-Med); (Harvard)

    2012-08-31

    MutM, a bacterial DNA-glycosylase, plays a critical role in maintaining genome integrity by catalyzing glycosidic bond cleavage of 8-oxoguanine (oxoG) lesions to initiate base excision DNA repair. The task faced by MutM of locating rare oxoG residues embedded in an overwhelming excess of undamaged bases is especially challenging given the close structural similarity between oxoG and its normal progenitor, guanine (G). MutM actively interrogates the DNA to detect the presence of an intrahelical, fully base-paired oxoG, whereupon the enzyme promotes extrusion of the target nucleobase from the DNA duplex and insertion into the extrahelical active site. Recent structural studies have begun to provide the first glimpse into the protein-DNA interactions that enable MutM to distinguish an intrahelical oxoG from G; however, these initial studies left open the important question of how MutM can recognize oxoG residues embedded in 16 different neighboring sequence contexts (considering only the 5'- and 3'-neighboring base pairs). In this study we set out to understand the manner and extent to which intrahelical lesion recognition varies as a function of the 5'-neighbor. Here we report a comprehensive, systematic structural analysis of the effect of the 5'-neighboring base pair on recognition of an intrahelical oxoG lesion. These structures reveal that MutM imposes the same extrusion-prone ('extrudogenic') backbone conformation on the oxoG lesion irrespective of its 5'-neighbor while leaving the rest of the DNA relatively free to adjust to the particular demands of individual sequences.

  12. Molecular crowding enhances facilitated diffusion of two human DNA glycosylases

    OpenAIRE

    Cravens, Shannen L.; Schonhoft, Joseph D.; Rowland, Meng M.; Rodriguez, Alyssa A.; Anderson, Breeana G.; Stivers, James T.

    2015-01-01

    Intracellular space is at a premium due to the high concentrations of biomolecules and is expected to have a fundamental effect on how large macromolecules move in the cell. Here, we report that crowded solutions promote intramolecular DNA translocation by two human DNA repair glycosylases. The crowding effect increases both the efficiency and average distance of DNA chain translocation by hindering escape of the enzymes to bulk solution. The increased contact time with the DNA chain provides...

  13. Molecular cloning of human uracil-DNA glycosylase, a highly conserved DNA repair enzyme.

    OpenAIRE

    Olsen, L C; Aasland, R; Wittwer, C U; Krokan, H E; Helland, D E

    1989-01-01

    Uracil-DNA glycosylase is the DNA repair enzyme responsible for the removal of uracil from DNA, and it is present in all organisms investigated. Here we report on the cloning and sequencing of a cDNA encoding the human uracil-DNA glycosylase. The sequences of uracil-DNA glycosylases from yeast, Escherichia coli, herpes simplex virus type 1 and 2, and homologous genes from varicella-zoster and Epstein-Barr viruses are known. It is shown in this report that the predicted amino acid sequence of ...

  14. Reactions of the OOH radical with guanine: Mechanisms of formation of 8-oxoguanine and other products

    Science.gov (United States)

    Kumar, Nagendra; Shukla, P. K.; Mishra, P. C.

    2010-09-01

    The mutagenic product 8-oxoguanine (8-oxoGua) is formed due to intermediacy of peroxyl (OOR) radicals in lipid peroxidation and protein oxidation-induced DNA damage. The mechanisms of these reactions are not yet understood properly. Therefore, in the present study, the mechanisms of formation of 8-oxoGua and other related products due to the reaction of the guanine base of DNA with the hydroperoxyl radical (OOH) were investigated theoretically employing the B3LYP and BHandHLYP hybrid functionals of density functional theory and the polarizable continuum model for solvation. It is found that the reaction of the OOH radical with guanine can occur following seven different mechanisms leading to the formation of various products including 8-oxoGua, its radicals, 5-hydroxy-8-oxoguanine and CO 2. The mechanism that yields 8-oxoGua as an intermediate and 5-hydroxy-8-oxoGua as the final product was found to be energetically most favorable.

  15. Mitochondrial Targeted Endonuclease III DNA Repair Enzyme Protects against Ventilator Induced Lung Injury in Mice

    OpenAIRE

    Masahiro Hashizume; Marc Mouner; Joshua M. Chouteau; Gorodnya, Olena M.; Ruchko, Mykhaylo V.; Wilson, Glenn L.; Gillespie, Mark N.; Parker, James C.

    2014-01-01

    The mitochondrial targeted DNA repair enzyme, 8-oxoguanine DNA glycosylase 1, was previously reported to protect against mitochondrial DNA (mtDNA) damage and ventilator induced lung injury (VILI). In the present study we determined whether mitochondrial targeted endonuclease III (EndoIII) which cleaves oxidized pyrimidines rather than purines from damaged DNA would also protect the lung. Minimal injury from 1 h ventilation at 40 cmH2O peak inflation pressure (PIP) was reversed by EndoIII pret...

  16. Molecular crowding enhances facilitated diffusion of two human DNA glycosylases.

    Science.gov (United States)

    Cravens, Shannen L; Schonhoft, Joseph D; Rowland, Meng M; Rodriguez, Alyssa A; Anderson, Breeana G; Stivers, James T

    2015-04-30

    Intracellular space is at a premium due to the high concentrations of biomolecules and is expected to have a fundamental effect on how large macromolecules move in the cell. Here, we report that crowded solutions promote intramolecular DNA translocation by two human DNA repair glycosylases. The crowding effect increases both the efficiency and average distance of DNA chain translocation by hindering escape of the enzymes to bulk solution. The increased contact time with the DNA chain provides for redundant damage patrolling within individual DNA chains at the expense of slowing the overall rate of damaged base removal from a population of molecules. The significant biological implication is that a crowded cellular environment could influence the mechanism of damage recognition as much as any property of the enzyme or DNA. PMID:25845592

  17. A DNA glycosylase from human lymphoblasts that releases cis-thymine glycol from oxidized DNA

    International Nuclear Information System (INIS)

    An endonuclease (termed the UVX endonuclease) partially purified from cultured human leukemic lymphoblasts (CEM-CCRF line) was previously shown to act specifically on DNA irradiated by ionizing radiation, UV light, or treated with osmium tetroxide. This activity is tightly associated with an endonuclease specific for apurinic /apyrimidinic (AP) sites in DNA, suggesting that the initial attack on the radiation or oxidation induced lesions is by a DNA glycosylase that generates such AP sites. Thymine glycol has been shown to be a product common to γ-irradiated and oxidized DNA and in the present studies the authors have shown that the UVX endonuclease releases free cis-thymine glycol from osmium tetroxide treated DNA. HPLC analysis of the reaction products failed to detect any cis-thymidine glycol or nucleotide material indicating that the activity responsible is truly a DNA glycosylase. This enzyme thus resembles Endonuclease III of E. coli which contains both AP endonuclease and thymine glucol-DNA glycosylase activities

  18. Transcriptional regulation of thymine DNA glycosylase (TDG) by the tumor suppressor protein p53

    OpenAIRE

    da Costa, Nathalia Meireles; Hautefeuille, Agnès; Cros, Marie-Pierre; Melendez, Matias Eliseo; Waters, Timothy; Swann, Peter; Hainaut, Pierre; Pinto, Luis Felipe Ribeiro

    2012-01-01

    Thymine DNA glycosylase (TDG) belongs to the superfamily of uracil DNA glycosylases (UDG) and is the first enzyme in the base-excision repair pathway (BER) that removes thymine from G:T mismatches at CpG sites. This glycosylase activity has also been found to be critical for active demethylation of genes involved in embryonic development. Here we show that wild-type p53 transcriptionally regulates TDG expression. Chromatin immunoprecipitation (ChIP) and luciferase assays indicate that wild-ty...

  19. Linking active DNA demethylation by Thymine DNA Glycosylase with epigenetic regulation of gene expression

    OpenAIRE

    Wirz, Annika

    2014-01-01

    The correct regulation of epigenetic modifications is crucial for cell plasticity and the establishment of cell identity. The underlying molecular mechanisms are not clear, but a role for DNA repair proteins has been implicated in this context, the investigation of which was the overall aim of my PhD thesis. The Thymine DNA Glycosylase (TDG) was described to excise the deamination products of cytosine (C) and 5-methylcytosine (5-mC), thereby initiating base excision repair (BER; Nedderman...

  20. Base excision by thymine DNA glycosylase mediates DNA-directed cytotoxicity of 5-fluorouracil.

    Directory of Open Access Journals (Sweden)

    Christophe Kunz

    2009-04-01

    Full Text Available 5-Fluorouracil (5-FU, a chemotherapeutic drug commonly used in cancer treatment, imbalances nucleotide pools, thereby favoring misincorporation of uracil and 5-FU into genomic DNA. The processing of these bases by DNA repair activities was proposed to cause DNA-directed cytotoxicity, but the underlying mechanisms have not been resolved. In this study, we investigated a possible role of thymine DNA glycosylase (TDG, one of four mammalian uracil DNA glycosylases (UDGs, in the cellular response to 5-FU. Using genetic and biochemical tools, we found that inactivation of TDG significantly increases resistance of both mouse and human cancer cells towards 5-FU. We show that excision of DNA-incorporated 5-FU by TDG generates persistent DNA strand breaks, delays S-phase progression, and activates DNA damage signaling, and that the repair of 5-FU-induced DNA strand breaks is more efficient in the absence of TDG. Hence, excision of 5-FU by TDG, but not by other UDGs (UNG2 and SMUG1, prevents efficient downstream processing of the repair intermediate, thereby mediating DNA-directed cytotoxicity. The status of TDG expression in a cancer is therefore likely to determine its response to 5-FU-based chemotherapy.

  1. Microscopic mechanism of DNA damage searching by hOGG1

    OpenAIRE

    Rowland, Meng M.; Schonhoft, Joseph D.; McKibbin, Paige L.; David, Sheila S.; Stivers, James T.

    2014-01-01

    The DNA backbone is often considered a track that allows long-range sliding of DNA repair enzymes in their search for rare damage sites in DNA. A proposed exemplar of DNA sliding is human 8-oxoguanine (oG) DNA glycosylase 1 (hOGG1), which repairs mutagenic oG lesions in DNA. Here we use our high-resolution molecular clock method to show that macroscopic 1D DNA sliding of hOGG1 occurs by microscopic 2D and 3D steps that masquerade as sliding in resolution-limited single-molecule images. Strand...

  2. G-quadruplex DNA structures can interfere with uracil glycosylase activity in vitro.

    Science.gov (United States)

    Holton, Nate W; Larson, Erik D

    2016-07-01

    Genome sequences that contain tandem repeats of guanine can form stable four-stranded structures known as G-quadruplex, or G4 DNA. While the molecular mechanisms are not fully defined, such guanine-rich loci are prone to mutagenesis and recombination. Various repair pathways function to reduce the potential for genome instability by correcting base damage and replication errors; however, it is not yet fully defined how well these processes function at G4 DNA. One frequent form of base damage occurs from cytidine deamination, resulting in deoxyuracil and UG mismatches. In duplex and single-stranded DNA, uracil bases are recognised and excised by uracil glycosylases. Here, we tested the efficiency of uracil glycosylase activity in vitro on uracil bases located directly adjacent to guanine repeats and G4 DNA. We show that uracil excision by bacterial UDG and human hUNG2 is reduced at uracils positioned directly 5' or 3' of a guanine tetrad. Control reactions using oligonucleotides disrupted for G4 formation or reaction conditions that do not favour G4 formation resulted in full uracil excision activity. Based on these in vitro results, we suggest that folding of guanine-rich DNA into G4 DNA results in a DNA conformation that is resistant to uracil glycosylase-initiated repair and this has the potential to increase the risk of instability at guanine repeats in the genome. PMID:26671821

  3. Structure determination of uracil-DNA N-glycosylase from Deinococcus radiodurans in complex with DNA.

    Science.gov (United States)

    Pedersen, Hege Lynum; Johnson, Kenneth A; McVey, Colin E; Leiros, Ingar; Moe, Elin

    2015-10-01

    Uracil-DNA N-glycosylase (UNG) is a DNA-repair enzyme in the base-excision repair (BER) pathway which removes uracil from DNA. Here, the crystal structure of UNG from the extremophilic bacterium Deinococcus radiodurans (DrUNG) in complex with DNA is reported at a resolution of 1.35 Å. Prior to the crystallization experiments, the affinity between DrUNG and different DNA oligonucleotides was tested by electrophoretic mobility shift assays (EMSAs). As a result of this analysis, two 16 nt double-stranded DNAs were chosen for the co-crystallization experiments, one of which (16 nt AU) resulted in well diffracting crystals. The DNA in the co-crystal structure contained an abasic site (substrate product) flipped into the active site of the enzyme, with no uracil in the active-site pocket. Despite the high resolution, it was not possible to fit all of the terminal nucleotides of the DNA complex into electron density owing to disorder caused by a lack of stabilizing interactions. However, the DNA which was in contact with the enzyme, close to the active site, was well ordered and allowed detailed analysis of the enzyme-DNA interaction. The complex revealed that the interaction between DrUNG and DNA is similar to that in the previously determined crystal structure of human UNG (hUNG) in complex with DNA [Slupphaug et al. (1996). Nature (London), 384, 87-92]. Substitutions in a (here defined) variable part of the leucine loop result in a shorter loop (eight residues instead of nine) in DrUNG compared with hUNG; regardless of this, it seems to fulfil its role and generate a stabilizing force with the minor groove upon flipping out of the damaged base into the active site. The structure also provides a rationale for the previously observed high catalytic efficiency of DrUNG caused by high substrate affinity by demonstrating an increased number of long-range electrostatic interactions between the enzyme and the DNA. Interestingly, specific interactions between residues

  4. Cockayne Syndrome group B protein stimulates NEIL2 DNA glycosylase activity

    DEFF Research Database (Denmark)

    Aamann, Maria Diget; Hvitby, Christina Poulsen; Popuri, Venkateswarlu;

    2014-01-01

    excision repair and base excision repair. Here, we describe a new interaction partner for CSB, the DNA glycosylase NEIL2. Using both cell extracts and recombinant proteins, CSB and NEIL2 were found to physically interact independently of DNA. We further found that CSB is able to stimulate NEIL2 glycosylase...... activity on a 5-hydroxyl uracil lesion in a DNA bubble structure substrate in vitro. A novel 4,6-diamino-5-formamidopyrimidine (FapyA) specific incision activity of NEIL2 was also stimulated by CSB. To further elucidate the biological role of the interaction, immunofluorescence studies were performed......, showing an increase in cytoplasmic CSB and NEIL2 co-localization after oxidative stress. Additionally, stalling of the progression of the transcription bubble with α-amanitin resulted in increased co-localization of CSB and NEIL2. Finally, CSB knockdown resulted in reduced incision of 8-hydroxyguanine...

  5. Stimulation of DNA Glycosylase Activities by XPC Protein Complex: Roles of Protein-Protein Interactions

    Directory of Open Access Journals (Sweden)

    Yuichiro Shimizu

    2010-01-01

    Full Text Available We showed that XPC complex, which is a DNA damage detector for nucleotide excision repair, stimulates activity of thymine DNA glycosylase (TDG that initiates base excision repair. XPC appeared to facilitate the enzymatic turnover of TDG by promoting displacement from its own product abasic site, although the precise mechanism underlying this stimulation has not been clarified. Here we show that XPC has only marginal effects on the activity of E. coli TDG homolog (EcMUG, which remains bound to the abasic site like human TDG but does not significantly interacts with XPC. On the contrary, XPC significantly stimulates the activities of sumoylated TDG and SMUG1, both of which exhibit quite different enzymatic kinetics from unmodified TDG but interact with XPC. These results point to importance of physical interactions for stimulation of DNA glycosylases by XPC and have implications in the molecular mechanisms underlying mutagenesis and carcinogenesis in XP-C patients.

  6. Uracil-DNA glycosylase-deficient yeast exhibit a mitochondrial mutator phenotype

    OpenAIRE

    Chatterjee, Aditi; Keshav K Singh

    2001-01-01

    Mutations in mitochondrial DNA (mtDNA) have been reported in cancer and are involved in the pathogenesis of many mitochondrial diseases. Uracil-DNA glycosylase, encoded by the UNG1 gene in Saccharomyces cerevisiae, repairs uracil in DNA formed due to deamination of cytosine. Our study demonstrates that inactivation of the UNG1 gene leads to at least a 3-fold increased frequency of mutations in mtDNA compared with the wild-type. Using a Ung1p–green fluorescent protein (GFP) fusion construct, w...

  7. Expression and the Peculiar Enzymatic Behavior of the Trypanosoma cruzi NTH1 DNA Glycosylase

    Science.gov (United States)

    Ormeño, Fernando; Barrientos, Camila; Ramirez, Santiago; Ponce, Iván; Valenzuela, Lucía; Sepúlveda, Sofía; Bitar, Mainá; Kemmerling, Ulrike; Machado, Carlos Renato; Cabrera, Gonzalo; Galanti, Norbel

    2016-01-01

    Trypanosoma cruzi, the etiological agent of Chagas’ disease, presents three cellular forms (trypomastigotes, epimastigotes and amastigotes), all of which are submitted to oxidative species in its hosts. However, T. cruzi is able to resist oxidative stress suggesting a high efficiency of its DNA repair machinery.The Base Excision Repair (BER) pathway is one of the main DNA repair mechanisms in other eukaryotes and in T. cruzi as well. DNA glycosylases are enzymes involved in the recognition of oxidative DNA damage and in the removal of oxidized bases, constituting the first step of the BER pathway. Here, we describe the presence and activity of TcNTH1, a nuclear T. cruzi DNA glycosylase. Surprisingly, purified recombinant TcNTH1 does not remove the thymine glycol base, but catalyzes the cleavage of a probe showing an AP site. The same activity was found in epimastigote and trypomastigote homogenates suggesting that the BER pathway is not involved in thymine glycol DNA repair. TcNTH1 DNA-binding properties assayed in silico are in agreement with the absence of a thymine glycol removing function of that parasite enzyme. Over expression of TcNTH1 decrease parasite viability when transfected epimastigotes are submitted to a sustained production of H2O2.Therefore, TcNTH1 is the only known NTH1 orthologous unable to eliminate thymine glycol derivatives but that recognizes and cuts an AP site, most probably by a beta-elimination mechanism. We cannot discard that TcNTH1 presents DNA glycosylase activity on other DNA base lesions. Accordingly, a different DNA repair mechanism should be expected leading to eliminate thymine glycol from oxidized parasite DNA. Furthermore, TcNTH1 may play a role in the AP site recognition and processing. PMID:27284968

  8. A 5-methylcytosine DNA glycosylase/lyase demethylates the retrotransposon Tos17 and promotes its transposition in rice

    KAUST Repository

    La, Honggui

    2011-09-06

    DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.

  9. Differential modes of DNA binding by mismatch uracil DNA glycosylase from Escherichia coli: implications for abasic lesion processing and enzyme communication in the base excision repair pathway

    OpenAIRE

    Grippon, Seden; Zhao, Qiyuan; Robinson, Tom; Marshall, Jacqueline J. T.; O’Neill, Rory J.; Manning, Hugh; Kennedy, Gordon; Dunsby, Christopher; Neil, Mark; Halford, Stephen E.; French, Paul M. W.; Baldwin, Geoff S.

    2010-01-01

    Mismatch uracil DNA glycosylase (Mug) from Escherichia coli is an initiating enzyme in the base-excision repair pathway. As with other DNA glycosylases, the abasic product is potentially more harmful than the initial lesion. Since Mug is known to bind its product tightly, inhibiting enzyme turnover, understanding how Mug binds DNA is of significance when considering how Mug interacts with downstream enzymes in the base-excision repair pathway. We have demonstrated differential binding modes o...

  10. A DNA enzyme with N-glycosylase activity

    OpenAIRE

    Sheppard, Terry L.; Ordoukhanian, Phillip; Joyce, Gerald F.

    2000-01-01

    In vitro evolution was used to develop a DNA enzyme that catalyzes the site-specific depurination of DNA with a catalytic rate enhancement of about 106-fold. The reaction involves hydrolysis of the N-glycosidic bond of a particular deoxyguanosine residue, leading to DNA strand scission at the apurinic site. The DNA enzyme contains 93 nucleotides and is structurally complex. It has an absolute requirement for a divalent metal cation and exhibits optimal activity at about pH 5. The mechanism of...

  11. Listeria monocytogenes DNA Glycosylase AdlP Affects Flagellar Motility, Biofilm Formation, Virulence, and Stress Responses

    Science.gov (United States)

    Zhang, Ting; Bae, Dongryeoul

    2016-01-01

    ABSTRACT The temperature-dependent alteration of flagellar motility gene expression is critical for the foodborne pathogen Listeria monocytogenes to respond to a changing environment. In this study, a genetic determinant, L. monocytogenes f2365_0220 (lmof2365_0220), encoding a putative protein that is structurally similar to the Bacillus cereus alkyl base DNA glycosylase (AlkD), was identified. This determinant was involved in the transcriptional repression of flagellar motility genes and was named adlP (encoding an AlkD-like protein [AdlP]). Deletion of adlP activated the expression of flagellar motility genes at 37°C and disrupted the temperature-dependent inhibition of L. monocytogenes motility. The adlP null strains demonstrated decreased survival in murine macrophage-like RAW264.7 cells and less virulence in mice. Furthermore, the deletion of adlP significantly decreased biofilm formation and impaired the survival of bacteria under several stress conditions, including the presence of a DNA alkylation compound (methyl methanesulfonate), an oxidative agent (H2O2), and aminoglycoside antibiotics. Our findings strongly suggest that adlP may encode a bifunctional protein that transcriptionally represses the expression of flagellar motility genes and influences stress responses through its DNA glycosylase activity. IMPORTANCE We discovered a novel protein that we named AlkD-like protein (AdlP). This protein affected flagellar motility, biofilm formation, and virulence. Our data suggest that AdlP may be a bifunctional protein that represses flagellar motility genes and influences stress responses through its DNA glycosylase activity. PMID:27316964

  12. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    International Nuclear Information System (INIS)

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [32P]-based oligonucleotide cleavage assay (MPG substrate 5′-CCGCTεAGCGGGTACCGAGCTCGAAT; εA = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 ± 1.67 fmol/μg DNA/h vs 3.47 ± 1.35 fmol/μg DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16–7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  13. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Crosbie, Philip A.J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Watson, Amanda J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Agius, Raymond [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Barber, Philip V. [North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Margison, Geoffrey P. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Povey, Andrew C., E-mail: apovey@manchester.ac.uk [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom)

    2012-04-01

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [{sup 32}P]-based oligonucleotide cleavage assay (MPG substrate 5 Prime -CCGCT{epsilon}AGCGGGTACCGAGCTCGAAT; {epsilon}A = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 {+-} 1.67 fmol/{mu}g DNA/h vs 3.47 {+-} 1.35 fmol/{mu}g DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  14. Base excision DNA repair in the embryonic development of the sea urchin, Strongylocentrotus intermedius.

    Science.gov (United States)

    Torgasheva, Natalya A; Menzorova, Natalya I; Sibirtsev, Yurii T; Rasskazov, Valery A; Zharkov, Dmitry O; Nevinsky, Georgy A

    2016-06-21

    In actively proliferating cells, such as the cells of the developing embryo, DNA repair is crucial for preventing the accumulation of mutations and synchronizing cell division. Sea urchin embryo growth was analyzed and extracts were prepared. The relative activity of DNA polymerase, apurinic/apyrimidinic (AP) endonuclease, uracil-DNA glycosylase, 8-oxoguanine-DNA glycosylase, and other glycosylases was analyzed using specific oligonucleotide substrates of these enzymes; the reaction products were resolved by denaturing 20% polyacrylamide gel electrophoresis. We have characterized the profile of several key base excision repair activities in the developing embryos (2 blastomers to mid-pluteus) of the grey sea urchin, Strongylocentrotus intermedius. The uracil-DNA glycosylase specific activity sharply increased after blastula hatching, whereas the specific activity of 8-oxoguanine-DNA glycosylase steadily decreased over the course of the development. The AP-endonuclease activity gradually increased but dropped at the last sampled stage (mid-pluteus 2). The DNA polymerase activity was high at the first cleavage division and then quickly decreased, showing a transient peak at blastula hatching. It seems that the developing sea urchin embryo encounters different DNA-damaging factors early in development within the protective envelope and later as a free-floating larva, with hatching necessitating adaptation to the shift in genotoxic stress conditions. No correlation was observed between the dynamics of the enzyme activities and published gene expression data from developing congeneric species, S. purpuratus. The results suggest that base excision repair enzymes may be regulated in the sea urchin embryos at the level of covalent modification or protein stability.

  15. Transcriptional regulation of thymine DNA glycosylase (TDG) by the tumor suppressor protein p53.

    Science.gov (United States)

    da Costa, Nathalia Meireles; Hautefeuille, Agnès; Cros, Marie-Pierre; Melendez, Matias Eliseo; Waters, Timothy; Swann, Peter; Hainaut, Pierre; Pinto, Luis Felipe Ribeiro

    2012-12-15

    Thymine DNA glycosylase (TDG) belongs to the superfamily of uracil DNA glycosylases (UDG) and is the first enzyme in the base-excision repair pathway (BER) that removes thymine from G:T mismatches at CpG sites. This glycosylase activity has also been found to be critical for active demethylation of genes involved in embryonic development. Here we show that wild-type p53 transcriptionally regulates TDG expression. Chromatin immunoprecipitation (ChIP) and luciferase assays indicate that wild-type p53 binds to a domain of TDG promoter containing two p53 consensus response elements (p53RE) and activates its transcription. Next, we have used a panel of cell lines with different p53 status to demonstrate that TDG mRNA and protein expression levels are induced in a p53-dependent manner under different conditions. This panel includes isogenic breast and colorectal cancer cell lines with wild-type or inactive p53, esophageal squamous cell carcinoma cell lines lacking p53 or expressing a temperature-sensitive p53 mutant and normal human bronchial epithelial cells. Induction of TDG mRNA expression is accompanied by accumulation of TDG protein in both nucleus and cytoplasm, with nuclear re-localization occurring upon DNA damage in p53-competent, but not -incompetent, cells. These observations suggest a role for p53 activity in TDG nuclear translocation. Overall, our results show that TDG expression is directly regulated by p53, suggesting that loss of p53 function may affect processes mediated by TDG, thus negatively impacting on genetic and epigenetic stability. PMID:23165212

  16. Cockayne syndrome group B protein stimulates repair of formamidopyrimidines by NEIL1 DNA glycosylase

    DEFF Research Database (Denmark)

    Muftuoglu, Meltem; de Souza-Pinto, Nadja C; Dogan, Arin;

    2009-01-01

    for endonuclease VIII-like (NEIL1) DNA glycosylase. Results presented here show that csb(-/-) mice have a higher level of endogenous FapyAde and FapyGua in DNA from brain and kidney than wild type mice as well as higher levels of endogenous FapyAde in genomic DNA and mtDNA from liver. In addition, CSB stimulates...... NEIL1 incision activity in vitro, and CSB and NEIL1 co-immunoprecipitate and co-localize in HeLa cells. When CSB and NEIL1 are depleted from HeLa cells by short hairpin RNA knockdown, repair of induced FapyGua is strongly inhibited. These results suggest that CSB plays a role in repair...... of formamidopyrimidines, possibly by interacting with and stimulating NEIL1, and that accumulation of such modifications may have a causal role in the pathogenesis of CS....

  17. den V gene of bacteriophage T4 determines a DNA glycosylase specific for pyrimidine dimers in DNA.

    OpenAIRE

    Seawell, P C; Smith, C A; Ganesan, A K

    1980-01-01

    Endonuclease V of bacteriophage T4 has been described as an enzyme, coded for by the denV gene, that incises UV-irradiated DNA. It has recently been proposed that incision of irradiated DNA by this enzyme and the analogous "correndonucleases" I and II of Micrococcus luteus requires the sequential action of a pyrimidine dimer-specific DNA glycosylase and an apyrimidinic/apurinic endonuclease. In support of this two-step mechanism, we found that our preparations of T4 endonuclease V contained a...

  18. Cytosine photoproduct-DNA glycosylase in Escherichia coli and cultured human cells

    International Nuclear Information System (INIS)

    Ultraviolet irradiation of DNA produces a variety of pyrimidine base damages. The activities of Escherichia coli endonuclease III and a human lymphoblast endonuclease that incises ultraviolet-irradiated DNA at modified cytosine moieties were compared. Both the bacterial and human enzymes release this cytosine photoproduct as a free base. These glycosylase activities are linear with times of reaction, quantities of enzyme, and irradiation dosages of the substrates. Both enzyme activities are similarly inhibited by the addition of monovalent and divalent cations. Analysis by DNA sequencing identified loci of endonucleolytic incision as cytosines. These are neither cyclobutane pyrimidine dimers, 6-(1,2-dihydro-2-oxo-4-pyrimidinyl)-5-methyl-2,4(1H,3H)-pyrimidinediones, nor apyrimidinic sites. This cytosine photoproduct is separable from unmodified cytosine by high-performance liquid chromatography. This separation should facilitate identification of this modified cytosine and elucidation of its biological significance

  19. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity

    International Nuclear Information System (INIS)

    Herein, we introduced a tungsten disulfide (WS2) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3′-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS2 nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS2 nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics. - Highlights: • A fluorescence polarization strategy for DNA glycosylase activity detection was developed. • The present method was based on WS2 nanosheet and exonuclease III co-assisted signal amplification. • A high sensitivity and desirable selectivity were achieved. • This method provides a promising universal platform for DNA glycosylase activity

  20. Kinetics and binding of the thymine-DNA mismatch glycosylase, Mig-Mth, with mismatch-containing DNA substrates.

    Science.gov (United States)

    Begley, Thomas J; Haas, Brian J; Morales, Juan C; Kool, Eric T; Cunningham, Richard P

    2003-01-01

    We have examined the removal of thymine residues from T-G mismatches in DNA by the thymine-DNA mismatch glycosylase from Methanobacterium thermoautrophicum (Mig-Mth), within the context of the base excision repair (BER) pathway, to investigate why this glycosylase has such low activity in vitro. Using single-turnover kinetics and steady-state kinetics, we calculated the catalytic and product dissociation rate constants for Mig-Mth, and determined that Mig-Mth is inhibited by product apyrimidinic (AP) sites in DNA. Electrophoretic mobility shift assays (EMSA) provide evidence that the specificity of product binding is dependent upon the base opposite the AP site. The binding of Mig-Mth to DNA containing the non-cleavable substrate analogue difluorotoluene (F) was also analyzed to determine the effect of the opposite base on Mig-Mth binding specificity for substrate-like duplex DNA. The results of these experiments support the idea that opposite strand interactions play roles in determining substrate specificity. Endonuclease IV, which cleaves AP sites in the next step of the BER pathway, was used to analyze the effect of product removal on the overall rate of thymine hydrolysis by Mig-Mth. Our results support the hypothesis that endonuclease IV increases the apparent activity of Mig-Mth significantly under steady-state conditions by preventing reassociation of enzyme to product. PMID:12509271

  1. A MATE-family efflux pump rescues the Escherichia coli 8-oxoguanine-repair-deficient mutator phenotype and protects against H(2O(2 killing.

    Directory of Open Access Journals (Sweden)

    Javier R Guelfo

    2010-05-01

    Full Text Available Hypermutation may accelerate bacterial evolution in the short-term. In the long-term, however, hypermutators (cells with an increased rate of mutation can be expected to be at a disadvantage due to the accumulation of deleterious mutations. Therefore, in theory, hypermutators are doomed to extinction unless they compensate the elevated mutational burden (deleterious load. Different mechanisms capable of restoring a low mutation rate to hypermutators have been proposed. By choosing an 8-oxoguanine-repair-deficient (GO-deficient Escherichia coli strain as a hypermutator model, we investigated the existence of genes able to rescue the hypermutable phenotype by multicopy suppression. Using an in vivo-generated mini-MudII4042 genomic library and a mutator screen, we obtained chromosomal fragments that decrease the rate of mutation in a mutT-deficient strain. Analysis of a selected clone showed that the expression of NorM is responsible for the decreased mutation rate in 8-oxoguanine-repair-deficient (mutT, mutY, and mutM mutY strains. NorM is a member of the multidrug and toxin extrusion (MATE family of efflux pumps whose role in E. coli cell physiology remains unknown. Our results indicate that NorM may act as a GO-system backup decreasing AT to CG and GC to TA transversions. In addition, the ability of NorM to reduce the level of intracellular reactive oxygen species (ROS in a GO-deficient strain and protect the cell from oxidative stress, including protein carbonylation, suggests that it can extrude specific molecules-byproducts of bacterial metabolism-that oxidize the guanine present in both DNA and nucleotide pools. Altogether, our results indicate that NorM protects the cell from specific ROS when the GO system cannot cope with the damage.

  2. OGG1 is essential in oxidative stress induced DNA demethylation.

    Science.gov (United States)

    Zhou, Xiaolong; Zhuang, Ziheng; Wang, Wentao; He, Lingfeng; Wu, Huan; Cao, Yan; Pan, Feiyan; Zhao, Jing; Hu, Zhigang; Sekhar, Chandra; Guo, Zhigang

    2016-09-01

    DNA demethylation is an essential cellular activity to regulate gene expression; however, the mechanism that triggers DNA demethylation remains unknown. Furthermore, DNA demethylation was recently demonstrated to be induced by oxidative stress without a clear molecular mechanism. In this manuscript, we demonstrated that 8-oxoguanine DNA glycosylase-1 (OGG1) is the essential protein involved in oxidative stress-induced DNA demethylation. Oxidative stress induced the formation of 8-oxoguanine (8-oxoG). We found that OGG1, the 8-oxoG binding protein, promotes DNA demethylation by interacting and recruiting TET1 to the 8-oxoG lesion. Downregulation of OGG1 makes cells resistant to oxidative stress-induced DNA demethylation, while over-expression of OGG1 renders cells susceptible to DNA demethylation by oxidative stress. These data not only illustrate the importance of base excision repair (BER) in DNA demethylation but also reveal how the DNA demethylation signal is transferred to downstream DNA demethylation enzymes. PMID:27251462

  3. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis

    Energy Technology Data Exchange (ETDEWEB)

    Hassim, Farzanah; Papadopoulos, Andrea O.; Kana, Bavesh D.; Gordhan, Bhavna G., E-mail: bhavna.gordhan@nhls.ac.za

    2015-09-15

    Highlights: • We studied the combined role of MutY and Fpg DNA glycosylases in M. smegmatis. • Loss of MutY showed increased sensitivity to oxidative damage. • Loss of MutY together with the Fpg glycosylases showed increased mutation rates. • Our data indicate interplay between these enzymes to control mutagenesis. - Abstract: Hydroxyl radical (·OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen ({sup 1}0{sub 2}) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to ·OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei

  4. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis

    International Nuclear Information System (INIS)

    Highlights: • We studied the combined role of MutY and Fpg DNA glycosylases in M. smegmatis. • Loss of MutY showed increased sensitivity to oxidative damage. • Loss of MutY together with the Fpg glycosylases showed increased mutation rates. • Our data indicate interplay between these enzymes to control mutagenesis. - Abstract: Hydroxyl radical (·OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen (102) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to ·OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei homologues did

  5. A germline polymorphism of thymine DNA glycosylase induces genomic instability and cellular transformation.

    Directory of Open Access Journals (Sweden)

    Ashley Sjolund

    2014-11-01

    Full Text Available Thymine DNA glycosylase (TDG functions in base excision repair, a DNA repair pathway that acts in a lesion-specific manner to correct individual damaged or altered bases. TDG preferentially catalyzes the removal of thymine and uracil paired with guanine, and is also active on 5-fluorouracil (5-FU paired with adenine or guanine. The rs4135113 single nucleotide polymorphism (SNP of TDG is found in 10% of the global population. This coding SNP results in the alteration of Gly199 to Ser. Gly199 is part of a loop responsible for stabilizing the flipped abasic nucleotide in the active site pocket. Biochemical analyses indicate that G199S exhibits tighter binding to both its substrate and abasic product. The persistent accumulation of abasic sites in cells expressing G199S leads to the induction of double-strand breaks (DSBs. Cells expressing the G199S variant also activate a DNA damage response. When expressed in cells, G199S induces genomic instability and cellular transformation. Together, these results suggest that individuals harboring the G199S variant may have increased risk for developing cancer.

  6. Mutants of the Base Excision Repair Glycosylase, Endonuclease III: DNA Charge Transport as a First Step in Lesion Detection

    OpenAIRE

    Romano, Christine A.; Sontz, Pamela A.; Barton, Jacqueline K.

    2011-01-01

    Endonuclease III (EndoIII) is a base excision repair glycosylase that targets damaged pyrimidines and contains a [4Fe-4S] cluster. We have proposed a model where BER proteins that contain redox-active [4Fe-4S] clusters utilize DNA charge transport (CT) as a first step in the detection of DNA lesions. Here, several mutants of EndoIII were prepared to probe their efficiency of DNA/protein charge transport. Cyclic voltammetry experiments on DNA-modified electrodes show that aromatic residues F30...

  7. 3,N4-ethenocytosine, a highly mutagenic adduct, is a primary substrate for Escherichia coli double-stranded uracil-DNA glycosylase and human mismatch-specific thymine-DNA glycosylase

    OpenAIRE

    Saparbaev, Murat; Laval, Jacques

    1998-01-01

    Exocyclic DNA adducts are generated in cellular DNA by various industrial pollutants such as the carcinogen vinyl chloride and by endogenous products of lipid peroxidation. The etheno derivatives of purine and pyrimidine bases 3,N4-ethenocytosine (ɛC), 1,N6-ethenoadenine (ɛA), N2,3-ethenoguanine, and 1,N2-ethenoguanine cause mutations. The ɛA residues are excised by the human and the Escherichia coli 3-methyladenine-DNA glycosylases (ANPG and AlkA proteins, respectively), but the enzymes repa...

  8. Increase of O6-methylguanine-DNA-methyltransferase and N3-methyladenine glycosylase RNA transcripts in rat hepatoma cells treated with DNA-damaging agents

    International Nuclear Information System (INIS)

    A variety of DNA-damaging agents increase the O6-methylguanine-DNA-methyltransferase (transferase) and the N3-methyladenine (3-meAde)-DNA-glycosylase activities in a rat hepatoma cell line (H4 cells). Using two cDNA expressing either the rat 3-meAde-DNA-glycosylase or the transferase, the level of mRNA transcripts was measured by hybridization in H4 cells treated with three different inducing agents, gamma-rays, cis-dichlorodiammine platinum II or N-methyl-9-hydroxy ellipticinium. The two mRNA increased 24 hours after the cell treatments but this enhanced transcription was a transient phenomenon, as it was no longer observed after 96 hours. No significant DNA amplification was detectable in the treated cells

  9. The DNA glycosylases OGG1 and NEIL3 influence differentiation potential, proliferation, and senescence-associated signs in neural stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Reis, Amilcar [Linnaeus Center in Developmental Biology for Regenerative Medicine (DBRM), Department of Neuroscience, Karolinska Institutet, SE 17177 Stockholm (Sweden); Hermanson, Ola, E-mail: ola.hermanson@ki.se [Linnaeus Center in Developmental Biology for Regenerative Medicine (DBRM), Department of Neuroscience, Karolinska Institutet, SE 17177 Stockholm (Sweden)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer DNA glycosylases OGG1 and NEIL3 are required for neural stem cell state. Black-Right-Pointing-Pointer No effect on cell viability by OGG1 or NEIL3 knockdown in neural stem cells. Black-Right-Pointing-Pointer OGG1 or NEIL3 RNA knockdown result in decreased proliferation and differentiation. Black-Right-Pointing-Pointer Increased HP1{gamma} immunoreactivity after NEIL3 knockdown suggests premature senescence. -- Abstract: Embryonic neural stem cells (NSCs) exhibit self-renewal and multipotency as intrinsic characteristics that are key parameters for proper brain development. When cells are challenged by oxidative stress agents the resulting DNA lesions are repaired by DNA glycosylases through the base excision repair (BER) pathway as a means to maintain the fidelity of the genome, and thus, proper cellular characteristics. The functional roles for DNA glycosylases in NSCs have however remained largely unexplored. Here we demonstrate that RNA knockdown of the DNA glycosylases OGG1 and NEIL3 decreased NSC differentiation ability and resulted in decreased expression of both neuronal and astrocytic genes after mitogen withdrawal, as well as the stem cell marker Musashi-1. Furthermore, while cell survival remained unaffected, NEIL3 deficient cells displayed decreased cell proliferation rates along with an increase in HP1{gamma} immunoreactivity, a sign of premature senescence. Our results suggest that DNA glycosylases play multiple roles in governing essential neural stem cell characteristics.

  10. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Jingjin; Ma, Yefei [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Kong, Rongmei [The Key Laboratory of Life-Organic Analysis, College of Chemistry and Chemical Engineering, Qufu Normal University, Qufu, Shandong 273165 (China); Zhang, Liangliang, E-mail: liangzhang319@163.com [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Yang, Wen; Zhao, Shulin [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China)

    2015-08-05

    Herein, we introduced a tungsten disulfide (WS{sub 2}) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3′-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS{sub 2} nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS{sub 2} nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics. - Highlights: • A fluorescence polarization strategy for DNA glycosylase activity detection was developed. • The present method was based on WS{sub 2} nanosheet and exonuclease III co-assisted signal amplification. • A high sensitivity and desirable selectivity were achieved. • This method provides a promising universal platform for DNA

  11. Differential regulation of S-region hypermutation and class-switch recombination by noncanonical functions of uracil DNA glycosylase

    OpenAIRE

    Yousif, Ashraf S.; Stanlie, Andre; Mondal, Samiran; Honjo, Tasuku; Begum, Nasim A.

    2014-01-01

    Uracil DNA glycosylase (UNG) has been known as a critical base excision repair protein required for class switch recombination (CSR) and somatic hypermutation (SHM). On the other hand, its precise function in both CSR and SHM is extremely debatable and elusive. Here, we showed that UNG suppresses S region SHM (s-SHM) by recruiting the faithful DNA repair complex and, in the absence of UNG, the error-prone repair complex that induces s-SHM overrides. Moreover, UNG promotes activation-induced c...

  12. Human proteins that specifically bind to 8-oxoguanine-containing RNA and their responses to oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Hayakawa, Hiroshi, E-mail: hiroshi@college.fdcnet.ac.jp [Department of Functional Bioscience and Advanced Science Research Center, Fukuoka Dental College, Fukuoka 814-0193 (Japan); Fujikane, Aya; Ito, Riyoko [Department of Functional Bioscience and Advanced Science Research Center, Fukuoka Dental College, Fukuoka 814-0193 (Japan); Matsumoto, Masaki; Nakayama, Keiichi I. [Department of Molecular and Cellular Biology, Medical Institute of Bioregulation, Kyushu University, Fukuoka 812-8582 (Japan); Sekiguchi, Mutsuo [Department of Functional Bioscience and Advanced Science Research Center, Fukuoka Dental College, Fukuoka 814-0193 (Japan)

    2010-12-10

    Research highlights: {yields} We performed comprehensive survey for proteins that bind to oxidized RNA. {yields} HNRNPD and HNRNPC proteins were identified as oxidized RNA binding proteins. {yields} Knockdown of HNRNPD/C expression caused increased sensitivity to H{sub 2}O{sub 2}. {yields} Amounts of HNRNPD protein rapidly decreased when cells were exposed to H{sub 2}O{sub 2}. -- Abstract: Exposure of cells to oxygen radicals damage various biologically important molecules. Among the oxidized bases produced in nucleic acids, 8-oxo-7,8-dihydroguanine (8-oxoguanine) is particularly important since it causes base mispairing. To ensure accurate gene expression, organisms must have a mechanism to discriminate 8-oxoguanine-containing RNA from normal transcripts. We searched for proteins that specifically bind to 8-oxoguanine-containing RNA from human HeLa cell extracts, and the candidate proteins were identified using mass spectrometry. Among the identified candidates, splicing isoform 1 of heterogeneous nuclear ribonucleoprotein D0 (HNRNPD) and splicing isoform C1 of heterogeneous nuclear ribonucleoprotein C1/C2 (HNRNPC) exhibited strong abilities to bind to oxidized RNA. The amount of HNRNPD protein rapidly decreased when cells were exposed to hydrogen peroxide, an agent that enhances oxidative stress. Moreover, the suppression of HNRNPD expression by siRNA caused cells to exhibit an increased sensitivity to hydrogen peroxide. The application of siRNA against HNRNPC also caused an increase in sensitivity to hydrogen peroxide. Since no additive effect was observed with a combined addition of siRNAs for HNRNPD and HNRNPC, we concluded that the two proteins may function in the same mechanism for the accurate gene expression.

  13. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

    Energy Technology Data Exchange (ETDEWEB)

    Fortes, F.P. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Kuasne, H. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Marchi, F.A. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Programa Inter-Institucional em Bioinformtica, Instituto de Matemtica e Estatstica, Universidade So Paulo, So Paulo, SP (Brazil); Miranda, P.M. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Rogatto, S.R. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Achatz, M.I. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Oncogentica, A.C. Camargo Cancer Center, So Paulo, SP (Brazil)

    2015-04-28

    Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.

  14. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

    International Nuclear Information System (INIS)

    Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results

  15. Expansion Mechanisms and Evolutionary History on Genes Encoding DNA Glycosylases and Their Involvement in Stress and Hormone Signaling.

    Science.gov (United States)

    Jiang, Shu-Ye; Ramachandran, Srinivasan

    2016-01-01

    DNA glycosylases catalyze the release of methylated bases. They play vital roles in the base excision repair pathway and might also function in DNA demethylation. At least three families of DNA glycosylases have been identified, which included 3'-methyladenine DNA glycosylase (MDG) I, MDG II, and HhH-GPD (Helix-hairpin-Helix and Glycine/Proline/aspartate (D)). However, little is known on their genome-wide identification, expansion, and evolutionary history as well as their expression profiling and biological functions. In this study, we have genome-widely identified and evolutionarily characterized these family members. Generally, a genome encodes only one MDG II gene in most of organisms. No MDG I or MDG II gene was detected in green algae. However, HhH-GPD genes were detectable in all available organisms. The ancestor species contain small size of MDG I and HhH-GPD families. These two families were mainly expanded through the whole-genome duplication and segmental duplication. They were evolutionarily conserved and were generally under purifying selection. However, we have detected recent positive selection among the Oryza genus, which might play roles in species divergence. Further investigation showed that expression divergence played important roles in gene survival after expansion. All of these family genes were expressed in most of developmental stages and tissues in rice plants. High ratios of family genes were downregulated by drought and fungus pathogen as well as abscisic acid (ABA) and jasmonic acid (JA) treatments, suggesting a negative regulation in response to drought stress and pathogen infection through ABA- and/or JA-dependent hormone signaling pathway. PMID:27026054

  16. Expansion Mechanisms and Evolutionary History on Genes Encoding DNA Glycosylases and Their Involvement in Stress and Hormone Signaling.

    Science.gov (United States)

    Jiang, Shu-Ye; Ramachandran, Srinivasan

    2016-04-25

    DNA glycosylases catalyze the release of methylated bases. They play vital roles in the base excision repair pathway and might also function in DNA demethylation. At least three families of DNA glycosylases have been identified, which included 3'-methyladenine DNA glycosylase (MDG) I, MDG II, and HhH-GPD (Helix-hairpin-Helix and Glycine/Proline/aspartate (D)). However, little is known on their genome-wide identification, expansion, and evolutionary history as well as their expression profiling and biological functions. In this study, we have genome-widely identified and evolutionarily characterized these family members. Generally, a genome encodes only one MDG II gene in most of organisms. No MDG I or MDG II gene was detected in green algae. However, HhH-GPD genes were detectable in all available organisms. The ancestor species contain small size of MDG I and HhH-GPD families. These two families were mainly expanded through the whole-genome duplication and segmental duplication. They were evolutionarily conserved and were generally under purifying selection. However, we have detected recent positive selection among the Oryza genus, which might play roles in species divergence. Further investigation showed that expression divergence played important roles in gene survival after expansion. All of these family genes were expressed in most of developmental stages and tissues in rice plants. High ratios of family genes were downregulated by drought and fungus pathogen as well as abscisic acid (ABA) and jasmonic acid (JA) treatments, suggesting a negative regulation in response to drought stress and pathogen infection through ABA- and/or JA-dependent hormone signaling pathway.

  17. BCR-ABL1 kinase inhibits uracil DNA glycosylase UNG2 to enhance oxidative DNA damage and stimulate genomic instability

    Science.gov (United States)

    Slupianek, Artur; Falinski, Rafal; Znojek, Pawel; Stoklosa, Tomasz; Flis, Sylwia; Doneddu, Valentina; Pytel, Dariusz; Synowiec, Ewelina; Blasiak, Janusz; Bellacosa, Alfonso; Skorski, Tomasz

    2013-01-01

    Tyrosine kinase inhibitors (TKIs) revolutionized the treatment of CML-CP. Unfortunately, 25% of TKI-naive patients and 50–90% of TKI-responding patients carry CML clones expressing TKI resistant BCR-ABL1 kinase mutants. We reported that CML-CP leukemia stem and progenitor cell populations accumulate high amounts of reactive oxygen species (ROS), which may result in accumulation of uracil derivatives in genomic DNA. Unfaithful and/or inefficient repair of these lesions generates TKI resistant point mutations in BCR-ABL1 kinase. Using an array of specific substrates and inhibitors/blocking antibodies we found that uracil-DNA glycosylase UNG2 were inhibited in BCR-ABL1 –transformed cell lines and CD34+ CML cells. The inhibitory effect was not accompanied by downregulation of nuclear expression and/or chromatin association of UNG2. The effect was BCR-ABL1 kinase-specific because several other fusion tyrosine kinases did not reduce UNG2 activity. Using UNG2-specific inhibitor UGI we found that reduction of UNG2 activity increased the number of uracil derivatives in genomic DNA detected by modified comet assay and facilitated accumulation of ouabain-resistant point mutations in reporter gene Na+/K+ATPase. In conclusion, we postulate that BCR-ABL1 kinase-mediated inhibition of UNG2 contributes to accumulation of point mutations responsible for TKI-resistance causing the disease relapse, and perhaps also other point mutations facilitating malignant progression of CML. PMID:23047475

  18. Dramatic reduction of sequence artefacts from DNA isolated from formalin-fixed cancer biopsies by treatment with uracil- DNA glycosylase.

    Science.gov (United States)

    Do, Hongdo; Dobrovic, Alexander

    2012-05-01

    Non-reproducible sequence artefacts are frequently detected in DNA from formalinfixed and paraffin-embedded (FFPE) tissues. However, no rational strategy has been developed for reduction of sequence artefacts from FFPE DNA as the underlying causes of the artefacts are poorly understood. As cytosine deamination to uracil is a common form of DNA damage in ancient DNA, we set out to examine whether treatment of FFPE DNA with uracil-DNA glycosylase (UDG) would lead to the reduction of C>T (and G>A) sequence artefacts. Heteroduplex formation in high resolution melting (HRM)-based assays was used for the detection of sequence variants in FFPE DNA samples. A set of samples that gave false positive HRM results for screening for the E17K mutation in exon 4 of the AKT1 gene were chosen for analysis. Sequencing of these samples showed multiple non-reproducible C:G>T:A artefacts. Treatment of the FFPE DNA with UDG prior to PCR amplification led to a very marked reduction of the sequence artefacts as indicated by both HRM and sequencing analysis, indicating that uracil lesions are the major cause of sequence artefacts. Similar results were shown for the BRAF V600 region in the same sample set and EGFR exon 19 in another sample set. UDG treatment specifically suppressed the formation of artefacts in FFPE DNA as it did not affect the detection of true KRAS codon 12 and true EGFR exon 19 and 20 mutations. We conclude that uracil in FFPE DNA leads to a significant proportion of sequence artefacts. These can be minimised by a simple UDG pretreatment which can be readily carried out, in the same tube, as the PCR immediately prior to commencing thermal cycling. HRM is a convenient way of monitoring both the degree of damage and the effectiveness of the UDG treatment. These findings have immediate and important implications for cancer diagnostics where FFPE DNA is used as the primary genetic material for mutational studies guiding personalised medicine strategies and where simple

  19. Metal inhibition of human alkylpurine-DNA-N-glycosylase activityin base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ping; Guliaev, Anton B.; Hang, Bo

    2006-02-28

    Cadmium (Cd{sup 2+}), nickel (Ni{sup 2+}) and cobalt (Co{sup 2+}) are human and/or animal carcinogens. Zinc (Zn{sup 2+}) is not categorized as a carcinogen, and rather an essential element to humans. Metals were recently shown to inhibit DNA repair proteins that use metals for their function and/or structure. Here we report that the divalent ions Cd{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} can inhibit the activity of a recombinant human N-methylpurine-DNA glycosylase (MPG) toward a deoxyoligonucleotide with ethenoadenine (var epsilonA). MPG removes a variety of toxic/mutagenic alkylated bases and does not require metal for its catalytic activity or structural integrity. At concentrations starting from 50 to 1000 {micro}M, both Cd{sup 2+} and Zn{sup 2+} showed metal-dependent inhibition of the MPG catalytic activity. Ni{sup 2+} also inhibited MPG, but to a lesser extent. Such an effect can be reversed with EDTA addition. In contrast, Co{sup 2+} and Mg{sup 2+} did not inhibit the MPG activity in the same dose range. Experiments using HeLa cell-free extracts demonstrated similar patterns of inactivation of the var epsilonA excision activity by the same metals. Binding of MPG to the substrate was not significantly affected by Cd{sup 2+}, Zn{sup 2+}, and Ni{sup 2+} at concentrations that show strong inhibition of the catalytic function, suggesting that the reduced catalytic activity is not due to altered MPG binding affinity to the substrate. Molecular dynamics (MD) simulations with Zn{sup 2+} showed that the MPG active site has a potential binding site for Zn{sup 2+}, formed by several catalytically important and conserved residues. Metal binding to such a site is expected to interfere with the catalytic mechanism of this protein. These data suggest that inhibition of MPG activity may contribute to metal genotoxicity and depressed repair of alkylation damage by metals in vivo.

  20. Structure-function studies of an unusual 3-methyladenine DNA glycosylase II (AlkA) from Deinococcus radiodurans.

    Science.gov (United States)

    Moe, Elin; Hall, David R; Leiros, Ingar; Monsen, Vivi Talstad; Timmins, Joanna; McSweeney, Sean

    2012-06-01

    3-Methyladenine DNA glycosylase II (AlkA) is a DNA-repair enzyme that removes alkylated bases in DNA via the base-excision repair (BER) pathway. The enzyme belongs to the helix-hairpin-helix (HhH) superfamily of DNA glycosylases and possesses broad substrate specificity. In the genome of Deinococcus radiodurans, two genes encoding putative AlkA have been identified (Dr_2074 and Dr_2584). Dr_2074 is a homologue of human AlkA (MPG or AAG) and Dr_2584 is a homologue of bacterial AlkAs. Here, the three-dimensional structure of Dr_2584 (DrAlkA2) is presented and compared with the previously determined structure of Escherichia coli AlkA (EcAlkA). The results show that the enzyme consists of two helical-bundle domains separated by a wide DNA-binding cleft and contains an HhH motif. Overall, the protein fold is similar to the two helical-bundle domains of EcAlkA, while the third N-terminal mixed α/β domain observed in EcAlkA is absent. Substrate-specificity analyses show that DrAlkA2, like EcAlkA, is able to remove both 3-methyladenine (3meA) and 7-methylguanine (7meG) from DNA; however, the enzyme possesses no activity towards 1,N(6)-ethenoadenine (ℇA) and hypoxanthine (Hx). In addition, it shows activity towards the AlkB dioxygenase substrates 3-methylcytosine (3meC) and 1-methyladenine (1meA). Thus, the enzyme seems to preferentially repair methylated bases with weakened N-glycosidic bonds; this is an unusual specificity for a bacterial AlkA protein and is probably dictated by a combination of the wide DNA-binding cleft and a highly accessible specificity pocket.

  1. BCR-ABL1 kinase inhibits uracil DNA glycosylase UNG2 to enhance oxidative DNA damage and stimulate genomic instability.

    Science.gov (United States)

    Slupianek, A; Falinski, R; Znojek, P; Stoklosa, T; Flis, S; Doneddu, V; Pytel, D; Synowiec, E; Blasiak, J; Bellacosa, A; Skorski, T

    2013-03-01

    Tyrosine kinase inhibitors (TKIs) revolutionized the treatment of chronic myeloid leukemia in chronic phase (CML-CP). Unfortunately, 25% of TKI-naive patients and 50-90% of patients developing TKI-resistance carry CML clones expressing TKI-resistant BCR-ABL1 kinase mutants. We reported that CML-CP leukemia stem and progenitor cell populations accumulate high amounts of reactive oxygen species, which may result in accumulation of uracil derivatives in genomic DNA. Unfaithful and/or inefficient repair of these lesions generates TKI-resistant point mutations in BCR-ABL1 kinase. Using an array of specific substrates and inhibitors/blocking antibodies we found that uracil DNA glycosylase UNG2 were inhibited in BCR-ABL1-transformed cell lines and CD34(+) CML cells. The inhibitory effect was not accompanied by downregulation of nuclear expression and/or chromatin association of UNG2. The effect was BCR-ABL1 kinase-specific because several other fusion tyrosine kinases did not reduce UNG2 activity. Using UNG2-specific inhibitor UGI, we found that reduction of UNG2 activity increased the number of uracil derivatives in genomic DNA detected by modified comet assay and facilitated accumulation of ouabain-resistant point mutations in reporter gene Na(+)/K(+)ATPase. In conclusion, we postulate that BCR-ABL1 kinase-mediated inhibition of UNG2 contributes to accumulation of point mutations responsible for TKI resistance causing the disease relapse, and perhaps also other point mutations facilitating malignant progression of CML.

  2. Characterization of a novel DNA glycosylase from S. sahachiroi involved in the reduction and repair of azinomycin B induced DNA damage.

    Science.gov (United States)

    Wang, Shan; Liu, Kai; Xiao, Le; Yang, LiYuan; Li, Hong; Zhang, FeiXue; Lei, Lei; Li, ShengQing; Feng, Xu; Li, AiYing; He, Jing

    2016-01-01

    Azinomycin B is a hybrid polyketide/nonribosomal peptide natural product and possesses antitumor activity by interacting covalently with duplex DNA and inducing interstrand crosslinks. In the biosynthetic study of azinomycin B, a gene (orf1) adjacent to the azinomycin B gene cluster was found to be essential for the survival of the producer, Streptomyces sahachiroi ATCC33158. Sequence analyses revealed that Orf1 belongs to the HTH_42 superfamily of conserved bacterial proteins which are widely distributed in pathogenic and antibiotic-producing bacteria with unknown functions. The protein exhibits a protective effect against azinomycin B when heterologously expressed in azinomycin-sensitive strains. EMSA assays showed its sequence nonspecific binding to DNA and structure-specific binding to azinomycin B-adducted sites, and ChIP assays revealed extensive association of Orf1 with chromatin in vivo. Interestingly, Orf1 not only protects target sites by protein-DNA interaction but is also capable of repairing azinomycin B-mediated DNA cross-linking. It possesses the DNA glycosylase-like activity and specifically repairs DNA damage induced by azinomycin B through removal of both adducted nitrogenous bases in the cross-link. This bifunctional protein massively binds to genomic DNA to reduce drug attack risk as a novel DNA binding protein and triggers the base excision repair system as a novel DNA glycosylase.

  3. Slow base excision by human alkyladenine DNA glycosylase limits the rate of formation of AP sites and AP endonuclease 1 does not stimulate base excision.

    Science.gov (United States)

    Maher, Robyn L; Vallur, Aarthy C; Feller, Joyce A; Bloom, Linda B

    2007-01-01

    The base excision repair pathway removes damaged DNA bases and resynthesizes DNA to replace the damage. Human alkyladenine DNA glycosylase (AAG) is one of several damage-specific DNA glycosylases that recognizes and excises damaged DNA bases. AAG removes primarily damaged adenine residues. Human AP endonuclease 1 (APE1) recognizes AP sites produced by DNA glycosylases and incises the phophodiester bond 5' to the damaged site. The repair process is completed by a DNA polymerase and DNA ligase. If not tightly coordinated, base excision repair could generate intermediates that are more deleterious to the cell than the initial DNA damage. The kinetics of AAG-catalyzed excision of two damaged bases, hypoxanthine and 1,N6-ethenoadenine, were measured in the presence and absence of APE1 to investigate the mechanism by which the base excision activity of AAG is coordinated with the AP incision activity of APE1. 1,N6-ethenoadenine is excised significantly slower than hypoxanthine and the rate of excision is not affected by APE1. The excision of hypoxanthine is inhibited to a small degree by accumulated product, and APE1 stimulates multiple turnovers by alleviating product inhibition. These results show that APE1 does not significantly affect the kinetics of base excision by AAG. It is likely that slow excision by AAG limits the rate of AP site formation in vivo such that AP sites are not created faster than can be processed by APE1. PMID:17018265

  4. Sensitive and selective real-time electrochemical monitoring of DNA repair (Presentation Recording)

    Science.gov (United States)

    Slinker, Jason D.; McWilliams, Marc; Anka, Fadwa; Balkus, Kenneth

    2015-10-01

    Unrepaired DNA damage can lead to mutation, cancer, and death of cells or organisms. However, due to the subtlety of DNA damage, it is difficult to sense the repair of damage products with high selectivity and sensitivity. Here, we show sensitive and selective electrochemical sensing of the repair activity of 8-oxoguanine and uracil glycosylases within DNA monolayers on gold by multiplexed analysis with silicon chips and low-cost electrospun nanofibers. Our approach involves comparing the electrochemical signal of redox probe modified monolayers containing the defect versus the rational control of defect-free monolayers. We find sequence-specific sensitivity thresholds on the order of femtomoles of proteins and dynamic ranges of over two orders of magnitude for each target. For 8-oxoguanine repair, temperature-dependent kinetics are extracted, showing exponential signal loss with time constants of seconds. Electrospun fibers are shown to behave similarly to conventional gold-on-silicon devices, showing the potential of these low-cost devices for sensing applications.

  5. Opinion: uracil DNA glycosylase (UNG) plays distinct and non-canonical roles in somatic hypermutation and class switch recombination.

    Science.gov (United States)

    Yousif, Ashraf S; Stanlie, Andre; Begum, Nasim A; Honjo, Tasuku

    2014-10-01

    Activation-induced cytidine deaminase (AID) is essential to class switch recombination (CSR) and somatic hypermutation (SHM). Uracil DNA glycosylase (UNG), a member of the base excision repair complex, is required for CSR. The role of UNG in CSR and SHM is extremely controversial. AID deficiency in mice abolishes both CSR and SHM, while UNG-deficient mice have drastically reduced CSR but augmented SHM raising a possibility of differential functions of UNG in CSR and SHM. Interestingly, UNG has been associated with a CSR-specific repair adapter protein Brd4, which interacts with acetyl histone 4, γH2AX and 53BP1 to promote non-homologous end joining during CSR. A non-canonical scaffold function of UNG, but not the catalytic activity, can be attributed to the recruitment of essential repair proteins associated with the error-free repair during SHM, and the end joining during CSR. PMID:24994819

  6. Differential regulation of S-region hypermutation and class-switch recombination by noncanonical functions of uracil DNA glycosylase

    Science.gov (United States)

    Yousif, Ashraf S.; Stanlie, Andre; Mondal, Samiran; Honjo, Tasuku; Begum, Nasim A.

    2014-01-01

    Activation-induced cytidine deaminase (AID) is essential to class-switch recombination (CSR) and somatic hypermutation (SHM) in both V region SHM and S region SHM (s-SHM). Uracil DNA glycosylase (UNG), a member of the base excision repair (BER) complex, is required for CSR. Strikingly, however, UNG deficiency causes augmentation of SHM, suggesting involvement of distinct functions of UNG in SHM and CSR. Here, we show that noncanonical scaffold functions of UNG regulate s-SHM negatively and CSR positively. The s-SHM suppressive function of UNG is attributed to the recruitment of faithful BER components at the cleaved DNA locus, with competition against error-prone polymerases. By contrast, the CSR-promoting function of UNG enhances AID-dependent S-S synapse formation by recruiting p53-binding protein 1 and DNA-dependent protein kinase, catalytic subunit. Several loss-of-catalysis mutants of UNG discriminated CSR-promoting activity from s-SHM suppressive activity. Taken together, the noncanonical function of UNG regulates the steps after AID-induced DNA cleavage: error-prone repair suppression in s-SHM and end-joining promotion in CSR. PMID:24591630

  7. Differential regulation of S-region hypermutation and class-switch recombination by noncanonical functions of uracil DNA glycosylase.

    Science.gov (United States)

    Yousif, Ashraf S; Stanlie, Andre; Mondal, Samiran; Honjo, Tasuku; Begum, Nasim A

    2014-03-18

    Activation-induced cytidine deaminase (AID) is essential to class-switch recombination (CSR) and somatic hypermutation (SHM) in both V region SHM and S region SHM (s-SHM). Uracil DNA glycosylase (UNG), a member of the base excision repair (BER) complex, is required for CSR. Strikingly, however, UNG deficiency causes augmentation of SHM, suggesting involvement of distinct functions of UNG in SHM and CSR. Here, we show that noncanonical scaffold functions of UNG regulate s-SHM negatively and CSR positively. The s-SHM suppressive function of UNG is attributed to the recruitment of faithful BER components at the cleaved DNA locus, with competition against error-prone polymerases. By contrast, the CSR-promoting function of UNG enhances AID-dependent S-S synapse formation by recruiting p53-binding protein 1 and DNA-dependent protein kinase, catalytic subunit. Several loss-of-catalysis mutants of UNG discriminated CSR-promoting activity from s-SHM suppressive activity. Taken together, the noncanonical function of UNG regulates the steps after AID-induced DNA cleavage: error-prone repair suppression in s-SHM and end-joining promotion in CSR. PMID:24591630

  8. Structure/Function Analysis of DNA-glycosylases That Repair Oxidized Purines and Pyrimidines and the Influence of Surrounding DNA Sequence on Their Interactions

    Energy Technology Data Exchange (ETDEWEB)

    Wallace, Susan S.

    2005-08-22

    The overall goal of this project was to elucidate the structure/function relationships between oxidized DNA bases and the DNA repair enzymes that recognize and remove them. The NMR solution structure of formamidopyrimidine DNA glycosylase (Fpg) that recognizes oxidized DNA purines was to be determined. Furthermore, the solution structures of DNA molecules containing specific lesions recognized by Fpg was to be determined in sequence contexts that either facilitate or hinder this recognition. These objectives were in keeping with the long-term goals of the Principal Investigator's laboratory, that is, to understand the basic mechanisms that underpin base excision repair processing of oxidative DNA lesions and to elucidate the interactions of unrepaired lesions with DNA polymerases. The results of these two DNA transactions can ultimately determine the fate of the cell. These objectives were also in keeping with the goals of our collaborator, Dr. Michael Kennedy, who is studying the repair and recognition of damaged DNA. Overall the goals of this project were congruent with those of the Department of Energy's Health Effects and Life Sciences Research Program, especially to the Structural Biology, the Human Genome and the Health Effects Programs. The mission of the latter Program includes understanding the biological effects and consequences of DNA damages produced by toxic agents in the many DOE waste sites so that cleanup can be accomplished in a safe, effective and timely manner.

  9. The disordered C-terminal domain of human DNA glycosylase NEIL1 contributes to its stability via intramolecular interactions.

    Science.gov (United States)

    Hegde, Muralidhar L; Tsutakawa, Susan E; Hegde, Pavana M; Holthauzen, Luis Marcelo F; Li, Jing; Oezguen, Numan; Hilser, Vincent J; Tainer, John A; Mitra, Sankar

    2013-07-10

    NEIL1 [Nei (endonuclease VIII)-like protein 1], one of the five mammalian DNA glycosylases that excise oxidized DNA base lesions in the human genome to initiate base excision repair, contains an intrinsically disordered C-terminal domain (CTD; ~100 residues), not conserved in its Escherichia coli prototype Nei. Although dispensable for NEIL1's lesion excision and AP lyase activities, this segment is required for efficient in vivo enzymatic activity and may provide an interaction interface for many of NEIL1's interactions with other base excision repair proteins. Here, we show that the CTD interacts with the folded domain in native NEIL1 containing 389 residues. The CTD is poised for local folding in an ordered structure that is induced in the purified fragment by osmolytes. Furthermore, deletion of the disordered tail lacking both Tyr and Trp residues causes a red shift in NEIL1's intrinsic Trp-specific fluorescence, indicating a more solvent-exposed environment for the Trp residues in the truncated protein, which also exhibits reduced stability compared to the native enzyme. These observations are consistent with stabilization of the native NEIL1 structure via intramolecular, mostly electrostatic, interactions that were disrupted by mutating a positively charged (Lys-rich) cluster of residues (amino acids 355-360) near the C-terminus. Small-angle X-ray scattering (SAXS) analysis confirms the flexibility and dynamic nature of NEIL1's CTD, a feature that may be critical to providing specificity for NEIL1's multiple, functional interactions.

  10. Accelerated repair and reduced mutagenicity of DNA damage induced by cigarette smoke in human bronchial cells transfected with E.coli formamidopyrimidine DNA glycosylase.

    Directory of Open Access Journals (Sweden)

    Mara Foresta

    Full Text Available Cigarette smoke (CS is associated to a number of pathologies including lung cancer. Its mutagenic and carcinogenic effects are partially linked to the presence of reactive oxygen species and polycyclic aromatic hydrocarbons (PAH inducing DNA damage. The bacterial DNA repair enzyme formamidopyrimidine DNA glycosylase (FPG repairs both oxidized bases and different types of bulky DNA adducts. We investigated in vitro whether FPG expression may enhance DNA repair of CS-damaged DNA and counteract the mutagenic effects of CS in human lung cells. NCI-H727 non small cell lung carcinoma cells were transfected with a plasmid vector expressing FPG fused to the Enhanced Green Fluorescent Protein (EGFP. Cells expressing the fusion protein EGFP-FPG displayed accelerated repair of adducts and DNA breaks induced by CS condensate. The mutant frequencies induced by low concentrations of CS condensate to the Na(+K(+-ATPase locus (oua(r were significantly reduced in cells expressing EGFP-FPG. Hence, expression of the bacterial DNA repair protein FPG stably protects human lung cells from the mutagenic effects of CS by improving cells' capacity to repair damaged DNA.

  11. Neil3 DNA Glycosylase in Maintenance and Repair of the Mammalian Brain

    OpenAIRE

    2012-01-01

    The DNA molecule is susceptible to damage induced by cellular metabolites and exogenous DNA damaging agents. Reactive oxygen species (ROS), generated as respiration by-products or arising from inflammatory reactions, are the most abundant endogenous DNA damaging agents and lead to the formation of a number of mutagenic and cytotoxic DNA lesions. To preserve DNA integrity and allow correct transmission of genetic information, several pathways for the repair of such lesions have evolved. Among ...

  12. Partial uracil–DNA–glycosylase treatment for screening of ancient DNA

    OpenAIRE

    Rohland, Nadin; Harney, Eadaoin; Mallick, Swapan; Nordenfelt, Susanne; Reich, David

    2015-01-01

    The challenge of sequencing ancient DNA has led to the development of specialized laboratory protocols that have focused on reducing contamination and maximizing the number of molecules that are extracted from ancient remains. Despite the fact that success in ancient DNA studies is typically obtained by screening many samples to identify a promising subset, ancient DNA protocols have not, in general, focused on reducing the time required to screen samples. We present an adaptation of a popula...

  13. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers.

    Science.gov (United States)

    Osorio, Ana; Milne, Roger L; Kuchenbaecker, Karoline; Vaclová, Tereza; Pita, Guillermo; Alonso, Rosario; Peterlongo, Paolo; Blanco, Ignacio; de la Hoya, Miguel; Duran, Mercedes; Díez, Orland; Ramón Y Cajal, Teresa; Konstantopoulou, Irene; Martínez-Bouzas, Cristina; Andrés Conejero, Raquel; Soucy, Penny; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; Swe-Brca; Arver, Brita; Rantala, Johanna; Loman, Niklas; Ehrencrona, Hans; Olopade, Olufunmilayo I; Beattie, Mary S; Domchek, Susan M; Nathanson, Katherine; Rebbeck, Timothy R; Arun, Banu K; Karlan, Beth Y; Walsh, Christine; Lester, Jenny; John, Esther M; Whittemore, Alice S; Daly, Mary B; Southey, Melissa; Hopper, John; Terry, Mary B; Buys, Saundra S; Janavicius, Ramunas; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Steele, Linda; Neuhausen, Susan L; Ding, Yuan Chun; Hansen, Thomas V O; Jønson, Lars; Ejlertsen, Bent; Gerdes, Anne-Marie; Infante, Mar; Herráez, Belén; Moreno, Leticia Thais; Weitzel, Jeffrey N; Herzog, Josef; Weeman, Kisa; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Bonanni, Bernardo; Mariette, Frederique; Volorio, Sara; Viel, Alessandra; Varesco, Liliana; Papi, Laura; Ottini, Laura; Tibiletti, Maria Grazia; Radice, Paolo; Yannoukakos, Drakoulis; Garber, Judy; Ellis, Steve; Frost, Debra; Platte, Radka; Fineberg, Elena; Evans, Gareth; Lalloo, Fiona; Izatt, Louise; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Cole, Trevor; Eccles, Diana; Cook, Jackie; Hodgson, Shirley; Brewer, Carole; Tischkowitz, Marc; Douglas, Fiona; Porteous, Mary; Side, Lucy; Walker, Lisa; Morrison, Patrick; Donaldson, Alan; Kennedy, John; Foo, Claire; Godwin, Andrew K; Schmutzler, Rita Katharina; Wappenschmidt, Barbara; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hans Jörg; Niederacher, Dieter; Sutter, Christian; Wang-Gohrke, Shan; Steinemann, Doris; Preisler-Adams, Sabine; Kast, Karin; Varon-Mateeva, Raymonda; Gehrig, Andrea; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M; Mazoyer, Sylvie; Damiola, Francesca; Poppe, Bruce; Claes, Kathleen; Piedmonte, Marion; Tucker, Kathy; Backes, Floor; Rodríguez, Gustavo; Brewster, Wendy; Wakeley, Katie; Rutherford, Thomas; Caldés, Trinidad; Nevanlinna, Heli; Aittomäki, Kristiina; Rookus, Matti A; van Os, Theo A M; van der Kolk, Lizet; de Lange, J L; Meijers-Heijboer, Hanne E J; van der Hout, A H; van Asperen, Christi J; Gómez Garcia, Encarna B; Hoogerbrugge, Nicoline; Collée, J Margriet; van Deurzen, Carolien H M; van der Luijt, Rob B; Devilee, Peter; Hebon; Olah, Edith; Lázaro, Conxi; Teulé, Alex; Menéndez, Mireia; Jakubowska, Anna; Cybulski, Cezary; Gronwald, Jacek; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Johannsson, Oskar Th; Maugard, Christine; Montagna, Marco; Tognazzo, Silvia; Teixeira, Manuel R; Healey, Sue; Investigators, Kconfab; Olswold, Curtis; Guidugli, Lucia; Lindor, Noralane; Slager, Susan; Szabo, Csilla I; Vijai, Joseph; Robson, Mark; Kauff, Noah; Zhang, Liying; Rau-Murthy, Rohini; Fink-Retter, Anneliese; Singer, Christian F; Rappaport, Christine; Geschwantler Kaulich, Daphne; Pfeiler, Georg; Tea, Muy-Kheng; Berger, Andreas; Phelan, Catherine M; Greene, Mark H; Mai, Phuong L; Lejbkowicz, Flavio; Andrulis, Irene; Mulligan, Anna Marie; Glendon, Gord; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Sunde, Lone; Thomassen, Mads; Kruse, Torben A; Jensen, Uffe Birk; Friedman, Eitan; Laitman, Yael; Shimon, Shani Paluch; Simard, Jacques; Easton, Douglas F; Offit, Kenneth; Couch, Fergus J; Chenevix-Trench, Georgia; Antoniou, Antonis C; Benitez, Javier

    2014-04-01

    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase), and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2). Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2) gene (HR: 1.09, 95% CI (1.03-1.16), p = 2.7 × 10(-3)) for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase) gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03-1.21, p = 4.8 × 10(-3)). DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied.

  14. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers.

    Directory of Open Access Journals (Sweden)

    Ana Osorio

    2014-04-01

    Full Text Available Single Nucleotide Polymorphisms (SNPs in genes involved in the DNA Base Excision Repair (BER pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase, and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2. Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2 gene (HR: 1.09, 95% CI (1.03-1.16, p = 2.7 × 10(-3 for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03-1.21, p = 4.8 × 10(-3. DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied.

  15. Pathophysiology of Bronchoconstriction: Role of Oxidatively Damaged DNA Repair

    Science.gov (United States)

    Bacsi, Attila; Pan, Lang; Ba, Xueqing; Boldogh, Istvan

    2016-01-01

    Purpose of review To provide an overview on the present understanding of roles of oxidative DNA damage repair in cell signaling underlying bronchoconstriction common to, but not restricted to various forms of asthma and chronic obstructive pulmonary disease Recent findings Bronchoconstriction is a tightening of smooth muscle surrounding the bronchi and bronchioles with consequent wheezing and shortness of breath. Key stimuli include air pollutants, viral infections, allergens, thermal and osmotic changes, and shear stress of mucosal epithelium, triggering a wide range of cellular, vascular and neural events. Although activation of nerve fibers, the role of G-proteins, protein kinases and Ca++, and molecular interaction within contracting filaments of muscle are well defined, the overarching mechanisms by which a wide range of stimuli initiate these events are not fully understood. Many, if not all, stimuli increase levels of reactive oxygen species (ROS), which are signaling and oxidatively modifying macromolecules, including DNA. The primary ROS target in DNA is guanine, and 8-oxoguanine is one of the most abundant base lesions. It is repaired by 8-oxoguanine DNA glycosylase1 (OGG1) during base excision repair processes. The product, free 8-oxoG base, is bound by OGG1 with high affinity, and the complex then functions as an activator of small GTPases, triggering pathways for inducing gene expression and contraction of intracellular filaments in mast and smooth muscle cells. Summary Oxidative DNA damage repair-mediated cell activation signaling result in gene expression that “primes” the mucosal epithelium and submucosal tissues to generate mediators of airway smooth muscle contractions. PMID:26694039

  16. The DNA glycosylases Ogg1 and Nth1 do not contribute to Ig class switching in activated mouse splenic B cells.

    Directory of Open Access Journals (Sweden)

    Anna J Ucher

    Full Text Available During activation of B cells to undergo class switching, B cell metabolism is increased, and levels of reactive oxygen species (ROS are increased. ROS can oxidize DNA bases resulting in substrates for the DNA glycosylases Ogg1 and Nth1. Ogg1 and Nth1 excise oxidized bases, and nick the resulting abasic sites, forming single-strand DNA breaks (SSBs as intermediates during the repair process. In this study, we asked whether splenic B cells from mice deficient in these two enzymes would show altered class switching and decreased DNA breaks in comparison with wild-type mice. As the c-myc gene frequently recombines with the IgH S region in B cells induced to undergo class switching, we also analyzed the effect of deletion of these two glycosylases on DSBs in the c-myc gene. We did not detect a reduction in S region or c-myc DSBs or in class switching in splenic B cells from Ogg1- or Nth1-deficient mice or from mice deficient in both enzymes.

  17. DNA Repair Glycosylases with a [4Fe-4S] Cluster: A Redox Cofactor for DNA-mediated Charge Transport?

    OpenAIRE

    Boal, Amie K.; Yavin, Eylon; Barton, Jacqueline K.

    2007-01-01

    The [4Fe-4S] cluster is ubiquitous to a class of base excision repair enzymes, in organisms ranging from bacteria to man, and was first considered as a structural element, owing to its redox stability under physiological conditions. When studied bound to DNA, two of these repair proteins (MutY and Endonuclease III from Escherichia coli) display DNA-dependent reversible electron transfer with characteristics typical of high potential iron proteins. These results have inspired a reexamination o...

  18. An OGG1 polymorphism is associated with mitochondrial DNA content in pesticide-exposed fruit growers

    International Nuclear Information System (INIS)

    Highlights: → Individuals experiencing pesticide exposure had greater mtDNA content. → OGG1 genotype may modulate mtDNA content in pesticide-exposed fruit growers. → No association between MnSOD genotypes and mtDNA content was revealed in this study. -- Abstract: Exposure to pesticides has the capacity to cause mitochondrial dysfunction. An increase mitochondrial DNA (mtDNA) content has also been suggested to relate with DNA damaging agent. In mitochondria, the manganese superoxide dismutase (MnSOD) is a scavenger of reactive oxygen species, and the 8-oxoguanine DNA glycosylase (OGG1) is the major DNA glycosylase for the repair of 8-oxoG lesions. However, the alteration of mtDNA content elicited by pesticide exposure in people with genetic variations in MnSOD or OGG1 has not been investigated. In this study, the mitochondrial to nuclear DNA ratio was quantified in the peripheral blood of 120 fruit growers who experienced pesticide exposure and 106 unexposed controls by real-time quantitative polymerase chain reaction (real-time qPCR). Questionnaires were administered to obtain demographic data and occupational history. The MnSOD and OGG1 genotypes were identified by the PCR based restriction fragment length polymorphism analysis. After adjusting for confounding effects, multiple regression model revealed that subjects experiencing high or low pesticide exposure had a greater mtDNA content than that of controls. The OGG1 Ser-Ser genotype was also associated with an increased mtDNA content. No association between MnSOD genotype and mtDNA content was revealed. Thus, subjects experiencing pesticide exposure had greater mtDNA content and the OGG1 genotype may modulate mtDNA content in pesticide-exposed fruit growers.

  19. Mechanistic studies of ionizing radiation and oxidative mutagenesis: Genetic effects of a single 8-hydroxyguanine (7-hydro-8-oxoguanine) residue inserted at a unique site in a viral genome

    International Nuclear Information System (INIS)

    T4 RNA ligase was used to construct a deoxypentanucleotide containing a single 8-hydroxyguanine (7-hydro-8-oxoguanine; G8-OH) residue, which is one of the putatively mutagenic DNA adducts produced by oxidants and ionizing radiation. The pentamer d(GCTAG8-OH)p was prepared by the ligation of a chemically synthesized acceptor molecule, d(GCTA), to an adducted donor, 8-hydroxy-2'-deoxyguanosine 5',3'-bisphosphate. Following 3'-dephosphorylation, the pentamer was characterized by UV spectroscopy, by high-pressure liquid chromatography, and by gas chromatography-mass spectrometry of the nucleosides released by enzymatic hydrolysis. Both d(GCTAG8-OH) and an unmodified control were 5'-phosphorylated by using [γ-32P]ATP and incorporated covalently by DNA ligase into a five-base gap at a unique NheI restriction site in the otherwise duplex genome of an M13mp19 derivative. The adduct was part of a nonsense codon in a unique restriction site in order to facilitate the identification and selection of mutants generated by the replication of the modified genome in Escherichia coli. Both control and adducted pentamers ligated into the genome at 50% of the maximum theoretical efficiency, and nearly all of the site-specifically adducted products possessed pentanucleotides that were covalently linked at both 5' and 3' termini. Transformation of E. coli strain DL7 with the uniquely modified single-stranded genome resulted in ∼0.5-1.0% of the progeny phase showing the G → T transversion mutation at the original position of G8-OH. The vector containing G8-OH also transformed 50-90% as efficiently as the unmodified control, indicating that the adduct can be both weakly cytotoxic and mutagenic to the phase genome

  20. Islet expression of the DNA repair enzyme 8-oxoguanosine DNA glycosylase (Ogg1 in human type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Yoon Kun-Ho

    2002-04-01

    Full Text Available Abstract Background It has become increasingly clear that β-cell failure plays a critical role in the pathogenesis of type 2 diabetes. Free-radical mediated β-cell damage has been intensively studied in type 1 diabetes, but not in human type 2 diabetes. Therefore, we studied the protein expression of the DNA repair enzyme Ogg1 in pancreases from type 2 diabetics. Ogg1 was studied because it is the major enzyme involved in repairing 7,8-dihydro-8-oxoguanosine DNA adducts, a lesion previously observed in a rat model of type 2 diabetes. Moreover, in a gene expression screen, Ogg1 was over-expressed in islets from a human type 2 diabetic. Methods Immunofluorescent staining of Ogg1 was performed on pancreatic specimens from healthy controls and patients with diabetes for 2–23 years. The intensity and islet area stained for Ogg1 was evaluated by semi-quantitative scoring. Results Both the intensity and the area of islet Ogg1 staining were significantly increased in islets from the type 2 diabetic subjects compared to the healthy controls. A correlation between increased Ogg1 fluorescent staining intensity and duration of diabetes was also found. Most of the staining observed was cytoplasmic, suggesting that mitochondrial Ogg1 accounts primarily for the increased Ogg1 expression. Conclusion We conclude that oxidative stress related DNA damage may be a novel important factor in the pathogenesis of human type 2 diabetes. An increase of Ogg1 in islet cell mitochondria is consistent with a model in which hyperglycemia and consequent increased β-cell oxidative metabolism lead to DNA damage and the induction of Ogg1 expression.

  1. Establishment of a non-radioactive cleavage assay to assess the DNA repair capacity towards oxidatively damaged DNA in subcellular and cellular systems and the impact of copper

    International Nuclear Information System (INIS)

    Oxidative stress is involved in many diseases, and the search for appropriate biomarkers is one major focus in molecular epidemiology. 8-Oxoguanine (8-oxoG), a potentially mutagenic DNA lesion, is considered to be a sensitive biomarker for oxidative stress. Another approach consists in assessing the repair capacity towards 8-oxoG, mediated predominantly by the human 8-oxoguanine DNA glycosylase 1 (hOGG1). With respect to the latter, during the last few years so-called cleavage assays have been described, investigating the incision of 32P-labelled and 8-oxoG damaged oligonucleotides by cell extracts. Within the present study, a sensitive non-radioactive test system based on a Cy5-labelled oligonucleotide has been established. Sources of incision activity are isolated proteins or extracts prepared from cultured cells and peripheral blood mononuclear cells (PBMC). After comparing different oligonucleotide structures, a hairpin-like structure was selected which was not degraded by cell extracts. Applying this test system the impact of copper on the activity of isolated hOGG1 and on hOGG activity in A549 cells was examined, showing a distinct inhibition of the isolated protein at low copper concentration as compared to a modest inhibition of hOGG activity in cells at beginning cytotoxic concentrations. For investigating PBMC, all reaction conditions, including the amounts of oligonucleotide and cell extract as well as the reaction time have been optimized. The incision activities of PBMC protein extracts obtained from different donors have been investigated, and inter-individual differences have been observed. In summary, the established method is as sensitive and even faster than the radioactive technique, and additionally, offers the advantage of reduced costs and low health risk.

  2. The Role of Mitochondrial DNA in Mediating Alveolar Epithelial Cell Apoptosis and Pulmonary Fibrosis

    Directory of Open Access Journals (Sweden)

    Seok-Jo Kim

    2015-09-01

    Full Text Available Convincing evidence has emerged demonstrating that impairment of mitochondrial function is critically important in regulating alveolar epithelial cell (AEC programmed cell death (apoptosis that may contribute to aging-related lung diseases, such as idiopathic pulmonary fibrosis (IPF and asbestosis (pulmonary fibrosis following asbestos exposure. The mammalian mitochondrial DNA (mtDNA encodes for 13 proteins, including several essential for oxidative phosphorylation. We review the evidence implicating that oxidative stress-induced mtDNA damage promotes AEC apoptosis and pulmonary fibrosis. We focus on the emerging role for AEC mtDNA damage repair by 8-oxoguanine DNA glycosylase (OGG1 and mitochondrial aconitase (ACO-2 in maintaining mtDNA integrity which is important in preventing AEC apoptosis and asbestos-induced pulmonary fibrosis in a murine model. We then review recent studies linking the sirtuin (SIRT family members, especially SIRT3, to mitochondrial integrity and mtDNA damage repair and aging. We present a conceptual model of how SIRTs modulate reactive oxygen species (ROS-driven mitochondrial metabolism that may be important for their tumor suppressor function. The emerging insights into the pathobiology underlying AEC mtDNA damage and apoptosis is suggesting novel therapeutic targets that may prove useful for the management of age-related diseases, including pulmonary fibrosis and lung cancer.

  3. The Role of Mitochondrial DNA in Mediating Alveolar Epithelial Cell Apoptosis and Pulmonary Fibrosis.

    Science.gov (United States)

    Kim, Seok-Jo; Cheresh, Paul; Jablonski, Renea P; Williams, David B; Kamp, David W

    2015-01-01

    Convincing evidence has emerged demonstrating that impairment of mitochondrial function is critically important in regulating alveolar epithelial cell (AEC) programmed cell death (apoptosis) that may contribute to aging-related lung diseases, such as idiopathic pulmonary fibrosis (IPF) and asbestosis (pulmonary fibrosis following asbestos exposure). The mammalian mitochondrial DNA (mtDNA) encodes for 13 proteins, including several essential for oxidative phosphorylation. We review the evidence implicating that oxidative stress-induced mtDNA damage promotes AEC apoptosis and pulmonary fibrosis. We focus on the emerging role for AEC mtDNA damage repair by 8-oxoguanine DNA glycosylase (OGG1) and mitochondrial aconitase (ACO-2) in maintaining mtDNA integrity which is important in preventing AEC apoptosis and asbestos-induced pulmonary fibrosis in a murine model. We then review recent studies linking the sirtuin (SIRT) family members, especially SIRT3, to mitochondrial integrity and mtDNA damage repair and aging. We present a conceptual model of how SIRTs modulate reactive oxygen species (ROS)-driven mitochondrial metabolism that may be important for their tumor suppressor function. The emerging insights into the pathobiology underlying AEC mtDNA damage and apoptosis is suggesting novel therapeutic targets that may prove useful for the management of age-related diseases, including pulmonary fibrosis and lung cancer. PMID:26370974

  4. Hyperosmotic stress memory in Arabidopsis is mediated by distinct epigenetically labile sites in the genome and is restricted in the male germline by DNA glycosylase activity.

    Science.gov (United States)

    Wibowo, Anjar; Becker, Claude; Marconi, Gianpiero; Durr, Julius; Price, Jonathan; Hagmann, Jorg; Papareddy, Ranjith; Putra, Hadi; Kageyama, Jorge; Becker, Jorg; Weigel, Detlef; Gutierrez-Marcos, Jose

    2016-01-01

    Inducible epigenetic changes in eukaryotes are believed to enable rapid adaptation to environmental fluctuations. We have found distinct regions of the Arabidopsis genome that are susceptible to DNA (de)methylation in response to hyperosmotic stress. The stress-induced epigenetic changes are associated with conditionally heritable adaptive phenotypic stress responses. However, these stress responses are primarily transmitted to the next generation through the female lineage due to widespread DNA glycosylase activity in the male germline, and extensively reset in the absence of stress. Using the CNI1/ATL31 locus as an example, we demonstrate that epigenetically targeted sequences function as distantly-acting control elements of antisense long non-coding RNAs, which in turn regulate targeted gene expression in response to stress. Collectively, our findings reveal that plants use a highly dynamic maternal 'short-term stress memory' with which to respond to adverse external conditions. This transient memory relies on the DNA methylation machinery and associated transcriptional changes to extend the phenotypic plasticity accessible to the immediate offspring. PMID:27242129

  5. Mitochondrial Targeted Endonuclease III DNA Repair Enzyme Protects against Ventilator Induced Lung Injury in Mice

    Directory of Open Access Journals (Sweden)

    Masahiro Hashizume

    2014-08-01

    Full Text Available The mitochondrial targeted DNA repair enzyme, 8-oxoguanine DNA glycosylase 1, was previously reported to protect against mitochondrial DNA (mtDNA damage and ventilator induced lung injury (VILI. In the present study we determined whether mitochondrial targeted endonuclease III (EndoIII which cleaves oxidized pyrimidines rather than purines from damaged DNA would also protect the lung. Minimal injury from 1 h ventilation at 40 cmH2O peak inflation pressure (PIP was reversed by EndoIII pretreatment. Moderate lung injury due to ventilation for 2 h at 40 cmH2O PIP produced a 25-fold increase in total extravascular albumin space, a 60% increase in W/D weight ratio, and marked increases in MIP-2 and IL-6. Oxidative mtDNA damage and decreases in the total tissue glutathione (GSH and the GSH/GSSH ratio also occurred. All of these indices of injury were attenuated by mitochondrial targeted EndoIII. Massive lung injury caused by 2 h ventilation at 50 cmH2O PIP was not attenuated by EndoIII pretreatment, but all untreated mice died prior to completing the two hour ventilation protocol, whereas all EndoIII-treated mice lived for the duration of ventilation. Thus, mitochondrial targeted DNA repair enzymes were protective against mild and moderate lung damage and they enhanced survival in the most severely injured group.

  6. Mitochondrial Targeted Endonuclease III DNA Repair Enzyme Protects against Ventilator Induced Lung Injury in Mice.

    Science.gov (United States)

    Hashizume, Masahiro; Mouner, Marc; Chouteau, Joshua M; Gorodnya, Olena M; Ruchko, Mykhaylo V; Wilson, Glenn L; Gillespie, Mark N; Parker, James C

    2014-01-01

    The mitochondrial targeted DNA repair enzyme, 8-oxoguanine DNA glycosylase 1, was previously reported to protect against mitochondrial DNA (mtDNA) damage and ventilator induced lung injury (VILI). In the present study we determined whether mitochondrial targeted endonuclease III (EndoIII) which cleaves oxidized pyrimidines rather than purines from damaged DNA would also protect the lung. Minimal injury from 1 h ventilation at 40 cmH2O peak inflation pressure (PIP) was reversed by EndoIII pretreatment. Moderate lung injury due to ventilation for 2 h at 40 cmH2O PIP produced a 25-fold increase in total extravascular albumin space, a 60% increase in W/D weight ratio, and marked increases in MIP-2 and IL-6. Oxidative mtDNA damage and decreases in the total tissue glutathione (GSH) and the GSH/GSSH ratio also occurred. All of these indices of injury were attenuated by mitochondrial targeted EndoIII. Massive lung injury caused by 2 h ventilation at 50 cmH2O PIP was not attenuated by EndoIII pretreatment, but all untreated mice died prior to completing the two hour ventilation protocol, whereas all EndoIII-treated mice lived for the duration of ventilation. Thus, mitochondrial targeted DNA repair enzymes were protective against mild and moderate lung damage and they enhanced survival in the most severely injured group. PMID:25153040

  7. Research progress of relationship among DNA oxidative damage, its repair enzymes and neoplasms%DNA氧化损伤及其修复酶与肿瘤关系的研究进展

    Institute of Scientific and Technical Information of China (English)

    范国琴

    2015-01-01

    DNA氧化损伤可引起机体功能的改变及疾病的发生.机体可通过多种途径修复DNA氧化损伤,而碱基切除修复(BER)方式是DNA氧化损伤修复最为重要的途径.参与DNA氧化损伤修复的代表酶为8-羟基鸟嘌呤核苷酸酶,即MutT同源酶(MTH)1和8-羟基鸟嘌呤DNA糖苷酶(OGG)1.DNA氧化损伤及其修复酶与肿瘤的发生、肿瘤细胞的生长关系密切.笔者拟就DNA氧化损伤及其修复酶与肿瘤的发生、肿瘤细胞的生长及治疗研究进行综述如下.%DNA oxidative damage can lead to dysfunctions and diseases.There are many pathways to repair DNA oxidative damage and base excision repair (BER) is the most important one.8 oxoguanine nucleotide triphosphatase,also known as MutT homologue (MTH)1,and 8-oxoguanine DNA glycosylase (OGG)I are major repair enzymes,which are closely related with tumorigenesis and growth of tumor cells.This review is about the relationship among tumorigenesis,growth of tumor cells,therapy of neoplasms and DNA oxidative damage and the repair enzymes.

  8. DNA damage and repair activity after broccoli intake in young healthy smokers.

    Science.gov (United States)

    Riso, Patrizia; Martini, Daniela; Møller, Peter; Loft, Steffen; Bonacina, Gaia; Moro, Massimo; Porrini, Marisa

    2010-11-01

    Cruciferous vegetables contain compounds with antioxidant properties (e.g. carotenoids, vitamin C and folates) and can alter the activity of xenobiotic metabolism (i.e. isothiocyanates). These constituents may be particularly important for subjects who are exposed to free radicals and genotoxic compounds, including smokers. The aim of the study was to evaluate the effect of broccoli intake on biomarkers of DNA damage and repair. Twenty-seven young healthy smokers consumed a portion of steamed broccoli (250 g/day) or a control diet for 10 days each within a crossover design with a washout period. Blood was collected before and after each period. The level of oxidatively damaged DNA lesions (formamidopyrimidine DNA glycosylase-sensitive sites), resistance to ex vivo H(2)O(2) treatment and repair of oxidised DNA lesions were measured in peripheral blood mononuclear cells (PBMCs). We also measured mRNA expression levels of repair and defence enzymes: 8-oxoguanine DNA glycosylase (OGG1), nucleoside diphosphate linked moiety X-type motif 1 (NUDT1) and heme oxygenase 1 (HO-1). After broccoli consumption, the level of oxidised DNA lesions decreased by 41% (95% confidence interval: 10%, 72%) and the resistance to H(2)O(2)-induced DNA strand breaks increased by 23% (95% CI: 13%, 34%). Following broccoli intake, a higher protection was observed in subjects with glutathione S-transferase (GST) M1-null genotype. The expression level and activity of repair enzymes was unaltered. In conclusion, broccoli intake was associated with increased protection against H(2)O(2)-induced DNA strand breaks and lower levels of oxidised DNA bases in PBMCs from smokers. This protective effect could be related to an overall improved antioxidant status.

  9. 肿瘤线粒体DNA损伤修复的研究进展%Research progress on mitochondrial DNA damage repair in tumors

    Institute of Scientific and Technical Information of China (English)

    李鹤佳

    2012-01-01

    Mitochondria are organelles in mammalian cells, with the only genetic material outside the nucleus mitochondrial DNA(mtDNA). It supported and participated in many important cellular functions. MtDNA vulnera-bled to a variety of factors and cause damage because of special structures and advancement of genetics. When mtDNA damage happened, some mtDNA repair factors, such as: Mitochondrial transcription factor A, mtDNA poly-merase-γ, 8-oxoguanine DNA glycosylase enzymes take part in the damage repairing. The entire repair process were regulated by related factors.%线粒体是哺乳动物细胞中唯一存在于细胞核外又带有遗传物质线粒体DNA(mtDNA)的细胞器.mtDNA支持和参与诸多重要的细胞功能.mtDNA因其特殊的结构和遗传学地位,易受各种因素的损伤.当损伤发生时,线粒体内的DNA损伤修复因子,诸如线粒体转录因子A、mtDNA聚合酶-γ、8-氧鸟嘌呤DNA糖基化酶等参与修复过程,而整个修复过程受到上游相关因子的调控.

  10. Novel repair activities of AlkA (3-methyladenine DNA glycosylase II) and endonuclease VIII for xanthine and oxanine, guanine lesions induced by nitric oxide and nitrous acid

    Science.gov (United States)

    Terato, Hiroaki; Masaoka, Aya; Asagoshi, Kenjiro; Honsho, Akiko; Ohyama, Yoshihiko; Suzuki, Toshinori; Yamada, Masaki; Makino, Keisuke; Yamamoto, Kazuo; Ide, Hiroshi

    2002-01-01

    Nitrosation of guanine in DNA by nitrogen oxides such as nitric oxide (NO) and nitrous acid leads to formation of xanthine (Xan) and oxanine (Oxa), potentially cytotoxic and mutagenic lesions. In the present study, we have examined the repair capacity of DNA N-glycosylases from Escherichia coli for Xan and Oxa. The nicking assay with the defined substrates containing Xan and Oxa revealed that AlkA [in combination with endonuclease (Endo) IV] and Endo VIII recognized Xan in the tested enzymes. The activity (Vmax/Km) of AlkA for Xan was 5-fold lower than that for 7-methylguanine, and that of Endo VIII was 50-fold lower than that for thymine glycol. The activity of AlkA and Endo VIII for Xan was further substantiated by the release of [3H]Xan from the substrate. The treatment of E.coli with N-methyl-N′-nitro-N-nitrosoguanidine increased the Xan-excising activity in the cell extract from alkA+ but not alkA– strains. The alkA and nei (the Endo VIII gene) double mutant, but not the single mutants, exhibited increased sensitivity to nitrous acid relative to the wild type strain. AlkA and Endo VIII also exhibited excision activity for Oxa, but the activity was much lower than that for Xan. PMID:12434002

  11. Exposure to 1800 MHz radiofrequency electromagnetic radiation induces oxidative DNA base damage in a mouse spermatocyte-derived cell line.

    Science.gov (United States)

    Liu, Chuan; Duan, Weixia; Xu, Shangcheng; Chen, Chunhai; He, Mindi; Zhang, Lei; Yu, Zhengping; Zhou, Zhou

    2013-03-27

    Whether exposure to radiofrequency electromagnetic radiation (RF-EMR) emitted from mobile phones can induce DNA damage in male germ cells remains unclear. In this study, we conducted a 24h intermittent exposure (5 min on and 10 min off) of a mouse spermatocyte-derived GC-2 cell line to 1800 MHz Global System for Mobile Communication (GSM) signals in GSM-Talk mode at specific absorption rates (SAR) of 1 W/kg, 2 W/kg or 4 W/kg. Subsequently, through the use of formamidopyrimidine DNA glycosylase (FPG) in a modified comet assay, we determined that the extent of DNA migration was significantly increased at a SAR of 4 W/kg. Flow cytometry analysis demonstrated that levels of the DNA adduct 8-oxoguanine (8-oxoG) were also increased at a SAR of 4 W/kg. These increases were concomitant with similar increases in the generation of reactive oxygen species (ROS); these phenomena were mitigated by co-treatment with the antioxidant α-tocopherol. However, no detectable DNA strand breakage was observed by the alkaline comet assay. Taking together, these findings may imply the novel possibility that RF-EMR with insufficient energy for the direct induction of DNA strand breaks may produce genotoxicity through oxidative DNA base damage in male germ cells.

  12. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

    Institute of Scientific and Technical Information of China (English)

    Shanshan Song; Guichun Xing; Lin Yuan; Jian Wang; Shan Wang; Yuxin Yin; Chunyan Tian; Fuchu He; Lingqiang Zhang

    2012-01-01

    Alkylating agents induce genome-wide base damage,which is repaired mainly by N-methylpurine DNA glycosylase (MPG).An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks.However,the determinant of drug sensitivity or insensitivity still remains unclear.Here,we report that the p53 status coordinates with MPG to play a pivotal role in such process.MPG expression is positive in breast,lung and colon cancers (38.7%,43.4% and 25.3%,respectively) but negative in all adjacent normal tissues.MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells.The overexpression of MPG reduced,whereas depletion of MPG increased,the expression levels of pro-arrest gene downstream of p53 including p21,14-3-3σ and Gadd45 but not pro-apoptotic ones.The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53.Upon DNA alkylation stress,in p53 wild-type tumor cells,p53 dissociated from MPG and induced cell growth arrest.Then,AP sites were repaired efficiently,which led to insensitivity to alkylating agents.By contrast,in p53-mutated cells,the AP sites were repaired with low efficacy.To our knowledge,this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53,and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  13. Effects of vaccinia virus uracil DNA glycosylase catalytic site and deoxyuridine triphosphatase deletion mutations individually and together on replication in active and quiescent cells and pathogenesis in mice

    Directory of Open Access Journals (Sweden)

    Moss Bernard

    2008-12-01

    Full Text Available Abstract Background Low levels of uracil in DNA result from misincorporation of dUMP or cytosine deamination. Vaccinia virus (VACV, the prototype poxvirus, encodes two enzymes that can potentially reduce the amount of uracil in DNA. Deoxyuridine triphosphatase (dUTPase hydrolyzes dUTP, generating dUMP for biosynthesis of thymidine nucleotides while decreasing the availability of dUTP for misincorporation; uracil DNA glycosylase (UNG cleaves uracil N-glycosylic bonds in DNA initiating base excision repair. Studies with actively dividing cells showed that the VACV UNG protein is required for DNA replication but the UNG catalytic site is not, whereas the dUTPase gene can be deleted without impairing virus replication. Recombinant VACV with an UNG catalytic site mutation was attenuated in vivo, while a dUTPase deletion mutant was not. However, the importance of the two enzymes for replication in quiescent cells, their possible synergy and roles in virulence have not been fully assessed. Results VACV mutants lacking the gene encoding dUTPase or with catalytic site mutations in UNG and double UNG/dUTPase mutants were constructed. Replication of UNG and UNG/dUTPase mutants were slightly reduced compared to wild type or the dUTPase mutant in actively dividing cells. Viral DNA replication was reduced about one-third under these conditions. After high multiplicity infection of quiescent fibroblasts, yields of wild type and mutant viruses were decreased by 2-logs with relative differences similar to those observed in active fibroblasts. However, under low multiplicity multi-step growth conditions in quiescent fibroblasts, replication of the dUTPase/UNG mutant was delayed and 5-fold lower than that of either single mutant or parental virus. This difference was exacerbated by 1-day serial passages on quiescent fibroblasts, resulting in 2- to 3-logs lower titer of the double mutant compared to the parental and single mutant viruses. Each mutant was more

  14. Ebselen attenuates oxidative DNA damage and enhances its repair activity in the thalamus after focal cortical infarction in hypertensive rats.

    Science.gov (United States)

    He, Meixia; Xing, Shihui; Yang, Bo; Zhao, Liqun; Hua, Haiying; Liang, Zhijian; Zhou, Wenliang; Zeng, Jinsheng; Pei, Zhong

    2007-11-21

    Oxidative DNA damage has been proposed to be a major contributor to focal cerebral ischemic injury. However, little is known about the role of oxidative DNA damage in remote damage secondary to the primary infarction. In the present study, we investigated oxidative damage within the ventroposterior nucleus (VPN) after distal middle cerebral artery occlusion (MCAO) in hypertensive rats. We also examined the possible protective effect of ebselen, one glutathione peroxidase mimic, on delayed degeneration in the VPN after distal MCAO. Neuronal damage in the ipsilateral VPN was examined by Nissl staining. Oxidative DNA damage and base repair enzyme activity were assessed by analyzing immunoreactivity of 8-hydroxy-2'-deoxyguanosine (8-ohdG) and 8-oxoguanine DNA glycosylase (OGG1), respectively. The number of intact neurons in the ipsilateral VPN decreased by 52% compared to the contralateral side in ischemia group 2 weeks after distal cerebral cortical infarction. The immunoreactivity of 8-ohdG significantly increased while OGG1 immunoreactivity significantly decreased in the ipsilateral VPN 2 weeks after distal cortical infarction (all pVPN (all pVPN region following distal MCAO. Furthermore, ebselen protects against the delayed damage in the VPN when given at 24 h following distal MCAO.

  15. Biomarkers of oxidative damage to DNA and repair.

    Science.gov (United States)

    Loft, Steffen; Høgh Danielsen, Pernille; Mikkelsen, Lone; Risom, Lotte; Forchhammer, Lykke; Møller, Peter

    2008-10-01

    Oxidative-stress-induced damage to DNA includes a multitude of lesions, many of which are mutagenic and have multiple roles in cancer and aging. Many lesions have been characterized by MS-based methods after extraction and digestion of DNA. These preparation steps may cause spurious base oxidation, which is less likely to occur with methods such as the comet assay, which are based on nicking of the DNA strand at modified bases, but offer less specificity. The European Standards Committee on Oxidative DNA Damage has concluded that the true levels of the most widely studied lesion, 8-oxodG (8-oxo-7,8-dihydro-2'-deoxyguanosine), in cellular DNA is between 0.5 and 5 lesions per 10(6) dG bases. Base excision repair of oxidative damage to DNA can be assessed by nicking assays based on oligonucleotides with lesions or the comet assay, by mRNA expression levels or, in the case of, e.g., OGG1 (8-oxoguanine DNA glycosylase 1), responsible for repair of 8-oxodG, by genotyping. Products of repair in DNA or the nucleotide pool, such as 8-oxodG, excreted into the urine can be assessed by MS-based methods and generally reflects the rate of damage. Experimental and population-based studies indicate that many environmental factors, including particulate air pollution, cause oxidative damage to DNA, whereas diets rich in fruit and vegetables or antioxidant supplements may reduce the levels and enhance repair. Urinary excretion of 8-oxodG, genotype and expression of OGG1 have been associated with risk of cancer in cohort settings, whereas altered levels of damage, repair or urinary excretion in case-control settings may be a consequence rather than the cause of the disease. PMID:18793191

  16. Low-level laser irradiation alters mRNA expression from genes involved in DNA repair and genomic stabilization in myoblasts

    Science.gov (United States)

    Trajano, L. A. S. N.; Sergio, L. P. S.; Silva, C. L.; Carvalho, L.; Mencalha, A. L.; Stumbo, A. C.; Fonseca, A. S.

    2016-07-01

    Low-level lasers are used for the treatment of diseases in soft and bone tissues, but few data are available regarding their effects on genomic stability. In this study, we investigated mRNA expression from genes involved in DNA repair and genomic stabilization in myoblasts exposed to low-level infrared laser. C2C12 myoblast cultures in different fetal bovine serum concentrations were exposed to low-level infrared laser (10, 35 and 70 J cm-2), and collected for the evaluation of DNA repair gene expression. Laser exposure increased gene expression related to base excision repair (8-oxoguanine DNA glycosylase and apurinic/apyrimidinic endonuclease 1), nucleotide excision repair (excision repair cross-complementation group 1 and xeroderma pigmentosum C protein) and genomic stabilization (ATM serine/threonine kinase and tumor protein p53) in normal and low fetal bovine serum concentrations. Results suggest that genomic stability could be part of a biostimulation effect of low-level laser therapy in injured muscles.

  17. Low-level laser irradiation alters mRNA expression from genes involved in DNA repair and genomic stabilization in myoblasts

    Science.gov (United States)

    Trajano, L. A. S. N.; Sergio, L. P. S.; Silva, C. L.; Carvalho, L.; Mencalha, A. L.; Stumbo, A. C.; Fonseca, A. S.

    2016-07-01

    Low-level lasers are used for the treatment of diseases in soft and bone tissues, but few data are available regarding their effects on genomic stability. In this study, we investigated mRNA expression from genes involved in DNA repair and genomic stabilization in myoblasts exposed to low-level infrared laser. C2C12 myoblast cultures in different fetal bovine serum concentrations were exposed to low-level infrared laser (10, 35 and 70 J cm‑2), and collected for the evaluation of DNA repair gene expression. Laser exposure increased gene expression related to base excision repair (8-oxoguanine DNA glycosylase and apurinic/apyrimidinic endonuclease 1), nucleotide excision repair (excision repair cross-complementation group 1 and xeroderma pigmentosum C protein) and genomic stabilization (ATM serine/threonine kinase and tumor protein p53) in normal and low fetal bovine serum concentrations. Results suggest that genomic stability could be part of a biostimulation effect of low-level laser therapy in injured muscles.

  18. Regulation of mitochondrial genome replication by hypoxia: The role of DNA oxidation in D-loop region.

    Science.gov (United States)

    Pastukh, Viktor M; Gorodnya, Olena M; Gillespie, Mark N; Ruchko, Mykhaylo V

    2016-07-01

    Mitochondria of mammalian cells contain multiple copies of mitochondrial (mt) DNA. Although mtDNA copy number can fluctuate dramatically depending on physiological and pathophysiologic conditions, the mechanisms regulating mitochondrial genome replication remain obscure. Hypoxia, like many other physiologic stimuli that promote growth, cell proliferation and mitochondrial biogenesis, uses reactive oxygen species as signaling molecules. Emerging evidence suggests that hypoxia-induced transcription of nuclear genes requires controlled DNA damage and repair in specific sequences in the promoter regions. Whether similar mechanisms are operative in mitochondria is unknown. Here we test the hypothesis that controlled oxidative DNA damage and repair in the D-loop region of the mitochondrial genome are required for mitochondrial DNA replication and transcription in hypoxia. We found that hypoxia had little impact on expression of mitochondrial proteins in pulmonary artery endothelial cells, but elevated mtDNA content. The increase in mtDNA copy number was accompanied by oxidative modifications in the D-loop region of the mitochondrial genome. To investigate the role of this sequence-specific oxidation of mitochondrial genome in mtDNA replication, we overexpressed mitochondria-targeted 8-oxoguanine glycosylase Ogg1 in rat pulmonary artery endothelial cells, enhancing the mtDNA repair capacity of transfected cells. Overexpression of Ogg1 resulted in suppression of hypoxia-induced mtDNA oxidation in the D-loop region and attenuation of hypoxia-induced mtDNA replication. Ogg1 overexpression also reduced binding of mitochondrial transcription factor A (TFAM) to both regulatory and coding regions of the mitochondrial genome without altering total abundance of TFAM in either control or hypoxic cells. These observations suggest that oxidative DNA modifications in the D-loop region during hypoxia are important for increased TFAM binding and ensuing replication of the mitochondrial

  19. Artesunate induces oxidative DNA damage, sustained DNA double-strand breaks, and the ATM/ATR damage response in cancer cells.

    Science.gov (United States)

    Berdelle, Nicole; Nikolova, Teodora; Quiros, Steve; Efferth, Thomas; Kaina, Bernd

    2011-12-01

    Artesunate, the active agent from Artemisia annua L. used in the traditional Chinese medicine, is being applied as a first-line drug for malaria treatment, and trials are ongoing that include this drug in cancer therapy. Despite increasing interest in its therapeutic application, the mode of cell killing provoked by artesunate in human cells is unknown. Here, we show that artesunate is a powerful inducer of oxidative DNA damage, giving rise to formamidopyrimidine DNA glycosylase-sensitive sites and the formation of 8-oxoguanine and 1,N6-ethenoadenine. Oxidative DNA damage was induced in LN-229 human glioblastoma cells dose dependently and was paralleled by cell death executed by apoptosis and necrosis, which could be attenuated by radical scavengers such as N-acetyl cysteine. Oxidative DNA damage resulted in DNA double-strand breaks (DSB) as determined by γH2AX foci that colocalized with 53BP1. Upon chronic treatment with artesunate, the level of DSB continuously increased over the treatment period up to a steady-state level, which is in contrast to ionizing radiation that induced a burst of DSB followed by a decline due to their repair. Knockdown of Rad51 by short interfering RNA and inactivation of DNA-PK strongly sensitized glioma cells to artesunate. These data indicate that both homologous recombination and nonhomologous end joining are involved in the repair of artesunate-induced DSB. Artesunate provoked a DNA damage response (DDR) with phosphorylation of ATM, ATR, Chk1, and Chk2. Overall, these data revealed that artesunate induces oxidative DNA lesions and DSB that continuously increase during the treatment period and accumulate until they trigger DDR and finally tumor cell death. PMID:21998290

  20. Characterization of a novel DNA glycosylase from S. sahachiroi involved in the reduction and repair of azinomycin B induced DNA damage

    OpenAIRE

    Wang, Shan; Liu, Kai; Xiao, Le; Yang, Liyuan; LI Hong; Zhang, Feixue; Lei, Lei; Li, Shengqing; Feng, Xu; Li, Aiying; He, Jing

    2015-01-01

    Azinomycin B is a hybrid polyketide/nonribosomal peptide natural product and possesses antitumor activity by interacting covalently with duplex DNA and inducing interstrand crosslinks. In the biosynthetic study of azinomycin B, a gene (orf1) adjacent to the azinomycin B gene cluster was found to be essential for the survival of the producer, Streptomyces sahachiroi ATCC33158. Sequence analyses revealed that Orf1 belongs to the HTH_42 superfamily of conserved bacterial proteins which are widel...

  1. The basal levels of 8-oxoG and other oxidative modifications in intact mitochondrial DNA are low even in repair-deficient (Ogg1{sup -/-}/Csb{sup -/-}) mice

    Energy Technology Data Exchange (ETDEWEB)

    Trapp, Christian [Institute of Pharmacy, University of Mainz, D-55099 Mainz (Germany); McCullough, Amanda K. [CROET/Mol. Med. Genetics, Oregon Health and Science University, Portland, OR 97239 (United States); Epe, Bernd [Institute of Pharmacy, University of Mainz, D-55099 Mainz (Germany)], E-mail: epe@uni-mainz.de

    2007-12-01

    Mitochondrial DNA (mtDNA) is assumed to be highly prone to damage by reactive oxygen species (ROS) because of its location in close proximity to the mitochondrial electron transport chain. Accordingly, mitochondrial oxidative DNA damage has been hypothesized to be responsible for various neurological diseases, ageing and cancer. Since 7,8-dihydro-8-oxoguanine (8-oxoG), one of the most frequent oxidative base modifications, is removed from the mitochondrial genome by the glycosylase OGG1, the basal levels of this lesion are expected to be highly elevated in Ogg1{sup -/-} mice. To investigate this hypothesis, we have used a mtDNA relaxation assay in combination with various repair enzymes (Fpg, MutY, endonuclease III, endonuclease IV) to determine the average steady-state number of oxidative DNA modifications within intact (supercoiled) mtDNA from the livers of wild-type mice and those deficient in OGG1 and/or the Cockayne syndrome B (CSB) protein for mice aged up to 23 months. The levels of all types of oxidative modifications were found to be less than 12 per million base pairs, and the difference between wild-type and repair-deficient (Ogg1{sup -/-}/Csb{sup -/-}) mice was not significant. Thus, the increase of 8-oxoG caused by the repair deficiency in intact mtDNA is not much higher than in the nuclear DNA, i.e., not more than a few modifications per million base pairs. Based on these data, it is hypothesized that the load of oxidative base modifications in mtDNA is efficiently reduced during replication even in the absence of excision repair.

  2. [Exercise training in hypoxia prevents hypoxia induced mitochondrial DNA oxidative damage in skeletal muscle].

    Science.gov (United States)

    Bo, Hai; Li, Ling; Duan, Fu-Qiang; Zhu, Jiang

    2014-10-25

    This study was undertaken to investigate the effect of exercise training on mitochondrial DNA (mtDNA) oxidative damage and 8-oxoguanine DNA glycosylase-1 (OGG1) expression in skeletal muscle of rats under continuous exposure to hypoxia. Male Sprague-Dawley rats were randomly divided into 4 groups (n = 8): normoxia control group (NC), normoxia training group (NT), hypoxia control group (HC), and hypoxia training group (HT). The hypoxia-treated animals were housed in normobaric hypoxic tent containing 11.3% oxygen for consecutive 4 weeks. The exercise-trained animals were exercised on a motor-driven rodent treadmill at a speed of 15 m/min, 5% grade for 60 min/day, 5 days per week for 4 weeks. The results showed that, compared with NC group, hypoxia attenuated complex I, II, IV and ATP synthase activities of the electron transport chain, and the level of mitochondrial membrane potential in HC group (P hypoxia decreased mitochondrial OGG1, MnSOD, and GPx activities (P hypoxia attenuated muscle and mitochondrial [NAD⁺]/ [NADH] ratio, and SIRT3 protein expression (P exercise training in hypoxia elevated complex I, II, IV and ATP synthase activities, and the level of mitochondrial membrane potential in HT group (P exercise training in hypoxia increased MnSOD and GPx activities and mitochondrial OGG1 level (P exercise training in hypoxia increased muscle and mitochondrial [NAD⁺]/[NADH] ratio, as well as SIRT3 protein expression (P exercise training in hypoxia can decrease hypoxia-induced mtDNA oxidative damage in the skeletal muscle through up-regulating exercise-induced mitochondrial OGG1 and antioxidant enzymes. Exercise training in hypoxia may improve hypoxia tolerance in skeletal muscle mitochondria via elevating [NAD⁺]/[NADH] ratio and SIRT3 expression. PMID:25332006

  3. Polymorphisms of DNA repair genes OGG1 and XPD and the risk of age-related cataract in Egyptians

    OpenAIRE

    Gharib, Amal F.; Dabour, Sherif A.; Etewa, Rasha L.; Fouad, Rania A.

    2014-01-01

    Purpose To analyze the association of the polymorphisms of xeroderma pigmentosum complementation group D (XPD) and 8-oxoguanine glycosylase-1 (OGG1) genes with the risk of age-related cataract (ARC) in an Egyptian population. Methods This case-control study included 150 patients with ARC and 50 controls. Genotyping of XPD Asp312Asn was performed by amplification refractory mutation system PCR assay and genotyping of OGG1 Ser326Cys was carried out by PCR including confronting two-pair primers....

  4. In vivo repair of alkylating and oxidative DNA damage in the mitochondrial and nuclear genomes of wild-type and glycosylase-deficient Caenorhabditis elegans

    OpenAIRE

    Hunter, Senyene E.; Gustafson, Margaret A; Margillo, Kathleen M; Lee, Sean A; Ryde, Ian T.; Meyer, Joel N.

    2012-01-01

    Base excision repair (BER) is an evolutionarily conserved DNA repair pathway that is critical for repair of many of the most common types of DNA damage generated both by endogenous metabolic pathways and exposure to exogenous stressors such as pollutants. C. elegans is an increasingly important model organism for the study of DNA damage-related processes including DNA repair, genotoxicity, and apoptosis, but BER is not well understood in this organism, and has not previously been measured in ...

  5. An experimental double-blind irradiation study of a novel topical product (TPF 50) compared to other topical products with DNA repair enzymes, antioxidants, and growth factors with sunscreens: implications for preventing skin aging and cancer.

    Science.gov (United States)

    Emanuele, Enzo; Spencer, James M; Braun, Martin

    2014-03-01

    The exposure to ultraviolet radiation (UVR) is a major risk factor for skin aging and the development of non-melanoma skin cancer (NMSC). Although traditional sunscreens remain the mainstay for the prevention of UVR-induced skin damage, they cannot ensure a complete protection against the whole spectrum of molecular lesions associated with UVR exposure. The formation of helix-distorting photoproducts such as cyclobutane pyrimidine dimers (CPD), as well as oxidative damage to DNA bases, including the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8OHdG) are among the key DNA lesions associated with photoaging and tumorigenesis. Besides DNA lesions, UVR-induced formation of free radicals can result in protein carbonylation (PC), a major form of irreversible protein damage that inactivates their biological function. This study compares a complex novel topical product (TPF50) consisting of three actives, ie, 1) traditional physical sunscreens (SPF 50), 2) a liposome-encapsulated DNA repair enzymes complex (photolyase, endonuclease, and 8-oxoguanine glycosylase [OGG1]), and 3) a potent antioxidant complex (carnosine, arazine, ergothionine) to existing products. Specifically, we assessed the ability of TFP50 vs those of DNA repair and antioxidant and growth factor topical products used with SPF 50 sunscreens in preventing CPD, 8OHdG, and PC formation in human skin biopsies after experimental irradiations. In head-to-head comparison studies, TPF50 showed the best efficacy in reducing all of the three molecular markers. The results indicated that the three TPF50 components had a synergistic effect in reducing CPD and PC, but not 8OHdG. Taken together, our results indicate that TPF50 improves the genomic and proteomic integrity of skin cells after repeated exposure to UVR, ultimately reducing the risk of skin aging and NMSC.

  6. Overexpression of transcription factor AP-2 stimulates the PA promoter of the human uracil-DNA glycosylase (UNG) gene through a mechanism involving derepression

    DEFF Research Database (Denmark)

    Aas, Per Arne; Pena Diaz, Javier; Liabakk, Nina Beate;

    2009-01-01

    within the region of DNA marked by PA. Footprinting analysis and electrophoretic mobility shift assays of PA and putative AP-2 binding regions with HeLa cell nuclear extract and recombinant AP-2alpha protein indicate that AP-2 transcription factors are central in the regulated expression of UNG2 m...... an inhibitory effect of endogenous AP-2 or AP-2-like factors....

  7. DNA Glycosylases Involved in Base Excision Repair May Be Associated with Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

    DEFF Research Database (Denmark)

    Osorio, Ana; Milne, Roger L; Kuchenbaecker, Karoline;

    2014-01-01

    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of th...

  8. DNA Glycosylases Involved in Base Excision Repair May Be Associated with Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

    NARCIS (Netherlands)

    Osorio, Ana; Milne, Roger L.; Kuchenbaecker, Karoline; Vaclova, Tereza; Pita, Guillermo; Alonso, Rosario; Peterlongo, Paolo; Blanco, Ignacio; de la Hoya, Miguel; Duran, Mercedes; Diez, Orland; Ramon y Cajal, Teresa; Konstantopoulou, Irene; Martinez-Bouzas, Cristina; Conejero, Raquel Andres; Soucy, Penny; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; Arver, Brita; Rantala, Johanna; Loman, Niklas; Ehrencrona, Hans; Olopade, Olufunmilayo I.; Beattie, Mary S.; Domchek, Susan M.; Nathanson, Katherine; Rebbeck, Timothy R.; Arun, Banu K.; Karlan, Beth Y.; Walsh, Christine; Lester, Jenny; John, Esther M.; Whittemore, Alice S.; Daly, Mary B.; Southey, Melissa; Hopper, John; Terry, Mary B.; Buys, Saundra S.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Steele, Linda; Neuhausen, Susan L.; Ding, Yuan Chun; Hansen, Thomas V. O.; Jonson, Lars; Ejlertsen, Bent; Gerdes, Anne-Marie; Infante, Mar; Herraez, Belen; Moreno, Leticia Thais; Weitzel, Jeffrey N.; Herzog, Josef; Weeman, Kisa; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Bonanni, Bernardo; Mariette, Frederique; Volorio, Sara; Viel, Alessandra; Varesco, Liliana; Papi, Laura; Ottini, Laura; Tibiletti, Maria Grazia; Radice, Paolo; Yannoukakos, Drakoulis; Garber, Judy; Ellis, Steve; Frost, Debra; Platte, Radka; Fineberg, Elena; Evans, Gareth; Lalloo, Fiona; Izatt, Louise; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Cole, Trevor; Eccles, Diana; Cook, Jackie; Hodgson, Shirley; Brewer, Carole; Tischkowitz, Marc; Douglas, Fiona; Porteous, Mary; Side, Lucy; Walker, Lisa; Morrison, Patrick; Donaldson, Alan; Kennedy, John; Foo, Claire; Godwin, Andrew K.; Schmutzler, Rita Katharina; Wappenschmidt, Barbara; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hans Joerg; Niederacher, Dieter; Sutter, Christian; Wang-Gohrke, Shan; Steinemann, Doris; Preisler-Adams, Sabine; Kast, Karin; Varon-Mateeva, Raymonda; Gehrig, Andrea; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M.; Mazoyer, Sylvie; Damiola, Francesca; Poppe, Bruce; Claes, Kathleen; Piedmonte, Marion; Tucker, Kathy; Backes, Floor; Rodriguez, Gustavo; Brewster, Wendy; Wakeley, Katie; Rutherford, Thomas; Caldes, Trinidad; Nevanlinna, Heli; Aittomaki, Kristiina; Rookus, Matti A.; van Os, Theo A. M.; van der Kolk, Lizet; de Lange, J. L.; Meijers-Heijboer, Hanne E. J.; van der Hout, A. H.; van Asperen, Christi J.; Gomez Garcia, Encarna B.; Hoogerbrugge, Nicoline; Collee, J. Margriet; van Deurzen, Carolien H. M.; van der Luijt, Rob B.; Devilee, Peter; Olah, Edith; Lazaro, Conxi; Teule, Alex; Menendez, Mireia; Jakubowska, Anna; Cybulski, Cezary; Gronwald, Jacek; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Johannsson, Oskar Th; Maugard, Christine; Montagna, Marco; Tognazzo, Silvia; Teixeira, Manuel R.; Healey, Sue; Olswold, Curtis; Guidugli, Lucia; Lindor, Noralane; Slager, Susan; Szabo, Csilla I.; Vijai, Joseph; Robson, Mark; Kauff, Noah; Zhang, Liying; Rau-Murthy, Rohini; Fink-Retter, Anneliese; Singer, Christian F.; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng; Berger, Andreas; Phelan, Catherine M.; Greene, Mark H.; Mai, Phuong L.; Lejbkowicz, Flavio; Andrulis, Irene; Mulligan, Anna Marie; Glendon, Gord; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Sunde, Lone; Thomassen, Mads; Kruse, Torben A.; Jensen, Uffe Birk; Friedman, Eitan; Laitman, Yael; Shimon, Shani Paluch; Simard, Jacques; Easton, Douglas F.; Offit, Kenneth; Couch, Fergus J.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Benitez, Javier

    2014-01-01

    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the c

  9. hSSB1 (NABP2/OBFC2B) is regulated by oxidative stress.

    Science.gov (United States)

    Paquet, Nicolas; Adams, Mark N; Ashton, Nicholas W; Touma, Christine; Gamsjaeger, Roland; Cubeddu, Liza; Leong, Vincent; Beard, Sam; Bolderson, Emma; Botting, Catherine H; O'Byrne, Kenneth J; Richard, Derek J

    2016-01-01

    The maintenance of genome stability is an essential cellular process to prevent the development of diseases including cancer. hSSB1 (NABP2/ OBFC2A) is a critical component of the DNA damage response where it participates in the repair of double-strand DNA breaks and in base excision repair of oxidized guanine residues (8-oxoguanine) by aiding the localization of the human 8-oxoguanine glycosylase (hOGG1) to damaged DNA. Here we demonstrate that following oxidative stress, hSSB1 is stabilized as an oligomer which is required for hSSB1 to function in the removal of 8-oxoguanine. Monomeric hSSB1 shows a decreased affinity for oxidized DNA resulting in a cellular 8-oxoguanine-repair defect and in the absence of ATM signaling initiation. While hSSB1 oligomerization is important for the removal of 8-oxoguanine from the genome, it is not required for the repair of double-strand DNA-breaks by homologous recombination. These findings demonstrate a novel hSSB1 regulatory mechanism for the repair of damaged DNA. PMID:27273218

  10. Expression of human oxoguanine glycosylase 1 or formamidopyrimidine glycosylase in human embryonic kidney 293 cells exacerbates methylmercury toxicity in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Ondovcik, Stephanie L.; Preston, Thomas J.; McCallum, Gordon P. [Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario M5S 3M2 (Canada); Wells, Peter G., E-mail: pg.wells@utoronto.ca [Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario M5S 3M2 (Canada); Department of Pharmacology and Toxicology, University of Toronto, Toronto, Ontario M5S 1A8 (Canada)

    2013-08-15

    Exposure to methylmercury (MeHg) acutely at high levels, or via chronic low-level dietary exposure from daily fish consumption, can lead to adverse neurological effects in both the adult and developing conceptus. To determine the impact of variable DNA repair capacity, and the role of reactive oxygen species (ROS) and oxidatively damaged DNA in the mechanism of toxicity, transgenic human embryonic kidney (HEK) 293 cells that stably express either human oxoguanine glycosylase 1 (hOgg1) or its bacterial homolog, formamidopyrimidine glycosylase (Fpg), which primarily repair the oxidative lesion 8-oxo-2′-deoxyguanosine (8-oxodG), were used to assess the in vitro effects of MeHg. Western blotting confirmed the expression of hOgg1 or Fpg in both the nuclear and mitochondrial compartments of their respective cell lines. Following acute (1–2 h) incubations with 0–10 μM MeHg, concentration-dependent decreases in clonogenic survival and cell growth accompanied concentration-dependent increases in lactate dehydrogenase (LDH) release, ROS formation, 8-oxodG levels and apurinic/apyrimidinic (AP) sites, consistent with the onset of cytotoxicity. Paradoxically, hOgg1- and Fpg-expressing HEK 293 cells were more sensitive than wild-type cells stably transfected with the empty vector control to MeHg across all cellular and biochemical parameters, exhibiting reduced clonogenic survival and cell growth, and increased LDH release and DNA damage. Accordingly, upregulation of specific components of the base excision repair (BER) pathway may prove deleterious potentially due to the absence of compensatory enhancement of downstream processes to repair toxic intermediary abasic sites. Thus, interindividual variability in DNA repair activity may constitute an important risk factor for environmentally-initiated, oxidatively damaged DNA and its pathological consequences. - Highlights: • hOgg1 and Fpg repair oxidatively damaged DNA. • hOgg1- and Fpg-expressing cells are more

  11. Chloroethyinitrosourea-derived ethano cytosine and adenine adducts are substrates for escherichia coli glycosylases excising analogous etheno adducts

    Energy Technology Data Exchange (ETDEWEB)

    Guliaev, Anton B.; Singer, B.; Hang, Bo

    2004-05-05

    Exocyclic ethano DNA adducts are saturated etheno ring derivatives formed mainly by therapeutic chloroethylnitrosoureas (CNUs), which are also mutagenic and carcinogenic. In this work, we report that two of the ethano adducts, 3,N{sup 4}-ethanocytosine (EC) and 1,N{sup 6}-ethanoadenine (EA), are novel substrates for the Escherichia coli mismatch-specific uracil-DNA glycosylase (Mug) and 3-methyladenine DNA glycosylase II (AlkA), respectively. It has been shown previously that Mug excises 3,N{sup 4}-ethenocytosine ({var_epsilon}C) and AlkA releases 1,N{sup 6}-ethenoadenine ({var_epsilon}A). Using synthetic oligonucleotides containing a single ethano or etheno adduct, we found that both glycosylases had a {approx}20-fold lower excision activity toward EC or EA than that toward their structurally analogous {var_epsilon}C or {var_epsilon}A adduct. Both enzymes were capable of excising the ethano base paired with any of the four natural bases, but with varying efficiencies. The Mug activity toward EC could be stimulated by E. coli endonuclease IV and, more efficiently, by exonuclease III. Molecular dynamics (MD) simulations showed similar structural features of the etheno and ethano derivatives when present in DNA duplexes. However, also as shown by MD, the stacking interaction between the EC base and Phe 30 in the Mug active site is reduced as compared to the {var_epsilon}C base, which could account for the lower EC activity observed in this study.

  12. Effect of high-intensity interval exercise training on rush entry into plateau induced mitochondrial DNA oxidative damage in leukocyte%高强度间歇运动训练对急进高原淋巴细胞线粒体DNA氧化损伤的影响

    Institute of Scientific and Technical Information of China (English)

    申去非; 彭朋; 段富强; 秦永生; 薄海

    2014-01-01

    [目的]观察平原短期高强度间歇运动训练(high-intensity interval training,HIT)对青年男性急进高原淋巴细胞线粒体DNA氧化损伤的影响.[方法]30例世居平原青年男性随机分为无运动训练组(NT,n=15)和高强度间歇运动训练组(HIT,n=15).HIT组受试者进行HIT训练,以90%~95%心率贮备强度快跑3 min,间歇以45%~50%心率贮备强度慢跑3 min,重复6个循环,7次/周,共2周.训练后所有受试者同批次急进高原,在移居高原24 h检测淋巴细胞线粒体DNA(mitochondrial DNA,mtDNA)中8-氧鸟嘌呤脱氧核苷(8-oxo-deoxyguanosine,8-oxodG)含量、线粒体复合体活性、8-氧鸟嘌呤DNA糖基化酶(8-oxoguanine DNA glycosylase-1,OGG1)蛋白表达.[结果]与NT组比较,HIT组淋巴细胞OGG1蛋白表达、线粒体复合体Ⅰ、Ⅱ、Ⅳ和ATP合成酶活性显著升高(P<0.05),mtDNA中8-oxodG含量显著降低(P<0.01).[结论]平原阶段短期高强度间歇运动训练可提高机体高原低氧环境下淋巴细胞线粒体抗氧化能力和能量代谢水平.

  13. Chronic restraint stress in rats causes sustained increase in urinary corticosterone excretion without affecting cerebral or systemic oxidatively generated DNA/RNA damage

    DEFF Research Database (Denmark)

    Jorgensen, Anders; Maigaard, Katrine; Wörtwein, Gitta;

    2013-01-01

    cortex and hippocampal levels of oxidatively generated nuclear DNA damage, as measured by oxoguanine DNA glycosylase and formamidopyrimidine DNA glycosylase sensitive sites detected by the comet assay, as well as the expression of genes involved in DNA repair (Ogg1 and Nudt1) and inflammation (Ccl2...

  14. Oxidative DNA damage background estimated by a system model of base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Sokhansanj, B A; Wilson, III, D M

    2004-05-13

    Human DNA can be damaged by natural metabolism through free radical production. It has been suggested that the equilibrium between innate damage and cellular DNA repair results in an oxidative DNA damage background that potentially contributes to disease and aging. Efforts to quantitatively characterize the human oxidative DNA damage background level based on measuring 8-oxoguanine lesions as a biomarker have led to estimates varying over 3-4 orders of magnitude, depending on the method of measurement. We applied a previously developed and validated quantitative pathway model of human DNA base excision repair, integrating experimentally determined endogenous damage rates and model parameters from multiple sources. Our estimates of at most 100 8-oxoguanine lesions per cell are consistent with the low end of data from biochemical and cell biology experiments, a result robust to model limitations and parameter variation. Our results show the power of quantitative system modeling to interpret composite experimental data and make biologically and physiologically relevant predictions for complex human DNA repair pathway mechanisms and capacity.

  15. Heavy Metal-Induced Oxidative DNA Damage in Earthworms: A Review

    Directory of Open Access Journals (Sweden)

    Takeshi Hirano

    2010-01-01

    Full Text Available Earthworms can be used as a bio-indicator of metal contamination in soil, Earlier reports claimed the bioaccumulation of heavy metals in earthworm tissues, while the metal-induced mutagenicity reared in contaminated soils for long duration. But we examined the metal-induced mutagenicity in earthworms reared in metal containing culture beddings. In this experiment we observed the generation of 8-oxoguanine (8-oxo-Gua in earthworms exposed to cadmium and nickel in soil. 8-oxo-Gua is a major premutagenic form of oxidative DNA damage that induces GC-to-TA point mutations, leading to carcinogenesis.

  16. Dietary elevated sucrose modulation of diesel-induced genotoxicity in the colon and liver of Big Blue rats

    DEFF Research Database (Denmark)

    Risom, L.; Moller, P.; Hansen, Max;

    2003-01-01

    . The mRNA expression levels of the DNA repair enzymes N-methylpurine DNA glycosylase (MPG), 8-oxoguanine DNA glycosylase (OGG1) and ERCC1 (part of the nucleotide excision repair complex) measured by reverse transcription-polymerase chain reaction were increased in liver by DEP feeding. In colon......Earlier studies have indicated that sucrose possesses either co-carcinogenic or tumor-promoter effects in colon carcinogenesis induced by genotoxic carcinogens. In this study we investigated the role of sucrose on diesel exhaust particle (DEP)-induced genotoxicity in the colonic mucosa and liver......-breaks and DNA adducts in liver. DEP and sucrose treatment did not have any effect on mutation frequency in colon and liver. Oxidative DNA damage detected as 8-oxodG (8-oxo-7,8-dihydro-2'-deoxyguanosine) and endonuclease III or formamidopyrimidine DNA glycosylase sensitive sites was unaltered in colon and liver...

  17. Metallic gold reduces TNFalpha expression, oxidative DNA damage and pro-apoptotic signals after experimental brain injury

    DEFF Research Database (Denmark)

    Pedersen, Mie Ostergaard; Larsen, Agnete; Pedersen, Dan Sonne;

    2009-01-01

    -45 microm in size or the vehicle (placebo) were implanted in the cortical tissue followed by a cortical freeze-lesioning. At 1-2 weeks post-injury, brains were analyzed by using immunohistochemistry and markers of inflammation, oxidative stress and apoptosis. This study shows that gold treatment...... significantly reduces the cerebral levels of tumor necrosis factor alpha (TNFalpha), oxidative DNA damage (as judged by 8-oxoguanine levels), and pro-apoptotic markers (cleaved caspase-3, cytochrome c leakage), when compared to those of controls. The data presented here points toward gold particles as a tool...

  18. Repair of DNA treated with γ-irradiation and chemical carcinogens. Progress report, 1980-1983

    International Nuclear Information System (INIS)

    We have studied in vitro DNA repair with the isolation and characterization of DNA glycosylases active in the removable of 3-methyladenine and the problem of repair of DNA in chromatin. The second area of focus has been on transposable elements and carcinogen action. The work on DNA adducts with β-propiolactone was done to define potential new substrates useful in a search for new glycosylases

  19. In vitro Repair of Oxidative DNA Damage by Human Nucleotide Excision Repair System: Possible Explanation for Neurodegeneration in Xeroderma Pigmentosum Patients

    Science.gov (United States)

    Reardon, Joyce T.; Bessho, Tadayoshi; Kung, Hsiang Chuan; Bolton, Philip H.; Sancar, Aziz

    1997-08-01

    Xeroderma pigmentosum (XP) patients fail to remove pyrimidine dimers caused by sunlight and, as a consequence, develop multiple cancers in areas exposed to light. The second most common sign, present in 20-30% of XP patients, is a set of neurological abnormalities caused by neuronal death in the central and peripheral nervous systems. Neural tissue is shielded from sunlight-induced DNA damage, so the cause of neurodegeneration in XP patients remains unexplained. In this study, we show that two major oxidative DNA lesions, 8-oxoguanine and thymine glycol, are excised from DNA in vitro by the same enzyme system responsible for removing pyrimidine dimers and other bulky DNA adducts. Our results suggest that XP neurological disease may be caused by defective repair of lesions that are produced in nerve cells by reactive oxygen species generated as by-products of an active oxidative metabolism.

  20. The hydantoin lesions formed from oxidation of 7,8-dihydro-8-oxoguanine are potnt sources of replication errors in vivo; Henderson, P.T.; Delaney, J.C.; Muller, J. G.; Neeley, W.L.; Tannenbaum, S.R.; Burrows, C.J.; Essigmann, J.M. Biochemistry (accelerate

    Energy Technology Data Exchange (ETDEWEB)

    Henderson, P; Delaney, J; Muller, J; Neeley, W; Tannenbaum, S; Burrows, C; Essigmann, J

    2003-10-27

    Single-stranded DNA genomes have been constructed that site-specifically contain the 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG) oxidation products guanidinohyndantoin (Gh), and the two stable stereoisomers of spiroiminodihydantoin (Sp1 and Sp2). The circular viral genomes were transfected into wild-type AB1157 Escherichia coli and the efficiency of lesion bypass by DNA polymerase(s) was assessed. Viral progeny were analyzed for mutation frequency and type using the recently developed restriction endonuclease and post-labeling (REAP) assay. Gh was bypassed nearly as efficiently as the parent 8-oxoG, but was highly mutagenic, causing almost exclusive G{yields}C transversions. The stereoisomers Sp1 and Sp2 were, in comparison, much stronger blocks to DNA polymerase extension, and caused a mixture of G{yields}T and G{yields}C transversions. The ratio of G{yields}T to G{yields}C mutations for each Sp lesion was dependent on the stereochemical configuration of the base. All observed mutation frequencies were at least an order of magnitude higher than those caused by 8-oxoG. Were these lesions to be formed in vivo, our data show that they are absolutely miscoding, and may be refractory to repair after translesion synthesis.

  1. Uracil excision by endogenous SMUG1 glycosylase promotes efficient Ig class switching and impacts on A:T substitutions during somatic mutation.

    Science.gov (United States)

    Dingler, Felix A; Kemmerich, Kristin; Neuberger, Michael S; Rada, Cristina

    2014-07-01

    Excision of uracil introduced into the immunoglobulin loci by AID is central to antibody diversification. While predominantly carried out by the UNG uracil-DNA glycosylase as reflected by deficiency in immunoglobulin class switching in Ung(-/-) mice, the deficiency is incomplete, as evidenced by the emergence of switched IgG in the serum of Ung(-/-) mice. Lack of switching in mice deficient in both UNG and MSH2 suggested that mismatch repair initiated a backup pathway. We now show that most of the residual class switching in Ung(-/-) mice depends upon the endogenous SMUG1 uracil-DNA glycosylase, with in vitro switching to IgG1 as well as serum IgG3, IgG2b, and IgA greatly diminished in Ung(-/-) Smug1(-/-) mice, and that Smug1 partially compensates for Ung deficiency over time. Nonetheless, using a highly MSH2-dependent mechanism, Ung(-/-) Smug1(-/-) mice can still produce detectable levels of switched isotypes, especially IgG1. While not affecting the pattern of base substitutions, SMUG1 deficiency in an Ung(-/-) background further reduces somatic hypermutation at A:T base pairs. Our data reveal an essential requirement for uracil excision in class switching and in facilitating noncanonical mismatch repair for the A:T phase of hypermutation presumably by creating nicks near the U:G lesion recognized by MSH2.

  2. Apoptosis and DNA Methylation

    Energy Technology Data Exchange (ETDEWEB)

    Meng, Huan X.; Hackett, James A. [MRC Human Genetics Unit, IGMM, Western General Hospital, Edinburgh EH4 2XU (United Kingdom); Nestor, Colm [MRC Human Genetics Unit, IGMM, Western General Hospital, Edinburgh EH4 2XU (United Kingdom); Breakthrough Research Unit, University of Edinburgh, Western General Hospital, Edinburgh EH4 2XU (United Kingdom); Dunican, Donncha S.; Madej, Monika; Reddington, James P. [MRC Human Genetics Unit, IGMM, Western General Hospital, Edinburgh EH4 2XU (United Kingdom); Pennings, Sari [Queen' s Medical Research Institute, University of Edinburgh, Edinburgh EH16 4TJ (United Kingdom); Harrison, David J. [Breakthrough Research Unit, University of Edinburgh, Western General Hospital, Edinburgh EH4 2XU (United Kingdom); Meehan, Richard R., E-mail: Richard.Meehan@hgu.mrc.ac.uk [MRC Human Genetics Unit, IGMM, Western General Hospital, Edinburgh EH4 2XU (United Kingdom); Breakthrough Research Unit, University of Edinburgh, Western General Hospital, Edinburgh EH4 2XU (United Kingdom)

    2011-04-01

    Epigenetic mechanisms assist in maintaining gene expression patterns and cellular properties in developing and adult tissues. The molecular pathology of disease states frequently includes perturbation of DNA and histone methylation patterns, which can activate apoptotic pathways associated with maintenance of genome integrity. This perspective focuses on the pathways linking DNA methyltransferases and methyl-CpG binding proteins to apoptosis, and includes new bioinformatic analyses to characterize the evolutionary origin of two G/T mismatch-specific thymine DNA glycosylases, MBD4 and TDG.

  3. Apoptosis and DNA Methylation

    Directory of Open Access Journals (Sweden)

    Richard R. Meehan

    2011-04-01

    Full Text Available Epigenetic mechanisms assist in maintaining gene expression patterns and cellular properties in developing and adult tissues. The molecular pathology of disease states frequently includes perturbation of DNA and histone methylation patterns, which can activate apoptotic pathways associated with maintenance of genome integrity. This perspective focuses on the pathways linking DNA methyltransferases and methyl-CpG binding proteins to apoptosis, and includes new bioinformatic analyses to characterize the evolutionary origin of two G/T mismatch-specific thymine DNA glycosylases, MBD4 and TDG.

  4. Biomarkers of oxidative damage to DNA and repair

    DEFF Research Database (Denmark)

    Loft, Steffen; Høgh Danielsen, Pernille; Mikkelsen, Lone;

    2008-01-01

    Oxidative-stress-induced damage to DNA includes a multitude of lesions, many of which are mutagenic and have multiple roles in cancer and aging. Many lesions have been characterized by MS-based methods after extraction and digestion of DNA. These preparation steps may cause spurious base oxidation......, which is less likely to occur with methods such as the comet assay, which are based on nicking of the DNA strand at modified bases, but offer less specificity. The European Standards Committee on Oxidative DNA Damage has concluded that the true levels of the most widely studied lesion, 8-oxodG (8-oxo-7......,8-dihydro-2'-deoxyguanosine), in cellular DNA is between 0.5 and 5 lesions per 10(6) dG bases. Base excision repair of oxidative damage to DNA can be assessed by nicking assays based on oligonucleotides with lesions or the comet assay, by mRNA expression levels or, in the case of, e.g., OGG1 (8-oxoguanine...

  5. Mitochondrial base excision repair assays

    DEFF Research Database (Denmark)

    Maynard, Scott; de Souza-Pinto, Nadja C; Scheibye-Knudsen, Morten;

    2010-01-01

    glycosylases, AP endonuclease, DNA polymerase (POLgamma in mitochondria) and DNA ligase. This article outlines procedures for measuring oxidative damage formation and BER in mitochondria, including isolation of mitochondria from tissues and cells, protocols for measuring BER enzyme activities, gene......The main source of mitochondrial DNA (mtDNA) damage is reactive oxygen species (ROS) generated during normal cellular metabolism. The main mtDNA lesions generated by ROS are base modifications, such as the ubiquitous 8-oxoguanine (8-oxoG) lesion; however, base loss and strand breaks may also occur....... Many human diseases are associated with mtDNA mutations and thus maintaining mtDNA integrity is critical. All of these lesions are repaired primarily by the base excision repair (BER) pathway. It is now known that mammalian mitochondria have BER, which, similarly to nuclear BER, is catalyzed by DNA...

  6. Laser controlled singlet oxygen generation in mitochondria to promote mitochondrial DNA replication in vitro.

    Science.gov (United States)

    Zhou, Xin; Wang, Yupei; Si, Jing; Zhou, Rong; Gan, Lu; Di, Cuixia; Xie, Yi; Zhang, Hong

    2015-11-18

    Reports have shown that a certain level of reactive oxygen species (ROS) can promote mitochondrial DNA (mtDNA) replication. However, it is unclear whether it is the mitochondrial ROS that stimulate mtDNA replication and this requires further investigation. Here we employed a photodynamic system to achieve controlled mitochondrial singlet oxygen ((1)O2) generation. HeLa cells incubated with 5-aminolevulinic acid (ALA) were exposed to laser irradiation to induce (1)O2 generation within mitochondria. Increased mtDNA copy number was detected after low doses of 630 nm laser light in ALA-treated cells. The stimulated mtDNA replication was directly linked to mitochondrial (1)O2 generation, as verified using specific ROS scavengers. The stimulated mtDNA replication was regulated by mitochondrial transcription factor A (TFAM) and mtDNA polymerase γ. MtDNA control region modifications were induced by (1)O2 generation in mitochondria. A marked increase in 8-Oxoguanine (8-oxoG) level was detected in ALA-treated cells after irradiation. HeLa cell growth stimulation and G1-S cell cycle transition were also observed after laser irradiation in ALA-treated cells. These cellular responses could be due to a second wave of ROS generation detected in mitochondria. In summary, we describe a controllable method of inducing mtDNA replication in vitro.

  7. The Mutyh base excision repair gene influences the inflammatory response in a mouse model of ulcerative colitis.

    Directory of Open Access Journals (Sweden)

    Ida Casorelli

    Full Text Available BACKGROUND: The Mutyh DNA glycosylase is involved in the repair of oxidized DNA bases. Mutations in the human MUTYH gene are responsible for colorectal cancer in familial adenomatous polyposis. Since defective DNA repair genes might contribute to the increased cancer risk associated with inflammatory bowel diseases, we compared the inflammatory response of wild-type and Mutyh(-/- mice to oxidative stress. METHODOLOGY/PRINCIPAL FINDINGS: The severity of colitis, changes in expression of genes involved in DNA repair and inflammation, DNA 8-oxoguanine levels and microsatellite instability were analysed in colon of mice treated with dextran sulfate sodium (DSS. The Mutyh(-/- phenotype was associated with a significant accumulation of 8-oxoguanine in colon DNA of treated mice. A single DSS cycle induced severe acute ulcerative colitis in wild-type mice, whereas lesions were modest in Mutyh(-/- mice, and this was associated with moderate variations in the expression of several cytokines. Eight DSS cycles caused chronic colitis in both wild-type and Mutyh(-/- mice. Lymphoid hyperplasia and a significant reduction in Foxp3(+ regulatory T cells were observed only in Mutyh(-/- mice. CONCLUSIONS: The findings indicate that, in this model of ulcerative colitis, Mutyh plays a major role in maintaining intestinal integrity by affecting the inflammatory response.

  8. Removal of deaminated cytosines and detection of in vivo methylation in ancient DNA

    OpenAIRE

    Briggs, A; Stenzel, U.; Meyer, M; Krause, J.; Kircher, M. (Manfred); Pääbo, S

    2010-01-01

    DNA sequences determined from ancient organisms have high error rates, primarily due to uracil bases created by cytosine deamination. We use synthetic oligonucleotides, as well as DNA extracted from mammoth and Neandertal remains, to show that treatment with uracil–DNA–glycosylase and endonuclease VIII removes uracil residues from ancient DNA and repairs most of the resulting abasic sites, leaving undamaged parts of the DNA fragments intact. Neandertal DNA sequences determined with this proto...

  9. Controlled exposure to diesel exhaust and traffic noise - Effects on oxidative stress and activation in mononuclear blood cells

    DEFF Research Database (Denmark)

    Hemmingsen, Jette Gjerke; Møller, Peter; Jantzen, Kim;

    2015-01-01

    Particulate air pollution increases risk of cancer and cardiopulmonary disease, partly through oxidative stress. Traffic-related noise increases risk of cardiovascular disease and may cause oxidative stress. In this controlled random sequence study, 18 healthy subjects were exposed for 3h to diesel...... exhaust (DE) at 276μg/m(3) from a passenger car or filtered air, with co-exposure to traffic noise at 48 or 75dB(A). Gene expression markers of inflammation, (interleukin-8 and tumor necrosis factor), oxidative stress (heme oxygenase (decycling-1)) and DNA repair (8-oxoguanine DNA glycosylase (OGG1)) were...... molecules in leukocyte subtypes. CONCLUSION: 3-h exposure to DE caused no genotoxicity, oxidative stress or inflammation in PBMCs, whereas exposure to noise might cause oxidatively damaged DNA....

  10. 3CAPS – a structural AP–site analogue as a tool to investigate DNA base excision repair

    Science.gov (United States)

    Schuermann, David; Scheidegger, Simon P.; Weber, Alain R.; Bjørås, Magnar; Leumann, Christian J.; Schär, Primo

    2016-01-01

    Abasic sites (AP-sites) are frequent DNA lesions, arising by spontaneous base hydrolysis or as intermediates of base excision repair (BER). The hemiacetal at the anomeric centre renders them chemically reactive, which presents a challenge to biochemical and structural investigation. Chemically more stable AP-site analogues have been used to avoid spontaneous decay, but these do not fully recapitulate the features of natural AP–sites. With its 3′–phosphate replaced by methylene, the abasic site analogue 3CAPS was suggested to circumvent some of these limitations. Here, we evaluated the properties of 3CAPS in biochemical BER assays with mammalian proteins. 3CAPS-containing DNA substrates were processed by APE1, albeit with comparably poor efficiency. APE1-cleaved 3CAPS can be extended by DNA polymerase β but repaired only by strand displacement as the 5′–deoxyribophosphate (dRP) cannot be removed. DNA glycosylases physically and functionally interact with 3CAPS substrates, underlining its structural integrity and biochemical reactivity. The AP lyase activity of bifunctional DNA glycosylases (NTH1, NEIL1, FPG), however, was fully inhibited. Notably, 3CAPS-containing DNA also effectively inhibited the activity of bifunctional glycosylases on authentic substrates. Hence, the chemically stable 3CAPS with its preserved hemiacetal functionality is a potent tool for BER research and a potential inhibitor of bifunctional DNA glycosylases. PMID:26733580

  11. Listeria monocytogenes DNA glycosylase AdiP affects flagellar motility, biofilm formation, virulence, and stress responses

    Science.gov (United States)

    The temperature-dependent alteration of flagellar motility gene expression is critical for the foodborne pathogen Listeria monocytogenes to respond to a changing environment. In this study, a genetic determinant, L. monocytogenes f2365_0220 (lmof2365_0220), encoding a putative protein that is struct...

  12. Regulation and function of DNA methylation in plants and animals

    KAUST Repository

    He, Xinjian

    2011-02-15

    DNA methylation is an important epigenetic mark involved in diverse biological processes. In plants, DNA methylation can be established through the RNA-directed DNA methylation pathway, an RNA interference pathway for transcriptional gene silencing (TGS), which requires 24-nt small interfering RNAs. In mammals, de novo DNA methylation occurs primarily at two developmental stages: during early embryogenesis and during gametogenesis. While it is not clear whether establishment of DNA methylation patterns in mammals involves RNA interference in general, de novo DNA methylation and suppression of transposons in germ cells require 24-32-nt piwi-interacting small RNAs. DNA methylation status is dynamically regulated by DNA methylation and demethylation reactions. In plants, active DNA demethylation relies on the repressor of silencing 1 family of bifunctional DNA glycosylases, which remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, initiating a base excision repair (BER) pathway. In animals, multiple mechanisms of active DNA demethylation have been proposed, including a deaminase- and DNA glycosylase-initiated BER pathway. New information concerning the effects of various histone modifications on the establishment and maintenance of DNA methylation has broadened our understanding of the regulation of DNA methylation. The function of DNA methylation in plants and animals is also discussed in this review. © 2011 IBCB, SIBS, CAS All rights reserved.

  13. Presence of base excision repair enzymes in the wheat aleurone and their activation in cells undergoing programmed cell death.

    Science.gov (United States)

    Bissenbaev, Amangeldy K; Ishchenko, Alexander A; Taipakova, Sabira M; Saparbaev, Murat K

    2011-10-01

    Cereal aleurone cells are specialized endosperm cells that produce enzymes to hydrolyze the starchy endosperm during germination. Aleurone cells can undergo programmed cell death (PCD) when incubated in the presence of gibberellic acid (GA) in contrast to abscisic acid (ABA) which inhibits the process. The progression of PCD in aleurone layer cells of wheat grain is accompanied by an increase in deoxyribonuclease (DNase) activities and the internucleosomal degradation of nuclear DNA. Reactive oxygen species (ROS) are increased during PCD in the aleurone cells owing to the β-oxidation of triglycerides and inhibition of the antioxidant enzymes possibly leading to extensive oxidative damage to DNA. ROS generate mainly non-bulky DNA base lesions which are removed in the base excision repair (BER) pathway, initiated by the DNA glycosylases. At present, very little is known about oxidative DNA damage repair in cereals. Here, we study DNA repair in the cell-free extracts of wheat aleurone layer incubated or not with phytohormones. We show, for the first time, the presence of 8-oxoguanine-DNA and ethenoadenine-DNA glycosylase activities in wheat aleurone cells. Interestingly, the DNA glycosylase and AP endonuclease activities are strongly induced in the presence of GA. Based on these data we propose that GA in addition to activation of nuclear DNases also induces the DNA repair activities which remove oxidized DNA bases in the BER pathway. Potential roles of the wheat DNA glycosylases in GA-induced oligonucleosomal fragmentation of DNA and metabolic activation of aleurone layer cells via repair of transcribed regions are discussed.

  14. The roles of APE1, APE2, DNA polymerase β and mismatch repair in creating S region DNA breaks during antibody class switch

    OpenAIRE

    Schrader, Carol E.; Guikema, Jeroen E.J.; Wu, Xiaoming; Stavnezer, Janet

    2008-01-01

    Immunoglobulin class switch recombination (CSR) occurs by an intrachromosomal deletion requiring generation of double-stranded DNA breaks (DSBs) in immunoglobulin switch region DNA. The initial steps of DSB formation have been elucidated: cytosine deamination by activation-induced cytidine deaminase (AID) and the generation of abasic sites by uracil-DNA glycosylase (UNG). We show that abasic sites are converted into single-strand breaks (SSBs) by apurinic/apyrimidinic endonucleases (APE1 and ...

  15. Finding and Producing Probiotic Glycosylases for the Biocatalysis of Ginsenosides: A Mini Review

    Directory of Open Access Journals (Sweden)

    Seockmo Ku

    2016-05-01

    Full Text Available Various microorganisms have been widely applied in nutraceutical industries for the processing of phytochemical conversion. Specifically, in the Asian food industry and academia, notable attention is paid to the biocatalytic process of ginsenosides (ginseng saponins using probiotic bacteria that produce high levels of glycosyl-hydrolases. Multiple groups have conducted experiments in order to determine the best conditions to produce more active and stable enzymes, which can be applicable to produce diverse types of ginsenosides for commercial applications. In this sense, there are various reviews that cover the biofunctional effects of multiple types of ginsenosides and the pathways of ginsenoside deglycosylation. However, little work has been published on the production methods of probiotic enzymes, which is a critical component of ginsenoside processing. This review aims to investigate current preparation methods, results on the discovery of new glycosylases, the application potential of probiotic enzymes and their use for biocatalysis of ginsenosides in the nutraceutical industry.

  16. Finding and Producing Probiotic Glycosylases for the Biocatalysis of Ginsenosides: A Mini Review.

    Science.gov (United States)

    Ku, Seockmo

    2016-01-01

    Various microorganisms have been widely applied in nutraceutical industries for the processing of phytochemical conversion. Specifically, in the Asian food industry and academia, notable attention is paid to the biocatalytic process of ginsenosides (ginseng saponins) using probiotic bacteria that produce high levels of glycosyl-hydrolases. Multiple groups have conducted experiments in order to determine the best conditions to produce more active and stable enzymes, which can be applicable to produce diverse types of ginsenosides for commercial applications. In this sense, there are various reviews that cover the biofunctional effects of multiple types of ginsenosides and the pathways of ginsenoside deglycosylation. However, little work has been published on the production methods of probiotic enzymes, which is a critical component of ginsenoside processing. This review aims to investigate current preparation methods, results on the discovery of new glycosylases, the application potential of probiotic enzymes and their use for biocatalysis of ginsenosides in the nutraceutical industry. PMID:27196878

  17. Regulation of MUTYH, a DNA Repair Enzyme, in Renal Proximal Tubular Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Jianping Lu

    2015-01-01

    Full Text Available MUTYH is a DNA repair enzyme that initiates a base excision repair (BER by recognizing and removing 8-Oxoguanine (8-oxoG and its paired adenine. We demonstrated that both TGF-β1 and H2O2 treatment led to an increased 8-oxoG in cultured human proximal tubule epithelial (HK-2 cells, while the former induced epithelial-mesenchymal transition and the latter caused cell apoptosis. Without stimulation, HK-2 cells showed MUTYH expression in mitochondria. TGF-β1 triggered a transient upregulation of mitochondrial MUTYH and induced the expression of nuclear isoforms, while H2O2 showed no role on MUTYH expression. Ureteral obstruction (UUO mice exhibited high 8-oxoG reactivity with tubulointerstitial lesions. After obstruction, the MUTYH expression was increased only in tubules at day 3 and decreased with obvious tubular atrophy at day 10. Particularly, MUTYH was primarily located in normal tubular cytoplasm with a dominant mitochondrial form. A few cells with nuclear MUTYH expression were observed in the fibrotic interstitium. We confirmed that increased MUTYH expression was upregulated and positively correlated with the severity of kidney fibrosis. Thus, renal fibrosis caused a cell-type-specific and time-dependent response of oxidative DNA repairs, even within the same tissues. It suggests that intervention of MUTYH might be effective for therapies.

  18. Nitroglycerin induces DNA damage and vascular cell death in the setting of nitrate tolerance.

    Science.gov (United States)

    Mikhed, Yuliya; Fahrer, Jörg; Oelze, Matthias; Kröller-Schön, Swenja; Steven, Sebastian; Welschof, Philipp; Zinßius, Elena; Stamm, Paul; Kashani, Fatemeh; Roohani, Siyer; Kress, Joana Melanie; Ullmann, Elisabeth; Tran, Lan P; Schulz, Eberhard; Epe, Bernd; Kaina, Bernd; Münzel, Thomas; Daiber, Andreas

    2016-07-01

    Nitroglycerin (GTN) and other organic nitrates are widely used vasodilators. Their side effects are development of nitrate tolerance and endothelial dysfunction. Given the potential of GTN to induce nitro-oxidative stress, we investigated the interaction between nitro-oxidative DNA damage and vascular dysfunction in experimental nitrate tolerance. Cultured endothelial hybridoma cells (EA.hy 926) and Wistar rats were treated with GTN (ex vivo: 10-1000 µM; in vivo: 10, 20 and 50 mg/kg/day for 3 days, s.c.). The level of DNA strand breaks, 8-oxoguanine and O (6)-methylguanine DNA adducts was determined by Comet assay, dot blot and immunohistochemistry. Vascular function was determined by isometric tension recording. DNA adducts and strand breaks were induced by GTN in cells in vitro in a concentration-dependent manner. GTN in vivo administration leads to endothelial dysfunction, nitrate tolerance, aortic and cardiac oxidative stress, formation of DNA adducts, stabilization of p53 and apoptotic death of vascular cells in a dose-dependent fashion. Mice lacking O (6)-methylguanine-DNA methyltransferase displayed more vascular O (6)-methylguanine adducts and oxidative stress under GTN therapy than wild-type mice. Although we were not able to prove a causal role of DNA damage in the etiology of nitrate tolerance, the finding of GTN-induced DNA damage such as the mutagenic and toxic adduct O (6)-methylguanine, and cell death supports the notion that GTN based therapy may provoke adverse side effects, including endothelial function. Further studies are warranted to clarify whether GTN pro-apoptotic effects are related to an impaired recovery of patients upon myocardial infarction. PMID:27357950

  19. Nitroglycerin induces DNA damage and vascular cell death in the setting of nitrate tolerance.

    Science.gov (United States)

    Mikhed, Yuliya; Fahrer, Jörg; Oelze, Matthias; Kröller-Schön, Swenja; Steven, Sebastian; Welschof, Philipp; Zinßius, Elena; Stamm, Paul; Kashani, Fatemeh; Roohani, Siyer; Kress, Joana Melanie; Ullmann, Elisabeth; Tran, Lan P; Schulz, Eberhard; Epe, Bernd; Kaina, Bernd; Münzel, Thomas; Daiber, Andreas

    2016-07-01

    Nitroglycerin (GTN) and other organic nitrates are widely used vasodilators. Their side effects are development of nitrate tolerance and endothelial dysfunction. Given the potential of GTN to induce nitro-oxidative stress, we investigated the interaction between nitro-oxidative DNA damage and vascular dysfunction in experimental nitrate tolerance. Cultured endothelial hybridoma cells (EA.hy 926) and Wistar rats were treated with GTN (ex vivo: 10-1000 µM; in vivo: 10, 20 and 50 mg/kg/day for 3 days, s.c.). The level of DNA strand breaks, 8-oxoguanine and O (6)-methylguanine DNA adducts was determined by Comet assay, dot blot and immunohistochemistry. Vascular function was determined by isometric tension recording. DNA adducts and strand breaks were induced by GTN in cells in vitro in a concentration-dependent manner. GTN in vivo administration leads to endothelial dysfunction, nitrate tolerance, aortic and cardiac oxidative stress, formation of DNA adducts, stabilization of p53 and apoptotic death of vascular cells in a dose-dependent fashion. Mice lacking O (6)-methylguanine-DNA methyltransferase displayed more vascular O (6)-methylguanine adducts and oxidative stress under GTN therapy than wild-type mice. Although we were not able to prove a causal role of DNA damage in the etiology of nitrate tolerance, the finding of GTN-induced DNA damage such as the mutagenic and toxic adduct O (6)-methylguanine, and cell death supports the notion that GTN based therapy may provoke adverse side effects, including endothelial function. Further studies are warranted to clarify whether GTN pro-apoptotic effects are related to an impaired recovery of patients upon myocardial infarction.

  20. Relation between DNA damage measured by comet assay and OGG1 Ser326Cys polymorphism in antineoplastic drugs biomonitoring

    OpenAIRE

    Carina Ladeira; Susana Viegas; Mário Pádua; Elisabete Carolino; Gomes, Manuel C.; Miguel Brito

    2015-01-01

    Antineoplastic drugs are hazardous chemical agents used mostly in the treatment of patients with cancer, however health professionals that handle and administer these drugs can become exposed and develop DNA damage. Comet assay is a standard method for assessing DNA damage in human biomonitoring and, combined with formamidopyrimidine DNA glycosylase (FPG) enzyme, it specifically detects DNA oxidative damage.The aim of this study was to investigate genotoxic effects in workers occupationally e...

  1. DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

    International Nuclear Information System (INIS)

    Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase. (letter)

  2. FANCJ helicase uniquely senses oxidative base damage in either strand of duplex DNA and is stimulated by replication protein A to unwind the damaged DNA substrate in a strand-specific manner.

    Science.gov (United States)

    Suhasini, Avvaru N; Sommers, Joshua A; Mason, Aaron C; Voloshin, Oleg N; Camerini-Otero, R Daniel; Wold, Marc S; Brosh, Robert M

    2009-07-01

    FANCJ mutations are genetically linked to the Fanconi anemia complementation group J and predispose individuals to breast cancer. Understanding the role of FANCJ in DNA metabolism and how FANCJ dysfunction leads to tumorigenesis requires mechanistic studies of FANCJ helicase and its protein partners. In this work, we have examined the ability of FANCJ to unwind DNA molecules with specific base damage that can be mutagenic or lethal. FANCJ was inhibited by a single thymine glycol, but not 8-oxoguanine, in either the translocating or nontranslocating strands of the helicase substrate. In contrast, the human RecQ helicases (BLM, RECQ1, and WRN) display strand-specific inhibition of unwinding by the thymine glycol damage, whereas other DNA helicases (DinG, DnaB, and UvrD) are not significantly inhibited by thymine glycol in either strand. In the presence of replication protein A (RPA), but not Escherichia coli single-stranded DNA-binding protein, FANCJ efficiently unwound the DNA substrate harboring the thymine glycol damage in the nontranslocating strand; however, inhibition of FANCJ helicase activity by the translocating strand thymine glycol was not relieved. Strand-specific stimulation of human RECQ1 helicase activity was also observed, and RPA bound with high affinity to single-stranded DNA containing a single thymine glycol. Based on the biochemical studies, we propose a model for the specific functional interaction between RPA and FANCJ on the thymine glycol substrates. These studies are relevant to the roles of RPA, FANCJ, and other DNA helicases in the metabolism of damaged DNA that can interfere with basic cellular processes of DNA metabolism. PMID:19419957

  3. Discovery and characterization of artifactual mutations in deep coverage targeted capture sequencing data due to oxidative DNA damage during sample preparation.

    Science.gov (United States)

    Costello, Maura; Pugh, Trevor J; Fennell, Timothy J; Stewart, Chip; Lichtenstein, Lee; Meldrim, James C; Fostel, Jennifer L; Friedrich, Dennis C; Perrin, Danielle; Dionne, Danielle; Kim, Sharon; Gabriel, Stacey B; Lander, Eric S; Fisher, Sheila; Getz, Gad

    2013-04-01

    As researchers begin probing deep coverage sequencing data for increasingly rare mutations and subclonal events, the fidelity of next generation sequencing (NGS) laboratory methods will become increasingly critical. Although error rates for sequencing and polymerase chain reaction (PCR) are well documented, the effects that DNA extraction and other library preparation steps could have on downstream sequence integrity have not been thoroughly evaluated. Here, we describe the discovery of novel C > A/G > T transversion artifacts found at low allelic fractions in targeted capture data. Characteristics such as sequencer read orientation and presence in both tumor and normal samples strongly indicated a non-biological mechanism. We identified the source as oxidation of DNA during acoustic shearing in samples containing reactive contaminants from the extraction process. We show generation of 8-oxoguanine (8-oxoG) lesions during DNA shearing, present analysis tools to detect oxidation in sequencing data and suggest methods to reduce DNA oxidation through the introduction of antioxidants. Further, informatics methods are presented to confidently filter these artifacts from sequencing data sets. Though only seen in a low percentage of reads in affected samples, such artifacts could have profoundly deleterious effects on the ability to confidently call rare mutations, and eliminating other possible sources of artifacts should become a priority for the research community.

  4. Urinary excretion of 8-oxo-7,8-dihydroguanine as biomarker of oxidative damage to DNA.

    OpenAIRE

    Loft, Steffen; Danielsen, Pernille; Løhr, Mille; Jantzen, Kim; Hemmingsen, Jette G.; Roursgaard, Martin; Karotki, Dorina Gabriela; Møller, Peter

    2012-01-01

    Oxidatively damaged DNA may be important in carcinogenesis. 8-Oxo-7,8-dihydroguanine (8-oxoGua) is an abundant and mutagenic lesion excised by oxoguanine DNA glycosylase 1 (OGG1) and measurable in urine or plasma by chromatographic methods with electrochemical or mass spectrometric detectors, reflecting the rate of damage in steady state. A common genetic OGG1 variant may affect the activity and was associated with increased levels of oxidized purines in leukocytes without apparent effect on ...

  5. Association of polymorphisms hOGG1 rs1052133 and hMUTYH rs3219472 with risk of nasopharyngeal carcinoma in a Chinese population

    Directory of Open Access Journals (Sweden)

    Xie Y

    2016-02-01

    Full Text Available Ying Xie,2 Yuan Wu,3 Xunzhao Zhou,3 Mengwei Yao,3 Sisi Ning,3 Zhengbo Wei1 1Department of Head and Neck Tumor Surgery, Affiliated Tumor Hospital of Guangxi Medical University, 2Guangxi Key Laboratory for High-Incidence Tumor Prevention and Treatment, Experimental Center of Medical Science of Guangxi Medical University,3Graduate School of Guangxi Medical University, Nanning, People’s Republic of China Abstract: This case–control study investigates the possible relationships between the single-nucleotide polymorphisms rs1052133 in the human 8-oxoguanine DNA glycosylase 1 (hOGG1 gene and rs3219472 in the human MutY glycosylase homologue (hMUTYH gene and the risk of nasopharyngeal carcinoma (NPC. The two polymorphisms were genotyped in 488 unrelated NPC patients and 573 cancer-free controls. Genotype GG at rs1052133 was associated with significantly lower NPC risk than genotypes GC + CC (odds ratio [OR] 0.770, 95% confidence interval [CI] 0.595–0.996, P=0.012. In subgroup analyses, subjects with genotype GG at rs1052133 were at lower risk of NPC than those with GC or CC among individuals older than 40 years (OR 0.706, 95% CI 0.524–0.950, women (OR 0.571, 95% CI 0.337–0.968, and those with no smoking history (OR 0.634, 95% CI 0.463–0.868. No significant association was seen between polymorphisms at hMUTYH rs3219472 and the risk of NPC. However, gene–gene interaction analysis showed that subjects with genotype CC at rs1052133 and genotype AA at rs3219472 (CC/AA were at 2.887-fold higher risk of NPC than those with GG/GG, 3.183-fold higher risk than those with GG/GA, and 3.392-fold higher risk than those with GG/AA. Our results suggest that hOGG1 rs1052133 polymorphism may play an important role in NPC pathogenesis, especially among women, >40 years old, and those with no smoking history. The hMUTYH rs3219472 polymorphism may interact with hOGG1 rs1052133 polymorphism to influence susceptibility to NPC. Keywords: nasopharyngeal

  6. Polymorphisms of DNA repair genes OGG1 and XPD and the risk of age-related cataract in Egyptians

    Science.gov (United States)

    Gharib, Amal F.; Dabour, Sherif A.; Fouad, Rania A.

    2014-01-01

    Purpose To analyze the association of the polymorphisms of xeroderma pigmentosum complementation group D (XPD) and 8-oxoguanine glycosylase-1 (OGG1) genes with the risk of age-related cataract (ARC) in an Egyptian population. Methods This case-control study included 150 patients with ARC and 50 controls. Genotyping of XPD Asp312Asn was performed by amplification refractory mutation system PCR assay and genotyping of OGG1 Ser326Cys was carried out by PCR including confronting two-pair primers. Results The Asn/Asn genotype of XPD gene was significantly associated with increased risk of ARC (odds ratio [OR] = 2.74, 95% confidence interval [CI] = 1.01–7.43, p = 0.04) and cortical cataract (OR = 5.06, 95% CI = 1.70–15.05, p = 0.002). The Asn312 allele was significantly associated with an increased risk of ARC (OR = 1.75, 95% CI 1.06–2.89, p = 0.03) and cortical cataract (OR = 2.81, 95% CI = 1.56–5.08, p<0.001). The OGG1 Cys/Cys genotype frequency was significantly higher in ARC (OR = 4.13, 95% CI = 0.93–18.21, p = 0.04) and the Cys326 allele (OR = 1.85, 95% CI = 1.07–3.20, p = 0.03). Moreover, the Cys/Cys genotype of the OGG1 gene was significantly higher in cortical cataract (OR = 6.00, 95% CI = 1.24–28.99, p = 0.01) and the Cys326 allele was also significantly associated with cortical cataract (OR = 2.45, 95% CI = 1.30–4.63, p = 0.005). Conclusions The results suggest that the Asn/Asn genotype and Asn312 allele of XPD polymorphism, as well as the Cys/Cys genotype and Cys326 allele of the OGG1 polymorphism, may be associated with increased risk of the development of ARC, particularly the cortical type, in the Egyptian population. PMID:24868140

  7. Error-Prone Translesion DNA Synthesis by Escherichia coli DNA Polymerase IV (DinB on Templates Containing 1,2-dihydro-2-oxoadenine

    Directory of Open Access Journals (Sweden)

    Masaki Hori

    2010-01-01

    Full Text Available Escherichia coli DNA polymerase IV (Pol IV is involved in bypass replication of damaged bases in DNA. Reactive oxygen species (ROS are generated continuously during normal metabolism and as a result of exogenous stress such as ionizing radiation. ROS induce various kinds of base damage in DNA. It is important to examine whether Pol IV is able to bypass oxidatively damaged bases. In this study, recombinant Pol IV was incubated with oligonucleotides containing thymine glycol (dTg, 5-formyluracil (5-fodU, 5-hydroxymethyluracil (5-hmdU, 7,8-dihydro-8-oxoguanine (8-oxodG and 1,2-dihydro-2-oxoadenine (2-oxodA. Primer extension assays revealed that Pol IV preferred to insert dATP opposite 5-fodU and 5-hmdU, while it inefficiently inserted nucleotides opposite dTg. Pol IV inserted dCTP and dATP opposite 8-oxodG, while the ability was low. It inserted dCTP more effectively than dTTP opposite 2-oxodA. Pol IV's ability to bypass these lesions decreased in the order: 2-oxodA > 5-fodU~5-hmdU > 8-oxodG > dTg. The fact that Pol IV preferred to insert dCTP opposite 2-oxodA suggests the mutagenic potential of 2-oxodA leading to A:T→G:C transitions. Hydrogen peroxide caused an ~2-fold increase in A:T→G:C mutations in E. coli, while the increase was significantly greater in E. coli overexpressing Pol IV. These results indicate that Pol IV may be involved in ROS-enhanced A:T→G:C mutations.

  8. Association of the hOGG1 Ser326Cys polymorphism with sporadic amyotrophic lateral sclerosis.

    Science.gov (United States)

    Coppedè, Fabio; Mancuso, Michelangelo; Lo Gerfo, Annalisa; Carlesi, Cecilia; Piazza, Selina; Rocchi, Anna; Petrozzi, Lucia; Nesti, Claudia; Micheli, Dario; Bacci, Andrea; Migliore, Lucia; Murri, Luigi; Siciliano, Gabriele

    2007-06-13

    Amyotropic lateral sclerosis (ALS) is a fatal and progressive neurodegenerative disease causing the loss of motoneurons of the brain and the spinal cord. The etiology of ALS is still uncertain, but males are at increased risk for the disease than females. Several studies have suggested that motoneurons in ALS might be subjected to the double insult of increased DNA oxidative damage and deficiencies in DNA repair systems. Particularly, increased levels of 8-oxoguanine and impairments of the DNA base excision repair system have been observed in neurons of ALS patients. There is evidence that the Ser326Cys polymorphism of the human 8-oxoguanine DNA glycosylase 1 (hOGG1) gene is associated with a reduced DNA repair activity. To evaluate the role of the hOGG1 Ser326Cys polymorphism in sporadic ALS (sALS), we screened 136 patients and 129 matched controls. In the total population, we observed association between both the Cys326 allele (p=0.02) and the combined Ser326Cys+Cys326Cys genotype (OR=1.65, 95% CI=1.06-2.88) and increased risk of disease. After stratification by gender, the Cys326 allele (p=0.01), both the Ser326Cys genotype (OR=2.14, 95% CI=1.09-4.19) and the combined Ser326Cys+Cys326Cys genotype (OR=2.15, 95% CI=1.16-4.01) were associated with sALS risk only in males. No significant association between the Ser326Cys polymorphism and disease phenotype, including age and site of onset and disease progression, was observed. Present results suggest a possible involvement of the hOGG1 Ser326Cys polymorphism in sALS pathogenesis. PMID:17531381

  9. Characterization of protein interactomes of DNA damages: application to oxidation injuries

    International Nuclear Information System (INIS)

    Cyclo-nucleosides are complex DNA damages implying both bases and sugar residues. They are generated by free radicals, in particular by the effect of ionizing radiations, and are not easily covered by cellular mechanisms. Using a protein trapping technique on probes containing these injuries, the negative influence of cyclo-nucleosides on the recognition of its target sequence by a DREF transcription factor and on the interactions of PARP1 with DNA have been identified. Interactions between Fpg bacterial glycosylase and cyclo-nucleosides have been analysed and it has been found that this enzyme has an affinity for them, without excision activity. Finally, a Thermococcus gammatolerans radiation resistant archae has been studied: the formation of simple and complex oxidation injuries at strong radiation doses has been measured and the action mechanism of two new glycosylases has been explained. (author)

  10. Radiation-induced damage to DNA

    International Nuclear Information System (INIS)

    This short survey focuses on the main radiation-induced base lesions that have been identified within cellular DNA. For this purpose, sensitive assays that are aimed at measuring a few modifications per 107 normal bases were set-up. In that respect high performance liquid chromatography - tandem mass spectrometry (CLHP-MS/MS) was found to be able to single out the formation of 9 oxidized nucleosides and two modified nucleo-bases out of the 70 oxidative base lesions that have been identified in model systems. As a striking result, it was found that in the DNA of γ-irradiated human monocytes, the formamide-pyrimidine derivative of guanine is produced in a higher yield than the ubiquitous 8-oxo-7,8-dihydro-guanine damage, both arising from the same radical precursor. However, relatively high doses of ionizing radiation (> 20 Gy) have to be applied in order to detect an increase in the level of the damage. This is due to the low efficiency for both low and high LET radiations to generate oxidative damage to DNA on one hand and the occurrence of artifactual oxidation of the overwhelming normal bases during DNA extraction on the other hand. Interestingly, a modified comet assays that involves the combined use of the alkaline single gel electrophoretic technique and DNA repair N-glycosylases has allowed the detection of three main types of radiation-induced damage within the dose range 0.3 Gy -10 Gy. It appears that the total of frank DNA strand breaks and alkali-labile sites is similar to the sum of oxidized pyrimidine bases and modified purine bases that are recognized by the endonuclease Ill protein and the formamide-pyrimidine DNA N-glycosylase respectively. (author)

  11. Selective enzymatic cleavage and labeling for sensitive capillary electrophoresis laser-induced fluorescence analysis of oxidized DNA bases.

    Science.gov (United States)

    Li, Cuiping; Wang, Hailin

    2015-08-01

    Oxidatively generated DNA damage is considered to be a significant contributing factor to cancer, aging, and age-related human diseases. It is important to detect oxidatively generated DNA damage to understand and clinically diagnosis diseases caused by oxidative damage. In this study, using selective enzymatic cleavage and quantum dot (QD) labeling, we developed a novel capillary electrophoresis-laser induced fluorescence method for the sensitive detection of oxidized DNA bases. First, oxidized DNA bases are recognized and removed by one DNA base excision repair glycosylase, leaving apurinic and apyrimidinic sites (AP sites) at the oxidized positions. The AP sites are further excised by the AP nicking activity of the chosen glycosylase, generating a nucleotide gap with 5'- and 3'- phosphate groups. After dephosphorylation with one alkaline phosphatase, a biotinylated ddNTP is introduced into the nucleotide space within the DNA strand by DNA polymerase I. The biotin-tagged DNA is further labeled with a QD-streptavidin conjugate via non-covalent interactions. The DNA-bound QD is well-separated from excess DNA-unbound QD by highly efficient capillary electrophoresis and is sensitively detected by online coupled laser-induced fluorescence analysis. Using this method, we can assess the trace levels of oxidized DNA bases induced by the Fenton reaction and UV irradiation. Interestingly, the use of the formamidopyrimidine glycosylase (FPG) protein and endonuclease VIII enables the detection of oxidized purine and pyrimidine bases, respectively. Using the synthesized standard DNA, the approach has low limits of detection of 1.1×10(-19)mol in mass and 2.9pM in concentration. PMID:26105778

  12. Trypanosoma cruzi contains a single detectable uracil-DNA glycosylase and repairs uracil exclusively via short patch base excision repair

    DEFF Research Database (Denmark)

    Pena Diaz, Javier; Akbari, Mansour; Sundheim, Ottar;

    2004-01-01

    Enzymes involved in genomic maintenance of human parasites are attractive targets for parasite-specific drugs. The parasitic protozoan Trypanosoma cruzi contains at least two enzymes involved in the protection against potentially mutagenic uracil, a deoxyuridine triphosphate nucleotidohydrolase (...

  13. DNA damage and repair activity after broccoli intake in young healthy smokers

    DEFF Research Database (Denmark)

    Riso, Patrizia; Martini, Daniela; Møller, Peter;

    2010-01-01

    Cruciferous vegetables contain compounds with antioxidant properties (e.g. carotenoids, vitamin C and folates) and can alter the activity of xenobiotic metabolism (i.e. isothiocyanates). These constituents may be particularly important for subjects who are exposed to free radicals and genotoxic....... Blood was collected before and after each period. The level of oxidatively damaged DNA lesions (formamidopyrimidine DNA glycosylase-sensitive sites), resistance to ex vivo H(2)O(2) treatment and repair of oxidised DNA lesions were measured in peripheral blood mononuclear cells (PBMCs). We also measured...

  14. miR-29 Represses the Activities of DNA Methyltransferases and DNA Demethylases

    Directory of Open Access Journals (Sweden)

    Izuho Hatada

    2013-07-01

    Full Text Available Members of the microRNA-29 (miR-29 family directly target the DNA methyltransferases, DNMT3A and DNMT3B. Disturbances in the expression levels of miR-29 have been linked to tumorigenesis and tumor aggressiveness. Members of the miR-29 family are currently thought to repress DNA methylation and suppress tumorigenesis by protecting against de novo methylation. Here, we report that members of the miR-29 family repress the activities of DNA methyltransferases and DNA demethylases, which have opposing roles in control of DNA methylation status. Members of the miR-29 family directly inhibited DNA methyltransferases and two major factors involved in DNA demethylation, namely tet methylcytosine dioxygenase 1 (TET1 and thymine DNA glycosylase (TDG. Overexpression of miR-29 upregulated the global DNA methylation level in some cancer cells and downregulated DNA methylation in other cancer cells, suggesting that miR-29 suppresses tumorigenesis by protecting against changes in the existing DNA methylation status rather than by preventing de novo methylation of DNA.

  15. Salvia fruticosa reduces intrinsic cellular and H2O2-induced DNA oxidation in HEK 293 cells;assessment using flow cytometry

    Institute of Scientific and Technical Information of China (English)

    Saleem Bani Hani; Mekki Bayachou

    2014-01-01

    Objective:To investigate the role of water-soluble extract of Salvia fruticosa (Greek sage) (S. fruticosa) leaves in reducing both intrinsic cellular and H2O2-induced DNA oxidation in cultured human embryonic kidney 293 cells. S. fruticosa, native to the Eastern-Mediterranean basin, is widely used as a medicinal herb for treatment of various diseases. Methods: Dried leaves of S. fruticosa were extracted in phosphate buffer saline and purified using both vacuum and high pressure filtrations. Each mL of the preparation contained (7.1±1.0) mg of extract. HEK-293 cells were incubated in one set with S. fruticosa extract in the presence of 0.1 mmol/L H2O2, and in the other set with the addition of the extract alone. The DNA oxidation was measured using fluorescence upon fluorescein isothiocyanate derivatization of 8-oxoguanine moieties. The fluorescence was measured using flow cytometry technique. Results:Cells incubated 3 h with 150 µL extract and exposed to 0.1 mmol/L H2O2 showed lower intensity of fluorescence, and thus lower DNA oxidation. Moreover, cells incubated 3 h with 100 µL of the extract showed lower intensity of fluorescence, and thus lower intrinsic cellular DNA oxidation compared to control (without S. fruticosa). Conclusions: The results from this study suggest that the water-soluble extract of S. fruticosa leaves protects against both H2O2-induced and intrinsic cellular DNA oxidation in human embryonic kidney 293 cells.

  16. DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.

    Directory of Open Access Journals (Sweden)

    Adam J L Cook

    2007-04-01

    Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.

  17. Infrared laser effects at fluences used for treatment of dentin hypersensitivity on DNA repair in Escherichia coli and plasmids

    Science.gov (United States)

    Rocha Teixeira, Gleica; da Silva Marciano, Roberta; da Silva Sergio, Luiz Philippe; Castanheira Polignano, Giovanni Augusto; Roberto Guimarães, Oscar; Geller, Mauro; de Paoli, Flavia; de Souza da Fonseca, Adenilson

    2014-12-01

    Low-intensity infrared lasers are proposed in clinical protocols based on biostimulative effects, yet dosimetry is inaccurate and their effects on DNA at therapeutic doses are controversial. The aim of this work was to evaluate the effects of low-intensity infrared laser on survival and induction of filamentation of Escherichia coli cells, and induction of DNA lesions in bacterial plasmids. E. coli cultures were exposed to laser (808 nm, 100 mW, 40 and 60 J/cm2) to study bacterial survival and filamentation. Also, bacterial plasmids were exposed to laser to study DNA lesions by electrophoretic profile and action of DNA repair enzymes. Data indicate low-intensity infrared laser has no effect on survival of E. coli wild type and exonuclease III, but decreases the survival of formamidopyrimidine DNA glycosylase/MutM protein and endonuclease III deficient cells in stationary growth phase, induces bacterial filamentation, does not alter the electrophoretic profile of plasmids in agarose gels and does not alter the electrophoretic profile of plasmids incubated with endonuclease III, formamidopyrimidine DNA glycosylase/MutM protein and exonuclease III. Our findings show that low-intensity laser exposure causes DNA lesions at sub-lethal level and induces cellular mechanisms involved in repair of oxidative lesions in DNA. Studies about laser dosimetry and safety strategies are necessary for professionals and patients exposed to low-intensity lasers at therapeutic doses.

  18. Repair of oxidative DNA base damage in the host genome influences the HIV integration site sequence preference.

    Directory of Open Access Journals (Sweden)

    Geoffrey R Bennett

    Full Text Available Host base excision repair (BER proteins that repair oxidative damage enhance HIV infection. These proteins include the oxidative DNA damage glycosylases 8-oxo-guanine DNA glycosylase (OGG1 and mutY homolog (MYH as well as DNA polymerase beta (Polβ. While deletion of oxidative BER genes leads to decreased HIV infection and integration efficiency, the mechanism remains unknown. One hypothesis is that BER proteins repair the DNA gapped integration intermediate. An alternative hypothesis considers that the most common oxidative DNA base damages occur on guanines. The subtle consensus sequence preference at HIV integration sites includes multiple G:C base pairs surrounding the points of joining. These observations suggest a role for oxidative BER during integration targeting at the nucleotide level. We examined the hypothesis that BER repairs a gapped integration intermediate by measuring HIV infection efficiency in Polβ null cell lines complemented with active site point mutants of Polβ. A DNA synthesis defective mutant, but not a 5'dRP lyase mutant, rescued HIV infection efficiency to wild type levels; this suggested Polβ DNA synthesis activity is not necessary while 5'dRP lyase activity is required for efficient HIV infection. An alternate hypothesis that BER events in the host genome influence HIV integration site selection was examined by sequencing integration sites in OGG1 and MYH null cells. In the absence of these 8-oxo-guanine specific glycosylases the chromatin elements of HIV integration site selection remain the same as in wild type cells. However, the HIV integration site sequence preference at G:C base pairs is altered at several positions in OGG1 and MYH null cells. Inefficient HIV infection in the absence of oxidative BER proteins does not appear related to repair of the gapped integration intermediate; instead oxidative damage repair may participate in HIV integration site preference at the sequence level.

  19. Causes and consequences of oxidative stress in spermatozoa.

    Science.gov (United States)

    Aitken, Robert John; Gibb, Zamira; Baker, Mark A; Drevet, Joel; Gharagozloo, Parviz

    2015-02-01

    Spermatozoa are highly vulnerable to oxidative attack because they lack significant antioxidant protection due to the limited volume and restricted distribution of cytoplasmic space in which to house an appropriate armoury of defensive enzymes. In particular, sperm membrane lipids are susceptible to oxidative stress because they abound in significant amounts of polyunsaturated fatty acids. Susceptibility to oxidative attack is further exacerbated by the fact that these cells actively generate reactive oxygen species (ROS) in order to drive the increase in tyrosine phosphorylation associated with sperm capacitation. However, this positive role for ROS is reversed when spermatozoa are stressed. Under these conditions, they default to an intrinsic apoptotic pathway characterised by mitochondrial ROS generation, loss of mitochondrial membrane potential, caspase activation, phosphatidylserine exposure and oxidative DNA damage. In responding to oxidative stress, spermatozoa only possess the first enzyme in the base excision repair pathway, 8-oxoguanine DNA glycosylase. This enzyme catalyses the formation of abasic sites, thereby destabilising the DNA backbone and generating strand breaks. Because oxidative damage to sperm DNA is associated with both miscarriage and developmental abnormalities in the offspring, strategies for the amelioration of such stress, including the development of effective antioxidant formulations, are becoming increasingly urgent. PMID:27062870

  20. Hippocampal Adult Neurogenesis Is Maintained by Neil3-Dependent Repair of Oxidative DNA Lesions in Neural Progenitor Cells

    Directory of Open Access Journals (Sweden)

    Christine Elisabeth Regnell

    2012-09-01

    Full Text Available Accumulation of oxidative DNA damage has been proposed as a potential cause of age-related cognitive decline. The major pathway for removal of oxidative DNA base lesions is base excision repair, which is initiated by DNA glycosylases. In mice, Neil3 is the main DNA glycosylase for repair of hydantoin lesions in single-stranded DNA of neural stem/progenitor cells, promoting neurogenesis. Adult neurogenesis is crucial for maintenance of hippocampus-dependent functions involved in behavior. Herein, behavioral studies reveal learning and memory deficits and reduced anxiety-like behavior in Neil3−/− mice. Neural stem/progenitor cells from aged Neil3−/− mice show impaired proliferative capacity and reduced DNA repair activity. Furthermore, hippocampal neurons in Neil3−/− mice display synaptic irregularities. It appears that Neil3-dependent repair of oxidative DNA damage in neural stem/progenitor cells is required for maintenance of adult neurogenesis to counteract the age-associated deterioration of cognitive performance.

  1. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ji Eun; Cho, Eun Ju; Kim, Ji Hong; Chung, Byung Yeoup; Kim, Jin Hong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  2. Oxidative DNA damage in peripheral leukocytes and its association with expression and polymorphisms of hOGG1: A study of adolescents in a high risk region for hepatocellular carcinoma in China

    Institute of Scientific and Technical Information of China (English)

    Tao Peng; Choon Nam Ong; Han-Ming Shen; Zhi-Ming Liu; Lu-Nan Yan; Min-Hao Peng; Le-Qun Li; Ren-Xiang Liang; Zong-Liang Wei; Barry Halliwell

    2003-01-01

    AIM: To study the oxidative DNA damage to adolescents of hepatocellular carcinoma (HCC) families in Guangxi Zhuang Autonomous Region, China.METHODS: Peripheral leukocytes' DNA 7, 8-dihydro-8-oxoguanine (8-oxoG) and repair enzyme hOGG1 were quantified by flow-cytometry. hOGG1-Cys326Ser single nucleotide polymorphism (SNP) was distinguished by polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) assay.RESULTS: There was a positive correlation between 8-oxoG and repair enzyme hOGG1 expression (P<0.001). HCC children (n=21) in Fusui county had a higher level of hOGG1(P<0.01) and a lower level of 8-oxoG (P<0.05) than the controls (n=63) in Nanning city. Children in Nanning exposed to passive-smoking had a higher hOGG1 expression (P<0.05)than the non-exposers. 8-oxoG and hOGG1 were negatively correlated with body mass index, while hOGG1 was positively correlated with age. There was a peak of 8-oxoG level nearby the 12 year point. Individuals with the hOGG1 326Ser allele had a significantly marginal higher concentration of leukocyte 8-oxoG level than hOGG1 326Cys allele.CONCLUSION: This is the first report using flow-cytometry to simultaneously quantify both the DNA oxidative damage and its repairing enzyme hOGG1. The results provide new insights towards a better understanding of the mechanisms of oxidative stress in a population highly susceptible to hepatocarcinogenesis.

  3. Inter-laboratory variation in DNA damage using a standard comet assay protocol

    DEFF Research Database (Denmark)

    Forchhammer, Lykke; Ersson, Clara; Loft, Steffen;

    2012-01-01

    There are substantial inter-laboratory variations in the levels of DNA damage measured by the comet assay. The aim of this study was to investigate whether adherence to a standard comet assay protocol would reduce inter-laboratory variation in reported values of DNA damage. Fourteen laboratories...... determined the baseline level of DNA strand breaks (SBs)/alkaline labile sites and formamidopyrimidine DNA glycosylase (FPG)-sensitive sites in coded samples of mononuclear blood cells (MNBCs) from healthy volunteers. There were technical problems in seven laboratories in adopting the standard protocol......, which were not related to the level of experience. Therefore, the inter-laboratory variation in DNA damage was only analysed using the results from laboratories that had obtained complete data with the standard comet assay protocol. This analysis showed that the differences between reported levels...

  4. DNA damage in lung after oral exposure to diesel exhaust particles in Big Blue (R) rats

    DEFF Research Database (Denmark)

    Müller, Anne Kirstine; Farombi, E.O.; Møller, P.;

    2004-01-01

    . Lung tissue is a target organ for DEP induced cancer following inhalation. Recent studies have provided evidence that the lung is also a target organ for DNA damage and cancer after oral exposure to other complex mixtures of PAHs. The genotoxic effect of oral administration of DEP was investigated...... as endonuclease III and fapyguanine glycosylase (FPG) sensitive sites increased at the intermediate dose levels. The induction of DNA damage by DEP exposure did not increase the expression of the repair genes OGG1 and ERCC1 at the mRNA level. The present study indicates that the lung is a target organ for primary...... DNA damage following oral exposure to DEP. DNA damage was induced following exposure to relatively low levels of DEP, but under the conditions used in the present experiment DNA damage did not result in an increased mutation rate....

  5. A MATE-Family Efflux Pump Rescues the Escherichia coli 8-Oxoguanine-Repair-Deficient Mutator Phenotype and Protects Against H2O2 Killing

    OpenAIRE

    Guelfo, Javier R.; Alexandro Rodríguez-Rojas; Ivan Matic; Jesús Blázquez

    2010-01-01

    Hypermutation may accelerate bacterial evolution in the short-term. In the long-term, however, hypermutators (cells with an increased rate of mutation) can be expected to be at a disadvantage due to the accumulation of deleterious mutations. Therefore, in theory, hypermutators are doomed to extinction unless they compensate the elevated mutational burden (deleterious load). Different mechanisms capable of restoring a low mutation rate to hypermutators have been proposed. By choosing an 8-oxog...

  6. Catalytically impaired hMYH and NEIL1 mutant proteins identified in patients with primary sclerosing cholangitis and cholangiocarcinoma

    Science.gov (United States)

    Forsbring, Monika; Vik, Erik S.; Dalhus, Bjørn; Karlsen, Tom H.; Bergquist, Annika; Schrumpf, Erik; Bjørås, Magnar; Boberg, Kirsten M.; Alseth, Ingrun

    2009-01-01

    The human hMYH and NEIL1 genes encode DNA glycosylases involved in repair of oxidative base damage and mutations in these genes are associated with certain cancers. Primary sclerosing cholangitis (PSC), a chronic cholestatic liver disease characterized by inflammatory destruction of the biliary tree, is often complicated by the development of cholangiocarcinoma (CCA). Here, we aimed to investigate the influence of genetic variations in the hMYH and NEIL1 genes on risk of CCA in PSC patients. The hMYH and NEIL1 gene loci in addition to the DNA repair genes hOGG1, NTHL1 and NUDT1 were analyzed in 66 PSC patients (37 with CCA and 29 without cancer) by complete genomic sequencing of exons and adjacent intronic regions. Several single-nucleotide polymorphisms and mutations were identified and severe impairment of protein function was observed for three non-synonymous variants. The NEIL1 G83D mutant was dysfunctional for the major oxidation products 7,8-dihydro-8-oxoguanine (8oxoG), thymine glycol and dihydrothymine in duplex DNA, and the ability to perform δ-elimination at abasic sites was significantly reduced. The hMYH R260Q mutant had severe defect in adenine DNA glycosylase activity, whereas hMYH H434D could excise adenines from A:8oxoG pairs but not from A:G mispairs. We found no overall associations between the 18 identified variants and susceptibility to CCA in PSC patients; however, the impaired variants may be of significance for carcinogenesis in general. Our findings demonstrate the importance of complete resequencing of selected candidate genes in order to identify rare genetic variants and their possible contribution to individual susceptibility to cancer development. PMID:19443904

  7. Evaluation of genotoxic risk and oxidative DNA damage in mammalian cells exposed to mycotoxins, patulin and citrinin

    International Nuclear Information System (INIS)

    Mycotoxins are fungal secondary metabolites with very diversified toxic effects in humans and animals. In the present study, patulin (PAT) and citrinin (CTN), two prevalent mycotoxins, were evaluated for their genotoxic effects and oxidative damage to mammalian cells, including Chinese hamster ovary cells (CHO-K1), human peripheral blood lymphocytes, and human embryonic kidney cells (HEK293). PAT, but not CTN, caused a significant dose-dependent increase in sister chromatid exchange (SCE) frequency in both CHO-K1 and human lymphocytes. PAT also elevated the levels of DNA gap and break in treated CHO-K1. In the single cell gel electrophoresis (SCGE) assay, exposure of HEK293 to concentrations above 15 μM of PAT induced DNA strand breaks; the tail moment values also greatly increased after posttreatment with formamidopyrimidine-DNA glycosylase (Fpg). This suggests that in human cells PAT is a potent clastogen with the ability to cause oxidative damage to DNA. However, no significant change in the tail moment values in CTN-treated cultures was found, suggesting that CTN is not genotoxic to HEK293. Incubation of HEK293 with CTN increased the mRNA level of heat shock protein 70 (HSP70), but not that of human 8-hydroxyguanine DNA glycosylase 1 (hOGG1). PAT treatment did not modulate the expression of either HSP70 or hOGG1 mRNA

  8. A functional Ser326Cys polymorphism in hOGG1 is associated with noise-induced hearing loss in a Chinese population.

    Directory of Open Access Journals (Sweden)

    Huanxi Shen

    Full Text Available DNA damage to cochlear hair cells caused by 8-oxoguanine (8-oxoG is essential for the development of noise-induced hearing loss (NIHL. Human 8-oxoG DNA glycosylase1 (hOGG1 is a key enzyme in the base excision repair (BER pathway that eliminates 8-oxoG. Many epidemiological and functional studies have suggested that the hOGG1 Ser326Cys polymorphism (rs1052133 is associated with many diseases. The purpose of this investigation was to investigate whether the hOGG1 Ser326Cys polymorphism in the human BER pathway is associated with genetic susceptibility to NIHL in a Chinese population. This polymorphism was genotyped among 612 workers with NIHL and 615 workers with normal hearing. We found that individuals with the hOGG1 Cys/Cys genotype had a statistically significantly increased risk of NIHL compared with those who carried the hOGG1 Ser/Ser genotype (adjusted OR=1.59, 95% CI=1.13-2.25 and this increased risk was more pronounced among the workers in the 15- to 25- and >25-year noise exposure time, 85-92 dB(A noise exposure level, ever smoking, and ever drinking groups, similar effects were also observed in a recessive model. In summary, our data suggested that the hOGG1 Cys/Cys genotype may be a genetic susceptibility marker for NIHL in the Chinese Han population.

  9. Repair of DNA-containing pyrimidine dimers

    International Nuclear Information System (INIS)

    Ultraviolet light-induced pyrimidine dimers in DNA are recognized and repaired by a number of unique cellular surveillance systems. The most direct biochemical mechanism responding to this kind of genotoxicity involves direct photoreversal by flavin enzymes that specifically monomerize pyrimidine:pyrimidine dimers monophotonically in the presence of visible light. Incision reactions are catalyzed by a combined pyrimidine dimer DNA-glycosylase:apyrimidinic endonuclease found in some highly UV-resistant organisms. At a higher level of complexity, Escherichia coli has a uvr DNA repair system comprising the UvrA, UvrB, and UvrC proteins responsible for incision. There are several preincision steps governed by this pathway, which includes an ATP-dependent UvrA dimerization reaction required for UvrAB nucleoprotein formation. This complex formation driven by ATP binding is associated with localized topological unwinding of DNA. This same protein complex can catalyze an ATPase-dependent 5'----3'-directed strand displacement of D-loop DNA or short single strands annealed to a single-stranded circular or linear DNA. This putative translocational process is arrested when damaged sites are encountered. The complex is now primed for dual incision catalyzed by UvrC. The remainder of the repair process involves UvrD (helicase II) and DNA polymerase I for a coordinately controlled excision-resynthesis step accompanied by UvrABC turnover. Furthermore, it is proposed that levels of repair proteins can be regulated by proteolysis. UvrB is converted to truncated UvrB* by a stress-induced protease that also acts at similar sites on the E. coli Ada protein. Although UvrB* can bind with UvrA to DNA, it cannot participate in helicase or incision reactions. It is also a DNA-dependent ATPase.21 references

  10. Repair of DNA-containing pyrimidine dimers

    Energy Technology Data Exchange (ETDEWEB)

    Grossman, L.; Caron, P.R.; Mazur, S.J.; Oh, E.Y.

    1988-08-01

    Ultraviolet light-induced pyrimidine dimers in DNA are recognized and repaired by a number of unique cellular surveillance systems. The most direct biochemical mechanism responding to this kind of genotoxicity involves direct photoreversal by flavin enzymes that specifically monomerize pyrimidine:pyrimidine dimers monophotonically in the presence of visible light. Incision reactions are catalyzed by a combined pyrimidine dimer DNA-glycosylase:apyrimidinic endonuclease found in some highly UV-resistant organisms. At a higher level of complexity, Escherichia coli has a uvr DNA repair system comprising the UvrA, UvrB, and UvrC proteins responsible for incision. There are several preincision steps governed by this pathway, which includes an ATP-dependent UvrA dimerization reaction required for UvrAB nucleoprotein formation. This complex formation driven by ATP binding is associated with localized topological unwinding of DNA. This same protein complex can catalyze an ATPase-dependent 5'----3'-directed strand displacement of D-loop DNA or short single strands annealed to a single-stranded circular or linear DNA. This putative translocational process is arrested when damaged sites are encountered. The complex is now primed for dual incision catalyzed by UvrC. The remainder of the repair process involves UvrD (helicase II) and DNA polymerase I for a coordinately controlled excision-resynthesis step accompanied by UvrABC turnover. Furthermore, it is proposed that levels of repair proteins can be regulated by proteolysis. UvrB is converted to truncated UvrB* by a stress-induced protease that also acts at similar sites on the E. coli Ada protein. Although UvrB* can bind with UvrA to DNA, it cannot participate in helicase or incision reactions. It is also a DNA-dependent ATPase.21 references.

  11. Beryllium chloride-induced oxidative DNA damage and alteration in the expression patterns of DNA repair-related genes.

    Science.gov (United States)

    Attia, Sabry M; Harisa, Gamaleldin I; Hassan, Memy H; Bakheet, Saleh A

    2013-09-01

    Beryllium metal has physical properties that make its use essential for very specific applications, such as medical diagnostics, nuclear/fusion reactors and aerospace applications. Because of the widespread human exposure to beryllium metals and the discrepancy of the genotoxic results in the reported literature, detail assessments of the genetic damage of beryllium are warranted. Mice exposed to beryllium chloride at an oral dose of 23mg/kg for seven consecutive days exhibited a significant increase in the level of DNA-strand breaking and micronuclei formation as detected by a bone marrow standard comet assay and micronucleus test. Whereas slight beryllium chloride-induced oxidative DNA damage was detected following formamidopyrimidine DNA glycosylase digestion, digestion with endonuclease III resulted in considerable increases in oxidative DNA damage after the 11.5 and 23mg/kg/day treatment as detected by enzyme-modified comet assays. Increased 8-hydroxydeoxyguanosine was also directly correlated with increased bone marrow micronuclei formation and DNA strand breaks, which further confirm the involvement of oxidative stress in the induction of bone marrow genetic damage after exposure to beryllium chloride. Gene expression analysis on the bone marrow cells from beryllium chloride-exposed mice showed significant alterations in genes associated with DNA damage repair. Therefore, beryllium chloride may cause genetic damage to bone marrow cells due to the oxidative stress and the induced unrepaired DNA damage is probably due to the down-regulation in the expression of DNA repair genes, which may lead to genotoxicity and eventually cause carcinogenicity.

  12. Oxidative damage to DNA and repair induced by Norwegian wood smoke particles in human A549 and THP-1 cell lines

    DEFF Research Database (Denmark)

    Danielsen, Pernille Høgh; Loft, Steffen; Kocbach, Anette;

    2009-01-01

    particulate matter (WSPM), authentic traffic-generated particles, mineral PM and standard reference material (SRM2975) of diesel exhaust particles in human A549 lung epithelial and THP-1 monocytic cell lines. DNA damage was measured as strand breaks (SB) and formamidopyrimidine DNA glycosylase (FPG) sites......Genotoxic effects of traffic-generated particulate matter (PM) are well described, whereas little data are available on PM from combustion of biomass and wood, which contributes substantially to air pollution world wide. The aim of this study was to compare the genotoxicity of wood smoke...

  13. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL−1 and 50 μg mL−1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  14. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    Energy Technology Data Exchange (ETDEWEB)

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier, E-mail: didier.gasparutto@cea.fr

    2014-02-17

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL{sup −1} and 50 μg mL{sup −1} of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair

  15. Increased oxidative DNA damage in mononuclear leukocytes in vitiligo

    Energy Technology Data Exchange (ETDEWEB)

    Giovannelli, Lisa [Department of Preclinical and Clinical Pharmacology, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy)]. E-mail: lisag@pharm.unifi.it; Bellandi, Serena [Department of Dermatological Sciences, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy); Pitozzi, Vanessa [Department of Preclinical and Clinical Pharmacology, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy); Fabbri, Paolo [Department of Dermatological Sciences, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy); Dolara, Piero [Department of Preclinical and Clinical Pharmacology, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy); Moretti, Silvia [Department of Dermatological Sciences, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy)

    2004-11-22

    Vitiligo is an acquired pigmentary disorder of the skin of unknown aetiology. The autocytotoxic hypothesis suggests that melanocyte impairment could be related to increased oxidative stress. Evidences have been reported that in vitiligo oxidative stress might also be present systemically. We used the comet assay (single cell alkaline gel electrophoresis) to evaluate DNA strand breaks and DNA base oxidation, measured as formamidopyrimidine DNA glycosylase (FPG)-sensitive sites, in peripheral blood cells from patients with active vitiligo and healthy controls. The basal level of oxidative DNA damage in mononuclear leukocytes was increased in vitiligo compared to normal subjects, whereas DNA strand breaks (SBs) were not changed. This alteration was not accompanied by a different capability to respond to in vitro oxidative challenge. No differences in the basal levels of DNA damage in polymorphonuclear leukocytes were found between patients and healthy subjects. Thus, this study supports the hypothesis that in vitiligo a systemic oxidative stress exists, and demonstrates for the first time the presence of oxidative alterations at the nuclear level. The increase in oxidative DNA damage shown in the mononuclear component of peripheral blood leukocytes from vitiligo patients was not particularly severe. However, these findings support an adjuvant role of antioxidant treatment in vitiligo.

  16. Effects of Anthocyanins on CAG Repeat Instability and Behaviour in Huntington’s Disease R6/1 Mice

    Science.gov (United States)

    Møllersen, Linda; Moldestad, Olve; Rowe, Alexander D.; Bjølgerud, Anja; Holm, Ingunn; Tveterås, Linda; Klungland, Arne; Retterstøl, Lars

    2016-01-01

    Background: Huntington’s disease (HD) is a progressive neurodegenerative disorder caused by CAG repeat expansions in the HTT gene. Somatic repeat expansion in the R6/1 mouse model of HD depends on mismatch repair and is worsened by base excision repair initiated by the 7,8-dihydroxy-8-oxoguanine-DNA glycosylase (Ogg1) or Nei-like 1 (Neil1). Ogg1 and Neil1 repairs common oxidative lesions. Methods: We investigated whether anthocyanin antioxidants added daily to the drinking water could affect CAG repeat instability in several organs and behaviour in R6/1 HD mice. In addition, anthocyanin-treated and untreated R6/1 HD mice at 22 weeks of age were tested in the open field test and on the rotarod. Results: Anthocyanin-treated R6/1 HD mice showed reduced instability index in the ears and in the cortex compared to untreated R6/1 mice, and no difference in liver and kidney. There were no significant differences in any of the parameters tested in the behavioural tests among anthocyanin-treated and untreated R6/1 HD mice. Conclusions: Our results indicate that continuous anthocyanin-treatment may have modest effects on CAG repeat instability in the ears and the cortex of R6/1 mice. More studies are required to investigate if anthocyanin-treatment could affect behaviour earlier in the disease course. PMID:27540492

  17.  Oxidation and deamination of nucleobases as an epigenetic tool

    Directory of Open Access Journals (Sweden)

    Jolanta Guz

    2012-05-01

    Full Text Available  Recent discoveries have demonstrated that 5-methylcytosine (5mC may be hydroxymethylated to 5-hydroxymethylcytosine (5hmC in mammals and that genomic DNA may contain about 0.02–0.7�0of 5hmC. The aforementioned modification is the key intermediate of active DNA demethylation and has been named “the sixth base in DNA”.Although active DNA demethylation in mammals is still controversial, the most plausible mechanism/s of active 5mC demethylation include involvement of three families of enzymes; i Tet, which is involved in hydroxylation of 5mC to form 5hmC, which can be further oxidized to 5-formylcytosine (5fC and 5-carboxylcytosine (5caC; ii deamination of 5mC (or 5hmC by AID/APOBEC to form thymine or 5-hydroxymethyluracil (5hmU mispaired with guanine; iii the BER pathway induced by involvement of TDG glycosylase to replace the above described base modification (5fC, 5caC, 5hmU with cytosine to demethylate DNA.A plausible scenario for engagement of TDG glycosylase (or some other G-T glycosylase is through prior deamination of 5-mC to thymine, which generates a G: T substrate for the enzyme. Here cytidine deaminase of the AID/APOBEC family was implicated in the deamination step. It is possible that TDG may act in concert with these deaminases.It seems that mutations are not the only effect of oxidatively modified DNA bases. These, as yet, understudied aspects of the damage suggest a potential for 8-oxoguanine (8-oxoGua to affect gene expression via chromatin relaxation. It is possible that 8-oxoGua presence in specific DNA sequences may be widely used for transcription regulation, which suggests the epigenetic nature of 8-oxoGua presence in DNA.

  18. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  19. Uracil-containing DNA in Drosophila: stability, stage-specific accumulation, and developmental involvement.

    Directory of Open Access Journals (Sweden)

    Villő Muha

    Full Text Available Base-excision repair and control of nucleotide pools safe-guard against permanent uracil accumulation in DNA relying on two key enzymes: uracil-DNA glycosylase and dUTPase. Lack of the major uracil-DNA glycosylase UNG gene from the fruit fly genome and dUTPase from fruit fly larvae prompted the hypotheses that i uracil may accumulate in Drosophila genomic DNA where it may be well tolerated, and ii this accumulation may affect development. Here we show that i Drosophila melanogaster tolerates high levels of uracil in DNA; ii such DNA is correctly interpreted in cell culture and embryo; and iii under physiological spatio-temporal control, DNA from fruit fly larvae, pupae, and imago contain greatly elevated levels of uracil (200-2,000 uracil/million bases, quantified using a novel real-time PCR-based assay. Uracil is accumulated in genomic DNA of larval tissues during larval development, whereas DNA from imaginal tissues contains much less uracil. Upon pupation and metamorphosis, uracil content in DNA is significantly decreased. We propose that the observed developmental pattern of uracil-DNA is due to the lack of the key repair enzyme UNG from the Drosophila genome together with down-regulation of dUTPase in larval tissues. In agreement, we show that dUTPase silencing increases the uracil content in DNA of imaginal tissues and induces strong lethality at the early pupal stages, indicating that tolerance of highly uracil-substituted DNA is also stage-specific. Silencing of dUTPase perturbs the physiological pattern of uracil-DNA accumulation in Drosophila and leads to a strongly lethal phenotype in early pupal stages. These findings suggest a novel role of uracil-containing DNA in Drosophila development and metamorphosis and present a novel example for developmental effects of dUTPase silencing in multicellular eukaryotes. Importantly, we also show lack of the UNG gene in all available genomes of other Holometabola insects, indicating a potentially

  20. Effects of ionizing radiations on DNA-protein complexes

    International Nuclear Information System (INIS)

    The radio-induced destruction of DNA-protein complexes may have serious consequences for systems implicated in important cellular functions. The first system which has been studied is the lactose operon system, that regulates gene expression in Escherichia coli. First of all, the repressor-operator complex is destroyed after irradiation of the complex or of the protein alone. The damaging of the domain of repressor binding to DNA (headpiece) has been demonstrated and studied from the point of view of peptide chain integrity, conformation and amino acids damages. Secondly, dysfunctions of the in vitro induction of an irradiated repressor-unirradiated DNA complex have been observed. These perturbations, due to a decrease of the number of inducer binding sites, are correlated to the damaging of tryptophan residues. Moreover, the inducer protects the repressor when they are irradiated together, both by acting as a scavenger in the bulk, and by the masking of its binding site on the protein. The second studied system is formed by Fpg (for Formamido pyrimidine glycosylase), a DNA repair protein and a DNA with an oxidative lesion. The results show that irradiation disturbs the repair both by decreasing its efficiency of DNA lesion recognition and binding, and by altering its enzymatic activity. (author)

  1. Measurement of oxidatively generated base damage in cellular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Cadet, Jean, E-mail: jean.cadet@cea.fr [Laboratoire ' Lesions des Acides Nucleiques' , SCIB-UMR-E no3 (CEA/UJF), FRE CNRS 3200, Departement de Recherche Fondamentale sur la Matiere Condensee, CEA/Grenoble, F-38054 Grenoble Cedex 9 (France); Douki, Thierry; Ravanat, Jean-Luc [Laboratoire ' Lesions des Acides Nucleiques' , SCIB-UMR-E no3 (CEA/UJF), FRE CNRS 3200, Departement de Recherche Fondamentale sur la Matiere Condensee, CEA/Grenoble, F-38054 Grenoble Cedex 9 (France)

    2011-06-03

    This survey focuses on the critical evaluation of the main methods that are currently available for monitoring single and complex oxidatively generated damage to cellular DNA. Among chromatographic methods, HPLC-ESI-MS/MS and to a lesser extent HPLC-ECD which is restricted to a few electroactive nucleobases and nucleosides are appropriate for measuring the formation of single and clustered DNA lesions. Such methods that require optimized protocols for DNA extraction and digestion are sensitive enough for measuring base lesions formed under conditions of severe oxidative stress including exposure to ionizing radiation, UVA light and high intensity UVC laser pulses. In contrast application of GC-MS and HPLC-MS methods that are subject to major drawbacks have been shown to lead to overestimated values of DNA damage. Enzymatic methods that are based on the use of DNA repair glycosylases in order to convert oxidized bases into strand breaks are suitable, even if they are far less specific than HPLC methods, to deal with low levels of single modifications. Several other methods including immunoassays and {sup 32}P-postlabeling methods that are still used suffer from drawbacks and therefore are not recommended. Another difficult topic is the measurement of oxidatively generated clustered DNA lesions that is currently achieved using enzymatic approaches and that would necessitate further investigations.

  2. The antileishmanial drug miltefosine (Impavido(®)) causes oxidation of DNA bases, apoptosis, and necrosis in mammalian cells.

    Science.gov (United States)

    Castelo Branco, Patrícia Valéria; Soares, Rossy-Eric Pereira; de Jesus, Luís Cláudio Lima; Moreira, Vanessa Ribeiro; Alves, Hugo José; de Castro Belfort, Marta Regina; Silva, Vera Lucia Maciel; Ferreira Pereira, Silma Regina

    2016-08-01

    Miltefosine was developed to treat skin cancer; further studies showed that the drug also has activity against Leishmania. Miltefosine is the first oral agent for treating leishmaniasis. However, its mechanism of action is not completely understood. We have evaluated the induction of DNA damage by miltefosine. Cytotoxicity and genotoxicity (comet assay) tests were performed on human leukocytes exposed to the drug in vitro. Apoptosis and necrosis were also evaluated. In vivo tests were conducted in Swiss male mice (Mus musculus) treated orally with miltefosine. Oxidation of DNA bases in peripheral blood cells was measured using the comet assay followed by digestion with formamidopyrimidine glycosylase (FPG), which removes oxidized guanine bases. The micronucleus test was performed on bone marrow erythrocytes. Miltefosine caused DNA damage, apoptosis, and necrosis in vitro. Mice treated with miltefosine showed an increase in the DNA damage score, which was further increased following FPG digestion. The micronucleus test was also positive. PMID:27476333

  3. The antileishmanial drug miltefosine (Impavido(®)) causes oxidation of DNA bases, apoptosis, and necrosis in mammalian cells.

    Science.gov (United States)

    Castelo Branco, Patrícia Valéria; Soares, Rossy-Eric Pereira; de Jesus, Luís Cláudio Lima; Moreira, Vanessa Ribeiro; Alves, Hugo José; de Castro Belfort, Marta Regina; Silva, Vera Lucia Maciel; Ferreira Pereira, Silma Regina

    2016-08-01

    Miltefosine was developed to treat skin cancer; further studies showed that the drug also has activity against Leishmania. Miltefosine is the first oral agent for treating leishmaniasis. However, its mechanism of action is not completely understood. We have evaluated the induction of DNA damage by miltefosine. Cytotoxicity and genotoxicity (comet assay) tests were performed on human leukocytes exposed to the drug in vitro. Apoptosis and necrosis were also evaluated. In vivo tests were conducted in Swiss male mice (Mus musculus) treated orally with miltefosine. Oxidation of DNA bases in peripheral blood cells was measured using the comet assay followed by digestion with formamidopyrimidine glycosylase (FPG), which removes oxidized guanine bases. The micronucleus test was performed on bone marrow erythrocytes. Miltefosine caused DNA damage, apoptosis, and necrosis in vitro. Mice treated with miltefosine showed an increase in the DNA damage score, which was further increased following FPG digestion. The micronucleus test was also positive.

  4. Base Flip in DNA Studied by Molecular Dynamics Simulationsof Differently-Oxidized Forms of Methyl-Cytosine

    Directory of Open Access Journals (Sweden)

    Mahdi Bagherpoor Helabad

    2014-07-01

    Full Text Available Distortions in the DNA sequence, such as damage or mispairs, are specifically recognized and processed by DNA repair enzymes. Many repair proteins and, in particular, glycosylases flip the target base out of the DNA helix into the enzyme’s active site. Our molecular dynamics simulations of DNA with intact and damaged (oxidized methyl-cytosine show that the probability of being flipped is similar for damaged and intact methyl-cytosine. However, the accessibility of the different 5-methyl groups allows direct discrimination of the oxidized forms. Hydrogen-bonded patterns that vary between methyl-cytosine forms carrying a carbonyl oxygen atom are likely to be detected by the repair enzymes and may thus help target site recognition.

  5. DNA damage and repair kinetics of the Alternaria mycotoxins alternariol, altertoxin II and stemphyltoxin III in cultured cells.

    Science.gov (United States)

    Fleck, Stefanie C; Sauter, Friederike; Pfeiffer, Erika; Metzler, Manfred; Hartwig, Andrea; Köberle, Beate

    2016-03-01

    The Alternaria mycotoxins alternariol (AOH) and altertoxin II (ATX II) have previously been shown to elicit mutagenic and genotoxic effects in bacterial and mammalian cells, although with vastly different activities. For example, ATX II was about 50 times more mutagenic than AOH. We now report that stemphyltoxin III (STTX III) is also highly mutagenic. The more pronounced effects of the perylene quinones ATX II and STTX III at lower concentrations compared to the dibenzo-α-pyrone AOH indicate a marked dependence of the genotoxic potential on the chemical structure and furthermore suggest that the underlying modes of action may be different. We have now further investigated the type of DNA damage induced by AOH, ATX II and STTX III, as well as the repair kinetics and their dependence on the status of nucleotide excision repair (NER). DNA double strand breaks induced by AOH due to poisoning of topoisomerase IIα were completely repaired in less than 2h. Under cell-free conditions, inhibition of topoisomerase IIα could also be measured for ATX II and STTX III at low concentrations, but the perylene quinones were catalytic inhibitors rather than topoisomerase poisons and did not induce DSBs. DNA strand breaks induced by ATX II and STTX III were more persistent and not completely repaired within 24h. A dependence of the repair rate on the NER status could only be demonstrated for STTX III, resulting in an accumulation of DNA damage in NER-deficient cells. Together with the finding that the DNA glycosylase formamidopyrimidine-DNA glycosylase (Fpg), but not T4 endonuclease V, is able to generate additional DNA strand breaks measurable by the alkaline unwinding assay, we conclude that the genotoxicity of the perylene quinones with an epoxide group is probably caused by the formation of DNA adducts which may be converted to Fpg sensitive sites.

  6. Monoclonal B-cell hyperplasia and leukocyte imbalance precede development of B-cell malignancies in uracil-DNA glycosylase deficient mice

    DEFF Research Database (Denmark)

    Andersen, Sonja; Ericsson, Madelene; Dai, Hong Yan;

    2005-01-01

    monoclonal while 25% were biclonal. Monoclonality was also observed in hyperplasia, and could represent an early stage of lymphoma development. Lymphoid hyperplasia occurs very early in otherwise healthy Ung-deficient mice, observed as a significant increase of splenic B-cells. Furthermore, loss of Ung also......Ung-deficient mice have reduced class switch recombination, skewed somatic hypermutation, lymphatic hyperplasia and a 22-fold increased risk of developing B-cell lymphomas. We find that lymphomas are of follicular (FL) and diffuse large B-cell type (DLBCL). All FLs and 75% of the DLBCLs were...... causes a significant reduction of T-helper cells, and 50% of the young Ung(-/-) mice investigated have no detectable NK/NKT-cell population in their spleen. The immunological imbalance is confirmed in experiments with spleen cells where the production of the cytokines interferon gamma, interleukin 6...

  7. No oxidative stress or DNA damage in peripheral blood mononuclear cells after exposure to particles from urban street air in overweight elderly

    DEFF Research Database (Denmark)

    Hemmingsen, Jette Gjerke; Jantzen, Kim; Møller, Peter;

    2015-01-01

    Exposure to traffic-related particulate matter (PM) has been associated with increased risk of lung disease, cancer and cardiovascular disease especially in elderly and overweight subjects. The proposed mechanisms involve intracellular production of reactive oxygen species (ROS), inflammation...... exposure to nanosized carbon black as well as expression of genes related to inflammation (chemokine (C-C motif) ligand 2, interleukin-8 and tumour necrosis factor), oxidative stress response (heme oxygenase (decycling)-1) and DNA repair (oxoguanine DNA glycosylase). DNA strand breaks and oxidised purines...... exposure. In conclusion, 5h of controlled exposure to PM from urban traffic did not change the gene expression related to inflammation, oxidative stress or DNA repair, ROS production or oxidatively damaged DNA in PBMCs from elderly overweight human subjects....

  8. In vivo genotoxicity of estragole in male F344 rats.

    Science.gov (United States)

    Ding, Wei; Levy, Dan D; Bishop, Michelle E; Pearce, Mason G; Davis, Kelly J; Jeffrey, Alan M; Duan, Jian-Dong; Williams, Gary M; White, Gene A; Lyn-Cook, Lascelles E; Manjanatha, Mugimane G

    2015-05-01

    Estragole, a naturally occurring constituent of various herbs and spices, is a rodent liver carcinogen which requires bio-activation. To further understand the mechanisms underlying its carcinogenicity, genotoxicity was assessed in F344 rats using the comet, micronucleus (MN), and DNA adduct assays together with histopathological analysis. Oxidative damage was measured using human 8-oxoguanine-DNA-N-glycosylase (hOGG1) and EndonucleaseIII (EndoIII)-modified comet assays. Results with estragole were compared with the structurally related genotoxic carcinogen, safrole. Groups of seven-week-old male F344 rats received corn oil or corn oil containing 300, 600, or 1,000 mg/kg bw estragole and 125, 250, or 450 mg/kg bw safrole by gavage at 0, 24, and 45 hr and terminated at 48 hr. Estragole-induced dose-dependent increases in DNA damage following EndoIII or hOGG1 digestion and without enzyme treatment in liver, the cancer target organ. No DNA damage was detected in stomach, the non-target tissue for cancer. No elevation of MN was observed in reticulocytes sampled from peripheral blood. Comet assays, both without digestion or with either EndoIII or hOGG1 digestion, also detected DNA damage in the liver of safrole-dosed rats. No DNA damage was detected in stomach, nor was MN elevated in peripheral blood following dosing with safrole suggesting that, as far both safrole and estragole, oxidative damage may contribute to genotoxicity. Taken together, these results implicate multiple mechanisms of estragole genotoxicity. DNA damage arises from chemical-specific interaction and is also mediated by oxidative species.

  9. Mechanism of maltal hydration catalyzed by β-amylase: Role of protein structure in controlling the steric outcome of reactions catalyzed by a glycosylase

    International Nuclear Information System (INIS)

    Crystalline (monomeric) soybean and (tetrameric) sweet potato β-amylase were shown to catalyze the cis hydration of maltal (α-D-glucopyranosyl-2-deoxy-D-arabino-hex-1-enitol) to form β-2-deoxymaltose. As reported earlier with the sweet potato enzyme, maltal hydration in D2O by soybean β-amylase was found to exhibit an unusually large solvent deuterium kinetic isotope effect (VH/VD=6.5), a reaction rate linearly dependent on the mole fraction of deuterium, and 2-deoxy-[2(a)-2H]maltose as product. These results indicate (for each β-amylase) that protonation is the rate-limiting step in a reaction involving a nearly symmetric one-proton transition state and that maltal is specifically protonated from above the double bond. That maltal undergoes cis hydration provides evidence in support of a general-acid-catalyzed, carbonium ion mediated reaction. Of fundamental significance is that β-amylase protonates maltal from a direction opposite that assumed for protonating strach, yet creates products of the same anomeric configuration from both. Such stereochemical dichotomy argues for the overriding role of protein structures is dictating the steric outcome of reactions catalyzed by a glycosylase, by limiting the approach and orientation of water or other acceptors to the reaction center

  10. Oxidative Stress, DNA Damage, and Inflammation Induced by Ambient Air and Wood Smoke Particulate Matter in Human A549 and THP-1 Cell Lines

    DEFF Research Database (Denmark)

    Danielsen, Pernille Høgh; Møller, Peter; Jensen, Keld Alstrup;

    2011-01-01

    polycyclic aromatic hydrocarbons (PAH), less soluble metals, and expectedly also had a smaller particle size than PM collected from ambient air. All four types of PM combined increased the levels of 8-oxo-7,8-dihydro-20-deoxyguanosine dose-dependently in A549 cells, whereas there was no change in the levels...... sampled from the wood stove area. Expression of oxoguanine glycosylase 1, lymphocyte function-associated antigen-1, and interleukin-6 did not change. We conclude that WSPM has small particle size, high level of PAH, low level of water-soluble metals, and produces high levels of free radicals, DNA damage...

  11. Accumulation of lipids and oxidatively damaged DNA in hepatocytes exposed to particles

    DEFF Research Database (Denmark)

    Vesterdal, Lise K; Danielsen, Pernille H; Folkmann, Janne K;

    2014-01-01

    Exposure to particles has been suggested to generate hepatosteatosis by oxidative stress mechanisms. We investigated lipid accumulation in cultured human hepatocytes (HepG2) and rat liver after exposure to four different carbon-based particles. HepG2 cells were exposed to particles for 3h...... single-walled carbon nanotubes. All four types of particles also generated oxidatively damaged DNA, assessed as formamidopyrimidine DNA glycosylase (FPG) sensitive sites, in HepG2 cells after 3h exposure. The animal model of metabolic syndrome showed increased lipid load in the liver after one oral...... exposure to 6.4mg/kg of CB in lean Zucker rats. This was not associated with increased iNOS staining in the liver, indicating that the oral CB exposure was associated with hepatic steatosis rather than steatohepatitis. The lipid accumulation did not seem to be related to increased lipogenesis because...

  12. Use of the comet assay to measure DNA damage in cells exposed to photosensitizers and gamma radiation

    Science.gov (United States)

    Pouget, J.-P.; Ravanat, J.-L.; Douki, T.; Richard, M.-J.; Cadet, J.

    1999-01-01

    We used the comet assay associated with DNA-glycosylases to estimate DNA damage in cells exposed to gamma irradiation or photosensitized either with methylene blue or orange acridine. A calibration performed using irradiation allowed the measurement of the steady-state level and the yield of 8-oxodGuo as well as strand breaks and alkali-labile sites. Nous avons utilisé la méthode des comètes associée à des ADN-glycosylases, pour estimer les dommages de l'ADN dans des cellules après l'exposition à un rayonnement gamma ou après photosensibilisation par le bleu de méthylène ou l'acridine orange. Une calibration de la méthode des comètes a permis de mesurer le niveau basal et les taux de formation de 8-oxodGuo ainsi que le nombre de cassures de brins et de sites alcali labiles.

  13. The Base Excision Repair system of Salmonella enterica serovar typhimurium counteracts DNA damage by host nitric oxide.

    Directory of Open Access Journals (Sweden)

    Anthony R Richardson

    2009-05-01

    Full Text Available Intracellular pathogens must withstand nitric oxide (NO. generated by host phagocytes. Salmonella enterica serovar Typhimurium interferes with intracellular trafficking of inducible nitric oxide synthase (iNOS and possesses multiple systems to detoxify NO.. Consequently, the level of NO. stress encountered by S. Typhimurium during infection in vivo has been unknown. The Base Excision Repair (BER system recognizes and repairs damaged DNA bases including cytosine and guanine residues modified by reactive nitrogen species. Apurinic/apyrimidinic (AP sites generated by BER glycosylases require subsequent processing by AP endonucleases. S. Typhimurium xth nfo mutants lacking AP endonuclease activity exhibit increased NO. sensitivity resulting from chromosomal fragmentation at unprocessed AP sites. BER mutant strains were thus used to probe the nature and extent of nitrosative damage sustained by intracellular bacteria during infection. Here we show that an xth nfo S. Typhimurium mutant is attenuated for virulence in C3H/HeN mice, and virulence can be completely restored by the iNOS inhibitor L-NIL. Inactivation of the ung or fpg glycosylase genes partially restores virulence to xth nfo mutant S. Typhimurium, demonstrating that NO. fluxes in vivo are sufficient to modify cytosine and guanine bases, respectively. Mutants lacking ung or fpg exhibit NO.-dependent hypermutability during infection, underscoring the importance of BER in protecting Salmonella from the genotoxic effects of host NO.. These observations demonstrate that host-derived NO. damages Salmonella DNA in vivo, and the BER system is required to maintain bacterial genomic integrity.

  14. Characterization of oxidative guanine damage and repair in mammalian telomeres.

    Directory of Open Access Journals (Sweden)

    Zhilong Wang

    2010-05-01

    Full Text Available 8-oxo-7,8-dihydroguanine (8-oxoG and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG are among the most common oxidative DNA lesions and are substrates for 8-oxoguanine DNA glycosylase (OGG1-initiated DNA base excision repair (BER. Mammalian telomeres consist of triple guanine repeats and are subject to oxidative guanine damage. Here, we investigated the impact of oxidative guanine damage and its repair by OGG1 on telomere integrity in mice. The mouse cells were analyzed for telomere integrity by telomere quantitative fluorescence in situ hybridization (telomere-FISH, by chromosome orientation-FISH (CO-FISH, and by indirect immunofluorescence in combination with telomere-FISH and for oxidative base lesions by Fpg-incision/Southern blot assay. In comparison to the wild type, telomere lengthening was observed in Ogg1 null (Ogg1(-/- mouse tissues and primary embryonic fibroblasts (MEFs cultivated in hypoxia condition (3% oxygen, whereas telomere shortening was detected in Ogg1(-/- mouse hematopoietic cells and primary MEFs cultivated in normoxia condition (20% oxygen or in the presence of an oxidant. In addition, telomere length abnormalities were accompanied by altered telomere sister chromatid exchanges, increased telomere single- and double-strand breaks, and preferential telomere lagging- or G-strand losses in Ogg1(-/- mouse cells. Oxidative guanine lesions were increased in telomeres in Ogg1(-/- mice with aging and primary MEFs cultivated in 20% oxygen. Furthermore, oxidative guanine lesions persisted at high level in Ogg1(-/- MEFs after acute exposure to hydrogen peroxide, while they rapidly returned to basal level in wild-type MEFs. These findings indicate that oxidative guanine damage can arise in telomeres where it affects length homeostasis, recombination, DNA replication, and DNA breakage repair. Our studies demonstrate that BER pathway is required in repairing oxidative guanine damage in telomeres and maintaining telomere integrity

  15. DNA polymerases beta and lambda mediate overlapping and independent roles in base excision repair in mouse embryonic fibroblasts.

    Directory of Open Access Journals (Sweden)

    Elena K Braithwaite

    Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.

  16. Are glutathione S transferases involved in DNA damage signalling? Interactions with DNA damage and repair revealed from molecular epidemiology studies

    Energy Technology Data Exchange (ETDEWEB)

    Dusinska, Maria, E-mail: Maria.DUSINSKA@nilu.no [CEE-Health Effects Group, NILU - Norwegian Institute for Air Research, Kjeller (Norway); Staruchova, Marta; Horska, Alexandra [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia); Smolkova, Bozena [Laboratory of Cancer Genetics, Cancer Research Institute of the Slovak Academy of Sciences, Bratislava (Slovakia); Collins, Andrew [Department of Nutrition, Faculty of Medicine, University of Oslo (Norway); Bonassi, Stefano [Unit of Clinical and Molecular Epidemiology, IRCCS San Raffaele Pisana, Rome (Italy); Volkovova, Katarina [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia)

    2012-08-01

    Glutathione S-transferases (GSTs) are members of a multigene family of isoenzymes that are important in the control of oxidative stress and in phase II metabolism. Acting non-enzymically, GSTs can modulate signalling pathways of cell proliferation, cell differentiation and apoptosis. Using a molecular epidemiology approach, we have investigated a potential involvement of GSTs in DNA damage processing, specifically the modulation of DNA repair in a group of 388 healthy adult volunteers; 239 with at least 5 years of occupational exposure to asbestos, stone wool or glass fibre, and 149 reference subjects. We measured DNA damage in lymphocytes using the comet assay (alkaline single cell gel electrophoresis): strand breaks (SBs) and alkali-labile sites, oxidised pyrimidines with endonuclease III, and oxidised purines with formamidopyrimidine DNA glycosylase. We also measured GST activity in erythrocytes, and the capacity for base excision repair (BER) in a lymphocyte extract. Polymorphisms in genes encoding three GST isoenzymes were determined, namely deletion of GSTM1 and GSTT1 and single nucleotide polymorphism Ile105Val in GSTP1. Consumption of vegetables and wine correlated negatively with DNA damage and modulated BER. GST activity correlated with oxidised bases and with BER capacity, and differed depending on polymorphisms in GSTP1, GSTT1 and GSTM1. A significantly lower BER rate was associated with the homozygous GSTT1 deletion in all asbestos site subjects and in the corresponding reference group. Multifactorial analysis revealed effects of sex and exposure in GSTP1 Ile/Val heterozygotes but not in Ile/Ile homozygotes. These variants affected also SBs levels, mainly by interactions of GSTP1 genotype with exposure, with sex, and with smoking habit; and by an interaction between sex and smoking. Our results show that GST polymorphisms and GST activity can apparently influence DNA stability and repair of oxidised bases, suggesting a potential new role for these

  17. Production of truncated MBD4 protein by frameshift mutation in DNA mismatch repair-deficient cells enhances 5-fluorouracil sensitivity that is independent of hMLH1 status.

    Science.gov (United States)

    Suzuki, Satoshi; Iwaizumi, Moriya; Tseng-Rogenski, Stephanie; Hamaya, Yasushi; Miyajima, Hiroaki; Kanaoka, Shigeru; Sugimoto, Ken; Carethers, John M

    2016-07-01

    Methyl-CpG binding domain protein 4 (MBD4) is a DNA glycosylase that can remove 5-fluorodeoxyuracil from DNA as well as repair T:G or U:G mismatches. MBD4 is a target for frameshift mutation with DNA mismatch repair (MMR) deficiency, creating a truncated MBD4 protein (TruMBD4) that lacks its glycosylase domain. Here we show that TruMBD4 plays an important role for enhancing 5-fluorouracil (5FU) sensitivity in MMR-deficient colorectal cancer cells. We found biochemically that TruMBD4 binds to 5FU incorporated into DNA with higher affinity than MBD4. TruMBD4 reduced the 5FU affinity of the MMR recognition complexes that determined 5FU sensitivity by previous reports, suggesting other mechanisms might be operative to trigger cytotoxicity. To analyze overall 5FU sensitivity with TruMBD4, we established TruMBD4 overexpression in hMLH1-proficient or -deficient colorectal cancer cells followed by treatment with 5FU. 5FU-treated TruMBD4 cells demonstrated diminished growth characteristics compared to controls, independently of hMLH1 status. Flow cytometry revealed more 5FU-treated TruMBD4 cells in S phase than controls. We conclude that patients with MMR-deficient cancers, which show characteristic resistance to 5FU therapy, may be increased for 5FU sensitivity via secondary frameshift mutation of the base excision repair gene MBD4.

  18. Cleaving DNA with DNA

    Science.gov (United States)

    Carmi, Nir; Balkhi, Shameelah R.; Breaker, Ronald R.

    1998-03-01

    A DNA structure is described that can cleave single-stranded DNA oligonucleotides in the presence of ionic copper. This ``deoxyribozyme'' can self-cleave or can operate as a bimolecular complex that simultaneously makes use of duplex and triplex interactions to bind and cleave separate DNA substrates. Bimolecular deoxyribozyme-mediated strand scission proceeds with a kobs of 0.2 min-1, whereas the corresponding uncatalyzed reaction could not be detected. The duplex and triplex recognition domains can be altered, making possible the targeted cleavage of single-stranded DNAs with different nucleotide sequences. Several small synthetic DNAs were made to function as simple ``restriction enzymes'' for the site-specific cleavage of single-stranded DNA.

  19. DNA polymerase X from Deinococcus radiodurans implicated in bacterial tolerance to DNA damage is characterized as a short patch base excision repair polymerase.

    Science.gov (United States)

    Khairnar, Nivedita P; Misra, Hari S

    2009-09-01

    The Deinococcus radiodurans R1 genome encodes an X-family DNA repair polymerase homologous to eukaryotic DNA polymerase beta. The recombinant deinococcal polymerase X (PolX) purified from transgenic Escherichia coli showed deoxynucleotidyltransferase activity. Unlike the Klenow fragment of E. coli, this enzyme showed short patch DNA synthesis activity on heteropolymeric DNA substrate. The recombinant enzyme showed 5'-deoxyribose phosphate (5'-dRP) lyase activity and base excision repair function in vitro, with the help of externally supplied glycosylase and AP endonuclease functions. A polX disruption mutant of D. radiodurans expressing 5'-dRP lyase and a truncated polymerase domain was comparatively less sensitive to gamma-radiation than a polX deletion mutant. Both mutants showed higher sensitivity to hydrogen peroxide. Excision repair mutants of E. coli expressing this polymerase showed functional complementation of UV sensitivity. These results suggest the involvement of deinococcal polymerase X in DNA-damage tolerance of D. radiodurans, possibly by contributing to DNA double-strand break repair and base excision repair. PMID:19542005

  20. DNA Damage Responses Are Induced by tRNA Anticodon Nucleases and Hygromycin B.

    Science.gov (United States)

    Wemhoff, Sabrina; Klassen, Roland; Beetz, Anja; Meinhardt, Friedhelm

    2016-01-01

    Previous studies revealed DNA damage to occur during the toxic action of PaT, a fungal anticodon ribonuclease (ACNase) targeting the translation machinery via tRNA cleavage. Here, we demonstrate that other translational stressors induce DNA damage-like responses in yeast as well: not only zymocin, another ACNase from the dairy yeast Kluyveromyces lactis, but also translational antibiotics, most pronouncedly hygromycin B (HygB). Specifically, DNA repair mechanisms BER (base excision repair), HR (homologous recombination) and PRR (post replication repair) provided protection, whereas NHEJ (non-homologous end-joining) aggravated toxicity of all translational inhibitors. Analysis of specific BER mutants disclosed a strong HygB, zymocin and PaT protective effect of the endonucleases acting on apurinic sites. In cells defective in AP endonucleases, inactivation of the DNA glycosylase Ung1 increased tolerance to ACNases and HygB. In addition, Mag1 specifically contributes to the repair of DNA lesions caused by HygB. Consistent with DNA damage provoked by translation inhibitors, mutation frequencies were elevated upon exposure to both fungal ACNases and HygB. Since polymerase ζ contributed to toxicity in all instances, error-prone lesion-bypass probably accounts for the mutagenic effects. The finding that differently acting inhibitors of protein biosynthesis induce alike cellular responses in DNA repair mutants is novel and suggests the dependency of genome stability on translational fidelity. PMID:27472060

  1. Spectroscopic approaches to study DNA damage induced in genome exposed to ionizing radiation and its enzymatic repair

    International Nuclear Information System (INIS)

    Recent progress on spectroscopic study on physicochemical process of DNA damage induction will be reported. It has been predicted by computer track simulation studies that complex DNA damage, so called clustered DNA damage sites, is produced along the tack particularly of high Linear Energy Transfer (LET) ions. The clustered DNA damage, consisting of two or more isolated lesions such as single strand breaks or nucleobase lesions, is thought to compromise DNA repair enzymes. We have revealed that the nucleobase lesions produced by He2+ ion impact to simple model DNA (plasmid) are hardly processed by base excision repair enzymes (E. coli DNA glycosylases). Using the third generation synchrotron radiation facility (SPring-8), we have studied unpaired electron species or desorbed ions as intermediates of DNA damage using an EPR apparatus or mass spectrometer installed in the soft X-ray beamline in SPring-8. These aspects are compared with the yields of final products of single- and double-strand breaks and base lesions revealed biochemical techniques. Models of complex DNA damage induction will be proposed considering various modification factors of the damage induction, ionization of valence and inner-shell electrons, OH radicals, hydration layer and the impact of secondary electrons. (author)

  2. XRCC1 and DNA polymerase β in cellular protection against cytotoxic DNA single-strand breaks

    Institute of Scientific and Technical Information of China (English)

    Julie K Horton; Mary Watson; Donna F Stefanick; Daniel T Shaughnessy; Jack A Taylor; Samuel H Wilson

    2008-01-01

    Single-strand breaks (SSBs) can occur in cells either directly, or indirectly following initiation of base excision re-pair (BER). SSBs generally have blocked termini lacking the conventional 5'-phosphate and 3'-hydroxyl groups and require further processing prior to DNA synthesis and ligation. XRCC1 is devoid of any known enzymatic activity, but it can physically interact with other proteins involved in all stages of the overlapping SSB repair and BER pathways, including those that conduct the rate-limiting end-tailoring, and in many cases can stimulate their enzymatic activities. XRCC1-/- mouse fibroblasts are most hypersensitive to agents that produce DNA lesions repaired by monofunctional glycosylase-initiated BER and that result in formation of indirect SSBs. A requirement for the deoxyribose phosphate lyase activity of DNA polymerase β (polβ) is specific to this pathway, whereas pol β is implicated in gap-filling during repair of many types of SSBs. Elevated levels of strand breaks, and diminished repair, have been demonstrated in MMS-treated XRCC1-/-, and to a lesser extent in polβ-/- cell lines, compared with wild-type cells. Thus a strong correlation is observed between cellular sensitivity to MMS and the ability of cells to repair MMS-induced damage. Exposure of wild-type andpolβ-/- cells to an inhibitor of PARP activity dramatically potentiates MMS-induccd cytotoxicity. XRCC1-/- cellsare also sensitized by PARP inhibition demonstrating that PARP-mediated poly(ADP-ribosyl)ation plays a role inmodulation of cytotoxicity beyond recruitment of XRCC1 to sites of DNA damage.

  3. No effect of 600 grams fruit and vegetables per day on oxidative DNA damage and repair in healthy nonsmokers

    DEFF Research Database (Denmark)

    Moller, P.; Vogel, Ulla Birgitte; Pedersen, A.;

    2003-01-01

    In several epidemiological studies, high intakes of fruits and vegetables have been associated with a lower incidence of cancer. Theoretically, intake of antioxidants by consumption of fruits and vegetables should protect against reactive oxygen species and decrease the formation of oxidative DNA...... damage. We set up a parallel 24-day dietary placebo-controlled intervention study in which 43 subjects were randomized into three groups receiving an antioxidant-free basal diet and 600 g of fruits and vegetables, or a supplement containing the corresponding amounts of vitamins and minerals, or placebo......-oxo-2'-deoxyguanine was measured in urine. The expressions of oxoguanine glycosylase I and excision repair cross complementing I DNA repair genes, determined by real-time reverse transcription-PCR of mRNAs, were investigated in leukocytes. Consumption of fruits and vegetables or vitamins and minerals...

  4. Heavy Metal-Induced Oxidative DNA Damage in Earthworms: A Review

    OpenAIRE

    Takeshi Hirano; Kazuyoshi Tamae

    2010-01-01

    Earthworms can be used as a bio-indicator of metal contamination in soil, Earlier reports claimed the bioaccumulation of heavy metals in earthworm tissues, while the metal-induced mutagenicity reared in contaminated soils for long duration. But we examined the metal-induced mutagenicity in earthworms reared in metal containing culture beddings. In this experiment we observed the generation of 8-oxoguanine (8-oxo-Gua) in earthworms exposed to cadmium and nickel in soil. 8-oxo-Gua is a major pr...

  5. Roles of oxidative stress and the ERK1/2, PTEN and p70S6K signaling pathways in arsenite-induced autophagy.

    Science.gov (United States)

    Huang, Ya-Chun; Yu, Hsin-Su; Chai, Chee-Yin

    2015-12-15

    Studies show that arsenite induces oxidative stress and modifies cellular function via phosphorylation of proteins and inhibition of DNA repair enzymes. Autophagy, which has multiple physiological and pathological roles in cellular function, is initiated by oxidative stress and is regulated by the signaling pathways of phosphatidylinositol 3-phosphate kinase (PI3K)/mammalian target of rapamycin (mTOR)/p70S6 kinase (p70S6K) and extracellular signaling-regulated protein kinase 1/2 (ERK1/2) that play important roles in oncogenesis. However, the effects of arsenite-induced oxidative stress on autophagy and on expression of related proteins are not fully understood. This study found that cells treated with sodium arsenite had reduced 8-oxoguanine DNA glycosylase 1 (OGG1) and increased 8-hydroxy-2'-deoxyguanosine (8-OHdG) and activating transcription factor (ATF) 3 in SV-40 immortalized human uroepithelial (SV-HUC-1) cells. Arsenite also increased the number of autophagosomes and increased levels of the autophagy markers Beclin-1 and microtubule-associated protein 1 light chain 3B. Reactive oxygen species scavenger decreased arsenite-induced autophagy in SV-HUC-1 cells. Our previous work showed that arsenite induced phosphorylation of the ERK1/2 signaling pathway. The current study further showed that arsenite decreased phosphatase and tensin homologue (PTEN) levels and increased phospho-p70S6 kinase (p-p70S6K) in SV-HUC-1 cells. However, both kinase inhibitor U0126 and the DNA (cytosine-5-)-methyltransferase 1 (DNMT1) inhibitor 5-aza-deoxycytidine abolished the effect of arsenite on expressions of PTEN and p-p70S6K. These results show that autophagy induced by arsenite exposure is mediated by oxidative stress, which regulates activation of the PTEN, p70S6K and ERK1/2 signaling pathways. Thus, this study clarifies the role of autophagy in arsenite-induced urothelial carcinogenesis. PMID:26432159

  6. An enzymatic activity isolated from Brassica oleracea specific for UV-irradiated DNA

    International Nuclear Information System (INIS)

    As a consequence of a breakdown in the ozone layer, an increase in the amount of DNA damage caused by ultraviolet irradiation can be expected. Organisms have evolved mechanisms to repair numerous types of DNA damages. While these DNA repair systems have been well characterized in bacteria and to a lesser extent in mammalian cells, surprisingly little is known about repair of potentially harmful DNA lesions in plants. An enzyme that recognizes and incises UV irradiated DNA has been partially purified from the leaf tissue of Brassica oleracea. Glycosylase-produced base loss sites were detected by a nitrocellulose filter-binding assay using UV-irradiated PM2 viral DNA as the substrate. The optimal temperature for maximal enzyme activity is 47C with a pH optimum between 7.0 and 7.5. In addition, the endonuclease is active in both Tris and phosphate buffers, although it is stimulated by phosphate concentrations up to 25 mM. Currently, a number of synthetic polynucleotides as well as DNAs of defined sequence are being employed as substrates to determine the nature of the UV-induced lesion and the precise mechanism of action of the enzyme

  7. DNA damage and defence gene expression after oxidative stress induced by x-rays and diesel exhaust particles

    International Nuclear Information System (INIS)

    Particulate air pollution is one the most important environmental health factors for people living in cities. Especially the exhaust particles from traffic are possible causes for cancer and cardiopulmonary diseases. The aim of this thesis was to characterize the health effects of diesel exhaust particles (DEP) by inducing oxidative stress and analyse the underlying mechanisms. Methods for determining oxidative stress, DNA damage, and gene expression were validated and calibrated in lung tissue by studying the dose response relations after ionizing radiation. The study showed the feasibility of partial-body x-ray irradiation as an in vivo model for induction and repair of oxidative DNA damage, of DNA repair enzymes expression, and antioxidant defense genes. A 'nose-only' mouse model for inhalation of ultra-fine particles showed that particles induce oxidative DNA damage in lung tissue and in bronchoalveolar lavage cells. The exposure increased the expression of HO-1 mRNA and oxoguanine DNA glycosylase OGG1 mRNA. The levels of 8-oxodG and OGG1 mRNA were mirror images. Colon and liver were analysed after administration of DEP in the diet with or without increasing doses of sucrose. This study indicated that DEP induces DNA adducts and oxidative stress through formation of DNA strand breaks, DNA repair enzyme expression, apoptosis, and protein oxidisation in colon and liver at relatively low exposure doses. The thesis is based on four published journal articles. (ln)

  8. Endonucleolytic activity directed towards 8-(2-hydroxy-2-propyl) purines in double-stranded DNA.

    Science.gov (United States)

    Livneh, Z; Elad, D; Sperling, J

    1979-11-01

    Photoalkylation of circular covalently closed DNA from phage PM2 with isopropyl alcohol by using a free radical photoinitiator and UV light of lambda greater than 305 nm led to the specific 8-substitution of purine moieties in the DNA, yielding 8-(2-hydroxy-2-propyl)adenine and 8-(2-hydroxy-2-propyl)guanine as the only detectable damage in the DNA. Using this specifically photoalkylated DNA as a substrate, we discovered in extracts of Micrococcus luteus an endonucleolytic activity that is directed towards 8-(2-hydroxy-2-propyl) purines in DNA. The activity is not a combination of a DNA-glycosylase and an apurinic site endonuclease. It is not inhibited by single-stranded DNA, by UV- or gamma-irradiated single-stranded DNA, or by normal or depurinated double-stranded DNA. however, gamma- or UV-(254 nm) irradiated double-stranded DNAs to inhibit the activity, hinting at the possibility of a common type of lesion in these damaged DNAs. Divalent cations are not required for the incising activity, and it is fully active in 1 mM EDTA, whereas caffeine and ATP cause inhibition. Extracts of mutant M. luteus lacking pyrimidine-dimer-directed endonucleases were found to contain the endonucleolytic activity in levels comparable to those present in the wild type. After the incision, we could demonstrate the specific excision of the 8-alkylated purines from the damaged DNA. The special conformational consequences of the 8-alkylation of purines, at the nucleotide level, namely their nonregular syn conformation, suggest that it is the distortion in the DNA that is recognized by the endonuclease. PMID:293658

  9. Oxidative stress and male reproductive health

    Directory of Open Access Journals (Sweden)

    Robert J Aitken

    2014-02-01

    Full Text Available One of the major causes of defective sperm function is oxidative stress, which not only disrupts the integrity of sperm DNA but also limits the fertilizing potential of these cells as a result of collateral damage to proteins and lipids in the sperm plasma membrane. The origins of such oxidative stress appear to involve the sperm mitochondria, which have a tendency to generate high levels of superoxide anion as a prelude to entering the intrinsic apoptotic cascade. Unfortunately, these cells have very little capacity to respond to such an attack because they only possess the first enzyme in the base excision repair (BER pathway, 8-oxoguanine glycosylase 1 (OGG1. The latter successfully creates an abasic site, but the spermatozoa cannot process the oxidative lesion further because they lack the downstream proteins (APE1, XRCC1 needed to complete the repair process. It is the responsibility of the oocyte to continue the BER pathway prior to initiation of S-phase of the first mitotic division. If a mistake is made by the oocyte at this stage of development, a mutation will be created that will be represented in every cell in the body. Such mechanisms may explain the increase in childhood cancers and other diseases observed in the offspring of males who have suffered oxidative stress in their germ line as a consequence of age, environmental or lifestyle factors. The high prevalence of oxidative DNA damage in the spermatozoa of male infertility patients may have implications for the health of children conceivedin vitro and serves as a driver for current research into the origins of free radical generation in the germ line.

  10. The hOGG1 Ser326Cys Gene Polymorphism and the Risk of Coronary Ectasia in the Chinese Population

    Directory of Open Access Journals (Sweden)

    Po-Chao Hsu

    2014-01-01

    Full Text Available Oxidative stress (OS is related to vascular inflammation possibly, contributing to the development of coronary ectasia (CE. Base excision repair (BER and nucleotide excision repair are the main DNA repair pathways that can help to remove 8-hydroxydeoxyguanine (8-OHdG, a marker of OS. Human 8-oxoguanine DNA glycosylase 1 (hOGG1 is a key enzyme of the BER pathway and catalyzes the removal of 8-OHdG. The aim of our study was to investigate the association between hOGG1 Ser326Cys gene polymorphism and CE in a Chinese population. Five-hundred forty-seven patients who underwent diagnostic coronary angiography in a tertiary medical center were recruited. The angiographic definition of CE is the diameter of the ectatic segment being more than 1.5 times larger compared with an adjacent healthy reference segment. The gene polymorphisms were analyzed by polymerase chain reaction. The urine 8OHdG concentration was measured using a commercial ELISA kit. The distribution of hOGG1 Ser326Cys genotypes was significantly different between CE and non-CE groups (p = 0.033. The odds ratio of CE development for the Ser to the Cys variant was 1.55 (95% confidence interval (CI, 1.04–2.31, p = 0.033. Both univariate and logistic regression analysis showed a significant association of hOGG1 Ser326Cys polymorphism in the dominant model with CE development (p = 0.009 and 0.011, respectively. Urine 8-OHdG levels were significantly higher in subjects carrying the hOGG1 Ser variant than in those with the Cys/Cys genotype (p < 0.03. In conclusion, our study suggests that the hOGG1 Ser326Cys gene variant might play a role in susceptibility to the development of CE.

  11. Use of a molecular beacon to track the activity of base excision repair protein OGG1 in live cells.

    Science.gov (United States)

    Mirbahai, Leda; Kershaw, Rachael M; Green, Richard M; Hayden, Rachel E; Meldrum, Rosalind A; Hodges, Nikolas J

    2010-02-01

    An abundant form of DNA damage caused by reactive oxygen species is 8-oxo-7,8-dihydroguanine for which the base excision repair protein 8-oxoguanine-DNA glycosylase 1 (OGG1) is a major repair enzyme. To assess the location and intracellular activity of the OGG1 protein in response to oxidative stress, we have utilised a fluorescence-quench molecular beacon switch containing a 8-oxo-dG:C base pair and a fluorescent and quencher molecule at opposite ends of a hairpin oligonucleotide. Oxidative stress was induced by treatment with potassium bromate. Flow cytometry demonstrated a concentration-dependent increase in the activity of OGG1 that was detected by the fluorescence produced when the oligonucleotide was cleaved in the cells treated with potassium bromate. This signal is highly specific and not detectable in OGG1 knock out cells. Induction of OGG1 activity is not a result of induction of OGG1 gene expression as assessed by qPCR suggesting a role for protein stabilisation or increased OGG1 catalytic activity. High resolution confocal microscopy pinpointed the location of the fluorescent molecular beacon in live cells to perinuclear regions that were identified as mitochondria by co-staining with mitotracker dye. There is no evidence of cut beacon within the nuclear compartment of the cell. Control experiments with a positive control beacon (G:C base pair and lacking the DAB quencher) did not result in mitochondrial localisation of fluorescence signal indicating that the dye does not accumulate in mitochondria independent of OGG1 activity. Furthermore, faint nuclear staining was apparent confirming that the beacon structure is able to enter the nucleus. In conclusion, these data indicate that the mitochondria are the major site for OGG1 repair activity under conditions of oxidative stress.

  12. Mechanism of Werner DNA helicase: POT1 and RPA stimulates WRN to unwind beyond gaps in the translocating strand.

    Science.gov (United States)

    Ahn, Byungchan; Lee, Jae Wan; Jung, Hana; Beck, Gad; Bohr, Vilhelm A

    2009-01-01

    WRN belongs to the RecQ family of DNA helicases and it plays a role in recombination, replication, telomere maintenance and long-patch base excision repair. Here, we demonstrate that WRN efficiently unwinds DNA substrates containing a 1-nucleotide gap in the translocating DNA strand, but when the gap size is increased to 3-nucleotides unwinding activity significantly declines. In contrast, E. coli UvrD (3'-->5' helicase), which recognizes nicks in DNA to initiate unwinding, does not unwind past a 1-nucleotide gap. This unique ability of WRN to bypass gaps supports its involvement in DNA replication and LP-BER where such gaps can be produced by glycosylases and the apurinic/apyrimidinic endonuclease 1 (APE1). Furthermore, we tested telomere repeat binding factor 2 (TRF2), both variants 1 and 2 of protector of telomeres 1 (POT1v1 and POT1v2) and RPA on telomeric DNA substrates containing much bigger gaps than 3-nucleotides in order to determine whether unwinding could be facilitated through WRN-protein interaction. Interestingly, POT1v1 and RPA are capable of stimulating WRN helicase on gapped DNA and 5'-overhang substrates, respectively. PMID:19262689

  13. Mechanism of Werner DNA helicase: POT1 and RPA stimulates WRN to unwind beyond gaps in the translocating strand.

    Directory of Open Access Journals (Sweden)

    Byungchan Ahn

    Full Text Available WRN belongs to the RecQ family of DNA helicases and it plays a role in recombination, replication, telomere maintenance and long-patch base excision repair. Here, we demonstrate that WRN efficiently unwinds DNA substrates containing a 1-nucleotide gap in the translocating DNA strand, but when the gap size is increased to 3-nucleotides unwinding activity significantly declines. In contrast, E. coli UvrD (3'-->5' helicase, which recognizes nicks in DNA to initiate unwinding, does not unwind past a 1-nucleotide gap. This unique ability of WRN to bypass gaps supports its involvement in DNA replication and LP-BER where such gaps can be produced by glycosylases and the apurinic/apyrimidinic endonuclease 1 (APE1. Furthermore, we tested telomere repeat binding factor 2 (TRF2, both variants 1 and 2 of protector of telomeres 1 (POT1v1 and POT1v2 and RPA on telomeric DNA substrates containing much bigger gaps than 3-nucleotides in order to determine whether unwinding could be facilitated through WRN-protein interaction. Interestingly, POT1v1 and RPA are capable of stimulating WRN helicase on gapped DNA and 5'-overhang substrates, respectively.

  14. DNA damage in leukocytes of workers occupationally exposed to arsenic in copper smelters.

    Science.gov (United States)

    Palus, Jadwiga; Lewinska, Dobroslawa; Dziubaltowska, Elzbieta; Stepnik, Maciej; Beck, Jens; Rydzynski, Konrad; Nilsson, Robert

    2005-08-01

    Inorganic arsenic (i-As) is a known human carcinogen; however, humans continue to be exposed to i-As in drinking water and in certain occupational settings. In this study, we used the Comet assay to evaluate DNA damage in the somatic cells of workers from three Polish copper smelters who were occupationally exposed to i-As. Blood samples were collected from 72 male workers and 83 unexposed male controls and used for the detection of DNA damage, oxidative DNA damage, and DNA damage after a 3-hr incubation in culture. Urine samples were collected to assess the level of exposure. The mean concentration of arsenic metabolites in urine [the sum of arsenite (AsIII), arsenate (AsV), monomethylarsenate (MMA) and dimethylarsenate (DMA)] and the concentrations of DMA (the main metabolite in urine) were higher in workers than in controls, but the differences were not statistically significant. By contrast, the level of DNA damage, expressed as the median tail moment, was significantly higher in the leukocytes of workers than in the controls. Comet assays conducted with formamidopyrimidine glycosylase (FPG) digestion to detect oxidative DNA damage indicated that oxidative lesions were present in leukocytes from both the exposed and control groups, but the levels of damage were significantly higher among the workers. Incubation of the cells in culture resulted in a significant reduction in the levels of DNA damage, especially among leukocytes from the workers, suggesting that the DNA damage was subject to repair. Our findings indicate that copper smelter workers have increased levels of DNA damage in somatic cells, suggesting a potential health risk for the workers. Although i-As was present in air samples from the smelters and in urine samples from workers, no clear association could be made between i-As exposure and the DNA damage. PMID:15880732

  15. HIV-1 and HIV-2 exhibit divergent interactions with HLTF and UNG2 DNA repair proteins.

    Science.gov (United States)

    Hrecka, Kasia; Hao, Caili; Shun, Ming-Chieh; Kaur, Sarabpreet; Swanson, Selene K; Florens, Laurence; Washburn, Michael P; Skowronski, Jacek

    2016-07-01

    HIV replication in nondividing host cells occurs in the presence of high concentrations of noncanonical dUTP, apolipoprotein B mRNA-editing, enzyme-catalytic, polypeptide-like 3 (APOBEC3) cytidine deaminases, and SAMHD1 (a cell cycle-regulated dNTP triphosphohydrolase) dNTPase, which maintains low concentrations of canonical dNTPs in these cells. These conditions favor the introduction of marks of DNA damage into viral cDNA, and thereby prime it for processing by DNA repair enzymes. Accessory protein Vpr, found in all primate lentiviruses, and its HIV-2/simian immunodeficiency virus (SIV) SIVsm paralogue Vpx, hijack the CRL4(DCAF1) E3 ubiquitin ligase to alleviate some of these conditions, but the extent of their interactions with DNA repair proteins has not been thoroughly characterized. Here, we identify HLTF, a postreplication DNA repair helicase, as a common target of HIV-1/SIVcpz Vpr proteins. We show that HIV-1 Vpr reprograms CRL4(DCAF1) E3 to direct HLTF for proteasome-dependent degradation independent from previously reported Vpr interactions with base excision repair enzyme uracil DNA glycosylase (UNG2) and crossover junction endonuclease MUS81, which Vpr also directs for degradation via CRL4(DCAF1) E3. Thus, separate functions of HIV-1 Vpr usurp CRL4(DCAF1) E3 to remove key enzymes in three DNA repair pathways. In contrast, we find that HIV-2 Vpr is unable to efficiently program HLTF or UNG2 for degradation. Our findings reveal complex interactions between HIV-1 and the DNA repair machinery, suggesting that DNA repair plays important roles in the HIV-1 life cycle. The divergent interactions of HIV-1 and HIV-2 with DNA repair enzymes and SAMHD1 imply that these viruses use different strategies to guard their genomes and facilitate their replication in the host. PMID:27335459

  16. Oxidative stress, inflammation, and DNA damage in rats after intratracheal instillation or oral exposure to ambient air and wood smoke particulate matter

    DEFF Research Database (Denmark)

    Danielsen, Pernille Høgh; Loft, Steffen; Jacobsen, Nicklas Raun;

    2010-01-01

    or intratracheal exposure in terms of oxidative stress, inflammation, genotoxicity, and DNA repair after 24 h in liver and lung tissue of rats. Rats were exposed to WSPM from high or low oxygen combustion and ambient PM collected in areas with and without many operating wood stoves or carbon black (CB) at the dose......Wood combustion is a significant source of ambient particulate matter (PM) in many regions of the world. Exposure occurs through inhalation or ingestion after deposition of wood smoke particulate matter (WSPM) on crops and food. We investigated effects of ambient PM and WSPM by intragastric...... expression of proinflammatory cytokines, heme oxygenase-1, and oxoguanine DNA glycosylase 1 was observed in the liver following intragastric exposure and in the lung following instillation in particular of LOWS. Exposure to LOWS also increased the proportion of neutrophils in BAL fluid. These results...

  17. Quantum mechanical study of the β- and δ-lyase reactions during the base excision repair process: application to FPG.

    Science.gov (United States)

    Sowlati-Hashjin, Shahin; Wetmore, Stacey D

    2015-10-14

    Bacterial FPG (or MutM) is a bifunctional DNA glycosylase that is primarily responsible for excising 8-oxoguanine (OG) from the genome by cleaving the glycosidic bond and the DNA backbone at the 3'- and 5'-phosphates of the damaged nucleoside. In the present work, quantum mechanical methods (SMD-M06-2X/6-311+G(2df,2p)//IEF-PCM-B3LYP/6-31G(d)) and a ring-opened Schiff base model that includes both the 3'- and 5'-phosphate groups are used to investigate the β- and δ-elimination reactions facilitated by FPG. Both the β- and δ-elimination reactions are shown to proceed through an E1cB mechanism that involves proton abstraction prior to the phosphate-ribose bond cleavage. Since transition states for the phosphate elimination reactions could not be characterized in the absence of leaving group protonation, our work confirms that the phosphate elimination reactions require protonation by a residue in the FPG active site, and can likely be further activated by additional active-site interactions. Furthermore, our model suggests that 5'-PO4 activation may proceed through a nearly isoenergetic direct (intramolecular) proton transfer involving the O4' proton of the deoxyribose of the damaged nucleoside. Regardless, our model predicts that both 3'- and 5'-phosphate protonation and elimination steps occur in a concerted reaction. Most importantly, our calculated barriers for the phosphate cleavage reactions reveal inherent differences between the β- and δ-elimination steps. Indeed, our calculations provide a plausible explanation for why the δ-elimination rather than the β-elimination is the rate-determining step in the BER facilitated by FPG, and why some bifunctional glycosylases (including the human counterpart, hOgg1) lack δ-lyase activity. Together, the new mechanistic features revealed by our work can be used in future large-scale modeling of the DNA-protein system to unveil the roles of key active sites residues in these relatively unexplored BER steps.

  18. Biomarkers of radiation or oxidative damage to DNA in cells

    International Nuclear Information System (INIS)

    Major efforts have been devoted during the last two decades to the development of chemical and biochemical assays aimed at monitoring oxidized bases within DNA. Until recently, the level of oxidized bases in cellular DNA was overestimated by factors varying from one to three orders of magnitude. The reasons of these inconsistencies are now identified. Thus, artifactual oxidation of nucleobases may occur during the silylation reaction prior to gas chromatography mass spectrometry analysis and to a lesser extent during DNA extraction. The use of the so-called chaotropic DNA extraction method together with chelating agents was found to significantly prevent spurious DNA oxidation to occur. HPLC separations coupled to either electrochemical detection or versatile electrospray ionization tandem-mass spectrometry appear to be appropriate analytical tools when at least 20 μg of DNA is available. Interestingly, up to 11 modified nucleosides and nucleobases including the four cis and trans diastereomers of 5,6- dihydroxy-5,6-dihydrothymidine, 5-formyl-2'-deoxyuridine, 5-(hydroxymethyl)-2'-deoxyuridine, and 5-hydroxy-2'-deoxyuridine, 8-oxo-7,8-dihydro-2'-deoxyguanosine, 8-oxo-7,8-dihydro-2'-deoxyadenosine together with related formamidopyrimidine derivatives were measured in the DNA of neoplastic human monocytes exposed to ionizing radiation using the latter assay. The association of base excision DNA repair enzymes including bacterial formamidopyrimidine glycosylase (Fpg) and endonuclease III (endo III) with the comet assay represents a better alternative for assessing low levels of base damage. The basal level of Fpg- and endo III-sensitive sites was found to be similar, close to 2.1 per 107 bases, within the DNA of human monocytes. The yields of the different classes of damage per Gy and 107 bases are the following: 0.48 Fpg-sensitive sites, 0.53 endo III-sensitive sites and 1.30 strand breaks (direct nicks and alkali-labile sites). Interestingly, the above three classes

  19. Effects of ionizing radiations on DNA-protein complexes; Effets des radiations ionisantes sur des complexes ADN-proteine

    Energy Technology Data Exchange (ETDEWEB)

    Gillard, N

    2005-11-15

    The radio-induced destruction of DNA-protein complexes may have serious consequences for systems implicated in important cellular functions. The first system which has been studied is the lactose operon system, that regulates gene expression in Escherichia coli. First of all, the repressor-operator complex is destroyed after irradiation of the complex or of the protein alone. The damaging of the domain of repressor binding to DNA (headpiece) has been demonstrated and studied from the point of view of peptide chain integrity, conformation and amino acids damages. Secondly, dysfunctions of the in vitro induction of an irradiated repressor-unirradiated DNA complex have been observed. These perturbations, due to a decrease of the number of inducer binding sites, are correlated to the damaging of tryptophan residues. Moreover, the inducer protects the repressor when they are irradiated together, both by acting as a scavenger in the bulk, and by the masking of its binding site on the protein. The second studied system is formed by Fpg (for Formamido pyrimidine glycosylase), a DNA repair protein and a DNA with an oxidative lesion. The results show that irradiation disturbs the repair both by decreasing its efficiency of DNA lesion recognition and binding, and by altering its enzymatic activity. (author)

  20. Dna Sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  1. The molecular genetics of the incision step in the DNA excision repair process

    International Nuclear Information System (INIS)

    In this historical review one particular aspect of excision repair, DNA incision, and how it is controlled at the genetic level in bacteriophage, bacteria, S. cerevisae, D. melanogaster, rodent cells and humans is examined. In phage T4, DNA is incised by a DNA glycosylase-AP endonuclease coded for by the denV gene. In E. coli, products of three genes, uvrA, uvrB and uvrC, are required to form UVRABC excinuclease that cleaves DNA and releases a fragment 12-13 nucleotides long containing the damage site. In S. cerevisiae, genes complementing five mutants of the RAD3 epistasis group, rad1, rad2, rad3, rad4 and rad10 have been cloned and analyzed. Rodent cells sensitive to a variety of mutagenic agents and deficient in excision repair are being used in molecular studies to identify and clone human repair genes (e.g. ERCC1) capable of complementing mammalian repair defects. Most studies of the human system, have been done with cells isolated from patients xeroderma pigmentosum, and these are now beginning to be characterized at the molecular level. (author)

  2. Biological consequences of potential repair intermediates of clustered base damage site in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Shikazono, Naoya, E-mail: shikazono.naoya@jaea.go.jp [Japan Atomic Energy Agency, Advanced Research Science Center, 2-4 Shirakata-Shirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); O' Neill, Peter [Gray Institute for Radiation Oncology and Biology, University of Oxford, Roosevelt Drive, Oxford OX3 7DQ (United Kingdom)

    2009-10-02

    Clustered DNA damage induced by a single radiation track is a unique feature of ionizing radiation. Using a plasmid-based assay in Escherichia coli, we previously found significantly higher mutation frequencies for bistranded clusters containing 7,8-dihydro-8-oxoguanine (8-oxoG) and 5,6-dihydrothymine (DHT) than for either a single 8-oxoG or a single DHT in wild type and in glycosylase-deficient strains of E. coli. This indicates that the removal of an 8-oxoG from a clustered damage site is most likely retarded compared to the removal of a single 8-oxoG. To gain further insights into the processing of bistranded base lesions, several potential repair intermediates following 8-oxoG removal were assessed. Clusters, such as DHT + apurinic/apyrimidinic (AP) and DHT + GAP have relatively low mutation frequencies, whereas clusters, such as AP + AP or GAP + AP, significantly reduce the number of transformed colonies, most probably through formation of a lethal double strand break (DSB). Bistranded AP sites placed 3' to each other with various interlesion distances also blocked replication. These results suggest that bistranded base lesions, i.e., single base lesions on each strand, but not clusters containing only AP sites and strand breaks, are repaired in a coordinated manner so that the formation of DSBs is avoided. We propose that, when either base lesion is initially excised from a bistranded base damage site, the remaining base lesion will only rarely be converted into an AP site or a single strand break in vivo.

  3. Archaeal DNA Polymerase-B as a DNA Template Guardian: Links between Polymerases and Base/Alternative Excision Repair Enzymes in Handling the Deaminated Bases Uracil and Hypoxanthine

    Directory of Open Access Journals (Sweden)

    Javier Abellón-Ruiz

    2016-01-01

    Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.

  4. Genome analysis of DNA repair genes in the alpha proteobacterium Caulobacter crescentus

    Directory of Open Access Journals (Sweden)

    Menck Carlos FM

    2007-03-01

    Full Text Available Abstract Background The integrity of DNA molecules is fundamental for maintaining life. The DNA repair proteins protect organisms against genetic damage, by removal of DNA lesions or helping to tolerate them. DNA repair genes are best known from the gamma-proteobacterium Escherichia coli, which is the most understood bacterial model. However, genome sequencing raises questions regarding uniformity and ubiquity of these DNA repair genes and pathways, reinforcing the need for identifying genes and proteins, which may respond to DNA damage in other bacteria. Results In this study, we employed a bioinformatic approach, to analyse and describe the open reading frames potentially related to DNA repair from the genome of the alpha-proteobacterium Caulobacter crescentus. This was performed by comparison with known DNA repair related genes found in public databases. As expected, although C. crescentus and E. coli bacteria belong to separate phylogenetic groups, many of their DNA repair genes are very similar. However, some important DNA repair genes are absent in the C. crescentus genome and other interesting functionally related gene duplications are present, which do not occur in E. coli. These include DNA ligases, exonuclease III (xthA, endonuclease III (nth, O6-methylguanine-DNA methyltransferase (ada gene, photolyase-like genes, and uracil-DNA-glycosylases. On the other hand, the genes imuA and imuB, which are involved in DNA damage induced mutagenesis, have recently been described in C. crescentus, but are absent in E. coli. Particularly interesting are the potential atypical phylogeny of one of the photolyase genes in alpha-proteobacteria, indicating an origin by horizontal transfer, and the duplication of the Ada orthologs, which have diverse structural configurations, including one that is still unique for C. crescentus. Conclusion The absence and the presence of certain genes are discussed and predictions are made considering the particular

  5. Synthesis of modified oligonucleotides for repair and replication studies of single and double radio-induced DNA lesions

    International Nuclear Information System (INIS)

    Several oxidative processes induce the formation of DNA lesions. In order to evaluate the biological and structural significance of such damage, several DNA lesions were inserted into synthetic oligonucleotides at defined sites. The research work aimed at describing the preparation of oligonucleotides t hat contained DNA damage and the evaluation of the biological properties of the lesions. A first part described the incorporation of radiation-induced lesions, namely (5'S,6S)-5',6-cyclo-5,6-dihydro-2'-deoxyuridine and (5'S,5S,6S)-5',6-cyclo-5-hydroxy-5,6-dihydro-2'-desoxyuridine into oligonucleotides. The modified DNA fragments were characterised by several spectroscopic and biochemical analyses including ESI MS, MALDI-TOF MS, CLHP and enzymatic digestions. During in vitro DNA synthesis by Taq DNA polymerase and Klenow exo fragment, the pyrimidine cyclo-nucleosides were found to block the progression of the enzymes. Then, repair studies by ADN N glycosylases, operating in the base excision repair pathway, have shown that the anhydro-nucleoside lesions were not recognised nor excised by Fpg, endo III, endo VIII, yNtg1 yNtg2 and yOgg1. Interestingly, the Latococcus lactis Fpg protein recognises (formation of a non covalent complex) but do not excise the damage. The incorporation into oligonucleotides of the (5R*) and (5S*) diastereoisomers of 1-[2-deoxy-β-D-erythro-pentofuranosyl]-5-hydroxy-hydantoin, generated by several oxidative processes was then described. In vitro DNA replication assays using modified oligonucleotides matrix showed a lethal potential of the latter base damage. Repair studies by ADN N-glycosylases showed that the damage was substrate for Fpg, endo III, endo VIII, Ntg1, Ntg2 and Fpg-L1. The rates of excision as inferred from the determination of the Michaelis kinetics constants were found to be affected by the presence of the damage. MALDI-TOF MS was used in order to gain insights into mechanistic aspects of oligonucleotides cleavage by the

  6. Analysis of the machinery and intermediates of the 5hmC-mediated DNA demethylation pathway in aging on samples from the MARK-AGE Study

    Science.gov (United States)

    Valentini, Elisabetta; Zampieri, Michele; Malavolta, Marco; Bacalini, Maria Giulia; Calabrese, Roberta; Guastafierro, Tiziana; Reale, Anna; Franceschi, Claudio; Hervonen, Antti; Koller, Bernhard; Bernhardt, Jürgen; Slagboom, P. Eline; Toussaint, Olivier; Sikora, Ewa; Gonos, Efstathios S.; Breusing, Nicolle; Grune, Tilman; Jansen, Eugène; Dollé, Martijn E.T.; Moreno-Villanueva, María; Sindlinger, Thilo; Bürkle, Alexander; Ciccarone, Fabio; Caiafa, Paola

    2016-01-01

    Gradual changes in the DNA methylation landscape occur throughout aging virtually in all human tissues. A widespread reduction of 5-methylcytosine (5mC), associated with highly reproducible site-specific hypermethylation, characterizes the genome in aging. Therefore, an equilibrium seems to exist between general and directional deregulating events concerning DNA methylation controllers, which may underpin the age-related epigenetic changes. In this context, 5mC-hydroxylases (TET enzymes) are new potential players. In fact, TETs catalyze the stepwise oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC), driving the DNA demethylation process based on thymine DNA glycosylase (TDG)-mediated DNA repair pathway. The present paper reports the expression of DNA hydroxymethylation components, the levels of 5hmC and of its derivatives in peripheral blood mononuclear cells of age-stratified donors recruited in several European countries in the context of the EU Project ‘MARK-AGE’. The results provide evidence for an age-related decline of TET1, TET3 and TDG gene expression along with a decrease of 5hmC and an accumulation of 5caC. These associations were independent of confounding variables, including recruitment center, gender and leukocyte composition. The observed impairment of 5hmC-mediated DNA demethylation pathway in blood cells may lead to aberrant transcriptional programs in the elderly. PMID:27587280

  7. The source and significance of DNA damage in human spermatozoa; a commentary on diagnostic strategies and straw man fallacies.

    Science.gov (United States)

    Aitken, R J; Bronson, R; Smith, T B; De Iuliis, G N

    2013-08-01

    This article considers the origins of DNA damage in human spermatozoa, the methods that are available to monitor this aspect of semen quality and the clinical significance of such measurements. DNA damage in spermatozoa appears to be largely oxidative in nature, inversely correlated with levels of nuclear protamination and frequently associated with the activation of a truncated apoptotic pathway. DNA base adducts formed as a result of oxidative attack are released from the spermatozoa into the extracellular space through the action of a glycosylase, OGG1. This creates an abasic site, which is not resolved until fertilization because spermatozoa do not possess the molecular machinery needed to continue the base excision repair pathway. The abasic sites so generated in human spermatozoa are readily detected by SCSA or the Comet assay; however, no signal is detectable with TUNEL. This is because spermatozoa lack the enzyme (APE1) needed to create the free 3' hydroxyl groups required by this detection system. Nevertheless, spermatozoa do eventually become TUNEL positive as they enter the perimortem. The American Society of Reproductive Medicine Practice Committee has suggested that DNA damage in spermatozoa should not be assessed because the correlation with pregnancy is inconsistent across independent studies. However, this is a straw man argument. The reason why such assays should be undertaken is not just that they reflect the underlying quality of spermatogenesis but, more importantly, that the DNA damage they reveal may have detrimental effects on the developmental normality of the embryo and the health of possible future children. PMID:23548339

  8. Modulating effects of pycnogenol® on oxidative stress and DNA damage induced by sepsis in rats.

    Science.gov (United States)

    Taner, Gökçe; Aydın, Sevtap; Bacanlı, Merve; Sarıgöl, Zehra; Sahin, Tolga; Başaran, A Ahmet; Başaran, Nurşen

    2014-11-01

    The aim of this study was to evaluate the protective effects of Pycnogenol® (Pyc), a complex plant extract from the bark of French maritime pine, on oxidative stress parameters (superoxide dismutase (SOD), and glutathione peroxidase (GPx) activities and total glutathione (GSH) and malondialdehyde (MDA) levels), an inflammatory cytokine (tumor necrosis factor alpha (TNF-α) level) and also DNA damage in Wistar albino rats. Rats were treated with 100 mg/kg intraperitonally Pyc following the induction of sepsis by cecal ligation and puncture. The decreases in MDA levels and increases in GSH levels, and SOD and GPx activities were observed in the livers and kidneys of Pyc-treated septic rats. Plasma TNF-α level was found to be decreased in the Pyc-treated septic rats. In the lymphocytes, kidney, and liver tissue cells of the sepsis-induced rats, Pyc treatment significantly decreased the DNA damage and oxidative base damage using standard alkaline assay and formamidopyrimidine DNA glycosylase-modified comet assay, respectively. In conclusion, Pyc treatment might have a role in the prevention of sepsis-induced oxidative damage not only by decreasing DNA damage but also increasing the antioxidant status and DNA repair capacity in rats. PMID:24919414

  9. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent d...

  10. DNA glue

    DEFF Research Database (Denmark)

    Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.;

    2008-01-01

    Significant alterations in thermal stability of parallel DNA triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in the structure of phenylmethylglycerol inserted as a bulge into DNA (TINA). Insertions of two ortho-TINAs as a pseudo...

  11. Selenium supplementation reduced oxidative DNA damage in adnexectomized BRCA1 mutations carriers.

    Science.gov (United States)

    Dziaman, Tomasz; Huzarski, Tomasz; Gackowski, Daniel; Rozalski, Rafal; Siomek, Agnieszka; Szpila, Anna; Guz, Jolanta; Lubinski, Jan; Wasowicz, Wojciech; Roszkowski, Krzysztof; Olinski, Ryszard

    2009-11-01

    Some experimental evidence suggests that BRCA1 plays a role in repair of oxidative DNA damage. Selenium has anticancer properties that are linked with protection against oxidative stress. To assess whether supplementation of BRCA1 mutation carriers with selenium have a beneficial effect concerning oxidative stress/DNA damage in the present double-blinded placebo control study, we determined 8-oxodG level in cellular DNA and urinary excretion of 8-oxodG and 8-oxoGua in the mutation carriers. We found that 8-oxodG level in leukocytes DNA is significantly higher in BRCA1 mutation carriers. In the distinct subpopulation of BRCA1 mutation carriers without symptoms of cancer who underwent adnexectomy and were supplemented with selenium, the level of 8-oxodG in DNA decreased significantly in comparison with the subgroup without supplementation. Simultaneously in the same group, an increase of urinary 8-oxoGua, the product of base excision repair (hOGG1 glycosylase), was observed. Therefore, it is likely that the selenium supplementation of the patients is responsible for the increase of BER enzymes activities, which in turn may result in reduction of oxidative DNA damage. Importantly, in a double-blinded placebo control prospective study, it was shown that in the same patient groups, reduction in cancer incidents was observed. Altogether, these results suggest that BRCA1 deficiency contributes to 8-oxodG accumulation in cellular DNA, which in turn may be a factor responsible for cancer development in women with mutations, and that the risk to developed breast cancer in BRCA1 mutation carriers may be reduced in selenium-supplemented patients who underwent adnexectomy. PMID:19843683

  12. DNA repair by MGMT, but not AAG, causes a threshold in alkylation-induced colorectal carcinogenesis.

    Science.gov (United States)

    Fahrer, Jörg; Frisch, Janina; Nagel, Georg; Kraus, Alexander; Dörsam, Bastian; Thomas, Adam D; Reißig, Sonja; Waisman, Ari; Kaina, Bernd

    2015-10-01

    Epidemiological studies indicate that N-nitroso compounds (NOC) are causally linked to colorectal cancer (CRC). NOC induce DNA alkylations, including O (6)-methylguanine (O (6)-MeG) and N-methylated purines, which are repaired by O (6)-MeG-DNA methyltransferase (MGMT) and N-alkyladenine-DNA glycosylase (AAG)-initiated base excision repair, respectively. In view of recent evidence of nonlinear mutagenicity for NOC-like compounds, the question arises as to the existence of threshold doses in CRC formation. Here, we set out to determine the impact of DNA repair on the dose-response of alkylation-induced CRC. DNA repair proficient (WT) and deficient (Mgmt (-/-), Aag (-/-) and Mgmt (-/-)/Aag (-/-)) mice were treated with azoxymethane (AOM) and dextran sodium sulfate to trigger CRC. Tumors were quantified by non-invasive mini-endoscopy. A non-linear increase in CRC formation was observed in WT and Aag (-/-) mice. In contrast, a linear dose-dependent increase in tumor frequency was found in Mgmt (-/-) and Mgmt (-/-)/Aag (-/-) mice. The data were corroborated by hockey stick modeling, yielding similar carcinogenic thresholds for WT and Aag (-/-) and no threshold for MGMT lacking mice. O (6)-MeG levels and depletion of MGMT correlated well with the observed dose-response in CRC formation. AOM induced dose-dependently DNA double-strand breaks in colon crypts including Lgr5-positive colon stem cells, which coincided with ATR-Chk1-p53 signaling. Intriguingly, Mgmt (-/-) mice displayed significantly enhanced levels of γ-H2AX, suggesting the usefulness of γ-H2AX as an early genotoxicity marker in the colorectum. This study demonstrates for the first time a non-linear dose-response for alkylation-induced colorectal carcinogenesis and reveals DNA repair by MGMT, but not AAG, as a key node in determining a carcinogenic threshold. PMID:26243310

  13. [DNA computing].

    Science.gov (United States)

    Błasiak, Janusz; Krasiński, Tadeusz; Popławski, Tomasz; Sakowski, Sebastian

    2011-01-01

    Biocomputers can be an alternative for traditional "silicon-based" computers, which continuous development may be limited due to further miniaturization (imposed by the Heisenberg Uncertainty Principle) and increasing the amount of information between the central processing unit and the main memory (von Neuman bottleneck). The idea of DNA computing came true for the first time in 1994, when Adleman solved the Hamiltonian Path Problem using short DNA oligomers and DNA ligase. In the early 2000s a series of biocomputer models was presented with a seminal work of Shapiro and his colleguas who presented molecular 2 state finite automaton, in which the restriction enzyme, FokI, constituted hardware and short DNA oligomers were software as well as input/output signals. DNA molecules provided also energy for this machine. DNA computing can be exploited in many applications, from study on the gene expression pattern to diagnosis and therapy of cancer. The idea of DNA computing is still in progress in research both in vitro and in vivo and at least promising results of these research allow to have a hope for a breakthrough in the computer science. PMID:21735816

  14. DNA probes

    International Nuclear Information System (INIS)

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  15. Induction and repair of DNA damage measured by the comet assay in human T lymphocytes separated by immunomagnetic cell sorting.

    Science.gov (United States)

    Bausinger, Julia; Speit, Günter

    2014-11-01

    The comet assay is widely used in human biomonitoring to measure DNA damage in whole blood or isolated peripheral blood mononuclear cells (PBMC) as a marker of exposure to genotoxic agents. Cytogenetic assays with phytohemagglutinin (PHA)-stimulated cultured T lymphocytes are also frequently performed in human biomonitoring. Cytogenetic effects (micronuclei, chromosome aberrations, sister chromatid exchanges) may be induced in vivo but also occur ex vivo during the cultivation of lymphocytes as a consequence of DNA damage present in lymphocytes at the time of sampling. To better understand whether DNA damage measured by the comet assay in PBMC is representative for DNA damage in T cells, we comparatively investigated DNA damage and its repair in PBMC and T cells obtained by immunomagnetic cell sorting. PBMC cultures and T cell cultures were exposed to mutagens with different modes of genotoxic action and DNA damage was measured by the comet assay after the end of a 2h exposure and after 18h post-incubation. The mutagens tested were methyl methanesulfonate (MMS), (±)-anti-B[a]P-7,8-dihydrodiol-9,10-epoxide (BPDE), 4-nitroquinoline-1-oxide (4NQO), styrene oxide and potassium bromate. MMS and potassium bromate were also tested by the modified comet assay with formamido pyrimidine glycosylase (FPG) protein. The results indicate that the mutagens tested induce DNA damage in PBMC and T cells in the same range of concentrations and removal of induced DNA lesions occurs to a comparable extent. Based on these results, we conclude that the comet assay with PBMC is suited to predict DNA damage and its removal in T cells.

  16. Studies on the repair of damaged DNA in bacteriophage, bacterial and mammalian systems. Comprehensive report, 1 February 1981-15 September 1983

    International Nuclear Information System (INIS)

    We have explored the molecular mechanism of the repair of DNA at a number of different levels of biological organization, by investigating bacteriophage, bacterial, yeast and mammalian (including human) cells. We have demonstrated that uv endonuclease of phage T4 not only possesses pyrimidine dimer (PD)-DNA glycosylase activity but also apyrimidinic (AP) endonuclease activity. The demonstration of both activities provided an explanation for the specific endonucleosytic cleavage of DNA at sites of pyrimidine dimers catalyzed by this small protein. A new apurinic/apyrimidinic (AP) endonuclease, specific for sites of of base loss in single stranded DNA has been isolated from E. celi and presumably recognizes these lesions in single stranded regions of duplex DNA. We have partially purified this enzyme and have carried out a preliminary characterization of the activity. We treated xeroderma pigmentosum and normal cells with sodium butyrate in the hope of restoring normal levels of excision repair to the former. Although this result was not obtained, we established that all cells treated with sodium butyrate show enhanced levels of repair synthesis, thus providing a means for increasing the sensitivity of this commonly used technique for measuring DNA repair in mammalian cells in culture

  17. DNA cleavage at the AP site via β-elimination mediated by the AP site-binding ligands.

    Science.gov (United States)

    Abe, Yukiko S; Sasaki, Shigeki

    2016-02-15

    DNA is continuously damaged by endogenous and exogenous factors such as oxidation and alkylation. In the base excision repair pathway, the damaged nucleobases are removed by DNA N-glycosylase to form the abasic sites (AP sites). The alkylating antitumor agent exhibits cytotoxicity through the formation of the AP site. Therefore blockage or modulation of the AP site repair pathway may enhance the antitumor efficacy of DNA alkylating agents. In this study, we have examined the effects of the nucleobase-polyamine conjugated ligands (G-, A-, C- and T-ligands) on the cleavage of the AP site. The G- and A-ligands cleaved DNA at the AP site by promoting β-elimination in a non-selective manner by the G-ligand, and in a selective manner for the opposing dT by the A-ligand. These results suggest that the nucleobase-polyamine conjugate ligands may have the potential for enhancement of the cytotoxicities of the AP site.

  18. DNA data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Raw DNA chromatogram data produced by the ABI 373, 377, 3130 and 3730 automated sequencing machines in ABI format. These are from fish (primarily Sebastes spp.,...

  19. Potent protection of gallic acid against DNA oxidation: Results of human and animal experiments

    Energy Technology Data Exchange (ETDEWEB)

    Ferk, Franziska; Chakraborty, Asima [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Jaeger, Walter [Department of Clinical Pharmacy and Diagnostic, University of Vienna, Vienna (Austria); Kundi, Michael [Institute of Environmental Health, Center for Public Health, Medical University of Vienna, A-1090 Vienna (Austria); Bichler, Julia; Misik, Miroslav [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Wagner, Karl-Heinz [Department of Nutritional Sciences, University of Vienna, 1090 Vienna (Austria); Grasl-Kraupp, Bettina; Sagmeister, Sandra [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Haidinger, Gerald [Department of Epidemiology, Center for Public Health, Medical University of Vienna, A-1090 Vienna (Austria); Hoelzl, Christine; Nersesyan, Armen [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Dusinska, Maria [Health Effect Laboratory, Center for Ecological Economics, Norwegian Institute for Air Research, NO-2027 Kjeller (Norway); Simic, Tatjana [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Knasmueller, Siegfried, E-mail: siegfried.knasmueller@meduniwien.ac.at [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria)

    2011-10-01

    Gallic acid (3,4,5-trihydroxybenzoic acid, GA) is a constituent of plant derived foods, beverages and herbal remedies. We investigated its DNA protective properties in a placebo controlled human intervention trial in single cell gel electrophoresis experiments. Supplementation of drinking water with GA (12.8 mg/person/d) for three days led to a significant reduction of DNA migration attributable to oxidised pyrimidines (endonuclease III sensitive sites) and oxidised purines (formamidopyrimidine glycosylase sensitive sites) in lymphocytes of healthy individuals by 75% and 64% respectively. Also DNA damage caused by treatment of the cells with reactive oxygen species (ROS) was reduced after GA consumption (by 41%). These effects were paralleled by an increase of the activities of antioxidant enzymes (superoxide dismutase, glutathione peroxidase and glutathion-S-transferase-{pi}) and a decrease of intracellular ROS concentrations in lymphocytes, while no alterations of the total antioxidant capacity (TAC), of malondialdehyde levels in serum and of the urinary excretion of isoprostanes were found. Experiments with rats showed that GA reduces oxidatively damaged DNA in lymphocytes, liver, colon and lungs and protects these organs against {gamma}-irradiation-induced strand breaks and formation of oxidatively damaged DNA-bases. Furthermore, the number of radiation-induced preneoplastic hepatic foci was decreased by 43% after oral administration of the phenolic. Since we did not find alterations of the TAC in plasma and lipid peroxidation of cell membranes but intracellular effects it is likely that the antioxidant properties of GA seen in vivo are not due to direct scavenging of radicals but rather to indirect mechanisms (e.g. protection against ROS via activation of transcription factors). As the amount of GA used in the intervention trial is similar to the daily intake in Middle Europe (18 mg/person/day), our findings indicate that it may contribute to prevention of

  20. Potent protection of gallic acid against DNA oxidation: Results of human and animal experiments

    International Nuclear Information System (INIS)

    Gallic acid (3,4,5-trihydroxybenzoic acid, GA) is a constituent of plant derived foods, beverages and herbal remedies. We investigated its DNA protective properties in a placebo controlled human intervention trial in single cell gel electrophoresis experiments. Supplementation of drinking water with GA (12.8 mg/person/d) for three days led to a significant reduction of DNA migration attributable to oxidised pyrimidines (endonuclease III sensitive sites) and oxidised purines (formamidopyrimidine glycosylase sensitive sites) in lymphocytes of healthy individuals by 75% and 64% respectively. Also DNA damage caused by treatment of the cells with reactive oxygen species (ROS) was reduced after GA consumption (by 41%). These effects were paralleled by an increase of the activities of antioxidant enzymes (superoxide dismutase, glutathione peroxidase and glutathion-S-transferase-π) and a decrease of intracellular ROS concentrations in lymphocytes, while no alterations of the total antioxidant capacity (TAC), of malondialdehyde levels in serum and of the urinary excretion of isoprostanes were found. Experiments with rats showed that GA reduces oxidatively damaged DNA in lymphocytes, liver, colon and lungs and protects these organs against γ-irradiation-induced strand breaks and formation of oxidatively damaged DNA-bases. Furthermore, the number of radiation-induced preneoplastic hepatic foci was decreased by 43% after oral administration of the phenolic. Since we did not find alterations of the TAC in plasma and lipid peroxidation of cell membranes but intracellular effects it is likely that the antioxidant properties of GA seen in vivo are not due to direct scavenging of radicals but rather to indirect mechanisms (e.g. protection against ROS via activation of transcription factors). As the amount of GA used in the intervention trial is similar to the daily intake in Middle Europe (18 mg/person/day), our findings indicate that it may contribute to prevention of formation

  1. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  2. What Is Mitochondrial DNA?

    Science.gov (United States)

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  3. DNA and RNA sensor

    Institute of Scientific and Technical Information of China (English)

    LIU; Tao; LIN; Lin; ZHAO; Hong; JIANG; Long

    2005-01-01

    This review summarizes recent advances in DNA sensor. Major areas of DNA sensor covered in this review include immobilization methods of DNA, general techniques of DNA detection and application of nanoparticles in DNA sensor.

  4. DNA vaccines

    Science.gov (United States)

    Gregersen, Jens-Peter

    2001-12-01

    Immunization by genes encoding immunogens, rather than with the immunogen itself, has opened up new possibilities for vaccine research and development and offers chances for new applications and indications for future vaccines. The underlying mechanisms of antigen processing, immune presentation and regulation of immune responses raise high expectations for new and more effective prophylactic or therapeutic vaccines, particularly for vaccines against chronic or persistent infectious diseases and tumors. Our current knowledge and experience of DNA vaccination is summarized and critically reviewed with particular attention to basic immunological mechanisms, the construction of plasmids, screening for protective immunogens to be encoded by these plasmids, modes of application, pharmacokinetics, safety and immunotoxicological aspects. DNA vaccines have the potential to accelerate the research phase of new vaccines and to improve the chances of success, since finding new immunogens with the desired properties is at least technically less demanding than for conventional vaccines. However, on the way to innovative vaccine products, several hurdles have to be overcome. The efficacy of DNA vaccines in humans appears to be much less than indicated by early studies in mice. Open questions remain concerning the persistence and distribution of inoculated plasmid DNA in vivo, its potential to express antigens inappropriately, or the potentially deleterious ability to insert genes into the host cell's genome. Furthermore, the possibility of inducing immunotolerance or autoimmune diseases also needs to be investigated more thoroughly, in order to arrive at a well-founded consensus, which justifies the widespread application of DNA vaccines in a healthy population.

  5. DNA nanotechnology

    Directory of Open Access Journals (Sweden)

    Nadrian C Seeman

    2003-01-01

    We are all aware that the DNA found in cells is a double helix consisting of two antiparallel strands held together by specific hydrogen-bonded base pairs; adenine (A always pairs with thymine (T, and guanine (G always pairs with cytosine (C. The specificity of this base pairing and the ability to ensure that it occurs in this fashion (and not some other1 is key to the use of DNA in materials applications. The double helical arrangement of the two molecules leads to a linear helix axis, linear not in the geometrical sense of being a straight line, but in the topological sense of being unbranched. Genetic engineers discovered in the 1970s how to splice together pieces of DNA to add new genes to DNA molecules2, and synthetic chemists worked out convenient syntheses for short pieces of DNA (up to ∼100–150 units in the 1980s3. Regardless of the impact of these technologies on biological systems, hooking together linear molecules leads only to longer linear molecules, with circles, knots, and catenanes perhaps resulting from time to time.

  6. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  7. Isolation of development-related genes in somatic embryo radicle of carrot (Daucus carota L.) using modified cDNA RDA

    Institute of Scientific and Technical Information of China (English)

    刁丰秋; 张雷; 黄美娟; 吴乃虎

    2000-01-01

    Using modified cDNA RDA capitalizing on the high affinity of streptavidin for biotin and magnetic-absorption-based separation, we have obtained four bands of specifically expressed cDNA in the carrot somatic embryo deregulated for 12 h, which were designated as NR-1, NR-2, NR-3 and NR-4, respectively. As revealed by homology analysis of their DNA sequences after cloning them into pBS, remarkable homology was demonstrated in NR-2, NR-3 and NR-4 with the genes coding for LEA (late embryogenesis abundant protein), Dna J and xyloglucan endo-trans-glycosylase in plants. On the other hand, NR-1 showing no homology with any known sequence may have come from unknown genes. Using 32P-labeled NR-1 as probe, hybridization with cDNA fragment population has shown that we have actually cloned a new gene fragment related to radicle development. As shown by further Southern hybridization, these genes may be present in carrot genome in the form of single or low copies.

  8. DNA nanotechnology

    OpenAIRE

    Seeman, Nadrian C.

    2003-01-01

    Since Watson and Crick’s determination of its structure nearly 50 years ago, DNA has come to fill our lives in many areas, from genetic counseling to forensics, from genomics to gene therapy. These, and other ways in which DNA affects human activities, are related to its function as genetic material, not just our genetic material, but the genetic material of all living organisms. Here, we will ignore DNA’s biological role; rather, we will discuss how the properties that make it so successful ...

  9. Assessment of DNA nucleo base oxidation and antioxidant defense in postmenopausal women under hormone replacement therapy

    Directory of Open Access Journals (Sweden)

    Tülay Akcay

    2010-01-01

    Full Text Available Background and Objective: The aim of the present study was to evaluate oxidative stress byinvesting oxidatively damaged DNA AS Formamidopyrimidine DNA glycosylase (Fpg -sensitive sites, glutathione peroxidase (GPx, superoxide dismutase (SOD activities reduced glutathione (GSH level and nitrite level as satble end product of in women receiving hormone replacement therapy (HRT. Materials and Methods: 127 healthy postmenopausal women receiving HRT and 25 healthy control postmenopausal women were included in this study. Women receiving HRT, comprised surgical menopausal women who underwent surgery for benign conditionsand received conjugated equine estrogen, 0.625 mg/day for 1year (group 1, 5 years (group 2 and more than 10 years (group 3, spontaneous postmenopausal women received conjugated equine estrogen, 0.625 (Premarin mg/day and medroxyprogesterone acetate, 2.5 mg/day (Premelle for 1 year (group 4, 5 years (group 5 and more than 5 years (group 6.We investigated in the present study the effects of HRT on nitrite level and GSH level, activities of SOD and GPx and oxidative damage to DNA by comet assays by measuring levels of Fpg-sensitive sites. Results: Although no significant differences were found in the SOD activities, in total group receiving HRT, increased DNA oxidation (P<0.001 together with an increased GPx activity (P<0.001 and nitrite level (P<0.001 as well as a decreased GSH level (P < 0.05 as compared with controls were observed. Conclusion: Estrogen alone or oestrogen in combination with progesterone and duration of use did not significantly alter the results. We evaluated that caused oxidative stress by investigating oxidative DNA damage as Fp-sensitive sites and GSH.NO levels in women receiving HRT.

  10. Transgenerational inheritance of modified DNA methylation patterns and enhanced tolerance induced by heavy metal stress in rice (Oryza sativa L..

    Directory of Open Access Journals (Sweden)

    Xiufang Ou

    Full Text Available BACKGROUND: DNA methylation is sensitive and responsive to stressful environmental conditions. Nonetheless, the extent to which condition-induced somatic methylation modifications can impose transgenerational effects remains to be fully understood. Even less is known about the biological relevance of the induced epigenetic changes for potentially altered well-being of the organismal progenies regarding adaptation to the specific condition their progenitors experienced. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed DNA methylation pattern by gel-blotting at genomic loci representing transposable elements and protein-coding genes in leaf-tissue of heavy metal-treated rice (Oryza sativa plants (S0, and its three successive organismal generations. We assessed expression of putative genes involved in establishing and/or maintaining DNA methylation patterns by reverse transcription (RT-PCR. We measured growth of the stressed plants and their unstressed progenies vs. the control plants. We found (1 relative to control, DNA methylation patterns were modified in leaf-tissue of the immediately treated plants, and the modifications were exclusively confined to CHG hypomethylation; (2 the CHG-demethylated states were heritable via both maternal and paternal germline, albeit often accompanying further hypomethylation; (3 altered expression of genes encoding for DNA methyltransferases, DNA glycosylase and SWI/SNF chromatin remodeling factor (DDM1 were induced by the stress; (4 progenies of the stressed plants exhibited enhanced tolerance to the same stress their progenitor experienced, and this transgenerational inheritance of the effect of condition accompanying heritability of modified methylation patterns. CONCLUSIONS/SIGNIFICANCE: Our findings suggest that stressful environmental condition can produce transgenerational epigenetic modifications. Progenies of stressed plants may develop enhanced adaptability to the condition, and this acquired trait is

  11. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  12. A TDG/CBP/RARα Ternary Complex Mediates the Retinoic Acid-dependent Expression of DNA Methylation-sensitive Genes

    Directory of Open Access Journals (Sweden)

    Hélène Léger

    2014-02-01

    Full Text Available The thymine DNA glycosylase (TDG is a multifunctional enzyme, which is essential for embryonic development. It mediates the base excision repair (BER of G:T and G:U DNA mismatches arising from the deamination of 5-methyl cytosine (5-MeC and cytosine, respectively. Recent studies have pointed at a role of TDG during the active demethylation of 5-MeC within CpG islands. TDG interacts with the histone acetylase CREB-binding protein (CBP to activate CBP-dependent transcription. In addition, TDG also interacts with the retinoic acid receptor α (RARα, resulting in the activation of RARα target genes. Here we provide evidence for the existence of a functional ternary complex containing TDG, CBP and activated RARα. Using global transcriptome profiling, we uncover a coupling of de novo methylation-sensitive and RA-dependent transcription, which coincides with a significant subset of CBP target genes. The introduction of a point mutation in TDG, which neither affects overall protein structure nor BER activity, leads to a significant loss in ternary complex stability, resulting in the deregulation of RA targets involved in cellular networks associated with DNA replication, recombination and repair. We thus demonstrate for the first time a direct coupling of TDG’s epigenomic and transcription regulatory function through ternary complexes with CBP and RARα.

  13. The effect of zinc sulphate and zinc carnosine on genome stability and cytotoxicity in the WIL2-NS human lymphoblastoid cell line.

    Science.gov (United States)

    Sharif, Razinah; Thomas, Philip; Zalewski, Peter; Graham, Robin D; Fenech, Michael

    2011-02-28

    Zinc (Zn) is an essential cofactor required by numerous enzymes that are essential for cell metabolism and the maintenance of DNA integrity. We investigated the effect of Zn deficiency or excess on genomic instability events and determined the optimal concentration of two Zn compounds that minimize DNA-damage events. The effects of Zn sulphate (ZnSO(4)) and Zn carnosine (ZnC) on cell proliferation were investigated in the WIL2-NS human lymphoblastoid cell line. DNA damage was determined by the use of both the comet assay and the cytokinesis-block micronucleus cytome (CBMN-Cyt) assay. Zn-deficient medium (0μM) was produced using Chelex treatment, and the two Zn compounds (i.e. ZnSO(4) and ZnC) were tested at concentrations of 0.0, 0.4, 4.0, 16.0, 32.0 and 100.0μM. Results from an MTT assay showed that cell growth and viability were decreased in Zn-depleted cells (0μM) as well as at 32μM and 100μM for both Zn compounds (P<0.0001). DNA strand-breaks, as measured by the comet assay, were found to be increased in Zn-depleted cells compared with the other treatment groups (P<0.05). The CBMN-Cyt assay showed a significant increase in the frequency of both apoptotic and necrotic cells under Zn-deficient conditions (P<0.0001). Elevated frequencies of micronuclei (MNi), nucleoplasmic bridges (NPBs) and nuclear buds (NBuds) were induced in Zn-depleted cells (P<0.0001), whereas genome damage was reduced in supplemented cultures for both Zn compounds at 4μM and 16μM, possibly suggesting that these concentrations may be optimal for genome stability. The potential protective effect of ZnSO(4) and ZnC was also investigated following exposure to 1.0Gy γ-radiation. Culture in medium containing these compounds at 4-32μM prior to irradiation displayed significantly reduced frequencies of MNi, NPBs and NBuds compared with cells maintained in 0μM medium (P<0.0001). Expression of γ-H2AX and 8-oxoguanine glycosylase measured by western blotting was increased in Zn

  14. Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance

    Directory of Open Access Journals (Sweden)

    Keeney Paula M

    2009-09-01

    Full Text Available Abstract Background Sporadic Parkinson's disease (sPD is a nervous system-wide disease that presents with a bradykinetic movement disorder and is frequently complicated by depression and cognitive impairment. sPD likely has multiple interacting causes that include increased oxidative stress damage to mitochondrial components and reduced mitochondrial bioenergetic capacity. We analyzed mitochondria from postmortem sPD and CTL brains for evidence of oxidative damage to mitochondrial DNA (mtDNA, heteroplasmic mtDNA point mutations and levels of electron transport chain proteins. We sought to determine if sPD brains possess any mtDNA genotype-respiratory phenotype relationships. Results Treatment of sPD brain mtDNA with the mitochondrial base-excision repair enzyme 8-oxyguanosine glycosylase-1 (hOGG1 inhibited, in an age-dependent manner, qPCR amplification of overlapping ~2 kbase products; amplification of CTL brain mtDNA showed moderate sensitivity to hOGG1 not dependent on donor age. hOGG1 mRNA expression was not different between sPD and CTL brains. Heteroplasmy analysis of brain mtDNA using Surveyor nuclease® showed asymmetric distributions and levels of heteroplasmic mutations across mtDNA but no patterns that statistically distinguished sPD from CTL. sPD brain mitochondria displayed reductions of nine respirasome proteins (respiratory complexes I-V. Reduced levels of sPD brain mitochondrial complex II, III and V, but not complex I or IV proteins, correlated closely with rates of NADH-driven electron flow. mtDNA levels and PGC-1α expression did not differ between sPD and CTL brains. Conclusion PD brain mitochondria have reduced mitochondrial respiratory protein levels in complexes I-V, implying a generalized defect in respirasome assembly. These deficiencies do not appear to arise from altered point mutational burden in mtDNA or reduction of nuclear signaling for mitochondrial biogenesis, implying downstream etiologies. The origin of age

  15. Effects of melatonin on DNA damage induced by cyclophosphamide in rats

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, S.G.; Peliciari-Garcia, R.A. [Departamento de Fisiologia e Biofísica, Instituto de Ciências Biomédicas I, Universidade de São Paulo, São Paulo, SP (Brazil); Takahashi-Hyodo, S.A. [Área de Ciências da Saúde, Universidade Braz Cubas, Mogi das Cruzes, SP (Brazil); Rodrigues, A.C. [Departamento de Análises Clínicas e Toxicológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, São Paulo, SP (Brazil); Amaral, F.G. [Departamento de Fisiologia e Biofísica, Instituto de Ciências Biomédicas I, Universidade de São Paulo, São Paulo, SP (Brazil); Berra, C.M. [Departamento de Microbiologia, Instituto de Ciências Biomédicas II, Universidade de São Paulo, São Paulo, SP (Brazil); Bordin, S.; Curi, R.; Cipolla-Neto, J. [Departamento de Fisiologia e Biofísica, Instituto de Ciências Biomédicas I, Universidade de São Paulo, São Paulo, SP (Brazil)

    2013-03-08

    The antioxidant and free radical scavenger properties of melatonin have been well described in the literature. In this study, our objective was to determine the protective effect of the pineal gland hormone against the DNA damage induced by cyclophosphamide (CP), an anti-tumor agent that is widely applied in clinical practice. DNA damage was induced in rats by a single intraperitoneal injection of CP (20 or 50 mg/kg). Animals received melatonin during the dark period for 15 days (1 mg/kg in the drinking water). Rat bone marrow cells were used for the determination of chromosomal aberrations and of formamidopyrimidine DNA glycosylase enzyme (Fpg)-sensitive sites by the comet technique and of Xpf mRNA expression by qRT-PCR. The number (mean ± SE) of chromosomal aberrations in pinealectomized (PINX) animals treated with melatonin and CP (2.50 ± 0.50/100 cells) was lower than that obtained for PINX animals injected with CP (12 ± 1.8/100 cells), thus showing a reduction of 85.8% in the number of chromosomal aberrations. This melatonin-mediated protection was also observed when oxidative lesions were analyzed by the Fpg-sensitive assay, both 24 and 48 h after CP administration. The expression of Xpf mRNA, which is involved in the DNA nucleotide excision repair machinery, was up-regulated by melatonin. The results indicate that melatonin is able to protect bone marrow cells by completely blocking CP-induced chromosome aberrations. Therefore, melatonin administration could be an alternative and effective treatment during chemotherapy.

  16. Effects of melatonin on DNA damage induced by cyclophosphamide in rats

    Directory of Open Access Journals (Sweden)

    S.G. Ferreira

    2013-08-01

    Full Text Available The antioxidant and free radical scavenger properties of melatonin have been well described in the literature. In this study, our objective was to determine the protective effect of the pineal gland hormone against the DNA damage induced by cyclophosphamide (CP, an anti-tumor agent that is widely applied in clinical practice. DNA damage was induced in rats by a single intraperitoneal injection of CP (20 or 50 mg/kg. Animals received melatonin during the dark period for 15 days (1 mg/kg in the drinking water. Rat bone marrow cells were used for the determination of chromosomal aberrations and of formamidopyrimidine DNA glycosylase enzyme (Fpg-sensitive sites by the comet technique and of Xpf mRNA expression by qRT-PCR. The number (mean ± SE of chromosomal aberrations in pinealectomized (PINX animals treated with melatonin and CP (2.50 ± 0.50/100 cells was lower than that obtained for PINX animals injected with CP (12 ± 1.8/100 cells, thus showing a reduction of 85.8% in the number of chromosomal aberrations. This melatonin-mediated protection was also observed when oxidative lesions were analyzed by the Fpg-sensitive assay, both 24 and 48 h after CP administration. The expression of Xpf mRNA, which is involved in the DNA nucleotide excision repair machinery, was up-regulated by melatonin. The results indicate that melatonin is able to protect bone marrow cells by completely blocking CP-induced chromosome aberrations. Therefore, melatonin administration could be an alternative and effective treatment during chemotherapy.

  17. Effects of melatonin on DNA damage induced by cyclophosphamide in rats

    International Nuclear Information System (INIS)

    The antioxidant and free radical scavenger properties of melatonin have been well described in the literature. In this study, our objective was to determine the protective effect of the pineal gland hormone against the DNA damage induced by cyclophosphamide (CP), an anti-tumor agent that is widely applied in clinical practice. DNA damage was induced in rats by a single intraperitoneal injection of CP (20 or 50 mg/kg). Animals received melatonin during the dark period for 15 days (1 mg/kg in the drinking water). Rat bone marrow cells were used for the determination of chromosomal aberrations and of formamidopyrimidine DNA glycosylase enzyme (Fpg)-sensitive sites by the comet technique and of Xpf mRNA expression by qRT-PCR. The number (mean ± SE) of chromosomal aberrations in pinealectomized (PINX) animals treated with melatonin and CP (2.50 ± 0.50/100 cells) was lower than that obtained for PINX animals injected with CP (12 ± 1.8/100 cells), thus showing a reduction of 85.8% in the number of chromosomal aberrations. This melatonin-mediated protection was also observed when oxidative lesions were analyzed by the Fpg-sensitive assay, both 24 and 48 h after CP administration. The expression of Xpf mRNA, which is involved in the DNA nucleotide excision repair machinery, was up-regulated by melatonin. The results indicate that melatonin is able to protect bone marrow cells by completely blocking CP-induced chromosome aberrations. Therefore, melatonin administration could be an alternative and effective treatment during chemotherapy

  18. Relation between DNA damage measured by comet assay and OGG1 Ser326Cys polymorphism in antineoplastic drugs biomonitoring

    Directory of Open Access Journals (Sweden)

    Carina Ladeira

    2015-09-01

    Full Text Available Antineoplastic drugs are hazardous chemical agents used mostly in the treatment of patients with cancer, however health professionals that handle and administer these drugs can become exposed and develop DNA damage. Comet assay is a standard method for assessing DNA damage in human biomonitoring and, combined with formamidopyrimidine DNA glycosylase (FPG enzyme, it specifically detects DNA oxidative damage. The aim of this study was to investigate genotoxic effects in workers occupationally exposed to cytostatics (n = 46, as compared to a control group with no exposure (n = 46 at two Portuguese hospitals, by means of the alkaline comet assay. The potential of the OGG1 Ser326Cys polymorphism as a susceptibility biomarker was also investigated. Exposure was evaluated by investigating the contamination of surfaces and genotoxic assessment was done by alkaline comet assay in peripheral blood lymphocytes. OGG1 Ser326Cys (rs1052133 polymorphism was studied by Real Time PCR. As for exposure assessment, there were 121 (37% positive samples out of a total of 327 samples analysed from both hospitals. No statistically significant differences (Mann-Whitney test, p > 0.05 were found between subjects with and without exposure, regarding DNA damage and oxidative DNA damage, nevertheless the exposed group exhibited higher values. Moreover, there was no consistent trend regarding the variation of both biomarkers as assessed by comet assay with OGG1 polymorphism. Our study was not statistically significant regarding occupational exposure to antineoplastic drugs and genetic damage assessed by comet assay. However, health professionals should be monitored for risk behaviour, in order to ensure that safety measures are applied and protection devices are used correctly.

  19. Relation between DNA damage measured by comet assay and OGG1 Ser326Cys polymorphism in antineoplastic drugs biomonitoring

    Directory of Open Access Journals (Sweden)

    Carina Ladeira

    2015-09-01

    Full Text Available Antineoplastic drugs are hazardous chemical agents used mostly in the treatment of patients with cancer, however health professionals that handle and administer these drugs can become exposed and develop DNA damage. Comet assay is a standard method for assessing DNA damage in human biomonitoring and, combined with formamidopyrimidine DNA glycosylase (FPG enzyme, it specifically detects DNA oxidative damage.The aim of this study was to investigate genotoxic effects in workers occupationally exposed to cytostatics (n = 46, as compared to a control group with no exposure (n = 46 at two Portuguese hospitals, by means of the alkaline comet assay. The potential of the OGG1 Ser326Cys polymorphism as a susceptibility biomarker was also investigated. Exposure was evaluated by investigating the contamination of surfaces and genotoxic assessment was done by alkaline comet assay in peripheral blood lymphocytes. OGG1 Ser326Cys (rs1052133 polymorphism was studied by Real Time PCR.As for exposure assessment, there were 121 (37% positive samples out of a total of 327 samples analysed from both hospitals. No statistically significant differences (Mann-Whitney test, p > 0.05 were found between subjects with and without exposure, regarding DNA damage and oxidative DNA damage, nevertheless the exposed group exhibited higher values. Moreover, there was no consistent trend regarding the variation of both biomarkers as assessed by comet assay with OGG1 polymorphism.Our study was not statistically significant regarding occupational exposure to antineoplastic drugs and genetic damage assessed by comet assay. However, health professionals should be monitored for risk behaviour, in order to ensure that safety measures are applied and protection devices are used correctly.

  20. Lung Cancer Susceptibility and hOGG1 Ser326Cys Polymorphism: A Meta-Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Kiyohara, Chikako, E-mail: chikako@phealth.med.kyushu-u.ac.jp [Department of Preventive Medicine, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Takayama, Koichi; Nakanishi, Yoichi [Research Institute for Diseases of the Chest, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)

    2010-10-28

    Recent lung cancer studies have focused on identifying the effects of single nucleotide polymorphisms (SNPs) in candidate genes, among which DNA repair genes are increasingly being studied. Genetic variations in DNA repair genes are thought to modulate DNA repair capacity and are suggested to be related to lung cancer risk. In this study, we tried to assess reported studies of association between polymorphism of human 8-oxoguanine DNA glycosylase 1 (hOGG1) Ser326Cys and lung cancer. We conducted MEDLINE, Current Contents and Web of Science searches using 'hOGG1', 'lung cancer' and 'polymorphism' as keywords to search for papers published (from January 1995 through August 2010). Data were combined using both a fixed effects (the inverse variance-weighted method) and a random effects (DerSimonian and Laird method) models. The Cochran Q test was used for the assessment of heterogeneity. Publication bias was assessed by both Begg’s and Egger’s tests. We identified 20 case-control studies in 21 different ethnic populations. As two studies were not in the Hardy-Weinberg equilibrium, 18 case-control studies in 19 different ethnic populations (7,792 cases and 9,358 controls) were included in our meta-analysis. Summary frequencies of the Cys allele among Caucasians and Asians based on the random effects model were 20.9% (95% confidence interval (CI) = 18.9–22.9) and 46.1% (95% CI = 40.2–52.0), respectively. The distribution of the Cys allele was significantly different between Asians and Caucasians (P < 0.001). The Cys/Cys genotype was significantly associated with lung cancer risk in Asian populations (odds ratio = 1.27, 95% CI = 1.09–1.48) but not in Caucasian populations. This ethnic difference in lung cancer risk may be due to environmental factors such as cigarette smoking and dietary factors. Although the summary risk for developing lung cancer may not be large, lung cancer is such a common malignancy that even a small increase

  1. Metformin inhibits 7,12-dimethylbenz[a]anthracene-induced breast carcinogenesis and adduct formation in human breast cells by inhibiting the cytochrome P4501A1/aryl hydrocarbon receptor signaling pathway

    International Nuclear Information System (INIS)

    Recent studies have established that metformin (MET), an oral anti-diabetic drug, possesses antioxidant activity and is effective against different types of cancer in several carcinogen-induced animal models and cell lines. However, whether MET can protect against breast cancer has not been reported before. Therefore, the overall objectives of the present study are to elucidate the potential chemopreventive effect of MET in non-cancerous human breast MCF10A cells and explore the underlying mechanism involved, specifically the role of cytochrome P4501A1 (CYP1A1)/aryl hydrocarbon receptor (AhR) pathway. Transformation of the MCF10A cells into initiated breast cancer cells with DNA adduct formation was conducted using 7,12-dimethylbenz[a]anthracene (DMBA), an AhR ligand. The chemopreventive effect of MET against DMBA-induced breast carcinogenesis was evidenced by the capability of MET to restore the induction of the mRNA levels of basic excision repair genes, 8-oxoguanine DNA glycosylase (OGG1) and apurinic/apyrimidinic endonuclease1 (APE1), and the level of 8-hydroxy-2-deoxyguanosine (8-OHdG). Interestingly, the inhibition of DMBA-induced DNA adduct formation was associated with proportional decrease in CYP1A1 and in NAD(P)H:quinone oxidoreductase 1 (NQO1) gene expression. Mechanistically, the involvements of AhR and nuclear factor erythroid 2-related factor-2 (Nrf2) in the MET-mediated inhibition of DMBA-induced CYP1A1 and NQO1 gene expression were evidenced by the ability of MET to inhibit DMBA-induced xenobiotic responsive element and antioxidant responsive element luciferase reporter gene expression which suggests an AhR- and Nrf2-dependent transcriptional control. However, the inability of MET to bind to AhR suggests that MET is not an AhR ligand. In conclusion, the present work shows a strong evidence that MET inhibits the DMBA-mediated carcinogenicity and adduct formation by inhibiting the expression of CYP1A1 through an AhR ligand-independent mechanism

  2. Metformin inhibits 7,12-dimethylbenz[a]anthracene-induced breast carcinogenesis and adduct formation in human breast cells by inhibiting the cytochrome P4501A1/aryl hydrocarbon receptor signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Maayah, Zaid H. [Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451 (Saudi Arabia); Ghebeh, Hazem [Stem Cell & Tissue Re-Engineering, King Faisal Specialist Hospital and Research Center, Riyadh 11211 (Saudi Arabia); Alhaider, Abdulqader A. [Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451 (Saudi Arabia); Camel Biomedical Research Unit, College of Pharmacy and Medicine, King Saud University, Riyadh 11451 (Saudi Arabia); El-Kadi, Ayman O.S. [Faculty of Pharmacy & Pharmaceutical Sciences, University of Alberta, Edmonton (Canada); Soshilov, Anatoly A.; Denison, Michael S. [Department of Environmental Toxicology, University of California at Davis, Davis, CA 95616 (United States); Ansari, Mushtaq Ahmad [Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451 (Saudi Arabia); Korashy, Hesham M., E-mail: hkorashy@ksu.edu.sa [Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451 (Saudi Arabia)

    2015-04-15

    Recent studies have established that metformin (MET), an oral anti-diabetic drug, possesses antioxidant activity and is effective against different types of cancer in several carcinogen-induced animal models and cell lines. However, whether MET can protect against breast cancer has not been reported before. Therefore, the overall objectives of the present study are to elucidate the potential chemopreventive effect of MET in non-cancerous human breast MCF10A cells and explore the underlying mechanism involved, specifically the role of cytochrome P4501A1 (CYP1A1)/aryl hydrocarbon receptor (AhR) pathway. Transformation of the MCF10A cells into initiated breast cancer cells with DNA adduct formation was conducted using 7,12-dimethylbenz[a]anthracene (DMBA), an AhR ligand. The chemopreventive effect of MET against DMBA-induced breast carcinogenesis was evidenced by the capability of MET to restore the induction of the mRNA levels of basic excision repair genes, 8-oxoguanine DNA glycosylase (OGG1) and apurinic/apyrimidinic endonuclease1 (APE1), and the level of 8-hydroxy-2-deoxyguanosine (8-OHdG). Interestingly, the inhibition of DMBA-induced DNA adduct formation was associated with proportional decrease in CYP1A1 and in NAD(P)H:quinone oxidoreductase 1 (NQO1) gene expression. Mechanistically, the involvements of AhR and nuclear factor erythroid 2-related factor-2 (Nrf2) in the MET-mediated inhibition of DMBA-induced CYP1A1 and NQO1 gene expression were evidenced by the ability of MET to inhibit DMBA-induced xenobiotic responsive element and antioxidant responsive element luciferase reporter gene expression which suggests an AhR- and Nrf2-dependent transcriptional control. However, the inability of MET to bind to AhR suggests that MET is not an AhR ligand. In conclusion, the present work shows a strong evidence that MET inhibits the DMBA-mediated carcinogenicity and adduct formation by inhibiting the expression of CYP1A1 through an AhR ligand-independent mechanism

  3. Lung Cancer Susceptibility and hOGG1 Ser326Cys Polymorphism: A Meta-Analysis

    International Nuclear Information System (INIS)

    Recent lung cancer studies have focused on identifying the effects of single nucleotide polymorphisms (SNPs) in candidate genes, among which DNA repair genes are increasingly being studied. Genetic variations in DNA repair genes are thought to modulate DNA repair capacity and are suggested to be related to lung cancer risk. In this study, we tried to assess reported studies of association between polymorphism of human 8-oxoguanine DNA glycosylase 1 (hOGG1) Ser326Cys and lung cancer. We conducted MEDLINE, Current Contents and Web of Science searches using 'hOGG1', 'lung cancer' and 'polymorphism' as keywords to search for papers published (from January 1995 through August 2010). Data were combined using both a fixed effects (the inverse variance-weighted method) and a random effects (DerSimonian and Laird method) models. The Cochran Q test was used for the assessment of heterogeneity. Publication bias was assessed by both Begg’s and Egger’s tests. We identified 20 case-control studies in 21 different ethnic populations. As two studies were not in the Hardy-Weinberg equilibrium, 18 case-control studies in 19 different ethnic populations (7,792 cases and 9,358 controls) were included in our meta-analysis. Summary frequencies of the Cys allele among Caucasians and Asians based on the random effects model were 20.9% (95% confidence interval (CI) = 18.9–22.9) and 46.1% (95% CI = 40.2–52.0), respectively. The distribution of the Cys allele was significantly different between Asians and Caucasians (P < 0.001). The Cys/Cys genotype was significantly associated with lung cancer risk in Asian populations (odds ratio = 1.27, 95% CI = 1.09–1.48) but not in Caucasian populations. This ethnic difference in lung cancer risk may be due to environmental factors such as cigarette smoking and dietary factors. Although the summary risk for developing lung cancer may not be large, lung cancer is such a common malignancy that even a small increase

  4. Genetic polymorphism in hOGG1 is associated with triple-negative breast cancer risk in Chinese Han women.

    Science.gov (United States)

    Xie, Hui; Xia, Kai; Rong, Hui; Chen, Xiaoxiang

    2013-10-01

    8-hydroxy-2'-deoxyguanine (8-OHdG), a typical product of oxidative stress-induced DNA damage, can cause a G-T transversion during DNA replication if it is not removed. Human 8-oxoguanine glycosylase 1 (hOGG1), a key DNA repair gene, recognizes and excises 8-OHdG from damaged DNA accurately; however, a c.977C>G (Ser326Cys) polymorphism in hOGG1 can inhibit the gene's ability to remove 8-OHdG. The aim of present study was to investigate the association between the c.977C>G polymorphism in hOGG1 and the risk of breast cancer in Chinese Han women. We used high-resolution melting and sequencing to analyze the genotypes of 630 patients with sporadic breast cancer patients and 777 healthy controls. We also performed risk-stratified subgroup analyses to determine the association between the c.977C>G polymorphism and other characteristics of breast cancer subgroups. Breast cancer patients and healthy controls did not have significantly different of c.977C/G genotypes (odds ratio [OR] = 1.10, 95% confidence interval [CI] = 0.82-1.49, p = 0.57) and c.977G/G genotypes (OR = 1.34, 95% CI = 0.97-1.84, p = 0.09). However, the c.977G/G genotype was especially prevalent in breast cancer patients who were younger than 55 years (OR = 1.58, 95% CI = 1.05-2.39, p = 0.04), were premenopausal status (OR = 1.87, 95% CI = 1.14-3.06, p = 0.02), had triple-negative disease (OR = 2.14, 95% CI = 1.06-4.29, p = 0.04), or p53-positive disease (OR = 1.56, 95% CI = 1.14-2.12, p = 0.005). These findings suggest that the c.977C>G polymorphism in hOGG1 is associated with an increased risk of breast cancer in Chinese Han women who are younger than 55 years, premenopausal, triple-negative, or p53-positive subgroups.

  5. DNA Microarrays

    Science.gov (United States)

    Nguyen, C.; Gidrol, X.

    Genomics has revolutionised biological and biomedical research. This revolution was predictable on the basis of its two driving forces: the ever increasing availability of genome sequences and the development of new technology able to exploit them. Up until now, technical limitations meant that molecular biology could only analyse one or two parameters per experiment, providing relatively little information compared with the great complexity of the systems under investigation. This gene by gene approach is inadequate to understand biological systems containing several thousand genes. It is essential to have an overall view of the DNA, RNA, and relevant proteins. A simple inventory of the genome is not sufficient to understand the functions of the genes, or indeed the way that cells and organisms work. For this purpose, functional studies based on whole genomes are needed. Among these new large-scale methods of molecular analysis, DNA microarrays provide a way of studying the genome and the transcriptome. The idea of integrating a large amount of data derived from a support with very small area has led biologists to call these chips, borrowing the term from the microelectronics industry. At the beginning of the 1990s, the development of DNA chips on nylon membranes [1, 2], then on glass [3] and silicon [4] supports, made it possible for the first time to carry out simultaneous measurements of the equilibrium concentration of all the messenger RNA (mRNA) or transcribed RNA in a cell. These microarrays offer a wide range of applications, in both fundamental and clinical research, providing a method for genome-wide characterisation of changes occurring within a cell or tissue, as for example in polymorphism studies, detection of mutations, and quantitative assays of gene copies. With regard to the transcriptome, it provides a way of characterising differentially expressed genes, profiling given biological states, and identifying regulatory channels.

  6. The Beneficial Effects of Renal Transplantation on Altered Oxidative Status of ESRD Patients

    Science.gov (United States)

    Cerrillos-Gutiérrez, José Ignacio; Preciado-Rojas, Priscila; Gómez-Navarro, Benjamín; Sifuentes-Franco, Sonia; Carrillo-Ibarra, Sandra; Andrade-Sierra, Jorge; Rojas-Campos, Enrique; Cueto-Manzano, Alfonso Martín

    2016-01-01

    Renal transplantation (RT), has been considered the best therapeutic option for end stage renal disease (ESRD). Objective. To determine the effect of RT on the evolution of oxidative DNA status. Methods. Prospective cohort (N = 50 receptors of RT); genotoxic damage, 8-hydroxy-2′-deoxyguanosine (8-OHdG), and DNA repair enzyme, human 8-oxoguanine-DNA-N- glycosylase-1 (hOGG1); and antioxidants, superoxide dismutase (SOD) and glutathione peroxidase (GPx), were evaluated. Results. Before RT, 8-OHdG were significantly elevated (11.04 ± 0.90 versus 4.73 ± 0.34 ng/mL) compared to healthy controls (p = 0.001), with normalization after 6 months of 4.78 ± 0.34 ng/mL (p < 0.001). The same phenomenon was observed with hOGG1 enzyme before RT with 2.14 ± 0.36 ng/mL (p = 0.01) and decreased significantly at the end of the study to 1.20 ng/mL (p < 0.001) but was higher than controls, 0.51 ± 0.07 ng/mL (p < 0.03). Antioxidant SOD was elevated at 24.09 ± 1.6 IU/mL versus healthy controls (p = 0.001) before RT; however, 6 months after RT it decreased significantly to 16.9 ± 1.6 IU/mL (p = 0.002), without achieving the levels of healthy controls (p = 0.01). The GPx, before RT, was significantly diminished with 24.09 ± 1.6 IU/mL versus healthy controls (39.0 ± 1.58) (p = 0.01), while, in the final results, levels increased significantly to 30.38 ± 3.16 IU/mL (p = 0.001). Discussion. Patients with ESRD have important oxidative damage before RT. The RT significantly reduces oxidative damage and partially regulates the antioxidant enzymes (SOD and GPx). PMID:27547292

  7. Isolated and clustered DNA lesions induced by high-energy iron and carbon ions

    Science.gov (United States)

    Ide, H.; Tanaka, R.; Nakaarai, Y.; Terato, H.; Furusawa, Y.

    and DNA glycosylase-induced DSB.

  8. Spaceflight induces both transient and heritable alterations in DNA methylation and gene expression in rice (Oryza sativa L.)

    International Nuclear Information System (INIS)

    Spaceflight represents a complex environmental condition in which several interacting factors such as cosmic radiation, microgravity and space magnetic fields are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic as well as external perturbations, it is conceivable that epigenetic markers like DNA methylation may undergo alterations in response to spaceflight. We report here that extensive alteration in both DNA methylation and gene expression occurred in rice plants subjected to a spaceflight, as revealed by a set of characterized sequences including 6 transposable elements (TEs) and 11 cellular genes. We found that several features characterize the alterations: (1) All detected alterations are hypermethylation events; (2) whereas alteration in both CG and CNG methylation occurred in the TEs, only alteration in CNG methylation occurred in the cellular genes; (3) alteration in expression includes both up- and down-regulations, which did not show a general correlation with alteration in methylation; (4) altered methylation patterns in both TEs and cellular genes are heritable to progenies at variable frequencies; however, stochastic reversion to wild-type patterns and further de novo changes in progenies are also apparent; and (5) the altered expression states in both TEs and cellular genes are also heritable to selfed progenies but with markedly lower transmission frequencies than altered DNA methylation states. Furthermore, we found that a set of genes encoding for the various putative DNA methyltransferases, 5-methylcytosine DNA glycosylases, the SWI/SNF chromatin remodeller (DDM1) and siRNA-related proteins are extremely sensitive to perturbation by spaceflight, which might be an underlying cause for the altered methylation patterns in the space-flown plants. We discuss implications of spaceflight-induced epigenetic variations with regard to health safety

  9. Benzene-derived N2-(4-hydroxyphenyl)-deoxyguanosine adduct: UvrABC incision and its conformation in DNA

    Energy Technology Data Exchange (ETDEWEB)

    Hang, Bo; Rodriguez, Ben; Yang, Yanu; Guliaev, Anton B.; Chenna, Ahmed

    2010-06-14

    Benzene, a ubiquitous human carcinogen, forms DNA adducts through its metabolites such as p-benzoquinone (p-BQ) and hydroquinone (HQ). N(2)-(4-Hydroxyphenyl)-2'-deoxyguanosine (N(2)-4-HOPh-dG) is the principal adduct identified in vivo by (32)P-postlabeling in cells or animals treated with p-BQ or HQ. To study its effect on repair specificity and replication fidelity, we recently synthesized defined oligonucleotides containing a site-specific adduct using phosphoramidite chemistry. We here report the repair of this adduct by Escherichia coli UvrABC complex, which performs the initial damage recognition and incision steps in the nucleotide excision repair (NER) pathway. We first showed that the p-BQ-treated plasmid was efficiently cleaved by the complex, indicating the formation of DNA lesions that are substrates for NER. Using a 40-mer substrate, we found that UvrABC incises the DNA strand containing N(2)-4-HOPh-dG in a dose- and time-dependent manner. The specificity of such repair was also compared with that of DNA glycosylases and damage-specific endonucleases of E. coli, both of which were found to have no detectable activity toward N(2)-4-HOPh-dG. To understand why this adduct is specifically recognized and processed by UvrABC, molecular modeling studies were performed. Analysis of molecular dynamics trajectories showed that stable G:C-like hydrogen bonding patterns of all three Watson-Crick hydrogen bonds are present within the N(2)-4-HOPh-G:C base pair, with the hydroxyphenyl ring at an almost planar position. In addition, N(2)-4-HOPh-dG has a tendency to form more stable stacking interactions than a normal G in B-type DNA. These conformational properties may be critical in differential recognition of this adduct by specific repair enzymes.

  10. Novel mechanism of regulation of the DNA repair enzyme OGG1 in tuberin-deficient cells

    Science.gov (United States)

    Habib, Samy L.; Bhandari, Besant K.; Sadek, Nahed; Abboud-Werner, Sherry L.; Abboud, Hanna E.

    2010-01-01

    Tuberin (protein encodes by tuberous sclerosis complex 2, Tsc2) deficiency is associated with the decrease in the DNA repair enzyme 8-oxoG-DNA glycosylase (OGG1) in tumour kidney of tuberous sclerosis complex (TSC) patients. The purpose of this study was to elucidate the mechanisms by which tuberin regulates OGG1. The partial deficiency in tuberin expression that occurs in the renal proximal tubular cells and kidney cortex of the Eker rat is associated with decreased activator protein 4 (AP4) and OGG1 expression. A complete deficiency in tuberin is associated with loss of AP4 and OGG1 expression in kidney tumour from Eker rats and the accumulation of significant levels of 8-oxo-deoxyguanosine. Knockdown of tuberin expression in human renal epithelial cells (HEK293) with small interfering RNA (siRNA) also resulted in a marked decrease in the expression of AP4 and OGG1. In contrast, overexpression of tuberin in HEK293 cells increased the expression of AP4 and OGG1 proteins. Downregulation of AP4 expression using siRNA resulted in a significant decrease in the protein expression of OGG1. Immunoprecipitation studies show that AP4 is associated with tuberin in cells. Gel shift analysis and chromatin immunoprecipitation identified the transcription factor AP4 as a positive regulator of the OGG1 promoter. AP4 DNA-binding activity is significantly reduced in Tsc2−/− as compared with Tsc2+/+ cells. Transcriptional activity of the OGG1 promoter is also decreased in tuberin-null cells compared with wild-type cells. These data indicate a novel role for tuberin in the regulation of OGG1 through the transcription factor AP4. This regulation may be important in the pathogenesis of kidney tumours in patients with TSC disease. PMID:20837600

  11. The effect of selenium supplementation in the prevention of DNA damage in white blood cells of hemodialyzed patients: a pilot study.

    Science.gov (United States)

    Zachara, Bronislaw A; Gromadzinska, Jolanta; Palus, Jadwiga; Zbrog, Zbigniew; Swiech, Rafal; Twardowska, Ewa; Wasowicz, Wojciech

    2011-09-01

    Patients with chronic kidney disease (CKD) have an increased incidence of cancer. It is well known that long periods of hemodialysis (HD) treatment are linked to DNA damage due to oxidative stress. In this study, we examined the effect of selenium (Se) supplementation to CKD patients on HD on the prevention of oxidative DNA damage in white blood cells. Blood samples were drawn from 42 CKD patients on HD (at the beginning of the study and after 1 and 3 months) and from 30 healthy controls. Twenty-two patients were supplemented with 200 μg Se (as Se-rich yeast) per day and 20 with placebo (baker's yeast) for 3 months. Se concentration in plasma and DNA damage in white blood cells expressed as the tail moment, including single-strand breaks (SSB) and oxidative bases lesion in DNA, using formamidopyrimidine glycosylase (FPG), were measured. Se concentration in patients was significantly lower than in healthy subjects (P < 0.0001) and increased significantly after 3 months of Se supplementation (P < 0.0001). Tail moment (SSB) in patients before the study was three times higher than in healthy subjects (P < 0.01). After 3 months of Se supplementation, it decreased significantly (P < 0.01) and was about 16% lower than in healthy subjects. The oxidative bases lesion in DNA (tail moment, FPG) of HD patients at the beginning of the study was significantly higher (P < 0.01) compared with controls, and 3 months after Se supplementation it was 2.6 times lower than in controls (P < 0.01). No changes in tail moment was observed in the placebo group. In conclusion, our study shows that in CKD patients on HD, DNA damage in white blood cells is higher than in healthy controls, and Se supplementation prevents the damage of DNA. PMID:20661660

  12. Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

    Energy Technology Data Exchange (ETDEWEB)

    Hata, Kuniki [Department of Nuclear Engineering and Management, School of Engineering, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Advanced Science Research Center, Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Urushibara, Ayumi; Yamashita, Shinichi; Shikazono, Naoya; Yokoya, Akinari [Advanced Science Research Center, Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Katsumura, Yosuke, E-mail: katsu@n.t.u-tokyo.ac.jp [Department of Nuclear Engineering and Management, School of Engineering, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Nuclear Professional School, School of Engineering, The University of Tokyo, 2-22 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1188 (Japan)

    2013-05-03

    Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield of DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems.

  13. Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

    International Nuclear Information System (INIS)

    Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield of DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems

  14. Sperm DNA oxidative damage and DNA adducts.

    Science.gov (United States)

    Jeng, Hueiwang Anna; Pan, Chih-Hong; Chao, Mu-Rong; Lin, Wen-Yi

    2015-12-01

    The objective of this study was to investigate DNA damage and adducts in sperm from coke oven workers who have been exposed to polycyclic aromatic hydrocarbons. A longitudinal study was conducted with repeated measurements during spermatogenesis. Coke-oven workers (n=112) from a coke-oven plant served the PAH-exposed group, while administrators and security personnel (n=67) served the control. Routine semen parameters (concentration, motility, vitality, and morphology) were analyzed simultaneously; the assessment of sperm DNA integrity endpoints included DNA fragmentation, bulky DNA adducts, and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dGuo). The degree of sperm DNA fragmentation was measured using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay and sperm chromatin structure assay (SCSA). The PAH-exposed group had a significant increase in bulky DNA adducts and 8-oxo-dGuo compared to the control subjects (Ps=0.002 and 0.045, respectively). Coke oven workers' percentages of DNA fragmentation and denaturation from the PAH-exposed group were not significantly different from those of the control subjects (Ps=0.232 and 0.245, respectively). Routine semen parameters and DNA integrity endpoints were not correlated. Concentrations of 8-oxo-dGuo were positively correlated with percentages of DNA fragmentation measured by both TUNEL and SCSA (Ps=0.045 and 0.034, respectively). However, the concentrations of 8-oxo-dGuo and percentages of DNA fragmentation did not correlate with concentrations of bulky DNA adducts. In summary, coke oven workers with chronic exposure to PAHs experienced decreased sperm DNA integrity. Oxidative stress could contribute to the degree of DNA fragmentation. Bulky DNA adducts may be independent of the formation of DNA fragmentation and oxidative adducts in sperm. Monitoring sperm DNA integrity is recommended as a part of the process of assessing the impact of occupational and environmental toxins on sperm

  15. Synthesis of DNA

    Science.gov (United States)

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  16. DNA damage in wounded, hypoxic and acidotic human skin fibroblast cell cultures after low laser irradiation

    Science.gov (United States)

    Hawkins Evans, D.; Mbene, A.; Zungu, I.; Houreld, N.; Abrahamse, H.

    2009-02-01

    Phototherapy has become more popular and widely used in the treatment of a variety of medical conditions. To ensure sound results as evidence of its effectiveness, well designed experiments must be conducted when determining the effect of phototherapy. Cell culture models such as hypoxic, acidotic and wounded cell cultures simulating different disease conditions including ischemic heart disease, diabetes and wound healing were used to determine the effect of laser irradiation on the genetic integrity of the cell. Even though phototherapy has been found to be beneficial in a wide spectrum of conditions, it has been shown to induce DNA damage. However, this damage appears to be repairable. The risk lies in the fact that phototherapy may help the medical condition initially but damage DNA at the same time leaving undetected damage that may result in late onset, more severe, induced medical conditions including cancer. Human skin fibroblasts were cultured and used to induce a wound (by the central scratch model), hypoxic (by incubation in an anaerobic jar, 95% N2 and 5% O2) and acidotic (reducing the pH of the media to 6.7) conditions. Different models were irradiated using a Helium-Neon (632.8 nm) laser with a power density of 2.07 mW/cm2 and a fluence of 5 J/cm2 or 16 J/cm2. The effect of the irradiation was determined using the Comet assay 1 and 24 h after irradiation. In addition, the Comet assay was performed with the addition of formamidopyrimidine glycosylase (FPG) obviating strand brakes in oxidized bases at a high fluence of 16 J/cm2. A significant increase in DNA damage was seen in all three injured models at both 1 and 24 h post-irradiation when compared to the normal un-injured cells. However, when compared to non-irradiated controls the acidotic model showed a significant decrease in DNA damage 24 h after irradiation indicating the possible induction of cellular DNA repair mechanisms. When wounded cells were irradiated with higher fluences of 16 J/cm2

  17. Biochemical Characterization of Mycobacterium tuberculosis DNA Repair Enzymes – Nfo, XthA and Nei2

    Directory of Open Access Journals (Sweden)

    Sailau Abeldenov

    2014-01-01

    protein mass spectrometry by ion trap tandem MS/MS on nLC-ESI-Ion-Trap platform. Biochemical characterization of DNA repair protein-catalyzed activity was carried out by measuring apurinic/apyrimidinic endonuclease, DNA glycosylase, exonuclease, and 3'-repair diesterase functions. In addition, effect of the opposite base and the influence of metal ion cofactors were measured. Conclusion: Results of the ongoing study will help us define the role of DNA repair enzymes in the emergence of mutations in the mycobacterial genome and, possibly, the origins of multi-drug resistance in mycobacteria.  

  18. DNA encoding a DNA repair protein

    Science.gov (United States)

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-08-15

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  19. 高强度间歇运动训练对急进高原淋巴细胞线粒体DNA氧化损伤的影响

    Institute of Scientific and Technical Information of China (English)

    申去非; 彭朋; 段富强; 秦永生; 薄海

    2014-01-01

    【目的】观察平原短期高强度间歇运动训练(high-intensity interval training,HIT)对青年男性急进高原淋巴细胞线粒体DNA氧化损伤的影响。【方法】30例世居平原青年男性随机分为无运动训练组(NT,n=15)和高强度间歇运动训练组(HIT,n=15)。HIT组受试者进行HIT训练,以90%~95%心率贮备强度快跑3 min,间歇以45%~50%心率贮备强度慢跑3 min,重复6个循环,7次/周,共2周。训练后所有受试者同批次急进高原,在移居高原24 h检测淋巴细胞线粒体DNA(mitochondrial DNA,mt DNA)中8-氧鸟嘌呤脱氧核苷(8-oxo-deoxyguanosine,8-oxod G)含量、线粒体复合体活性、8-氧鸟嘌呤DNA糖基化酶(8-oxoguanine DNA glycosylase-1,OGG1)蛋白表达。【结果】与NT组比较,HIT组淋巴细胞OGG1蛋白表达、线粒体复合体I、II、IV和ATP合成酶活性显著升高(P〈0.05),mt DNA中8-oxod G含量显著降低(P〈0.01)。【结论】平原阶段短期高强度间歇运动训练可提高机体高原低氧环境下淋巴细胞线粒体抗氧化能力和能量代谢水平。

  20. Genetic analysis of repair and damage tolerance mechanisms for DNA-protein cross-links in Escherichia coli.

    Science.gov (United States)

    Salem, Amir M H; Nakano, Toshiaki; Takuwa, Minako; Matoba, Nagisa; Tsuboi, Tomohiro; Terato, Hiroaki; Yamamoto, Kazuo; Yamada, Masami; Nohmi, Takehiko; Ide, Hiroshi

    2009-09-01

    DNA-protein cross-links (DPCs) are unique among DNA lesions in their unusually bulky nature. We have recently shown that nucleotide excision repair (NER) and RecBCD-dependent homologous recombination (HR) collaboratively alleviate the lethal effect of DPCs in Escherichia coli. In this study, to gain further insight into the damage-processing mechanism for DPCs, we assessed the sensitivities of a panel of repair-deficient E. coli mutants to DPC-inducing agents, including formaldehyde (FA) and 5-azacytidine (azaC). We show here that the damage tolerance mechanism involving HR and subsequent replication restart (RR) provides the most effective means of cell survival against DPCs. Translesion synthesis does not serve as an alternative damage tolerance mechanism for DPCs in cell survival. Elimination of DPCs from the genome relies primarily on NER, which provides a second and moderately effective means of cell survival against DPCs. Interestingly, Cho rather than UvrC seems to be an effective nuclease for the NER of DPCs. Together with the genes responsible for HR, RR, and NER, the mutation of genes involved in several aspects of DNA repair and transactions, such as recQ, xth nfo, dksA, and topA, rendered cells slightly but significantly sensitive to FA but not azaC, possibly reflecting the complexity of DPCs or cryptic lesions induced by FA. UvrD may have an additional role outside NER, since the uvrD mutation conferred a slight azaC sensitivity on cells. Finally, DNA glycosylases mitigate azaC toxicity, independently of the repair of DPCs, presumably by removing 5-azacytosine or its degradation product from the chromosome. PMID:19617358

  1. Role of hazelnut consumption on DNA damage and lipid-related markers in children with primary dyslipidemia

    Directory of Open Access Journals (Sweden)

    Cristian Del Bo'

    2015-06-01

    Sixty children (11.5 ± 2.5 years have participated in an 8-week controlled, parallel, dietary intervention study with hazelnuts (0.43 g/kg body weight per day. Subjects received dietary guidelines and were randomized in 3 groups: 1- hazelnuts with skin; 2- hazelnut without skin; 3- control (without hazelnuts. Before and after intervention, blood samples were collected and used to evaluate the levels of formamidopyrimidine-DNA glycosylase (FPG-sensitive sites and H2O2-induced DNA damage in peripheral blood mononuclear cells (by comet assay, serum lipid profile (by automatic analyzer and erythrocyte membrane phospholipids composition (by gas chromatography analysis. Preliminary results in a subgroup (5 subjects receiving hazelnut with skin and 5 controls show a reduction in the FPG-sensitive sites (from 13.8 ± 3.16% to 7.88 ± 2.98% and H2O2-induced DNA damage (from 44.4 ± 3.1% to 35.7 ± 7.6% following 8-week hazelnut consumption, while no effect seems to occur in the control group. Hazelnut decreases serum LDL-C level (-11.2%; p= 0.01 and seems to affect erythrocyte membrane phospholipids composition compared to baseline, while no difference in triglycerides, total and HDL-C levels has been documented in the subgroup analyzed. These preliminary results show a tendency towards a decrease in the levels of FPG-sensitive sites, H2O2-induced DNA damage and serum LDL-C after an 8-week hazelnut intervention. Data elaboration on the complete group of subjects will help understanding the effect of hazelnut consumption on lipid profile and markers of oxidative stress in children affected by primary dyslipidemia.

  2. Characterization of family IV UDG from Aeropyrum pernix and its application in hot-start PCR by family B DNA polymerase.

    Directory of Open Access Journals (Sweden)

    Xi-Peng Liu

    Full Text Available Recombinant uracil-DNA glycosylase (UDG from Aeropyrum pernix (A. pernix was expressed in E. coli. The biochemical characteristics of A. pernix UDG (ApeUDG were studied using oligonucleotides carrying a deoxyuracil (dU base. The optimal temperature range and pH value for dU removal by ApeUDG were 55-65°C and pH 9.0, respectively. The removal of dU was inhibited by the divalent ions of Zn, Cu, Co, Ni, and Mn, as well as a high concentration of NaCl. The opposite base in the complementary strand affected the dU removal by ApeUDG as follows: U/C≈U/G>U/T≈U/AP≈U/->U/U≈U/I>U/A. The phosphorothioate around dU strongly inhibited dU removal by ApeUDG. Based on the above biochemical characteristics and the conservation of amino acid residues, ApeUDG was determined to belong to the IV UDG family. ApeUDG increased the yield of PCR by Pfu DNA polymerase via the removal of dU in amplified DNA. Using the dU-carrying oligonucleotide as an inhibitor and ApeUDG as an activator of Pfu DNA polymerase, the yield of undesired DNA fragments, such as primer-dimer, was significantly decreased, and the yield of the PCR target fragment was increased. This strategy, which aims to amplify the target gene with high specificity and yield, can be applied to all family B DNA polymerases.

  3. DNA loops and semicatenated DNA junctions

    Directory of Open Access Journals (Sweden)

    Strauss François

    2000-07-01

    Full Text Available Abstract Background Alternative DNA conformations are of particular interest as potential signals to mark important sites on the genome. The structural variability of CA microsatellites is particularly pronounced; these are repetitive poly(CA · poly(TG DNA sequences spread in all eukaryotic genomes as tracts of up to 60 base pairs long. Many in vitro studies have shown that the structure of poly(CA · poly(TG can vary markedly from the classical right handed DNA double helix and adopt diverse alternative conformations. Here we have studied the mechanism of formation and the structure of an alternative DNA structure, named Form X, which was observed previously by polyacrylamide gel electrophoresis of DNA fragments containing a tract of the CA microsatellite poly(CA · poly(TG but had not yet been characterized. Results Formation of Form X was found to occur upon reassociation of the strands of a DNA fragment containing a tract of poly(CA · poly(TG, in a process strongly stimulated by the nuclear proteins HMG1 and HMG2. By inserting Form X into DNA minicircles, we show that the DNA strands do not run fully side by side but instead form a DNA knot. When present in a closed DNA molecule, Form X becomes resistant to heating to 100°C and to alkaline pH. Conclusions Our data strongly support a model of Form X consisting in a DNA loop at the base of which the two DNA duplexes cross, with one of the strands of one duplex passing between the strands of the other duplex, and reciprocally, to form a semicatenated DNA junction also called a DNA hemicatenane.

  4. Determination of apurinic/apyrimidinic lesions in DNA with high-performance liquid chromatography and tandem mass spectrometry.

    Science.gov (United States)

    Roberts, Kenneth P; Sobrino, Justin A; Payton, Julie; Mason, Lavinnia B; Turesky, Robert J

    2006-02-01

    A new method has been developed to accurately measure apurinic and apyrimidinic (AP) DNA damage sites, which are lesions in DNA formed by loss of a nucleobase from oxidative stress or carcinogen adducts. If AP sites are left unrepaired (or if improperly repaired), these sites can lead to DNA mutations that may ultimately result in the formation of cancer. Hence, detection of AP sites may provide a useful indicator of exposure and susceptibility to chemical carcinogens and oxidative stress. AP detection is currently accomplished by immunodetection methods using an aldehyde reactive probe [Nakamura, J., Walker, V. E., Upton, P. B., Chiang, S.-Y., Kow, Y. W., and Swenberg, J. A. (1998) Cancer Res. 58, 222-225; Atamna, H., Cheung, I., and Ames, B. N. (2000) Proc. Natl. Acad. Sci. U.S.A. 97, 686-691]; however, these approaches lack the specificity required for unequivocal identification of the AP site. Therefore, we have developed an accurate method based on mass spectrometry detection of AP sites from AP DNA that have been prelabeled with O-4-nitrobenzylhydroxylamine (NBHA). Once labeled and once the excess labeling agent has been removed, enzymatic digestion of DNA to monomeric subunits can be accomplished, followed by isolation and detection with high-performance liquid chromatography coupled to electrospray ionization tandem mass spectrometry (HPLC-ESI-MS/MS). Optimization and validation of the experimental procedures and detection limits have been established using a model DNA oligomer (11-mer) containing uracil. Enzymatic removal of uracil with uracil glycosylase generates well-defined AP sites in both single- and double-stranded DNA. The addition of NBHA labels the AP site in the oligomer, creating a labeled 11-mer. HPLC-ESI-MS/MS in the negative ionization mode was used to monitor and confirm binding of NBHA to the AP oligomer. The NBHA-tagged oligomer underwent endo- and exonuclease digestion to the 5'-deoxyribose monophosphate (5'-dRp) level, thereby releasing

  5. DNA extraction by zinc.

    OpenAIRE

    Kejnovský, E; Kypr, J

    1997-01-01

    A fast, very simple and efficient method of DNA extraction is described which takes advantage of DNA sedimentation induced by millimolar concentrations of ZnCl2. The zinc-induced sedimentation is furthermore strongly promoted by submillimolar phosphate anion concentrations. Within 90% of DNA irrespective of whether a plasmid DNA or short oligonucleotides are the extracted material. The method works with plasmid DNA and oligonucleotide concentrations as low as 100 ng/ml and 10 microg/ml, respe...

  6. Activity-based assay for ricin-like toxins

    Science.gov (United States)

    Keener, William K.; Ward, Thomas E.

    2007-02-06

    A method of detecting N-glycosylase activity in a sample involves incubating an oligodeoxyribonucleotide substrate containing a deoxyadenosine or deoxyuridine residue with the sample to be tested such that the N-glycosylase, if present, hydrolyzes the deoxyadenosine or deoxyuridine residue to result in an N-glycosylase product having an abasic site. A primer is annealed to the N-glycosylase product, and the primer is extended with a DNA polymerase, such as Taq DNA polymerase, that pauses at abasic sites. The resulting extension products are melted from the N-glycosylase product, allowed to form hairpins due to self-complementarity, and further extended in the presence of labeled precursors to result in labeled products. Extension products synthesized from undigested substrate as template do not result in labeled products. Thus, detection of labeled products results in detection of N-glycosylase activity. Oligodeoxyribonucleotide substrates, primer, and positive controls and a kit for N-glycosylase assay are also disclosed.

  7. Identification of Escherichia coli ygaQ and rpmG as novel mitomycin C resistance factors implicated in DNA repair.

    Science.gov (United States)

    Bolt, Edward L; Jenkins, Tabitha; Russo, Valeria Moreira; Ahmed, Sharlene; Cavey, James; Cass, Simon D

    2016-01-01

    Using the ASKA (A Complete Set of Escherichia coli K-12 ORF Archive) library for genome-wide screening of E. coli proteins we identified that expression of ygaQ and rpmG promotes mitomycin C resistance (MMC(R)). YgaQ mediated MMC(R) was independent of homologous recombination involving RecA or RuvABC, but required UvrD. YgaQ is an uncharacterized protein homologous with α-amylases that we identified to have nuclease activity directed to ssDNA of 5' flaps. Nuclease activity was inactivated by mutation of two amino acid motifs, which also abolished MMC(R). RpmG is frequently annotated as a bacterial ribosomal protein, although forms an operon with MutM glycosylase and a putative deubiquitinating (DUB) enzyme, YicR. RpmG associated MMC(R) was dependent on MutM. MMC(R) from RpmG resembles DNA repair phenotypes reported for 'idiosyncratic ribosomal proteins' in eukaryotes. PMID:26704888

  8. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions: relevance to class switch recombination.

    Science.gov (United States)

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela; Peña-Diaz, Javier; Jiricny, Josef

    2016-04-01

    During class switch recombination (CSR), antigen-stimulated B-cells rearrange their immunoglobulin constant heavy chain (CH) loci to generate antibodies with different effector functions. CSR is initiated by activation-induced deaminase (AID), which converts cytosines in switch (S) regions, repetitive sequences flanking the CH loci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (BER), uracil processing in S-regions of activated B-cells occasionally gives rise to double strand breaks (DSBs), which trigger CSR. Surprisingly, genetic experiments revealed that CSR is dependent not only on AID and UNG, but also on mismatch repair (MMR). To elucidate the role of MMR in CSR, we studied the processing of uracil-containing DNA substrates in extracts of MMR-proficient and -deficient human cells, as well as in a system reconstituted from recombinant BER and MMR proteins. Here, we show that the interplay of these repair systems gives rise to DSBs in vitro and to genomic deletions and mutations in vivo, particularly in an S-region sequence. Our findings further suggest that MMR affects pathway choice in DSB repair. Given its amenability to manipulation, our system represents a powerful tool for the molecular dissection of CSR.

  9. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions: relevance to class switch recombination.

    Science.gov (United States)

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela; Peña-Diaz, Javier; Jiricny, Josef

    2016-04-01

    During class switch recombination (CSR), antigen-stimulated B-cells rearrange their immunoglobulin constant heavy chain (CH) loci to generate antibodies with different effector functions. CSR is initiated by activation-induced deaminase (AID), which converts cytosines in switch (S) regions, repetitive sequences flanking the CH loci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (BER), uracil processing in S-regions of activated B-cells occasionally gives rise to double strand breaks (DSBs), which trigger CSR. Surprisingly, genetic experiments revealed that CSR is dependent not only on AID and UNG, but also on mismatch repair (MMR). To elucidate the role of MMR in CSR, we studied the processing of uracil-containing DNA substrates in extracts of MMR-proficient and -deficient human cells, as well as in a system reconstituted from recombinant BER and MMR proteins. Here, we show that the interplay of these repair systems gives rise to DSBs in vitro and to genomic deletions and mutations in vivo, particularly in an S-region sequence. Our findings further suggest that MMR affects pathway choice in DSB repair. Given its amenability to manipulation, our system represents a powerful tool for the molecular dissection of CSR. PMID:26743004

  10. Early host cell reactivation of an oxidatively damaged adenovirus-encoded reporter gene requires the Cockayne syndrome proteins CSA and CSB.

    Science.gov (United States)

    Leach, Derrik M; Rainbow, Andrew J

    2011-03-01

    Reduced host cell reactivation (HCR) of a reporter gene containing 8-oxoguanine (8-oxoG) lesions in Cockayne syndrome (CS) fibroblasts has previously been attributed to increased 8-oxoG-mediated inhibition of transcription resulting from a deficiency in repair. This interpretation has been challenged by a report suggesting reduced expression from an 8-oxoG containing reporter gene occurs in all cells by a mechanism involving gene inactivation by 8-oxoG DNA glycosylase and this inactivation is strongly enhanced in the absence of the CS group B (CSB) protein. The observation of reduced gene expression in the absence of CSB protein led to speculation that decreased HCR in CS cells results from enhanced gene inactivation rather than reduced gene reactivation. Using an adenovirus-based β-galactosidase (β-gal) reporter gene assay, we have examined the effect of methylene blue plus visible light (MB + VL)-induced 8-oxoG lesions on the time course of gene expression in normal and CSA and CSB mutant human SV40-transformed fibroblasts, repair proficient and CSB mutant Chinese hamster ovary (CHO) cells and normal mouse embryo fibroblasts. We demonstrate that MB + VL treatment of the reporter leads to reduced expression of the damaged β-gal reporter relative to control at early time points following infection in all cells, consistent with in vivo inhibition of RNA polII-mediated transcription. In addition, we have demonstrated HCR of reporter gene expression occurs in all cell types examined. A significant reduction in the rate of gene reactivation in human SV40-transformed cells lacking functional CSA or CSB compared to normal cells was found. Similarly, a significant reduction in the rate of reactivation in CHO cells lacking functional CSB (CHO-UV61) was observed compared to the wild-type parental counterpart (CHO-AA8). The data presented demonstrate that expression of an oxidatively damaged reporter gene is reactivated over time and that CSA and CSB are required for

  11. Poor maternal nutrition and accelerated postnatal growth induces an accelerated aging phenotype and oxidative stress in skeletal muscle of male rats

    Science.gov (United States)

    Fernandez-Twinn, Denise S.; Chen, Jian Hua; Hargreaves, Iain P.; Neergheen, Viruna; Aiken, Catherine E.; Ozanne, Susan E.

    2016-01-01

    ABSTRACT ‘Developmental programming’, which occurs as a consequence of suboptimal in utero and early environments, can be associated with metabolic dysfunction in later life, including an increased incidence of cardiovascular disease and type 2 diabetes, and predisposition of older men to sarcopenia. However, the molecular mechanisms underpinning these associations are poorly understood. Many conditions associated with developmental programming are also known to be associated with the aging process. We therefore utilized our well-established rat model of low birth weight and accelerated postnatal catch-up growth (termed ‘recuperated’) in this study to establish the effects of suboptimal maternal nutrition on age-associated factors in skeletal muscle. We demonstrated accelerated telomere shortening (a robust marker of cellular aging) as evidenced by a reduced frequency of long telomeres (48.5-8.6 kb) and an increased frequency of short telomeres (4.2-1.3 kb) in vastus lateralis muscle from aged recuperated offspring compared to controls. This was associated with increased protein expression of the DNA-damage-repair marker 8-oxoguanine-glycosylase (OGG1) in recuperated offspring. Recuperated animals also demonstrated an oxidative stress phenotype, with decreased citrate synthase activity, increased electron-transport-complex activities of complex I, complex II-III and complex IV (all markers of functional mitochondria), and increased xanthine oxidase (XO), p67phox and nuclear-factor kappa-light-chain-enhancer of activated B-cells (NF-κB). Recuperated offspring also demonstrated increased antioxidant defense capacity, with increased protein expression of manganese superoxide dismutase (MnSOD), copper-zinc superoxide dismutase (CuZnSOD), catalase and heme oxygenase-1 (HO1), all of which are known targets of NF-κB and can be upregulated as a consequence of oxidative stress. Recuperated offspring also had a pro-inflammatory phenotype, as evidenced by

  12. DNA polymerase δ and DNA repair: DNA repair synthesis in human fibroblasts requires DNA polymerase δ

    International Nuclear Information System (INIS)

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernate of similarly treated HeLa cells. Monoclonal antibody to KB cell DNA polymerase α, while binding to HeLa DNA polymerase α, did not bind to the HeLa DNA polymerase δ. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGT) and 2(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase α, but did not inhibit the DNA polymerase δ. Neither purified DNA polymerase α nor β could promote repair DNA synthesis in the permeabilized cells. Furthermore, if monoclonal antibodies to DNA polymerase α BuPdGTP, or BuAdATP was added to the reconstituted system, there was no significant inhibition

  13. An inverse switch in DNA base excision and strand break repair contributes to melphalan resistance in multiple myeloma cells.

    Directory of Open Access Journals (Sweden)

    Mirta M L Sousa

    Full Text Available Alterations in checkpoint and DNA repair pathways may provide adaptive mechanisms contributing to acquired drug resistance. Here, we investigated the levels of proteins mediating DNA damage signaling and -repair in RPMI8226 multiple myeloma cells and its Melphalan-resistant derivative 8226-LR5. We observed markedly reduced steady-state levels of DNA glycosylases UNG2, NEIL1 and MPG in the resistant cells and cross-resistance to agents inducing their respective DNA base lesions. Conversely, repair of alkali-labile sites was apparently enhanced in the resistant cells, as substantiated by alkaline comet assay, autoribosylation of PARP-1, and increased sensitivity to PARP-1 inhibition by 4-AN or KU58684. Reduced base-excision and enhanced single-strand break repair would both contribute to the observed reduction in genomic alkali-labile sites, which could jeopardize productive processing of the more cytotoxic Melphalan-induced interstrand DNA crosslinks (ICLs. Furthermore, we found a marked upregulation of proteins in the non-homologous end-joining (NHEJ pathway of double-strand break (DSB repair, likely contributing to the observed increase in DSB repair kinetics in the resistant cells. Finally, we observed apparent upregulation of ATR-signaling and downregulation of ATM-signaling in the resistant cells. This was accompanied by markedly increased sensitivity towards Melphalan in the presence of ATR-, DNA-PK, or CHK1/2 inhibitors whereas no sensitizing effect was observed subsequent to ATM inhibition, suggesting that replication blocking lesions are primary triggers of the DNA damage response in the Melphalan resistant cells. In conclusion, Melphalan resistance is apparently contributed by modulation of the DNA damage response at multiple levels, including downregulation of specific repair pathways to avoid repair intermediates that could impair efficient processing of cytotoxic ICLs and ICL-induced DSBs. This study has revealed several novel

  14. UV Differentially Induces Oxidative Stress, DNA Damage and Apoptosis in BCR-ABL1-Positive Cells Sensitive and Resistant to Imatinib

    Directory of Open Access Journals (Sweden)

    Ewelina Synowiec

    2015-08-01

    Full Text Available Chronic myeloid leukemia (CML cells express the active BCR-ABL1 protein, which has been targeted by imatinib in CML therapy, but resistance to this drug is an emerging problem. BCR-ABL1 induces endogenous oxidative stress promoting genomic instability and imatinib resistance. In the present work, we investigated the extent of oxidative stress, DNA damage, apoptosis and expression of apoptosis-related genes in BCR-ABL1 cells sensitive and resistant to imatinib. The resistance resulted either from the Y253H mutation in the BCR-ABL1 gene or incubation in increasing concentrations of imatinib (AR. UV irradiation at a dose rate of 0.12 J/(m2·s induced more DNA damage detected by the T4 pyrimidine dimers glycosylase and hOGG1, recognizing oxidative modifications to DNA bases in imatinib-resistant than -sensitive cells. The resistant cells displayed also higher susceptibility to UV-induced apoptosis. These cells had lower native mitochondrial membrane potential than imatinib-sensitive cells, but UV-irradiation reversed that relationship. We observed a significant lowering of the expression of the succinate dehydrogenase (SDHB gene, encoding a component of the complex II of the mitochondrial respiratory chain, which is involved in apoptosis sensing. Although detailed mechanism of imatinib resistance in AR cells in unknown, we detected the presence of the Y253H mutation in a fraction of these cells. In conclusion, imatinib-resistant cells may display a different extent of genome instability than their imatinib-sensitive counterparts, which may follow their different reactions to both endogenous and exogenous DNA-damaging factors, including DNA repair and apoptosis.

  15. DNA fragmentation in apoptosis

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Cleavage of chromosomal DNA into oligonucleosomal size fragments is an integral part of apoptosis. Elegant biochemical work identified the DNA fragmentation factor (DFF) as a major apoptotic endonuclease for DNA fragmentation in vitro. Genetic studies in mice support the importance of DFF in DNA fragmentation and possibly in apoptosis in vivo. Recent work also suggests the existence of additional endonucleases for DNA degradation. Understanding the roles of individual endonucleases in apoptosis, and how they might coordinate to degrade DNA in different tissues during normal development and homeostasis, as well as in various diseased states, will be a major research focus in the near future.

  16. Scaffold functions of 14-3-3 adaptors in B cell immunoglobulin class switch DNA recombination.

    Directory of Open Access Journals (Sweden)

    Tonika Lam

    Full Text Available Class switch DNA recombination (CSR of the immunoglobulin heavy chain (IgH locus crucially diversifies antibody biological effector functions. CSR involves the induction of activation-induced cytidine deaminase (AID expression and AID targeting to switch (S regions by 14-3-3 adaptors. 14-3-3 adaptors specifically bind to 5'-AGCT-3' repeats, which make up for the core of all IgH locus S regions. They selectively target the upstream and downstream S regions that are set to undergo S-S DNA recombination. We hypothesized that 14-3-3 adaptors function as scaffolds to stabilize CSR enzymatic elements on S regions. Here we demonstrate that all seven 14-3-3β, 14-3-3ε, 14-3-3γ, 14-3-3η, 14-3-3σ, 14-3-3τ and 14-3-3ζ adaptors directly interacted with AID, PKA-Cα (catalytic subunit and PKA-RIα (regulatory inhibitory subunit and uracil DNA glycosylase (Ung. 14-3-3 adaptors, however, did not interact with AID C-terminal truncation mutant AIDΔ(180-198 or AIDF193A and AIDL196A point-mutants (which have been shown not to bind to S region DNA and fail to mediate CSR. 14-3-3 adaptors colocalized with AID and replication protein A (RPA in B cells undergoing CSR. 14-3-3 and AID binding to S region DNA was disrupted by viral protein R (Vpr, an accessory protein of human immunodeficiency virus type-1 (HIV-1, which inhibited CSR without altering AID expression or germline IH-CH transcription. Accordingly, we demonstrated that 14-3-3 directly interact with Vpr, which in turn, also interact with AID, PKA-Cα and Ung. Altogether, our findings suggest that 14-3-3 adaptors play important scaffold functions and nucleate the assembly of multiple CSR factors on S regions. They also show that such assembly can be disrupted by a viral protein, thereby allowing us to hypothesize that small molecule compounds that specifically block 14-3-3 interactions with AID, PKA and/or Ung can be used to inhibit unwanted CSR.

  17. Scaffold functions of 14-3-3 adaptors in B cell immunoglobulin class switch DNA recombination.

    Science.gov (United States)

    Lam, Tonika; Thomas, Lisa M; White, Clayton A; Li, Guideng; Pone, Egest J; Xu, Zhenming; Casali, Paolo

    2013-01-01

    Class switch DNA recombination (CSR) of the immunoglobulin heavy chain (IgH) locus crucially diversifies antibody biological effector functions. CSR involves the induction of activation-induced cytidine deaminase (AID) expression and AID targeting to switch (S) regions by 14-3-3 adaptors. 14-3-3 adaptors specifically bind to 5'-AGCT-3' repeats, which make up for the core of all IgH locus S regions. They selectively target the upstream and downstream S regions that are set to undergo S-S DNA recombination. We hypothesized that 14-3-3 adaptors function as scaffolds to stabilize CSR enzymatic elements on S regions. Here we demonstrate that all seven 14-3-3β, 14-3-3ε, 14-3-3γ, 14-3-3η, 14-3-3σ, 14-3-3τ and 14-3-3ζ adaptors directly interacted with AID, PKA-Cα (catalytic subunit) and PKA-RIα (regulatory inhibitory subunit) and uracil DNA glycosylase (Ung). 14-3-3 adaptors, however, did not interact with AID C-terminal truncation mutant AIDΔ(180-198) or AIDF193A and AIDL196A point-mutants (which have been shown not to bind to S region DNA and fail to mediate CSR). 14-3-3 adaptors colocalized with AID and replication protein A (RPA) in B cells undergoing CSR. 14-3-3 and AID binding to S region DNA was disrupted by viral protein R (Vpr), an accessory protein of human immunodeficiency virus type-1 (HIV-1), which inhibited CSR without altering AID expression or germline IH-CH transcription. Accordingly, we demonstrated that 14-3-3 directly interact with Vpr, which in turn, also interact with AID, PKA-Cα and Ung. Altogether, our findings suggest that 14-3-3 adaptors play important scaffold functions and nucleate the assembly of multiple CSR factors on S regions. They also show that such assembly can be disrupted by a viral protein, thereby allowing us to hypothesize that small molecule compounds that specifically block 14-3-3 interactions with AID, PKA and/or Ung can be used to inhibit unwanted CSR.

  18. DNA damage and autophagy

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez-Rocha, Humberto; Garcia-Garcia, Aracely [Redox Biology Center and School of Veterinary Medicine and Biomedical Sciences, University of Nebraska-Lincoln, Lincoln, NE 68583 (United States); Panayiotidis, Mihalis I. [School of Community Health Sciences, University of Nevada, Reno, NV 89557 (United States); Franco, Rodrigo, E-mail: rfrancocruz2@unl.edu [Redox Biology Center and School of Veterinary Medicine and Biomedical Sciences, University of Nebraska-Lincoln, Lincoln, NE 68583 (United States)

    2011-06-03

    Both exogenous and endogenous agents are a threat to DNA integrity. Exogenous environmental agents such as ultraviolet (UV) and ionizing radiation, genotoxic chemicals and endogenous byproducts of metabolism including reactive oxygen species can cause alterations in DNA structure (DNA damage). Unrepaired DNA damage has been linked to a variety of human disorders including cancer and neurodegenerative disease. Thus, efficient mechanisms to detect DNA lesions, signal their presence and promote their repair have been evolved in cells. If DNA is effectively repaired, DNA damage response is inactivated and normal cell functioning resumes. In contrast, when DNA lesions cannot be removed, chronic DNA damage triggers specific cell responses such as cell death and senescence. Recently, DNA damage has been shown to induce autophagy, a cellular catabolic process that maintains a balance between synthesis, degradation, and recycling of cellular components. But the exact mechanisms by which DNA damage triggers autophagy are unclear. More importantly, the role of autophagy in the DNA damage response and cellular fate is unknown. In this review we analyze evidence that supports a role for autophagy as an integral part of the DNA damage response.

  19. DNA Open states and DNA hydratation

    International Nuclear Information System (INIS)

    It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic

  20. Modeling DNA Replication.

    Science.gov (United States)

    Bennett, Joan

    1998-01-01

    Recommends the use of a model of DNA made out of Velcro to help students visualize the steps of DNA replication. Includes a materials list, construction directions, and details of the demonstration using the model parts. (DDR)

  1. HPV DNA test

    Science.gov (United States)

    The HPV DNA test is used to check for high-risk HPV infection in women. HPV infection around the genitals is ... warts spread when you have sex. The HPV-DNA test is generally not recommended for detecting low- ...

  2. DNA tagged microparticles

    Science.gov (United States)

    Farquar, George Roy; Leif, Roald N; Wheeler, Elizabeth

    2015-05-05

    A simulant that includes a carrier and DNA encapsulated in the carrier. Also a method of making a simulant including the steps of providing a carrier and encapsulating DNA in the carrier to produce the simulant.

  3. Recombinant DNA in Medicine

    OpenAIRE

    Cederbaum, Stephen D.; Fareed, George C.; Lovett, Michael A.; Shapiro, Larry J.

    1984-01-01

    Studies in bacteria and bacterial viruses have led to methods to manipulate and recombine DNA in unique and reproducible ways and to amplify these recombined molecules millions of times. Once properly identified, the recombinant DNA molecules can be used in various ways useful in medicine and human biology. There are many applications for recombinant DNA technology. Cloned complementary DNA has been used to produce various human proteins in microorganisms. Insulin and growth hormone have been...

  4. DNA Damage Response

    OpenAIRE

    Giglia-Mari, Giuseppina; Zotter, Angelika; Vermeulen, Wim

    2011-01-01

    Structural changes to DNA severely affect its functions, such as replication and transcription, and play a major role in age-related diseases and cancer. A complicated and entangled network of DNA damage response (DDR) mechanisms, including multiple DNA repair pathways, damage tolerance processes, and cell-cycle checkpoints safeguard genomic integrity. Like transcription and replication, DDR is a chromatin-associated process that is generally tightly controlled in time and space. As DNA damag...

  5. DNA-Mediated Electrochemistry

    OpenAIRE

    Gorodetsky, Alon A.; Buzzeo, Marisa C.; Barton, Jacqueline K.

    2008-01-01

    The base pair stack of DNA has been demonstrated as a medium for long-range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here, we discuss the characteristi...

  6. Replicating animal mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Emily A. McKinney

    2013-01-01

    Full Text Available The field of mitochondrial DNA (mtDNA replication has been experiencing incredible progress in recent years, and yet little is certain about the mechanism(s used by animal cells to replicate this plasmid-like genome. The long-standing strand-displacement model of mammalian mtDNA replication (for which single-stranded DNA intermediates are a hallmark has been intensively challenged by a new set of data, which suggests that replication proceeds via coupled leading-and lagging-strand synthesis (resembling bacterial genome replication and/or via long stretches of RNA intermediates laid on the mtDNA lagging-strand (the so called RITOLS. The set of proteins required for mtDNA replication is small and includes the catalytic and accessory subunits of DNA polymerase y, the mtDNA helicase Twinkle, the mitochondrial single-stranded DNA-binding protein, and the mitochondrial RNA polymerase (which most likely functions as the mtDNA primase. Mutations in the genes coding for the first three proteins are associated with human diseases and premature aging, justifying the research interest in the genetic, biochemical and structural properties of the mtDNA replication machinery. Here we summarize these properties and discuss the current models of mtDNA replication in animal cells.

  7. DNA damage response

    NARCIS (Netherlands)

    G. Giglia-Mari (Giuseppina); A. Zotter (Angelika); W. Vermeulen (Wim)

    2011-01-01

    textabstractStructural changes to DNA severely affect its functions, such as replication and transcription, and play a major role in age-related diseases and cancer. A complicated and entangled network ofDNA damage response (DDR) mechanisms, including multiple DNA repair pathways, damage tolerance p

  8. DNA: Structure and function

    DEFF Research Database (Denmark)

    Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir;

    1998-01-01

    This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...

  9. DNA去甲基化机制的研究进展%Progress in Study on Mechanism of DNA Demethylation

    Institute of Scientific and Technical Information of China (English)

    曹领改; 张旸; 蓝兴国; 李玉花

    2012-01-01

    As a significant epigenetic modification, DNA methylation plays a critical role in regulating gene expression and maintaining genomic stability in mammals and flowering plants. DNA methylation level and pattern of change will lead to abnormal phenotype or even death. The level and pattern of 5-Mc are determined by both DNA methylation and demethylation processes. Demethylation of DNA can be passive and active. The formation of DNA methylation pattern depends on the active demethylation. Five potential mechanisms of DNA active demethylation are reviewed in this paper: base excision repair involved with DNA glycosylases, base excision repair involved with enzymatic deamination, nucleotide excision repair, oxidative demethylation and hydrolysis.%DNA甲基化作为动植物体内一种重要的表观遗传修饰形式,在调控基因表达、维持基因组的稳定性等方面发挥重要的生物学作用.固有DNA甲基化水平和模式的变化会导致生物的表型异常甚至死亡.而5-甲基胞嘧啶的水平和模式是由DNA甲基化和去甲基化共同决定的.DNA去甲基化可以分为主动去甲基化与被动去甲基化,而基因组甲基化模式的形成主要依赖于主动去甲基化.本文综述了生物体内DNA主动去甲基化五种潜在机制:DNA转葡糖基酶参与的碱基切除修复途径、脱氨酶参与的碱基切除修复途径、核苷酸切除修复途径、氧化作用去甲基化与水解作用去甲基化.

  10. Protective effects of rosmarinic acid on sepsis-induced DNA damage in the liver of Wistar albino rats

    Directory of Open Access Journals (Sweden)

    Hatice Gul Goktas

    2015-06-01

    Full Text Available Sepsis is an imbalance between pro and anti-inflammatory responses. Sepsis induced multiple organ failure that is associated with mortality is characterized by liver, renal, cardiovascular and pulmonary dysfunction and reactive oxygen species (ROS are believed to be involved in the development of sepsis. Plant polyphenols may act as antioxidants by different mechanisms such as free radical scavenging, metal chelation and protein binding. Data indicates possible beneficial effects of plant derived phenolic compounds against sepsis. Rosmarinic acid (RA (α-O-caffeoyl-3,4-dihydroxyphenyllactic acid is a phenolic compound commonly found in various plants such as Rosmarinus officinalis (rosemary, Origanum vulgare (oregano, Thymus vulgaris (thyme, Mentha spicata (spearmint, Perilla frutescens (perilla, Ocimum basilicum (sweet basil and several other medicinal plants. It has been shown that RA has many biological activities including antioxidant, anti-inflammatory, antiallergic, anticancer and actimicrobial and is widely used in cosmetic and food industry. In the present study, we aimed to determine the protective effects of RA against the oxidative DNA damage induced by sepsis in Wistar albino rats. The rats were divided into four groups; sham, sepsis induced, RA-treated, RA treated and sepsis induced groups. Wistar rats were subjected to sepsis by cecal ligation puncture. The liver tissues were carefully dissected from their attachments and totally excised. The concentrations of the hepatic tissue cells were adjusted to approximately 2 x 106 cells/ml. Standard and formamidopyrimidine-DNA glycosylase (Fpg modified comet assay described by Singh et al were used. There were no statistically significant differences in terms of tail length, tail intensity and tail moment between the sham group and the RA-treated groups (p>0.05. The DNA damage was found significantly higher in the sepsis-induced group compared to the sham group (p0.05, and the DNA damage

  11. Counterintuitive DNA Sequence Dependence in Supercoiling-Induced DNA Melting

    NARCIS (Netherlands)

    Vlijm, R.; Torre, J.; Dekker, C.

    2015-01-01

    The metabolism of DNA in cells relies on the balance between hybridized double-stranded DNA (dsDNA) and local de-hybridized regions of ssDNA that provide access to binding proteins. Traditional melting experiments, in which short pieces of dsDNA are heated up until the point of melting into ssDNA, h

  12. Racemic DNA crystallography.

    Science.gov (United States)

    Mandal, Pradeep K; Collie, Gavin W; Kauffmann, Brice; Huc, Ivan

    2014-12-22

    Racemates increase the chances of crystallization by allowing molecular contacts to be formed in a greater number of ways. With the advent of protein synthesis, the production of protein racemates and racemic-protein crystallography are now possible. Curiously, racemic DNA crystallography had not been investigated despite the commercial availability of L- and D-deoxyribo-oligonucleotides. Here, we report a study into racemic DNA crystallography showing the strong propensity of racemic DNA mixtures to form racemic crystals. We describe racemic crystal structures of various DNA sequences and folded conformations, including duplexes, quadruplexes, and a four-way junction, showing that the advantages of racemic crystallography should extend to DNA.

  13. Electronic Transport in DNA

    OpenAIRE

    Klotsa, Daphne; Römer, Rudolf A.; Turner, Matthew S.

    2005-01-01

    We study the electronic properties of DNA by way of a tight-binding model applied to four particular DNA sequences. The charge transfer properties are presented in terms of localisation lengths, crudely speaking the length over which electrons travel. Various types of disorder, including random potentials, are employed to account for different real environments. We have performed calculations on poly(dG)-poly(dC), telomeric-DNA, random-ATGC DNA and lambda-DNA. We find that random and lambda-D...

  14. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske;

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  15. Exposure to runoff from coal-tar-sealed pavement induces genotoxicity and impairment of DNA repair capacity in the RTL-W1 fish liver cell line

    Science.gov (United States)

    Kienzler, Aude; Mahler, Barbara J.; Van Metre, Peter C.; Schweigert, Nathalie; Devaux, Alain; Bony, Sylvie

    2015-01-01

    Coal-tar-based (CTB) sealcoat, frequently applied to parking lots and driveways in North America, contains elevated concentrations of polycyclic aromatic hydrocarbons (PAHs) and related compounds. The RTL-W1 fish liver cell line was used to investigate two endpoints (genotoxicity and DNA-repair-capacity impairment) associated with exposure to runoff from asphalt pavement with CTB sealcoat or with an asphalt-based sealcoat hypothesized to contain about 7% CTB sealcoat (AS-blend). Genotoxic potential was assessed by the Formamido pyrimidine glycosylase (Fpg)-modified comet assay for 1:10 and 1:100 dilutions of runoff samples collected from 5 h to 36 d following sealcoat application. DNA-repair capacity was assessed by the base excision repair comet assay for 1:10 dilution of samples collected 26 h and 36 d following application. Both assays were run with and without co-exposure to ultraviolet-A radiation (UVA). With co-exposure to UVA, genotoxic effects were significant for both dilutions of CTB runoff for three of four sample times, and for some samples of AS-blend runoff. Base excision repair was significantly impaired for CTB runoff both with and without UVA exposure, and for AS-blend runoff only in the absence of UVA. This study is the first to investigate the effects of exposure to the complex mixture of chemicals in coal tar on DNA repair capacity. The results indicate that co-exposure to runoff from CT-sealcoated pavement and UVA as much as a month after sealcoat application has the potential to cause genotoxicity and impair DNA repair capacity.

  16. DNA in Nanoscale Electronics

    Science.gov (United States)

    Slinker, Jason

    2012-10-01

    DNA, the quintessential molecule of life, possesses a number of attractive properties for use in nanoscale circuits. Charge transport (CT) through DNA itself is of both fundamental and practical interest. Fundamentally, DNA has a unique configuration of π-stacked bases in a well ordered, double helical structure. Given its unparalleled importance to life processes and its arrangement of conjugated subunits, DNA has been a compelling target of conductivity studies. In addition, further understanding of DNA CT will elucidate the biological implications of this process and advance its use in sensing technologies. We have investigated the fundamentals of DNA CT by measuring the electrochemistry of DNA monolayers under biologically-relevant conditions. We have uncovered both fundamental kinetic parameters to distinguish between competing models of operation as well as the practical implications of DNA CT for sensing. Furthermore, we are leveraging our studies of DNA conductivity for the manufacture of nanoscale circuits. We are investigating the electrical properties and self-assembly of DNA nanowires containing artificial base pair surrogates, which can be prepared through low cost and high throughput automated DNA synthesis. This unique and economically viable approach will establish a new paradigm for the scalable manufacture of nanoscale semiconductor devices.

  17. Impact of radiotherapy on PBMCs DNA repair capacity - Use of a multiplexed functional repair assay

    International Nuclear Information System (INIS)

    Radiation therapy is an essential part of cancer treatment as about 50% of patients will receive radiations at least once. Significant broad variation in radiosensitivity has been demonstrated in patients. About 5-10% of patients develop acute toxicity after radiotherapy. Therefore there is a need for the identification of markers able to predict the occurrence of adverse effects and thus adapt the radiotherapy regimen for radiosensitive patients. As a first step toward this goal, and considering the DNA repair defects associated with hypersensitivity radiation syndromes, we investigated the DNA repair phenotype of patients receiving radiotherapy. More precisely, we used a functional repair assay on support to follow the evolution of the glycosylases/AP endonuclease activities of PBMCs extracts of a series of patients during the time course of radiotherapy. For each patient, we collected one PBMCs sample before the first radiotherapy application (S1) and three samples after (S2 to S4) (one day and one week after application 1, and one at the end of the radiotherapy protocol). These four samples have been analysed for 11 donors. Clustering analyses of the results demonstrated a great heterogeneity of responses among the patients. Interestingly, this heterogeneity decreased between S1 and S4 where only 2 classes of patients remained if we except one patient that exhibited an atypical DNA repair phenotype. Furthermore, we showed that repair of several oxidized bases significantly increased between S1 and S3 or S4 (8oxoG, thymine glycol, A paired with 8oxoG), suggesting an adaptation of patients repair systems to the oxidative stress generated by the ionising radiations. Our preliminary results provided evidence that the DNA repair phenotype was impacted by the radiotherapy regimen. Further characterization of patients with known repair defects are needed to determine if atypical repair phenotypes could be associated with radiotherapy complications. Finally

  18. Biophysics of DNA

    CERN Document Server

    Vologodskii, Alexander

    2015-01-01

    Surveying the last sixty years of research, this book describes the physical properties of DNA in the context of its biological functioning. It is designed to enable both students and researchers of molecular biology, biochemistry and physics to better understand the biophysics of DNA, addressing key questions and facilitating further research. The chapters integrate theoretical and experimental approaches, emphasising throughout the importance of a quantitative knowledge of physical properties in building and analysing models of DNA functioning. For example, the book shows how the relationship between DNA mechanical properties and the sequence specificity of DNA-protein binding can be analyzed quantitatively by using our current knowledge of the physical and structural properties of DNA. Theoretical models and experimental methods in the field are critically considered to enable the reader to engage effectively with the current scientific literature on the physical properties of DNA.

  19. Forensic DNA analysis.

    Science.gov (United States)

    McDonald, Jessica; Lehman, Donald C

    2012-01-01

    Before the routine use of DNA profiling, blood typing was an important forensic tool. However, blood typing was not very discriminating. For example, roughly 30% of the United States population has type A-positive blood. Therefore, if A-positive blood were found at a crime scene, it could have come from 30% of the population. DNA profiling has a much better ability for discrimination. Forensic laboratories no longer routinely determine blood type. If blood is found at a crime scene, DNA profiling is performed. From Jeffrey's discovery of DNA fingerprinting to the development of PCR of STRs to the formation of DNA databases, our knowledge of DNA and DNA profiling have expanded greatly. Also, the applications for which we use DNA profiling have increased. DNA profiling is not just used for criminal case work, but it has expanded to encompass paternity testing, disaster victim identification, monitoring bone marrow transplants, detecting fetal cells in a mother's blood, tracing human history, and a multitude of other areas. The future of DNA profiling looks expansive with the development of newer instrumentation and techniques. PMID:22693781

  20. DNA media storage

    Institute of Scientific and Technical Information of China (English)

    Christy M.Bogard; Eric C.Rouchka; Benjamin Arazi

    2008-01-01

    In 1994. University of Southern California computer scientist,Dr.Leonard Adleman solved the Hamiltonian path problem using DNA as a computational mechanism.He proved the principle that DNA computing could be used to solve computationally complex problems.Because of the limitations in discovery time,resource requirements,and sequence mismatches,DNA computing has not yet become a commonly accepted practice.However,advancements are continually being discovered that are evolving the field of DNA computing.Practical applications of DNA are not restricted to computation alone.This research presents a novel approach in which DNA could be used as a means of storing files.Through the use of multiple sequence alignment combined with intelligent heuristics,the most probabilistic file contents can be determined with minimal errors.

  1. DNA profiles from fingermarks.

    Science.gov (United States)

    Templeton, Jennifer E L; Linacre, Adrian

    2014-11-01

    Criminal investigations would be considerably improved if DNA profiles could be routinely generated from single fingermarks. Here we report a direct DNA profiling method that was able to generate interpretable profiles from 71% of 170 fingermarks. The data are based on fingermarks from all 5 digits of 34 individuals. DNA was obtained from the fingermarks using a swab moistened with Triton-X, and the fibers were added directly to one of two commercial DNA profiling kits. All profiles were obtained without increasing the number of amplification cycles; therefore, our method is ideally suited for adoption by the forensic science community. We indicate the use of the technique in a criminal case in which a DNA profile was generated from a fingermark on tape that was wrapped around a drug seizure. Our direct DNA profiling approach is rapid and able to generate profiles from touched items when current forensic practices have little chance of success. PMID:25391915

  2. Electrocatalysis in DNA Sensors.

    Science.gov (United States)

    Furst, Ariel; Hill, Michael G; Barton, Jacqueline K

    2014-12-14

    Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge transport properties of DNA. Electrocatalysis coupled with DNA-mediated charge transport has enabled specific and sensitive detection of lesions, mismatches and DNA-binding proteins. Even greater signal amplification from these platforms is now being achieved through the incorporation of a secondary electrode to the platform both for patterning DNA arrays and for detection. Here, we describe the evolution of this new DNA sensor technology. PMID:25435647

  3. DNA replication and cancer

    DEFF Research Database (Denmark)

    Boyer, Anne-Sophie; Walter, David; Sørensen, Claus Storgaard

    2016-01-01

    A dividing cell has to duplicate its DNA precisely once during the cell cycle to preserve genome integrity avoiding the accumulation of genetic aberrations that promote diseases such as cancer. A large number of endogenous impacts can challenge DNA replication and cells harbor a battery of pathways...... to promote genome integrity during DNA replication. This includes suppressing new replication origin firing, stabilization of replicating forks, and the safe restart of forks to prevent any loss of genetic information. Here, we describe mechanisms by which oncogenes can interfere with DNA replication thereby...... causing DNA replication stress and genome instability. Further, we describe cellular and systemic responses to these insults with a focus on DNA replication restart pathways. Finally, we discuss the therapeutic potential of exploiting intrinsic replicative stress in cancer cells for targeted therapy....

  4. Innovations. DNA detectives.

    OpenAIRE

    May, M

    1999-01-01

    To understand the many potential causes and resulting consequences of DNA damage, scientists first need methods to detect it. Canadian scientists X. Chris Le and Michael Weinfeld, with help from U.S. molecular biologist Steven Leadon, developed a selective, sensitive technique for measuring DNA damage. The scientists combined a thymine glycol antibody with thymine glycol to selectively tag a specific type of DNA damage. They then added a second antibody with fluorescing properties, and used l...

  5. DNA Microarray Technique

    Directory of Open Access Journals (Sweden)

    Thakare SP

    2012-11-01

    Full Text Available DNA Microarray is the emerging technique in Biotechnology. The many varieties of DNA microarray or DNA chip devices and systems are described along with their methods for fabrication and their use. It also includes screening and diagnostic applications. The DNA microarray hybridization applications include the important areas of gene expression analysis and genotyping for point mutations, single nucleotide polymorphisms (SNPs, and short tandem repeats (STRs. In addition to the many molecular biological and genomic research uses, this review covers applications of microarray devices and systems for pharmacogenomic research and drug discovery, infectious and genetic disease and cancer diagnostics, and forensic and genetic identification purposes.

  6. The Bacillus subtilis DnaD and DnaB Proteins Exhibit Different DNA Remodelling Activities

    OpenAIRE

    Zhang, Wenke; Carneiro, Maria J. V. M.; Turner, Ian J.; ALLEN, Stephanie; Roberts, Clive J.; Soultanas, Panos

    2005-01-01

    Primosomal protein cascades load the replicative helicase onto DNA. In Bacillus subtilis a putative primosomal cascade involving the DnaD-DnaB-DnaI proteins has been suggested to participate in both the DnaA and PriA-dependent loading of the replicative helicase DnaC onto the DNA. Recently we discovered that DnaD has a global remodelling DNA activity suggesting a more widespread role in bacterial nucleoid architecture. Here, we show that DnaB forms a “square-like” tetramer with a hole in the ...

  7. Repair of U/G and U/A in DNA by UNG2-associated repair complexes takes place predominantly by short-patch repair both in proliferating and growth-arrested cells

    DEFF Research Database (Denmark)

    Akbari, Mansour; Otterlei, Marit; Pena Diaz, Javier;

    2004-01-01

    , PCNA and DNA ligase, the latter detected as activity. Short-patch repair was the predominant mechanism both in extracts and UNG2-ARC from proliferating and less BER-proficient growth-arrested cells. Repair of U/G mispairs and U/A pairs was completely inhibited by neutralizing UNG......-antibodies, but whereas added recombinant SMUG1 could partially restore repair of U/G mispairs, it was unable to restore repair of U/A pairs in UNG2-ARC. Neutralizing antibodies to APE1 and POLbeta, and depletion of XRCC1 strongly reduced short-patch BER, and a fraction of long-patch repair was POLbeta dependent......Nuclear uracil-DNA glycosylase UNG2 has an established role in repair of U/A pairs resulting from misincorporation of dUMP during replication. In antigen-stimulated B-lymphocytes UNG2 removes uracil from U/G mispairs as part of somatic hypermutation and class switch recombination processes. Using...

  8. 大豆DNA去甲基化酶ROS1的生物信息学分析%Bioinformatics Analysis of DNA Demethylase ROS1 in Soybean

    Institute of Scientific and Technical Information of China (English)

    梁喜龙; 李国兰; 崔洪秋; 鞠世杰; 洪艳华; 方淑梅; 郑殿峰

    2014-01-01

    利用NCBI、Phytozome、ExPASy等网站及其数据库,初步确定了大豆DNA去甲基化酶ROS1的蛋白及基因序列、基因拷贝数、理化特性等,并进一步预测分析了二级结构及结构域,同时结合ClustalX2.0和MEGA4.0等软件进行多重序列比对和分子系统进化关系研究.结果显示,大豆ROS1包括6个拷贝,ROS1各拷贝的分子量相近,等电点酸性,具有相似的潜在磷酸化位点,属于不稳定的疏水性蛋白,都位于细胞核内,且不含信号序列.α螺旋是主要的二级结构,均含有DNA_glycosylase,HhH-GPD_domain和HTH_base_excis_C三个结构域.

  9. Molecular characterization of a complex site-specific radiation-induced DNA double-strand break

    International Nuclear Information System (INIS)

    Full text: Radiation lethality is a function of radiation-induced DNA double-strand breaks (DSB). Current models propose the lethality of a DSB to be a function of its structural complexity. We present here for the first time a map of damage associated with a site-specific double-strand break produced by decay of 125I in a plasmid bound by a 125I-labeled triplex forming oligonucleotide (125 I-TFO). The E. coli DNA repair enzymes, endonuclease IV (endo IV), endonuclease III (endo III), and formamidopyrimidine-DNA glycosylase (Fpg), which recognize AP sites, and pyrimidine and purine base damage respectively, were used as probes in this study. 125I-TFO bound plasmid was incubated with and without DMSO at -80 deg C for 1 month. No significant difference in DSB yield was observed under these conditions. A 32 base pair fragment from the upstream side of the decay site was isolated by restriction digestion and enzymatically probed to identify damage sites. Endo IV treatment of the 5'-end labeled upper strand indicated clustering of AP sites within 3 bases downstream and 7 bases upstream of the targeted base. Also, repeated experiments consistently detected an AP site 4 bases upstream of the 125 I target base. This was further supported by complementary results with the 3'-end labeled upper strand. Endo IV analysis of the lower strand also shows clustering of AP sites near the DSB end. Endo III and Fpg probing demonstrated that base damage is also clustered near the targeted break site. DSBs produced in the absence of DMSO displayed a different pattern of enzyme sensitive damage than those produced in the presence of DMSO. Identification of specific base damage types within the restriction fragment containing the DSB end was achieved with GC/MS. Base damage consisted of 8-hydroguanine, 8-hydroxyadenine, and 5-hydroxycytosine. These lesions were observed at relative yields of 8-hydroguanine and 5-hydroxycytosine to 8-hydroxyadenine of 7.4:1 and 4.7:1, respectively, in the

  10. Molecular characterization of a complex site-specific radiation-induced DNA double-strand break

    International Nuclear Information System (INIS)

    Radiation lethality is a function of radiation-induced DNA double-strand breaks (DSB). Current models propose the lethality of a DSB to be a function of its structural complexity. We present here for the first time a map of damage associated with a site-specific double-strand break produced by decay of 125I in a plasmid bound by a 125I-labeled triplex forming oligonucleotide ( 125I-TFO). The E. coli DNA repair enzymes, endonuclease IV (endo IV), endonuclease III (endo III), and formamidopyrimidine-DNA glycosylase (Fpg), which recognize AP sites, and pyrimidine and purine base damage respectively, were used as probes in this study. 125I-TFO bound plasmid was incubated with and without DMSO at -80 deg C for 1 month. No significant difference in DSB yield was observed under these conditions. A 32 base pair fragment from the upstream side of the decay site was isolated by restriction digestion and enzymatically probed to identify damage sites. Endo IV treatment of the 5'-end labeled upper strand indicated clustering of AP sites within 3 bases downstream and 7 bases upstream of the targeted base. Also, repeated experiments consistently detected an AP site 4 bases upstream of the 125Itarget base. This was further supported by complementary results with the 3'-end labeled upper strand. Endo IV analysis of the lower strand also shows clustering of AP sites near the DSB end. Endo III and Fpg probing demonstrated that base damage is also clustered near the targeted break site. DSBs produced in the absence of DMSO displayed a different pattern of enzyme sensitive damage than those produced in the presence of DMSO. Identification of specific base damage types within the restriction fragment containing the DSB end was achieved with GC/MS. Base damage consisted of 8-hydroguanine, 8-hydroxyadenine, and 5-hydroxycytosine. These lesions were observed at relative yields of 8-hydroguanine and 5-hydroxycytosine to 8-hydroxyadenine of 7.4:1 and 4.7:1, respectively, in the absence of

  11. Elevated incidence of polyp formation in APC(Min/⁺Msh2⁻/⁻ mice is independent of nitric oxide-induced DNA mutations.

    Directory of Open Access Journals (Sweden)

    Antoaneta Belcheva

    Full Text Available Gut microbiota has been linked to a number of human diseases including colon cancer. However, the mechanism through which gut bacteria influence colon cancer development and progression remains unclear. Perturbation of the homeostasis between the host immune system and microbiota leads to inflammation and activation of macrophages which produce large amounts of nitric oxide that acts as a genotoxic effector molecule to suppress bacterial growth. However, nitric oxide also has genotoxic effects to host cells by producing mutations that can predispose to colon cancer development. The major DNA lesions caused by nitric oxide are 8oxoG and deamination of deoxycytosine bases. Cellular glycosylases that belong to the base excision repair pathway have been demonstrated to repair these mutations. Recent evidence suggests that the mismatch repair pathway (MMR might also repair nitric oxide-induced DNA damage. Since deficiency in MMR predisposes to colon cancer, we hypothesized that MMR-deficient colon epithelial cells are incapable of repairing nitric-oxide induced genetic lesions that can promote colon cancer. Indeed, we found that the MMR pathway repairs nitric oxide-induced DNA mutations in cell lines. To test whether nitric oxide promotes colon cancer, we genetically ablated the inducible nitric oxide synthase (iNOS or inhibited iNOS activity in the APC(Min/+Msh2(-/- mouse model of colon cancer. However, despite the fact that nitric oxide production was strongly reduced in the colon using both approaches, colon cancer incidence was not affected. These data show that nitric oxide and iNOS do not promote colon cancer in APC(Min/+Msh2(-/- mice.

  12. Curcumin protects against cytotoxic and inflammatory effects of quartz particles but causes oxidative DNA damage in a rat lung epithelial cell line

    International Nuclear Information System (INIS)

    Chronic inhalation of high concentrations of respirable quartz particles has been implicated in various lung diseases including lung fibrosis and cancer. Generation of reactive oxygen species (ROS) and oxidative stress is considered a major mechanism of quartz toxicity. Curcumin, a yellow pigment from Curcuma longa, has been considered as nutraceutical because of its strong anti-inflammatory, antitumour and antioxidant properties. The aim of our present study was to investigate whether curcumin can protect lung epithelial cells from the cytotoxic, genotoxic and inflammatory effects associated with quartz (DQ12) exposure. Electron paramagnetic resonance (EPR) measurements using the spin-trap DMPO demonstrated that curcumin reduces hydrogen peroxide-dependent hydroxyl-radical formation by quartz. Curcumin was also found to reduce quartz-induced cytotoxicity and cyclooxygenase 2 (COX-2) mRNA expression in RLE-6TN rat lung epithelial cells (RLE). Curcumin also inhibited the release of macrophage inflammatory protein-2 (MIP-2) from RLE cells as observed upon treatment with interleukin-1 beta (IL-1β) and tumour necrosis factor-alpha (TNFα). However, curcumin failed to protect the RLE cells from oxidative DNA damage induced by quartz, as shown by formamidopyrimidine glycosylase (FPG)-modified comet assay and by immunocytochemistry for 8-hydroxydeoxyguanosine. In contrast, curcumin was found to be a strong inducer of oxidative DNA damage itself at non-cytotoxic and anti-inflammatory concentrations. In line with this, curcumin also enhanced the mRNA expression of the oxidative stress response gene heme oxygenase-1 (ho-1). Curcumin also caused oxidative DNA damage in NR8383 rat alveolar macrophages and A549 human lung epithelial cells. Taken together, these observations indicate that one should be cautious in considering the potential use of curcumin in the prevention or treatment of lung diseases associated with quartz exposure

  13. DNA-cell conjugates

    Energy Technology Data Exchange (ETDEWEB)

    Hsiao, Shih-Chia; Francis, Matthew B.; Bertozzi, Carolyn; Mathies, Richard; Chandra, Ravi; Douglas, Erik; Twite, Amy; Toriello, Nicholas; Onoe, Hiroaki

    2016-05-03

    The present invention provides conjugates of DNA and cells by linking the DNA to a native functional group on the cell surface. The cells can be without cell walls or can have cell walls. The modified cells can be linked to a substrate surface and used in assay or bioreactors.

  14. Characterization of muntjac DNA

    International Nuclear Information System (INIS)

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange

  15. Routine DNA testing

    Science.gov (United States)

    Routine DNA testing. It’s done once you’ve Marker-Assisted Breeding Pipelined promising Qantitative Trait Loci within your own breeding program and thereby established the performance-predictive power of each DNA test for your germplasm under your conditions. By then you are ready to screen your par...

  16. DNA sequences encoding erythropoietin

    Energy Technology Data Exchange (ETDEWEB)

    Lin, F.K.

    1987-10-27

    A purified and isolated DNA sequence is described consisting essentially of a DNA sequence encoding a polypeptide having an amino acid sequence sufficiently duplicative of that of erythropoietin to allow possession of the biological property of causing bone marrow cells to increase production of reticulocytes and red blood cells, and to increase hemoglobin synthesis or iron uptake.

  17. Recombinant DNA for Teachers.

    Science.gov (United States)

    Duvall, James G., III

    1992-01-01

    A science teacher describes his experience at a workshop to learn to teach the Cold Spring Harbor DNA Science Laboratory Protocols. These protocols lead students through processes for taking E. coli cells and transforming them into a new antibiotic resistant strain. The workshop featured discussions of the role of DNA recombinant technology in…

  18. Protein–DNA Interactions

    NARCIS (Netherlands)

    Kovacic, L.; Boelens, R.

    2012-01-01

    The recognition of specific DNA sequences by proteins and the coupling to signaling events are fundamental occurrences that lie at the root of many cellular processes. Many examples of tight control by protein–DNA interactions can be found in such dynamic processes as transcription, replication and

  19. Characterization of muntjac DNA

    Energy Technology Data Exchange (ETDEWEB)

    Davis, R.C.

    1981-05-27

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange.

  20. Workshop on DNA repair.

    NARCIS (Netherlands)

    A.R. Lehmann (Alan); J.H.J. Hoeijmakers (Jan); A.A. van Zeeland (Albert); C.M.P. Backendorf (Claude); B.A. Bridges; A. Collins; R.P.D. Fuchs; G.P. Margison; R. Montesano; E. Moustacchi; A.T. Natarajan; M. Radman; A. Sarasin; E. Seeberg; C.A. Smith; M. Stefanini (Miria); L.H. Thompson; G.P. van der Schans; C.A. Weber (Christine); M.Z. Zdzienika

    1992-01-01

    textabstractA workshop on DNA repair with emphasis on eukaryotic systems was held, under the auspices of the EC Concerted Action on DNA Repair and Cancer, at Noordwijkerhout (The Netherlands) 14-19 April 1991. The local organization of the meeting was done under the auspices of the Medical Genetic C

  1. Extended DNA Tile Actuators

    DEFF Research Database (Denmark)

    Kristiansen, Martin; Kryger, Mille; Zhang, Zhao;

    2012-01-01

    A dynamic linear DNA tile actuator is expanded to three new structures of higher complexity. The original DNA actuator was constructed from a central roller strand which hybridizes with two piston strands by forming two half-crossover junctions. A linear expansion of the actuator is obtained...

  2. Premeltons in DNA.

    Science.gov (United States)

    Sobell, Henry M

    2016-03-01

    Premeltons are examples of emergent-structures (i.e., structural-solitons) that arise spontaneously in DNA due to the presence of nonlinear-excitations in its structure. They are of two kinds: B-B (or A-A) premeltons form at specific DNA-regions to nucleate site-specific DNA melting. These are stationary and, being globally-nontopological, undergo breather-motions that allow drugs and dyes to intercalate into DNA. B-A (or A-B) premeltons, on the other hand, are mobile, and being globally-topological, act as phase-boundaries transforming B- into A-DNA during the structural phase-transition. They are not expected to undergo breather motions. A key feature of both types of premeltons is the presence of an intermediate structural-form in their central regions (proposed as being a transition-state intermediate in DNA-melting and in the B- to A-transition), which differs from either A- or B-DNA. Called beta-DNA, this is both metastable and hyperflexible--and contains an alternating sugar-puckering pattern along the polymer backbone combined with the partial unstacking (in its lower energy-forms) of every-other base-pair. Beta-DNA is connected to either B- or to A-DNA on either side by boundaries possessing a gradation of nonlinear structural-change, these being called the kink and the antikink regions. The presence of premeltons in DNA leads to a unifying theory to understand much of DNA physical chemistry and molecular biology. In particular, premeltons are predicted to define the 5' and 3' ends of genes in naked-DNA and DNA in active-chromatin, this having important implications for understanding physical aspects of the initiation, elongation and termination of RNA-synthesis during transcription. For these and other reasons, the model will be of broader interest to the general-audience working in these areas. The model explains a wide variety of data, and carries with it a number of experimental predictions--all readily testable--as will be described in this review.

  3. Archaeal DNA replication.

    Science.gov (United States)

    Kelman, Lori M; Kelman, Zvi

    2014-01-01

    DNA replication is essential for all life forms. Although the process is fundamentally conserved in the three domains of life, bioinformatic, biochemical, structural, and genetic studies have demonstrated that the process and the proteins involved in archaeal DNA replication are more similar to those in eukaryal DNA replication than in bacterial DNA replication, but have some archaeal-specific features. The archaeal replication system, however, is not monolithic, and there are some differences in the replication process between different species. In this review, the current knowledge of the mechanisms governing DNA replication in Archaea is summarized. The general features of the replication process as well as some of the differences are discussed. PMID:25421597

  4. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  5. DNA vaccines against influenza.

    Science.gov (United States)

    Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka

    2014-01-01

    Genetic vaccine technology has been considerably developed within the last two decades. This cost effective and promising strategy can be applied for therapy of cancers and for curing allergy, chronic and infectious diseases, such as a seasonal and pandemic influenza. Despite numerous advantages, several limitations of this technology reduce its performance and can retard its commercial exploitation in humans and its veterinary applications. Inefficient delivery of the DNA vaccine into cells of immunized individuals results in low intracellular supply of suitable expression cassettes encoding an antigen, in its low expression level and, in turn, in reduced immune responses against the antigen. Improvement of DNA delivery into the host cells might significantly increase effectiveness of the DNA vaccine. A vast array of innovative methods and various experimental strategies have been applied in order to enhance the effectiveness of DNA vaccines. They include various strategies improving DNA delivery as well as expression and immunogenic potential of the proteins encoded by the DNA vaccines. Researchers focusing on DNA vaccines against influenza have applied many of these strategies. Recent examples of the most successful modern approaches are discussed in this review.

  6. DNA mini-barcodes.

    Science.gov (United States)

    Hajibabaei, Mehrdad; McKenna, Charly

    2012-01-01

    Conventional DNA barcoding uses an approximately 650 bp DNA barcode of the mitochondrial gene COI for species identification in animal groups. Similar size fragments from chloroplast genes have been proposed as barcode markers for plants. While PCR amplification and sequencing of a 650 bp fragment is consistent in freshly collected and well-preserved specimens, it is difficult to obtain a full-length barcode in older museum specimens and samples which have been preserved in formalin or similar DNA-unfriendly preservatives. A comparable issue may prevent effective DNA-based authentication and testing in processed biological materials, such as food products, pharmaceuticals, and nutraceuticals. In these cases, shorter DNA sequences-mini-barcodes-have been robustly recovered and shown to be effective in identifying majority of specimens to a species level. Furthermore, short DNA regions can be utilized via high-throughput sequencing platforms providing an inexpensive and comprehensive means of large-scale species identification. These properties of mini-barcodes, coupled with the availability of standardized and universal primers make mini-barcodes a feasible option for DNA barcode analysis in museum samples and applied diagnostic and environmental biodiversity analysis.

  7. HIV DNA Integration

    Science.gov (United States)

    Craigie, Robert; Bushman, Frederic D.

    2012-01-01

    Retroviruses are distinguished from other viruses by two characteristic steps in the viral replication cycle. The first is reverse transcription, which results in the production of a double-stranded DNA copy of the viral RNA genome, and the second is integration, which results in covalent attachment of the DNA copy to host cell DNA. The initial catalytic steps of the integration reaction are performed by the virus-encoded integrase (IN) protein. The chemistry of the IN-mediated DNA breaking and joining steps is well worked out, and structures of IN-DNA complexes have now clarified how the overall complex assembles. Methods developed during these studies were adapted for identification of IN inhibitors, which received FDA approval for use in patients in 2007. At the chromosomal level, HIV integration is strongly favored in active transcription units, which may promote efficient viral gene expression after integration. HIV IN binds to the cellular factor LEDGF/p75, which promotes efficient infection and tethers IN to favored target sites. The HIV integration machinery must also interact with many additional host factors during infection, including nuclear trafficking and pore proteins during nuclear entry, histones during initial target capture, and DNA repair proteins during completion of the DNA joining steps. Models for some of the molecular mechanisms involved have been proposed, but important details remain to be clarified. PMID:22762018

  8. Quantitive DNA Fiber Mapping

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  9. What Controls DNA Looping?

    Directory of Open Access Journals (Sweden)

    Pamela J. Perez

    2014-08-01

    Full Text Available The looping of DNA provides a means of communication between sequentially distant genomic sites that operate in tandem to express, copy, and repair the information encoded in the DNA base sequence. The short loops implicated in the expression of bacterial genes suggest that molecular factors other than the naturally stiff double helix are involved in bringing the interacting sites into close spatial proximity. New computational techniques that take direct account of the three-dimensional structures and fluctuations of protein and DNA allow us to examine the likely means of enhancing such communication. Here, we describe the application of these approaches to the looping of a 92 base-pair DNA segment between the headpieces of the tetrameric Escherichia coli Lac repressor protein. The distortions of the double helix induced by a second protein—the nonspecific nucleoid protein HU—increase the computed likelihood of looping by several orders of magnitude over that of DNA alone. Large-scale deformations of the repressor, sequence-dependent features in the DNA loop, and deformability of the DNA operators also enhance looping, although to lesser degrees. The correspondence between the predicted looping propensities and the ease of looping derived from gene-expression and single-molecule measurements lends credence to the derived structural picture.

  10. Radiation-induced DNA damage and DNA repair

    International Nuclear Information System (INIS)

    Although DNA undergoes various types of damage from radiation, active oxygen, and the like, a living body has a plurality of DNA repair mechanisms responding to the types of DNA damage. On the other hand, there are a system that results in cell death if the repair is impossible and a mechanism to lead to concretization if further repair is not accurately made. This paper explains the following items as the basic researches on these types of DNA damage and the repair mechanisms: (1) biological effects of DNA damage, (2) effect of DNA damage on DNA synthesis, and (3) effects of DNA damage on cells. It also explains the effects of radiation on cells with a focus on specific mechanism for (1) DNA damage caused by direct action due to radiation and by indirect action due mainly to active oxygen, and (2) DNA repair mechanism that works on DNA double-strand break (DSB). (A.O.)

  11. DNA-PK assay

    Science.gov (United States)

    Anderson, Carl W.; Connelly, Margery A.

    2004-10-12

    The present invention provides a method for detecting DNA-activated protein kinase (DNA-PK) activity in a biological sample. The method includes contacting a biological sample with a detectably-labeled phosphate donor and a synthetic peptide substrate defined by the following features to provide specific recognition and phosphorylation by DNA-PK: (1) a phosphate-accepting amino acid pair which may include serine-glutamine (Ser-Gln) (SQ), threonine-glutamine (Thr-Gln) (TQ), glutamine-serine (Gln-Ser) (QS), or glutamine-threonine (Gln-Thr) (QT); (2) enhancer amino acids which may include glutamic acid or glutamine immediately adjacent at the amino- or carboxyl- side of the amino acid pair and forming an amino acid pair-enhancer unit; (3) a first spacer sequence at the amino terminus of the amino acid pair-enhancer unit; (4) a second spacer sequence at the carboxyl terminus of the amino acid pair-enhancer unit, which spacer sequences may include any combination of amino acids that does not provide a phosphorylation site consensus sequence motif; and, (5) a tag moiety, which may be an amino acid sequence or another chemical entity that permits separating the synthetic peptide from the phosphate donor. A compostion and a kit for the detection of DNA-PK activity are also provided. Methods for detecting DNA, protein phosphatases and substances that alter the activity of DNA-PK are also provided. The present invention also provides a method of monitoring protein kinase and DNA-PK activity in living cells. -A composition and a kit for monitoring protein kinase activity in vitro and a composition and a kit for monitoring DNA-PK activities in living cells are also provided. A method for identifying agents that alter protein kinase activity in vitro and a method for identifying agents that alter DNA-PK activity in living cells are also provided.

  12. DNA from keratinous tissue

    DEFF Research Database (Denmark)

    Olsen, Maia E.; Bengtsson, Camilla Friis; Bertelsen, Mads Frost;

    2012-01-01

    feathers. As with nail and hair, we demonstrate that although DNA can, in general, be recovered from all parts of the feather, the quality of such DNA varies. As such, although one can expect a priori that genetic analyses are possible on the feather, for PCR based analyses, it is extremely difficult...... to predict the size of amplicon that can be used in such analyses. However, PCR-free genetic analyses that can exploit much smaller DNA fragments may promise to be a powerful tool for future exploitation....

  13. "Artifactual" arsenate DNA

    DEFF Research Database (Denmark)

    Nielsen, Peter E

    2012-01-01

    The recent claim by Wolfe-Simon et al. that the Halomonas bacterial strain GFAJ-1 when grown in arsenate-containing medium with limiting phosphate is able to substitute phosphate with arsenate in biomolecules including nucleic acids and in particular DNA(1) arose much skepticism, primarily due...... to the very limited chemical stability of arsenate esters (see ref. 2 and references therein). A major part of the criticisms was concerned with the insufficient (bio)chemical evidence in the Wolfe-Simon study for the actual chemical incorporation of arsenate in DNA (and/or RNA). Redfield et al. now present...... evidence that the identification of arsenate DNA was artifactual....

  14. DNA Sampling Hook

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The DNA Sampling Hook is a significant improvement on a method of obtaining a tissue sample from a live fish in situ from an aquatic environment. A tissue sample...

  15. Whose DNA is this?

    DEFF Research Database (Denmark)

    Taroni, Franco; Biedermann, Alex; Vuille, Joëlle;

    2013-01-01

    evoked during the international conference "The hidden side of DNA profiles. Artifacts, errors and uncertain evidence" held in Rome (April 27th to 28th, 2012). Indeed, despite the fact that this conference brought together some of the world's leading forensic DNA specialists, it appeared clearly......This communication seeks to draw the attention of researchers and practitioners dealing with forensic DNA profiling analyses to the following question: is a scientist's report, offering support to a hypothesis according to which a particular individual is the source of DNA detected during...... the analysis of a stain, relevant from the point of view of a Court of Justice? This question relates to skeptical views previously voiced by commentators mainly in the judicial area, but is avoided by a large majority of forensic scientists. Notwithstanding, the pivotal role of this question has recently been...

  16. DNA sequencing conference, 2

    Energy Technology Data Exchange (ETDEWEB)

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  17. DNA damage and carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Stelow, R B

    1980-01-01

    Although cancer may arise as a result of many different types of molecular changes, there is little reason to doubt that changes to DNA are one of the more important ones in cancer initiation. Although DNA repair mechanisms seem able to eliminate a very large fraction of deleterious changes to DNA, we not only have little insight into the molecular mechanisms involved in such repair, but have a negligible amount of information to permit us to estimate the shape of dose response relations at low doses. The case of skin cancer is a special one, in that the average population is exposed to sufficient solar uv so that the effects of small increments in uv dose may be estimated. An approximate 85% reduction in DNA repair increases skin cancer incidence 10/sup 4/ fold.

  18. FBI's DNA analysis program

    Science.gov (United States)

    Brown, John R.

    1994-03-01

    Forensic DNA profiling technology is a significant law enforcement tool due to its superior discriminating power. Applying the principles of population genetics to the DNA profile obtained in violent crime investigations results in low frequency of occurrence estimates for the DNA profile. These estimates often range from a frequency of occurrence of 1 in 50 unrelated individuals to 1 in a million unrelated individuals or even smaller. It is this power to discriminate among individuals in the population that has propelled forensic DNA technology to the forefront of forensic testing in violent crime cases. Not only is the technology extremely powerful in including or excluding a criminal suspect as the perpetrator, but it also gives rise to the potential of identifying criminal suspects in cases where the investigators of unknown suspect cases have exhausted all other available leads.

  19. Kink solitons in DNA

    CERN Document Server

    Zdravković, S; Daniel, M

    2012-01-01

    We here examine the nonlinear dynamics of artificial homogeneous DNA chain relying on the plain-base rotator model. It is shown that such dynamics can exhibit kink and antikink solitons of sine-Gordon type. In that respect we propose possible experimental assays based on single molecule micromanipulation techniques. The aim of these experiments is to excite the rotational waves and to determine their speeds along excited DNA. We propose that these experiments should be conducted either for the case of double stranded (DS) or single stranded (SS) DNA. A key question is to compare the corresponding velocities of the rotational waves indicating which one is bigger. The ratio of these velocities appears to be related with the sign of the model parameter representing ratio of the hydrogen-bonding and the covalent-bonding interaction within the considered DNA chain.

  20. DNA fusion gene vaccines

    DEFF Research Database (Denmark)

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup;

    2010-01-01

    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... of antigens into molecular domains that enhance antigen presentation. More specifically, the immunogenicity of DNA vaccines may benefit from increased protein synthesis, increased T-cell help and MHC class I presentation, and the addition of a range of specific cytokines and pathogen-associated molecular...... with viral-vectored vaccines, various synergistic components may need to be incorporated into DNA vaccines. From the perspective of the future clinical use of DNA vaccines, it has been suggested that antigen presentation should be improved and cytokine coadministration attempted. However, even...

  1. DNA synthesis on discontinuous templates by human DNA polymerases: implications for non-homologous DNA recombination.

    OpenAIRE

    Islas, L; Fairley, C F; Morgan, W. F.

    1998-01-01

    DNA polymerases catalyze the synthesis of DNA using a continuous uninterrupted template strand. However, it has been shown that a 3'-->5' exonuclease-deficient form of the Klenow fragment of Escherichia coli DNA polymerase I as well as DNA polymerase of Thermus aquaticus can synthesize DNA across two unlinked DNA templates. In this study, we used an oligonucleotide-based assay to show that discontinuous DNA synthesis was present in HeLa cell extracts. DNA synthesis inhibitor studies as well a...

  2. Interaction of DNA and DNA-anti-DNA complexes to fibronectin

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, R.C.; Simpson, W.A.; Raghow, R.; Hasty, K.

    1986-03-01

    Fibronectin (Fn) is a large multidomain glycoprotein found in the basement membrane, on cell surface and in plasma. The interactions of Fn with DNA may be significant in glomerular deposition of DNA-anti-DNA complexes in patients with systemic lupus erythematosus (SLE). The authors examined the binding of DNA and DNA-anti-DNA complexes to Fn by a solid phase assay in which Fn was coated to microtiter plates and reacted with (/sup 3/H)DNA or DNA complexes with a monoclonal anti-DNA antibody. The optimal interaction of DNA with Fn occurs at <0.1M NaCl suggesting that the binding is charge dependent; the specificity of this binding was shown by competitive inhibition and locking experiments using anti-Fn. The binding was maximum at pH 6.5 and in the absence of Ca/sup 2 +/. The addition of Clq enhanced the binding of DNA and DNA-anti-DNA complexes to Fn, whereas heparan sulfate inhibited such binding. The monomeric or aggregated IgC did not bind Fn but aggregated IgG bound to Fn in the presence of Clq. Furthermore, DNA-anti-DNA complexes in sera from active SLE patients bound Fn which was enhanced in the presence of Clq; DNase abolished this binding indicating that the interaction of these complexes was mediated by DNA. These observations may partially explain the molecular mechanism(s) of the deposition of DNA-anti-DNA complexes in basement membrane.

  3. Patterning nanocrystals using DNA

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Shara Carol

    2003-09-01

    One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made.[1] Here, we have sought to assemble larger and more complex nanostructures. Gold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure [2][3] that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA ''trimer.'' This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices

  4. Expansion of the DNA Alphabet beyond Natural DNA Recognition.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Sugimoto, Naoki

    2016-07-15

    Simple and inexpensive DNA fibres: New, stable DNA structures are created by the binding of a small molecule to poly(A). Because these DNA fibres are formed from inexpensive materials by using very simple methods, DNA materials suitable for practical use such as information storage should be possible in the near future. PMID:27061868

  5. Ejer jeg mit DNA?

    DEFF Research Database (Denmark)

    Hoffmeyer, Jesper

    2010-01-01

    Havasupai-indianerne har så lidt som nogen andre mennesker selv frembragt deres DNA. Det repræsenterer en form for biologisk viden opsamlet gennem milliuoner af års forhistorie......Havasupai-indianerne har så lidt som nogen andre mennesker selv frembragt deres DNA. Det repræsenterer en form for biologisk viden opsamlet gennem milliuoner af års forhistorie...

  6. What Controls DNA Looping?

    OpenAIRE

    Perez, Pamela J.; Nicolas Clauvelin; Grosner, Michael A.; Colasanti, Andrew V.; Olson, Wilma K.

    2014-01-01

    The looping of DNA provides a means of communication between sequentially distant genomic sites that operate in tandem to express, copy, and repair the information encoded in the DNA base sequence. The short loops implicated in the expression of bacterial genes suggest that molecular factors other than the naturally stiff double helix are involved in bringing the interacting sites into close spatial proximity. New computational techniques that take direct account of the three-dimensional stru...

  7. DNA-Origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Gothelf, Kurt Vesterager

    2010-01-01

    DNA-nanostrukturer giver nye muligheder for studier af individuelle molekyler. Ved at udnytte DNAs unikke selvsamlende egenskaber kan man designe systemer, hvorpå der kan studeres kemiske reaktioner, fluoroforer og biiomolekyler på enkeltmolekyle-niveau.......DNA-nanostrukturer giver nye muligheder for studier af individuelle molekyler. Ved at udnytte DNAs unikke selvsamlende egenskaber kan man designe systemer, hvorpå der kan studeres kemiske reaktioner, fluoroforer og biiomolekyler på enkeltmolekyle-niveau....

  8. Photofootprinting of DNA triplexes.

    OpenAIRE

    Lyamichev, V I; Voloshin, O N; Frank-Kamenetskii, M D; Soyfer, V N

    1991-01-01

    We have used a photofootprinting assay to study intermolecular and intramolecular DNA triplexes. The assay is based on the fact that the DNA duplex is protected against photodamage (specifically, against the formation of the (6-4) pyrimidine photoproducts) within a triplex structure. We have shown that this is the case for PyPuPu (YRR) as well as PyPuPy (YRY) triplexes. Using the photofootprinting assay, we have studied the triplex formation under a variety of experimentally defined condition...

  9. PDA: Pooled DNA analyzer

    Directory of Open Access Journals (Sweden)

    Lin Chin-Yu

    2006-04-01

    Full Text Available Abstract Background Association mapping using abundant single nucleotide polymorphisms is a powerful tool for identifying disease susceptibility genes for complex traits and exploring possible genetic diversity. Genotyping large numbers of SNPs individually is performed routinely but is cost prohibitive for large-scale genetic studies. DNA pooling is a reliable and cost-saving alternative genotyping method. However, no software has been developed for complete pooled-DNA analyses, including data standardization, allele frequency estimation, and single/multipoint DNA pooling association tests. This motivated the development of the software, 'PDA' (Pooled DNA Analyzer, to analyze pooled DNA data. Results We develop the software, PDA, for the analysis of pooled-DNA data. PDA is originally implemented with the MATLAB® language, but it can also be executed on a Windows system without installing the MATLAB®. PDA provides estimates of the coefficient of preferential amplification and allele frequency. PDA considers an extended single-point association test, which can compare allele frequencies between two DNA pools constructed under different experimental conditions. Moreover, PDA also provides novel chromosome-wide multipoint association tests based on p-value combinations and a sliding-window concept. This new multipoint testing procedure overcomes a computational bottleneck of conventional haplotype-oriented multipoint methods in DNA pooling analyses and can handle data sets having a large pool size and/or large numbers of polymorphic markers. All of the PDA functions are illustrated in the four bona fide examples. Conclusion PDA is simple to operate and does not require that users have a strong statistical background. The software is available at http://www.ibms.sinica.edu.tw/%7Ecsjfann/first%20flow/pda.htm.

  10. Introduction to DNA methods

    International Nuclear Information System (INIS)

    The purpose of this session is to discuss the various possibilities for detecting modifications in DNA after irradiation and whether these changes can be utilized as an indicator for the irradiation treatment of foods. The requirement to be fulfilled is that the method be able to distinguish irradiated food without the presence of a control sample, thus the measured response after irradiation must be large enough to supersede background levels from other treatments. Much work has been performed on the effects of radiation on DNA, particularly due to its importance in radiation biology. The main lesions of DNA as a result of irradiation are base damage, damage of the sugar moiety, single strand and double strand breaks. Crosslinking between bases also occurs, e.g. production of thymine dimers, or between DNA and protein. A valuable review on how to utilize these DNA changes for detection purposes has already appeared. Tables 1, 2 and 3 list the proposed methods of detecting changes in irradiated DNA, some identified products as examples for a possible irradiation indicator, in the case of immunoassay the substance used as antigen, and some selected literature references. In this short review, it is not intended to provide a complete literature survey

  11. DNA vaccines and intradermal vaccination by DNA tattooing.

    Science.gov (United States)

    Oosterhuis, K; van den Berg, J H; Schumacher, T N; Haanen, J B A G

    2012-01-01

    Over the past two decades, DNA vaccination has been developed as a method for the induction of immune responses. However, in spite of high expectations based on their efficacy in preclinical models, immunogenicity of first generation DNA vaccines in clinical trials was shown to be poor, and no DNA vaccines have yet been licensed for human use. In recent years significant progress has been made in the development of second generation DNA vaccines and DNA vaccine delivery methods. Here we review the key characteristics of DNA vaccines as compared to other vaccine platforms, and recent insights into the prerequisites for induction of immune responses by DNA vaccines will be discussed. We illustrate the development of second generation DNA vaccines with the description of DNA tattooing as a novel DNA delivery method. This technique has shown great promise both in a small animal model and in non-human primates and is currently under clinical evaluation.

  12. Carbinolamine formation and dehydration in a DNA repair enzyme active site.

    Directory of Open Access Journals (Sweden)

    M L Dodson

    Full Text Available In order to suggest detailed mechanistic hypotheses for the formation and dehydration of a key carbinolamine intermediate in the T4 pyrimidine dimer glycosylase (T4PDG reaction, we have investigated these reactions using steered molecular dynamics with a coupled quantum mechanics-molecular mechanics potential (QM/MM. We carried out simulations of DNA abasic site carbinolamine formation with and without a water molecule restrained to remain within the active site quantum region. We recovered potentials of mean force (PMF from thirty replicate reaction trajectories using Jarzynski averaging. We demonstrated feasible pathways involving water, as well as those independent of water participation. The water-independent enzyme-catalyzed reaction had a bias-corrected Jarzynski-average barrier height of approximately (6.5 kcal mol(-1 (27.2 kJ mol(-1 for the carbinolamine formation reaction and 44.5 kcal mol(-1 (186 kJ mol(-1 for the reverse reaction at this level of representation. When the proton transfer was facilitated with an intrinsic quantum water, the barrier height was approximately 15 kcal mol(-1 (62.8 kJ mol(-1 in the forward (formation reaction and 19 kcal mol(-1 (79.5 kJ mol(-1 for the reverse. In addition, two modes of unsteered (free dynamics carbinolamine dehydration were observed: in one, the quantum water participated as an intermediate proton transfer species, and in the other, the active site protonated glutamate hydrogen was directly transferred to the carbinolamine oxygen. Water-independent unforced proton transfer from the protonated active site glutamate carboxyl to the unprotonated N-terminal amine was also observed. In summary, complex proton transfer events, some involving water intermediates, were studied in QM/MM simulations of T4PDG bound to a DNA abasic site. Imine carbinolamine formation was characterized using steered QM/MM molecular dynamics. Dehydration of the carbinolamine intermediate to form the final imine product

  13. Accumulation of lipids and oxidatively damaged DNA in hepatocytes exposed to particles

    Energy Technology Data Exchange (ETDEWEB)

    Vesterdal, Lise K.; Danielsen, Pernille H.; Folkmann, Janne K.; Jespersen, Line F.; Aguilar-Pelaez, Karin; Roursgaard, Martin; Loft, Steffen; Møller, Peter, E-mail: pemo@sund.ku.dk

    2014-01-15

    Exposure to particles has been suggested to generate hepatosteatosis by oxidative stress mechanisms. We investigated lipid accumulation in cultured human hepatocytes (HepG2) and rat liver after exposure to four different carbon-based particles. HepG2 cells were exposed to particles for 3 h and subsequently incubated for another 18 h to manifest lipid accumulation. In an animal model of metabolic syndrome we investigated the association between intake of carbon black (CB, 14 nm) particles and hepatic lipid accumulation, inflammation and gene expression of Srebp-1, Fasn and Scd-1 involved in lipid synthesis. There was a concentration-dependent increase in intracellular lipid content after exposure to CB in HepG2 cells, which was only observed after co-exposure to oleic/palmitic acid. Similar results were observed in HepG2 cells after exposure to diesel exhaust particles, fullerenes C{sub 60} or pristine single-walled carbon nanotubes. All four types of particles also generated oxidatively damaged DNA, assessed as formamidopyrimidine DNA glycosylase (FPG) sensitive sites, in HepG2 cells after 3 h exposure. The animal model of metabolic syndrome showed increased lipid load in the liver after one oral exposure to 6.4 mg/kg of CB in lean Zucker rats. This was not associated with increased iNOS staining in the liver, indicating that the oral CB exposure was associated with hepatic steatosis rather than steatohepatitis. The lipid accumulation did not seem to be related to increased lipogenesis because there were unaltered gene expression levels in both the HepG2 cells and rat livers. Collectively, exposure to particles is associated with oxidative stress and steatosis in hepatocytes. - Highlights: • Oral exposure to nanosized carbon black was associated with hepatosteatosis in rats. • In vitro studies included carbon black, C{sub 60}, diesel exhaust particles and SWCNTs. • Exposure to particles and free fatty acids increased lipid load in HepG2 cells. • Unaltered

  14. Origin DNA Melting and Unwinding in DNA Replication

    OpenAIRE

    Gai, Dahai; Chang, Y Paul; Chen, Xiaojiang S.

    2010-01-01

    Genomic DNA replication is a necessary step in the life cycles of all organisms. To initiate DNA replication, the double-stranded DNA (dsDNA) at the origin of replication must be separated or melted; this melted region is propagated and a mature replication fork is formed. To accomplish origin recognition, initial DNA melting, and the eventual formation of a replication fork, coordinated activity of initiators, helicases, and other cellular factors are required. In this review, we focus on re...

  15. DNA display I. Sequence-encoded routing of DNA populations.

    OpenAIRE

    Halpin, David R; Pehr B Harbury

    2004-01-01

    Recently reported technologies for DNA-directed organic synthesis and for DNA computing rely on routing DNA populations through complex networks. The reduction of these ideas to practice has been limited by a lack of practical experimental tools. Here we describe a modular design for DNA routing genes, and routing machinery made from oligonucleotides and commercially available chromatography resins. The routing machinery partitions nanomole quantities of DNA into physically distinct subpools ...

  16. Exposure to runoff from coal-tar-sealed pavement induces genotoxicity and impairment of DNA repair capacity in the RTL-W1 fish liver cell line

    Energy Technology Data Exchange (ETDEWEB)

    Kienzler, Aude, E-mail: aude.kienzler@entpe.fr [Université de Lyon, UMR LEHNA 5023, USC INRA, ENTPE, rue Maurice Audin, Vaulx-en-Velin F-69518 (France); Mahler, Barbara J., E-mail: bjmahler@usgs.gov [U.S. Geological Survey, 1505 Ferguson Lane, Austin, TX 78754 (United States); Van Metre, Peter C., E-mail: pcvanmet@usgs.gov [U.S. Geological Survey, 1505 Ferguson Lane, Austin, TX 78754 (United States); Schweigert, Nathalie [Université de Lyon, UMR LEHNA 5023, USC INRA, ENTPE, rue Maurice Audin, Vaulx-en-Velin F-69518 (France); Devaux, Alain, E-mail: alain.devaux@entpe.fr [Université de Lyon, UMR LEHNA 5023, USC INRA, ENTPE, rue Maurice Audin, Vaulx-en-Velin F-69518 (France); Bony, Sylvie, E-mail: bony@entpe.fr [Université de Lyon, UMR LEHNA 5023, USC INRA, ENTPE, rue Maurice Audin, Vaulx-en-Velin F-69518 (France)

    2015-07-01

    Coal-tar-based (CTB) sealcoat, frequently applied to parking lots and driveways in North America, contains elevated concentrations of polycyclic aromatic hydrocarbons (PAHs) and related compounds. The RTL-W1 fish liver cell line was used to investigate two endpoints (genotoxicity and DNA-repair-capacity impairment) associated with exposure to runoff from asphalt pavement with CTB sealcoat or with an asphalt-based sealcoat hypothesized to contain about 7% CTB sealcoat (AS-blend). Genotoxic potential was assessed by the Formamido pyrimidine glycosylase (Fpg)-modified comet assay for 1:10 and 1:100 dilutions of runoff samples collected from 5 h to 36 d following sealcoat application. DNA-repair capacity was assessed by the base excision repair comet assay for 1:10 dilution of samples collected 26 h and 36 d following application. Both assays were run with and without co-exposure to ultraviolet-A radiation (UVA). With co-exposure to UVA, genotoxic effects were significant for both dilutions of CTB runoff for three of four sample times, and for some samples of AS-blend runoff. Base excision repair was significantly impaired for CTB runoff both with and without UVA exposure, and for AS-blend runoff only in the absence of UVA. This study is the first to investigate the effects of exposure to the complex mixture of chemicals in coal tar on DNA repair capacity. The results indicate that co-exposure to runoff from CT-sealcoated pavement and UVA as much as a month after sealcoat application has the potential to cause genotoxicity and impair DNA repair capacity. - Highlights: • Co-exposure to runoff from coal-tar-sealcoated pavement and UVA caused DNA damage. • Significant genotoxicity occurred with a 1:100 dilution of runoff. • Runoff collected up to 36 d following coal-tar-sealcoat application was genotoxic. • Exposure to runoff from sealed pavement impaired an important DNA repair pathway. • Repair capacity was impaired with a 1:10 dilution of runoff (1:100 not

  17. Exposure to runoff from coal-tar-sealed pavement induces genotoxicity and impairment of DNA repair capacity in the RTL-W1 fish liver cell line

    International Nuclear Information System (INIS)

    Coal-tar-based (CTB) sealcoat, frequently applied to parking lots and driveways in North America, contains elevated concentrations of polycyclic aromatic hydrocarbons (PAHs) and related compounds. The RTL-W1 fish liver cell line was used to investigate two endpoints (genotoxicity and DNA-repair-capacity impairment) associated with exposure to runoff from asphalt pavement with CTB sealcoat or with an asphalt-based sealcoat hypothesized to contain about 7% CTB sealcoat (AS-blend). Genotoxic potential was assessed by the Formamido pyrimidine glycosylase (Fpg)-modified comet assay for 1:10 and 1:100 dilutions of runoff samples collected from 5 h to 36 d following sealcoat application. DNA-repair capacity was assessed by the base excision repair comet assay for 1:10 dilution of samples collected 26 h and 36 d following application. Both assays were run with and without co-exposure to ultraviolet-A radiation (UVA). With co-exposure to UVA, genotoxic effects were significant for both dilutions of CTB runoff for three of four sample times, and for some samples of AS-blend runoff. Base excision repair was significantly impaired for CTB runoff both with and without UVA exposure, and for AS-blend runoff only in the absence of UVA. This study is the first to investigate the effects of exposure to the complex mixture of chemicals in coal tar on DNA repair capacity. The results indicate that co-exposure to runoff from CT-sealcoated pavement and UVA as much as a month after sealcoat application has the potential to cause genotoxicity and impair DNA repair capacity. - Highlights: • Co-exposure to runoff from coal-tar-sealcoated pavement and UVA caused DNA damage. • Significant genotoxicity occurred with a 1:100 dilution of runoff. • Runoff collected up to 36 d following coal-tar-sealcoat application was genotoxic. • Exposure to runoff from sealed pavement impaired an important DNA repair pathway. • Repair capacity was impaired with a 1:10 dilution of runoff (1:100 not

  18. Simultaneous RNA-DNA FISH.

    Science.gov (United States)

    Lai, Lan-Tian; Meng, Zhenyu; Shao, Fangwei; Zhang, Li-Feng

    2016-01-01

    A highly useful tool for studying lncRNAs is simultaneous RNA-DNA FISH, which reveals the localization and quantitative information of RNA and DNA in cellular contexts. However, a simple combination of RNA FISH and DNA FISH often generates disappointing results because the fragile RNA signals are often damaged by the harsh conditions used in DNA FISH for denaturing the DNA. Here, we describe a robust and simple RNA-DNA FISH protocol, in which amino-labeled nucleic acid probes are used for RNA FISH. The method is suitable to detect single-RNA molecules simultaneously with DNA.

  19. Defects of mitochondrial DNA replication.

    Science.gov (United States)

    Copeland, William C

    2014-09-01

    Mitochondrial DNA is replicated by DNA polymerase γ in concert with accessory proteins such as the mitochondrial DNA helicase, single-stranded DNA binding protein, topoisomerase, and initiating factors. Defects in mitochondrial DNA replication or nucleotide metabolism can cause mitochondrial genetic diseases due to mitochondrial DNA deletions, point mutations, or depletion, which ultimately cause loss of oxidative phosphorylation. These genetic diseases include mitochondrial DNA depletion syndromes such as Alpers or early infantile hepatocerebral syndromes, and mitochondrial DNA deletion disorders, such as progressive external ophthalmoplegia, ataxia-neuropathy, or mitochondrial neurogastrointestinal encephalomyopathy. This review focuses on our current knowledge of genetic defects of mitochondrial DNA replication (POLG, POLG2, C10orf2, and MGME1) that cause instability of mitochondrial DNA and mitochondrial disease.

  20. Forensic DNA profiling and database.

    Science.gov (United States)

    Panneerchelvam, S; Norazmi, M N

    2003-07-01

    The incredible power of DNA technology as an identification tool had brought a tremendous change in crimnal justice . DNA data base is an information resource for the forensic DNA typing community with details on commonly used short tandem repeat (STR) DNA markers. This article discusses the essential steps in compilation of COmbined DNA Index System (CODIS) on validated polymerase chain amplified STRs and their use in crime detection.

  1. Forensic DNA Profiling and Database

    OpenAIRE

    Panneerchelvam, S.; Norazmi, M. N.

    2003-01-01

    The incredible power of DNA technology as an identification tool had brought a tremendous change in crimnal justice . DNA data base is an information resource for the forensic DNA typing community with details on commonly used short tandem repeat (STR) DNA markers. This article discusses the essential steps in compilation of COmbined DNA Index System (CODIS) on validated polymerase chain amplified STRs and their use in crime detection.

  2. DNA Nanotechnology for Cancer Therapy

    OpenAIRE

    Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio

    2016-01-01

    DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as sta...

  3. Local chromatin microenvironment determines DNMT activity : from DNA methyltransferase to DNA demethylase or DNA dehydroxymethylase

    NARCIS (Netherlands)

    van der Wijst, Monique G. P.; Venkiteswaran, Muralidhar; Chen, Hui; Xu, Guo-Liang; Plosch, Torsten; Rots, Marianne G.

    2015-01-01

    Insights on active DNA demethylation disproved the original assumption that DNA methylation is a stable epigenetic modification. Interestingly, mammalian DNA methyltransferases 3A and 3B (DNMT-3A and -3B) have also been reported to induce active DNA demethylation, in addition to their well-known fun

  4. Programmable Quantitative DNA Nanothermometers.

    Science.gov (United States)

    Gareau, David; Desrosiers, Arnaud; Vallée-Bélisle, Alexis

    2016-07-13

    Developing molecules, switches, probes or nanomaterials that are able to respond to specific temperature changes should prove of utility for several applications in nanotechnology. Here, we describe bioinspired strategies to design DNA thermoswitches with programmable linear response ranges that can provide either a precise ultrasensitive response over a desired, small temperature interval (±0.05 °C) or an extended linear response over a wide temperature range (e.g., from 25 to 90 °C). Using structural modifications or inexpensive DNA stabilizers, we show that we can tune the transition midpoints of DNA thermometers from 30 to 85 °C. Using multimeric switch architectures, we are able to create ultrasensitive thermometers that display large quantitative fluorescence gains within small temperature variation (e.g., > 700% over 10 °C). Using a combination of thermoswitches of different stabilities or a mix of stabilizers of various strengths, we can create extended thermometers that respond linearly up to 50 °C in temperature range. Here, we demonstrate the reversibility, robustness, and efficiency of these programmable DNA thermometers by monitoring temperature change inside individual wells during polymerase chain reactions. We discuss the potential applications of these programmable DNA thermoswitches in various nanotechnology fields including cell imaging, nanofluidics, nanomedecine, nanoelectronics, nanomaterial, and synthetic biology. PMID:27058370

  5. Active DNA demethylation by DNA repair: Facts and uncertainties.

    Science.gov (United States)

    Schuermann, David; Weber, Alain R; Schär, Primo

    2016-08-01

    Pathways that control and modulate DNA methylation patterning in mammalian cells were poorly understood for a long time, although their importance in establishing and maintaining cell type-specific gene expression was well recognized. The discovery of proteins capable of converting 5-methylcytosine (5mC) to putative substrates for DNA repair introduced a novel and exciting conceptual framework for the investigation and ultimate discovery of molecular mechanisms of DNA demethylation. Against the prevailing notion that DNA methylation is a static epigenetic mark, it turned out to be dynamic and distinct mechanisms appear to have evolved to effect global and locus-specific DNA demethylation. There is compelling evidence that DNA repair, in particular base excision repair, contributes significantly to the turnover of 5mC in cells. By actively demethylating DNA, DNA repair supports the developmental establishment as well as the maintenance of DNA methylation landscapes and gene expression patterns. Yet, while the biochemical pathways are relatively well-established and reviewed, the biological context, function and regulation of DNA repair-mediated active DNA demethylation remains uncertain. In this review, we will thus summarize and critically discuss the evidence that associates active DNA demethylation by DNA repair with specific functional contexts including the DNA methylation erasure in the early embryo, the control of pluripotency and cellular differentiation, the maintenance of cell identity, and the nuclear reprogramming. PMID:27247237

  6. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  7. Optimality in DNA repair.

    Science.gov (United States)

    Richard, Morgiane; Fryett, Matthew; Miller, Samantha; Booth, Ian; Grebogi, Celso; Moura, Alessandro

    2012-01-01

    DNA within cells is subject to damage from various sources. Organisms have evolved a number of mechanisms to repair DNA damage. The activity of repair enzymes carries its own risk, however, because the repair of two nearby lesions may lead to the breakup of DNA and result in cell death. We propose a mathematical theory of the damage and repair process in the important scenario where lesions are caused in bursts. We use this model to show that there is an optimum level of repair enzymes within cells which optimises the cell's response to damage. This optimal level is explained as the best trade-off between fast repair and a low probability of causing double-stranded breaks. We derive our results analytically and test them using stochastic simulations, and compare our predictions with current biological knowledge. PMID:21945337

  8. Synapsis of DNA ends by DNA-dependent protein kinase

    OpenAIRE

    DeFazio, Lisa G.; Stansel, Rachel M.; Griffith, Jack D.; Chu, Gilbert

    2002-01-01

    The catalytic subunit of DNA-dependent protein kinase (DNA-PKCS) is required for a non-homologous end-joining pathway that repairs DNA double-strand breaks produced by ionizing radiation or V(D)J recombination; however, its role in this pathway has remained obscure. Using a neutravidin pull-down assay, we found that DNA-PKCS mediates formation of a synaptic complex containing two DNA molecules. Furthermore, kinase activity was cooperative with respect to DNA concentration, suggesting that act...

  9. DNA display I. Sequence-encoded routing of DNA populations.

    Directory of Open Access Journals (Sweden)

    David R Halpin

    2004-07-01

    Full Text Available Recently reported technologies for DNA-directed organic synthesis and for DNA computing rely on routing DNA populations through complex networks. The reduction of these ideas to practice has been limited by a lack of practical experimental tools. Here we describe a modular design for DNA routing genes, and routing machinery made from oligonucleotides and commercially available chromatography resins. The routing machinery partitions nanomole quantities of DNA into physically distinct subpools based on sequence. Partitioning steps can be iterated indefinitely, with worst-case yields of 85% per step. These techniques facilitate DNA-programmed chemical synthesis, and thus enable a materials biology that could revolutionize drug discovery.

  10. DNA repair and DNA antibodies during experimental mycoplasma arthritis

    International Nuclear Information System (INIS)

    To clarify the pathogenesis of a mycoplasma induced arthritis in rats, investigations were carried out on the influence of mycoplasma infection on DNA repair and the occurrence of DNA antibodies. During acute and subacute stage of the experimentally induced arthritis an inhibition of DNA repair could be observed. Besides the results indicated a correlation between reduced or inhibited DNA repair and the appearance of DNA antibodies could be found. The DNA-repair behaviour after the mycoplasma infection was compared with the influence of γ-irradiation

  11. DNA-mediated charge transport for DNA repair

    OpenAIRE

    Boon, Elizabeth M; Livingston, Alison L.; Chmiel, Nikolas H.; David, Sheila S.; Barton, Jacqueline K.

    2003-01-01

    MutY, like many DNA base excision repair enzymes, contains a [4Fe4S](2+) cluster of undetermined function. Electrochemical studies of MutY bound to a DNA-modified gold electrode demonstrate that the [4Fe4S] cluster of MutY can be accessed in a DNA-mediated redox reaction. Although not detectable without DNA, the redox potential of DNA-bound MutY is approximate to275 mV versus NHE, which is characteristic of HiPiP iron proteins. Binding to DNA is thus associated with a change in [4Fe4S](3+/2+)...

  12. DNA templated magnetic nanoparticles

    Science.gov (United States)

    Kinsella, Joseph M.

    Recent discoveries in nanoscience are predicted to potentially revolutionize future technologies in an extensive number of fields. These developments are contingent upon discovering new and often unconventional methods to synthesize and control nanoscale components. Nature provides several examples of working nanotechnology such as the use of programmed self assembly to build and deconstruct complex molecular systems. We have adopted a method to control the one dimensional assembly of magnetic nanoparticles using DNA as a scaffold molecule. With this method we have demonstrated the ability to organize 5 nm particles into chains that stretch up to ˜20 mum in length. One advantage of using DNA compared is the ability of the molecule to interact with other biomolecules. After assembling particles onto DNA we have been able to cleave the molecule into smaller fragments using restriction enzymes. Using ligase enzymes we have re-connected these fragments, coated with either gold or iron oxide, to form long one-dimensional arrangements of the two different types of nanoparticles on a single molecular guide. We have also created a sensitive magnetic field sensor by incorporating magnetic nanoparticle coated DNA strands with microfabricated electrodes. The IV characteristics of the aligned nanoparticles are dependant on the magnitude of an externally applied magnetic field. This transport phenomenon known as tunneling magnetoresistance (TMR) shows room temperature resistance of our devices over 80% for cobalt ferrite coated DNA when a field of 20 kOe is applied. In comparison, studies using two dimensional nanoparticle films of irox oxides xii only exhibit a 35% MR effect. Confinement into one dimension using the DNA guide produces a TMR mechanism which produces significant increases in magnetoresistance. This property can be utilized for applications in magnetic field sensing, data storage, and logic elements.

  13. Rigidity of melting DNA

    Science.gov (United States)

    Pal, Tanmoy; Bhattacharjee, Somendra M.

    2016-05-01

    The temperature dependence of DNA flexibility is studied in the presence of stretching and unzipping forces. Two classes of models are considered. In one case the origin of elasticity is entropic due to the polymeric correlations, and in the other the double-stranded DNA is taken to have an intrinsic rigidity for bending. In both cases single strands are completely flexible. The change in the elastic constant for the flexible case due to thermally generated bubbles is obtained exactly. For the case of intrinsic rigidity, the elastic constant is found to be proportional to the square root of the bubble number fluctuation.

  14. DNA from keratinous tissue

    DEFF Research Database (Denmark)

    Bengtsson, Camilla F.; Olsen, Maja E.; Brandt, Luise Ørsted;

    2011-01-01

    systematic research has been undertaken to characterize how such degradation may relate to sample source. In this review paper we present the current understanding of the quality and limitations of DNA in two key keratinous tissues, nail and hair. The findings indicate that although some fragments of nuclear...... genetic analyses, the fact that sampling generally causes minimal visual damage to valuable specimens. Even when freshly sampled, however, the DNA quantity and quality in the fully keratinized parts of such tissues is extremely poor in comparison to other tissues such as blood and muscle – although little...

  15. DNA from keratinous tissue

    DEFF Research Database (Denmark)

    Bengtsson, Camilla Friis; Olsen, Maia E.; Brandt, Luise Ørsted;

    2012-01-01

    systematic research has been undertaken to characterize how such degradation may relate to sample source. In this review paper we present the current understanding of the quality and limitations of DNA in two key keratinous tissues, nail and hair. The findings indicate that although some fragments of nuclear...... genetic analyses, the fact that sampling generally causes minimal visual damage to valuable specimens. Even when freshly sampled, however, the DNA quantity and quality in the fully keratinized parts of such tissues is extremely poor in comparison to other tissues such as blood and muscle - although little...

  16. DNA Topoisomerases in Transcription

    DEFF Research Database (Denmark)

    Rødgaard, Morten Terpager

    2015-01-01

    This Ph.D. thesis summarizes the main results of my studies on the interplay between DNA topoisomerases and transcription. The work was performed from 2011 to 2015 at Aarhus University in the Laboratory of Genome Research, and was supervised by associate professor Anni H. Andersen. Most of the ex......This Ph.D. thesis summarizes the main results of my studies on the interplay between DNA topoisomerases and transcription. The work was performed from 2011 to 2015 at Aarhus University in the Laboratory of Genome Research, and was supervised by associate professor Anni H. Andersen. Most...

  17. Quantification of human mitochondrial DNA using synthesized DNA standards.

    Science.gov (United States)

    Kavlick, Mark F; Lawrence, Helen S; Merritt, R Travis; Fisher, Constance; Isenberg, Alice; Robertson, James M; Budowle, Bruce

    2011-11-01

    Successful mitochondrial DNA (mtDNA) forensic analysis depends on sufficient quantity and quality of mtDNA. A real-time quantitative PCR assay was developed to assess such characteristics in a DNA sample, which utilizes a duplex, synthetic DNA to ensure optimal quality assurance and quality control. The assay's 105-base pair target sequence facilitates amplification of degraded DNA and is minimally homologous to nonhuman mtDNA. The primers and probe hybridize to a region that has relatively few sequence polymorphisms. The assay can also identify the presence of PCR inhibitors and thus indicate the need for sample repurification. The results show that the assay provides information down to 10 copies and provides a dynamic range spanning seven orders of magnitude. Additional experiments demonstrated that as few as 300 mtDNA copies resulted in successful hypervariable region amplification, information that permits sample conservation and optimized downstream PCR testing. The assay described is rapid, reliable, and robust.

  18. DNA tagged microparticles

    Energy Technology Data Exchange (ETDEWEB)

    Farquar, George R.; Leif, Roald N.; Wheeler, Elizabeth

    2016-03-22

    In one embodiment, a product includes a plurality of particles, each particle including: a carrier that includes a non-toxic material; and at least one DNA barcode coupled to the carrier, where the particles each have a diameter in a range from about 1 nanometer to about 100 microns.

  19. Field Deployable DNA analyzer

    Energy Technology Data Exchange (ETDEWEB)

    Wheeler, E; Christian, A; Marion, J; Sorensen, K; Arroyo, E; Vrankovich, G; Hara, C; Nguyen, C

    2005-02-09

    This report details the feasibility of a field deployable DNA analyzer. Steps for swabbing cells from surfaces and extracting DNA in an automatable way are presented. Since enzymatic amplification reactions are highly sensitive to environmental contamination, sample preparation is a crucial step to make an autonomous deployable instrument. We perform sample clean up and concentration in a flow through packed bed. For small initial samples, whole genome amplification is performed in the packed bed resulting in enough product for subsequent PCR amplification. In addition to DNA, which can be used to identify a subject, protein is also left behind, the analysis of which can be used to determine exposure to certain substances, such as radionuclides. Our preparative step for DNA analysis left behind the protein complement as a waste stream; we determined to learn if the proteins themselves could be analyzed in a fieldable device. We successfully developed a two-step lateral flow assay for protein analysis and demonstrate a proof of principle assay.

  20. Making environmental DNA count.

    Science.gov (United States)

    Kelly, Ryan P

    2016-01-01

    The arc of reception for a new technology or method--like the reception of new information itself--can pass through predictable stages, with audiences' responses evolving from 'I don't believe it', through 'well, maybe' to 'yes, everyone knows that' to, finally, 'old news'. The idea that one can sample a volume of water, sequence DNA out of it, and report what species are living nearby has experienced roughly this series of responses among biologists, beginning with the microbial biologists who developed genetic techniques to reveal the unseen microbiome. 'Macrobial' biologists and ecologists--those accustomed to dealing with species they can see and count--have been slower to adopt such molecular survey techniques, in part because of the uncertain relationship between the number of recovered DNA sequences and the abundance of whole organisms in the sampled environment. In this issue of Molecular Ecology Resources, Evans et al. (2015) quantify this relationship for a suite of nine vertebrate species consisting of eight fish and one amphibian. Having detected all of the species present with a molecular toolbox of six primer sets, they consistently find DNA abundances are associated with species' biomasses. The strength and slope of this association vary for each species and each primer set--further evidence that there is no universal parameter linking recovered DNA to species abundance--but Evans and colleagues take a significant step towards being able to answer the next question audiences tend to ask: 'Yes, but how many are there?'

  1. DNA ligase I selectively affects DNA synthesis by DNA polymerases delta and epsilon suggesting differential functions in DNA replication and repair.

    OpenAIRE

    Mossi, R; Ferrari, E.; Hübscher, U

    1998-01-01

    The joining of single-stranded breaks in double-stranded DNA is an essential step in many important processes such as DNA replication, DNA repair, and genetic recombination. Several data implicate a role for DNA ligase I in DNA replication, probably coordinated by the action of other enzymes and proteins. Since both DNA polymerases delta and epsilon show multiple functions in different DNA transactions, we investigated the effect of DNA ligase I on various DNA synthesis events catalyzed by th...

  2. DNA supercoiling and its role in DNA decatenation and unknotting

    OpenAIRE

    Witz, Guillaume; Stasiak, Andrzej

    2009-01-01

    Chromosomal and plasmid DNA molecules in bacterial cells are maintained under torsional tension and are therefore supercoiled. With the exception of extreme thermophiles, supercoiling has a negative sign, which means that the torsional tension diminishes the DNA helicity and facilitates strand separation. In consequence, negative supercoiling aids such processes as DNA replication or transcription that require global- or local-strand separation. In extreme thermophiles, DNA is positively supe...

  3. Lipophilic DNA-conjugates: DNA controlled assembly of liposomes

    DEFF Research Database (Denmark)

    Vogel, Stefan; Jakobsen, Ulla

    2009-01-01

    DNA detection systems based on encoded solid particles have been reported but require often tedious and not generally applicable surface chemistry. In the present study a system comprised of a lipid-modified DNA probe sequence and unmodified DNA target sequences is used to non-covalently assemble...

  4. Emerging roles of DNA-PK besides DNA repair.

    Science.gov (United States)

    Kong, Xianming; Shen, Ying; Jiang, Na; Fei, Xin; Mi, Jun

    2011-08-01

    The DNA-dependent protein kinase (DNA-PK) is a DNA-activated serine/threonine protein kinase, and abundantly expressed in almost all mammalian cells. The roles of DNA-PK in DNA-damage repair pathways, including non-homologous end-joining (NHEJ) repair and homologous recombinant (HR) repair, have been studied intensively. However, the high levels of DNA-PK in human cells are somewhat paradoxical in that it does not impart any increased ability to repair DNA damage. If DNA-PK essentially exceeds the demand for DNA damage repair, why do human cells universally express such high levels of this huge complex? DNA-PK has been recently reported to be involved in metabolic gene regulation in response to feeding/insulin stimulation; our studies have also suggested a role of DNA-PK in the regulation of the homeostasis of cell proliferation. These novel findings expand our horizons about the importance of DNA-PK. PMID:21514376

  5. DNA polymerase beta can substitute for DNA polymerase I in the initiation of plasmid DNA replication.

    OpenAIRE

    Sweasy, J B; Chen, M.; Loeb, L A

    1995-01-01

    We previously demonstrated that mammalian DNA polymerase beta can substitute for DNA polymerase I of Escherichia coli in DNA replication and in base excision repair. We have now obtained genetic evidence suggesting that DNA polymerase beta can substitute for E. coli DNA polymerase I in the initiation of replication of a plasmid containing a pMB1 origin of DNA replication. Specifically, we demonstrate that a plasmid with a pMB1 origin of replication can be maintained in an E. coli polA mutant ...

  6. Thermodynamic comparison of PNA/DNA and DNA/DNA hybridization reactions at ambient temperature.

    OpenAIRE

    Schwarz, F. P.; Robinson, S; Butler, J. M.

    1999-01-01

    The thermodynamics of 13 hybridization reactions between 10 base DNA sequences of design 5'-ATGCXYATGC-3' with X, Y = A, C, G, T and their complementary PNA and DNA sequences were determined from isothermal titration calorimetry (ITC) measurements at ambient temperature. For the PNA/DNA hybridization reactions, the binding constants range from 1.8 x 10(6)M(-1)for PNA(TT)/DNA to 4.15 x 10(7)M(-1)for PNA(GA)/DNA and the binding enthalpies range from -194 kJ mol(-1)for PNA(CG)/DNA to -77 kJ mol(...

  7. Esitleti kakskeelset luulekogu "Luule DNA"

    Index Scriptorium Estoniae

    2007-01-01

    Magrelli, Valerio. Luule DNA = Il DNA della poesia / tõlkinud [ja saatesõna:] Maarja Kangro ja Kalju Kruusa. Tallinn : Koma, 2006. Sisaldab autori teksti. Esitlus 24. jaan. Kirjanike majas Tallinnas

  8. Structural diversity of supercoiled DNA

    Science.gov (United States)

    Irobalieva, Rossitza N.; Fogg, Jonathan M.; Catanese, Daniel J.; Sutthibutpong, Thana; Chen, Muyuan; Barker, Anna K.; Ludtke, Steven J.; Harris, Sarah A.; Schmid, Michael F.; Chiu, Wah; Zechiedrich, Lynn

    2015-10-01

    By regulating access to the genetic code, DNA supercoiling strongly affects DNA metabolism. Despite its importance, however, much about supercoiled DNA (positively supercoiled DNA, in particular) remains unknown. Here we use electron cryo-tomography together with biochemical analyses to investigate structures of individual purified DNA minicircle topoisomers with defined degrees of supercoiling. Our results reveal that each topoisomer, negative or positive, adopts a unique and surprisingly wide distribution of three-dimensional conformations. Moreover, we uncover striking differences in how the topoisomers handle torsional stress. As negative supercoiling increases, bases are increasingly exposed. Beyond a sharp supercoiling threshold, we also detect exposed bases in positively supercoiled DNA. Molecular dynamics simulations independently confirm the conformational heterogeneity and provide atomistic insight into the flexibility of supercoiled DNA. Our integrated approach reveals the three-dimensional structures of DNA that are essential for its function.

  9. Alterations of ultraviolet irradiated DNA

    International Nuclear Information System (INIS)

    Thymine dimers production has been studied in several DNA-3H irradiated at various wave lenght of U.V. Light. The influence of dimers on the hydrodynamic and optic properties, thermal structural stability and transformant capacity of DNA have been studied too. At last the recognition and excision of dimers by the DNA-UV-Endonuclease and DNA-Polimerase-I was also studied. (author)

  10. Interpreting DNA Evidence: A Review

    OpenAIRE

    Foreman, L.A.; Champod, C.; Evett, I.W.; Lambert, J.A.; Pope, S.

    2003-01-01

    The paper provides a review of current issues relating to the use of DNA profiling in forensic science. A short historical section gives the main statistical milestones that occurred during a rapid development of DNA technology and operational uses. Greater detail is then provided for interpretation issues involving STR DNA profiles, including: ¶ methods that take account of population substructure in DNA calculations; ¶ parallel work carried out by the US National Research ...

  11. Forensic trace DNA: a review

    OpenAIRE

    van Oorschot Roland AH; Ballantyne Kaye N; Mitchell R John

    2010-01-01

    Abstract DNA analysis is frequently used to acquire information from biological material to aid enquiries associated with criminal offences, disaster victim identification and missing persons investigations. As the relevance and value of DNA profiling to forensic investigations has increased, so too has the desire to generate this information from smaller amounts of DNA. Trace DNA samples may be defined as any sample which falls below recommended thresholds at any stage of the analysis, from ...

  12. Event extraction for DNA methylation

    OpenAIRE

    Ohta Tomoko; Pyysalo Sampo; Miwa Makoto; Tsujii Jun’ichi

    2011-01-01

    Abstract Background We consider the task of automatically extracting DNA methylation events from the biomedical domain literature. DNA methylation is a key mechanism of epigenetic control of gene expression and implicated in many cancers, but there has been little study of automatic information extraction for DNA methylation. Results We present an annotation scheme for DNA methylation following the representation of the BioNLP shared task on event extraction, select a set of 200 abstracts inc...

  13. Recoiling DNA Molecule: Simulation & Experiment

    OpenAIRE

    Neto, Jose Coelho; Dickman, Ronald; Mesquita, O. N.

    2002-01-01

    Single molecule DNA experiments often generate data from force versus extension measurements involving the tethering of a microsphere to one end of a single DNA molecule while the other is attached to a substrate. We show that the persistence length of single DNA molecules can also be measured based on the recoil dynamics of these DNA-microsphere complexes if appropriate corrections are made to the friction coefficient of the microsphere in the vicinity of the substrate. Comparison between co...

  14. Supramolecular Polymers in DNA Nanotechnology

    OpenAIRE

    Vyborna, Yuliia; Vybornyi, Mykhailo; Häner, Robert

    2016-01-01

    Creation of biocompatible functional materials is an important task in supramolecular chemistry. In this contribution, we report on noncovalent synthesis of DNA-grafted supramolecular polymers (SPs). DNA-grafted SPs enable programmed arrangement of oligonucleotides in a regular, tightly packed one-dimensional array. Further interactions of DNA-grafted SPs with complementary DNA strands leads to the formation of networks through highly cooperative G-C blunt-end stacking interactions. The struc...

  15. Dipole relaxation losses in DNA

    OpenAIRE

    Briman, M.; N. P. Armitage; Helgren, E.; Gruner, G.

    2003-01-01

    The electrodynamic response of DNA in the millimeter wave range is investigated. By performing measurements under a wide range of humidity conditions and comparing the response of single strand DNA and double strand DNA, we show that the appreciable AC conductivity of DNA is not due to photon activated hopping between localized states, but instead due to dissipation from dipole motion in the surrounding water helix. Such a result, where the conductivity is due to the constrained motion of ove...

  16. Mechanisms for DNA Charge Transport

    OpenAIRE

    Genereux, Joseph C.; Barton, Jacqueline K.

    2010-01-01

    DNA charge transport (CT) chemistry has received considerable attention by scientific researchers over the past 15 years since our first provocative publication on long range CT in a DNA assembly.1,2 This interest, shared by physicists, chemists and biologists, reflects the potential of DNA CT to provide a sensitive route for signaling, whether in the construction of nanoscale biosensors or as an enzymatic tool to detect damage in the genome. Research into DNA CT chemistry began as a quest to...

  17. DNA-based hybrid catalysis

    NARCIS (Netherlands)

    Rioz-Martínez, Ana; Roelfes, Gerard

    2015-01-01

    In the past decade, DNA-based hybrid catalysis has merged as a promising novel approach to homogeneous (asymmetric) catalysis. A DNA hybrid catalysts comprises a transition metal complex that is covalently or supramolecularly bound to DNA. The chiral microenvironment and the second coordination sphe

  18. Environmental influences on DNA curvature

    DEFF Research Database (Denmark)

    Ussery, David; Higgins, C.F.; Bolshoy, A.

    1999-01-01

    DNA curvature plays an important role in many biological processes. To study environmentalinfluences on DNA curvature we compared the anomalous migration on polyacrylamide gels ofligation ladders of 11 specifically-designed oligonucleotides. At low temperatures (25 degreesC and below) most...... for DNAcurvature and for environmentally-sensitive DNA conformations in the regulation of geneexpression....

  19. An ECVAG inter-laboratory validation study of the comet assay: inter-laboratory and intra-laboratory variations of DNA strand breaks and FPG-sensitive sites in human mononuclear cells.

    Science.gov (United States)

    Ersson, Clara; Møller, Peter; Forchhammer, Lykke; Loft, Steffen; Azqueta, Amaya; Godschalk, Roger W L; van Schooten, Frederik-Jan; Jones, George D D; Higgins, Jennifer A; Cooke, Marcus S; Mistry, Vilas; Karbaschi, Mahsa; Phillips, David H; Sozeri, Osman; Routledge, Michael N; Nelson-Smith, Kirsty; Riso, Patrizia; Porrini, Marisa; Matullo, Giuseppe; Allione, Alessandra; Stepnik, Maciej; Ferlińska, Magdalena; Teixeira, João Paulo; Costa, Solange; Corcuera, Laura-Ana; López de Cerain, Adela; Laffon, Blanca; Valdiglesias, Vanessa; Collins, Andrew R; Möller, Lennart

    2013-05-01

    The alkaline comet assay is an established, sensitive method extensively used in biomonitoring studies. This method can be modified to measure a range of different types of DNA damage. However, considerable differences in the protocols used by different research groups affect the inter-laboratory comparisons of results. The aim of this study was to assess the inter-laboratory, intra-laboratory, sample and residual (unexplained) variations in DNA strand breaks and formamidopyrimidine DNA glycosylase (FPG)-sensitive sites measured by the comet assay by using a balanced Latin square design. Fourteen participating laboratories used their own comet assay protocols to measure the level of DNA strand breaks and FPG-sensitive sites in coded samples containing peripheral blood mononuclear cells (PBMC) and the level of DNA strand breaks in coded calibration curve samples (cells exposed to different doses of ionising radiation) on three different days of analysis. Eleven laboratories found dose-response relationships in the coded calibration curve samples on two or three days of analysis, whereas three laboratories had technical problems in their assay. In the coded calibration curve samples, the dose of ionising radiation, inter-laboratory variation, intra-laboratory variation and residual variation contributed to 60.9, 19.4, 0.1 and 19.5%, respectively, of the total variation. In the coded PBMC samples, the inter-laboratory variation explained the largest fraction of the overall variation of DNA strand breaks (79.2%) and the residual variation (19.9%) was much larger than the intra-laboratory (0.3%) and inter-subject (0.5%) variation. The same partitioning of the overall variation of FPG-sensitive sites in the PBMC samples indicated that the inter-laboratory variation was the strongest contributor (56.7%), whereas the residual (42.9%), intra-laboratory (0.2%) and inter-subject (0.3%) variations again contributed less to the overall variation. The results suggest that the

  20. DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA

    DEFF Research Database (Denmark)

    Christensen, H.; Angen, Øystein; Mutters, R.;

    2000-01-01

    The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...

  1. Fleet DNA (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Walkokwicz, K.; Duran, A.

    2014-06-01

    The Fleet DNA project objectives include capturing and quantifying drive cycle and technology variation for the multitude of medium- and heavy-duty vocations; providing a common data storage warehouse for medium- and heavy-duty vehicle fleet data across DOE activities and laboratories; and integrating existing DOE tools, models, and analyses to provide data-driven decision making capabilities. Fleet DNA advantages include: for Government - providing in-use data for standard drive cycle development, R&D, tech targets, and rule making; for OEMs - real-world usage datasets provide concrete examples of customer use profiles; for fleets - vocational datasets help illustrate how to maximize return on technology investments; for Funding Agencies - ways are revealed to optimize the impact of financial incentive offers; and for researchers -a data source is provided for modeling and simulation.

  2. Tops and Writhing DNA

    Science.gov (United States)

    Samuel, Joseph; Sinha, Supurna

    2011-04-01

    The torsional elasticity of semiflexible polymers like DNA is of biological significance. A mathematical treatment of this problem was begun by Fuller using the relation between link, twist and writhe, but progress has been hindered by the non-local nature of the writhe. This stands in the way of an analytic statistical mechanical treatment, which takes into account thermal fluctuations, in computing the partition function. In this paper we use the well known analogy with the dynamics of tops to show that when subjected to stretch and twist, the polymer configurations which dominate the partition function admit a local writhe formulation in the spirit of Fuller and thus provide an underlying justification for the use of Fuller's "local writhe expression" which leads to considerable mathematical simplification in solving theoretical models of DNA and elucidating their predictions. Our result facilitates comparison of the theoretical models with single molecule micromanipulation experiments and computer simulations.

  3. Tops and Writhing DNA

    OpenAIRE

    Samuel, Joseph; Sinha, Supurna

    2010-01-01

    The torsional elasticity of semiflexible polymers like DNA is of biological significance. A mathematical treatment of this problem was begun by Fuller using the relation between link, twist and writhe, but progress has been hindered by the non-local nature of the writhe. This stands in the way of an analytic statistical mechanical treatment, which takes into account thermal fluctuations, in computing the partition function. In this paper we use the well known analogy with the dynamics of tops...

  4. Electrocatalysis in DNA sensors

    OpenAIRE

    Furst, Ariel; Hill, Michael G.; Barton, Jacqueline K.

    2014-01-01

    Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge tr...

  5. Geant4-DNA simulations using complex DNA geometries generated by the DnaFabric tool

    Science.gov (United States)

    Meylan, S.; Vimont, U.; Incerti, S.; Clairand, I.; Villagrasa, C.

    2016-07-01

    Several DNA representations are used to study radio-induced complex DNA damages depending on the approach and the required level of granularity. Among all approaches, the mechanistic one requires the most resolved DNA models that can go down to atomistic DNA descriptions. The complexity of such DNA models make them hard to modify and adapt in order to take into account different biological conditions. The DnaFabric project was started to provide a tool to generate, visualise and modify such complex DNA models. In the current version of DnaFabric, the models can be exported to the Geant4 code to be used as targets in the Monte Carlo simulation. In this work, the project was used to generate two DNA fibre models corresponding to two DNA compaction levels representing the hetero and the euchromatin. The fibres were imported in a Geant4 application where computations were performed to estimate the influence of the DNA compaction on the amount of calculated DNA damage. The relative difference of the DNA damage computed in the two fibres for the same number of projectiles was found to be constant and equal to 1.3 for the considered primary particles (protons from 300 keV to 50 MeV). However, if only the tracks hitting the DNA target are taken into account, then the relative difference is more important for low energies and decreases to reach zero around 10 MeV. The computations were performed with models that contain up to 18,000 DNA nucleotide pairs. Nevertheless, DnaFabric will be extended to manipulate multi-scale models that go from the molecular to the cellular levels.

  6. Compressive Sensing DNA Microarrays

    Directory of Open Access Journals (Sweden)

    Richard G. Baraniuk

    2009-01-01

    Full Text Available Compressive sensing microarrays (CSMs are DNA-based sensors that operate using group testing and compressive sensing (CS principles. In contrast to conventional DNA microarrays, in which each genetic sensor is designed to respond to a single target, in a CSM, each sensor responds to a set of targets. We study the problem of designing CSMs that simultaneously account for both the constraints from CS theory and the biochemistry of probe-target DNA hybridization. An appropriate cross-hybridization model is proposed for CSMs, and several methods are developed for probe design and CS signal recovery based on the new model. Lab experiments suggest that in order to achieve accurate hybridization profiling, consensus probe sequences are required to have sequence homology of at least 80% with all targets to be detected. Furthermore, out-of-equilibrium datasets are usually as accurate as those obtained from equilibrium conditions. Consequently, one can use CSMs in applications in which only short hybridization times are allowed.

  7. Next generation DNA led technologies

    CERN Document Server

    Jyothsna, G; Kashyap, Amita

    2016-01-01

    This brief highlights advances in DNA technologies and their wider applications. DNA is the source of life and has been studied since a generation, but very little is known as yet. Several sophisticated technologies of the current era have laid their foundations on the principle of DNA based mechanisms. DNA based technologies are bringing a new revolution of Advanced Science and Technology. Forensic Investigation, Medical Diagnosis, Paternity Disputes, Individual Identity, Health insurance, Motor Insurance have incorporated the DNA testing and profiling technologies for settling the issues.

  8. A physicist's view of DNA

    CERN Document Server

    Mashaghi, Alireza

    2013-01-01

    Nucleic acids, like DNA and RNA, are molecules that are present in any life form. Their most notable function is to encode biological information. Why then would a physicist be interested in these molecules? As we will see, DNA is an interesting molecular tool for physicists to test and explore physical laws and theories, like the ergodic theorem, the theory of elasticity and information theory. DNA also has unique material properties, which attract material scientists, nanotechnologists and engineers. Among interesting developments in this field are DNA-based hybrid materials and DNA origami.

  9. DNA adducts-chemical addons

    OpenAIRE

    T. R. Rajalakshmi; N AravindhaBabu; Shanmugam, K. T.; Masthan, K. M. K.

    2015-01-01

    DNA adduct is a piece of DNA covalently bond to a chemical (safrole, benzopyrenediol epoxide, acetaldehyde). This process could be the start of a cancerous cell. When a chemical binds to DNA, it gets damaged resulting in abnormal replication. This could be the start of a mutation and without proper DNA repair, this can lead to cancer. It is this chemical that binds with the DNA is our prime area of concern. Instead of performing the whole body analysis for diagnosing cancer, this test could b...

  10. DNA nanotechnology and fluorescence applications.

    Science.gov (United States)

    Schlichthaerle, Thomas; Strauss, Maximilian T; Schueder, Florian; Woehrstein, Johannes B; Jungmann, Ralf

    2016-06-01

    Structural DNA nanotechnology allow researchers to use the unique molecular recognition properties of DNA strands to construct nanoscale objects with almost arbitrary complexity in two and three dimensions. Abstracted as molecular breadboards, DNA nanostructures enable nanometer-precise placement of guest molecules such as proteins, fluorophores, or nanoparticles. These assemblies can be used to study biological phenomena with unprecedented control over number, spacing, and molecular identity. Here, we give a general introduction to structural DNA nanotechnology and more specifically discuss applications of DNA nanostructures in the field of fluorescence and plasmonics. PMID:26773303

  11. Stimulation of mouse DNA primase-catalyzed oligoribonucleotide synthesis by mouse DNA helicase B.

    OpenAIRE

    Saitoh, A; S. Tada; Katada, T; Enomoto, T.

    1995-01-01

    Many prokaryotic and viral DNA helicases involved in DNA replication stimulate their cognate DNA primase activity. To assess the stimulation of DNA primase activity by mammalian DNA helicases, we analyzed the synthesis of oligoribonucleotides by mouse DNA polymerase alpha-primase complex on single-stranded circular M13 DNA in the presence of mouse DNA helicase B. DNA helicase B was purified by sequential chromatography through eight columns. When the purified DNA helicase B was applied to a M...

  12. Mitochondrial DNA in Sensitive Forensic Analysis

    OpenAIRE

    Nilsson, Martina

    2007-01-01

    Genetic profiling is commonly performed on the autosomes using multiple DNA markers. Although routine forensic DNA analysis is robust and based on reliable technologies, samples with degraded or limited amounts of DNA often fail. In these cases, the analysis of mitochondrial DNA (mtDNA) can be very valuable due to the high copy number per cell. This thesis describes evaluation and modifications of existing technologies that are useful in forensic DNA typing, mainly focusing on mtDNA. DNA quan...

  13. DNA adducts-chemical addons

    Directory of Open Access Journals (Sweden)

    T R Rajalakshmi

    2015-01-01

    Full Text Available DNA adduct is a piece of DNA covalently bond to a chemical (safrole, benzopyrenediol epoxide, acetaldehyde. This process could be the start of a cancerous cell. When a chemical binds to DNA, it gets damaged resulting in abnormal replication. This could be the start of a mutation and without proper DNA repair, this can lead to cancer. It is this chemical that binds with the DNA is our prime area of concern. Instead of performing the whole body analysis for diagnosing cancer, this test could be carried out for early detection of cancer. When scanning tunneling microscope is used, the DNA results can be obtained earlier. DNA adducts in scientific experiments are used as biomarkers.

  14. DNA adducts-chemical addons

    Science.gov (United States)

    Rajalakshmi, T. R.; AravindhaBabu, N.; Shanmugam, K. T.; Masthan, K. M. K.

    2015-01-01

    DNA adduct is a piece of DNA covalently bond to a chemical (safrole, benzopyrenediol epoxide, acetaldehyde). This process could be the start of a cancerous cell. When a chemical binds to DNA, it gets damaged resulting in abnormal replication. This could be the start of a mutation and without proper DNA repair, this can lead to cancer. It is this chemical that binds with the DNA is our prime area of concern. Instead of performing the whole body analysis for diagnosing cancer, this test could be carried out for early detection of cancer. When scanning tunneling microscope is used, the DNA results can be obtained earlier. DNA adducts in scientific experiments are used as biomarkers. PMID:26015708

  15. Forensic trace DNA: a review

    Directory of Open Access Journals (Sweden)

    van Oorschot Roland AH

    2010-12-01

    Full Text Available Abstract DNA analysis is frequently used to acquire information from biological material to aid enquiries associated with criminal offences, disaster victim identification and missing persons investigations. As the relevance and value of DNA profiling to forensic investigations has increased, so too has the desire to generate this information from smaller amounts of DNA. Trace DNA samples may be defined as any sample which falls below recommended thresholds at any stage of the analysis, from sample detection through to profile interpretation, and can not be defined by a precise picogram amount. Here we review aspects associated with the collection, DNA extraction, amplification, profiling and interpretation of trace DNA samples. Contamination and transfer issues are also briefly discussed within the context of trace DNA analysis. Whilst several methodological changes have facilitated profiling from trace samples in recent years it is also clear that many opportunities exist for further improvements.

  16. Touch DNA-The prospect of DNA profiles from cables.

    Science.gov (United States)

    Lim, Sharon; Subhani, Zuhaib; Daniel, Barbara; Frascione, Nunzianda

    2016-05-01

    Metal theft in the railroad industry poses significant challenges to transport investigators. Cable sheaths left behind at crime scenes, if appropriately analysed, could provide valuable evidence in a forensic investigation, but attempts at recovering DNA are not routinely made. Experiments were set up to ascertain the success in DNA recovery from the surface of cable sheaths after deposition of (a) sweat, (b) extracted DNA and (c) fingermarks. Since investigators try to collect fingermarks and often treat the cables with cyanoacrylate fuming (CNA fuming) or wet powder suspensions (WPS) to enhance the marks this study investigated the recovery of DNA from fingermarks pre- and post-enhancement. The double-swab technique and mini-taping were compared as options to recover DNA from the cable sheaths. Results demonstrate that generally, there is no significant difference between using swabs or mini-tapes to recover the DNA from the non-porous cables (p>0.05). It was also illustrated that CNA fuming performed better than WPS in terms of subsequent recovery and profiling of DNA. CNA fuming resulted in an average increase in DNA recovered via swabbing and taping (more than 4× and 8×, respectively), as compared to no treatment, with 50% of the DNA recovered after CNA fuming generating full DNA profiles. PMID:27162019

  17. Touch DNA-The prospect of DNA profiles from cables.

    Science.gov (United States)

    Lim, Sharon; Subhani, Zuhaib; Daniel, Barbara; Frascione, Nunzianda

    2016-05-01

    Metal theft in the railroad industry poses significant challenges to transport investigators. Cable sheaths left behind at crime scenes, if appropriately analysed, could provide valuable evidence in a forensic investigation, but attempts at recovering DNA are not routinely made. Experiments were set up to ascertain the success in DNA recovery from the surface of cable sheaths after deposition of (a) sweat, (b) extracted DNA and (c) fingermarks. Since investigators try to collect fingermarks and often treat the cables with cyanoacrylate fuming (CNA fuming) or wet powder suspensions (WPS) to enhance the marks this study investigated the recovery of DNA from fingermarks pre- and post-enhancement. The double-swab technique and mini-taping were compared as options to recover DNA from the cable sheaths. Results demonstrate that generally, there is no significant difference between using swabs or mini-tapes to recover the DNA from the non-porous cables (p>0.05). It was also illustrated that CNA fuming performed better than WPS in terms of subsequent recovery and profiling of DNA. CNA fuming resulted in an average increase in DNA recovered via swabbing and taping (more than 4× and 8×, respectively), as compared to no treatment, with 50% of the DNA recovered after CNA fuming generating full DNA profiles.

  18. Functionalizing Designer DNA Crystals

    Science.gov (United States)

    Chandrasekaran, Arun Richard

    Three-dimensional crystals have been self-assembled from a DNA tensegrity triangle via sticky end interaction. The tensegrity triangle is a rigid DNA motif containing three double helical edges connected pair-wise by three four-arm junctions. The symmetric triangle contains 3 unique strands combined in a 3:3:1 ratio: 3 crossover, 3 helical and 1 central. The length of the sticky end reported previously was two nucleotides (nt) (GA:TC) and the motif with 2-helical turns of DNA per edge diffracted to 4.9 A at beam line NSLS-X25 and to 4 A at beam line ID19 at APS. The purpose of these self-assembled DNA crystals is that they can be used as a framework for hosting external guests for use in crystallographic structure solving or the periodic positioning of molecules for nanoelectronics. This thesis describes strategies to improve the resolution and to incorporate guests into the 3D lattice. The first chapter describes the effect of varying sticky end lengths and the influence of 5'-phosphate addition on crystal formation and resolution. X-ray diffraction data from beam line NSLS-X25 revealed that the crystal resolution for 1-nt (G:C) sticky end was 3.4 A. Motifs with every possible combination of 1-nt and 2-nt sticky-ended phosphorylated strands were crystallized and X-ray data were collected. The position of the 5'-phosphate on either the crossover (strand 1), helical (strand 2), or central strand (3) had an impact on the resolution of the self-assembled crystals with the 1-nt 1P-2-3 system diffracting to 2.62 A at APS and 3.1 A at NSLS-X25. The second chapter describes the sequence-specific recognition of DNA motifs with triplex-forming oligonucleotides (TFOs). This study examined the feasibility of using TFOs to bind to specific locations within a 3-turn DNA tensegrity triangle motif. The TFO 5'-TTCTTTCTTCTCT was used to target the tensegrity motif containing an appropriately embedded oligopurine.oligopyrimidine binding site. As triplex formation involving cytidine

  19. DNA adducts as molecular dosimeters

    International Nuclear Information System (INIS)

    There is compelling evidence that DNA adducts play an important role in the actions of many pulmonary carcinogens. During the last ten years sensitive methods (antibodies and 32P-postlabeling) have been developed that permit detection of DNA adducts in tissues of animals or humans exposed to low levels of some genotoxic carcinogens. This capability has led to approaches designed to more reliably estimate the shape of the dose-response curve in the low dose region for a few carcinogens. Moreover, dosimetry comparisions can, in some cases, be made between animals and humans which help in judging the adequacy of animal models for human risk assessments. There are several points that need to be considered in the evaluation of DNA adducts as a molecular dosimeter. For example, DNA adduct formation is only one of many events that are needed for tumor development and some potent carcinogens do not form DNA adducts; i.e., TCDD. Other issues that need to be considered are DNA adduct heterogeneity, DNA repair, relationship of DNA adducts to somatic mutation and cell specificity in DNA adduct formation and persistence. Molecular epidemiology studies often require quantitation of adducts in cells such as lymphocytes which may or may not be reliable surrogates for adduct concentrations in target issues. In summary, accurate quantitation of low levels of DNA adducts may provide data useful in species to species extrapolation of risk including the development of more meaningful human monitoring programs

  20. Mechanism of DNA damage tolerance

    Institute of Scientific and Technical Information of China (English)

    Xin; Bi

    2015-01-01

    DNA damage may compromise genome integrity and lead to cell death. Cells have evolved a variety of processes to respond to DNA damage including damage repair and tolerance mechanisms, as well as damage checkpoints. The DNA damage tolerance(DDT) pathway promotes the bypass of single-stranded DNA lesions encountered by DNA polymerases during DNA replication. This prevents the stalling of DNA replication. Two mechanistically distinct DDT branches have been characterized. One is translesion synthesis(TLS) in which a replicative DNA polymerase is temporarily replaced by a specialized TLS polymerase that has the ability to replicate across DNA lesions. TLS is mechanistically simple and straightforward, but it is intrinsically error-prone. The other is the error-free template switching(TS) mechanism in which the stalled nascent strand switches from the damaged template to the undamaged newly synthesized sister strand for extension past the lesion. Error-free TS is a complex but preferable process for bypassing DNA lesions. However, our current understanding of this pathway is sketchy. An increasing number of factors are being found to participate or regulate this important mechanism, which is the focus of this editorial.

  1. Using DNA looping to measure sequence dependent DNA elasticity

    Science.gov (United States)

    Kandinov, Alan; Raghunathan, Krishnan; Meiners, Jens-Christian

    2012-10-01

    We are using tethered particle motion (TPM) microscopy to observe protein-mediated DNA looping in the lactose repressor system in DNA constructs with varying AT / CG content. We use these data to determine the persistence length of the DNA as a function of its sequence content and compare the data to direct micromechanical measurements with constant-force axial optical tweezers. The data from the TPM experiments show a much smaller sequence effect on the persistence length than the optical tweezers experiments.

  2. Dynamics of DNA conformations and DNA-protein interaction

    DEFF Research Database (Denmark)

    Metzler, R.; Ambjörnsson, T.; Lomholt, Michael Andersen;

    2005-01-01

    Optical tweezers, atomic force microscopes, patch clamping, or fluorescence techniques make it possible to study both the equilibrium conformations and dynamics of single DNA molecules as well as their interaction with binding proteins. In this paper we address the dynamics of local DNA denaturat...... report recent findings on the search process of proteins for a specific target on the DNA. © 2006 Materials Research Society....

  3. DNA reviews: the national DNA database of the United Kingdom.

    Science.gov (United States)

    Graham, E A M

    2007-12-01

    The national DNA database in United Kingdom has now been operational for over 10 years. This review looks at the history and development of this investigative resource. From the development of commercial DNA profiling kits to the current statistics for matches obtained in relation to criminal investigation in the United Kingdom, before moving onto discussing potential future direction that national DNA databases might take, including international collaboration on a European and global scale. PMID:25869270

  4. The DNA Files

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-06-09

    The DNA Files is a radio documentary which disseminates genetics information over public radio. The documentaries explore subjects which include the following: How genetics affects society. How human life began and how it evolved. Could new prenatal genetic tests hold the key to disease prevention later in life? Would a national genetic data base sacrifice individual privacy? and Should genes that may lead to the cure for cancer be privately owned? This report serves as a project update for the second quarter of 1998. It includes the spring/summer 1998 newsletter, the winter 1998 newsletter, the program clock, and the latest flyer.

  5. Protein-DNA complexes: specificity and DNA readout mechanisms

    Directory of Open Access Journals (Sweden)

    Shestopalova A. V.

    2011-02-01

    Full Text Available Protein-nucleic acid recognition is essential in a number of cellular processes, in particular, gene regulation, DNA replication and compaction. Studies on the recognition mechanisms show that DNA sequence carries information which is read out by proteins that selectively bind to specific DNA sites. The review is focused on the processes taking place during formation of specific and nonspecific complexes of proteins and DNA. Special attention is paid to direct and indirect mechanisms of sequence-specific recognition. Several examples of protein-nucleic acid complexes are given to illustrate the variety of recognition mechanisms

  6. Homologous recombination in DNA repair and DNA damage tolerance

    Institute of Scientific and Technical Information of China (English)

    Xuan Li; Wolf-Dietrich Heyer

    2008-01-01

    Homologous recombination (HR) comprises a series of interrelated pathways that function in the repair of DNA double-stranded breaks (DSBs) and interstrand crosslinks (ICLs). In addition, recombination provides critical sup-port for DNA replication in the recovery of stalled or broken replication forks, contributing to tolerance of DNA damage. A central core of proteins, most critically the RecA homolog Rad51, catalyzes the key reactions that typify HR: homology search and DNA strand invasion. The diverse functions of recombination are reflected in the need for context-specific factors that perform supplemental functions in conjunction with the core proteins. The inability to properly repair complex DNA damage and resolve DNA replication stress leads to genomic instability and contributes to cancer etiology. Mutations in the BRCA2 recombination gene cause predisposition to breast and ovarian cancer as well as Fanconi anemia, a cancer predisposition syndrome characterized by a defect in the repair of DNA interstrand crosslinks. The cellular functions of recombination are also germane to DNA-based treatment modaUties of cancer, which target replicating cells by the direct or indirect induction of DNA lesions that are substrates for recombination pathways. This review focuses on mechanistic aspects of HR relating to DSB and ICL repair as well as replication fork support.

  7. DNA vaccine: the miniature miracle

    Directory of Open Access Journals (Sweden)

    Karthik Kaliaperumal

    2013-08-01

    Full Text Available DNA, the essential part of the life is making way in to new vaccine technology. Plasmid vectors from the bacteria have revolutionized the world of vaccine design by its new technology – DNA vaccines. Small portion of the nucleotides from the pathogen held under the control of promoter in a plasmid vector can be used as a vaccine. DNA vaccines alleviate the odds of the other vaccines by having good hold on both the faces of the immunity. The key to the success of DNA vaccine lies in the route of administration of the vaccine which can be done in many ways. Prime boost strategy is an approach used to boost the action of DNA vaccine. To date there are only four DNA vaccine available in the market. [Vet World 2013; 6(4.000: 228-232

  8. DNA-based hybrid catalysis.

    Science.gov (United States)

    Rioz-Martínez, Ana; Roelfes, Gerard

    2015-04-01

    In the past decade, DNA-based hybrid catalysis has merged as a promising novel approach to homogeneous (asymmetric) catalysis. A DNA hybrid catalysts comprises a transition metal complex that is covalently or supramolecularly bound to DNA. The chiral microenvironment and the second coordination sphere interactions provided by the DNA are key to achieve high enantioselectivities and, often, additional rate accelerations in catalysis. Nowadays, current efforts are focused on improved designs, understanding the origin of the enantioselectivity and DNA-induced rate accelerations, expanding the catalytic scope of the concept and further increasing the practicality of the method for applications in synthesis. Herein, the recent developments will be reviewed and the perspectives for the emerging field of DNA-based hybrid catalysis will be discussed.

  9. Interaction of chlorpromazine with DNA.

    Science.gov (United States)

    Motohashi, N; Kamata, K; Meyer, R

    1990-01-01

    The mechanism of the potential anticancer agent chlorpromazine hydrochloride (CPZ) with DNA was investigated by the techniques of high-performance liquid chromatography (HPLC), viscosity and Raman spectroscopy. It has been suggested from HPLC work that DNA nucleotides (except nucleosides) from either a CPZ-DNA system or a CPZ-nucleotide system. Furthermore, the shear stress of the viscosity of the CPZ-DNA system and the CPZ-nucleotide systems ware shown to be apparently the higher increasing than that of DNA and nucleotide alone. These systems had non-Newtonian properties for the formation of the CPZ-DNA and the CPZ-nucleotide systems under experimental conditions. The Raman spectra showed a dramatic difference at 982 cm-1 due to the symmetric P-O stretching vibration of the PO4(2-) group between dGMP and the CPZ-dGMP system. PMID:2285233

  10. Cryptography with DNA binary strands.

    Science.gov (United States)

    Leier, A; Richter, C; Banzhaf, W; Rauhe, H

    2000-06-01

    Biotechnological methods can be used for cryptography. Here two different cryptographic approaches based on DNA binary strands are shown. The first approach shows how DNA binary strands can be used for steganography, a technique of encryption by information hiding, to provide rapid encryption and decryption. It is shown that DNA steganography based on DNA binary strands is secure under the assumption that an interceptor has the same technological capabilities as sender and receiver of encrypted messages. The second approach shown here is based on steganography and a method of graphical subtraction of binary gel-images. It can be used to constitute a molecular checksum and can be combined with the first approach to support encryption. DNA cryptography might become of practical relevance in the context of labelling organic and inorganic materials with DNA 'barcodes'.

  11. Charge transport in desolvated DNA

    Science.gov (United States)

    Wolter, Mario; Elstner, Marcus; Kubař, Tomáš

    2013-09-01

    The conductivity of DNA in molecular junctions is often probed experimentally under dry conditions, but it is unclear how much of the solvent remains attached to the DNA and how this impacts its structure, electronic states, and conductivity. Classical MD simulations show that DNA is unstable if the solvent is removed completely, while a micro-hydrated system with few water molecules shows similar charge transport properties as fully solvated DNA does. This surprising effect is analyzed in detail by mapping the density functional theory-based electronic structure to a tight-binding Hamiltonian, allowing for an estimate of conductivity of various DNA sequences with snapshot-averaged Landauer's approach. The characteristics of DNA charge transport turn out to be determined by the nearest hydration shell(s), and the removal of bulk solvent has little effect on the transport.

  12. Characterization of a stable, major DNA polymerase alpha species devoid of DNA primase activity.

    OpenAIRE

    Kaiserman, H B; Benbow, R. M.

    1987-01-01

    We have purified from Xenopus laevis ovaries a major DNA polymerase alpha species that lacked DNA primase activity. This primase-devoid DNA polymerase alpha species exhibited the same sensitivity as the DNA polymerase DNA primase alpha to BuAdATP and BuPdGTP, nucleotide analogs capable of distinguishing between DNA polymerase delta and DNA polymerase DNA primase alpha. The primase-devoid DNA polymerase alpha species also lacked significant nuclease activity indicative of the alpha-like (rathe...

  13. Evolution of DNA Sequencing

    International Nuclear Information System (INIS)

    Sanger and coworkers introduced DNA sequencing in 1970s for the first time. It principally relied on termination of growing nucleotide chain when a dideoxythymidine triphosphate (ddTTP) was inserted in it. Detection of terminated sequences was done radiographically on Polyacrylamide Gel Electrophoresis (PAGE). Improvements that have evolved over time in original Sanger sequencing include replacement of radiography with fluorescence, use of separate fluorescent markers for each nucleotide, use of capillary electrophoresis instead of polyacrylamide gel electrophoresis and then introduction of capillary array electrophoresis. However, this technique suffered from few inherent limitations like decreased sensitivity for low level mutant alleles, complexities in analyzing highly polymorphic regions like Major Histocompatibility Complex (MHC) and high DNA concentrations required. Several Next Generation Sequencing (NGS) technologies have been introduced by Roche, Illumina and other commercial manufacturers that tend to overcome Sanger sequencing limitations and have been reviewed. Introduction of NGS in clinical research and medical diagnostics is expected to change entire diagnostic approach. These include study of cancer variants, detection of minimal residual disease, exome sequencing, detection of Single Nucleotide Polymorphisms (SNPs) and their disease association, epigenetic regulation of gene expression and sequencing of microorganisms genome. (author)

  14. Functionalizing Designer DNA Crystals

    Science.gov (United States)

    Chandrasekaran, Arun Richard

    Three-dimensional crystals have been self-assembled from a DNA tensegrity triangle via sticky end interaction. The tensegrity triangle is a rigid DNA motif containing three double helical edges connected pair-wise by three four-arm junctions. The symmetric triangle contains 3 unique strands combined in a 3:3:1 ratio: 3 crossover, 3 helical and 1 central. The length of the sticky end reported previously was two nucleotides (nt) (GA:TC) and the motif with 2-helical turns of DNA per edge diffracted to 4.9 A at beam line NSLS-X25 and to 4 A at beam line ID19 at APS. The purpose of these self-assembled DNA crystals is that they can be used as a framework for hosting external guests for use in crystallographic structure solving or the periodic positioning of molecules for nanoelectronics. This thesis describes strategies to improve the resolution and to incorporate guests into the 3D lattice. The first chapter describes the effect of varying sticky end lengths and the influence of 5'-phosphate addition on crystal formation and resolution. X-ray diffraction data from beam line NSLS-X25 revealed that the crystal resolution for 1-nt (G:C) sticky end was 3.4 A. Motifs with every possible combination of 1-nt and 2-nt sticky-ended phosphorylated strands were crystallized and X-ray data were collected. The position of the 5'-phosphate on either the crossover (strand 1), helical (strand 2), or central strand (3) had an impact on the resolution of the self-assembled crystals with the 1-nt 1P-2-3 system diffracting to 2.62 A at APS and 3.1 A at NSLS-X25. The second chapter describes the sequence-specific recognition of DNA motifs with triplex-forming oligonucleotides (TFOs). This study examined the feasibility of using TFOs to bind to specific locations within a 3-turn DNA tensegrity triangle motif. The TFO 5'-TTCTTTCTTCTCT was used to target the tensegrity motif containing an appropriately embedded oligopurine.oligopyrimidine binding site. As triplex formation involving cytidine

  15. Human DNA Ligase III Recognizes DNA Ends by Dynamic Switching between Two DNA-Bound States

    Energy Technology Data Exchange (ETDEWEB)

    Cotner-Gohara, Elizabeth; Kim, In-Kwon; Hammel, Michal; Tainer, John A.; Tomkinson, Alan E.; Ellenberger, Tom (Scripps); (Maryland-MED); (WU-MED); (LBNL)

    2010-09-13

    Human DNA ligase III has essential functions in nuclear and mitochondrial DNA replication and repair and contains a PARP-like zinc finger (ZnF) that increases the extent of DNA nick joining and intermolecular DNA ligation, yet the bases for ligase III specificity and structural variation among human ligases are not understood. Here combined crystal structure and small-angle X-ray scattering results reveal dynamic switching between two nick-binding components of ligase III: the ZnF-DNA binding domain (DBD) forms a crescent-shaped surface used for DNA end recognition which switches to a ring formed by the nucleotidyl transferase (NTase) and OB-fold (OBD) domains for catalysis. Structural and mutational analyses indicate that high flexibility and distinct DNA binding domain features in ligase III assist both nick sensing and the transition from nick sensing by the ZnF to nick joining by the catalytic core. The collective results support a 'jackknife model' in which the ZnF loads ligase III onto nicked DNA and conformational changes deliver DNA into the active site. This work has implications for the biological specificity of DNA ligases and functions of PARP-like zinc fingers.

  16. Human DNA ligase III recognizes DNA ends by dynamic switching between two DNA-bound states.

    Science.gov (United States)

    Cotner-Gohara, Elizabeth; Kim, In-Kwon; Hammel, Michal; Tainer, John A; Tomkinson, Alan E; Ellenberger, Tom

    2010-07-27

    Human DNA ligase III has essential functions in nuclear and mitochondrial DNA replication and repair and contains a PARP-like zinc finger (ZnF) that increases the extent of DNA nick joining and intermolecular DNA ligation, yet the bases for ligase III specificity and structural variation among human ligases are not understood. Here combined crystal structure and small-angle X-ray scattering results reveal dynamic switching between two nick-binding components of ligase III: the ZnF-DNA binding domain (DBD) forms a crescent-shaped surface used for DNA end recognition which switches to a ring formed by the nucleotidyl transferase (NTase) and OB-fold (OBD) domains for catalysis. Structural and mutational analyses indicate that high flexibility and distinct DNA binding domain features in ligase III assist both nick sensing and the transition from nick sensing by the ZnF to nick joining by the catalytic core. The collective results support a "jackknife model" in which the ZnF loads ligase III onto nicked DNA and conformational changes deliver DNA into the active site. This work has implications for the biological specificity of DNA ligases and functions of PARP-like zinc fingers. PMID:20518483

  17. DNA-Based Kinship Analysis

    OpenAIRE

    Maguire, Christopher; Woodward, Michael

    2008-01-01

    Relatedness between individuals and groups can be investigated using DNA markers. A child’s DNA profile is a combination of alleles passed down from the father and mother. This means that relationships can be investigated between alleged family members. DNA profiling is commonly used to test for potential paternity, parentage and sibship (whether people are related as brothers or sisters) relationships. In many forensic cases more complex relationships have to be considered.

  18. DNA controlled assembly of liposomes

    DEFF Research Database (Denmark)

    Vogel, Stefan; Jakobsen, Ulla; Simonsen, Adam Cohen

    2009-01-01

    DNA-encoding of solid nanoparticles requires surfacechemistry, which is often tedious and not generally applicable. In the present study non-covalently attached DNA are used to assemble soft nanoparticles (liposomes) in solution. This process displays remarkably sharp thermal transitions from...... assembled to disassembled state for which reason this method allows easy and fast detection of polynucleotides (e.g. DNA or RNA), including single nucleotide polymorphisms as well as insertions and deletions....

  19. Some properties for DNA curve

    International Nuclear Information System (INIS)

    A DNA sequence can be identified with a word over the alphabet Σ {A, C, G, T}. An algebraic method is used to analyse DNA sequences and their three-dimensional vector representation, and, via their geometric representation, an equivalence relation on DNA sequences is introduced, and the number of equivalence classes of sequences is counted. Finally, a kind of inequality involving equivalent sequences' entropy is proved

  20. An autoradiographic demonstration of nuclear DNA replication by DNA polymerase alpha and of mitochondrial DNA synthesis by DNA polymerase gamma.

    OpenAIRE

    Geuskens, M.; Hardt, N; Pedrali-Noy, G; Spadari, S

    1981-01-01

    The incorporation of thymidine into the DNA of eukaryotic cells is markedly depressed, but not completely inhibited, by aphidicolin, a highly specific inhibitor of DNA polymerase alpha. An electron microscope autoradiographic analysis of the synthesis of nuclear and mitochondrial DNA in vivo in Concanavalin A stimulated rabbit spleen lymphocytes and in Hamster cell cultures, in the absence and in the presence of aphidicolin, revealed that aphidicolin inhibits the nuclear but not the mitochond...

  1. DNA condensation in two dimensions

    OpenAIRE

    Koltover, Ilya; Wagner, Kathrin; Safinya, Cyrus R.

    2000-01-01

    We have found that divalent electrolyte counterions common in biological cells (Ca2+, Mg2+, and Mn2+ ) can condense anionic DNA molecules confined to two-dimensional cationic surfaces. DNA-condensing agents in vivo include cationic histones and polyamines spermidine and spermine with sufficiently high valence (Z) 3 or larger. In vitro studies show that electrostatic forces between DNA chains in bulk aqueous solution containing divalent counterions remain purely ...

  2. Quantitative assessment of DNA condensation.

    Science.gov (United States)

    Trubetskoy, V S; Slattum, P M; Hagstrom, J E; Wolff, J A; Budker, V G

    1999-02-15

    A fluorescent method is proposed for assessing DNA condensation in aqueous solutions with variety of condensing agents. The technique is based on the effect of concentration-dependent self-quenching of covalently bound fluorophores upon DNA collapse. The method allows a more precise determination of charge equivalency in titration experiments with various polycations. The technique's ability to determine the number of DNA molecules that are condensed together in close proximity is under further investigation.

  3. Cisplatin–DNA adducts inhibit translocation of the Ku subunits of DNA-PK

    OpenAIRE

    Turchi, John J.; Henkels, Karen M.; Zhou, Yun

    2000-01-01

    We have determined the effect of cisplatin–DNA damage on the ability of the DNA-dependent protein kinase (DNA-PK) to interact with duplex DNA molecules in vitro. The Ku DNA binding subunits of DNA-PK display a reduced ability to translocate on duplex DNA containing cisplatin–DNA adducts compared to control, undamaged duplex DNA. The decreased rates of translocation resulted in a decrease in the association of the p460 catalytic subunit of DNA-PK (DNA-PKcs) with the Ku–DNA complex. In addition...

  4. Stabbing simulations and DNA transfer.

    Science.gov (United States)

    Samie, Lydie; Hicks, Tacha; Castella, Vincent; Taroni, Franco

    2016-05-01

    Technical developments have made it possible to analyze very low amounts of DNA. This has many advantages, but the drawback of this technological progress is that interpretation of the results becomes increasingly complex: the number of mixed DNA profiles increased relatively to single source DNA profiles and stochastic effects in the DNA profile, such as drop-in and drop-out, are more frequently observed. Moreover, the relevance of low template DNA material regarding the activities alleged is not as straightforward as it was a few years ago, when for example large quantities of blood were recovered. The possibility of secondary and tertiary transfer is now becoming an issue. The purpose of this research is twofold: first, to study the transfer of DNA from the handler and secondly, to observe if handlers would transfer DNA from persons closely connected to them. We chose to mimic cases where the offender would attack a person with a knife. As a first approach, we envisaged that the defense would not give an alternative explanation for the origin of the DNA. In our transfer experiments (4 donors, 16 experiments each, 64 traces), 3% of the traces were single DNA profiles. Most of the time, the DNA profile of the person handling the knife was present as the major profile: in 83% of the traces the major contributor profile corresponded to the stabber's DNA profile (in single stains and mixtures). Mixture with no clear major/minor fraction (12%) were observed. 5% of the traces were considered of insufficient quality (more than 3 contributors, presence of a few minor peaks). In that case, we considered that the stabber's DNA was absent. In our experiments, no traces allowed excluding the stabber, however it must be noted that precautions were taken to minimize background DNA as knives were cleaned before the experiments. DNA profiles of the stabber's colleagues were not observed. We hope that this study will allow for a better understanding of the transfer mechanism and

  5. Statistical Approaches for DNA Barcoding

    DEFF Research Database (Denmark)

    Nielsen, Rasmus; Matz, M.

    2006-01-01

    The use of DNA as a tool for species identification has become known as "DNA barcoding" (Floyd et al., 2002; Hebert et al., 2003; Remigio and Hebert, 2003). The basic idea is straightforward: a small amount of DNA is extracted from the specimen, amplified and sequenced. The gene region sequenced...... is chosen so that it is nearly identical among individuals of the same species, but different between species, and therefore its sequence, can serve as an identification tag for the species ("DNA barcode"). By matching the sequence obtained from an unidentified specimen ("query" sequence) to the database...

  6. DNA repair: keeping it together

    DEFF Research Database (Denmark)

    Lisby, Michael; Rothstein, Rodney

    2004-01-01

    A protein scaffold has been identified that holds a chromosome together in the event of a DNA double-strand break. This scaffold is dependent on Rad52 and the Rad50-Mre11-Xrs2 complex and withstands the pulling forces of the mitotic spindle during DNA damage checkpoint arrest.......A protein scaffold has been identified that holds a chromosome together in the event of a DNA double-strand break. This scaffold is dependent on Rad52 and the Rad50-Mre11-Xrs2 complex and withstands the pulling forces of the mitotic spindle during DNA damage checkpoint arrest....

  7. Monitoring Biodiversity using Environmental DNA

    DEFF Research Database (Denmark)

    Thomsen, Philip Francis

    of eDNA in monitoring of biodiversity in different settings. First, it is shown that a diversity of rare freshwater animals – representing amphibians, fish, mammals, insects and crustaceans – can be detected based on eDNA obtained directly from 15 ml water samples of lakes, ponds and streams....... For the amphibians there is a quantitative relationship between species-specific eDNA molecules and population sizes. Furthermore, it is demonstrated that entire faunas of amphibians and fish can be detected by next-generation sequencing (NGS) of eDNA from pond water. Secondly, the method is applied in a marine...

  8. Synthesis of chemically modified DNA.

    Science.gov (United States)

    Shivalingam, Arun; Brown, Tom

    2016-06-15

    Naturally occurring DNA is encoded by the four nucleobases adenine, cytosine, guanine and thymine. Yet minor chemical modifications to these bases, such as methylation, can significantly alter DNA function, and more drastic changes, such as replacement with unnatural base pairs, could expand its function. In order to realize the full potential of DNA in therapeutic and synthetic biology applications, our ability to 'write' long modified DNA in a controlled manner must be improved. This review highlights methods currently used for the synthesis of moderately long chemically modified nucleic acids (up to 1000 bp), their limitations and areas for future expansion. PMID:27284032

  9. DNA nanotechnology-enabled biosensors.

    Science.gov (United States)

    Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

    2016-02-15

    Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. PMID:26212206

  10. DNA nanotechnology-enabled biosensors.

    Science.gov (United States)

    Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

    2016-02-15

    Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors.

  11. UV Damage in DNA Promotes Nucleosome Unwrapping*

    OpenAIRE

    Duan, Ming-Rui; Smerdon, Michael J.

    2010-01-01

    The association of DNA with histones in chromatin impedes DNA repair enzymes from accessing DNA lesions. Nucleosomes exist in a dynamic equilibrium in which portions of the DNA molecule spontaneously unwrap, transiently exposing buried DNA sites. Thus, nucleosome dynamics in certain regions of chromatin may provide the exposure time and space needed for efficient repair of buried DNA lesions. We have used FRET and restriction enzyme accessibility to study nucleosome dynamics following DNA dam...

  12. Aging and DNA repair capability. [Review

    Energy Technology Data Exchange (ETDEWEB)

    Tice, R R

    1977-01-01

    A review of the literature on DNA repair processes in relation to aging is presented under the following headings: DNA repair processes; age-related occurrence of unrepaired DNA lesions; DNA repair capability as a function of age; tissue-specific DNA repair capability; acceleration of the aging process by exposure to DNA damaging agents; human genetic syndromes; and longevity and DNA repair processes. (HLW)

  13. DNA extraction from formalin-fixed material.

    Science.gov (United States)

    Campos, Paula F; Gilbert, Thomas M P

    2012-01-01

    The principal challenges facing PCR-based analyses of DNA extracted from formalin-fixed materials are fragmentation of the DNA and cross-linked protein-DNA complexes. Here, we present an efficient protocol to extract DNA from formalin-fixed or paraffin-embedded tissues (FFPE). In this protocol, protein-DNA cross-links are reversed using heat and alkali treatment, yielding significantly longer fragments and larger amounts of PCR-amplifiable DNA than standard DNA extraction protocols.

  14. hOGG1基因多态性与胃癌遗传易感性的关系%Relationship between polymorphism in hOGG1 and XPD and genetic susceptibility to gastric cancer

    Institute of Scientific and Technical Information of China (English)

    于兆亚; 汤静

    2013-01-01

    Objective To investigate the relationship between polymorphism in human 8-oxoguanine DNA glycosylase 1(hOGG1) and xeroderma pigmentosum group D (XPD) and genetic susceptibility to gastric cancer. Methods The peripheral blood samples of 98 cases of gastric cancer and 80 non-tumor volunteers(control group) in Zhengzhou and Kaifeng of Henan were collected, the peripheral DNA repair enzyme gene polymorphism in gastric cancer populations were detected by using polymerase chain reaction restriction fragment length polymorphism(PCR-RFLP), and it's relationship with genetic susceptibility to cancer was analyzed. Results There were significant differences in genotypes frequency of hOGG1Ser326Cys and XPD Lys751Gln between gastric cancer group and control group (P 1, API=0.38). Conclusion The Lys751Gln genotype and susceptibility to gastric cancer in individuals can be relevant. The interaction between carrying Cys or Gln gene-gene and alcohol can increase the susceptibility to gastric cancer.%目的:探讨人类8-羟基鸟嘌呤DNA糖苷酶1(hOGG 1)基因多态性与胃癌遗传易感性的关系。方法收集河南郑州和开封地区98例胃癌患者和80例非肿瘤对照组志愿者外周血样,应用聚合酶链反应-限制性片段长度多态性(PCR-RFLP)检测法检测胃癌人群的外周血中DNA损伤修复酶基因多态性,分析其与肿瘤遗传易感性的关系。结果 hOGG1Ser326Cys基因的各基因型频率在胃癌组和对照组间的分布差异有统计学意义(P<0.05)。携带Cys326Cys基因型者胃癌的发病风险增加1.7倍(OR=1.706,95%CI=0.341~2.462,P=0.002)。hOGG1Ser 326Cys基因多态性与酒的交互作用增加胃癌的发病风险(S>1,API=0.38)。结论Cys326Cys基因型是胃癌发病的危险基因型,携带Cys易感基因与饮酒交互作用时可能增加患胃癌的易感性。

  15. DNA Ladder的制备%Preparation of DNA Ladder

    Institute of Scientific and Technical Information of China (English)

    王俐; 董卫华; 张俊河; 王天云

    2011-01-01

    背景:目前,制备DNA 分子量标准的方法主要有2 种,一种是用限制性内切酶消化某种DNA,另一种是利用PCR 扩增,2 种方法各有优缺点.在前期采用PCR 技术在前期扩增100~500 bp 片段的基础上,实验室又成功扩增出600~1 000 bp片段,PCR 产物经过纯化,混匀,制备的DNA Ladder,结果制备DNA Ladder 的条带清晰,易于识别,可完全与公司商品化的DNA Ladder 相比,完全可用于分子生物学实验.目的:利用PCR 扩增技术制备DNA 分子量标准参照物.方法:自行构建了一种特殊适宜扩增的质粒pUC-DNA,根据pUC-DNA 的基因序列,利用primer5.0 设计能特异扩增100~1 000 bp 的PCR 引物.PCR 扩增出100~1 000 bp 大小的DNA 片段,在2%琼脂糖凝胶中电泳观察结果.用凝胶回收试剂盒回收目的PCR 产物,测序结果与pUC-DNA 上基因序列进行序列比对,Blast 进行同源性分析.将PCR 产物用酚/氯仿抽提,乙醇沉淀,按比例混匀,即可使用.结果与结论:利用PCR 技术能够成功扩增出100~1 000 bp 条带,片段大小与预期结果相符,片段序列与GenBank 序列完全一致,利用回收片段制备的DNA Ladder 条带清晰,可与同类产品相比.%BACKGROUND: DNA molecular weight standard (DNA Ladder) is one of necessary reagents in molecular biological laboratory.It can correctly measure the length of DNA fragments and serve as the DNA molecular weight standard. Now, there are two methods to prepare the DNA Ladder, one is PCR technique, the other is through DNA digestion by restriction enzyme. The two methods all have some merits and drawbacks. The first one can produce standard bands, but is difficult to obtain large bands.The second method is to prepare DNA Ladder restriction digestion of plasmid or phage DNA. In previous study, we have amplified 100-500 bp DNA fragments by using PCR technique, then purified the PCR product and prepared DNA Ladder. The bands of the prepared DNA Ladder were clear, higher

  16. Influence of DNA methylation on positioning and DNA flexibility of nucleosomes with pericentric satellite DNA.

    Science.gov (United States)

    Osakabe, Akihisa; Adachi, Fumiya; Arimura, Yasuhiro; Maehara, Kazumitsu; Ohkawa, Yasuyuki; Kurumizaka, Hitoshi

    2015-10-01

    DNA methylation occurs on CpG sites and is important to form pericentric heterochromatin domains. The satellite 2 sequence, containing seven CpG sites, is located in the pericentric region of human chromosome 1 and is highly methylated in normal cells. In contrast, the satellite 2 region is reportedly hypomethylated in cancer cells, suggesting that the methylation status may affect the chromatin structure around the pericentric regions in tumours. In this study, we mapped the nucleosome positioning on the satellite 2 sequence in vitro and found that DNA methylation modestly affects the distribution of the nucleosome positioning. The micrococcal nuclease assay revealed that the DNA end flexibility of the nucleosomes changes, depending on the DNA methylation status. However, the structures and thermal stabilities of the nucleosomes are unaffected by DNA methylation. These findings provide new information to understand how DNA methylation functions in regulating pericentric heterochromatin formation and maintenance in normal and malignant cells.

  17. DNA primase acts as a molecular brake in DNA replication

    NARCIS (Netherlands)

    Lee, Jong-Bong; Hite, Richard K.; Hamdan, Samir M.; Xie, X. Sunney; Richardson, Charles C.; Oijen, Antoine M. van

    2006-01-01

    A hallmark feature of DNA replication is the coordination between the continuous polymerization of nucleotides on the leading strand and the discontinuous synthesis of DNA on the lagging strand. This synchronization requires a precisely timed series of enzymatic steps that control the synthesis of a

  18. Pea amyloplast DNA is qualitatively similar to pea chloroplast DNA

    Science.gov (United States)

    Gaynor, J. J.

    1984-01-01

    Amyloplast DNA (apDNA), when subjected to digestion with restriction endonucleases, yields patterns nearly identical to that of DNA from mature pea chloroplasts (ctDNA). Southern transfers of apDNA and ctDNA, probed with the large subunit (LS) gene of ribulose-1,5-bisphosphate carboxylase (Rubisco), shows hybridization to the expected restriction fragments for both apDNA and ctDNA. However, Northern transfers of total RNA from chloroplasts and amyloplasts, probed again with the LS gene of Rubisco, shows that no detectable LS meggage is found in amyloplasts although LS expression in mature chloroplasts is high. Likewise, two dimensional polyacrylamide gel electrophoresis of etiolated gravisensitive pea tissue shows that both large and small subunits of Rubisco are conspicuously absent; however, in greening tissue these two constitute the major soluble proteins. These findings suggest that although the informational content of these two organelle types is equivalent, gene expression is quite different and is presumably under nuclear control.

  19. Priming DNA Replication from Triple Helix Oligonucleotides: Possible Threestranded DNA in DNA Polymerases

    OpenAIRE

    Lestienne, Patrick P.

    2011-01-01

    Triplex associate with a duplex DNA presenting the same polypurine or polypyrimidine-rich sequence in an antiparallel orientation. So far, triplex forming oligonucleotides (TFOs) are known to inhibit transcription, replication, and to induce mutations. A new property of TFO is reviewed here upon analysis of DNA breakpoint yielding DNA rearrangements; the synthesized sequence of the first direct repeat displays a skewed polypurine- rich sequence. This synthesized sequence can bind the second h...

  20. Master equation approach to DNA breathing in heteropolymer DNA

    DEFF Research Database (Denmark)

    Ambjörnsson, Tobias; Banik, Suman K; Lomholt, Michael A;

    2007-01-01

    After crossing an initial barrier to break the first base-pair (bp) in double-stranded DNA, the disruption of further bps is characterized by free energies up to a few k(B)T. Thermal motion within the DNA double strand therefore causes the opening of intermittent single-stranded denaturation zones......, the DNA bubbles. The unzipping and zipping dynamics of bps at the two zipper forks of a bubble, where the single strand of the denatured zone joins the still intact double strand, can be monitored by single molecule fluorescence or NMR methods. We here establish a dynamic description of this DNA breathing...... in a heteropolymer DNA with given sequence in terms of a master equation that governs the time evolution of the joint probability distribution for the bubble size and position along the sequence. The transfer coefficients are based on the Poland-Scheraga free energy model. We derive the autocorrelation function...