WorldWideScience

Sample records for 710 reactor

  1. Reactors

    CERN Document Server

    International Electrotechnical Commission. Geneva

    1988-01-01

    This standard applies to the following types of reactors: shunt reactors, current-limiting reactors including neutral-earthing reactors, damping reactors, tuning (filter) reactors, earthing transformers (neutral couplers), arc-suppression reactors, smoothing reactors, with the exception of the following reactors: small reactors with a rating generally less than 2 kvar single-phase and 10 kvar three-phase, reactors for special purposes such as high-frequency line traps or reactors mounted on rolling stock.

  2. Reactor

    Science.gov (United States)

    Evans, Robert M.

    1976-10-05

    1. A neutronic reactor having a moderator, coolant tubes traversing the moderator from an inlet end to an outlet end, bodies of material fissionable by neutrons of thermal energy disposed within the coolant tubes, and means for circulating water through said coolant tubes characterized by the improved construction wherein the coolant tubes are constructed of aluminum having an outer diameter of 1.729 inches and a wall thickness of 0.059 inch, and the means for circulating a liquid coolant through the tubes includes a source of water at a pressure of approximately 350 pounds per square inch connected to the inlet end of the tubes, and said construction including a pressure reducing orifice disposed at the inlet ends of the tubes reducing the pressure of the water by approximately 150 pounds per square inch.

  3. 710ECO Repower机车

    Institute of Scientific and Technical Information of China (English)

    Bill Siuru; 程永陆

    2010-01-01

    710ECO Repower技术是美国EMD公司不久前专门针对自己早先制造的中低功率机车的升级改造而开发的,其核心部件包括久经考验的EMD 710系列柴油机、EM2000微机控制系统及发动机自动起动和停机(AESS)系统等.采用710ECO Repower技术完成升级改造的机车比原型机车减少燃油消耗25%,减少机油消耗50%,减少排放70%,从而达到美国环保局的Tier2排放标准.文中简要介绍了710ECO Repower机车的设计特点和主要技术参数.

  4. Status of Fermilab E-710

    Energy Technology Data Exchange (ETDEWEB)

    Rubinstein, R.; E-710 Collaboration

    1993-08-01

    This report give the current status of E-710, an experiment at the Fermilab {bar p}p Tevatron Collider to measure elastic scattering, total cross sections and diffraction dissociation up to {radical}s = 1.8 TeV.

  5. 23 CFR 710.303 - Planning.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Planning. 710.303 Section 710.303 Highways FEDERAL... ESTATE Project Development § 710.303 Planning. State and local governments conduct metropolitan and statewide planning to develop coordinated, financially constrained system plans to meet transportation needs...

  6. 21 CFR 710.4 - Information requested.

    Science.gov (United States)

    2010-04-01

    ... VOLUNTARY REGISTRATION OF COSMETIC PRODUCT ESTABLISHMENTS § 710.4 Information requested. Form FD-2511 requests information on the name and address of the cosmetic product establishment, including post office... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Information requested. 710.4 Section 710.4 Food...

  7. 30 CFR 710.2 - Objectives.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Objectives. 710.2 Section 710.2 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION AND ENFORCEMENT, DEPARTMENT OF THE INTERIOR INITIAL PROGRAM REGULATIONS INITIAL REGULATORY PROGRAM § 710.2 Objectives. The objectives of the initial regulatory...

  8. 23 CFR 710.309 - Acquisition.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Acquisition. 710.309 Section 710.309 Highways FEDERAL... ESTATE Project Development § 710.309 Acquisition. The process of acquiring real property includes... settlements, and condemnation. The State shall conduct acquisition and related relocation activities...

  9. 23 CFR 710.501 - Early acquisition.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Early acquisition. 710.501 Section 710.501 Highways... REAL ESTATE Property Acquisition Alternatives § 710.501 Early acquisition. (a) Real property acquisition. The State may initiate acquisition of real property at any time it has the legal authority to...

  10. 23 CFR 710.407 - Leasing.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Leasing. 710.407 Section 710.407 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RIGHT-OF-WAY AND ENVIRONMENT RIGHT-OF-WAY AND REAL ESTATE Real Property Management § 710.407 Leasing. (a) Leasing of real property acquired with title 23...

  11. 40 CFR 1065.710 - Gasoline.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Gasoline. 1065.710 Section 1065.710... PROCEDURES Engine Fluids, Test Fuels, Analytical Gases and Other Calibration Standards § 1065.710 Gasoline. (a) Gasoline for testing must have octane values that represent commercially available fuels for...

  12. 40 CFR 710.58 - Confidentiality.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Confidentiality. 710.58 Section 710.58... CHEMICAL INVENTORY REGULATIONS Inventory Update Reporting for 2006 and Beyond § 710.58 Confidentiality. (a) Any person submitting information under this subpart may assert a business confidentiality claim for...

  13. 23 CFR 710.403 - Management.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Management. 710.403 Section 710.403 Highways FEDERAL... ESTATE Real Property Management § 710.403 Management. (a) The STD must assure that all real property..., planning, right-of-way, environment, access management, and traffic operations. (c) The STD shall...

  14. 23 CFR 710.311 - Construction advertising.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Construction advertising. 710.311 Section 710.311...-WAY AND REAL ESTATE Project Development § 710.311 Construction advertising. The State must manage real... advertising for construction, the State shall develop ROW availability statements and certifications...

  15. 10 CFR 710.34 - Attorney representation.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Attorney representation. 710.34 Section 710.34 Energy DEPARTMENT OF ENERGY CRITERIA AND PROCEDURES FOR DETERMINING ELIGIBILITY FOR ACCESS TO CLASSIFIED MATTER OR... Classified Matter or Special Nuclear Material Miscellaneous § 710.34 Attorney representation. In the event...

  16. 10 CFR 710.35 - Time frames.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Time frames. 710.35 Section 710.35 Energy DEPARTMENT OF... Matter or Special Nuclear Material Miscellaneous § 710.35 Time frames. Statements of time established for processing aspects of a case under this subpart are the agency's desired time frames in implementing...

  17. 42 CFR 431.710 - Provisional licenses.

    Science.gov (United States)

    2010-10-01

    ... (CONTINUED) MEDICAL ASSISTANCE PROGRAMS STATE ORGANIZATION AND GENERAL ADMINISTRATION State Programs for Licensing Nursing Home Administrators § 431.710 Provisional licenses. To fill a position of nursing...

  18. 48 CFR 2446.710 - Contract clauses.

    Science.gov (United States)

    2010-10-01

    ... Performance Specifications or Design Criteria, whenever it is in the Government's interest. ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Contract clauses. 2446.710... CONTRACT MANAGEMENT QUALITY ASSURANCE Warranties 2446.710 Contract clauses. (c)(1) The contracting...

  19. Dicty_cDB: SSI710 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSI710 (Link to dictyBase) - G02331 DDB0220493 Contig-U01839-1 | Contig-U15575-1 SSI...710P (Link to Original site) SSI710F 425 SSI710Z 550 SSI710P 975 - - Show SSI710 Libra...ry SS (Link to library) Clone ID SSI710 (Link to dictyBase) Atlas ID - NBRP ID G02331 dictyBase ID DDB022049...cdb.biol.tsukuba.ac.jp/CSM/SS/SSI7-A/SSI710Q.Seq.d/ Representative seq. ID SSI710P (Link to Original site) R...epresentative DNA sequence >SSI710 (SSI710Q) /CSM/SS/SSI7-A/SSI710Q.Seq.d/ CCAAAAACTATTTATAAATTTTGTCTCCAAACA

  20. Dicty_cDB: SLE710 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0.00 m3b: 0.00 m_ : 1.00 60.0 %: cytoplasmic 36.0 %: nuclear 4.0 %: mitochondrial >> prediction for SLE710 ...SL (Link to library) SLE710 (Link to dictyBase) - G24179 DDB0183969 Contig-U01273-1 SLE...710P (Link to Original site) SLE710F 170 SLE710Z 562 SLE710P 732 - - Show SLE710 Library SL (Link to library) Clone ID SLE...ontig-U01273-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLE7-A/SLE...710Q.Seq.d/ Representative seq. ID SLE710P (Link to Original site) Representative DNA sequence >SLE710 (SLE710Q) /CSM/SL/SLE

  1. 48 CFR 246.710 - Contract clauses.

    Science.gov (United States)

    2010-10-01

    ... OF DEFENSE CONTRACT MANAGEMENT QUALITY ASSURANCE Warranties 246.710 Contract clauses. (1) Use a... Construction (Germany), instead of the clause at FAR 52.246-21, Warranty of Construction, in solicitations and... Germany....

  2. Dicty_cDB: CHP710 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHP710 (Link to dictyBase) - G02976 - Contig-U15934-1 CHP710P ...(Link to Original site) CHP710F 578 CHP710Z 701 CHP710P 1259 - - Show CHP710 Library CH (Link to library) Clone ID CHP...iginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHP7-A/CHP710Q.Seq.d/ Representative seq. ID CHP...710P (Link to Original site) Representative DNA sequence >CHP710 (CHP710Q) /CSM/CH/CHP7-A/CHP...-cDNA Score E Sequences producing significant alignments: (bits) Value SFI407 (SFI407Q) /CSM/SF/SFI4-A/SFI407Q.Seq.d/ 652 0.0 CHP

  3. 23 CFR 710.201 - State responsibilities.

    Science.gov (United States)

    2010-04-01

    ... Federal laws and regulations. (c) Right-of-way (ROW) operations manual. Each STD which receives funding from the highway trust fund shall maintain a manual describing its right-of-way organization, policies... REAL ESTATE Program Administration § 710.201 State responsibilities. (a) Organization. Each STD shall...

  4. 12 CFR 268.710 - Compliance procedures.

    Science.gov (United States)

    2010-01-01

    ... Women's Program Manager, the Hispanic Employment Program Coordinator, or the People with Disabilities... Because of Physical or Mental Disability § 268.710 Compliance procedures. (a) Applicability. Except as..., applies to all allegations of discrimination on the basis of a disability in programs or...

  5. 23 CFR 710.409 - Disposals.

    Science.gov (United States)

    2010-04-01

    ... market value for continued public use is clearly justified as in the public interest and approved by the FHWA, the deed shall provide for reversion of the property for failure to continue public ownership and... described in 23 CFR 710.403(d)(1) for less than fair market value require a public interest determination...

  6. 36 CFR 7.10 - Zion National Park.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Zion National Park. 7.10 Section 7.10 Parks, Forests, and Public Property NATIONAL PARK SERVICE, DEPARTMENT OF THE INTERIOR SPECIAL REGULATIONS, AREAS OF THE NATIONAL PARK SYSTEM § 7.10 Zion National Park. (a) Vehicle convoy requirements....

  7. 22 CFR 710.15 - Delegation of authority.

    Science.gov (United States)

    2010-04-01

    ... of OPIC. An examiner shall be delegated authority on an ad hoc basis. ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Delegation of authority. 710.15 Section 710.15... ENFORCEMENT PROCEDURES OF POST-EMPLOYMENT RESTRICTIONS § 710.15 Delegation of authority. The functions of the...

  8. 46 CFR 182.710 - Piping for vital systems.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Piping for vital systems. 182.710 Section 182.710... TONS) MACHINERY INSTALLATION Piping Systems § 182.710 Piping for vital systems. (a) Vital systems are... section is a non-vital system. (c) Piping used in a vital system must: (1) Be composed of...

  9. 46 CFR 119.710 - Piping for vital systems.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Piping for vital systems. 119.710 Section 119.710... Piping Systems § 119.710 Piping for vital systems. (a) Vital systems are those systems that are vital to...-vital system. (c) Piping used in a vital system must meet § 56.60 in subchapter F of this...

  10. 23 CFR 710.313 - Design-build projects.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Design-build projects. 710.313 Section 710.313 Highways... REAL ESTATE Project Development § 710.313 Design-build projects. (a) In the case of a design-build...-way acquisition and clearance services may be incorporated into the design-build contract if...

  11. 40 CFR 710.33 - When to report.

    Science.gov (United States)

    2010-07-01

    ... person manufactured during the corporate fiscal year described in § 710.28(a). (b) Recurring reporting... applicable corporate fiscal year described in § 710.28(b). (c) Reporting in 1998. The 1998 reporting period... manufactured during the applicable corporate fiscal year described in § 710.28(b). This reporting period...

  12. 46 CFR 184.710 - First-aid kits.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false First-aid kits. 184.710 Section 184.710 Shipping COAST... CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Miscellaneous § 184.710 First-aid kits. A vessel must carry either a first-aid kit approved under approval series 160.041 or a kit with equivalent...

  13. Nuclear Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Hogerton, John

    1964-01-01

    This pamphlet describes how reactors work; discusses reactor design; describes research, teaching, and materials testing reactors; production reactors; reactors for electric power generation; reactors for supply heat; reactors for propulsion; reactors for space; reactor safety; and reactors of tomorrow. The appendix discusses characteristics of U.S. civilian power reactor concepts and lists some of the U.S. reactor power projects, with location, type, capacity, owner, and startup date.

  14. Reference: 710 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 710 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u18162593i Jung Choonkyun et al. 2008 Fe...ic stress tolerance of transgenic Arabidopsis overexpressing AtMYB44 was conferred by reduced expression of ...naling. Overexpression of AtMYB44 enhances stomatal closure to confer abiotic stress tolerance in transgenic... Arabidopsis. 2 623-35 18162593 2008 Feb Plant physiology Cheong Jong-Joo|Choi Yang Do|Han Sang Won|Jung Choonkyun|Kim Chung Ho|Koo Yeon Jong|Nahm Baek Hie|Seo Jun Sung|Song Sang Ik

  15. 46 CFR 121.710 - First-aid kits.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false First-aid kits. 121.710 Section 121.710 Shipping COAST... SYSTEMS AND EQUIPMENT Miscellaneous § 121.710 First-aid kits. A vessel must carry either a first-aid kit... kits, the contents must be stowed in a suitable, watertight container that is marked “First-Aid Kit”....

  16. Dicty_cDB: VSH710 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available S/VSH7-A/VSH710Q.Seq.d/ Representative seq. ID VSH710F (Link to Original site) Representative...as ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/V

  17. 40 CFR 710.32 - Reporting information to EPA.

    Science.gov (United States)

    2010-07-01

    ... corporate fiscal year for which the person is required to report. (a) Reporting in writing. Any person who... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Reporting information to EPA. 710.32... CONTROL ACT TSCA CHEMICAL INVENTORY REGULATIONS 2002 Inventory Update Reporting § 710.32...

  18. 40 CFR 710.4 - Scope of the inventory.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Scope of the inventory. 710.4 Section... ACT TSCA CHEMICAL INVENTORY REGULATIONS General Provisions § 710.4 Scope of the inventory. (a... is extracted from air by any means, will automatically be included in the inventory under...

  19. 40 CFR 1042.710 - Averaging emission credits.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Averaging emission credits. 1042.710..., Banking, and Trading for Certification § 1042.710 Averaging emission credits. (a) Averaging is the exchange of emission credits among your engine families. (b) You may certify one or more engine families to...

  20. 19 CFR 10.710 - Value-content requirement.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Value-content requirement. 10.710 Section 10.710 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE... salaries, casualty and liability insurance, advertising, and salesmen's salaries, commissions, or expenses....

  1. 12 CFR 710.8 - Certificate of dissolution and liquidation.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Certificate of dissolution and liquidation. 710... UNIONS VOLUNTARY LIQUIDATION § 710.8 Certificate of dissolution and liquidation. Within 120 days after the final distribution of assets to members is started, a duly executed Certificate of Dissolution and...

  2. Equine dermatopathies in southern Brazil: a study of 710 cases

    Directory of Open Access Journals (Sweden)

    Nathalia Dode de Assis-Brasil

    2015-03-01

    Full Text Available A retrospective study of equine skin diseases diagnosed in the Laboratório Regional de Diagnóstico, Faculdade de Veterinária, Universidade Federal de Pelotas was conducted between 1978 and 2013. The necropsy and biopsy protocols for horses received for diagnosis were reviewed to determine the prevalence of dermatopathies in southern Brazil. The most prevalent skin diseases in decreasing order were: sarcoid [234/710 (32.9%], exuberant granulation tissue [81/710 (11.4%], pythiosis [67/710 (9.4%], squamous cell carcinoma [55/710 (7.7%], papillomatosis [33/710 (4.6%] and habronemiasis [30/710 (4.2%]. Other skin lesions accounted for 25.3% of all cases studied. The Crioulo breed was the most prevalent [310/710 (43.6%]. Horses aged between 2-5 years old [230/710 (32.3%] were the most frequently affected. The data obtained in this study demonstrate the importance of skin diseases that affect horses in southern Brazil. The most of the dermatopathies observed in horses, although not resulting in death could cause aesthetic damage resulting in animal rejection, the inability to participate in collective sports activities and economic losses due to treatment and surgery costs

  3. 27 CFR 7.10 - Meaning of terms.

    Science.gov (United States)

    2010-04-01

    ..., Alcohol and Tobacco Tax and Trade Bureau, Department of the Treasury, Washington, DC. Advertisement. See... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Meaning of terms. 7.10 Section 7.10 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU,...

  4. H Reactor

    Data.gov (United States)

    Federal Laboratory Consortium — The H Reactor was the first reactor to be built at Hanford after World War II.It became operational in October of 1949, and represented the fourth nuclear reactor on...

  5. 40 CFR 141.710 - Bin classification for filtered systems.

    Science.gov (United States)

    2010-07-01

    ... Cryptosporidium Treatment Technique Requirements § 141.710 Bin classification for filtered systems. (a) Following... systems must determine their initial bin classification from the following table and using the... systems must report their initial bin classification under paragraph (c) of this section to the State...

  6. 20 CFR 725.710 - Objective of vocational rehabilitation.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Objective of vocational rehabilitation. 725... OF THE FEDERAL MINE SAFETY AND HEALTH ACT, AS AMENDED Medical Benefits and Vocational Rehabilitation § 725.710 Objective of vocational rehabilitation. The objective of vocational rehabilitation is...

  7. 40 CFR 710.28 - Persons who must report.

    Science.gov (United States)

    2010-07-01

    ... CONTROL ACT TSCA CHEMICAL INVENTORY REGULATIONS 2002 Inventory Update Reporting § 710.28 Persons who must... during the person's latest complete corporate fiscal year before August 25, 1986. (b) Persons subject to recurring reporting. Any person who manufactured for commercial purposes 10,000 pounds (4,540 kilograms)...

  8. 40 CFR 1033.710 - Averaging emission credits.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Averaging emission credits. 1033.710... Averaging emission credits. (a) Averaging is the exchange of emission credits among your engine families. You may average emission credits only as allowed by § 1033.740. (b) You may certify one or more engine...

  9. 24 CFR 3280.710 - Venting, ventilation and combustion air.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 5 2010-04-01 2010-04-01 false Venting, ventilation and combustion... Fuel Burning Systems § 3280.710 Venting, ventilation and combustion air. (a) The venting as required by... appliance listing and the appliance manufacturer's instructions. (b) Venting and combustion air systems...

  10. 42 CFR 457.710 - State plan requirements: Strategic objectives and performance goals.

    Science.gov (United States)

    2010-10-01

    ... performance goals. 457.710 Section 457.710 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT...) ALLOTMENTS AND GRANTS TO STATES Strategic Planning, Reporting, and Evaluation § 457.710 State plan requirements: Strategic objectives and performance goals. (a) Plan description. A State plan must include...

  11. 46 CFR 7.10 - Eastport, ME to Cape Ann, MA.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Eastport, ME to Cape Ann, MA. 7.10 Section 7.10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY PROCEDURES APPLICABLE TO THE PUBLIC BOUNDARY LINES Atlantic Coast § 7.10 Eastport, ME to Cape Ann, MA. (a) A line drawn from the easternmost extremity of...

  12. 21 CFR 1404.710 - When does a suspension take effect?

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 9 2010-04-01 2010-04-01 false When does a suspension take effect? 1404.710 Section 1404.710 Food and Drugs OFFICE OF NATIONAL DRUG CONTROL POLICY GOVERNMENTWIDE DEBARMENT AND SUSPENSION (NONPROCUREMENT) Suspension § 1404.710 When does a suspension take effect? A suspension...

  13. 21 CFR 358.710 - Active ingredients for the control of dandruff, seborrheic dermatitis, or psoriasis.

    Science.gov (United States)

    2010-04-01

    ..., seborrheic dermatitis, or psoriasis. 358.710 Section 358.710 Food and Drugs FOOD AND DRUG ADMINISTRATION... Psoriasis § 358.710 Active ingredients for the control of dandruff, seborrheic dermatitis, or psoriasis. The... psoriasis. (1) Coal tar, 0.5 to 5 percent. When a coal tar solution, derivative, or fraction is used as...

  14. 33 CFR 150.710 - What are the requirements for supplying power to aids to navigation?

    Science.gov (United States)

    2010-07-01

    ... supplying power to aids to navigation? 150.710 Section 150.710 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS: OPERATIONS Aids to Navigation § 150.710 What are the requirements for supplying power to aids to navigation? The power of all...

  15. Reactor Physics

    Energy Technology Data Exchange (ETDEWEB)

    Ait Abderrahim, A

    2001-04-01

    The Reactor Physics and MYRRHA Department of SCK-CEN offers expertise in various areas of reactor physics, in particular in neutronics calculations, reactor dosimetry, reactor operation, reactor safety and control and non-destructive analysis of reactor fuel. This expertise is applied in the Department's own research projects in the VENUS critical facility, in the BR1 reactor and in the MYRRHA project (this project aims at designing a prototype Accelerator Driven System). Available expertise is also used in programmes external to the Department such as the reactor pressure steel vessel programme, the BR2 reactor dosimetry, and the preparation and interpretation of irradiation experiments by means of neutron and gamma calculations. The activities of the Fuzzy Logic and Intelligent Technologies in Nuclear Science programme cover several domains outside the department. Progress and achievements in these topical areas in 2000 are summarised.

  16. Reactor safeguards

    CERN Document Server

    Russell, Charles R

    1962-01-01

    Reactor Safeguards provides information for all who are interested in the subject of reactor safeguards. Much of the material is descriptive although some sections are written for the engineer or physicist directly concerned with hazards analysis or site selection problems. The book opens with an introductory chapter on radiation hazards, the construction of nuclear reactors, safety issues, and the operation of nuclear reactors. This is followed by separate chapters that discuss radioactive materials, reactor kinetics, control and safety systems, containment, safety features for water reactor

  17. Reactor operation

    CERN Document Server

    Shaw, J

    2013-01-01

    Reactor Operation covers the theoretical aspects and design information of nuclear reactors. This book is composed of nine chapters that also consider their control, calibration, and experimentation.The opening chapters present the general problems of reactor operation and the principles of reactor control and operation. The succeeding chapters deal with the instrumentation, start-up, pre-commissioning, and physical experiments of nuclear reactors. The remaining chapters are devoted to the control rod calibrations and temperature coefficient measurements in the reactor. These chapters also exp

  18. Reactor Neutrinos

    OpenAIRE

    Soo-Bong Kim; Thierry Lasserre; Yifang Wang

    2013-01-01

    We review the status and the results of reactor neutrino experiments. Short-baseline experiments have provided the measurement of the reactor neutrino spectrum, and their interest has been recently revived by the discovery of the reactor antineutrino anomaly, a discrepancy between the reactor neutrino flux state of the art prediction and the measurements at baselines shorter than one kilometer. Middle and long-baseline oscillation experiments at Daya Bay, Double Chooz, and RENO provided very ...

  19. BOILING REACTORS

    Science.gov (United States)

    Untermyer, S.

    1962-04-10

    A boiling reactor having a reactivity which is reduced by an increase in the volume of vaporized coolant therein is described. In this system unvaporized liquid coolant is extracted from the reactor, heat is extracted therefrom, and it is returned to the reactor as sub-cooled liquid coolant. This reduces a portion of the coolant which includes vaporized coolant within the core assembly thereby enhancing the power output of the assembly and rendering the reactor substantially self-regulating. (AEC)

  20. Membrane reactor. Membrane reactor

    Energy Technology Data Exchange (ETDEWEB)

    Shindo, Y.; Wakabayashi, K. (National Chemical Laboratory for Industry, Tsukuba (Japan))

    1990-08-05

    Many reaction examples were introduced of membrane reactor, to be on the point of forming a new region in the field of chemical technology. It is a reactor to exhibit excellent function, by its being installed with membrane therein, and is generally classified into catalyst function type and reaction promotion type. What firstly belongs to the former is stabilized zirconia, where oxygen, supplied to the cathodic side of membrane with voltage, impressed thereon, becomes O {sup 2 {minus}} to be diffused through the membrane and supplied, as variously activated oxygenous species, on the anodic side. Examples with many advantages can be given such as methane coupling, propylene oxidation, methanating reaction of carbon dioxide, etc. Apart, palladium film and naphion film also belong to the former. While examples of the latter comprise, among others, decomposition of hydrogen sulfide by porous glass film and dehydrogenation of cyclohexane or palladium alloy film, which are expected to be developed and materialized in the industry. 33 refs., 8 figs.

  1. E710, Proton, Antiproton Elastic Scattering at Tevatron Energies

    Science.gov (United States)

    Sadr, Sasan

    Experiment E710, located at site E0 of the Tevatron collider at Fermilab, was conceived in order to measure pp elastic scattering. The measured parameters were: the total cross section sigma_{t }, the ratio of the real to the imaginary part of the forward scattering amplitude rho, the nuclear slope parameter B, the nuclear curvature parameter C, the total elastic cross section sigma _{el}, and the single diffractive cross section sigma_{sd} . These measurements were taken at center-of-mass energies of sqrt{s}=1.02 and 1.8 TeV.

  2. Phenotype-gene: 710 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 710 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u3ria224u818i white cotyledon... for AT5G02250 Bollenbach Thomas J et al. 2005. Nucleic Acids Res. 33(8):2751-63. http://metadb.riken.jp/db/...SciNetS_ria224i/cria224u4ria224u15891117i white cotyledon http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u485i AT5G02250

  3. Combustion instability investigations on the BR710 jet engine

    Energy Technology Data Exchange (ETDEWEB)

    Konrad, W.; Brehm, N.; Kameier, F. [BMW Rolls-Royce AeroEngines, Dahlewitz (Germany); Freeman, C. [Rolls-Royce PLC, Derby (United Kingdom). Advanced Propulsion Systems; Day, I.J. [Cambridge Univ. (United Kingdom). Whittle Lab.

    1998-01-01

    During the development of the BR710 jet engine, audible combustor instabilities (termed rumble) occurred. Amplitudes measured with test cell microphones were up to 130 dB at around 100 Hz. Disturbances of this amplitude are clearly undesirable, even if only present during start-up, and a research program was initiated to eliminate the problem. Presented here is the methodical and structured approach used to identify, understand, and remove the instability. Some reference is made to theory, which was used for guidance, but the focus of the work is on the research done to find the cause of the problem and to correct it. The investigation followed two separate, but parallel, paths--one looking in detail at individual components of the engine to identify possible involvement in the instability and the other looking at the pressure signals from various parts of a complete engine to help pinpoint the source of the disturbance. The main cause of the BR710 combustor rumble was found to be a self-excited aerodynamic instability arising from the design of the fuel injector head. In the end, minor modifications lead to spray pattern changes, which greatly reduced the combustor noise. As a result of this work, new recommendation are made for reducing the risk of combustion instabilities in jet engines.

  4. Multifunctional reactors

    NARCIS (Netherlands)

    Westerterp, K.R.

    1992-01-01

    Multifunctional reactors are single pieces of equipment in which, besides the reaction, other functions are carried out simultaneously. The other functions can be a heat, mass or momentum transfer operation and even another reaction. Multifunctional reactors are not new, but they have received much

  5. Reactor vessel

    OpenAIRE

    Makkee, M.; Kapteijn, F.; Moulijn, J.A

    1999-01-01

    A reactor vessel (1) comprises a reactor body (2) through which channels (3) are provided whose surface comprises longitudinal inwardly directed parts (4) and is provided with a catalyst (6), as well as buffer bodies (8, 12) connected to the channels (3) on both sides of the reactor body (2) and comprising connections for supplying (9, 10, 11) and discharging (13, 14, 15) via the channels (3) gases and/or liquids entering into a reaction with each other and substances formed upon this reactio...

  6. 30 CFR 72.710 - Selection, fit, use, and maintenance of approved respirators.

    Science.gov (United States)

    2010-07-01

    ... approved respirators. 72.710 Section 72.710 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... Selection, fit, use, and maintenance of approved respirators. In order to ensure the maximum amount of respiratory protection, approved respirators shall be selected, fitted, used, and maintained in...

  7. 13 CFR 120.710 - What is the Loan Loss Reserve Fund?

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false What is the Loan Loss Reserve Fund? 120.710 Section 120.710 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS LOANS... performance related measurements and information (such as contribution toward SBA mission); and (2) No other...

  8. 32 CFR 37.710 - What standards do I include for purchasing systems of nonprofit organizations?

    Science.gov (United States)

    2010-07-01

    ... systems of nonprofit organizations? 37.710 Section 37.710 National Defense Department of Defense OFFICE OF... standards do I include for purchasing systems of nonprofit organizations? (a) So as not to force system... governmental organization. (2) 32 CFR 32.40 through 32.49 if the participant is a nonprofit organization...

  9. 20 CFR 405.710 - How to request an expedited appeal.

    Science.gov (United States)

    2010-04-01

    ... before you receive notice of the administrative law judge's decision. (b) Place for filing request. You... Section 405.710 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Expedited Appeals Process for Constitutional Issues § 405.710 How to...

  10. 37 CFR 1.710 - Patents subject to extension of the patent term.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Patents subject to extension of the patent term. 1.710 Section 1.710 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and Extension...

  11. Chemical Reactors.

    Science.gov (United States)

    Kenney, C. N.

    1980-01-01

    Describes a course, including content, reading list, and presentation on chemical reactors at Cambridge University, England. A brief comparison of chemical engineering education between the United States and England is also given. (JN)

  12. Reactor Neutrinos

    Directory of Open Access Journals (Sweden)

    Soo-Bong Kim

    2013-01-01

    Full Text Available We review the status and the results of reactor neutrino experiments. Short-baseline experiments have provided the measurement of the reactor neutrino spectrum, and their interest has been recently revived by the discovery of the reactor antineutrino anomaly, a discrepancy between the reactor neutrino flux state of the art prediction and the measurements at baselines shorter than one kilometer. Middle and long-baseline oscillation experiments at Daya Bay, Double Chooz, and RENO provided very recently the most precise determination of the neutrino mixing angle θ13. This paper provides an overview of the upcoming experiments and of the projects under development, including the determination of the neutrino mass hierarchy and the possible use of neutrinos for society, for nonproliferation of nuclear materials, and geophysics.

  13. NUCLEAR REACTOR

    Science.gov (United States)

    Miller, H.I.; Smith, R.C.

    1958-01-21

    This patent relates to nuclear reactors of the type which use a liquid fuel, such as a solution of uranyl sulfate in ordinary water which acts as the moderator. The reactor is comprised of a spherical vessel having a diameter of about 12 inches substantially surrounded by a reflector of beryllium oxide. Conventionnl control rods and safety rods are operated in slots in the reflector outside the vessel to control the operation of the reactor. An additional means for increasing the safety factor of the reactor by raising the ratio of delayed neutrons to prompt neutrons, is provided and consists of a soluble sulfate salt of beryllium dissolved in the liquid fuel in the proper proportion to obtain the result desired.

  14. Reactor Engineering

    Science.gov (United States)

    Lema, Juan M.; López, Carmen; Eibes, Gemma; Taboada-Puig, Roberto; Moreira, M. Teresa; Feijoo, Gumersindo

    In this chapter, the engineering aspects of processes catalyzed by peroxidases will be presented. In particular, a discussion of the existing technologies that utilize peroxidases for different purposes, such as the removal of recalcitrant compounds or the synthesis of polymers, is analyzed. In the first section, the essential variables controlling the process will be investigated, not only those that are common in any enzymatic system but also those specific to peroxidative reactions. Next, different reactor configurations and operational modes will be proposed, emphasizing their suitability and unsuitability for different systems. Finally, two specific reactors will be described in detail: enzymatic membrane reactors and biphasic reactors. These configurations are especially valuable for the treatment of xenobiotics with high and poor water solubility, respectively.

  15. Reactor Neutrinos

    OpenAIRE

    Lasserre, T.; Sobel, H.W.

    2005-01-01

    We review the status and the results of reactor neutrino experiments, that toe the cutting edge of neutrino research. Short baseline experiments have provided the measurement of the reactor neutrino spectrum, and are still searching for important phenomena such as the neutrino magnetic moment. They could open the door to the measurement of coherent neutrino scattering in a near future. Middle and long baseline oscillation experiments at Chooz and KamLAND have played a relevant role in neutrin...

  16. 41 CFR 102-75.710 - What responsibilities do landholding and disposal agencies have concerning properties used for...

    Science.gov (United States)

    2010-07-01

    ... persons who will be displaced by Federal or Federally assisted projects? 102-75.710 Section 102-75.710... Property for Displaced Persons § 102-75.710 What responsibilities do landholding and disposal agencies have concerning properties used for providing replacement housing for persons who will be displaced by Federal...

  17. 30 CFR 285.710 - When conducting onsite installation inspections, what must the CVA or project engineer do?

    Science.gov (United States)

    2010-07-01

    ..., what must the CVA or project engineer do? 285.710 Section 285.710 Mineral Resources MINERALS MANAGEMENT... § 285.710 When conducting onsite installation inspections, what must the CVA or project engineer do? To comply with § 285.708(a)(4), the CVA or project engineer must make periodic onsite inspections while...

  18. Bioconversion reactor

    Science.gov (United States)

    McCarty, Perry L.; Bachmann, Andre

    1992-01-01

    A bioconversion reactor for the anaerobic fermentation of organic material. The bioconversion reactor comprises a shell enclosing a predetermined volume, an inlet port through which a liquid stream containing organic materials enters the shell, and an outlet port through which the stream exits the shell. A series of vertical and spaced-apart baffles are positioned within the shell to force the stream to flow under and over them as it passes from the inlet to the outlet port. The baffles present a barrier to the microorganisms within the shell causing them to rise and fall within the reactor but to move horizontally at a very slow rate. Treatment detention times of one day or less are possible.

  19. Sonochemical Reactors.

    Science.gov (United States)

    Gogate, Parag R; Patil, Pankaj N

    2016-10-01

    Sonochemical reactors are based on the generation of cavitational events using ultrasound and offer immense potential for the intensification of physical and chemical processing applications. The present work presents a critical analysis of the underlying mechanisms for intensification, available reactor configurations and overview of the different applications exploited successfully, though mostly at laboratory scales. Guidelines have also been presented for optimum selection of the important operating parameters (frequency and intensity of irradiation, temperature and liquid physicochemical properties) as well as the geometric parameters (type of reactor configuration and the number/position of the transducers) so as to maximize the process intensification benefits. The key areas for future work so as to transform the successful technique at laboratory/pilot scale into commercial technology have also been discussed. Overall, it has been established that there is immense potential for sonochemical reactors for process intensification leading to greener processing and economic benefits. Combined efforts from a wide range of disciplines such as material science, physics, chemistry and chemical engineers are required to harness the benefits at commercial scale operation.

  20. 15 CFR 710.4 - Overview of scheduled chemicals and examples of affected industries.

    Science.gov (United States)

    2010-01-01

    ... provides examples of the types of industries that may be affected by the CWCR (parts 710 through 729 of...; (5) Epoxy resins; and (6) Insecticides, herbicides, fungicides, defoliants, and rodenticides....

  1. Hybrid adsorptive membrane reactor

    Science.gov (United States)

    Tsotsis, Theodore T. (Inventor); Sahimi, Muhammad (Inventor); Fayyaz-Najafi, Babak (Inventor); Harale, Aadesh (Inventor); Park, Byoung-Gi (Inventor); Liu, Paul K. T. (Inventor)

    2011-01-01

    A hybrid adsorbent-membrane reactor in which the chemical reaction, membrane separation, and product adsorption are coupled. Also disclosed are a dual-reactor apparatus and a process using the reactor or the apparatus.

  2. D and DR Reactors

    Data.gov (United States)

    Federal Laboratory Consortium — The world's second full-scale nuclear reactor was the D Reactor at Hanford which was built in the early 1940's and went operational in December of 1944.D Reactor ran...

  3. Hybrid adsorptive membrane reactor

    Science.gov (United States)

    Tsotsis, Theodore T.; Sahimi, Muhammad; Fayyaz-Najafi, Babak; Harale, Aadesh; Park, Byoung-Gi; Liu, Paul K. T.

    2011-03-01

    A hybrid adsorbent-membrane reactor in which the chemical reaction, membrane separation, and product adsorption are coupled. Also disclosed are a dual-reactor apparatus and a process using the reactor or the apparatus.

  4. Site Investigation for Detection of KIJANG Reactor Core Center

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Tae-Hyun; Kim, Jun Yeon; Kim, Jeeyoung [KAERI, Daejeon (Korea, Republic of)

    2015-05-15

    It was planned for the end of March 2017 and extended to April 2018 according to the government budget adjustment. The KJRR project is intended for filling the self-sufficiency of RI demand including Mo-99, increasing the NTD capacity and developing technologies related to the research reactor. In project, site investigation is the first activity that defines seismologic and related geologic aspects of the site. Site investigation was carried out from Oct. 2012 to Jan. 2014 and this study is intended to describe detail procedures in locating the reactor core center. The location of the reactor core center was determined by collectively reviewing not only geological information but also information from architects engineering. EL 50m was selected as ground level by levering construction cost. Four recommended locations (R-1a - R-1d) are displayed for the reactor core center. R-1a was found optimal in consideration of medium rock contour, portion of medium rock covering reactor buildings, construction cost, physical protection and electrical resistivity. It is noted that engineering properties of the medium rock is TCR/RQD 100/53, elastic modulus 7,710 - 8,720MPa, permeability coefficient 2.92E-06cm/s, and S-wave velocity 1,380m/s, sound for foundations of reactor buildings.

  5. Magellan推出610和710eXplorist GPS导航仪

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    日前,Magellan更新了其eXplorist系列个人手持导航仪,配置了3英寸触摸屏显示器,320万像素,自动对焦摄像头,带麦克风和扬声器,同时预装了全球地图,710则装载了最详细的越野地图,610和710则带了三点罗盘,

  6. Nuclear reactor neutron shielding

    Energy Technology Data Exchange (ETDEWEB)

    Speaker, Daniel P; Neeley, Gary W; Inman, James B

    2017-09-12

    A nuclear reactor includes a reactor pressure vessel and a nuclear reactor core comprising fissile material disposed in a lower portion of the reactor pressure vessel. The lower portion of the reactor pressure vessel is disposed in a reactor cavity. An annular neutron stop is located at an elevation above the uppermost elevation of the nuclear reactor core. The annular neutron stop comprises neutron absorbing material filling an annular gap between the reactor pressure vessel and the wall of the reactor cavity. The annular neutron stop may comprise an outer neutron stop ring attached to the wall of the reactor cavity, and an inner neutron stop ring attached to the reactor pressure vessel. An excore instrument guide tube penetrates through the annular neutron stop, and a neutron plug comprising neutron absorbing material is disposed in the tube at the penetration through the neutron stop.

  7. Reactor and method of operation

    Science.gov (United States)

    Wheeler, John A.

    1976-08-10

    A nuclear reactor having a flattened reactor activity curve across the reactor includes fuel extending over a lesser portion of the fuel channels in the central portion of the reactor than in the remainder of the reactor.

  8. 29 CFR 780.710 - A country elevator may sell products and services to farmers.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false A country elevator may sell products and services to... Elevator § 780.710 A country elevator may sell products and services to farmers. Section 13(b)(14... the exemption, includes “such an establishment which sells products and services used in the...

  9. 13 CFR 108.710 - Requirement to finance Low-Income Enterprises.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Requirement to finance Low-Income... Eligibility of A Small Business for Nmvc Financing § 108.710 Requirement to finance Low-Income Enterprises. (a) Low-Income Enterprise Financings. At the close of each of your fiscal years— (1) At least 80...

  10. 5 CFR 315.710 - Professional and administrative career employees serving under Schedule B appointments.

    Science.gov (United States)

    2010-01-01

    ... PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CAREER AND CAREER-CONDITIONAL EMPLOYMENT Conversion to Career or Career-Conditional Employment From Other Types of Employment § 315.710 Professional and... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Professional and administrative career...

  11. 20 CFR 668.710 - What planning documents must an INA grantee submit?

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What planning documents must an INA grantee... LABOR INDIAN AND NATIVE AMERICAN PROGRAMS UNDER TITLE I OF THE WORKFORCE INVESTMENT ACT Section 166 Planning/Funding Process § 668.710 What planning documents must an INA grantee submit? Each...

  12. 30 CFR 7.10 - MSHA acceptance of equivalent non-MSHA product safety standards.

    Science.gov (United States)

    2010-07-01

    ... General § 7.10 MSHA acceptance of equivalent non-MSHA product safety standards. (a) MSHA will accept non-MSHA product safety standards, or groups of standards, as equivalent after determining that they: (1... protection as those MSHA requirements. (b) MSHA will publish its intent to review any non-MSHA product...

  13. 49 CFR 176.710 - Care following leakage or sifting of radioactive materials.

    Science.gov (United States)

    2010-10-01

    ... CARRIAGE BY VESSEL Detailed Requirements for Radioactive Materials § 176.710 Care following leakage or sifting of radioactive materials. (a) In case of fire, collision, or breakage involving any shipment of radioactive materials, other than materials of low specific activity, the radioactive materials must...

  14. 21 CFR 710.6 - Notification of registrant; cosmetic product establishment registration number.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Notification of registrant; cosmetic product... OF HEALTH AND HUMAN SERVICES (CONTINUED) COSMETICS VOLUNTARY REGISTRATION OF COSMETIC PRODUCT ESTABLISHMENTS § 710.6 Notification of registrant; cosmetic product establishment registration number....

  15. 20 CFR 641.710 - How are the performance indicators defined?

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false How are the performance indicators defined... LABOR PROVISIONS GOVERNING THE SENIOR COMMUNITY SERVICE EMPLOYMENT PROGRAM Performance Accountability § 641.710 How are the performance indicators defined? (a) The core indicators are defined as follows:...

  16. Streaming for Mathematics in Years 7-10 in Victoria: An Issue of Equity?

    Science.gov (United States)

    Forgasz, Helen

    2010-01-01

    "Streaming" for mathematics remains a contentious issue and particular forms of the practice have been considered inequitable. In the study reported here, the focus was on the extent to which streaming is used for mathematics at years 7-10 in Victorian secondary schools. Also of interest were the forms of streaming adopted and the…

  17. 15 CFR Supplement No. 1 to Part 710 - States Parties to the Convention on the Prohibition of the Development, Production, Stockpiling...

    Science.gov (United States)

    2010-01-01

    ... Destruction No. Supplement No. 1 to Part 710 Commerce and Foreign Trade Regulations Relating to Commerce and...) Pt. 710, Supp. 1 Supplement No. 1 to Part 710—States Parties to the Convention on the Prohibition of... Liechtenstein Lithuania Luxembourg Macedonia (The Former Yugoslav Republic of) Madagascar Malawi Malaysia...

  18. Reactor Physics Programme

    Energy Technology Data Exchange (ETDEWEB)

    De Raedt, C

    2000-07-01

    The Reactor Physics and Department of SCK-CEN offers expertise in various areas of reactor physics, in particular in neutronics calculations, reactor dosimetry, reactor operation, reactor safety and control and non-destructive analysis on reactor fuel. This expertise is applied within the Reactor Physics and MYRRHA Research Department's own research projects in the VENUS critical facility, in the BR1 reactor and in the MYRRHA project (this project aims at designing a prototype Accelerator Driven System). Available expertise is also used in programmes external to the Department such as the reactor pressure steel vessel programme, the BR2 reactor dosimetry, and the preparation and interpretation of irradiation experiments. Progress and achievements in 1999 in the following areas are reported on: (1) investigations on the use of military plutonium in commercial power reactors; (2) neutron and gamma calculations performed for BR-2 and for other reactors; (3) the updating of neutron and gamma cross-section libraries; (4) the implementation of reactor codes; (6) the management of the UNIX workstations; and (6) fuel cycle studies.

  19. Attrition reactor system

    Science.gov (United States)

    Scott, Charles D.; Davison, Brian H.

    1993-01-01

    A reactor vessel for reacting a solid particulate with a liquid reactant has a centrifugal pump in circulatory flow communication with the reactor vessel for providing particulate attrition, resulting in additional fresh surface where the reaction can occur.

  20. Off-line production of intense {sup 7,10}Be{sup +} beams

    Energy Technology Data Exchange (ETDEWEB)

    Koester, U. E-mail: ulli.koster@cern.ch; Argentini, M.; Catherall, R.; Fedoseyev, V.N.; Gaeggeler, H.W.; Jonsson, O.C.; Weinreich, R

    2003-05-01

    {sup 7}Be and {sup 10}Be were produced by 590 MeV proton bombardment of a graphite target at PSI. Parts of this graphite target were transferred into an ISOLDE target and ion source unit and ionized with the ISOLDE resonance ionization laser ion source. Thus intense radioactive ion beams of 300 nA of {sup 7,10}Be{sup +} were produced off-line.

  1. Off-line production of intense $^{7,10}Be^{+}$ beams

    CERN Document Server

    Köster, U; Catherall, R; Fedosseev, V; Gäggeler, H W; Jonsson, O C; Weinreich, R

    2003-01-01

    $^7$Be and $^{10}$Be were produced by 590~MeV proton bombardment of a graphite target at PSI. Parts of this graphite target were transferred into an ISOLDE target and ion source unit and ionized with the ISOLDE resonance ionization laser ion source (RILIS). Thus intense radioactive ion beams of 300~nA of $^{7,10}$Be$^+$ were produced off-line.

  2. LMFBR type reactor

    Energy Technology Data Exchange (ETDEWEB)

    Kawakami, Hiroto

    1995-02-07

    A reactor container of the present invention has a structure that the reactor container is entirely at the same temperature as that at the inlet of the reactor and, a hot pool is incorporated therein, and the reactor container has is entirely at the same temperature and has substantially uniform temperature follow-up property transiently. Namely, if the temperature at the inlet of the reactor core changes, the temperature of the entire reactor container changes following this change, but no great temperature gradient is caused in the axial direction and no great heat stresses due to axial temperature distribution is caused. Occurrence of thermal stresses caused by the axial temperature distribution can be suppressed to improve the reliability of the reactor container. In addition, since the laying of the reactor inlet pipelines over the inside of the reactor is eliminated, the reactor container is made compact and the heat shielding structures above the reactor and a protection structure of container walls are simplified. Further, secondary coolants are filled to the outside of the reactor container to simplify the shieldings. The combined effects described above can improve economical property and reliability. (N.H.).

  3. Light water reactor safety

    CERN Document Server

    Pershagen, B

    2013-01-01

    This book describes the principles and practices of reactor safety as applied to the design, regulation and operation of light water reactors, combining a historical approach with an up-to-date account of the safety, technology and operating experience of both pressurized water reactors and boiling water reactors. The introductory chapters set out the basic facts upon which the safety of light water reactors depend. The central section is devoted to the methods and results of safety analysis. The accidents at Three Mile Island and Chernobyl are reviewed and their implications for light wate

  4. Nuclear reactor physics

    CERN Document Server

    Stacey, Weston M

    2010-01-01

    Nuclear reactor physics is the core discipline of nuclear engineering. Nuclear reactors now account for a significant portion of the electrical power generated worldwide, and new power reactors with improved fuel cycles are being developed. At the same time, the past few decades have seen an ever-increasing number of industrial, medical, military, and research applications for nuclear reactors. The second edition of this successful comprehensive textbook and reference on basic and advanced nuclear reactor physics has been completely updated, revised and enlarged to include the latest developme

  5. Spinning fluids reactor

    Science.gov (United States)

    Miller, Jan D; Hupka, Jan; Aranowski, Robert

    2012-11-20

    A spinning fluids reactor, includes a reactor body (24) having a circular cross-section and a fluid contactor screen (26) within the reactor body (24). The fluid contactor screen (26) having a plurality of apertures and a circular cross-section concentric with the reactor body (24) for a length thus forming an inner volume (28) bound by the fluid contactor screen (26) and an outer volume (30) bound by the reactor body (24) and the fluid contactor screen (26). A primary inlet (20) can be operatively connected to the reactor body (24) and can be configured to produce flow-through first spinning flow of a first fluid within the inner volume (28). A secondary inlet (22) can similarly be operatively connected to the reactor body (24) and can be configured to produce a second flow of a second fluid within the outer volume (30) which is optionally spinning.

  6. 一种710MHz LTE天线的去耦合分析%Decoupling Analysis of 710 MHz LTE Antenna

    Institute of Scientific and Technical Information of China (English)

    赵飞; 朱守正

    2011-01-01

    为了提高天线的容量和发射接收速率,LTE通信系统使用了MIMO天线.由于移动终端上空间有限,多个天线间存在较大耦合,天线的辐射效率和通信容量会降低.为了解决这一问题,从S参数的角度推导出了天线的正交辐射模式,提出了通过加入180°耦合器来降低多个天线间耦合的方法.使用HFSS和ADS对设计好的710 MHz天线进行联合仿真,结果显示加入耦合器后,两个天线间的耦合明显减小.这种设计使得该天线可以很好地应用于LTE通信系统的移动终端.%In order to improve the capacity and transceiving vocitey of antennas, MIMO antenna is used in LTE sysyem. But design and implementation of multiple antennas for small portable terminals become a serious technical challenge. Especially at low frequencies * because there is more couping between antennas. Therefore, a systematic approach for the design of lossless decoupling based on 180° directional couplers is proposed for the coupleing of two antennas. HFSS and ADS are a-dopted for the simulation of 710 MHz antenna. It is found that the isolation between antennas increases, which makes it suitable for LTE-standardized mobile phones.

  7. Reactor Vessel Surveillance Program for Advanced Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Kyeong-Hoon; Kim, Tae-Wan; Lee, Gyu-Mahn; Kim, Jong-Wook; Park, Keun-Bae; Kim, Keung-Koo

    2008-10-15

    This report provides the design requirements of an integral type reactor vessel surveillance program for an integral type reactor in accordance with the requirements of Korean MEST (Ministry of Education, Science and Technology Development) Notice 2008-18. This report covers the requirements for the design of surveillance capsule assemblies including their test specimens, test block materials, handling tools, and monitors of the surveillance capsule neutron fluence and temperature. In addition, this report provides design requirements for the program for irradiation surveillance of reactor vessel materials, a layout of specimens and monitors in the surveillance capsule, procedures of installation and retrieval of the surveillance capsule assemblies, and the layout of the surveillance capsule assemblies in the reactor.

  8. SNTP program reactor design

    Science.gov (United States)

    Walton, Lewis A.; Sapyta, Joseph J.

    1993-06-01

    The Space Nuclear Thermal Propulsion (SNTP) program is evaluating the feasibility of a particle bed reactor for a high-performance nuclear thermal rocket engine. Reactors operating between 500 MW and 2,000 MW will produce engine thrusts ranging from 20,000 pounds to 80,000 pounds. The optimum reactor arrangement depends on the power level desired and the intended application. The key components of the reactor have been developed and are being tested. Flow-to-power matching considerations dominate the thermal-hydraulic design of the reactor. Optimal propellant management during decay heat cooling requires a three-pronged approach. Adequate computational methods exist to perform the neutronics analysis of the reactor core. These methods have been benchmarked to critical experiment data.

  9. Hybrid reactors. [Fuel cycle

    Energy Technology Data Exchange (ETDEWEB)

    Moir, R.W.

    1980-09-09

    The rationale for hybrid fusion-fission reactors is the production of fissile fuel for fission reactors. A new class of reactor, the fission-suppressed hybrid promises unusually good safety features as well as the ability to support 25 light-water reactors of the same nuclear power rating, or even more high-conversion-ratio reactors such as the heavy-water type. One 4000-MW nuclear hybrid can produce 7200 kg of /sup 233/U per year. To obtain good economics, injector efficiency times plasma gain (eta/sub i/Q) should be greater than 2, the wall load should be greater than 1 MW.m/sup -2/, and the hybrid should cost less than 6 times the cost of a light-water reactor. Introduction rates for the fission-suppressed hybrid are usually rapid.

  10. Fast Spectrum Reactors

    CERN Document Server

    Todd, Donald; Tsvetkov, Pavel

    2012-01-01

    Fast Spectrum Reactors presents a detailed overview of world-wide technology contributing to the development of fast spectrum reactors. With a unique focus on the capabilities of fast spectrum reactors to address nuclear waste transmutation issues, in addition to the well-known capabilities of breeding new fuel, this volume describes how fast spectrum reactors contribute to the wide application of nuclear power systems to serve the global nuclear renaissance while minimizing nuclear proliferation concerns. Readers will find an introduction to the sustainable development of nuclear energy and the role of fast reactors, in addition to an economic analysis of nuclear reactors. A section devoted to neutronics offers the current trends in nuclear design, such as performance parameters and the optimization of advanced power systems. The latest findings on fuel management, partitioning and transmutation include the physics, efficiency and strategies of transmutation, homogeneous and heterogeneous recycling, in addit...

  11. E710, $p\\bar{p}$ Elastic Scattering at Tevatron Energies

    Energy Technology Data Exchange (ETDEWEB)

    Sadr, Sasan [Northwestern Univ., Evanston, IL (United States)

    1993-11-01

    Experiment E710, located at site EO of the Tevatron collider at Fermilab, was conceived in order to measure $p\\bar{p}$ elastic scattering. The measured parameters were: the total cross section $\\sigma_t$, the ratio of the real to the imaginary part of the forward scattering amplitude $p$, the nuclear slope parameter B, the nuclear curvature parameter C, the total elastic cross section $\\sigma_{el}$, and the single diffractive cross section $\\sigma_{sd}$. These measurements were taken at center-of-mass energies of $\\sqrt{s}$= 1.02 and 1.8 TeV.

  12. LMFBR type reactor

    Energy Technology Data Exchange (ETDEWEB)

    Kanbe, Mitsuru

    1997-04-04

    An LMFBR type reactor comprises a plurality of reactor cores in a reactor container. Namely, a plurality of pot containing vessels are disposed in the reactor vessel and a plurality of reactor cores are formed in a state where an integrated-type fuel assembly is each inserted to a pot, and a coolant pipeline is connected to each of the pot containing-vessel to cool the reactor core respectively. When fuels are exchanged, the integrated-type fuel assembly is taken out together with the pot from the reactor vessel in a state where the integrated-type fuel assembly is immersed in the coolants in the pot as it is. Accordingly, coolants are supplied to each of the pot containing-vessel connected with the coolant pipeline and circulate while cooling the integrated-type fuel assembly for every pot. Then, when the fuels are exchanged, the integrated type fuel assembly is taken out to the outside of the reactor together with the pot by taking up the pot from the pot-containing vessel. Then, neutron economy is improved to thereby improve reactor power and the breeding ratio. (N.H.)

  13. INVAP's Research Reactor Designs

    Directory of Open Access Journals (Sweden)

    Eduardo Villarino

    2011-01-01

    Full Text Available INVAP, an Argentine company founded more than three decades ago, is today recognized as one of the leaders within the research reactor industry. INVAP has participated in several projects covering a wide range of facilities, designed in accordance with the requirements of our different clients. For complying with these requirements, INVAP developed special skills and capabilities to deal with different fuel assemblies, different core cooling systems, and different reactor layouts. This paper summarizes the general features and utilization of several INVAP research reactor designs, from subcritical and critical assemblies to high-power reactors.

  14. Multi purpose research reactor

    Energy Technology Data Exchange (ETDEWEB)

    Raina, V.K. [Research Reactor Design and Projects Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)]. E-mail: vkrain@magnum.barc.ernet.in; Sasidharan, K. [Research Reactor Design and Projects Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Sengupta, Samiran [Research Reactor Design and Projects Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Singh, Tej [Research Reactor Services Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2006-04-15

    At present Dhruva and Cirus reactors provide the majority of research reactor based facilities to cater to the various needs of a vast pool of researchers in the field of material sciences, physics, chemistry, bio sciences, research and development work for nuclear power plants and production of radio isotopes. With a view to further consolidate and expand the scope of research and development in nuclear and allied sciences, a new 20 MWt multi purpose research reactor is being designed. This paper describes some of the design features and safety aspects of this reactor.

  15. ANATOMY OF HELICAL EXTRAGALACTIC JETS: THE CASE OF S5 0836+710

    Energy Technology Data Exchange (ETDEWEB)

    Perucho, M.; Kovalev, Y. Y. [Departament d' Astronomia i Astrofisica, Universitat de Valencia, 46100 Burjassot (Valencia) (Spain); Lobanov, A. P. [Max-Planck-Institut fuer Radioastronomie, Auf dem Huegel 69, 53121 Bonn (Germany); Hardee, P. E. [Department of Physics and Astronomy, The University of Alabama, Tuscaloosa, AL 35487 (United States); Agudo, I., E-mail: manel.perucho@uv.es [Instituto de Astrofisica de Andalucia, Apartado 3004, 18080 Granada (Spain)

    2012-04-10

    Helical structures are common in extragalactic jets. They are usually attributed in the literature to periodical phenomena in the source (e.g., precession). In this work, we use very long baseline interferometry data of the radio jet in the quasar S5 0836+710 and hypothesize that the ridgeline of helical jets like this corresponds to a pressure maximum in the jet and assume that the helically twisted pressure maximum is the result of a helical wave pattern. For our study, we use observations of the jet in S5 0836+710 at different frequencies and epochs. The results show that the structures observed are physical and not generated artificially by the observing arrays. Our hypothesis that the observed intensity ridgeline can correspond to a helically twisted pressure maximum is confirmed by our observational tests. This interpretation allows us to explain jet misalignment between parsec and kiloparsec scales when the viewing angle is small, and also brings us to the conclusion that high-frequency observations may show only a small region of the jet flow concentrated around the maximum pressure ridgeline observed at low frequencies. Our work provides a potential explanation for the apparent transversal superluminal speeds observed in several extragalactic jets by means of transversal shift of an apparent core position with time.

  16. Anatomy of helical relativistic jets: The case of S5 0836+710

    CERN Document Server

    Perucho, Manel; Lobanov, Andrei P; Hardee, Philip E; Agudo, Ivan

    2012-01-01

    Helical structures are common in extragalactic jets. They are usually attributed in the literature to periodical phenomena in the source (e.g., precession). In this work, we use VLBI data of the radio-jet in the quasar S5 0836+710 and hypothesize that the ridge-line of helical jets like this corresponds to a pressure maximum in the jet and assume that the helically twisted pressure maximum is the result of a helical wave pattern. For our study, we use observations of the jet in S5 0836+710 at different frequencies and epochs. The results show that the structures observed are physical and not generated artificially by the observing arrays. Our hypothesis that the observed intensity ridge-line can correspond to a helically twisted pressure maximum is confirmed by our observational tests. This interpretation allows us to explain jet misalignment between parsec and kiloparsec scales when the viewing angle is small, and also brings us to the conclusion that high-frequency observations may show only a small region ...

  17. Reactor Materials Research

    Energy Technology Data Exchange (ETDEWEB)

    Van Walle, E

    2001-04-01

    The activities of the Reactor Materials Research Department of the Belgian Nuclear Research Centre SCK-CEN in 2000 are summarised. The programmes within the department are focussed on studies concerning (1) fusion, in particular mechanical testing; (2) Irradiation Assisted Stress Corrosion Cracking (IASCC); (3) nuclear fuel; and (4) Reactor Pressure Vessel Steel (RPVS)

  18. Space Nuclear Reactor Engineering

    Energy Technology Data Exchange (ETDEWEB)

    Poston, David Irvin [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-03-06

    We needed to find a space reactor concept that could be attractive to NASA for flight and proven with a rapid turnaround, low-cost nuclear test. Heat-pipe-cooled reactors coupled to Stirling engines long identified as the easiest path to near-term, low-cost concept.

  19. Light water reactor program

    Energy Technology Data Exchange (ETDEWEB)

    Franks, S.M.

    1994-12-31

    The US Department of Energy`s Light Water Reactor Program is outlined. The scope of the program consists of: design certification of evolutionary plants; design, development, and design certification of simplified passive plants; first-of-a-kind engineering to achieve commercial standardization; plant lifetime improvement; and advanced reactor severe accident program. These program activities of the Office of Nuclear Energy are discussed.

  20. Status of French reactors

    Energy Technology Data Exchange (ETDEWEB)

    Ballagny, A. [Commissariat a l`Energie Atomique, Saclay (France)

    1997-08-01

    The status of French reactors is reviewed. The ORPHEE and RHF reactors can not be operated with a LEU fuel which would be limited to 4.8 g U/cm{sup 3}. The OSIRIS reactor has already been converted to LEU. It will use U{sub 3}Si{sub 2} as soon as its present stock of UO{sub 2} fuel is used up, at the end of 1994. The decision to close down the SILOE reactor in the near future is not propitious for the start of a conversion process. The REX 2000 reactor, which is expected to be commissioned in 2005, will use LEU (except if the fast neutrons core option is selected). Concerning the end of the HEU fuel cycle, the best option is reprocessing followed by conversion of the reprocessed uranium to LEU.

  1. Nuclear reactor design

    CERN Document Server

    2014-01-01

    This book focuses on core design and methods for design and analysis. It is based on advances made in nuclear power utilization and computational methods over the past 40 years, covering core design of boiling water reactors and pressurized water reactors, as well as fast reactors and high-temperature gas-cooled reactors. The objectives of this book are to help graduate and advanced undergraduate students to understand core design and analysis, and to serve as a background reference for engineers actively working in light water reactors. Methodologies for core design and analysis, together with physical descriptions, are emphasized. The book also covers coupled thermal hydraulic core calculations, plant dynamics, and safety analysis, allowing readers to understand core design in relation to plant control and safety.

  2. Mirror reactor surface study

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, A. L.; Damm, C. C.; Futch, A. H.; Hiskes, J. R.; Meisenheimer, R. G.; Moir, R. W.; Simonen, T. C.; Stallard, B. W.; Taylor, C. E.

    1976-09-01

    A general survey is presented of surface-related phenomena associated with the following mirror reactor elements: plasma first wall, ion sources, neutral beams, director converters, vacuum systems, and plasma diagnostics. A discussion of surface phenomena in possible abnormal reactor operation is included. Several studies which appear to merit immediate attention and which are essential to the development of mirror reactors are abstracted from the list of recommended areas for surface work. The appendix contains a discussion of the fundamentals of particle/surface interactions. The interactions surveyed are backscattering, thermal desorption, sputtering, diffusion, particle ranges in solids, and surface spectroscopic methods. A bibliography lists references in a number of categories pertinent to mirror reactors. Several complete published and unpublished reports on surface aspects of current mirror plasma experiments and reactor developments are also included.

  3. Slurry reactor design studies

    Energy Technology Data Exchange (ETDEWEB)

    Fox, J.M.; Degen, B.D.; Cady, G.; Deslate, F.D.; Summers, R.L. (Bechtel Group, Inc., San Francisco, CA (USA)); Akgerman, A. (Texas A and M Univ., College Station, TX (USA)); Smith, J.M. (California Univ., Davis, CA (USA))

    1990-06-01

    The objective of these studies was to perform a realistic evaluation of the relative costs of tublar-fixed-bed and slurry reactors for methanol, mixed alcohols and Fischer-Tropsch syntheses under conditions where they would realistically be expected to operate. The slurry Fischer-Tropsch reactor was, therefore, operated at low H{sub 2}/CO ratio on gas directly from a Shell gasifier. The fixed-bed reactor was operated on 2.0 H{sub 2}/CO ratio gas after adjustment by shift and CO{sub 2} removal. Every attempt was made to give each reactor the benefit of its optimum design condition and correlations were developed to extend the models beyond the range of the experimental pilot plant data. For the methanol design, comparisons were made for a recycle plant with high methanol yield, this being the standard design condition. It is recognized that this is not necessarily the optimum application for the slurry reactor, which is being proposed for a once-through operation, coproducing methanol and power. Consideration is also given to the applicability of the slurry reactor to mixed alcohols, based on conditions provided by Lurgi for an Octamix{trademark} plant using their standard tubular-fixed reactor technology. 7 figs., 26 tabs.

  4. Fast Breeder Reactor studies

    Energy Technology Data Exchange (ETDEWEB)

    Till, C.E.; Chang, Y.I.; Kittel, J.H.; Fauske, H.K.; Lineberry, M.J.; Stevenson, M.G.; Amundson, P.I.; Dance, K.D.

    1980-07-01

    This report is a compilation of Fast Breeder Reactor (FBR) resource documents prepared to provide the technical basis for the US contribution to the International Nuclear Fuel Cycle Evaluation. The eight separate parts deal with the alternative fast breeder reactor fuel cycles in terms of energy demand, resource base, technical potential and current status, safety, proliferation resistance, deployment, and nuclear safeguards. An Annex compares the cost of decommissioning light-water and fast breeder reactors. Separate abstracts are included for each of the parts.

  5. Gas cooled fast reactor

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1972-06-01

    Although most of the development work on fast breeder reactors has been devoted to the use of liquid metal cooling, interest has been expressed for a number of years in alternative breeder concepts using other coolants. One of a number of concepts in which interest has been retained is the Gas-Cooled Fast Reactor (GCFR). As presently envisioned, it would operate on the uranium-plutonium mixed oxide fuel cycle, similar to that used in the Liquid Metal Fast Breeder Reactor (LMFBR), and would use helium gas as the coolant.

  6. Microfluidic electrochemical reactors

    Science.gov (United States)

    Nuzzo, Ralph G [Champaign, IL; Mitrovski, Svetlana M [Urbana, IL

    2011-03-22

    A microfluidic electrochemical reactor includes an electrode and one or more microfluidic channels on the electrode, where the microfluidic channels are covered with a membrane containing a gas permeable polymer. The distance between the electrode and the membrane is less than 500 micrometers. The microfluidic electrochemical reactor can provide for increased reaction rates in electrochemical reactions using a gaseous reactant, as compared to conventional electrochemical cells. Microfluidic electrochemical reactors can be incorporated into devices for applications such as fuel cells, electrochemical analysis, microfluidic actuation, pH gradient formation.

  7. Motor skills in children aged 7-10 years, diagnosed with autism spectrum disorder.

    Science.gov (United States)

    Whyatt, Caroline P; Craig, Cathy M

    2012-09-01

    This study used the Movement Assessment Battery for Children (M-ABC2) to assess motor skills in children aged 7-10 years with autism (n = 18) in comparison to two groups of age-matched typically developing children; a receptive vocabulary matched group (n = 19) and a nonverbal IQ matched group (n = 22). The results supported previous work, as indicated by a significant general motor impairment in the group with autism. However, sub-analysis of the M-ABC2 revealed that there were only 2 out of 8 subcomponent skills which showed universal significant specific deficits for the autism group; i.e. catching a ball and static balance. These results suggest that motor skill deficits associated with autism may not be pervasive but more apparent in activities demanding complex, interceptive actions or core balance ability.

  8. Solvent Hold Tank Sample Results For MCU-15-710-711-712: June 2015 Monthly Sample

    Energy Technology Data Exchange (ETDEWEB)

    Fondeur, F. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Taylor-Pashow, K. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-10-07

    Savannah River National Laboratory (SRNL) received one set of Solvent Hold Tank (SHT) samples (MCU-15-710, MCU-15-711, and MCU-15-712), pulled on 06/15/2015 for analysis. The samples were combined and analyzed for composition. Analysis of the composite sample MCU-15-710-711-712 indicated a low concentration (~ 55 % of nominal) of the suppressor (TiDG) and concentrations of the extractant (MaxCalix), and of the modifier (Cs-7SB) in the solvent that were slightly lower than nominal. This analysis confirms the addition of TiDG, MaxCalix, and modifier (92 % of nominal) to the solvent in February 2015. Based on the current monthly sample, the levels of TiDG, MaxCalix, and modifier were sufficient when this solvent sample was collected from MCU. A higher cesium concentration (9.3 E6 dpm/mL) was observed in this sample relative to recent samples. In the past, this level of cesium appeared to correlate with upsets in the MCU operation. It is not known at this time the reason for the higher cesium level in this solvent. No impurities above the 1000 ppm level were found in this solvent by the Semi-Volatile Organic Analysis (SVOA). In addition, the sample contains up to 10.4 micrograms of mercury per gram of solvent (or 8.7 µg/mL). A relatively large cesium concentration (9.3 E 6 dpm/mL) was measured in this solvent and it may indicate poor cesium stripping. The laboratory will continue to monitor the quality of the solvent in particular for any new impurities or degradation of the solvent components.

  9. 20 CFR 10.710 - Under what circumstances must a recovery of money or other property in connection with an injury...

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Under what circumstances must a recovery of... FECA be reported to OWCP or SOL? 10.710 Section 10.710 Employees' Benefits OFFICE OF WORKERS... Under what circumstances must a recovery of money or other property in connection with an injury...

  10. Fusion Reactor Materials

    Energy Technology Data Exchange (ETDEWEB)

    Decreton, M

    2002-04-01

    The objective of SCK-CEN's programme on fusion reactor materials is to contribute to the knowledge on the radiation-induced behaviour of fusion reactor materials and components as well as to help the international community in building the scientific and technical basis needed for the construction of the future reactor. Ongoing projects include: the study of the mechanical and chemical (corrosion) behaviour of structural materials under neutron irradiation and water coolant environment; the investigation of the characteristics of irradiated first wall material such as beryllium; investigations on the management of materials resulting from the dismantling of fusion reactors including waste disposal. Progress and achievements in these areas in 2001 are discussed.

  11. New reactor type proposed

    CERN Multimedia

    2003-01-01

    "Russian scientists at the Research Institute of Nuclear Power Engineering in Moscow are hoping to develop a new reactor that will use lead and bismuth as fuel instead of uranium and plutonium" (1/2 page).

  12. Reactor Neutrino Spectra

    CERN Document Server

    Hayes, A C

    2016-01-01

    We present a review of the antineutrino spectra emitted from reactors. Knowledge of these and their associated uncertainties are crucial for neutrino oscillation studies. The spectra used to-date have been determined by either conversion of measured electron spectra to antineutrino spectra or by summing over all of the thousands of transitions that makeup the spectra using modern databases as input. The uncertainties in the subdominant corrections to beta-decay plague both methods, and we provide estimates of these uncertainties. Improving on current knowledge of the antineutrino spectra from reactors will require new experiments. Such experiments would also address the so-called reactor neutrino anomaly and the possible origin of the shoulder observed in the antineutrino spectra measured in recent high-statistics reactor neutrino experiments.

  13. Reactor BR2. Introduction

    Energy Technology Data Exchange (ETDEWEB)

    Gubel, P

    2001-04-01

    The BR2 is a materials testing reactor and is still one of SCK-CEN's important nuclear facilities. After an extensive refurbishment to compensate for the ageing of the installation, the reactor was restarted in April 1997. During the last three years, the availability of the installation was maintained at an average level of 97.6 percent. In the year 2000, the reactor was operated for a total of 104 days at a mean power of 56 MW. In 2000, most irradiation experiments were performed in the CALLISTO PWR loop. The report describes irradiations achieved or under preparation in 2000, including the development of advanced facilities and concept studies for new programmes. An overview of the scientific irradiation programmes as well as of the R and D programme of the BR2 reactor in 2000 is given.

  14. Antibacterial activity of a 7,10-dihydroxy-8(E)-octadecenoic acid against food-bourne pathogenic bacteria

    Science.gov (United States)

    Microbial conversion of the natural unsaturated fatty acids often generate polyhydroxy fatty acids rendering them to have new properties such as higher viscosity and reactivity. A bacterial strain Pseudomonas aeruginosa (PR3) has been intensively studied to produce a novel 7,10-dihydroxy-8(E)-octad...

  15. Future Reactor Experiments

    OpenAIRE

    He, Miao

    2013-01-01

    The measurement of the neutrino mixing angle $\\theta_{13}$ opens a gateway for the next generation experiments to measure the neutrino mass hierarchy and the leptonic CP-violating phase. Future reactor experiments will focus on mass hierarchy determination and the precision measurement of mixing parameters. Mass hierarchy can be determined from the disappearance of reactor electron antineutrinos based on the interference effect of two separated oscillation modes. Relative and absolute measure...

  16. Reactor Neutrino Experiments

    OpenAIRE

    Cao, Jun

    2007-01-01

    Precisely measuring $\\theta_{13}$ is one of the highest priority in neutrino oscillation study. Reactor experiments can cleanly determine $\\theta_{13}$. Past reactor neutrino experiments are reviewed and status of next precision $\\theta_{13}$ experiments are presented. Daya Bay is designed to measure $\\sin^22\\theta_{13}$ to better than 0.01 and Double Chooz and RENO are designed to measure it to 0.02-0.03. All are heading to full operation in 2010. Recent improvements in neutrino moment measu...

  17. Department of Reactor Technology

    DEFF Research Database (Denmark)

    Risø National Laboratory, Roskilde

    The general development of the Department of Reactor Technology at Risø during 1981 is presented, and the activities within the major subject fields are described in some detail. Lists of staff, publications, and computer programs are included.......The general development of the Department of Reactor Technology at Risø during 1981 is presented, and the activities within the major subject fields are described in some detail. Lists of staff, publications, and computer programs are included....

  18. Helias reactor studies

    Energy Technology Data Exchange (ETDEWEB)

    Beidler, C.D. [Max-Planck-Institut fuer Plasmaphysik, Garching (Germany); Grieger, G. [Max-Planck-Institut fuer Plasmaphysik, Garching (Germany); Harmeyer, E. [Max-Planck-Institut fuer Plasmaphysik, Garching (Germany); Kisslinger, J. [Max-Planck-Institut fuer Plasmaphysik, Garching (Germany); Karulin, N. [Nuclear Fusion Institute, Moscow (Russian Federation); Maurer, W. [Forschungszentrum Karlsruhe GmbH Technik und Umwelt (Germany); Nuehrenberg, J. [Max-Planck-Institut fuer Plasmaphysik, Garching (Germany); Rau, F. [Max-Planck-Institut fuer Plasmaphysik, Garching (Germany); Sapper, J. [Max-Planck-Institut fuer Plasmaphysik, Garching (Germany); Wobig, H. [Max-Planck-Institut fuer Plasmaphysik, Garching (Germany)

    1995-10-01

    The present status of Helias reactor studies is characterised by the identification and investigation of specific issues which result from the particular properties of this type of stellarator. On the technical side these are issues related to the coil system, while physics studies have concentrated on confinement, alpha-particle behaviour and ignition conditions. The usual assumptions have been made in those fields which are common to all toroidal fusion reactors: blanket and shield, refuelling and exhaust, safety and economic aspects. For blanket and shield sufficient space has been provided, a detailed concept will be developed in future. To date more emphasis has been placed on scoping and parameter studies as opposed to fixing a specific set of parameters and providing a detailed point study. One result of the Helias reactor studies is that physical dimensions are on the same order as those of tokamak reactors. However, it should be noticed that this comparison is difficult in view of the large spectrum of tokamak reactors ranging from a small reactor like Aries, to a large device such as SEAFP. The notion that the large aspect ratio of 10 or more in Helias configurations also leads to large reactors is misleading, since the large major radius of 22 m is compensated by the average plasma radius of 1.8 m and the average coil radius of 5 m. The plasma volume of 1400 m{sup 3} is about the same as the ITER reactor and the magnetic energy of the coil system is about the same or even slightly smaller than envisaged in ITER. (orig.)

  19. INVAP's Research Reactor Designs

    OpenAIRE

    Eduardo Villarino; Alicia Doval

    2011-01-01

    INVAP, an Argentine company founded more than three decades ago, is today recognized as one of the leaders within the research reactor industry. INVAP has participated in several projects covering a wide range of facilities, designed in accordance with the requirements of our different clients. For complying with these requirements, INVAP developed special skills and capabilities to deal with different fuel assemblies, different core cooling systems, and different reactor layouts. This paper ...

  20. The reactor antineutrino anomalies

    Energy Technology Data Exchange (ETDEWEB)

    Haser, Julia; Buck, Christian; Lindner, Manfred [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany)

    2016-07-01

    Major discoveries were made in the past few years in the field of neutrino flavour oscillation. Nuclear reactors produce a clean and intense flux of electron antineutrinos and are thus an essential neutrino source for the determination of oscillation parameters. Most currently the reactor antineutrino experiments Double Chooz, Daya Bay and RENO have accomplished to measure θ{sub 13}, the smallest of the three-flavour mixing angles. In the course of these experiments two anomalies emerged: (1) the reanalysis of the reactor predictions revealed a deficit in experimentally observed antineutrino flux, known as the ''reactor antineutrino anomaly''. (2) The high precision of the latest generation of neutrino experiments resolved a spectral shape distortion relative to the expected energy spectra. Both puzzles are yet to be solved and triggered new experimental as well as theoretical studies, with the search for light sterile neutrinos as most popular explanation for the flux anomaly. This talk outlines the two reactor antineutrino anomalies. Discussing possible explanations for their occurrence, recent and upcoming efforts to solve the reactor puzzles are highlighted.

  1. Moon base reactor system

    Science.gov (United States)

    Chavez, H.; Flores, J.; Nguyen, M.; Carsen, K.

    1989-01-01

    The objective of our reactor design is to supply a lunar-based research facility with 20 MW(e). The fundamental layout of this lunar-based system includes the reactor, power conversion devices, and a radiator. The additional aim of this reactor is a longevity of 12 to 15 years. The reactor is a liquid metal fast breeder that has a breeding ratio very close to 1.0. The geometry of the core is cylindrical. The metallic fuel rods are of beryllium oxide enriched with varying degrees of uranium, with a beryllium core reflector. The liquid metal coolant chosen was natural lithium. After the liquid metal coolant leaves the reactor, it goes directly into the power conversion devices. The power conversion devices are Stirling engines. The heated coolant acts as a hot reservoir to the device. It then enters the radiator to be cooled and reenters the Stirling engine acting as a cold reservoir. The engines' operating fluid is helium, a highly conductive gas. These Stirling engines are hermetically sealed. Although natural lithium produces a lower breeding ratio, it does have a larger temperature range than sodium. It is also corrosive to steel. This is why the container material must be carefully chosen. One option is to use an expensive alloy of cerbium and zirconium. The radiator must be made of a highly conductive material whose melting point temperature is not exceeded in the reactor and whose structural strength can withstand meteor showers.

  2. Reactor Safety Planning for Prometheus Project, for Naval Reactors Information

    Energy Technology Data Exchange (ETDEWEB)

    P. Delmolino

    2005-05-06

    The purpose of this letter is to submit to Naval Reactors the initial plan for the Prometheus project Reactor Safety work. The Prometheus project is currently developing plans for cold physics experiments and reactor prototype tests. These tests and facilities may require safety analysis and siting support. In addition to the ground facilities, the flight reactor units will require unique analyses to evaluate the risk to the public from normal operations and credible accident conditions. This letter outlines major safety documents that will be submitted with estimated deliverable dates. Included in this planning is the reactor servicing documentation and shipping analysis that will be submitted to Naval Reactors.

  3. REACTOR GROUT THERMAL PROPERTIES

    Energy Technology Data Exchange (ETDEWEB)

    Steimke, J.; Qureshi, Z.; Restivo, M.; Guerrero, H.

    2011-01-28

    Savannah River Site has five dormant nuclear production reactors. Long term disposition will require filling some reactor buildings with grout up to ground level. Portland cement based grout will be used to fill the buildings with the exception of some reactor tanks. Some reactor tanks contain significant quantities of aluminum which could react with Portland cement based grout to form hydrogen. Hydrogen production is a safety concern and gas generation could also compromise the structural integrity of the grout pour. Therefore, it was necessary to develop a non-Portland cement grout to fill reactors that contain significant quantities of aluminum. Grouts generate heat when they set, so the potential exists for large temperature increases in a large pour, which could compromise the integrity of the pour. The primary purpose of the testing reported here was to measure heat of hydration, specific heat, thermal conductivity and density of various reactor grouts under consideration so that these properties could be used to model transient heat transfer for different pouring strategies. A secondary purpose was to make qualitative judgments of grout pourability and hardened strength. Some reactor grout formulations were unacceptable because they generated too much heat, or started setting too fast, or required too long to harden or were too weak. The formulation called 102H had the best combination of characteristics. It is a Calcium Alumino-Sulfate grout that contains Ciment Fondu (calcium aluminate cement), Plaster of Paris (calcium sulfate hemihydrate), sand, Class F fly ash, boric acid and small quantities of additives. This composition afforded about ten hours of working time. Heat release began at 12 hours and was complete by 24 hours. The adiabatic temperature rise was 54 C which was within specification. The final product was hard and displayed no visible segregation. The density and maximum particle size were within specification.

  4. Scaleable, High Efficiency Microchannel Sabatier Reactor Project

    Data.gov (United States)

    National Aeronautics and Space Administration — A Microchannel Sabatier Reactor System (MSRS) consisting of cross connected arrays of isothermal or graded temperature reactors is proposed. The reactor array...

  5. LMFBR type reactor

    Energy Technology Data Exchange (ETDEWEB)

    Shimizu, Takeshi; Iida, Masaaki; Moriki, Yasuyuki

    1994-10-18

    A reactor core is divided into a plurality of coolants flowrate regions, and electromagnetic pumps exclusively used for each of the flowrate regions are disposed to distribute coolants flowrates in the reactor core. Further, the flowrate of each of the electromagnetic pumps is automatically controlled depending on signals from a temperature detector disposed at the exit of the reactor core, so that the flowrate of the region can be controlled optimally depending on the burning of reactor core fuels. Then, the electromagnetic pumps disposed for every divided region are controlled respectively, so that the coolants flowrate distribution suitable to each of the regions can be attained. Margin for fuel design is decreased, fuels are used effectively, as well as an operation efficiency can be improved. Moreover, since the electromagnetic pump has less flow resistance compared with a mechanical type pump, and flow resistance of the reactor core flowrate control mechanism is eliminated, greater circulating flowrate can be ensured after occurrence of accident in a natural convection using a buoyancy of coolants utilizable for after-heat removal as a driving force. (N.H.).

  6. Reactor Structural Materials: Reactor Pressure Vessel Steels

    Energy Technology Data Exchange (ETDEWEB)

    Chaouadi, R

    2000-07-01

    The objectives of SCK-CEN's R and D programme on Rector Pressure Vessel (RPV) Steels are:(1) to complete the fracture toughness data bank of various reactor pressure vessel steels by using precracked Charpy specimens that were tested statically as well as dynamically; (2) to implement the enhanced surveillance approach in a user-friendly software; (3) to improve the existing reconstitution technology by reducing the input energy (short cycle welding) and modifying the stud geometry. Progress and achievements in 1999 are reported.

  7. Operation of Reactor

    Institute of Scientific and Technical Information of China (English)

    1996-01-01

    3.1 Annual Report of SPR Operation Chu Shaochu Having overseen by National Nuclear Safety Administration and specialists, the reactor restarted up successfully after Safety renovation on April 16, 1996. In August 1996 the normal operation of SPR was approved by the authorities of Naitonal Nuclear Safety Administration. 1 Operation status In 1996, the reactor operated safely for 40 d and the energy released was about 137.3 MW·d. The operation status of SPR is shown in table 1. The reactor started up to higher power (power more than 1 MW) and lower power (for physics experiments) 4 times and 14 times respectively. Measurement of control rod efficiency and other measurement tasks were 2 times and 5 times respectively.

  8. Nuclear Rocket Engine Reactor

    CERN Document Server

    Lanin, Anatoly

    2013-01-01

    The development of a nuclear rocket engine reactor (NRER ) is presented in this book. The working capacity of an active zone NRER under mechanical and thermal load, intensive neutron fluxes, high energy generation (up to 30 MBT/l) in a working medium (hydrogen) at temperatures up to 3100 K is displayed. Design principles and bearing capacity of reactors area discussed on the basis of simulation experiments and test data of a prototype reactor. Property data of dense constructional, porous thermal insulating and fuel materials like carbide and uranium carbide compounds in the temperatures interval 300 - 3000 K are presented. Technological aspects of strength and thermal strength resistance of materials are considered. The design procedure of possible emergency processes in the NRER is developed and risks for their origination are evaluated. Prospects of the NRER development for pilotless space devices and piloted interplanetary ships are viewed.

  9. Thermionic Reactor Design Studies

    Energy Technology Data Exchange (ETDEWEB)

    Schock, Alfred

    1994-08-01

    Paper presented at the 29th IECEC in Monterey, CA in August 1994. The present paper describes some of the author's conceptual designs and their rationale, and the special analytical techniques developed to analyze their (thermionic reactor) performance. The basic designs, first published in 1963, are based on single-cell converters, either double-ended diodes extending over the full height of the reactor core or single-ended diodes extending over half the core height. In that respect they are similar to the thermionic fuel elements employed in the Topaz-2 reactor subsequently developed in the Soviet Union, copies of which were recently imported by the U.S. As in the Topaz-2 case, electrically heated steady-state performance tests of the converters are possible before fueling.

  10. An Overview of Reactor Concepts, a Survey of Reactor Designs.

    Science.gov (United States)

    1985-02-01

    Public Affairs Office and is releasaole to the National Technical Information Services (NTIS). At NTIS, it will be available to the general public...Reactors that use deu- terium (heavy water) as a coolant can use natural uranium as a fuel. The * Canadian reactor, CANDU , utilizes this concept...reactor core at the top and discharged at the Dotton while the reactor is in operation. The discharged fuel can then b inspected to see if it can De used

  11. Oscillatory flow chemical reactors

    Directory of Open Access Journals (Sweden)

    Slavnić Danijela S.

    2014-01-01

    Full Text Available Global market competition, increase in energy and other production costs, demands for high quality products and reduction of waste are forcing pharmaceutical, fine chemicals and biochemical industries, to search for radical solutions. One of the most effective ways to improve the overall production (cost reduction and better control of reactions is a transition from batch to continuous processes. However, the reactions of interests for the mentioned industry sectors are often slow, thus continuous tubular reactors would be impractically long for flow regimes which provide sufficient heat and mass transfer and narrow residence time distribution. The oscillatory flow reactors (OFR are newer type of tube reactors which can offer solution by providing continuous operation with approximately plug flow pattern, low shear stress rates and enhanced mass and heat transfer. These benefits are the result of very good mixing in OFR achieved by vortex generation. OFR consists of cylindrical tube containing equally spaced orifice baffles. Fluid oscillations are superimposed on a net (laminar flow. Eddies are generated when oscillating fluid collides with baffles and passes through orifices. Generation and propagation of vortices create uniform mixing in each reactor cavity (between baffles, providing an overall flow pattern which is close to plug flow. Oscillations can be created by direct action of a piston or a diaphragm on fluid (or alternatively on baffles. This article provides an overview of oscillatory flow reactor technology, its operating principles and basic design and scale - up characteristics. Further, the article reviews the key research findings in heat and mass transfer, shear stress, residence time distribution in OFR, presenting their advantages over the conventional reactors. Finally, relevant process intensification examples from pharmaceutical, polymer and biofuels industries are presented.

  12. Perspectives on reactor safety

    Energy Technology Data Exchange (ETDEWEB)

    Haskin, F.E. [New Mexico Univ., Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Camp, A.L. [Sandia National Labs., Albuquerque, NM (United States)

    1994-03-01

    The US Nuclear Regulatory Commission (NRC) maintains a technical training center at Chattanooga, Tennessee to provide appropriate training to both new and experienced NRC employees. This document describes a one-week course in reactor, safety concepts. The course consists of five modules: (1) historical perspective; (2) accident sequences; (3) accident progression in the reactor vessel; (4) containment characteristics and design bases; and (5) source terms and offsite consequences. The course text is accompanied by slides and videos during the actual presentation of the course.

  13. Reactor Materials Research

    Energy Technology Data Exchange (ETDEWEB)

    Van Walle, E

    2002-04-01

    The activities of SCK-CEN's Reactor Materials Research Department for 2001 are summarised. The objectives of the department are: (1) to evaluate the integrity and behaviour of structural materials used in nuclear power industry; (2) to conduct research to unravel and understand the parameters that determine the material behaviour under or after irradiation; (3) to contribute to the interpretation, the modelling of the material behaviour and to develop and assess strategies for optimum life management of nuclear power plant components. The programmes within the department are focussed on studies concerning (1) Irradiation Assisted Stress Corrosion Cracking (IASCC); (2) nuclear fuel; and (3) Reactor Pressure Vessel Steel.

  14. Fusion Reactor Materials

    Energy Technology Data Exchange (ETDEWEB)

    Decreton, M

    2000-07-01

    SCK-CEN's research and development programme on fusion reactor materials includes: (1) the study of the mechanical behaviour of structural materials under neutron irradiation (including steels, inconel, molybdenum, chromium); (2) the determination and modelling of the characteristics of irradiated first wall materials such as beryllium; (3) the detection of abrupt electrical degradation of insulating ceramics under high temperature and neutron irradiation; (4) the study of the dismantling and waste disposal strategy for fusion reactors.; (5) a feasibility study for the testing of blanket modules under neutron radiation. Main achievements in these topical areas in the year 1999 are summarised.

  15. Dynamics of comprehensive physical fitness in artistic gymnasts aged 7-10 years

    Directory of Open Access Journals (Sweden)

    Boraczyńska Sandra

    2014-12-01

    Full Text Available Purpose: The aim of the study was to evaluate the somatic development and comprehensive physical fitness of artistic gymnasts aged 7-10 years. Materials and methods: Gymnasts (n = 307, split up into four age groups performed eight Eurofit tests. The results were evaluated in points according to the development standards prepared in scale T for the Polish girls population. Results : The gymnasts obtained the highest growth rate in balance test - FLB (13 points, arm and shoulder muscular endurance test - BAH (7 points and speed of the upper limb movement test - PLT (4 points out of eight physical fitness tests. Conclusions. High and very high level of performance in the six Eurofit tests and increased total number of points in the subsequent age groups of artistic gymnasts proved high effectiveness of training in shaping the key components of a comprehensive physical fitness in artistic gymnastics - balance, strength, endurance, speed and flexibility. Relatively little progress in isometric hand strength (HGR and standing broad jump (SBJ suggests a significant influence of genetic factors on the level of these abilities. The results provide an objective information useful in optimizing control system of training effects in comprehensive physical fitness and optimization of artistic gymnasts training at the comprehensive stage of sports training.

  16. Expanding the search for galaxies at z ~7-10 with new NICMOS Parallel Fields

    CERN Document Server

    Henry, Alaina; Malkan, Matthew; Ashby, Matthew; Bridge, Carrie; Chary, Ranga-Ram; Colbert, James; Giavalisco, Mauro; Teplitz, Harry; McCarthy, Patrick

    2009-01-01

    We have carried out a search for galaxies at z ~ 7-10 in 14.4 sq. arcmin of new NICMOS parallel imaging taken in the Great Observatories Origins Deep Survey (GOODS, 5.9 sq. arcmin), the Cosmic Origins Survey (COSMOS, 7.2 sq. arcmin), and SSA22 (1.3 sq. arcmin). These images reach 5 sigma sensitivities of J110 = 26.0-27.5 (AB), and combined they increase the amount of deep near-infrared data by more than 60% in fields where the investment in deep optical data has already been made. We find no z>7 candidates in our survey area, consistent with the Bouwens et al. (2008) measurement at z~7 (over 23 sq. arcmin), which predicts 0.8 galaxies at z~7-8 and 7 galaxies are missed by both this survey and Bouwens et al., due to incompleteness from foreground contamination by faint sources. For the case of luminosity evolution, assuming a Schecter parameterization with a typical phi* = 10^-3 Mpc^-3, we find M* > -20.0 for z~7 and M* > -20.7 for z~9 (68% confidence). This suggests that the downward luminosity evolution of L...

  17. First hints of pressure waves in a helical extragalactic jet: S5~0836+710

    CERN Document Server

    Perucho, Manel

    2013-01-01

    One of the open questions in extragalactic jet Astrophysics is related to the nature of the observed radio jet, namely whether it traces a pattern or the flow structure itself. In this paper I summarize the evidence collected for the presence of waves in extragalactic jets. The evidence points towards the peak of emission in helical jets corresponding to pressure-maxima of a wave that is generated within the core region and propagates downstream. Making use of a number of very long baseline interferometry (VLBI) observations of the radio jet in the quasar S5~0836+710 at different frequencies and epochs, Perucho et al. (2012) were able to observe wave-like behavior within the observed radio-jet. The ridge-line of the emission in the jet coincides within the errors at all frequencies. Moreover, small differences between epochs at 15 GHz reveal wave-like motion of the ridge-line transversal to the jet propagation axis. The authors conclude that the helicity is a real, physical structure. I report here on those r...

  18. Long-Term Multiwavelength Studies of High-Redshift Blazar 0836+710

    CERN Document Server

    Akyuz, A; Donato, D; Perkins, J S; Fuhrmann, L; Angelakis, E; Zensus, J A; Larsson, S; Sokolovsky, K; Kurtanidze, O

    2013-01-01

    Aims. The observation of gamma -ray flares from blazar 0836+710 in 2011, following a period of quiescence, offered an opportunity to study correlated activity at different wavelengths for a high-redshift (z=2.218) active galactic nucleus. Methods. Optical and radio monitoring, plus Fermi-LAT gamma-ray monitoring provided 2008-2012 coverage, while Swift offered auxiliary optical, ultraviolet, and X-ray information. Other contemporaneous observations were used to construct a broad-band spectral energy distribution. Results. There is evidence of correlation but not a measurable lag between the optical and gamma-ray flaring emission. On the contrary, there is no clear correlation between radio and gamma-ray activity, indicating radio emission regions that are unrelated to the parts of the jet that produce the gamma-rays. The gamma-ray energy spectrum is unusual in showing a change of shape from a power law to a curved spectrum when going from the quiescent state to the active state.

  19. High Flux Isotope Reactor (HFIR)

    Data.gov (United States)

    Federal Laboratory Consortium — The HFIR at Oak Ridge National Laboratory is a light-water cooled and moderated reactor that is the United States’ highest flux reactor-based neutron source. HFIR...

  20. Reactor operation environmental information document

    Energy Technology Data Exchange (ETDEWEB)

    Haselow, J.S.; Price, V.; Stephenson, D.E.; Bledsoe, H.W.; Looney, B.B.

    1989-12-01

    The Savannah River Site (SRS) produces nuclear materials, primarily plutonium and tritium, to meet the requirements of the Department of Defense. These products have been formed in nuclear reactors that were built during 1950--1955 at the SRS. K, L, and P reactors are three of five reactors that have been used in the past to produce the nuclear materials. All three of these reactors discontinued operation in 1988. Currently, intense efforts are being extended to prepare these three reactors for restart in a manner that protects human health and the environment. To document that restarting the reactors will have minimal impacts to human health and the environment, a three-volume Reactor Operations Environmental Impact Document has been prepared. The document focuses on the impacts of restarting the K, L, and P reactors on both the SRS and surrounding areas. This volume discusses the geology, seismology, and subsurface hydrology. 195 refs., 101 figs., 16 tabs.

  1. Reactor operation safety information document

    Energy Technology Data Exchange (ETDEWEB)

    1990-01-01

    The report contains a reactor facility description which includes K, P, and L reactor sites, structures, operating systems, engineered safety systems, support systems, and process and effluent monitoring systems; an accident analysis section which includes cooling system anomalies, radioactive materials releases, and anticipated transients without scram; a summary of onsite doses from design basis accidents; severe accident analysis (reactor core disruption); a description of operating contractor organization and emergency planning; and a summary of reactor safety evolution. (MB)

  2. Validity and Reliability of the TGMD-2 in 7-10-Year-Old Flemish Children with Intellectual Disability

    Science.gov (United States)

    Simons, Johan; Daly, Daniel; Theodorou, Fani; Caron, Cindy; Simons, Joke; Andoniadou, Elena

    2008-01-01

    The purpose of this study was to assess validity and reliability of the TGMD-2 on Flemish children with intellectual disability. The total sample consisted of 99 children aged 7-10 years of which 67 were boys and 32 were girls. A factor analysis supported a two factor model of the TGMD-2. A low significant age effect was also found for the object…

  3. REACTOR FUEL ELEMENTS TESTING CONTAINER

    Science.gov (United States)

    Whitham, G.K.; Smith, R.R.

    1963-01-15

    This patent shows a method for detecting leaks in jacketed fuel elements. The element is placed in a sealed tank within a nuclear reactor, and, while the reactor operates, the element is sparged with gas. The gas is then led outside the reactor and monitored for radioactive Xe or Kr. (AEC)

  4. Nuclear Reactors and Technology

    Energy Technology Data Exchange (ETDEWEB)

    Cason, D.L.; Hicks, S.C. [eds.

    1992-01-01

    This publication Nuclear Reactors and Technology (NRT) announces on a monthly basis the current worldwide information available from the open literature on nuclear reactors and technology, including all aspects of power reactors, components and accessories, fuel elements, control systems, and materials. This publication contains the abstracts of DOE reports, journal articles, conference papers, patents, theses, and monographs added to the Energy Science and Technology Database during the past month. Also included are US information obtained through acquisition programs or interagency agreements and international information obtained through the International Energy Agency`s Energy Technology Data Exchange or government-to-government agreements. The digests in NRT and other citations to information on nuclear reactors back to 1948 are available for online searching and retrieval on the Energy Science and Technology Database and Nuclear Science Abstracts (NSA) database. Current information, added daily to the Energy Science and Technology Database, is available to DOE and its contractors through the DOE Integrated Technical Information System. Customized profiles can be developed to provide current information to meet each user`s needs.

  5. WATER BOILER REACTOR

    Science.gov (United States)

    King, L.D.P.

    1960-11-22

    As its name implies, this reactor utilizes an aqueous solution of a fissionable element salt, and is also conventional in that it contains a heat exchanger cooling coil immersed in the fuel. Its novelty lies in the utilization of a cylindrical reactor vessel to provide a critical region having a large and constant interface with a supernatant vapor region, and the use of a hollow sleeve coolant member suspended from the cover assembly in coaxial relation with the reactor vessel. Cool water is circulated inside this hollow coolant member, and a gap between its outer wall and the reactor vessel is used to carry off radiolytic gases for recombination in an external catalyst chamber. The central passage of the coolant member defines a reflux condenser passage into which the externally recombined gases are returned and condensed. The large and constant interface between fuel solution and vapor region prevents the formation of large bubbles and minimizes the amount of fuel salt carried off by water vapor, thus making possible higher flux densities, specific powers and power densities.

  6. MULTISTAGE FLUIDIZED BED REACTOR

    Science.gov (United States)

    Jonke, A.A.; Graae, J.E.A.; Levitz, N.M.

    1959-11-01

    A multistage fluidized bed reactor is described in which each of a number of stages is arranged with respect to an associated baffle so that a fluidizing gas flows upward and a granular solid downward through the stages and baffles, whereas the granular solid stopsflowing downward when the flow of fluidizing gas is shut off.

  7. Fusion reactor materials

    Energy Technology Data Exchange (ETDEWEB)

    none,

    1989-01-01

    This paper discuses the following topics on fusion reactor materials: irradiation, facilities, test matrices, and experimental methods; dosimetry, damage parameters, and activation calculations; materials engineering and design requirements; fundamental mechanical behavior; radiation effects; development of structural alloys; solid breeding materials; and ceramics.

  8. Integral Fast Reactor concept

    Energy Technology Data Exchange (ETDEWEB)

    Till, C.E.; Chang, Y.I.

    1986-01-01

    The Integral Fast Reactor (IFR) is an innovative LMR concept, being developed at Argonne National Laboratory, that fully exploits the inherent properties of liquid metal cooling and metallic fuel to achieve breakthroughs in economics and inherent safety. This paper describes key features and potential advantages of the IFR concept, technology development status, fuel cycle economics potential, and future development path.

  9. The First Reactor.

    Science.gov (United States)

    Department of Energy, Washington, DC.

    On December 2, 1942, in a racquet court underneath the West Stands of Stagg Field at the University of Chicago, a team of scientists led by Enrico Fermi created the first controlled, self-sustaining nuclear chain reaction. This updated and revised story of the first reactor (or "pile") is based on postwar interviews (as told to Corbin…

  10. Thermal Reactor Safety

    Energy Technology Data Exchange (ETDEWEB)

    1980-06-01

    Information is presented concerning fire risk and protection; transient thermal-hydraulic analysis and experiments; class 9 accidents and containment; diagnostics and in-service inspection; risk and cost comparison of alternative electric energy sources; fuel behavior and experiments on core cooling in LOCAs; reactor event reporting analysis; equipment qualification; post facts analysis of the TMI-2 accident; and computational methods.

  11. Chromatographic and Related Reactors.

    Science.gov (United States)

    1988-01-07

    special information about effects of surface heteroge- neity in the methanation reaction. Studies of an efficient multicolumn assembly for measuring...of organic basic catalysts such as pyridine and 4-methylpicoline. It was demonstrated that the chromatographic reactor gave special information about...Programmed Reaction to obtain special information about surface heterogeneity in the methanation reaction. Advantages of stopped flow over steady state

  12. New concepts for shaftless recycle reactors

    Energy Technology Data Exchange (ETDEWEB)

    Berty, J.M.; Berty, I.J.

    1987-01-01

    Berty Reaction Engineers, Ltd. (BREL) is developing two new laboratory recycle reactors, the ROTOBERTY and the TURBOBERTY. These new reactors are basically improved versions of the original Berty reactor. To understand why the reactors have the features that they do, it is first necessary to briefly review laboratory reactors in general and specifically the original Berty reactor.

  13. Brazilian multipurpose reactor

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2014-07-01

    The Brazilian Multipurpose Reactor (RMB) Project is an action of the Federal Government, through the Ministry of Science Technology and Innovation (MCTI) and has its execution under the responsibility of the Brazilian National Nuclear Energy Commission (CNEN). Within the CNEN, the project is coordinated by the Research and Development Directorate (DPD) and developed through research units of this board: Institute of Nuclear Energy Research (IPEN); Nuclear Engineering Institute (IEN); Centre for Development of Nuclear Technology (CDTN); Regional Center of Nuclear Sciences (CRCN-NE); and Institute of Radiation Protection and Dosimetry (IRD). The Navy Technological Center in Sao Paulo (CTMSP) and also the participation of other research centers, universities, laboratories and companies in the nuclear sector are important and strategic partnerships. The conceptual design and the safety analysis of the reactor and main facilities, related to nuclear and environmental licensing, are performed by technicians of the research units of DPD / CNEN. The basic design was contracted to engineering companies as INTERTHECNE from Brazil and INVAP from Argentine. The research units from DPD/CNEN are also responsible for the design verification on all engineering documents developed by the contracted companies. The construction and installation should be performed by specific national companies and international partnerships. The Nuclear Reactor RMB will be a open pool type reactor with maximum power of 30 MW and have the OPAL nuclear reactor of 20 MW, built in Australia and designed by INVAP, as reference. The RMB reactor core will have a 5x5 configuration, consisting of 23 elements fuels (EC) of U{sub 3}Si{sub 2} dispersion-type Al having a density of up to 3.5 gU/cm{sup 3} and enrichment of 19.75% by weight of {sup 23{sup 5}}U. Two positions will be available in the core for materials irradiation devices. The main objectives of the RMB Reactor and the other nuclear and radioactive

  14. Modeling Chemical Reactors I: Quiescent Reactors

    CERN Document Server

    Michoski, C E; Schmitz, P G

    2010-01-01

    We introduce a fully generalized quiescent chemical reactor system in arbitrary space $\\vdim =1,2$ or 3, with $n\\in\\mathbb{N}$ chemical constituents $\\alpha_{i}$, where the character of the numerical solution is strongly determined by the relative scaling between the local reactivity of species $\\alpha_{i}$ and the local functional diffusivity $\\mathscr{D}_{ij}(\\alpha)$ of the reaction mixture. We develop an operator time-splitting predictor multi-corrector RK--LDG scheme, and utilize $hp$-adaptivity relying only on the entropy $\\mathscr{S}_{\\mathfrak{R}}$ of the reactive system $\\mathfrak{R}$. This condition preserves these bounded nonlinear entropy functionals as a necessarily enforced stability condition on the coupled system. We apply this scheme to a number of application problems in chemical kinetics; including a difficult classical problem arising in nonequilibrium thermodynamics known as the Belousov-Zhabotinskii reaction where we utilize a concentration-dependent diffusivity tensor $\\mathscr{D}_{ij}(...

  15. Alternative approaches to fusion. [reactor design and reactor physics for Tokamak fusion reactors

    Science.gov (United States)

    Roth, R. J.

    1976-01-01

    The limitations of the Tokamak fusion reactor concept are discussed and various other fusion reactor concepts are considered that employ the containment of thermonuclear plasmas by magnetic fields (i.e., stellarators). Progress made in the containment of plasmas in toroidal devices is reported. Reactor design concepts are illustrated. The possibility of using fusion reactors as a power source in interplanetary space travel and electric power plants is briefly examined.

  16. Reactor monitoring using antineutrino detectors

    Science.gov (United States)

    Bowden, N. S.

    2011-08-01

    Nuclear reactors have served as the antineutrino source for many fundamental physics experiments. The techniques developed by these experiments make it possible to use these weakly interacting particles for a practical purpose. The large flux of antineutrinos that leaves a reactor carries information about two quantities of interest for safeguards: the reactor power and fissile inventory. Measurements made with antineutrino detectors could therefore offer an alternative means for verifying the power history and fissile inventory of a reactor as part of International Atomic Energy Agency (IAEA) and/or other reactor safeguards regimes. Several efforts to develop this monitoring technique are underway worldwide.

  17. Reactor vessel support system. [LMFBR

    Science.gov (United States)

    Golden, M.P.; Holley, J.C.

    1980-05-09

    A reactor vessel support system includes a support ring at the reactor top supported through a box ring on a ledge of the reactor containment. The box ring includes an annular space in the center of its cross-section to reduce heat flow and is keyed to the support ledge to transmit seismic forces from the reactor vessel to the containment structure. A coolant channel is provided at the outside circumference of the support ring to supply coolant gas through the keyways to channels between the reactor vessel and support ledge into the containment space.

  18. Methanogenesis in Thermophilic Biogas Reactors

    DEFF Research Database (Denmark)

    Ahring, Birgitte Kiær

    1995-01-01

    Methanogenesis in thermophilic biogas reactors fed with different wastes is examined. The specific methanogenic activity with acetate or hydrogen as substrate reflected the organic loading of the specific reactor examined. Increasing the loading of thermophilic reactors stabilized the process...... as indicated by a lower concentration of volatile fatty acids in the effluent from the reactors. The specific methanogenic activity in a thermophilic pilot-plant biogas reactor fed with a mixture of cow and pig manure reflected the stability of the reactor. The numbers of methanogens counted by the most...... against Methanothrix soehngenii or Methanothrix CALS-I in any of the thermophilic biogas reactors examined. Studies using 2-14C-labeled acetate showed that at high concentrations (more than approx. 1 mM) acetate was metabolized via the aceticlastic pathway, transforming the methyl-group of acetate...

  19. Compact fusion reactors

    CERN Document Server

    CERN. Geneva

    2015-01-01

    Fusion research is currently to a large extent focused on tokamak (ITER) and inertial confinement (NIF) research. In addition to these large international or national efforts there are private companies performing fusion research using much smaller devices than ITER or NIF. The attempt to achieve fusion energy production through relatively small and compact devices compared to tokamaks decreases the costs and building time of the reactors and this has allowed some private companies to enter the field, like EMC2, General Fusion, Helion Energy, Lawrenceville Plasma Physics and Lockheed Martin. Some of these companies are trying to demonstrate net energy production within the next few years. If they are successful their next step is to attempt to commercialize their technology. In this presentation an overview of compact fusion reactor concepts is given.

  20. MEANS FOR COOLING REACTORS

    Science.gov (United States)

    Wheeler, J.A.

    1957-11-01

    A design of a reactor is presented in which the fuel elements may be immersed in a liquid coolant when desired without the necessity of removing them from the reactor structure. The fuel elements, containing the fissionable material are in plate form and are disposed within spaced slots in a moderator material, such as graphite to form the core. Adjacent the core is a tank containing the liquid coolant. The fuel elements are mounted in spaced relationship on a rotatable shaft which is located between the core and the tank so that by rotation of the shaft the fuel elements may be either inserted in the slots in the core to sustain a chain reaction or immersed in the coolant.

  1. Integrated Microfluidic Reactors.

    Science.gov (United States)

    Lin, Wei-Yu; Wang, Yanju; Wang, Shutao; Tseng, Hsian-Rong

    2009-12-01

    Microfluidic reactors exhibit intrinsic advantages of reduced chemical consumption, safety, high surface-area-to-volume ratios, and improved control over mass and heat transfer superior to the macroscopic reaction setting. In contract to a continuous-flow microfluidic system composed of only a microchannel network, an integrated microfluidic system represents a scalable integration of a microchannel network with functional microfluidic modules, thus enabling the execution and automation of complicated chemical reactions in a single device. In this review, we summarize recent progresses on the development of integrated microfluidics-based chemical reactors for (i) parallel screening of in situ click chemistry libraries, (ii) multistep synthesis of radiolabeled imaging probes for positron emission tomography (PET), (iii) sequential preparation of individually addressable conducting polymer nanowire (CPNW), and (iv) solid-phase synthesis of DNA oligonucleotides. These proof-of-principle demonstrations validate the feasibility and set a solid foundation for exploring a broad application of the integrated microfluidic system.

  2. Reactor Neutrino Spectra

    OpenAIRE

    Hayes, A. C.; Vogel, Petr

    2016-01-01

    We present a review of the antineutrino spectra emitted from reactors. Knowledge of these spectra and their associated uncertainties is crucial for neutrino oscillation studies. The spectra used to date have been determined either by converting measured electron spectra to antineutrino spectra or by summing over all of the thousands of transitions that make up the spectra, using modern databases as input. The uncertainties in the subdominant corrections to β-decay plague both methods, and we ...

  3. REACTOR MODERATOR STRUCTURE

    Science.gov (United States)

    Greenstreet, B.L.

    1963-12-31

    A system for maintaining the alignment of moderator block structures in reactors is presented. Integral restraining grids are placed between each layer of blocks in the moderator structure, at the top of the uppermost layer, and at the bottom of the lowermost layer. Slots are provided in the top and bottom surfaces of the moderator blocks so as to provide a keying action with the grids. The grids are maintained in alignment by vertical guiding members disposed about their peripheries. (AEC)

  4. BOILER-SUPERHEATED REACTOR

    Science.gov (United States)

    Heckman, T.P.

    1961-05-01

    A nuclear power reactor of the type in which a liquid moderator-coolant is transformed by nuclear heating into a vapor that may be used to drive a turbo- generator is described. The core of this reactor comprises a plurality of freely suspended tubular fuel elements, called fuel element trains, within which nonboiling pressurized liquid moderator-coolant is preheated and sprayed through orifices in the walls of the trains against the outer walls thereof to be converted into vapor. Passage of the vapor ovcr other unwetted portions of the outside of the fuel elements causes the steam to be superheated. The moderatorcoolant within the fuel elements remains in the liqUid state, and that between the fuel elements remains substantiaily in the vapor state. A unique liquid neutron-absorber control system is used. Advantages expected from the reactor design include reduced fuel element failure, increased stability of operation, direct response to power demand, and circulation of a minimum amount of liquid moderatorcoolant. (A.G.W.)

  5. The OPAL reactor

    Energy Technology Data Exchange (ETDEWEB)

    Miller, R.; Irwin, T. [Australian Nuclear Science and Technology Organisation, Sydney (Australia); Ordonez, J.P. [INVAP SE, Bariloche (Argentina)

    2007-07-01

    The project to provide a replacement for Australia's HIFAR reactor began with governmental approval in September 1997 and reached its latest milestone with the achievement of the first full power operation of the OPAL reactor in November 2006. OPAL is a pool-type reactor with a thermal power of 20 MW and a fuel enrichment maximum of 20 per cent. This has been a successful project for both ANSTO (Australian Nuclear Science and Technology Organisation) and the contractor INVAP SE. This project was characterised by extensive interaction with the project's stake-holders during project definition and the use of a performance-based turnkey contract which gave the contractor the maximum opportunity to optimise the design to achieve performance and cost effectiveness. The contactor provided significant in-house resources as well as capacity to manage an international team of suppliers and sub-contractors. A key contributor to the project's successful outcomes has been the development and maintenance of an excellent working relationship between ANSTO and INVAP project teams. Commissioning was undertaken in accordance with the IAEA recommended stages. This paper presents the approaches used to define the project requirements, to choose the supplier and to deliver the project. The main results of hot commissioning are reviewed and the problems encountered examined. Operational experience since hot commissioning is also reviewed.

  6. Nuclear research reactors in Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Cota, Anna Paula Leite; Mesquita, Amir Zacarias, E-mail: aplc@cdtn.b, E-mail: amir@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2011-07-01

    The rising concerns about global warming and energy security have spurred a revival of interest in nuclear energy, giving birth to a 'nuclear power renaissance' in several countries in the world. Particularly in Brazil, in the recent years, the nuclear power renaissance can be seen in the actions that comprise its nuclear program, summarily the increase of the investments in nuclear research institutes and the government target to design and build the Brazilian Multipurpose research Reactor (BMR). In the last 50 years, Brazilian research reactors have been used for training, for producing radioisotopes to meet demands in industry and nuclear medicine, for miscellaneous irradiation services and for academic research. Moreover, the research reactors are used as laboratories to develop technologies in power reactors, which are evaluated today at around 450 worldwide. In this application, those reactors become more viable in relation to power reactors by the lowest cost, by the operation at low temperatures and, furthermore, by lower demand for nuclear fuel. In Brazil, four research reactors were installed: the IEA-R1 and the MB-01 reactors, both at the Instituto de Pesquisas Energeticas Nucleares (IPEN, Sao Paulo); the Argonauta, at the Instituto de Engenharia Nuclear (IEN, Rio de Janeiro) and the IPR-R1 TRIGA reactor, at the Centro de Desenvolvimento da Tecnologia Nuclear (CDTN, Belo Horizonte). The present paper intends to enumerate the characteristics of these reactors, their utilization and current academic research. Therefore, through this paper, we intend to collaborate on the BMR project. (author)

  7. Nuclear research reactors in Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Cota, Anna Paula Leite; Mesquita, Amir Zacarias, E-mail: aplc@cdtn.b, E-mail: amir@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2011-07-01

    The rising concerns about global warming and energy security have spurred a revival of interest in nuclear energy, giving birth to a 'nuclear power renaissance' in several countries in the world. Particularly in Brazil, in the recent years, the nuclear power renaissance can be seen in the actions that comprise its nuclear program, summarily the increase of the investments in nuclear research institutes and the government target to design and build the Brazilian Multipurpose research Reactor (BMR). In the last 50 years, Brazilian research reactors have been used for training, for producing radioisotopes to meet demands in industry and nuclear medicine, for miscellaneous irradiation services and for academic research. Moreover, the research reactors are used as laboratories to develop technologies in power reactors, which are evaluated today at around 450 worldwide. In this application, those reactors become more viable in relation to power reactors by the lowest cost, by the operation at low temperatures and, furthermore, by lower demand for nuclear fuel. In Brazil, four research reactors were installed: the IEA-R1 and the MB-01 reactors, both at the Instituto de Pesquisas Energeticas Nucleares (IPEN, Sao Paulo); the Argonauta, at the Instituto de Engenharia Nuclear (IEN, Rio de Janeiro) and the IPR-R1 TRIGA reactor, at the Centro de Desenvolvimento da Tecnologia Nuclear (CDTN, Belo Horizonte). The present paper intends to enumerate the characteristics of these reactors, their utilization and current academic research. Therefore, through this paper, we intend to collaborate on the BMR project. (author)

  8. Thermionic Reactor Design Studies

    Energy Technology Data Exchange (ETDEWEB)

    Schock, Alfred

    1994-06-01

    During the 1960's and early 70's the author performed extensive design studies, analyses, and tests aimed at thermionic reactor concepts that differed significantly from those pursued by other investigators. Those studies, like most others under Atomic Energy Commission (AEC and DOE) and the National Aeronautics and Space Administration (NASA) sponsorship, were terminated in the early 1970's. Some of this work was previously published, but much of it was never made available in the open literature. U.S. interest in thermionic reactors resumed in the early 80's, and was greatly intensified by reports about Soviet ground and flight tests in the late 80's. This recent interest resulted in renewed U.S. thermionic reactor development programs, primarily under Department of Defense (DOD) and Department of Energy (DOE) sponsorship. Since most current investigators have not had an opportunity to study all of the author's previous work, a review of the highlights of that work may be of value to them. The present paper describes some of the author's conceptual designs and their rationale, and the special analytical techniques developed to analyze their performance. The basic designs, first published in 1963, are based on single-cell converters, either double-ended diodes extending over the full height of the reactor core or single-ended diodes extending over half the core height. In that respect they are similar to the thermionic fuel elements employed in the Topaz-2 reactor subsequently developed in the Soviet Union, copies of which were recently imported by the U.S. As in the Topaz-2 case, electrically heated steady-state performance tests of the converters are possible before fueling. Where the author's concepts differed from the later Topaz-2 design was in the relative location of the emitter and the collector. Placing the fueled emitter on the outside of the cylindrical diodes permits much higher axial conductances to reduce ohmic

  9. New reactors for laboratory studies

    Energy Technology Data Exchange (ETDEWEB)

    Berty, J.M.

    1978-02-01

    Recent developments in design of laboratory and bench-scale reactors reflect mostly the developments in reaction engineering; that is the improved understanding of physical and chemical rate limiting processes, their interactions, and their effects on commercial-scale reactor performance. Whether a laboratory reactor is used to study the fundamentals of a commercial process or for pure scientific interest, it is important to know what physical or chemical process is limiting or influencing the rate and selectivity. To clarify this, a definition is required of the regime where physical influences exist, and study the intrinsic kinetics at conditions where physical processes do not affect the rate. Reactors are illustrated whose design was influenced by the above considerations. These reactors produce results which are independent of the reactors in which they were measured, and which can be scaled up with up-to-date reaction engineering techniques.

  10. Solvent Hold Tank Sample Results for MCU-16-701-702-703: May 2016 Monthly Sample and MCU-16-710-711-712: May 2016 Superwashed Sample

    Energy Technology Data Exchange (ETDEWEB)

    Fondeur, F. F. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Jones, D. H. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2016-08-30

    The Savannah River National Laboratory (SRNL) received one set of Solvent Hold Tank (SHT) samples (MCU-16-701, MCU-16-702 and MCU-16-703), pulled on 05/23/2016 and another set of SHT samples (MCU-16-710, MCU-16-711, and MCU-16-712) were pulled on 05/28/2016 after the solvent was superwashed with 300 mM sodium hydroxide for analysis. Samples MCU-16-701, MCU-16-702, and MCU-16-703 were combined into one sample (MCU-16-701-702-703) and samples MCU-16-710, MCU- 16-711, and MCU-16-712 were combined into one sample (MCU-16-710-711-712). Of the two composite samples MCU-16-710-711-712 represents the current chemical state of the solvent at MCU. All analytical conclusions are based on the chemical analysis of MCU-16-710-711-712. There were no chemical differences between MCU-16-701-702-703 and superwashed MCU-16-710-711-712. Analysis of the composited sample MCU-16-710-712-713 indicated the Isopar™L concentration is above its nominal level (102%). The modifier (CS-7SB) is 16% below its nominal concentration while the TiDG and MaxCalix concentrations are at and above their nominal concentrations respectively. The TiDG level has begun to decrease and it is 7% below its nominal level as of May 28, 2016. Based on this current analysis, the levels of TiDG, Isopar™L, MaxCalix, and modifier are sufficient for continuing operation but are expected to decrease with time. Periodic characterization and trimming additions to the solvent are recommended.

  11. Solvent Hold Tank Sample Results for MCU-16-701-702-703: May 2016 Monthly Sample and MCU-16-710-711-712: May 2016 Superwashed Sample

    Energy Technology Data Exchange (ETDEWEB)

    Fondeur, F. F. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Jones, D. H. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2016-08-30

    The Savannah River National Laboratory (SRNL) received one set of Solvent Hold Tank (SHT) samples (MCU-16-701, MCU-16-702 and MCU-16-703), pulled on 05/23/2016, and another set of SHT samples (MCU-16-710, MCU-16-711, and MCU-16-712) were pulled on 05/28/2016 after the solvent was superwashed with 300 mM sodium hydroxide for analysis. Samples MCU-16-701, MCU-16-702, and MCU-16-703 were combined into one sample (MCU-16-701-702-703) and samples MCU-16-710, MCU- 16-711, and MCU-16-712 were combined into one sample (MCU-16-710-711-712). Of the two composite samples MCU-16-710-711-712 represents the current chemical state of the solvent at MCU. All analytical conclusions are based on the chemical analysis of MCU-16-710-711-712. There were no chemical differences between MCU-16-701-702-703 and superwashed MCU-16-710-711-712. Analysis of the composited sample MCU-16-710-712-713 indicated the Isopar™L concentration is above its nominal level (102%). The modifier (CS-7SB) is 16% below its nominal concentration, while the TiDG and MaxCalix concentrations are at and above their nominal concentrations, respectively. The TiDG level has begun to decrease, and it is 7% below its nominal level as of May 28, 2016. Based on this current analysis, the levels of TiDG, Isopar™L, MaxCalix, and modifier are sufficient for continuing operation but are expected to decrease with time. Periodic characterization and trimming additions to the solvent are recommended.

  12. Spiral-shaped disinfection reactors

    KAUST Repository

    Ghaffour, Noreddine

    2015-08-20

    This disclosure includes disinfection reactors and processes for the disinfection of water. Some disinfection reactors include a body that defines an inlet, an outlet, and a spiral flow path between the inlet and the outlet, in which the body is configured to receive water and a disinfectant at the inlet such that the water is exposed to the disinfectant as the water flows through the spiral flow path. Also disclosed are processes for disinfecting water in such disinfection reactors.

  13. Turning points in reactor design

    Energy Technology Data Exchange (ETDEWEB)

    Beckjord, E.S.

    1995-09-01

    This article provides some historical aspects on nuclear reactor design, beginning with PWR development for Naval Propulsion and the first commercial application at Yankee Rowe. Five turning points in reactor design and some safety problems associated with them are reviewed: (1) stability of Dresden-1, (2) ECCS, (3) PRA, (4) TMI-2, and (5) advanced passive LWR designs. While the emphasis is on the thermal-hydraulic aspects, the discussion is also about reactor systems.

  14. Acceptability of reactors in space

    Energy Technology Data Exchange (ETDEWEB)

    Buden, D.

    1981-04-01

    Reactors are the key to our future expansion into space. However, there has been some confusion in the public as to whether they are a safe and acceptable technology for use in space. The answer to these questions is explored. The US position is that when reactors are the preferred technical choice, that they can be used safely. In fact, it dies not appear that reactors add measurably to the risk associated with the Space Transportation System.

  15. Hydrogen Production in Fusion Reactors

    OpenAIRE

    Sudo, S.; Tomita, Y.; Yamaguchi, S.; Iiyoshi, A.; Momota, H; Motojima, O.; Okamoto, M.; Ohnishi, M.; Onozuka, M; Uenosono, C.

    1993-01-01

    As one of methods of innovative energy production in fusion reactors without having a conventional turbine-type generator, an efficient use of radiation produced in a fusion reactor with utilizing semiconductor and supplying clean fuel in a form of hydrogen gas are studied. Taking the candidates of reactors such as a toroidal system and an open system for application of the new concepts, the expected efficiency and a concept of plant system are investigated.

  16. Fast reactor programme in India

    Indian Academy of Sciences (India)

    P Chellapandi; P R Vasudeva Rao; Prabhat Kumar

    2015-09-01

    Role of fast breeder reactor (FBR) in the Indian context has been discussed with appropriate justification. The FBR programme since 1985 till 2030 is highlighted focussing on the current status and future direction of fast breeder test reactor (FBTR), prototype fast breeder reactor (PFBR) and FBR-1 and 2. Design and technological challenges of PFBR and design and safety targets with means to achieve the same are the major highlights of this paper.

  17. Effect of 710 nm visible light irradiation on neurite outgrowth in primary rat cortical neurons following ischemic insult

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Dong-Hee [Center for Neuroscience Research, SMART Institute of Advanced Biomedical Science, Konkuk University, Seoul (Korea, Republic of); Department of Medical Science, Konkuk University School of Medicine, Seoul (Korea, Republic of); Lee, Kyoung-Hee; Kim, Ji-Hye; Kim, Moon Young [Center for Neuroscience Research, SMART Institute of Advanced Biomedical Science, Konkuk University, Seoul (Korea, Republic of); Lim, Jeong Hoon [Department of Rehabilitation Medicine, Konkuk University School of Medicine, Seoul (Korea, Republic of); Rehabilitation Medicine, Division of Neurology, Department of Medicine, National University Hospital, National University Health System (Singapore); Lee, Jongmin, E-mail: leej@kuh.ac.kr [Center for Neuroscience Research, SMART Institute of Advanced Biomedical Science, Konkuk University, Seoul (Korea, Republic of); Department of Rehabilitation Medicine, Konkuk University School of Medicine, Seoul (Korea, Republic of)

    2012-06-01

    Highlights: Black-Right-Pointing-Pointer 710 nm wavelength light (LED) has a protective effect in the stroke animal model. Black-Right-Pointing-Pointer We determined the effects of LED irradiation in vitro stroke model. Black-Right-Pointing-Pointer LED treatment promotes the neurite outgrowth through MAPK activation. Black-Right-Pointing-Pointer The level of synaptic markers significantly increased with LED treatment. Black-Right-Pointing-Pointer LED treatment protects cell death in the in vitro stroke model. -- Abstract: Objective: We previously reported that 710 nm Light-emitting Diode (LED) has a protective effect through cellular immunity activation in the stroke animal model. However, whether LED directly protects neurons suffering from neurodegeneration was entirely unknown. Therefore, we sought to determine the effects of 710 nm visible light irradiation on neuronal protection and neuronal outgrowth in an in vitro stroke model. Materials and methods: Primary cultured rat cortical neurons were exposed to oxygen-glucose deprivation (OGD) and reoxygenation and normal conditions. An LED array with a peak wavelength of 710 nm was placed beneath the covered culture dishes with the room light turned off and were irradiated accordingly. LED treatments (4 min at 4 J/cm{sup 2} and 50 mW/cm{sup 2}) were given once to four times within 8 h at 2 h intervals for 7 days. Mean neurite density, mean neurite diameter, and total fiber length were also measured after microtubule associated protein 2 (MAP2) immunostaining using the Axio Vision program. Synaptic marker expression and MAPK activation were confirmed by Western blotting. Results: Images captured after MAP2 immunocytochemistry showed significant (p < 0.05) enhancement of post-ischemic neurite outgrowth with LED treatment once and twice a day. MAPK activation was enhanced by LED treatment in both OGD-exposed and normal cells. The levels of synaptic markers such as PSD 95, GAP 43, and synaptophysin significantly

  18. Neutrino Oscillation Studies with Reactors

    CERN Document Server

    Vogel, Petr; Zhang, Chao

    2015-01-01

    Nuclear reactors are one of the most intense, pure, controllable, cost-effective, and well-understood sources of neutrinos. Reactors have played a major role in the study of neutrino oscillations, a phenomenon that indicates that neutrinos have mass and that neutrino flavors are quantum mechanical mixtures. Over the past several decades reactors were used in the discovery of neutrinos, were crucial in solving the solar neutrino puzzle, and allowed the determination of the smallest mixing angle $\\theta_{13}$. In the near future, reactors will help to determine the neutrino mass hierarchy and to solve the puzzling issue of sterile neutrinos.

  19. Accelerator based fusion reactor

    Science.gov (United States)

    Liu, Keh-Fei; Chao, Alexander Wu

    2017-08-01

    A feasibility study of fusion reactors based on accelerators is carried out. We consider a novel scheme where a beam from the accelerator hits the target plasma on the resonance of the fusion reaction and establish characteristic criteria for a workable reactor. We consider the reactions d+t\\to n+α,d+{{}3}{{H}\\text{e}}\\to p+α , and p+{{}11}B\\to 3α in this study. The critical temperature of the plasma is determined from overcoming the stopping power of the beam with the fusion energy gain. The needed plasma lifetime is determined from the width of the resonance, the beam velocity and the plasma density. We estimate the critical beam flux by balancing the energy of fusion production against the plasma thermo-energy and the loss due to stopping power for the case of an inert plasma. The product of critical flux and plasma lifetime is independent of plasma density and has a weak dependence on temperature. Even though the critical temperatures for these reactions are lower than those for the thermonuclear reactors, the critical flux is in the range of {{10}22}-{{10}24}~\\text{c}{{\\text{m}}-2}~{{\\text{s}}-1} for the plasma density {ρt}={{10}15}~\\text{c}{{\\text{m}}-3} in the case of an inert plasma. Several approaches to control the growth of the two-stream instability are discussed. We have also considered several scenarios for practical implementation which will require further studies. Finally, we consider the case where the injected beam at the resonance energy maintains the plasma temperature and prolongs its lifetime to reach a steady state. The equations for power balance and particle number conservation are given for this case.

  20. Biparticle fluidized bed reactor

    Science.gov (United States)

    Scott, C.D.

    1993-12-14

    A fluidized bed reactor system which utilizes a fluid phase, a retained fluidized primary particulate phase, and a migratory second particulate phase is described. The primary particulate phase is a particle such as a gel bead containing an immobilized biocatalyst. The secondary particulate phase, continuously introduced and removed in either cocurrent or countercurrent mode, acts in a secondary role such as a sorbent to continuously remove a product or by-product constituent from the fluid phase. Introduction and removal of the sorbent phase is accomplished through the use of feed screw mechanisms and multivane slurry valves. 3 figures.

  1. FAST NEUTRONIC REACTOR

    Science.gov (United States)

    Snell, A.H.

    1957-12-01

    This patent relates to a reactor and process for carrying out a controlled fast neutron chain reaction. A cubical reactive mass, weighing at least 920 metric tons, of uranium metal containing predominantly U/sup 238/ and having a U/sup 235/ content of at least 7.63% is assembled and the maximum neutron reproduction ratio is limited to not substantially over 1.01 by insertion and removal of a varying amount of boron, the reactive mass being substantially freed of moderator.

  2. Licensed reactor nuclear safety criteria applicable to DOE reactors

    Energy Technology Data Exchange (ETDEWEB)

    1991-04-01

    The Department of Energy (DOE) Order DOE 5480.6, Safety of Department of Energy-Owned Nuclear Reactors, establishes reactor safety requirements to assure that reactors are sited, designed, constructed, modified, operated, maintained, and decommissioned in a manner that adequately protects health and safety and is in accordance with uniform standards, guides, and codes which are consistent with those applied to comparable licensed reactors. This document identifies nuclear safety criteria applied to NRC (Nuclear Regulatory Commission) licensed reactors. The titles of the chapters and sections of USNRC Regulatory Guide 1.70, Standard Format and Content of Safety Analysis Reports for Nuclear Power Plants, Rev. 3, are used as the format for compiling the NRC criteria applied to the various areas of nuclear safety addressed in a safety analysis report for a nuclear reactor. In each section the criteria are compiled in four groups: (1) Code of Federal Regulations, (2) US NRC Regulatory Guides, SRP Branch Technical Positions and Appendices, (3) Codes and Standards, and (4) Supplemental Information. The degree of application of these criteria to a DOE-owned reactor, consistent with their application to comparable licensed reactors, must be determined by the DOE and DOE contractor.

  3. Fast Reactor Fuel Type and Reactor Safety Performance

    Energy Technology Data Exchange (ETDEWEB)

    R. Wigeland; J. Cahalan

    2009-09-01

    Fast Reactor Fuel Type and Reactor Safety Performance R. Wigeland , Idaho National Laboratory J. Cahalan, Argonne National Laboratory The sodium-cooled fast neutron reactor is currently being evaluated for the efficient transmutation of the highly-hazardous, long-lived, transuranic elements that are present in spent nuclear fuel. One of the fundamental choices that will be made is the selection of the fuel type for the fast reactor, whether oxide, metal, carbide, nitride, etc. It is likely that a decision on the fuel type will need to be made before many of the related technologies and facilities can be selected, from fuel fabrication to spent fuel reprocessing. A decision on fuel type should consider all impacts on the fast reactor system, including safety. Past work has demonstrated that the choice of fuel type may have a significant impact on the severity of consequences arising from accidents, especially for severe accidents of low probability. In this paper, the response of sodium-cooled fast reactors is discussed for both oxide and metal fuel types, highlighting the similarities and differences in reactor response and accident consequences. Any fast reactor facility must be designed to be able to successfully prevent, mitigate, or accommodate all consequences of potential events, including accidents. This is typically accomplished by using multiple barriers to the release of radiation, including the cladding on the fuel, the intact primary cooling system, and most visibly the reactor containment building. More recently, this has also included the use of ‘inherent safety’ concepts to reduce or eliminate the potential for serious damage in some cases. Past experience with oxide and metal fuel has demonstrated that both fuel types are suitable for use as fuel in a sodium-cooled fast reactor. However, safety analyses for these two fuel types have also shown that there can be substantial differences in accident consequences due to the neutronic and

  4. Reactor Physics Analysis Models for a CANDU Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Hang Bok

    2007-10-15

    Canada deuterium uranium (CANDU) reactor physics analysis is typically performed in three steps. At first, macroscopic cross-sections of the reference lattice is produced by modeling the reference fuel channel. Secondly macroscopic cross-sections of reactivity devices in the reactor are generated. The macroscopic cross-sections of a reactivity device are calculated as incremental cross-sections by subtracting macroscopic cross-sections of a three-dimensional lattice without reactivity device from those of a three-dimensional lattice with a reactivity device. Using the macroscopic cross-sections of the reference lattice and incremental cross-sections of the reactivity devices, reactor physics calculations are performed. This report summarizes input data of typical CANDU reactor physics codes, which can be utilized for the future CANDU reactor physics analysis.

  5. Reactor Physics Analysis Models for a CANDU Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Hang Bok

    2007-10-15

    Canada deuterium uranium (CANDU) reactor physics analysis is typically performed in three steps. At first, macroscopic cross-sections of the reference lattice is produced by modeling the reference fuel channel. Secondly macroscopic cross-sections of reactivity devices in the reactor are generated. The macroscopic cross-sections of a reactivity device are calculated as incremental cross-sections by subtracting macroscopic cross-sections of a three-dimensional lattice without reactivity device from those of a three-dimensional lattice with a reactivity device. Using the macroscopic cross-sections of the reference lattice and incremental cross-sections of the reactivity devices, reactor physics calculations are performed. This report summarizes input data of typical CANDU reactor physics codes, which can be utilized for the future CANDU reactor physics analysis.

  6. Chemical-vapor-deposition reactor

    Science.gov (United States)

    Chern, S.

    1979-01-01

    Reactor utilizes multiple stacked trays compactly arranged in paths of horizontally channeled reactant gas streams. Design allows faster and more efficient deposits of film on substrates, and reduces gas and energy consumption. Lack of dead spots that trap reactive gases reduces reactor purge time.

  7. Thermochemical reactor systems and methods

    Energy Technology Data Exchange (ETDEWEB)

    Lipinski, Wojciech; Davidson, Jane Holloway; Chase, Thomas Richard

    2016-11-29

    Thermochemical reactor systems that may be used to produce a fuel, and methods of using the thermochemical reactor systems, utilizing a reactive cylindrical element, an optional energy transfer cylindrical element, an inlet gas management system, and an outlet gas management system.

  8. Test reactor risk assessment methodology

    Energy Technology Data Exchange (ETDEWEB)

    Jennings, R.H.; Rawlins, J.K.; Stewart, M.E.

    1976-04-01

    A methodology has been developed for the identification of accident initiating events and the fault modeling of systems, including common mode identification, as these methods are applied in overall test reactor risk assessment. The methods are exemplified by a determination of risks to a loss of primary coolant flow in the Engineering Test Reactor.

  9. Studies on a membrane reactor

    Energy Technology Data Exchange (ETDEWEB)

    Mohan, K.; Govind, R.

    1988-10-01

    Simulation is used to evaluate the performance of a catalytic reactor with permeable wall (membrane reactor) in shifting the equilibrium of three reversible reactions (cyclohexane dehydrogenation, hydrogen iodide decomposition, and propylene disproportionation). It is found that the preferred choice of cocurrernt or countercurrent operation is dependent on the physical properties and operating conditions. Methods of enhancing conversion are suggested and temperature effects are discussed.

  10. Thermochemical reactor systems and methods

    Science.gov (United States)

    Lipinski, Wojciech; Davidson, Jane Holloway; Chase, Thomas Richard

    2016-11-29

    Thermochemical reactor systems that may be used to produce a fuel, and methods of using the thermochemical reactor systems, utilizing a reactive cylindrical element, an optional energy transfer cylindrical element, an inlet gas management system, and an outlet gas management system.

  11. Brookhaven leak reactor to close

    CERN Multimedia

    MacIlwain, C

    1999-01-01

    The DOE has announced that the High Flux Beam Reactor at Brookhaven is to close for good. Though the news was not unexpected researchers were angry the decision had been taken before the review to assess the impact of reopening the reactor had been concluded (1 page).

  12. Metallic fuels for advanced reactors

    Science.gov (United States)

    Carmack, W. J.; Porter, D. L.; Chang, Y. I.; Hayes, S. L.; Meyer, M. K.; Burkes, D. E.; Lee, C. B.; Mizuno, T.; Delage, F.; Somers, J.

    2009-07-01

    In the framework of the Generation IV Sodium Fast Reactor Program, the Advanced Fuel Project has conducted an evaluation of the available fuel systems supporting future sodium cooled fast reactors. This paper presents an evaluation of metallic alloy fuels. Early US fast reactor developers originally favored metal alloy fuel due to its high fissile density and compatibility with sodium. The goal of fast reactor fuel development programs is to develop and qualify a nuclear fuel system that performs all of the functions of a conventional fast spectrum nuclear fuel while destroying recycled actinides. This will provide a mechanism for closure of the nuclear fuel cycle. Metal fuels are candidates for this application, based on documented performance of metallic fast reactor fuels and the early results of tests currently being conducted in US and international transmutation fuel development programs.

  13. A model of reactor kinetics

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, A.S.; Thompson, B.R.

    1988-09-01

    The analytical model of nuclear reactor transients, incorporating both mechanical and nuclear effects, simulates reactor kinetics. Linear analysis shows the stability borderline for small power perturbations. In a stable system, initial power disturbances die out with time. With an unstable combination of nuclear and mechanical characteristics, initial disturbances persist and may increase with time. With large instability, oscillations of great magnitude occur. Stability requirements set limits on the power density at which particular reactors can operate. The limiting power density depends largely on the product of two terms: the fraction of delayed neutrons and the frictional damping of vibratory motion in reactor core components. As the fraction of delayed neutrons is essentially fixed, mechanical damping largely determines the maximum power density. A computer program, based on the analytical model, calculates and plots reactor power as a nonlinear function of time in response to assigned values of mechanical and nuclear characteristics.

  14. Engineering reactors for catalytic reactions

    Indian Academy of Sciences (India)

    Vivek V Ranade

    2014-03-01

    Catalytic reactions are ubiquitous in chemical and allied industries. A homogeneous or heterogeneous catalyst which provides an alternative route of reaction with lower activation energy and better control on selectivity can make substantial impact on process viability and economics. Extensive studies have been conducted to establish sound basis for design and engineering of reactors for practising such catalytic reactions and for realizing improvements in reactor performance. In this article, application of recent (and not so recent) developments in engineering reactors for catalytic reactions is discussed. Some examples where performance enhancement was realized by catalyst design, appropriate choice of reactor, better injection and dispersion strategies and recent advances in process intensification/ multifunctional reactors are discussed to illustrate the approach.

  15. Unsteady processes in catalytic reactors

    Energy Technology Data Exchange (ETDEWEB)

    Matros, Yu.Sh.

    1985-01-01

    In recent years a realization has occurred that reaction and reactor dynamics must be considered when designing and operating catalytic reactors. In this book, the author has focussed on both the processes occurring on individual porous-catalyst particles as well as the phenomena displayed by collections of these particles in fixed-bed reactors. The major topics discussed include the effects of unsteady-state heat and mass transfer, the influence of inhomogeneities and stagnant regions in fixed beds, and reactor operation during forced cycling of operating conditions. Despite the title of the book, attention is also paid to the determination of the number and stability of fixed-bed steady states, with the aim of describing the possibility of controlling reactors at unstable steady states. However, this development is somewhat dated, given the recent literature on multiplicity phenomena and process control.

  16. Antineutrino Monitoring of Thorium Reactors

    CERN Document Server

    Akindele, Oluwatomi A; Norman, Eric B

    2015-01-01

    Various groups have demonstrated that antineutrino monitoring can be successful in assessing the plutonium content in water-cooled nuclear reactors for nonproliferation applications. New reactor designs and concepts incorporate nontraditional fuels types and chemistry. Understanding how these properties affect the antineutrino emission from a reactor can extend the applicability of antineutrino monitoring.Thorium molten salt reactors (MSR) breed U-233, that if diverted constitute an IAEA direct use material. The antineutrino spectrum from the fission of U-233 has been determined, the feasibility of detecting the diversion of a significant quantity, 8 kg of U-233, within the IAEA timeliness goal of 30 days has been evaluated. The antineutrino emission from a thorium reactor operating under normal conditions is compared to a diversion scenario at a 25 meter standoff by evaluating the daily antineutrino count rate and the energy spectrum of the detected antineutrinos. It was found that the diversion of a signifi...

  17. Licensed reactor nuclear safety criteria applicable to DOE reactors

    Energy Technology Data Exchange (ETDEWEB)

    1993-11-01

    This document is a compilation and source list of nuclear safety criteria that the Nuclear Regulatory Commission (NRC) applies to licensed reactors; it can be used by DOE and DOE contractors to identify NRC criteria to be evaluated for application to the DOE reactors under their cognizance. The criteria listed are those that are applied to the areas of nuclear safety addressed in the safety analysis report of a licensed reactor. They are derived from federal regulations, USNRC regulatory guides, Standard Review Plan (SRP) branch technical positions and appendices, and industry codes and standards.

  18. University Reactor Conversion Lessons Learned Workshop for Purdue University Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Eric C. Woolstenhulme; Dana M. Hewit

    2008-09-01

    The Department of Energy’s Idaho National Laboratory, under its programmatic responsibility for managing the University Research Reactor Conversions, has completed the conversion of the reactor at Purdue University Reactor. With this work completed and in anticipation of other impending conversion projects, the INL convened and engaged the project participants in a structured discussion to capture the lessons learned. The lessons learned process has allowed us to capture gaps, opportunities, and good practices, drawing from the project team’s experiences. These lessons will be used to raise the standard of excellence, effectiveness, and efficiency in all future conversion projects.

  19. Neutronic Reactor Shield

    Science.gov (United States)

    Fermi, Enrico; Zinn, Walter H.

    The argument of the present Patent is a radiation shield suitable for protection of personnel from both gamma rays and neutrons. Such a shield from dangerous radiations is achieved to the best by the combined action of a neutron slowing material (a moderator) and a neutron absorbing material. Hydrogen is particularly effective for this shield since it is a good absorber of slow neutrons and a good moderator of fast neutrons. The neutrons slowed down by hydrogen may, then, be absorbed by other materials such as boron, cadmium, gadolinium, samarium or steel. Steel is particularly convenient for the purpose, given its effectiveness in absorbing also the gamma rays from the reactor (both primary gamma rays and secondary ones produced by the moderation of neutrons). In particular, in the present Patent a shield is described, made of alternate layers of steel and Masonite (an hydrolized ligno-cellulose material). The object of the present Patent is not discussed in any other published paper.

  20. Neutrino Experiments at Reactors

    Science.gov (United States)

    Reines, F.; Gurr, H. S.; Jenkins, T. L.; Munsee, J. H.

    1968-09-09

    A description is given of the electron-antineutrino program using a large fission reactor. A search has been made for a neutral weak interaction via the reaction (electron antineutrino + d .> p + n + electron antineutrino), the reaction (electron antineutrino + d .> n + n + e{sup +}) has now been detected, and an effort is underway to observe the elastic scattering reaction (electron antineutrino + e{sup -} .> electron antineutrino + e{sup -}) as well as to measure more precisely the reaction (electron antineutrino + p .> n + e{sup+}). The upper limit on the elastic scattering reaction which we have obtained with our large composite NaI, plastic, liquid scintillation detector is now about 50 times the predicted value.

  1. Reactor service life extension program

    Energy Technology Data Exchange (ETDEWEB)

    Caskey, G.R.; Sindelar, R.L.; Ondrejcin, R.S.; Baumann, E.W.

    1990-12-31

    A review of the Savannah River Site production reactor systems was initiated in 1980 and led to implementation of the Reactor Materials Program in 1984 to assess reactor safety and reactor service life. The program evaluated performance of the reactor tanks, primary coolant piping, and thermal shields, components of welded construction that were fabricated from Type 304 stainless steel. The structural integrity analysis of the primary coolant system has shown that the pressure boundary is not susceptible to gross rupture, including a double ended guillotine break or equivalent large area bank. Residual service life is potentially limited by two material degradation modes, irradiation damage and intergranular stress corrosion cracking. Analysis of the structural integrity of the tanks and piping has shown that continued safe operation of the reactors for several additional decades is not limited by the material performance of the primary coolant system. Although irradiation damage has not degraded material behavior to an unacceptable level, past experience has revealed serious difficulties with repair welding on irradiated stainless steel. Stress corrosion can be mitigated by newly identified limits on impurity concentrations in the coolant water and by stress mitigation of weld residual stresses. Work continues in several areas: the effects of helium on mechanical behavior of irradiated stainless steel; improved weld methods for piping and the reactor tanks; and a surveillance program to track irradiation effects on the tank walls.

  2. Reactor service life extension program

    Energy Technology Data Exchange (ETDEWEB)

    Caskey, G.R.; Sindelar, R.L.; Ondrejcin, R.S.; Baumann, E.W.

    1990-01-01

    A review of the Savannah River Site production reactor systems was initiated in 1980 and led to implementation of the Reactor Materials Program in 1984 to assess reactor safety and reactor service life. The program evaluated performance of the reactor tanks, primary coolant piping, and thermal shields, components of welded construction that were fabricated from Type 304 stainless steel. The structural integrity analysis of the primary coolant system has shown that the pressure boundary is not susceptible to gross rupture, including a double ended guillotine break or equivalent large area bank. Residual service life is potentially limited by two material degradation modes, irradiation damage and intergranular stress corrosion cracking. Analysis of the structural integrity of the tanks and piping has shown that continued safe operation of the reactors for several additional decades is not limited by the material performance of the primary coolant system. Although irradiation damage has not degraded material behavior to an unacceptable level, past experience has revealed serious difficulties with repair welding on irradiated stainless steel. Stress corrosion can be mitigated by newly identified limits on impurity concentrations in the coolant water and by stress mitigation of weld residual stresses. Work continues in several areas: the effects of helium on mechanical behavior of irradiated stainless steel; improved weld methods for piping and the reactor tanks; and a surveillance program to track irradiation effects on the tank walls.

  3. Assessment of torsatrons as reactors

    Energy Technology Data Exchange (ETDEWEB)

    Lyon, J.F. (Oak Ridge National Lab., TN (United States)); Painter, S.L. (Australian National Univ., Canberra, ACT (Australia))

    1992-12-01

    Stellarators have significant operational advantages over tokamaks as ignited steady-state reactors because stellarators have no dangerous disruptions and no need for continuous current drive or power recirculated to the plasma, both easing the first wall, blanket, and shield design; less severe constraints on the plasma parameters and profiles; and better access for maintenance. This study shows that a reactor based on the torsatron configuration (a stellarator variant) could also have up to double the mass utilization efficiency (MUE) and a significantly lower cost of electricity (COE) than a conventional tokamak reactor (ARIES-I) for a range of assumptions. Torsatron reactors can have much smaller coil systems than tokamak reactors because the coils are closer to the plasma and they have a smaller cross section (higher average current density because of the lower magnetic field). The reactor optimization approach and the costing and component models are those used in the current stage of the ARIES-I tokamak reactor study. Typical reactor parameters for a 1-GW(e) Compact Torsatron reactor example are major radius R[sub 0] = 6.6-8.8 m, on-axis magnetic field B[sup 0] = 4.8-7.5 T, B[sub max] (on coils) = 16 T, MUE 140-210 kW(e)/tonne, and COE (in constant 1990 dollars) = 67-79 mill/kW(e)h. The results are relatively sensitive to assumptions on the level of confinement improvement and the blanket thickness under the inboard half of the helical windings but relatively insensitive to other assumptions.

  4. Safety of VVER-440 reactors

    CERN Document Server

    Slugen, Vladimir

    2011-01-01

    Safety of VVER-440 Reactors endeavours to promote an increase in the safety of VVER-440 nuclear reactors via the improvement of fission products limitation systems and the implementation of special non-destructive spectroscopic methods for materials testing. All theoretical and experimental studies performed the by author over the last 25 years have been undertaken with the aim of improving VVER-440 defence in depth, which is one of the most important principle for ensuring safety in nuclear power plants. Safety of VVER-440 Reactors is focused on the barrier system through which the safety pri

  5. Random processes in nuclear reactors

    CERN Document Server

    Williams, M M R

    1974-01-01

    Random Processes in Nuclear Reactors describes the problems that a nuclear engineer may meet which involve random fluctuations and sets out in detail how they may be interpreted in terms of various models of the reactor system. Chapters set out to discuss topics on the origins of random processes and sources; the general technique to zero-power problems and bring out the basic effect of fission, and fluctuations in the lifetime of neutrons, on the measured response; the interpretation of power reactor noise; and associated problems connected with mechanical, hydraulic and thermal noise sources

  6. Reactor neutrons in nuclear astrophysics

    Science.gov (United States)

    Reifarth, René; Glorius, Jan; Göbel, Kathrin; Heftrich, Tanja; Jentschel, Michael; Jurado, Beatriz; Käppeler, Franz; Köster, Ulli; Langer, Christoph; Litvinov, Yuri A.; Weigand, Mario

    2017-09-01

    The huge neutron fluxes offer the possibility to use research reactors to produce isotopes of interest, which can be investigated afterwards. An example is the half-lives of long-lived isotopes like 129I. A direct usage of reactor neutrons in the astrophysical energy regime is only possible, if the corresponding ions are not at rest in the laboratory frame. The combination of an ion storage ring with a reactor and a neutron guide could open the path to direct measurements of neutron-induced cross sections on short-lived radioactive isotopes in the astrophysically interesting energy regime.

  7. Concept for LEU Burst Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Klein, Steven Karl [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kimpland, Robert Herbert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-03-07

    Design and performance of a proposed LEU burst reactor are sketched. Salient conclusions reached are the following: size would be ~1,500 kg or greater, depending on the size of the central cavity; internal stresses during burst require split rings for relief; the reactor would likely require multiple control and safety rods for fine control; the energy spectrum would be comparable to that of HEU machines; and burst yields and steady-state power levels will be significantly greater in an LEU reactor.

  8. Nuclear reactor downcomer flow deflector

    Energy Technology Data Exchange (ETDEWEB)

    Gilmore, Charles B. (Greensburg, PA); Altman, David A. (Pittsburgh, PA); Singleton, Norman R. (Murrysville, PA)

    2011-02-15

    A nuclear reactor having a coolant flow deflector secured to a reactor core barrel in line with a coolant inlet nozzle. The flow deflector redirects incoming coolant down an annulus between the core barrel and the reactor vessel. The deflector has a main body with a front side facing the fluid inlet nozzle and a rear side facing the core barrel. The rear side of the main body has at least one protrusion secured to the core barrel so that a gap exists between the rear side of the main body adjacent the protrusion and the core barrel. Preferably, the protrusion is a relief that circumscribes the rear side of the main body.

  9. Fuel Fabrication and Nuclear Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Karpius, Peter Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-02-02

    The uranium from the enrichment plant is still in the form of UF6. UF6 is not suitable for use in a reactor due to its highly corrosive chemistry as well as its phase diagram. UF6 is converted into UO2 fuel pellets, which are in turn placed in fuel rods and assemblies. Reactor designs are variable in moderators, coolants, fuel, performance etc.The dream of energy ‘too-cheap to meter’ is no more, and now the nuclear power industry is pushing ahead with advanced reactor designs.

  10. Nuclear reactor PBMR and cogeneration; Reactor nuclear PBMR y cogeneracion

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez S, J. R.; Alonso V, G., E-mail: ramon.ramirez@inin.gob.mx [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)

    2013-10-15

    In recent years the nuclear reactor designs for the electricity generation have increased their costs, so that at the moment costs are managed of around the 5000 US D for installed kw, reason for which a big nuclear plant requires of investments of the order of billions of dollars, the designed reactors as modular of low power seek to lighten the initial investment of a big reactor dividing the power in parts and dividing in modules the components to lower the production costs, this way it can begin to build a module and finished this to build other, differing the long term investment, getting less risk therefore in the investment. On the other hand the reactors of low power can be very useful in regions where is difficult to have access to the electric net being able to take advantage of the thermal energy of the reactor to feed other processes like the water desalination or the vapor generation for the processes industry like the petrochemical, or even more the possible hydrogen production to be used as fuel. In this work the possibility to generate vapor of high quality for the petrochemical industry is described using a spheres bed reactor of high temperature. (Author)

  11. Breeder Reactors, Understanding the Atom Series.

    Science.gov (United States)

    Mitchell, Walter, III; Turner, Stanley E.

    The theory of breeder reactors in relationship to a discussion of fission is presented. Different kinds of reactors are characterized by the cooling fluids used, such as liquid metal, gas, and molten salt. The historical development of breeder reactors over the past twenty-five years includes specific examples of reactors. The location and a brief…

  12. Evolution of the tandem mirror reactor concept

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, G.A.; Logan, B.G.

    1982-03-09

    We discuss the evolution of the tandem mirror reactor concept from the original conceptual reactor design (1977) through the first application of the thermal barrier concept to a reactor design (1979) to the beginning of the Mirror Advanced Reactor Study (1982).

  13. FASTER Test Reactor Preconceptual Design Report

    Energy Technology Data Exchange (ETDEWEB)

    Grandy, C. [Argonne National Lab. (ANL), Argonne, IL (United States); Belch, H. [Argonne National Lab. (ANL), Argonne, IL (United States); Brunett, A. J. [Argonne National Lab. (ANL), Argonne, IL (United States); Heidet, F. [Argonne National Lab. (ANL), Argonne, IL (United States); Hill, R. [Argonne National Lab. (ANL), Argonne, IL (United States); Hoffman, E. [Argonne National Lab. (ANL), Argonne, IL (United States); Jin, E. [Argonne National Lab. (ANL), Argonne, IL (United States); Mohamed, W. [Argonne National Lab. (ANL), Argonne, IL (United States); Moisseytsev, A. [Argonne National Lab. (ANL), Argonne, IL (United States); Passerini, S. [Argonne National Lab. (ANL), Argonne, IL (United States); Sienicki, J. [Argonne National Lab. (ANL), Argonne, IL (United States); Sumner, T. [Argonne National Lab. (ANL), Argonne, IL (United States); Vilim, R. [Argonne National Lab. (ANL), Argonne, IL (United States); Hayes, S. [Argonne National Lab. (ANL), Argonne, IL (United States)

    2016-03-31

    The FASTER test reactor plant is a sodium-cooled fast spectrum test reactor that provides high levels of fast and thermal neutron flux for scientific research and development. The 120MWe FASTER reactor plant has a superheated steam power conversion system which provides electrical power to a local grid allowing for recovery of operating costs for the reactor plant.

  14. FASTER test reactor preconceptual design report summary

    Energy Technology Data Exchange (ETDEWEB)

    Grandy, C. [Argonne National Lab. (ANL), Argonne, IL (United States); Belch, H. [Argonne National Lab. (ANL), Argonne, IL (United States); Brunett, A. [Argonne National Lab. (ANL), Argonne, IL (United States); Heidet, F. [Argonne National Lab. (ANL), Argonne, IL (United States); Hill, R. [Argonne National Lab. (ANL), Argonne, IL (United States); Hoffman, E. [Argonne National Lab. (ANL), Argonne, IL (United States); Jin, E. [Argonne National Lab. (ANL), Argonne, IL (United States); Mohamed, W. [Argonne National Lab. (ANL), Argonne, IL (United States); Moisseytsev, A. [Argonne National Lab. (ANL), Argonne, IL (United States); Passerini, S. [Argonne National Lab. (ANL), Argonne, IL (United States); Sienicki, J. [Argonne National Lab. (ANL), Argonne, IL (United States); Sumner, T. [Argonne National Lab. (ANL), Argonne, IL (United States); Vilim, R. [Argonne National Lab. (ANL), Argonne, IL (United States); Hayes, Steven [Argonne National Lab. (ANL), Argonne, IL (United States)

    2016-02-29

    The FASTER reactor plant is a sodium-cooled fast spectrum test reactor that provides high levels of fast and thermal neutron flux for scientific research and development. The 120MWe FASTER reactor plant has a superheated steam power conversion system which provides electrical power to a local grid allowing for recovery of operating costs for the reactor plant.

  15. ADAPTIVE CONTROL SYSTEM OF INDUSTRIAL REACTORS

    Directory of Open Access Journals (Sweden)

    Vyacheslav K. Mayevski

    2014-01-01

    Full Text Available This paper describes a mathematical model of an industrial chemical reactor for production of synthetic rubber. During reactor operation the model parameters vary considerably. To create a control algorithm performed transformation of mathematical model of the reactor in order to obtain a dependency that can be used to determine the model parameters are changing during reactor operation.

  16. Nuclear research reactors activities in INVAP

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez, Juan Pablo [INVAP, Bariloche (Argentina)

    2013-07-01

    This presentation describes the different activities in the research reactor field that are being carried out by INVAP. INVAP is presently involved in the design of three new research reactors in three different countries. The RA-10 is a multipurpose reactor, in Argentina, planned as a replacement for the RA-3 reactor. INVAP was contracted by CNEA for carrying out the preliminary engineering for this reactor, and has recently been contracted by CNEA for the detailed engineering. CNEA groups are strongly involved in the design of this reactor. The RMB is a multipurpose reactor, planned by CNEN from Brazil. CNEN, through REDETEC, has contracted INVAP to carry out the preliminary engineering for this reactor. As the user requirements for RA-10 and RMB are very similar, an agreement was signed between Argentina and Brasil governments to cooperate in these two projects. The agreement included that both reactors would use the OPAL reactor in Australia, design and built by INVAP, as a reference reactor. INVAP has also designed the LPRR reactor for KACST in Saudi Arabia. The LPRR is a 30 kw reactor for educational purposes. KACST initially contracted INVAP for the engineering for this reactor and has recently signed the contract with INVAP for building the reactor. General details of these three reactors will be presented.

  17. Number of antigens in early childhood vaccines and neuropsychological outcomes at age 7-10 years.

    Science.gov (United States)

    Iqbal, Shahed; Barile, John P; Thompson, William W; DeStefano, Frank

    2013-12-01

    Concerns have been raised that children may be receiving too many immunizations under the recommended schedule in the USA. We used a publicly available dataset to evaluate the association between antibody-stimulating proteins and polysaccharides from early childhood vaccines and neuropsychological outcomes at age 7-10 years. Children aged 7-10 years from four managed care organizations underwent standardized tests for domain-specific neuropsychological outcomes: general intellectual function, speech and language, verbal memory, attention and executive function, tics, achievement, visual spatial ability, and behavior regulation. Vaccination histories up to 24 months of age were obtained from medical charts, electronic records, and parents' records. Logistic regressions and structural equation modeling (SEM) were used to determine associations between total antigens up to 7, 12, and 24 months and domain-specific outcomes. On average, children (N = 1047) received 7266, 8127, and 10 341 antigens by ages 7, 12, and 24 months, respectively. For adjusted analyses, increase (per 1000) in the number of antigens was not associated with any neuropsychological outcomes. Antigen counts above the 10th percentile, compared with lower counts, were also not associated with any adverse outcomes. However, children with higher antigen counts up to 24 months performed better on attention and executive function tests (odds ratio for lower scores = 0.51, 95% confidence interval = 0.26, 0.99). Similar results were found with SEM analysis (b = 0.08, p = 0.02). We did not find any adverse associations between antigens received through vaccines in the first two years of life and neuropsychological outcomes in later childhood. Published 2013. This article is a U.S. Government work and is in the public domain in the USA. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  18. Advanced Carbothermal Electric Reactor Project

    Data.gov (United States)

    National Aeronautics and Space Administration — The overall objective of the Phase 1 effort was to demonstrate the technical feasibility of the Advanced Carbothermal Electric (ACE) Reactor concept. Unlike...

  19. Thermal Analysis for Mobile Reactor

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    <正>Mobile reactor design in the paper is consisted of two grades of thermal electric conversion. The first grade is the thermionic conversion inside the core and the second grade is thermocouple conversion

  20. Advanced Carbothermal Electric Reactor Project

    Data.gov (United States)

    National Aeronautics and Space Administration — ORBITEC proposes to develop the Advanced Carbothermal Electric (ACE) reactor to efficiently extract oxygen from lunar regolith. Unlike state-of-the-art carbothermal...

  1. Teaching About Nature's Nuclear Reactors

    CERN Document Server

    Herndon, J M

    2005-01-01

    Naturally occurring nuclear reactors existed in uranium deposits on Earth long before Enrico Fermi built the first man-made nuclear reactor beneath Staggs Field in 1942. In the story of their discovery, there are important lessons to be learned about scientific inquiry and scientific discovery. Now, there is evidence to suggest that the Earth's magnetic field and Jupiter's atmospheric turbulence are driven by planetary-scale nuclear reactors. The subject of planetocentric nuclear fission reactors can be a jumping off point for stimulating classroom discussions about the nature and implications of planetary energy sources and about the geomagnetic field. But more importantly, the subject can help to bring into focus the importance of discussing, debating, and challenging current thinking in a variety of areas.

  2. Reactor containment research and development

    Energy Technology Data Exchange (ETDEWEB)

    Weil, N. A.

    1963-06-15

    An outline is given of containment concepts, sources and release rates of energy, responses of containment structures, effects of projectiles, and leakage rates of radioisotopes, with particular regard to major reactor accidents. (T.F.H.)

  3. Reactor operation environmental information document

    Energy Technology Data Exchange (ETDEWEB)

    Bauer, L.R.; Hayes, D.W.; Hunter, C.H.; Marter, W.L.; Moyer, R.A.

    1989-12-01

    This volume is a reactor operation environmental information document for the Savannah River Plant. Topics include meteorology, surface hydrology, transport, environmental impacts, and radiation effects. 48 figs., 56 tabs. (KD)

  4. Advanced Catalytic Hydrogenation Retrofit Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Reinaldo M. Machado

    2002-08-15

    Industrial hydrogenation is often performed using a slurry catalyst in large stirred-tank reactors. These systems are inherently problematic in a number of areas, including industrial hygiene, process safety, environmental contamination, waste production, process operability and productivity. This program proposed the development of a practical replacement for the slurry catalysts using a novel fixed-bed monolith catalyst reactor, which could be retrofitted onto an existing stirred-tank reactor and would mitigate many of the minitations and problems associated with slurry catalysts. The full retrofit monolith system, consisting of a recirculation pump, gas/liquid ejector and monolith catalyst, is described as a monolith loop reactor or MLR. The MLR technology can reduce waste and increase raw material efficiency, which reduces the overall energy required to produce specialty and fine chemicals.

  5. Unique features of space reactors

    Science.gov (United States)

    Buden, David

    Space reactors are designed to meet a unique set of requirements; they must be sufficiently compact to be launched in a rocket to their operational location, operate for many years without maintenance and servicing, operate in extreme environments, and reject heat by radiation to space. To meet these restrictions, operating temperatures are much greater than in terrestrial power plants, and the reactors tend to have a fast neutron spectrum. Currently, a new generation of space reactor power plants is being developed. The major effort is in the SP-100 program, where the power plant is being designed for seven years of full power, and no maintenance operation at a reactor outlet operating temperature of 1350 K.

  6. Jules Horowitz Reactor, basic design

    Energy Technology Data Exchange (ETDEWEB)

    Bergamaschi, Y.; Bouilloux, Y.; Chantoin, P.; Guigon, B.; Bravo, X.; Germain, C.; Rommens, M.; Tremodeux, P

    2003-07-01

    Since the shutdown of the SILOE reactor in 1997, the OSIRIS reactor has ensured the needs regarding technological irradiation at CEA including those of its industrial partners and customers. The Jules Horowitz Reactor will replace it. It has the ambition to provide the necessary nuclear data and maintain a fission research capacity in Europe after 2010. This capacity should be service-oriented. It will be established in Cadarache. The Jules Horowitz reactor will also: - represent a significant step in term of performances and experimental capabilities, - be designed with a high flexibility, in order to satisfy the current demand from European industry, research and be able to accommodate future requirements, - reach a high level of safety, according to the best current practice. This paper will present the main functionalities and the design options resulting from the 'preliminary design' studies. (authors)

  7. Solid State Reactor Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Mays, G.T.

    2004-03-10

    The Solid State Reactor (SSR) is an advanced reactor concept designed to take advantage of Oak Ridge National Laboratory's (ORNL's) recently developed graphite foam that has enhanced heat transfer characteristics and excellent high-temperature mechanical properties, to provide an inherently safe, self-regulated, source of heat for power and other potential applications. This work was funded by the U.S. Department of Energy's Nuclear Energy Research Initiative (NERI) program (Project No. 99-064) from August 1999 through September 30, 2002. The initial concept of utilizing the graphite foam as a basis for developing an advanced reactor concept envisioned that a suite of reactor configurations and power levels could be developed for several different applications. The initial focus was looking at the reactor as a heat source that was scalable, independent of any heat removal/power conversion process. These applications might include conventional power generation, isotope production and destruction (actinides), and hydrogen production. Having conducted the initial research on the graphite foam and having performed the scoping parametric analyses from neutronics and thermal-hydraulic perspectives, it was necessary to focus on a particular application that would (1) demonstrate the viability of the overall concept and (2) require a reasonably structured design analysis process that would synthesize those important parameters that influence the concept the most as part of a feasible, working reactor system. Thus, the application targeted for this concept was supplying power for remote/harsh environments and a design that was easily deployable, simplistic from an operational standpoint, and utilized the new graphite foam. Specifically, a 500-kW(t) reactor concept was pursued that is naturally load following, inherently safe, optimized via neutronic studies to achieve near-zero reactivity change with burnup, and proliferation resistant. These four major areas

  8. Reactor antineutrinos and nuclear physics

    Science.gov (United States)

    Balantekin, A. B.

    2016-11-01

    Short-baseline reactor neutrino experiments successfully measured the neutrino parameters they set out to measure, but they also identified a shape distortion in the 5-7 MeV range as well as a reduction from the predicted value of the flux. Nuclear physics input into the calculations of reactor antineutrino spectra needs to be better refined if this anomaly is to be interpreted as due to sterile neutrino states.

  9. Microchannel Reactors for ISRU Applications

    Science.gov (United States)

    Carranza, Susana; Makel, Darby B.; Blizman, Brandon; Ward, Benjamin J.

    2005-02-01

    Affordable planning and execution of prolonged manned space missions depend upon the utilization of local resources and the waste products which are formed in manned spacecraft and surface bases. Successful in-situ resources utilization (ISRU) will require component technologies which provide optimal size, weight, volume, and power efficiency. Microchannel reactors enable the efficient chemical processing of in situ resources. The reactors can be designed for the processes that generate the most benefit for each mission. For instance, propellants (methane) can be produced from carbon dioxide from the Mars atmosphere using the Sabatier reaction and ethylene can be produced from the partial oxidation of methane. A system that synthesizes ethylene could be the precursor for systems to synthesize ethanol and polyethylene. Ethanol can be used as a nutrient for Astrobiology experiments, as well as the production of nutrients for human crew (e.g. sugars). Polyethylene can be used in the construction of habitats, tools, and replacement parts. This paper will present recent developments in miniature chemical reactors using advanced Micro Electro Mechanical Systems (MEMS) and microchannel technology to support ISRU of Mars and lunar missions. Among other applications, the technology has been demonstrated for the Sabatier process and for the partial oxidation of methane. Microchannel reactors were developed based on ceramic substrates as well as metal substrates. In both types of reactors, multiple layers coated with catalytic material are bonded, forming a monolithic structure. Such reactors are readily scalable with the incorporation of extra layers. In addition, this reactor structure minimizes pressure drop and catalyst settling, which are common problems in conventional packed bed reactors.

  10. The resonance absorption controlled reactor

    Energy Technology Data Exchange (ETDEWEB)

    Caro, R.

    1977-07-01

    In this report a new method of reactor control based on tho isotopic moderator composition variation is studied, taking as a reference a D{sub 2}O/H{sub 2}O system. With this method an spectacular increment in the burn-up degree and a sensible reduction of the conventional control system is obtained. An important part of this work has been the detailed analysis of the parameters affecting the neutron spectrum in a heterogeneous reactor. (Author) 50 refs.

  11. Calculation of reactor antineutrino spectra in TEXONO

    CERN Document Server

    Chen Dong Liang; Mao Ze Pu; Wong, T H

    2002-01-01

    In the low energy reactor antineutrino physics experiments, either for the researches of antineutrino oscillation and antineutrino reactions, or for the measurement of abnormal magnetic moment of antineutrino, the flux and the spectra of reactor antineutrino must be described accurately. The method of calculation of reactor antineutrino spectra was discussed in detail. Furthermore, based on the actual circumstances of NP2 reactors and the arrangement of detectors, the flux and the spectra of reactor antineutrino in TEXONO were worked out

  12. LMFBR type reactor

    Energy Technology Data Exchange (ETDEWEB)

    Iwashige, Kengo

    1996-06-21

    In an LMFBR type reactor, partitions are disposed to a coolant channel at positions lower than the free liquid level, and the width of the partitions is adapted to have a predetermined condition. Namely, when low temperature fluid overflowing the wall of the coolant channel, flows down and collided against the free liquid surface in the coolant channel, since the dropping speed thereof is reduced abruptly, large pressure waves are caused by kinetic force of the low temperature fluid. However, if appropriate numbers of partitions having an appropriate shape are formed, the dropping speed of the low temperature fluid is moderated to reduce the pressure waves. In addition, since the pressure waves are dispersed to the circumferential and lateral directions of the coolant flow channel respectively, the propagation of the pressure waves can be prevented effectively. Further, when the flow of the low temperature fluid is changed to the circumferential direction, for example, by earthquakes, since the partitions act as members resisting against the circumferential change of the low temperature fluid, the change of the direction can be suppressed. (N.H.)

  13. Reactor Simulator Testing

    Science.gov (United States)

    Schoenfeld, Michael P.; Webster, Kenny L.; Pearson, Boise J.

    2013-01-01

    As part of the Nuclear Systems Office Fission Surface Power Technology Demonstration Unit (TDU) project, a reactor simulator test loop (RxSim) was design & built to perform integrated testing of the TDU components. In particular, the objectives of RxSim testing was to verify the operation of the core simulator, the instrumentation and control system, and the ground support gas and vacuum test equipment. In addition, it was decided to include a thermal test of a cold trap purification design and a pump performance test at pump voltages up to 150 V since the targeted mass flow rate of 1.75 kg/s was not obtained in the RxSim at the originally constrained voltage of 120 V. This paper summarizes RxSim testing. The gas and vacuum ground support test equipment performed effectively in NaK fill, loop pressurization, and NaK drain operations. The instrumentation and control system effectively controlled loop temperature and flow rates or pump voltage to targeted settings. The cold trap design was able to obtain the targeted cold temperature of 480 K. An outlet temperature of 636 K was obtained which was lower than the predicted 750 K but 156 K higher than the cold temperature indicating the design provided some heat regeneration. The annular linear induction pump (ALIP) tested was able to produce a maximum flow rate of 1.53 kg/s at 800 K when operated at 150 V and 53 Hz.

  14. Novel Catalytic Membrane Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Stuart Nemser, PhD

    2010-10-01

    There are many industrial catalytic organic reversible reactions with amines or alcohols that have water as one of the products. Many of these reactions are homogeneously catalyzed. In all cases removal of water facilitates the reaction and produces more of the desired chemical product. By shifting the reaction to right we produce more chemical product with little or no additional capital investment. Many of these reactions can also relate to bioprocesses. Given the large number of water-organic compound separations achievable and the ability of the Compact Membrane Systems, Inc. (CMS) perfluoro membranes to withstand these harsh operating conditions, this is an ideal demonstration system for the water-of-reaction removal using a membrane reactor. Enhanced reaction synthesis is consistent with the DOE objective to lower the energy intensity of U.S. industry 25% by 2017 in accord with the Energy Policy Act of 2005 and to improve the United States manufacturing competitiveness. The objective of this program is to develop the platform technology for enhancing homogeneous catalytic chemical syntheses.

  15. Tritium management in fusion reactors

    Energy Technology Data Exchange (ETDEWEB)

    Galloway, T.R.

    1978-05-01

    This is a review paper covering the key environmental and safety issues and how they have been handled in the various magnetic and inertial confinement concepts and reference designs. The issues treated include: tritium accident analyses, tritium process control, occupational safety, HTO formation rate from the gas-phase, disposal of tritium contaminated wastes, and environmental impact--each covering the Joint European Tokamak (J.E.T. experiment), Tokamak Fusion Test Reactor (TFTR), Russian T-20, The Next Step (TNS) designs by Westinghouse/ORNL and General Atomic/ANL, the ANL and ORNL EPR's, the G.A. Doublet Demonstration Reactor, the Italian Fintor-D and the ORNL Demo Studies. There are also the following full scale plant reference designs: UWMAK-III, LASL's Theta Pinch Reactor Design (RTPR), Mirror Fusion Reactor (MFR), Tandem Mirror Reactor (TMR), and the Mirror Hybrid Reactor (MHR). There are four laser device breakeven experiments, SHIVA-NOVA, LLL reference designs, ORNL Laser Fusion power plant, the German ''Saturn,'' and LLL's Laser Fusion EPR I and II.

  16. Proceedings: 9th World Congress on Preventive Dentistry (WCPD): "Community Participation and Global Alliances for Lifelong Oral Health for All," Phuket, Thailand, September 7-10, 2009

    DEFF Research Database (Denmark)

    Clarkson, J; Watt, R G; Rugg-Gunn, A J

    2010-01-01

    Information is presented about the 9th World Congress on Preventive Dentistry which was hosted by the International Association for Dental Research in Phuket, Thailand on September 7-10, 2009. The conference's theme, "Community Participation and Global Alliances for Lifelong Oral Health for All...

  17. 20 CFR 664.710 - Do Local Boards have the flexibility to offer services to area youth who are not eligible under...

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Do Local Boards have the flexibility to offer... Section 664.710 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR YOUTH... have the flexibility to offer services to area youth who are not eligible under the youth...

  18. Production of Biologically Active 7,10-dihydroxy-8(E)-octadecenoic Acid from Korean Pine Seed Oil by Pseudomonas aeruginosa PR3.

    Science.gov (United States)

    Hydroxyl group of hydroxyl fatty acid (HFA) cause HFA to carry special properties such as higher viscosity and reactivity compared with other non-hydroxy fatty acids. Microbial conversion of oleic acid into 7,10-dihydroxy-8(E)-octadecenoic acid (DOD) caused DOD to carry strong antibacterial activit...

  19. Innovative hybrid biological reactors using membranes; Reactores biologico hibrido innovadores utilizando membranas

    Energy Technology Data Exchange (ETDEWEB)

    Diez, R.; Esteban-Garcia, A. L.; Florio, L. de; Rodriguez-Hernandez, L.; Tejero, I.

    2011-07-01

    In this paper we present two lines of research on hybrid reactors including the use of membranes, although with different functions: RBPM, biofilm reactors and membranes filtration RBSOM, supported biofilm reactors and oxygen membranes. (Author) 14 refs.

  20. Establishment of licensing process for development reactors

    Energy Technology Data Exchange (ETDEWEB)

    Jo, Jong Chull; Yune, Young Gill; Kim, Woong Sik (and others)

    2006-02-15

    A study on licensing processes for development reactors has been performed to prepare the licensing of development reactors developed in Korea. The contents and results of the study are summarized as follows. The licensing processes for nuclear reactors in Korea, U.S.A., Japan, France, U.K., Canada, and IAEA were surveyed and analyzed to obtain technical bases necessary for establishing licensing processes applicable to development reactors in Korea. Based on the technical bases obtained the above analysis, the purpose, power output, and design characteristics of development reactors were analyzed in detail. The analysis results suggested that development reactors should be classified as a new reactor category (called as 'development reactor') separated from the current reactor categories such as the research reactor and the power reactor. Therefore, it is proposed to establish a new reactor category classified as 'development reactor' for the development reactors. And licensing processes, including licensing technical requirements, licensing document requirements, and other regulatory requirements, were also proposed for the development reactors. In order to institutionalize the licensing processes developed in this study, it is necessary to revise the current laws. Therefore, draft provisions of Atomic Energy Act, Enforcement Decree of the Atomic Energy Act, and Enforcement Regulation of the Atomic Energy Act have been developed for the preparation of the future legalization of the licensing processes proposed for the development reactors. Conclusively, a proposal of licensing processes and draft provisions of laws have been developed for the development reactors. The results proposed in this study can be applied directly to the licensing of the future development reactors. Furthermore, they will also contribute to establishing successfully the licensing processes of the development reactors.

  1. Repairing liner of the reactor; Reparacion del liner del reactor

    Energy Technology Data Exchange (ETDEWEB)

    Aguilar H, F. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2001-07-15

    Due to the corrosion problems of the aluminum coating of the reactor pool, a periodic inspections program by ultrasound to evaluate the advance grade and the corrosion speed was settled down. This inspections have shown the necessity to repair some areas, in those that the slimming is significant, of not making it can arrive to the water escape of the reactor pool. The objective of the repair is to place patches of plates of 1/4 inch aluminum thickness in the areas of the reactor 'liner', in those that it has been detected by ultrasound a smaller thickness or similar to 3 mm. To carry out this the fuels are move (of the core and those that are decaying) to a temporary storage, the structure of the core is confined in a tank that this placed inside the pool of the reactor, a shield is placed in the thermal column and it is completely extracted the water for to leave uncover the 'liner' of the reactor. (Author)

  2. Reactor Simulator Testing

    Science.gov (United States)

    Schoenfeld, Michael P.; Webster, Kenny L.; Pearson, Boise Jon

    2013-01-01

    As part of the Nuclear Systems Office Fission Surface Power Technology Demonstration Unit (TDU) project, a reactor simulator test loop (RxSim) was design & built to perform integrated testing of the TDU components. In particular, the objectives of RxSim testing was to verify the operation of the core simulator, the instrumentation and control system, and the ground support gas and vacuum test equipment. In addition, it was decided to include a thermal test of a cold trap purification design and a pump performance test at pump voltages up to 150 V since the targeted mass flow rate of 1.75 kg/s was not obtained in the RxSim at the originally constrained voltage of 120 V. This paper summarizes RxSim testing. The gas and vacuum ground support test equipment performed effectively in NaK fill, loop pressurization, and NaK drain operations. The instrumentation and control system effectively controlled loop temperature and flow rates or pump voltage to targeted settings. The cold trap design was able to obtain the targeted cold temperature of 480 K. An outlet temperature of 636 K was obtained which was lower than the predicted 750 K but 156 K higher than the cold temperature indicating the design provided some heat regeneration. The annular linear induction pump (ALIP) tested was able to produce a maximum flow rate of 1.53 kg/s at 800 K when operated at 150 V and 53 Hz. Keywords: fission, space power, nuclear, liquid metal, NaK.

  3. Reactivity determination in accelerator driven reactors using reactor noise analysis

    Directory of Open Access Journals (Sweden)

    Kostić Ljiljana 1

    2002-01-01

    Full Text Available Feynman-alpha and Rossi-alpha methods are used in traditional nuclear reactors to determine the subcritical reactivity of a system. The methods are based on the measurement of the mean value, variance and the covariance of detector counts for different measurement times. Such methods attracted renewed attention recently with the advent of the so-called accelerator driven reactors (ADS proposed some time ago. The ADS systems, intended to be used either in energy generation or transuranium transmutation, will use a subcritical core with a strong spallation source. A spallation source has statistical properties that are different from those traditionally used by radioactive sources. In such reactors the monitoring of the subcritical reactivity is very important, and a statistical method, such as the Feynman-alpha method, is capable of resolving this problem.

  4. Thermonuclear Reflect AB-Reactor

    CERN Document Server

    Bolonkin, Alexander

    2008-01-01

    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  5. Heterogeneous Transmutation Sodium Fast Reactor

    Energy Technology Data Exchange (ETDEWEB)

    S. E. Bays

    2007-09-01

    The threshold-fission (fertile) nature of Am-241 is used to destroy this minor actinide by capitalizing upon neutron capture instead of fission within a sodium fast reactor. This neutron-capture and its subsequent decay chain leads to the breeding of even neutron number plutonium isotopes. A slightly moderated target design is proposed for breeding plutonium in an axial blanket located above the active “fast reactor” driver fuel region. A parametric study on the core height and fuel pin diameter-to-pitch ratio is used to explore the reactor and fuel cycle aspects of this design. This study resulted in both non-flattened and flattened core geometries. Both of these designs demonstrated a high capacity for removing americium from the fuel cycle. A reactivity coefficient analysis revealed that this heterogeneous design will have comparable safety aspects to a homogeneous reactor of comparable size. A mass balance analysis revealed that the heterogeneous design may reduce the number of fast reactors needed to close the current once-through light water reactor fuel cycle.

  6. Entropy Production in Chemical Reactors

    Science.gov (United States)

    Kingston, Diego; Razzitte, Adrián C.

    2017-06-01

    We have analyzed entropy production in chemically reacting systems and extended previous results to the two limiting cases of ideal reactors, namely continuous stirred tank reactor (CSTR) and plug flow reactor (PFR). We have found upper and lower bounds for the entropy production in isothermal systems and given expressions for non-isothermal operation and analyzed the influence of pressure and temperature in entropy generation minimization in reactors with a fixed volume and production. We also give a graphical picture of entropy production in chemical reactions subject to constant volume, which allows us to easily assess different options. We show that by dividing a reactor into two smaller ones, operating at different temperatures, the entropy production is lowered, going as near as 48 % less in the case of a CSTR and PFR in series, and reaching 58 % with two CSTR. Finally, we study the optimal pressure and temperature for a single isothermal PFR, taking into account the irreversibility introduced by a compressor and a heat exchanger, decreasing the entropy generation by as much as 30 %.

  7. Simplifying Microbial Electrosynthesis Reactor Design

    Directory of Open Access Journals (Sweden)

    Cloelle G.S. Giddings

    2015-05-01

    Full Text Available Microbial electrosynthesis, an artificial form of photosynthesis, can efficiently convert carbon dioxide into organic commodities; however, this process has only previously been demonstrated in reactors that have features likely to be a barrier to scale-up. Therefore, the possibility of simplifying reactor design by both eliminating potentiostatic control of the cathode and removing the membrane separating the anode and cathode was investigated with biofilms of Sporomusa ovata, which reduces carbon dioxide to acetate. In traditional ‘H-cell’ reactors, where the anode and cathode chambers were separated with a proton-selective membrane, the rates and columbic efficiencies of microbial electrosynthesis remained high when electron delivery at the cathode was powered with a direct current power source rather than with a poteniostat-poised cathode utilized in previous studies. A membrane-less reactor with a direct-current power source with the cathode and anode positioned to avoid oxygen exposure at the cathode, retained high rates of acetate production as well as high columbic and energetic efficiencies. The finding that microbial electrosynthesis is feasible without a membrane separating the anode from the cathode, coupled with a direct current power source supplying the energy for electron delivery, is expected to greatly simplify future reactor design and lower construction costs.

  8. Hanford reactor and separations facility advantages

    Energy Technology Data Exchange (ETDEWEB)

    1963-06-27

    This document describes the advantages and limitations of Hanford production facilities. In addition to summarizing the technical parameters of the reactors and separations plants and their mechanical features, the unique aspects of these facilities to the production of special materials in which the Commission may be interested have been discussed. As the primary difference between the B-C-D-DR-F-H reactors and the K reactors and the K reactors is in the number and length of process channels. This report is addressed primarily to the 2000-tube reactors. K reactor characteristics are within the range of lattice and flexibility parameters described.

  9. Imaging Fukushima Daiichi reactors with muons

    Directory of Open Access Journals (Sweden)

    Haruo Miyadera

    2013-05-01

    Full Text Available A study of imaging the Fukushima Daiichi reactors with cosmic-ray muons to assess the damage to the reactors is presented. Muon scattering imaging has high sensitivity for detecting uranium fuel and debris even through thick concrete walls and a reactor pressure vessel. Technical demonstrations using a reactor mockup, detector radiation test at Fukushima Daiichi, and simulation studies have been carried out. These studies establish feasibility for the reactor imaging. A few months of measurement will reveal the spatial distribution of the reactor fuel. The muon scattering technique would be the best and probably the only way for Fukushima Daiichi to make this determination in the near future.

  10. Fast breeder reactors an engineering introduction

    CERN Document Server

    Judd, A M

    1981-01-01

    Fast Breeder Reactors: An Engineering Introduction is an introductory text to fast breeder reactors and covers topics ranging from reactor physics and design to engineering and safety considerations. Reactor fuels, coolant circuits, steam plants, and control systems are also discussed. This book is comprised of five chapters and opens with a brief summary of the history of fast reactors, with emphasis on international and the prospect of making accessible enormous reserves of energy. The next chapter deals with the physics of fast reactors and considers calculation methods, flux distribution,

  11. A tubular focused sonochemistry reactor

    Institute of Scientific and Technical Information of China (English)

    ZHOU GuangPing; LIANG ZhaoFeng; LI ZhengZhong; ZHANG YiHui

    2007-01-01

    This paper presents a new sonochemistry reactor, which consists of a cylindrical tube with a certain length and piezoelectric transducers at tube's end with the longitudinal vibration. The tube can effectively transform the longitudinal vibration into the radial vibration and thereby generates ultrasound. Furthermore, ultrasound can be focused to form high-intensity ultrasonic field inside tube. The reactor boasts of simple structure and its whole vessel wall can radiate ultrasound so that the electroacoustic transfer efficiency is high. The focused ultrasonic field provides good condition for sonochemical reaction. The length of the reactor can be up to 2 meters, and liquids can pass through it continuously, so it can be widely applied in liquid processing such as sonochemistry.

  12. A compact Tokamak transmutation reactor

    Institute of Scientific and Technical Information of China (English)

    QiuLi-Jian; XiaoBing-Jia

    1997-01-01

    The low aspect ration tokamak is proposed for the driver of a transmutation reactor.The main parameters of the reactor core,neutronic analysis of the blanket are given>the neutron wall loading can be lowered from the magnitude order of 1 MW/m2 to 0.5MW/m2 which is much easier to reach in the near future,and the transmutation efficiency (fission/absorption ratio)is raised further.The blanket power density is about 200MW/m3 which is not difficult to deal with.The key components such as diverter and center conductor post are also designed and compared with conventional TOkamak,Finally,by comparison with the other drivers such as FBR,PWR and accelerator,it can be anticipated that the low aspect ratio transmutation reactor would be one way of fusion energy applications in the near future.

  13. Plasma reactor waste management systems

    Science.gov (United States)

    Ness, Robert O., Jr.; Rindt, John R.; Ness, Sumitra R.

    1992-01-01

    The University of North Dakota is developing a plasma reactor system for use in closed-loop processing that includes biological, materials, manufacturing, and waste processing. Direct-current, high-frequency, or microwave discharges will be used to produce plasmas for the treatment of materials. The plasma reactors offer several advantages over other systems, including low operating temperatures, low operating pressures, mechanical simplicity, and relatively safe operation. Human fecal material, sunflowers, oats, soybeans, and plastic were oxidized in a batch plasma reactor. Over 98 percent of the organic material was converted to gaseous products. The solids were then analyzed and a large amount of water and acid-soluble materials were detected. These materials could possibly be used as nutrients for biological systems.

  14. Investigation of KW reactor incident

    Energy Technology Data Exchange (ETDEWEB)

    Sturges, D G [USAEC Hanford Operations Office, Richland, WA (United States); Hauff, T W; Greager, O H [General Electric Co., Richland, WA (United States). Hanford Atomic Products Operation

    1955-02-11

    The new KW reactor was placed in operation on January 4, 1955, and had been running at relatively low power levels for only 17 hours when it was shut down because of a process tube water leak which appeared to be associated with a slug rupture. After several days of unrewarding effort to remove the slugs and tube by customary methods, it developed that considerable melting of the tube and slugs had taken place. It was then evident that removal of the stuck mass and repairs to the damaged tube channel would require unusual measures that were certain to extend the reactor outage for several weeks. This report documents the work and findings of the Committee which investigated the KW reactor incident. Its content represents unanimous agreement among the three Committee members.

  15. Gaseous fuel nuclear reactor research

    Science.gov (United States)

    Schwenk, F. C.; Thom, K.

    1975-01-01

    Gaseous-fuel nuclear reactors are described; their distinguishing feature is the use of fissile fuels in a gaseous or plasma state, thereby breaking the barrier of temperature imposed by solid-fuel elements. This property creates a reactor heat source that may be able to heat the propellant of a rocket engine to 10,000 or 20,000 K. At this temperature level, gas-core reactors would provide the breakthrough in propulsion needed to open the entire solar system to manned and unmanned spacecraft. The possibility of fuel recycling makes possible efficiencies of up to 65% and nuclear safety at reduced cost, as well as high-thrust propulsion capabilities with specific impulse up to 5000 sec.

  16. Nuclear Reactor Engineering Analysis Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Carlos Chavez-Mercado; Jaime B. Morales-Sandoval; Benjamin E. Zayas-Perez

    1998-12-31

    The Nuclear Reactor Engineering Analysis Laboratory (NREAL) is a sophisticated computer system with state-of-the-art analytical tools and technology for analysis of light water reactors. Multiple application software tools can be activated to carry out different analyses and studies such as nuclear fuel reload evaluation, safety operation margin measurement, transient and severe accident analysis, nuclear reactor instability, operator training, normal and emergency procedures optimization, and human factors engineering studies. An advanced graphic interface, driven through touch-sensitive screens, provides the means to interact with specialized software and nuclear codes. The interface allows the visualization and control of all observable variables in a nuclear power plant (NPP), as well as a selected set of nonobservable or not directly controllable variables from conventional control panels.

  17. Utilisation of thorium in reactors

    Science.gov (United States)

    Anantharaman, K.; Shivakumar, V.; Saha, D.

    2008-12-01

    India's nuclear programme envisages a large-scale utilisation of thorium, as it has limited deposits of uranium but vast deposits of thorium. The large-scale utilisation of thorium requires the adoption of closed fuel cycle. The stable nature of thoria and the radiological issues associated with thoria poses challenges in the adoption of a closed fuel cycle. A thorium fuel based Advanced Heavy Water Reactor (AHWR) is being planned to provide impetus to development of technologies for the closed thorium fuel cycle. Thoria fuel has been loaded in Indian reactors and test irradiations have been carried out with (Th-Pu) MOX fuel. Irradiated thorium assemblies have been reprocessed and the separated 233U fuel has been used for test reactor KAMINI. The paper highlights the Indian experience with the use of thorium and brings out various issues associated with the thorium cycle.

  18. External fuel thermionic reactor system.

    Science.gov (United States)

    Mondt, J. F.; Peelgren, M. L.

    1971-01-01

    Thermionic reactors are prime candidates for nuclear electric propulsion. The national thermionic reactor effort is concentrated on the flashlight concept with the external-fuel concept as the backup. The external-fuel concept is very adaptable to a completely modular power subsystem which is attractive for highly reliable long-life applications. The 20- to 25-cm long, externally-fueled converters have been designed, fabricated, and successfully tested with many thermal cycles by electrical heating. However, difficulties have been encountered during encapsulation for nuclear heated tests and none have been started to date. These nuclear tests are required to demonstrate the concept feasibility.

  19. Analysis of Adiabatic Batch Reactor

    Directory of Open Access Journals (Sweden)

    Erald Gjonaj

    2016-05-01

    Full Text Available A mixture of acetic anhydride is reacted with excess water in an adiabatic batch reactor to form an exothermic reaction. The concentration of acetic anhydride and the temperature inside the adiabatic batch reactor are calculated with an initial temperature of 20°C, an initial temperature of 30°C, and with a cooling jacket maintaining the temperature at a constant of 20°C. The graphs of the three different scenarios show that the highest temperatures will cause the reaction to occur faster.

  20. PITR: Princeton Ignition Test Reactor

    Energy Technology Data Exchange (ETDEWEB)

    1978-12-01

    The principal objectives of the PITR - Princeton Ignition Test Reactor - are to demonstrate the attainment of thermonuclear ignition in deuterium-tritium, and to develop optimal start-up techniques for plasma heating and current induction, in order to determine the most favorable means of reducing the size and cost of tokamak power reactors. This report describes the status of the plasma and engineering design features of the PITR. The PITR geometry is chosen to provide the highest MHD-stable values of beta in a D-shaped plasma, as well as ease of access for remote handling and neutral-beam injection.

  1. Reactor shutdown delays medical procedures

    Science.gov (United States)

    Gwynne, Peter

    2008-01-01

    A longer-than-expected maintenance shutdown of the Canadian nuclear reactor that produces North America's entire supply of molybdenum-99 - from which the radioactive isotopes technetium-99 and iodine-131 are made - caused delays to the diagnosis and treatment of thousands of seriously ill patients last month. Technetium-99 is a key component of nuclear-medicine scans, while iodine-131 is used to treat cancer and other diseases of the thyroid. Production eventually resumed, but only after the Canadian government had overruled the Canadian Nuclear Safety Commission (CNSC), which was still concerned about the reactor's safety.

  2. Fundamentals of Nuclear Reactor Physics

    CERN Document Server

    Lewis, E E

    2008-01-01

    This new streamlined text offers a one-semester treatment of the essentials of how the fission nuclear reactor works, the various approaches to the design of reactors, and their safe and efficient operation. The book includes numerous worked-out examples and end-of-chapter questions to help reinforce the knowledge presented. This textbook offers an engineering-oriented introduction to nuclear physics, with a particular focus on how those physics are put to work in the service of generating nuclear-based power, particularly the importance of neutron reactions and neutron behavior. Engin

  3. Scaledown of a methanol reactor

    Energy Technology Data Exchange (ETDEWEB)

    Berty, J.M.

    1983-07-01

    This article shows how it is possible to define operating conditions for pilot plants and development labs by scaling down a commercial reactor. Points out that scaledown consideration and experiment planning can be done in a similar manner for the boiling water-cooled, Lurgi-type reactor. Explains that although the design of large, single-train plants to produce methanol for fuel use has different economic objectives, product specifications, and technical constraints from the traditional commercial methanol plants, the same fundamental laws of thermodynamics and reaction kinetics apply to both types of operation.

  4. Reactor Antineutrino Signals at Morton and Boulby

    CERN Document Server

    Dye, Steve

    2016-01-01

    Increasing the distance from which an antineutrino detector is capable of monitoring the operation of a registered reactor, or discovering a clandestine reactor, strengthens the Non-Proliferation of Nuclear Weapons Treaty. This report presents calculations of reactor antineutrino interactions, from quasi-elastic neutrino-proton scattering and elastic neutrino-electron scattering, in a water-based detector operated >10 km from a commercial power reactor. It separately calculates signal from the proximal reactor and background from all other registered reactors. The main results are interaction rates and kinetic energy distributions of charged leptons scattered from quasi-elastic and elastic processes. Comparing signal and background distributions evaluates reactor monitoring capability. Scaling the results to detectors of different sizes, target media, and standoff distances is straightforward. Calculations are for two examples of a commercial reactor (P_th~3 GW) operating nearby (L~20 km) an underground facil...

  5. Oregon State University TRIGA Reactor annual report

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, T.V.; Johnson, A.G.; Bennett, S.L.; Ringle, J.C.

    1979-08-31

    The use of the Oregon State University TRIGA Reactor during the year ending June 30, 1979, is summarized. Environmental and radiation protection data related to reactor operation and effluents are included.

  6. Request for Naval Reactors Comment on Proposed Prometheus Space Flight Nuclear Reactor High Tier Reactor Safety Requirements and for Naval Reactors Approval to Transmit These Requirements to JPL

    Energy Technology Data Exchange (ETDEWEB)

    D. Kokkinos

    2005-04-28

    The purpose of this letter is to request Naval Reactors comments on the nuclear reactor high tier requirements for the PROMETHEUS space flight reactor design, pre-launch operations, launch, ascent, operation, and disposal, and to request Naval Reactors approval to transmit these requirements to Jet Propulsion Laboratory to ensure consistency between the reactor safety requirements and the spacecraft safety requirements. The proposed PROMETHEUS nuclear reactor high tier safety requirements are consistent with the long standing safety culture of the Naval Reactors Program and its commitment to protecting the health and safety of the public and the environment. In addition, the philosophy on which these requirements are based is consistent with the Nuclear Safety Policy Working Group recommendations on space nuclear propulsion safety (Reference 1), DOE Nuclear Safety Criteria and Specifications for Space Nuclear Reactors (Reference 2), the Nuclear Space Power Safety and Facility Guidelines Study of the Applied Physics Laboratory.

  7. Transmutation of actinides in power reactors.

    Science.gov (United States)

    Bergelson, B R; Gerasimov, A S; Tikhomirov, G V

    2005-01-01

    Power reactors can be used for partial short-term transmutation of radwaste. This transmutation is beneficial in terms of subsequent storage conditions for spent fuel in long-term storage facilities. CANDU-type reactors can transmute the main minor actinides from two or three reactors of the VVER-1000 type. A VVER-1000-type reactor can operate in a self-service mode with transmutation of its own actinides.

  8. Heavy Water Reactor; Reacteurs a eau lourde

    Energy Technology Data Exchange (ETDEWEB)

    Yu, St.; HOpwood, J.; Meneley, D. [Energie Atomique du Canada (Canada)

    2000-04-01

    This document deals with the Heavy Water Reactor (HWR) technology and especially the Candu (Canada Deuterium Uranium) reactor. This reactors type offers many advantages that promote them for the future. General concepts, a description of the Candu nuclear power plants, the safety systems, the fuel cycle and economical and environmental aspects are included. (A.L.B.)

  9. Heat-pipe thermionic reactor concept

    DEFF Research Database (Denmark)

    Storm Pedersen, E.

    1967-01-01

    Main components are reactor core, heat pipe, thermionic converter, secondary cooling system, and waste heat radiator; thermal power generated in reactor core is transported by heat pipes to thermionic converters located outside reactor core behind radiation shield; thermionic emitters are in direct...

  10. Some new viewpoints in reactor noise analysis

    Institute of Scientific and Technical Information of China (English)

    罗征培; 李富; 等

    1996-01-01

    It is propsed that the linearity criterion and order criterion via frequency spectrum features without any limitation of the model's phase can be used in reactor noise analysis.The time constant,natural frequency as well as the recovered transfer function of reactors can bhe obtained via the analyzable model based on reactor noise.

  11. Operating Modes Of Chemical Reactors Of Polymerization

    Directory of Open Access Journals (Sweden)

    Meruyert Berdieva

    2012-05-01

    Full Text Available In the work the issues of stable technological modes of operation of main devices of producing polysterol reactors have been researched as well as modes of stable operation of a chemical reactor have been presented, which enables to create optimum mode parameters of polymerization process, to prevent emergency situations of chemical reactor operation in industrial conditions.

  12. Laminar Entrained Flow Reactor (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2014-02-01

    The Laminar Entrained Flow Reactor (LEFR) is a modular, lab scale, single-user reactor for the study of catalytic fast pyrolysis (CFP). This system can be employed to study a variety of reactor conditions for both in situ and ex situ CFP.

  13. Silica-Immobilized Enzyme Reactors

    Science.gov (United States)

    2007-08-01

    immobilized artificial membrane chromatography and lysophospholipid micellar electrokinetic chromatography . J. Chromatogr. A 1998, 810, 95-103. 50...Journal of Liquid Chromatography and Related Technologies. Air Force Research Laboratory Materials and Manufacturing Directorate Airbase...immobilized enzyme reactors (IMERs) can also be integrated directly to further analytical methods such as liquid chromatography or mass spectrometry.[6] In

  14. Nozzle for electric dispersion reactor

    Science.gov (United States)

    Sisson, Warren G.; Basaran, Osman A.; Harris, Michael T.

    1995-01-01

    A nozzle for an electric dispersion reactor includes two concentric electrodes, the inner one of the two delivering disperse phase fluid into a continuous phase fluid. A potential difference generated by a voltage source creates a dispersing electric field at the end of the inner electrode.

  15. A Simple Tubular Reactor Experiment.

    Science.gov (United States)

    Hudgins, Robert R.; Cayrol, Bertrand

    1981-01-01

    Using the hydrolysis of crystal violet dye by sodium hydroxide as an example, the theory, apparatus, and procedure for a laboratory demonstration of tubular reactor behavior are described. The reaction presented can occur at room temperature and features a color change to reinforce measured results. (WB)

  16. High temperature catalytic membrane reactors

    Energy Technology Data Exchange (ETDEWEB)

    1990-03-01

    Current state-of-the-art inorganic oxide membranes offer the potential of being modified to yield catalytic properties. The resulting modules may be configured to simultaneously induce catalytic reactions with product concentration and separation in a single processing step. Processes utilizing such catalytically active membrane reactors have the potential for dramatically increasing yield reactions which are currently limited by either thermodynamic equilibria, product inhibition, or kinetic selectivity. Examples of commercial interest include hydrogenation, dehydrogenation, partial and selective oxidation, hydrations, hydrocarbon cracking, olefin metathesis, hydroformylation, and olefin polymerization. A large portion of the most significant reactions fall into the category of high temperature, gas phase chemical and petrochemical processes. Microporous oxide membranes are well suited for these applications. A program is proposed to investigate selected model reactions of commercial interest (i.e. dehydrogenation of ethylbenzene to styrene and dehydrogenation of butane to butadiene) using a high temperature catalytic membrane reactor. Membranes will be developed, reaction dynamics characterized, and production processes developed, culminating in laboratory-scale demonstration of technical and economic feasibility. As a result, the anticipated increased yield per reactor pass economic incentives are envisioned. First, a large decrease in the temperature required to obtain high yield should be possible because of the reduced driving force requirement. Significantly higher conversion per pass implies a reduced recycle ratio, as well as reduced reactor size. Both factors result in reduced capital costs, as well as savings in cost of reactants and energy.

  17. Nuclear Reactors and Technology; (USA)

    Energy Technology Data Exchange (ETDEWEB)

    Cason, D.L.; Hicks, S.C. (eds.)

    1991-01-01

    Nuclear Reactors and Technology (NRT) announces on a monthly basis the current worldwide information available from the open literature on nuclear reactors and technology, including all aspects of power reactors, components and accessories, fuel elements, control systems, and materials. This publication contains the abstracts of DOE reports, journal articles, conference papers, patents, theses, and monographs added to the Energy Science and Technology Database (EDB) during the past month. Also included are US information obtained through acquisition programs or interagency agreements and international information obtained through the International Energy Agency's Energy Technology Data Exchange or government-to-government agreements. The digests in NRT and other citations to information on nuclear reactors back to 1948 are available for online searching and retrieval on EDB and Nuclear Science Abstracts (NSA) database. Current information, added daily to EDB, is available to DOE and its contractors through the DOE integrated Technical Information System. Customized profiles can be developed to provide current information to meet each user's needs.

  18. British high flux beam reactor.

    Science.gov (United States)

    Egelstaff, P A

    1970-10-24

    The neutron scattering technique has become an accepted method for the study of condensed matter. Because of the great scientific and technical value of neutron experiments and the growing body of users, several proposals have been made during the past decade for a nuclear reactor devoted primarily to this technique. This article reviews the reasons for and history behind these proposals.

  19. Nuclear reactors and fuel cycle

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2014-07-01

    The Nuclear Fuel Center (CCN) of IPEN produces nuclear fuel for the continuous operation of the IEA-R1 research reactor of IPEN. The serial production started in 1988, when the first nuclear fuel element was delivered for IEA-R1. In 2011, CCN proudly presents the 100{sup th} nuclear fuel element produced. Besides routine production, development of new technologies is also a permanent concern at CCN. In 2005, U{sub 3}O{sub 8} were replaced by U{sub 3}Si{sub 2}-based fuels, and the research of U Mo is currently under investigation. Additionally, the Brazilian Multipurpose Research Reactor (RMB), whose project will rely on the CCN for supplying fuel and uranium targets. Evolving from an annual production from 10 to 70 nuclear fuel elements, plus a thousand uranium targets, is a huge and challenging task. To accomplish it, a new and modern Nuclear Fuel Factory is being concluded, and it will provide not only structure for scaling up, but also a safer and greener production. The Nuclear Engineering Center has shown, along several years, expertise in the field of nuclear, energy systems and correlated areas. Due to the experience obtained during decades in research and technological development at Brazilian Nuclear Program, personnel has been trained and started to actively participate in design of the main system that will compose the Brazilian Multipurpose Reactor (RMB) which will make Brazil self-sufficient in production of radiopharmaceuticals. The institution has participated in the monitoring and technical support concerning the safety, licensing and modernization of the research reactors IPEN/MB-01 and IEA-R1. Along the last two decades, numerous specialized services of engineering for the Brazilian nuclear power plants Angra 1 and Angra 2 have been carried out. The contribution in service, research, training, and teaching in addition to the development of many related technologies applied to nuclear engineering and correlated areas enable the institution to

  20. NuSTAR and multifrequency study of the two high-redshift blazars S5 0836+710 and PKS 2149-306

    DEFF Research Database (Denmark)

    Tagliaferri, G.; Ghisellini, G.; Perri, M.

    2015-01-01

    Powerful blazars are flat-spectrum radio quasars whose emission is dominated by a Compton component peakingbetween a few hundred keV and a few hundred MeV. We observed two bright blazars, PKS 2149–306 at redshift z = 2.345 and S5 0836+710 at z = 2.172, in the hard X-ray band with the Nuclear Spec...

  1. Proceedings of the Annual Meeting (26th) Technical Documentation Division Held at San Antonio, Texas on 7-10 May 1984.

    Science.gov (United States)

    1984-05-10

    963-A PROCEEDINGS * TWENTY-SIXTH ANNUAL MEETING TECHNICAL DOCUMENTATION DIVISION C:) ~ 7-10 May196BE4 ’-X.MAR 15 5 t.EL Tropicano Hotel San Antonio...with the U.S. Navy for four years as a Lt. J.G. Mr. Knob joined the Engineering Data Mangement Section of the American Defense Preparedness Association...Preparedness Association Technical Documentation Division May 8-11, 1984 El Tropicano Hotel , San Antonio, Texas -S

  2. Mechanical properties and histological evaluation of sintered beta-Ca2P2O7 with Na4P2O7.10H2O addition.

    Science.gov (United States)

    Lin, F H; Lin, C C; Lu, C M; Liu, H C; Sun, J S; Wang, C Y

    1995-07-01

    The ultimate goal of implantation of biomaterials in the skeleton is to reach full integration of the non-living implant with the living bone. The biomaterial can be used much as a bone graft, resorbing or dissolving as bone growth occurs, and the end result is a new remoulded bone. Calcium pyrophosphate, Ca2P2O7, is one of the intermediate products of bone mineralization. beta-Dicalcium pyrophosphate (beta-DCP) doped with certain amounts of Na4P2O7.10H2O was prepared as the developed material. Na4P2O7.10H2O was used as a liquid-phase additive to improve the sintering process and promote physiological bioresorbability. Compressive strength and four-point bending strength were measured by the Bionix test system 858. The mechanical strength of the sintered beta-DCP increased with the addition of Na4P2O7.10H2O up to 5 wt%, but thereafter decreased. The microstructure and crystal structure were analysed by the techniques of SEM, EPMA, TEM and XRD. The relationship between the mechanical strength of the sintered bioceramics and the Na4P2O7.10H2O dopant was examined in terms of the presence of NaCa(PO3)3, grain growth and abnormal grain coalescence while the dopant increased. Preliminary in vivo evaluation was studied by rabbit femur condyle implantation. There was no inflammation or any toxic sign during the experimental period. The histological section of intraosseous implantation revealed that the new bone deposited directly on the surface of the material in the fourth week after operation. The implant gradually decreased in volume and was replaced by the surrounding regenerated bone in the rabbit condyle in vivo environment. The results led us to conclude that the developed material has great potential as a biodegradable bone substitute.

  3. A new MTR fuel for a new MTR reactor: UMo for the Jules Horowitz reactor

    Energy Technology Data Exchange (ETDEWEB)

    Guigon, B. [CEA Cadarache, F-13108 Saint Paul lez Durance (France); Vacelet, H. [CERCA, Romans (France); Dornbusch, D. [Technicatome, Aix en Provence (France)

    2000-07-01

    Within some years, the Jules Horowitz Reactor will be the only working experimental reactor (material and fuel testing reactor) in France. It will have to provide facilities for a wide range of needs from activation analysis to power reactor fuel qualification. In this paper the main characteristics of the Jules Horowitz Reactor are presented. Safety criteria are explained. Finally, merits and disadvantages of UMo compared to the standard U{sub 3}Si{sub 2} fuel are discussed. (author)

  4. Heterogeneous Recycling in Fast Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Forget, Benoit; Pope, Michael; Piet, Steven J.; Driscoll, Michael

    2012-07-30

    Current sodium fast reactor (SFR) designs have avoided the use of depleted uranium blankets over concerns of creating weapons grade plutonium. While reducing proliferation risks, this restrains the reactor design space considerably. This project will analyze various blanket and transmutation target configurations that could broaden the design space while still addressing the non-proliferation issues. The blanket designs will be assessed based on the transmutation efficiency of key minor actinide (MA) isotopes and also on mitigation of associated proliferation risks. This study will also evaluate SFR core performance under different scenarios in which depleted uranium blankets are modified to include minor actinides with or without moderators (e.g. BeO, MgO, B4C, and hydrides). This will be done in an effort to increase the sustainability of the reactor and increase its power density while still offering a proliferation resistant design with the capability of burning MA waste produced from light water reactors (LWRs). Researchers will also analyze the use of recycled (as opposed to depleted) uranium in the blankets. The various designs will compare MA transmutation efficiency, plutonium breeding characteristics, proliferation risk, shutdown margins and reactivity coefficients with a current reference sodium fast reactor design employing homogeneous recycling. The team will also evaluate the out-of-core accumulation and/or burn-down rates of MAs and plutonium isotopes on a cycle-by-cycle basis. This cycle-by-cycle information will be produced in a format readily usable by the fuel cycle systems analysis code, VISION, for assessment of the sustainability of the deployment scenarios.

  5. Neutronic assessment of liquid-metal cooled fast reactors using thorium fuel

    Energy Technology Data Exchange (ETDEWEB)

    Pilarski, Stevan [Electricite de France R et D, 1 Avenue du General de Gaulle, 92141 Clamart (France); Institut de Physique Nucleaire d' Orsay, 15 rue Georges Clemenceau 91406 Orsay (France)

    2009-06-15

    {sup 232}Th-{sup 233}U fuel cycle for 3600 MW{sub th} concepts with radial and axial blankets, for all lead-based coolants (with the lowest value of -3$ for pure lead). In the case of sodium, similar core design options concerning the fuel and the blankets allow to decrease the void reactivity from 5$ to 1$ in a concept very similar to the SFR (Sodium Fast Reactor) [4]. In all cases, the use of thorium fuel is beneficial to the safety parameters, and the use of blankets ensures favourable breeding performance. References: 1. D. BISWAS, Problemes neutroniques lies a l'utilisation du cycle thorium dans un reacteur rapide de 1200 MWe. Doctoral thesis, Universite Paris-Sud Orsay (1979). 2. J. Y. Doriath, C. W. McCallien, E. Kiefhaber, U. Wehmann and J.-M. Rieunier, 'ERANOS - The Advanced European System of Codes for Reactor Physics Calculations', Joint Conference on Mathematical Methods and Supercomputing in Nuclear Applications, Karlsruhe, Germany, April 19-23 (1993). 3. G. Rimpault, D. Honde, J. Tommasi, J.-M. Rieunier, R. Jacqmin, D. Verrier, D. Biron, 'The ERANOS Data Code and Code System for Fast Reactor Neutronic Analyses', International Conference on the New Frontiers of Nuclear Technology: Reactor Physics, Safety and High-Performance Computing, Seoul, Korea, October 7-10 (2004). 3. G. Mignot et al., 'Studies on French SFR advanced core designs', 2008 International Congress on Advances in Nuclear Power Plants (ICAPP '08), Anaheim, USA, June 8-12 (2008). (authors)

  6. Reactor monitoring and safeguards using antineutrino detectors

    CERN Document Server

    Bowden, N S

    2008-01-01

    Nuclear reactors have served as the antineutrino source for many fundamental physics experiments. The techniques developed by these experiments make it possible to use these very weakly interacting particles for a practical purpose. The large flux of antineutrinos that leaves a reactor carries information about two quantities of interest for safeguards: the reactor power and fissile inventory. Measurements made with antineutrino detectors could therefore offer an alternative means for verifying the power history and fissile inventory of a reactors, as part of International Atomic Energy Agency (IAEA) and other reactor safeguards regimes. Several efforts to develop this monitoring technique are underway across the globe.

  7. Neutrino Mixing Discriminates Geo-reactor Models

    CERN Document Server

    Dye, S T

    2009-01-01

    Geo-reactor models suggest the existence of natural nuclear reactors at different deep-earth locations with loosely defined output power. Reactor fission products undergo beta decay with the emission of electron antineutrinos, which routinely escape the earth. Neutrino mixing distorts the energy spectrum of the electron antineutrinos. Characteristics of the distorted spectrum observed at the earth's surface could specify the location of a geo-reactor, discriminating the models and facilitating more precise power measurement. The existence of a geo-reactor with known position could enable a precision measurement of the neutrino oscillation parameter delta-mass-squared.

  8. Reactor assessments of advanced bumpy torus configurations

    Energy Technology Data Exchange (ETDEWEB)

    Uckan, N.A.; Owen, L.W.; Spong, D.A.; Miller, R.L.; Ard, W.B.; Pipkins, J.F.; Schmitt, R.J.

    1983-01-01

    Recently, several configurational approaches and concept improvement schemes were introduced for enhancing the performance of the basic ELMO Bumpy Torus (EBT) concept and for improving its reactor potential. These configurations include planar racetrack and square geometries, Andreoletti coil systems, and bumpy torus-stellarator hybrids (which include twisted racetrack and helical axis stellarator-snakey torus). Preliminary evaluations of reactor implications of each of these configurations have been carried out based on magnetics (vacuum) calculations, transport and scaling relationships, and stability properties. Results indicate favorable reactor projections with a significant reduction in reactor physical size as compared to conventional EBT reactor designs carried out in the past.

  9. Refurbishment of existing research reactors for BNCT

    Energy Technology Data Exchange (ETDEWEB)

    Jatuff, F.E.; Gessaghi, V. [INVAP S.E., de Bariloche (Argentina)

    1997-12-01

    Some research reactors have been selected for the development of boron neutron capture therapy (BNCT) in the United States like the Massachusetts Institute of Technology research reactor, the University of Missouri research reactor 2 or the Brookhaven Medical Research Reactor, among others. These reactors have received excellent analyses and designs to accommodate extremely optimized beam shaping assemblies (BSAs) for the proper tuning of neutron spectra and absorption of undesired particles such as photons and fast neutrons. Due to the importance of BNCT in these facilities, the physicists and engineers have used many degrees of freedom for the optimization process.

  10. Tandem Mirror Reactor Systems Code (Version I)

    Energy Technology Data Exchange (ETDEWEB)

    Reid, R.L.; Finn, P.A.; Gohar, M.Y.; Barrett, R.J.; Gorker, G.E.; Spampinaton, P.T.; Bulmer, R.H.; Dorn, D.W.; Perkins, L.J.; Ghose, S.

    1985-09-01

    A computer code was developed to model a Tandem Mirror Reactor. Ths is the first Tandem Mirror Reactor model to couple, in detail, the highly linked physics, magnetics, and neutronic analysis into a single code. This report describes the code architecture, provides a summary description of the modules comprising the code, and includes an example execution of the Tandem Mirror Reactor Systems Code. Results from this code for two sensitivity studies are also included. These studies are: (1) to determine the impact of center cell plasma radius, length, and ion temperature on reactor cost and performance at constant fusion power; and (2) to determine the impact of reactor power level on cost.

  11. Savannah River Site production reactor technical specifications. K Production Reactor

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-02-01

    These technical specifications are explicit restrictions on the operation of the Savannah River Site K Production Reactor. They are designed to preserve the validity of the plant safety analysis by ensuring that the plant is operated within the required conditions bounded by the analysis, and with the operable equipment that is assumed to mitigate the consequences of an accident. Technical specifications preserve the primary success path relied upon to detect and respond to accidents. This report describes requirements on thermal-hydraulic limits; limiting conditions for operation and surveillance for the reactor, power distribution control, instrumentation, process water system, emergency cooling and emergency shutdown systems, confinement systems, plant systems, electrical systems, components handling, and special test exceptions; design features; and administrative controls.

  12. CFD Simulation on Ethylene Furnace Reactor Tubes

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Different mathematical models for ethylene furnace reactor tubes were reviewed. On the basis of these models a new mathematical simulation approach for reactor tubes based on computational fluid dynamics (CFD) technique was presented. This approach took the flow, heat transfer, mass transfer and thermal cracking reactions in the reactor tubes into consideration. The coupled reactor model was solved with the SIMPLE algorithm. Some detailed information about the flow field, temperature field and concentration distribution in the reactor tubes was obtained, revealing the basic characteristics of the hydrodynamic phenomena and reaction behavior in the reactor tubes. The CFD approach provides the necessary information for conclusive decisions regarding the production optimization, the design and improvement of reactor tubes, and the new techniques implementation.

  13. Advanced reactor physics methods for heterogeneous reactor cores

    Science.gov (United States)

    Thompson, Steven A.

    To maintain the economic viability of nuclear power the industry has begun to emphasize maximizing the efficiency and output of existing nuclear power plants by using longer fuel cycles, stretch power uprates, shorter outage lengths, mixed-oxide (MOX) fuel and more aggressive operating strategies. In order to accommodate these changes, while still satisfying the peaking factor and power envelope requirements necessary to maintain safe operation, more complexity in commercial core designs have been implemented, such as an increase in the number of sub-batches and an increase in the use of both discrete and integral burnable poisons. A consequence of the increased complexity of core designs, as well as the use of MOX fuel, is an increase in the neutronic heterogeneity of the core. Such heterogeneous cores introduce challenges for the current methods that are used for reactor analysis. New methods must be developed to address these deficiencies while still maintaining the computational efficiency of existing reactor analysis methods. In this thesis, advanced core design methodologies are developed to be able to adequately analyze the highly heterogeneous core designs which are currently in use in commercial power reactors. These methodological improvements are being pursued with the goal of not sacrificing the computational efficiency which core designers require. More specifically, the PSU nodal code NEM is being updated to include an SP3 solution option, an advanced transverse leakage option, and a semi-analytical NEM solution option.

  14. Reactor pulse repeatability studies at the annular core research reactor

    Energy Technology Data Exchange (ETDEWEB)

    DePriest, K.R. [Applied Nuclear Technologies, Sandia National Laboratories, Mail Stop 1146, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States); Trinh, T.Q. [Nuclear Facility Operations, Sandia National Laboratories, Mail Stop 0614, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States); Luker, S. M. [Applied Nuclear Technologies, Sandia National Laboratories, Mail Stop 1146, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States)

    2011-07-01

    The Annular Core Research Reactor (ACRR) at Sandia National Laboratories is a water-moderated pool-type reactor designed for testing many types of objects in the pulse and steady-state mode of operations. Personnel at Sandia began working to improve the repeatability of pulse operations for experimenters in the facility. The ACRR has a unique UO{sub 2}-BeO fuel that makes the task of producing repeatable pulses difficult with the current operating procedure. The ACRR produces a significant quantity of photoneutrons through the {sup 9}Be({gamma}, n){sup 8}Be reaction in the fuel elements. The photoneutrons are the result of the gammas produced during fission and in fission product decay, so their production is very much dependent on the reactor power history and changes throughout the day/week of experiments in the facility. Because the photoneutrons interfere with the delayed-critical measurements required for accurate pulse reactivity prediction, a new operating procedure was created. The photoneutron effects at delayed critical are minimized when using the modified procedure. In addition, the pulse element removal time is standardized for all pulse operations with the modified procedure, and this produces less variation in reactivity removal times. (authors)

  15. In-reactor performance of pressure tubes in CANDU reactors

    Science.gov (United States)

    Rodgers, D. K.; Coleman, C. E.; Griffiths, M.; Bickel, G. A.; Theaker, J. R.; Muir, I.; Bahurmuz, A. A.; Lawrence, S. St.; Resta Levi, M.

    2008-12-01

    The pressure tubes in CANDU reactors have been operating for times up to about 25 years. The in-reactor performance of Zr-2.5Nb pressure tubes has been evaluated by sampling and periodic inspection. This paper describes the behaviour and discusses the factors controlling the behaviour of these components in currently operating CANDU reactors. The mechanical properties (such as ultimate tensile strength, UTS, and fracture toughness), and delayed-hydride-cracking properties (crack growth rate Vc, and threshold stress intensity factor, KIH) change with irradiation; the former reach a limiting value at a fluence of Pressure tubes exhibit elongation and diametral expansion. The deformation behaviour is a function of operating conditions and material properties that vary from tube-to-tube and as a function of axial location. Semi-empirical predictive models have been developed to describe the deformation response of average tubes as a function of operating conditions. For corrosion and, more importantly deuterium pickup, semi-empirical predictive models have also been developed to represent the behaviour of an average tube. The effect of material variability on corrosion behaviour is less well defined compared with other properties. Improvements in manufacturing have increased fracture resistance by minimising trace elements, especially H and Cl, and reduced variability by tightening controls on forming parameters, especially hot-working temperatures.

  16. Gas-liquid autoxidation reactors

    Energy Technology Data Exchange (ETDEWEB)

    Morbidelli, M.; Paludetto, R.; Carra, S.

    1986-01-01

    A procedure for the simulation of autoxidation gas-liquid reactors has been developed based both on mathematical models and laboratory experiments. It has been shown that the complex radical chain mechanism of the autoxidation process can be simulated through two global parallel reactions, whose rates are obtained by assuming pseudo-steady-state concentration values for all the radical species involved. Using ethylbenzene autoxidation as a model reaction, an experimental analysis has been performed in order to estimate all the kinetic parameters of the model. The effect of the interaction between gas-liquid mass-transfer phenomena and the complex kinetic mechanism on the overall performance of an autoxidation reactor has been examined in detail within the framework of the liquid film model.

  17. Transport simulation for EBT reactor

    Energy Technology Data Exchange (ETDEWEB)

    Uckan, T.; Uckan, N.A.; Jaeger, E.F.

    1983-08-01

    Transport simulation and modeling studies for the ELMO Bumpy Torus (EBT) reactor are carried out by using zero-dimensional (0-D) and one-and-one-half-dimensional (1 1/2-D) transport calculations. The time-dependent 0-D model is used for global analysis, whereas the 1 1/2-D radial transport code is used for accurate determination of density, temperature, and ambipolar potential profiles and of the role of these profiles in reactor plasma performance. Analysis with the 1 1/2-D transport code shows that profile effects near the outer edge of the hot electron ring lead to enhanced confinement by at least a factor of 2 to 5 beyond the simple scaling that is obtained from the global analysis. The radial profiles of core plasma density and temperatures (or core pressure) obtained from 1 1/2-D transport calculations are found to be similar to those theoretically required for stability.

  18. Nuclear reactor alignment plate configuration

    Energy Technology Data Exchange (ETDEWEB)

    Altman, David A; Forsyth, David R; Smith, Richard E; Singleton, Norman R

    2014-01-28

    An alignment plate that is attached to a core barrel of a pressurized water reactor and fits within slots within a top plate of a lower core shroud and upper core plate to maintain lateral alignment of the reactor internals. The alignment plate is connected to the core barrel through two vertically-spaced dowel pins that extend from the outside surface of the core barrel through a reinforcement pad and into corresponding holes in the alignment plate. Additionally, threaded fasteners are inserted around the perimeter of the reinforcement pad and into the alignment plate to further secure the alignment plate to the core barrel. A fillet weld also is deposited around the perimeter of the reinforcement pad. To accomodate thermal growth between the alignment plate and the core barrel, a gap is left above, below and at both sides of one of the dowel pins in the alignment plate holes through with the dowel pins pass.

  19. Fluidized bed coal combustion reactor

    Science.gov (United States)

    Moynihan, P. I.; Young, D. L. (Inventor)

    1981-01-01

    A fluidized bed coal reactor includes a combination nozzle-injector ash-removal unit formed by a grid of closely spaced open channels, each containing a worm screw conveyor, which function as continuous ash removal troughs. A pressurized air-coal mixture is introduced below the unit and is injected through the elongated nozzles formed by the spaces between the channels. The ash build-up in the troughs protects the worm screw conveyors as does the cooling action of the injected mixture. The ash layer and the pressure from the injectors support a fluidized flame combustion zone above the grid which heats water in boiler tubes disposed within and/or above the combustion zone and/or within the walls of the reactor.

  20. Fast breeder reactor protection system

    Science.gov (United States)

    van Erp, J.B.

    1973-10-01

    Reactor protection is provided for a liquid-metal-fast breeder reactor core by measuring the coolant outflow temperature from each of the subassemblies of the core. The outputs of the temperature sensors from a subassembly region of the core containing a plurality of subassemblies are combined in a logic circuit which develops a scram alarm if a predetermined number of the sensors indicate an over temperature condition. The coolant outflow from a single subassembly can be mixed with the coolant outflow from adjacent subassemblies prior to the temperature sensing to increase the sensitivity of the protection system to a single subassembly failure. Coherence between the sensors can be required to discriminate against noise signals. (Official Gazette)

  1. Reactor vessel lower head integrity

    Energy Technology Data Exchange (ETDEWEB)

    Rubin, A.M.

    1997-02-01

    On March 28, 1979, the Three Mile Island Unit 2 (TMI-2) nuclear power plant underwent a prolonged small break loss-of-coolant accident that resulted in severe damage to the reactor core. Post-accident examinations of the TMI-2 reactor core and lower plenum found that approximately 19,000 kg (19 metric tons) of molten material had relocated onto the lower head of the reactor vessel. Results of the OECD TMI-2 Vessel Investigation Project concluded that a localized hot spot of approximately 1 meter diameter had existed on the lower head. The maximum temperature on the inner surface of the reactor pressure vessel (RPV) in this region reached 1100{degrees}C and remained at that temperature for approximately 30 minutes before cooling occurred. Even under the combined loads of high temperature and high primary system pressure, the TMI-2 RPV did not fail. (i.e. The pressure varied from about 8.5 to 15 MPa during the four-hour period following the relocation of melt to the lower plenum.) Analyses of RPV failure under these conditions, using state-of-the-art computer codes, predicted that the RPV should have failed via local or global creep rupture. However, the vessel did not fail; and it has been hypothesized that rapid cooling of the debris and the vessel wall by water that was present in the lower plenum played an important role in maintaining RPV integrity during the accident. Although the exact mechanism(s) of how such cooling occurs is not known, it has been speculated that cooling in a small gap between the RPV wall and the crust, and/or in cracks within the debris itself, could result in sufficient cooling to maintain RPV integrity. Experimental data are needed to provide the basis to better understand these phenomena and improve models of RPV failure in severe accident codes.

  2. The ARIES tokamak reactor study

    Energy Technology Data Exchange (ETDEWEB)

    1989-10-01

    The ARIES study is a community effort to develop several visions of tokamaks as fusion power reactors. The aims are to determine the potential economics, safety, and environmental features of a range of possible tokamak reactors, and to identify physics and technology areas with the highest leverage for achieving the best tokamak reactor. Three ARIES visions are planned, each having a different degree of extrapolation from the present data base in physics and technology. The ARIES-I design assumes a minimum extrapolation from current tokamak physics (e.g., 1st stability) and incorporates technological advances that can be available in the next 20 to 30 years. ARIES-II is a DT-burning tokamak which would operate at a higher beta in the 2nd MHD stability regime. It employs both potential advances in the physics and expected advances in technology and engineering. ARIES-II will examine the potential of the tokamak and the D{sup 3}He fuel cycle. This report is a collection of 14 papers on the results of the ARIES study which were presented at the IEEE 13th Symposium on Fusion Engineering (October 2-6, 1989, Knoxville, TN). This collection describes the ARIES research effort, with emphasis on the ARIES-I design, summarizing the major results, the key technical issues, and the central conclusions.

  3. Actinide transmutation in nuclear reactors

    Energy Technology Data Exchange (ETDEWEB)

    Bultman, J.H.

    1995-01-17

    An optimization method is developed to maximize the burning capability of the ALMR while complying with all constraints imposed on the design for reliability and safety. This method leads to a maximal transuranics enrichment, which is being limited by constraints on reactivity. The enrichment can be raised by using the neutrons less efficiently by increasing leakage from the fuel. With the developed optimization method, a metallic and an oxide fueled ALMR were optimized. Both reactors perform equally well considering the burning of transuranics. However, metallic fuel has a much higher heat conductivity coefficient, which in general leads to better safety characteristics. In search of a more effective waste transmuter, a modified Molten Salt Reactor was designed. A MSR operates on a liquid fuel salt which makes continuous refueling possible, eliminating the issue of the burnup reactivity loss. Also, a prompt negative reactivity feedback is possible for an overmoderated reactor design, even when the Doppler coefficient is positive, due to the fuel expansion with fuel temperature increase. Furthermore, the molten salt fuel can be reprocessed based on a reduction process which is not sensitive to the short-lived spontaneously fissioning actinides. (orig./HP).

  4. Assessment of the thorium fuel cycle in power reactors

    Energy Technology Data Exchange (ETDEWEB)

    Kasten, P.R.; Homan, F.J.; Allen, E.J.

    1977-01-01

    A study was conducted at Oak Ridge National Laboratory to evaluate the role of thorium fuel cycles in power reactors. Three thermal reactor systems were considered: Light Water Reactors (LWRs); High-Temperature Gas-Cooled Reactors (HTGRs); and Heavy Water Reactors (HWRs) of the Canadian Deuterium Uranium Reactor (CANDU) type; most of the effort was on these systems. A summary comparing thorium and uranium fuel cycles in Fast Breeder Reactors (FBRs) was also compiled.

  5. Advanced Safeguards Approaches for New Fast Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Durst, Philip C.; Therios, Ike; Bean, Robert; Dougan, A.; Boyer, Brian; Wallace, Rick L.; Ehinger, Michael H.; Kovacic, Don N.; Tolk, K.

    2007-12-15

    This third report in the series reviews possible safeguards approaches for new fast reactors in general, and the ABR in particular. Fast-neutron spectrum reactors have been used since the early 1960s on an experimental and developmental level, generally with fertile blanket fuels to “breed” nuclear fuel such as plutonium. Whether the reactor is designed to breed plutonium, or transmute and “burn” actinides depends mainly on the design of the reactor neutron reflector and the whether the blanket fuel is “fertile” or suitable for transmutation. However, the safeguards issues are very similar, since they pertain mainly to the receipt, shipment and storage of fresh and spent plutonium and actinide-bearing “TRU”-fuel. For these reasons, the design of existing fast reactors and details concerning how they have been safeguarded were studied in developing advanced safeguards approaches for the new fast reactors. In this regard, the design of the Experimental Breeder Reactor-II “EBR-II” at the Idaho National Laboratory (INL) was of interest, because it was designed as a collocated fast reactor with a pyrometallurgical reprocessing and fuel fabrication line – a design option being considered for the ABR. Similarly, the design of the Fast Flux Facility (FFTF) on the Hanford Site was studied, because it was a successful prototype fast reactor that ran for two decades to evaluate fuels and the design for commercial-scale fast reactors.

  6. Investigation of molten salt fast reactor

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Kenichi; Konomura, Mamoru [Japan Nuclear Cycle Development Inst., Tokai, Ibaraki (Japan)

    2002-05-01

    On survey research for practicability strategy of fast reactor (FR) (phase 1), to extract future practicability image candidates of FR from wide options, in addition to their survey and investigation objects of not only solid fuel reactors of conventional research object but also molten salt reactor as a flowing fuel reactor, investigation on concept of molten salt FR plant was carried out. As a part of the first step of the survey research for practicability strategy, a basic concept on plant centered at nuclear reactor facility using chloride molten salt reactor capable of carrying out U-Pu cycle was examined, to perform a base construction to evaluate economical potential for a practical FBR. As a result, a result could be obtained that because of inferior fuel inventory and heat transmission to those in Na cooling reactor in present knowledge, mass of reactor vessel and intermediate heat exchanger were to widely increased to expect reduction of power generation unit price even on considering cheapness of its fuel cycle cost. Therefore, at present step further investigation on concept design of the chloride molten salt reactor plant system is too early in time, and it is at a condition where basic and elementary researches aiming at upgrading of economical efficiency such as wide reduction of fuel inventory, a measure expectable for remarkable rationalization effect of reprocessing system integrating a reactor to a processing facility, and so on. (G.K.)

  7. Performance of a multipurpose research electrochemical reactor

    Energy Technology Data Exchange (ETDEWEB)

    Henquin, E.R. [Programa de Electroquimica Aplicada e Ingenieria Electroquimica (PRELINE), Facultad de Ingenieria Quimica, Universidad Nacional del Litoral, Santiago del Estero 2829, S3000AOM Santa Fe (Argentina); Bisang, J.M., E-mail: jbisang@fiq.unl.edu.ar [Programa de Electroquimica Aplicada e Ingenieria Electroquimica (PRELINE), Facultad de Ingenieria Quimica, Universidad Nacional del Litoral, Santiago del Estero 2829, S3000AOM Santa Fe (Argentina)

    2011-07-01

    Highlights: > For this reactor configuration the current distribution is uniform. > For this reactor configuration with bipolar connection the leakage current is small. > The mass-transfer conditions are closely uniform along the electrode. > The fluidodynamic behaviour can be represented by the dispersion model. > This reactor represents a suitable device for laboratory trials. - Abstract: This paper reports on a multipurpose research electrochemical reactor with an innovative design feature, which is based on a filter press arrangement with inclined segmented electrodes and under a modular assembly. Under bipolar connection, the fraction of leakage current is lower than 4%, depending on the bipolar Wagner number, and the current distribution is closely uniform. When a turbulence promoter is used, the local mass-transfer coefficient shows a variation of {+-}10% with respect to its mean value. The fluidodynamics of the reactor responds to the dispersion model with a Peclet number higher than 10. It is concluded that this reactor is convenient for laboratory research.

  8. Molten-Salt Depleted-Uranium Reactor

    CERN Document Server

    Dong, Bao-Guo; Gu, Ji-Yuan

    2015-01-01

    The supercritical, reactor core melting and nuclear fuel leaking accidents have troubled fission reactors for decades, and greatly limit their extensive applications. Now these troubles are still open. Here we first show a possible perfect reactor, Molten-Salt Depleted-Uranium Reactor which is no above accident trouble. We found this reactor could be realized in practical applications in terms of all of the scientific principle, principle of operation, technology, and engineering. Our results demonstrate how these reactors can possess and realize extraordinary excellent characteristics, no prompt critical, long-term safe and stable operation with negative feedback, closed uranium-plutonium cycle chain within the vessel, normal operation only with depleted-uranium, and depleted-uranium high burnup in reality, to realize with fission nuclear energy sufficiently satisfying humanity long-term energy resource needs, as well as thoroughly solve the challenges of nuclear criticality safety, uranium resource insuffic...

  9. Sulfide toxicity kinetics of a uasb reactor

    Directory of Open Access Journals (Sweden)

    D. R. Paula Jr.

    2009-12-01

    Full Text Available The effect of sulfide toxicity on kinetic parameters of anaerobic organic matter removal in a UASB (up-flow anaerobic sludge blanket reactor is presented. Two lab-scale UASB reactors (10.5 L were operated continuously during 12 months. The reactors were fed with synthetic wastes prepared daily using glucose, ammonium acetate, methanol and nutrient solution. One of the reactors also received increasing concentrations of sodium sulfide. For both reactors, the flow rate of 16 L.d-1 was held constant throughout the experiment, corresponding to a hydraulic retention time of 15.6 hours. The classic model for non-competitive sulfide inhibition was applied to the experimental data for determining the overall kinetic parameter of specific substrate utilization (q and the sulfide inhibition coefficient (Ki. The application of the kinetic parameters determined allows prediction of methanogenesis inhibition and thus the adoption of operating parameters to minimize sulfide toxicity in UASB reactors.

  10. Introduction to the neutron kinetics of nuclear power reactors

    CERN Document Server

    Tyror, J G; Grant, P J

    2013-01-01

    An Introduction to the Neutron Kinetics of Nuclear Power Reactors introduces the reader to the neutron kinetics of nuclear power reactors. Topics covered include the neutron physics of reactor kinetics, feedback effects, water-moderated reactors, fast reactors, and methods of plant control. The reactor transients following faults are also discussed, along with the use of computers in the study of power reactor kinetics. This book is comprised of eight chapters and begins with an overview of the reactor physics characteristics of a nuclear power reactor and their influence on system design and

  11. Microstructured reactors for hydrogen production

    Energy Technology Data Exchange (ETDEWEB)

    Aartun, Ingrid

    2005-07-01

    Small scale hydrogen production by partial oxidation (POX) and oxidative steam reforming (OSR) have been studied over Rh-impregnated microchannel Fecralloy reactors and alumina foams. Trying to establish whether metallic microchannel reactors have special advantages for hydrogen production via catalytic POX or OSR with respect to activity, selectivity and stability was of special interest. The microchannel Fecralloy reactors were oxidised at 1000 deg C to form a {alpha}-Al2O3 layer in the channels in order to enhance the surface area prior to impregnation. Kr-BET measurements showed that the specific surface area after oxidation was approximately 10 times higher than the calculated geometric surface area. Approximately 1 mg Rh was deposited in the channels by impregnation with an aqueous solution of RhCl3. Annular pieces (15 mm o.d.,4 mm i.d., 14 mm length) of extruded {alpha}-Al2O3 foams were impregnated with aqueous solutions of Rh(NO3)3 to obtain 0.01, 0.05 and 0.1 wt.% loadings, as predicted by solution uptake. ICP-AES analyses showed that the actual Rh loadings probably were higher, 0.025, 0.077 and 0.169 wt.% respectively. One of the microchannel Fecralloy reactors and all Al2O3 foams were equipped with a channel to allow for temperature measurement inside the catalytic system. Temperature profiles obtained along the reactor axes show that the metallic microchannel reactor is able to minimize temperature gradients as compared to the alumina foams. At sufficiently high furnace temperature, the gas phase in front of the Rh/Al2O3/Frecralloy microchannel reactor and the 0.025 wt.% Rh/Al2O3 foams ignites. Gas phase ignition leads to lower syngas selectivity and higher selectivity to total oxidation products and hydrocarbon by-products. Before ignition of the gas phase the hydrogen selectivity is increased in OSR as compared to POX, the main contribution being the water-gas shift reaction. After gas phase ignition, increased formation of hydrocarbon by

  12. Reactor Bolshoi Moshchnosti Kalani; Reacteurs RBMK

    Energy Technology Data Exchange (ETDEWEB)

    Bastien, D. [Conservatoire National des Arts et Metiers (CNAM), 75 - Paris (France)

    2000-01-01

    The Reactor Bolshoi Molshchnosti Kalani (RBMK) are pressure tubes reactor, boiling light water cooled. Exported since 1990 from the ex-USSR, they are today in three independent countries: Russian, Ukraine and Lithuania. Since this date, data exchange with the occident allowed the better knowledge of this reactor type. The design, the technical description (core, fuel, primary system), the safety and the improvement since Chernobyl are detailed. (A.L.B.)

  13. D-D tokamak reactor studies

    Energy Technology Data Exchange (ETDEWEB)

    Evans, K.E. Jr.; Baker, C.C.; Brooks, J.N.; Ehst, D.A.; Finn, P.A.; Jung, J.; Mattas, R.F.; Misra, B.; Smith, D.L.; Stevens, H.C.

    1980-11-01

    A tokamak D-D reactor design, utilizing the advantages of a deuterium-fueled reactor but with parameters not unnecessarily extended from existing D-T designs, is presented. Studies leading to the choice of a design and initial studies of the design are described. The studies are in the areas of plasma engineering, first-wall/blanket/shield design, magnet design, and tritium/fuel/vacuum requirements. Conclusions concerning D-D tokamak reactors are stated.

  14. NASA Reactor Facility Hazards Summary. Volume 1

    Science.gov (United States)

    1959-01-01

    The Lewis Research Center of the National Aeronautics and Space Administration proposes to build a nuclear research reactor which will be located in the Plum Brook Ordnance Works near Sandusky, Ohio. The purpose of this report is to inform the Advisory Committee on Reactor Safeguards of the U. S. Atomic Energy Commission in regard to the design Lq of the reactor facility, the characteristics of the site, and the hazards of operation at this location. The purpose of this research reactor is to make pumped loop studies of aircraft reactor fuel elements and other reactor components, radiation effects studies on aircraft reactor materials and equipment, shielding studies, and nuclear and solid state physics experiments. The reactor is light water cooled and moderated of the MTR-type with a primary beryllium reflector and a secondary water reflector. The core initially will be a 3 by 9 array of MTR-type fuel elements and is designed for operation up to a power of 60 megawatts. The reactor facility is described in general terms. This is followed by a discussion of the nuclear characteristics and performance of the reactor. Then details of the reactor control system are discussed. A summary of the site characteristics is then presented followed by a discussion of the larger type of experiments which may eventually be operated in this facility. The considerations for normal operation are concluded with a proposed method of handling fuel elements and radioactive wastes. The potential hazards involved with failures or malfunctions of this facility are considered in some detail. These are examined first from the standpoint of preventing them or minimizing their effects and second from the standpoint of what effect they might have on the reactor facility staff and the surrounding population. The most essential feature of the design for location at the proposed site is containment of the maximum credible accident.

  15. Plasma spark discharge reactor and durable electrode

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Young I.; Cho, Daniel J.; Fridman, Alexander; Kim, Hyoungsup

    2017-01-10

    A plasma spark discharge reactor for treating water. The plasma spark discharge reactor comprises a HV electrode with a head and ground electrode that surrounds at least a portion of the HV electrode. A passage for gas may pass through the reactor to a location proximate to the head to provide controlled formation of gas bubbles in order to facilitate the plasma spark discharge in a liquid environment.

  16. Heat for industry from nuclear reactors

    Energy Technology Data Exchange (ETDEWEB)

    Kikoin, I.K.; Novikov, V.M.

    Two factors which incline nations toward the use of heat from nuclear reactors for industrial use are: 1) exhaustion of cheap fossil fuel resources, and 2) ecological problems associated both with extraction of fossil fuel from the earth and with its combustion. In addition to the usual problems that beset nuclear reactors, special problems associated with using heat from nuclear reactors in various industries are explored.

  17. Experimental Breeder Reactor I Preservation Plan

    Energy Technology Data Exchange (ETDEWEB)

    Julie Braun

    2006-10-01

    Experimental Breeder Reactor I (EBR I) is a National Historic Landmark located at the Idaho National Laboratory, a Department of Energy laboratory in southeastern Idaho. The facility is significant for its association and contributions to the development of nuclear reactor testing and development. This Plan includes a structural assessment of the interior and exterior of the EBR I Reactor Building from a preservation, rather than an engineering stand point and recommendations for maintenance to ensure its continued protection.

  18. Initiating Events for Multi-Reactor Plant Sites

    Energy Technology Data Exchange (ETDEWEB)

    Muhlheim, Michael David [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Flanagan, George F. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Poore, III, Willis P. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2014-09-01

    Inherent in the design of modular reactors is the increased likelihood of events that initiate at a single reactor affecting another reactor. Because of the increased level of interactions between reactors, it is apparent that the Probabilistic Risk Assessments (PRAs) for modular reactor designs need to specifically address the increased interactions and dependencies.

  19. Advances in light water reactor technologies

    CERN Document Server

    Saito, Takehiko; Ishiwatari, Yuki; Oka, Yoshiaki

    2010-01-01

    ""Advances in Light Water Reactor Technologies"" focuses on the design and analysis of advanced nuclear power reactors. This volume provides readers with thorough descriptions of the general characteristics of various advanced light water reactors currently being developed worldwide. Safety, design, development and maintenance of these reactors is the main focus, with key technologies like full MOX core design, next-generation digital I&C systems and seismic design and evaluation described at length. This book is ideal for researchers and engineers working in nuclear power that are interested

  20. High Performance Photocatalytic Oxidation Reactor System Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Pioneer Astronautics proposes a technology program for the development of an innovative photocatalytic oxidation reactor for the removal and mineralization of...

  1. NCSU reactor sharing program. Final technical report

    Energy Technology Data Exchange (ETDEWEB)

    Perez, P.B.

    1997-01-10

    The Nuclear Reactor Program at North Carolina State University provides the PULSTAR Research Reactor and associated facilities to eligible institutions with support, in part, from the Department of Energy Reactor Sharing Program. Participation in the NCSU Reactor Sharing Program continues to increase steadily with visitors ranging from advance high school physics and chemistry students to Ph.D. level research from neighboring universities. This report is the Final Technical Report for the DOE award reference number DE-FG05-95NE38136 which covers the period September 30, 1995 through September 30, 1996.

  2. Nanostructured Catalytic Reactors for Air Purification Project

    Data.gov (United States)

    National Aeronautics and Space Administration — This SBIR Phase I project proposes the development of lightweight compact nanostructured catalytic reactors for air purification from toxic gaseous organic...

  3. Nanostructured Catalytic Reactors for Air Purification Project

    Data.gov (United States)

    National Aeronautics and Space Administration — This SBIR Phase II project proposes the development of lightweight compact nanostructured catalytic reactors for air purification from toxic gaseous organic...

  4. Advanced nuclear reactor types and technologies

    Energy Technology Data Exchange (ETDEWEB)

    Ignatiev, V. [ed.; Feinberg, O.; Morozov, A. [Russian Research Centre `Kurchatov Institute`, Moscow (Russian Federation); Devell, L. [Studsvik Eco and Safety AB, Nykoeping (Sweden)

    1995-07-01

    The document is a comprehensive world-wide catalogue of concepts and designs of advanced fission reactor types and fuel cycle technologies. Two parts have been prepared: Part 1 Reactors for Power Production and Part 2 Heating and Other Reactor Applications. Part 3, which will cover advanced waste management technology, reprocessing and disposal for different nuclear fission options is planned for compilation during 1995. The catalogue was prepared according to a special format which briefly presents the project title, technical approach, development status, application of the technology, reactor type, power output, and organization which developed these designs. Part 1 and 2 cover water cooled reactors, liquid metal fast reactors, gas-cooled reactors and molten salt reactors. Subcritical accelerator-driven systems are also considered. Various reactor applications as power production, heat generation, ship propulsion, space power sources and transmutation of such waste are included. Each project is described within a few pages with the main features of an actual design using a table with main technical data and figure as well as references for additional information. Each chapter starts with an introduction which briefly describes main trends and approaches in this field. Explanations of terms and abbreviations are provided in a glossary.

  5. Neutron imaging on the VR-1 reactor

    Science.gov (United States)

    Crha, J.; Sklenka, L.; Soltes, J.

    2016-09-01

    Training reactor VR-1 is a low power research reactor with maximal thermal power of 1 kW. The reactor is operated by the Faculty of Nuclear Science and Physical Engineering of the Czech Technical University in Prague. Due to its low power it suits as a tool for education of university students and training of professionals. In 2015, as part of student research project, neutron imaging was introduced as another type of reactor utilization. The low available neutron flux and the limiting spatial and construction capabilities of the reactor's radial channel led to the development of a special filter/collimator insertion inside the channel and choosing a nonstandard approach by placing a neutron imaging plate inside the channel. The paper describes preliminary experiments carried out on the VR-1 reactor which led to first radiographic images. It seems, that due to the reactor construction and low reactor power, the neutron imaging technique on the VR-1 reactor is feasible mainly for demonstration or educational and training purposes.

  6. Supercritical-pressure light water cooled reactors

    CERN Document Server

    Oka, Yoshiaki

    2014-01-01

    This book focuses on the latest reactor concepts, single pass core and experimental findings in thermal hydraulics, materials, corrosion, and water chemistry. It highlights research on supercritical-pressure light water cooled reactors (SCWRs), one of the Generation IV reactors that are studied around the world. This book includes cladding material development and experimental findings on heat transfer, corrosion and water chemistry. The work presented here will help readers to understand the fundamental elements of reactor design and analysis methods, thermal hydraulics, materials and water

  7. BOILING SLURRY REACTOR AND METHOD FO CONTROL

    Science.gov (United States)

    Petrick, M.; Marchaterre, J.F.

    1963-05-01

    The control of a boiling slurry nuclear reactor is described. The reactor consists of a vertical tube having an enlarged portion, a steam drum at the top of the vertical tube, and at least one downcomer connecting the steam drum and the bottom of the vertical tube, the reactor being filled with a slurry of fissionabie material in water of such concentration that the enlarged portion of the vertical tube contains a critical mass. The slurry boils in the vertical tube and circulates upwardly therein and downwardly in the downcomer. To control the reactor by controlling the circulation of the slurry, a gas is introduced into the downcomer. (AEC)

  8. Sodium fast reactors with closed fuel cycle

    CERN Document Server

    Raj, Baldev; Vasudeva Rao, PR 0

    2015-01-01

    Sodium Fast Reactors with Closed Fuel Cycle delivers a detailed discussion of an important technology that is being harnessed for commercial energy production in many parts of the world. Presenting the state of the art of sodium-cooled fast reactors with closed fuel cycles, this book:Offers in-depth coverage of reactor physics, materials, design, safety analysis, validations, engineering, construction, and commissioning aspectsFeatures a special chapter on allied sciences to highlight advanced reactor core materials, specialized manufacturing technologies, chemical sensors, in-service inspecti

  9. Microchannel Methanation Reactors Using Nanofabricated Catalysts Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Makel Engineering, Inc. (MEI) and the Pennsylvania State University (Penn State) propose to develop and demonstrate a microchannel methanation reactor based on...

  10. Phosphorus removal in aerated stirred tank reactor

    Energy Technology Data Exchange (ETDEWEB)

    Ghigliazza, R.; Lodi, A.; Rovatti, M. [Inst. of Chemical and Process Engineering ``G.B. Bonino``, Univ. of Genoa (Italy)

    1999-03-01

    The possibility to obtain biological phosphorus removal in strictly aerobic conditions has been investigated. Experiments, carried out in a continuous stirred tank reactor (CSTR), show the feasibility to obtain phosphorus removal without the anaerobic phase. Reactor performance in terms of phosphorus abatement kept always higher then 65% depending on adopted sludge retention time (SRT). In fact increasing SRT from 5 days to 8 days phosphorus removal and reactor performance increase but overcoming this SRT value a decreasing in reactor efficiency was recorded. (orig.) With 6 figs., 3 tabs., 18 refs.

  11. Savannah River Site reactor safety assessment. Draft

    Energy Technology Data Exchange (ETDEWEB)

    Woody, N.D.; Brandyberry, M.D. [eds.] [Westinghouse Savannah River Co., Aiken, SC (United States); Baker, W.H.; Brandyberry, M.D.; Kearnaghan, D.P.; O`Kula, K.R.; Woody, N.D. [Westinghouse Savannah River Co., Aiken, SC (United States); Amos, C.N.; Weingardt, J.J. [Science Applications International Corp., San Diego, CA (United States)

    1991-02-28

    This report gives the results of a Savannah River Site (SRS) Production Reactor risk assessment. Measures of adverse consequences to health and safety resulting from representations of severe accidents in SRS reactors are presented. In addition, the report gives a summary of the methods employed to represent these accidents and to assess the resultant consequences. The report is issued to provide timely information to the US Department of Energy (DOE) on the risk of operation of SRS reactors, for insights into severe accident phenomena that contribute to this risk, and in support of improved bases for other Site programs in Heavy Water Reactor safety.

  12. History of fast reactor fuel development

    Energy Technology Data Exchange (ETDEWEB)

    Kittel, J.H.; Frost, B.R.T. (Argonne National Lab., IL (United States)); Mustelier, J.P. (COGEMA, Velizy-Villacoublay (France))

    1992-01-01

    Most of the first generation of fast reactors that were operated at significant power levels employed solid metal fuels. They were constructed in the United States and United Kingdom in the 1950s and included Experimental Breeder Reactor (EBR)-I and -II operated by Argonne National Laboratory, United States, the Enrico Fermi Reactor operated by the Atomic Power Development Associates, United States and DFR operated by the U.K. Atomic Energy Authority (UKAEA). Their paper tracer pre-development of fast reactor fuel from these early days through the 1980s including ceramic fuels.

  13. Plant maintenance and advanced reactors, 2006

    Energy Technology Data Exchange (ETDEWEB)

    Agnihotri, Newal (ed.)

    2006-09-15

    The focus of the September-October issue is on plant maintenance and advanced reactors. Major articles/reports in this issue include: Advanced plants to meet rising expectations, by John Cleveland, International Atomic Energy Agency, Vienna; A flexible and economic small reactor, by Mario D. Carelli and Bojan Petrovic, Westinghouse Electric Company; A simple and passively safe reactor, by Yury N. Kuznetsov, Research and Development Institute of Power Engineering (NIKIET), Russia; Gas-cooled reactors, by Jeffrey S. Merrifield, U.S. Nuclear Regulatory Commission; ISI project managment in the PRC, by Chen Chanbing, RINPO, China; and, Fort Calhoun refurbishment, by Sudesh Cambhir, Omaha Public Power District.

  14. Usage of burnable poison on research reactors

    Energy Technology Data Exchange (ETDEWEB)

    Villarino, Eduardo Anibal [INVAP S.E., San Carlos de Bariloche (Argentina)

    2002-07-01

    The fuel assemblies with burnable poison are widely used on power reactors, but there are not commonly used on research reactors. This paper shows a neutronic analysis of the advantages and disadvantages of the burnable poison usage on research reactors. This paper analyses both burnable poison design used on research reactors: Boron on the lateral wall and Cadmium wires. Both designs include a parametric study on the design parameters like the amount and geometry of the burnable poison. This paper presents the design flexibility using burnable poisons, it does not find an optimal or final design, which it will strongly depend on the core characteristics and fuel management strategy. (author)

  15. Autonomous Control of Space Nuclear Reactors Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Nuclear reactors to support future robotic and manned missions impose new and innovative technological requirements for their control and protection instrumentation....

  16. Continuous steroid biotransformations in microchannel reactors.

    Science.gov (United States)

    Marques, Marco P C; Fernandes, Pedro; Cabral, Joaquim M S; Znidaršič-Plazl, Polona; Plazl, Igor

    2012-01-15

    The use of microchannel reactor based technologies within the scope of bioprocesses as process intensification and production platforms is gaining momentum. Such trend can be ascribed a particular set of characteristics of microchannel reactors, namely the enhanced mass and heat transfer, combined with easier handling and smaller volumes required, as compared to traditional reactors. In the present work, a continuous production process of 4-cholesten-3-one by the enzymatic oxidation of cholesterol without the formation of any by-product was assessed. The production was carried out within Y-shaped microchannel reactors in an aqueous-organic two-phase system. Substrate was delivered from the organic phase to aqueous phase containing cholesterol oxidase and the product formed partitions back to the organic phase. The aqueous phase was then forced through a plug-flow reactor, containing immobilized catalase. This step aimed at the reduction of hydrogen peroxide formed as a by-product during cholesterol oxidation, to avoid cholesterol oxidase deactivation due to said by-product. This setup was compared with traditional reactors and modes of operation. The results showed that microchannel reactor geometry outperformed traditional stirred tank and plug-flow reactors reaching similar conversion yields at reduced residence time. Coupling the plug-flow reactor containing catalase enabled aqueous phase reuse with maintenance of 30% catalytic activity of cholesterol oxidase while eliminating hydrogen peroxide. A final production of 36 m of cholestenone was reached after 300 hours of operation.

  17. Application of the ABEEM/MM model in studying the properties of the water clusters(H2O)n(n=7-10

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    ABEEM/MM model has been applied to compute the various properties characterizing water clusters(H2O) n(n = 7-10) ,such as optimized geometries,the hydrogen bonds number,cluster interaction en-ergies,stabilities,ABEEM charge distributions,dipole moments,structural parameters,and so on,and to describe the transition reflected by the hexamer region from two-dimensional(from dimer to pen-tamer) to three-dimensional structures(for clusters larger than the hexamer) .

  18. Spheromak reactor-design study

    Energy Technology Data Exchange (ETDEWEB)

    Les, J.M.

    1981-06-30

    A general overview of spheromak reactor characteristics, such as MHD stability, start up, and plasma geometry is presented. In addition, comparisons are made between spheromaks, tokamaks and field reversed mirrors. The computer code Sphero is also discussed. Sphero is a zero dimensional time independent transport code that uses particle confinement times and profile parameters as input since they are not known with certainty at the present time. More specifically, Sphero numerically solves a given set of transport equations whose solutions include such variables as fuel ion (deuterium and tritium) density, electron density, alpha particle density and ion, electron temperatures.

  19. Reactors for nuclear electric propulsion

    Energy Technology Data Exchange (ETDEWEB)

    Buden, D.; Angelo, J.A. Jr.

    1981-01-01

    Propulsion is the key to space exploitation and power is the key to propulsion. This paper examines the role of nuclear fission reactors as the primary power source for high specific impulse electric propulsion systems for space missions of the 1980s and 1990s. Particular mission applications include transfer to and a reusable orbital transfer vehicle from low-Earth orbit to geosynchronous orbit, outer planet exploration and reconnaissance missions, and as a versatile space tug supporting lunar resource development. Nuclear electric propulsion is examined as an indispensable component in space activities of the next two decades.

  20. K-East and K-West Reactors

    Data.gov (United States)

    Federal Laboratory Consortium — Hanford's "sister reactors", the K-East and the K-West Reactors, were built side-by-side in the early 1950's. The two reactors went operational within four months of...

  1. Research on plasma core reactors

    Energy Technology Data Exchange (ETDEWEB)

    Jarvis, G.A.; Barton, D.M.; Helmick, H.H.; Bernard, W.; White, R.H.

    1977-01-01

    Experiments and theoretical studies are being conducted for NASA on critical assemblies with 1-m-diam by 1-m-long low-density cores surrounded by a thick beryllium reflector. These assemblies make extensive use of existing nuclear propulsion reactor components, facilities, and instrumentation. Due to excessive porosity in the reflector, the initial critical mass was 19 kg U(93.2). Addition of a 17-cm-thick by 89-cm-diam beryllium flux trap in the cavity reduced the critical mass to 7 kg when all the uranium was in the zone just outside the flux trap. A mockup aluminum UF/sub 6/ container was placed inside the flux trap and fueled with uranium-graphite elements. Fission distributions and reactivity worths of fuel and structural materials were measured. Finally, an 85,000-cm/sup 3/ aluminum canister in the central region was fueled with UF/sub 6/ gas and fission density distributions determined. These results will be used to guide the design of a prototype plasma core reactor which will test energy removal by optical radiation.

  2. Compound cryopump for fusion reactors

    CERN Document Server

    Kovari, M; Shephard, T

    2013-01-01

    We reconsider an old idea: a three-stage compound cryopump for use in fusion reactors such as DEMO. The helium "ash" is adsorbed on a 4.5 K charcoal-coated surface, while deuterium and tritium are adsorbed at 15-22 K on a second charcoal-coated surface. The helium is released by raising the first surface to ~30 K. In a separate regeneration step, deuterium and tritium are released at ~110 K. In this way, the helium can be pre-separated from other species. In the simplest design, all three stages are in the same vessel, with a single valve to close the pump off from the tokamak during regeneration. In an alternative design, the three stages are in separate vessels, connected by valves, allowing the stages to regenerate without interfering with each other. The inclusion of the intermediate stage would not affect the overall pumping speed significantly. The downstream exhaust processing system could be scaled down, as much of the deuterium and tritium could be returned directly to the reactor. This could reduce ...

  3. Dissecting Reactor Antineutrino Flux Calculations

    Science.gov (United States)

    Sonzogni, A. A.; McCutchan, E. A.; Hayes, A. C.

    2017-09-01

    Current predictions for the antineutrino yield and spectra from a nuclear reactor rely on the experimental electron spectra from 235U, 239Pu, 241Pu and a numerical method to convert these aggregate electron spectra into their corresponding antineutrino ones. In the present work we investigate quantitatively some of the basic assumptions and approximations used in the conversion method, studying first the compatibility between two recent approaches for calculating electron and antineutrino spectra. We then explore different possibilities for the disagreement between the measured Daya Bay and the Huber-Mueller antineutrino spectra, including the 238U contribution as well as the effective charge and the allowed shape assumption used in the conversion method. We observe that including a shape correction of about +6 % MeV-1 in conversion calculations can better describe the Daya Bay spectrum. Because of a lack of experimental data, this correction cannot be ruled out, concluding that in order to confirm the existence of the reactor neutrino anomaly, or even quantify it, precisely measured electron spectra for about 50 relevant fission products are needed. With the advent of new rare ion facilities, the measurement of shape factors for these nuclides, for many of which precise beta intensity data from TAGS experiments already exist, would be highly desirable.

  4. A new MTR fuel for a new MTR reactor: UMo for the Jules Horowitz reactor

    Energy Technology Data Exchange (ETDEWEB)

    Guigon, B. [CEA Cadarache, Dir. de l' Energie Nucleaire DEN, Reacteur Jules Horowitz, 13 - Saint-Paul-lez-Durance (France); Vacelet, H. [Compagnie pour l' Etude et la Realisation de Combustibles Atomiques, CERCA, Etablissement de Romans, 26 (France); Dornbusch, D. [Technicatome, Service d' Architecture Generale, 13 - Aix-en-Provence (France)

    2003-07-01

    Within some years, the Jules Horowitz Reactor will be the only working experimental reactor (material and fuel testing reactor) in France. It will have to provide facilities for a wide range of needs: from activation analysis to power reactor fuel qualification. In this paper will be presented the main characteristics of the Jules Horowitz Reactor: its total power, neutron flux, fuel element... Safety criteria will be explained. Finally merits and disadvantages of UMo compared to the standard U{sub 3}Si{sub 2} fuel will be discussed. (authors)

  5. Annual report on JEN-1 reactor; Informe periodico del Reactor JEN-1 correspondiente al ano 1971

    Energy Technology Data Exchange (ETDEWEB)

    Montes, J.

    1972-07-01

    In the annual report on the JEN-1 reactor the main features of the reactor operations and maintenance are described. The reactor has been critical for 1831 hours, what means 65,8% of the total working time. Maintenance and pool water contamination have occupied the rest of the time. The maintenance schedule is shown in detail according to three subjects. The main failures and reactor scrams are also described. The daily maximum values of the water activity are given so as the activity of the air in the reactor hall. (Author)

  6. Mathematical Modeling for Simulation of Nuclear Reactor Analysis

    OpenAIRE

    Salah Ud-Din Khan; Shahab Ud-Din Khan

    2013-01-01

    In this paper, we have developed a mathematical model for the nuclear reactor analysis to be implemented in the nuclear reactor code. THEATRe is nuclear reactor analysis code which can only work for the cylindrical type fuel reactor and cannot applicable for the plate type fuel nuclear reactor. Therefore, the current studies encompasses on the modification of THEATRe code for the plate type fuel element. This mathematical model is applicable to the thermal analysis of the reactor which is ver...

  7. Parametric sensitivity and runaway in tubular reactors

    Energy Technology Data Exchange (ETDEWEB)

    Morbidelli, M.; Varma, A.

    1982-09-01

    Parametric sensitivity of tubular reactors is analyzed to provide critical values of the heat of reaction and heat transfer parameters defining runaway and stable operations for all positive-order exothermic reactions with finite activation energies, and for all reactor inlet temperatures. Evaluation of the critical values does not involve any trial and error.

  8. Design of an organic simplified nuclear reactor

    Energy Technology Data Exchange (ETDEWEB)

    Shirvan, Koroush [Dept. of Nuclear Science and Engineering, Massachusetts Institute of Technology, Cambridge (United States); Forrest, Eric [Primary Standards Laboratory, Sandia National Laboratories, Albuquerque (United States)

    2016-08-15

    Numerous advanced reactor concepts have been proposed to replace light water reactors ever since their establishment as the dominant technology for nuclear energy production. While most designs seek to improve cost competitiveness and safety, the implausibility of doing so with affordable materials or existing nuclear fuel infrastructure reduces the possibility of near-term deployment, especially in developing countries. The organic nuclear concept, first explored in the 1950s, offers an attractive alternative to advanced reactor designs being considered. The advent of high temperature fluids, along with advances in hydrocracking and reforming technologies driven by the oil and gas industries, make the organic concept even more viable today. We present a simple, cost-effective, and safe small modular nuclear reactor for offshore underwater deployment. The core is moderated by graphite, zirconium hydride, and organic fluid while cooled by the organic fluid. The organic coolant enables operation near atmospheric pressure and use of plain carbon steel for the reactor tank and primary coolant piping system. The core is designed to mitigate the coolant degradation seen in early organic reactors. Overall, the design provides a power density of 40 kW/L, while reducing the reactor hull size by 40% compared with a pressurized water reactor while significantly reducing capital plant costs.

  9. Helix reactor: great potential for flow chemistry

    NARCIS (Netherlands)

    Geerdink, P.; Runstraat, A. van den; Roelands, C.P.M.; Goetheer, E.L.V.

    2009-01-01

    The Helix reactor is highly suited for precise reaction control based on good hydrodynamics. The hydrodynamics are controlled by the Dean vortices, which create excellent heat transfer properties, approach plug flow and avoid turbulence. The flexibility of this reactor has been demonstrated using a

  10. Startup of an industrial adiabatic tubular reactor

    NARCIS (Netherlands)

    Verwijs, J.W.; Berg, van den H.; Westerterp, K.R.

    1992-01-01

    The dynamic behaviour of an adiabatic tubular plant reactor during the startup is demonstrated, together with the impact of a feed-pump failure of one of the reactants. A dynamic model of the reactor system is presented, and the system response is calculated as a function of experimentally-determine

  11. Rotor for a pyrolysis centrifuge reactor

    DEFF Research Database (Denmark)

    2015-01-01

    The present invention relates to a rotor for a pyrolysis centrifuge reactor, said rotor comprising a rotor body having a longitudinal centre axis, and at least one pivotally mounted blade being adapted to pivot around a pivot axis under rotation of the rotor body around the longitudinal centre axis....... Moreover, the present invention relates to a pyrolysis centrifuge reactor applying such a rotor....

  12. Technical features of the MR reactor decommissioning

    Directory of Open Access Journals (Sweden)

    Craig David

    2008-01-01

    Full Text Available This paper presents a preliminary technical design for the dismantling of the MR reactor. The goal of the design is the removal of reactor components allowing the re-use of the building for a different nuclear related purpose. The sequence of segmentation procedures is established. Considerations on the size reduction and tooling are presented.

  13. University of Virginia Reactor Facility Decommissioning Results

    Energy Technology Data Exchange (ETDEWEB)

    Ervin, P. F.; Lundberg, L. A.; Benneche, P. E.; Mulder, R. U.; Steva, D. P.

    2003-02-24

    The University of Virginia Reactor Facility started accelerated decommissioning in 2002. The facility consists of two licensed reactors, the CAVALIER and the UVAR. This paper will describe the progress in 2002, remaining efforts and the unique organizational structure of the project team.

  14. Advanced tokamak concepts and reactor designs

    NARCIS (Netherlands)

    Oomens, A. A. M.

    2000-01-01

    From a discussion of fusion reactor designs based on today's well-established experience gained in the operation of large tokamaks, it is concluded that such reactors are economically not attractive. The physics involved in the various options for concept improvement is described, some examples

  15. The Design of a Nuclear Reactor

    Indian Academy of Sciences (India)

    2016-09-01

    The aim of this largely pedagogical article is toemploy pre-college physics to arrive at an understanding of a system as complex as a nuclear reactor. We focus on three key issues: the fuelpin, the moderator, and lastly the dimensions ofthe nuclear reactor.

  16. MODERATOR ELEMENTS FOR UNIFORM POWER NUCLEAR REACTOR

    Science.gov (United States)

    Balent, R.

    1963-03-12

    This patent describes a method of obtaining a flatter flux and more uniform power generation across the core of a nuclear reactor. The method comprises using moderator elements having differing moderating strength. The elements have an increasing amount of the better moderating material as a function of radial and/or axial distance from the reactor core center. (AEC)

  17. Selective purge for hydrogenation reactor recycle loop

    Science.gov (United States)

    Baker, Richard W.; Lokhandwala, Kaaeid A.

    2001-01-01

    Processes and apparatus for providing improved contaminant removal and hydrogen recovery in hydrogenation reactors, particularly in refineries and petrochemical plants. The improved contaminant removal is achieved by selective purging, by passing gases in the hydrogenation reactor recycle loop or purge stream across membranes selective in favor of the contaminant over hydrogen.

  18. The First Reactor, 40th Anniversary (rev.)

    Energy Technology Data Exchange (ETDEWEB)

    Allardice, Corbin; Trapnell, Edward R; Fermi, Enrico; Fermi, Laura; Williams, Robert C

    1982-12-01

    This booklet, an updated version of the original booklet describing the first nuclear reactor, was written in honor of the 40th anniversary of the first reactor or "pile". It is based on firsthand accounts told to Corbin Allardice and Edward R. Trapnell, and includes recollections of Enrico and Laura Fermi.

  19. The First Reactor, 40th Anniversary (rev.)

    Energy Technology Data Exchange (ETDEWEB)

    Allardice, Corbin; Trapnell, Edward R; Fermi, Enrico; Fermi, Laura; Williams, Robert C

    1982-12-01

    This booklet, an updated version of the original booklet describing the first nuclear reactor, was written in honor of the 40th anniversary of the first reactor or "pile". It is based on firsthand accounts told to Corbin Allardice and Edward R. Trapnell, and includes recollections of Enrico and Laura Fermi.

  20. Radiochemical problems of fusion reactors. 1. Facilities

    Energy Technology Data Exchange (ETDEWEB)

    Crespi, M.B.A.

    1984-02-01

    A list of fusion reactor candidate materials is given, for use in connection with blanket structure, breeding, moderation, neutron multiplication, cooling, magnetic field generation, electrical insulation and radiation shielding. The phenomena being studied for each group of materials are indicated. Suitable irradiation test facilities are discussed under the headings (1) accelerator-based neutron sources, (2) fission reactors, and (3) ion accelerators.

  1. Nuclear data requirements for fusion reactor nucleonics

    Energy Technology Data Exchange (ETDEWEB)

    Bhat, M.R.; Abdou, M.A.

    1980-01-01

    Nuclear data requirements for fusion reactor nucleonics are reviewed and the present status of data are assessed. The discussion is divided into broad categories dealing with data for Fusion Materials Irradiation Test Facility (FMIT), D-T Fusion Reactors, Alternate Fuel Cycles and the Evaluated Data Files that are available or would be available in the near future.

  2. Design of an Organic Simplified Nuclear Reactor

    Directory of Open Access Journals (Sweden)

    Koroush Shirvan

    2016-08-01

    Full Text Available Numerous advanced reactor concepts have been proposed to replace light water reactors ever since their establishment as the dominant technology for nuclear energy production. While most designs seek to improve cost competitiveness and safety, the implausibility of doing so with affordable materials or existing nuclear fuel infrastructure reduces the possibility of near-term deployment, especially in developing countries. The organic nuclear concept, first explored in the 1950s, offers an attractive alternative to advanced reactor designs being considered. The advent of high temperature fluids, along with advances in hydrocracking and reforming technologies driven by the oil and gas industries, make the organic concept even more viable today. We present a simple, cost-effective, and safe small modular nuclear reactor for offshore underwater deployment. The core is moderated by graphite, zirconium hydride, and organic fluid while cooled by the organic fluid. The organic coolant enables operation near atmospheric pressure and use of plain carbon steel for the reactor tank and primary coolant piping system. The core is designed to mitigate the coolant degradation seen in early organic reactors. Overall, the design provides a power density of 40 kW/L, while reducing the reactor hull size by 40% compared with a pressurized water reactor while significantly reducing capital plant costs.

  3. Naval reactors physics handbook. Volume 3: The physics of intermediate spectrum reactors

    Energy Technology Data Exchange (ETDEWEB)

    Stehn, J.R. [ed.] [Knolls Atomic Power Lab., Schenectady, NY (United States)

    1958-09-01

    The present volume has been prepared for persons with some knowledge of the physics of nuclear reactors. It is intended to make available the accumulated physics experience of the Knolls Atomic Power Laboratory in its work on intermediate spectrum reactors. Only those portions have been selected which were deemed to be most useful and significant to other physicists concerned with the problems of reactor design. The volume is divided into four parts which are more or less independent of one another. Part 1 (Chaps. 2--9), Investigation of Reactor Characteristics by Critical Assemblies, reflects the importance of the properties of critical assemblies and of the techniques for obtaining experimental information about such assemblies. Part 2 (Chaps. 10--20), Reactivity Effects Associated with Reactor Operation, details the use of both critical assemblies and reactor theory to make and test predictions of the manner in which the reactivity of an intermediate power reactor will vary during operation. Part 3 (Chaps. 21--26), Heat Generation and Nuclear Materials Problems, considers how reactor heat generation is spread out in space and time, and what nuclear effects result from the presence of beryllium or sodium in the reactor. Part 4 (Chaps. 27--38), Reactor Kinetics and Temperature Coefficients, relates to the transient or near-transient behavior of intermediate reactors.

  4. Experimental study of the supercritical water oxidation of recalcitrant compounds under hydrothermal flames using tubular reactors.

    Science.gov (United States)

    Cabeza, Pablo; Bermejo, M Dolores; Jiménez, Cristina; Cocero, M José

    2011-04-01

    The hydrothermal flame is a new method of combustion that takes place in supercritical water oxidation reactions when the temperature is higher than the autoignition temperature. In these conditions, waste can be completely mineralized in residence times of milliseconds without the formation of by-products typical of conventional combustion. The object of this work is to study the hydrothermal flame formation in aqueous streams with high concentrations of recalcitrant compounds: an industrial waste with a high concentration of acetic acid and various concentrated solutions of ammonia. A tubular reactor with a residence time of 0.7 s was used. Oxygen was used as the oxidant and isopropyl alcohol (IPA) as co-fuel to reach the operation temperature required. The increase of IPA concentrations in the feeds resulted in a better TOC removal. For mixtures containing acetic acid, 99% elimination of TOC was achieved at temperatures higher than 750 °C. In the case of mixtures containing ammonia, TOC removals reached 99% while maximum total nitrogen removals were never higher than 94%, even for reaction temperatures higher than 710 °C. Ignition was observed at concentrations as high as 6% wt NH(3) with 2% wt IPA while at IPA concentrations below 2% wt IPA, the ammonia did not ignite.

  5. Nondestructive characterization of embrittlement in reactor pressure vessel steels -- A feasibility study

    Energy Technology Data Exchange (ETDEWEB)

    McHenry, H.I.; Alers, G.A. [National Inst. of Standards and Technology, Boulder, CO (United States). Materials Reliability Div.

    1998-03-01

    The Nuclear Regulatory Commission recently initiated a study by NIST to assess the feasibility of using physical-property measurements for evaluating radiation embrittlement in reactor pressure vessel (RPV) steels. Ultrasonic and magnetic measurements provide the most promising approaches for nondestructive characterization of RPV steels because elastic waves and magnetic fields can sense the microstructural changes that embrittle materials. The microstructural changes of particular interest are copper precipitation hardening, which is the likely cause of radiation embrittlement in RPV steels, and the loss of dislocation mobility that is an attribute of the ductile-to-brittle transition. Measurements were made on a 1% copper steel, ASTM grade A710, in the annealed, peak-aged and overaged conditions, and on an RPV steel, ASTM grade A533B. Nonlinear ultrasonic and micromagnetic techniques were the most promising measures of precipitation hardening. Ultrasonic velocity measurements and the magnetic properties associated with hysteresis-loop measurements were not particularly sensitive to either precipitation hardening or the ductile-to-brittle transition. Measurements of internal friction using trapped ultrasonic resonance modes detected energy losses due to the motion of pinned dislocations; however, the ultrasonic attenuation associated with these measurements was small compared to the attenuation caused by beam spreading that would occur in conventional ultrasonic testing of RPVs.

  6. Anomalous findings of number, morphology and size of permanent teeth in 7-10 years children living in the Czech Republic.

    Science.gov (United States)

    Ginzelová, K; Kripnerová, T; Dostálová, T

    2013-01-01

    6,043 children, who were ordinary patients and children of Caucasian population, were examined clinically and radiographically. 430 children were aged 7-10 years. Dental anomalies were diagnosed in 14.1% (61 children) of those observed between 7-10 years. We aimed at numerical anomalies (78.6% of children with anomalies), morphological anomalies (19.6% of children with anomalies), size anomalies (3.2% of children with anomalies) and combinations of diagnoses (1.4% reflects the combinations of teeth 2 times calculated in combinations of diagnoses). Congenital numerical variations, i.e. hypodontia and hyperodontia, are among the most common deviations of the permanent dentition. Both conditions can occur as isolated traits or in association with other syndromes. Many studies indicate that hereditary factors are involved in the aetiology of anomalies. Gen MSX1 involves a primary position in mediating interactions between epithelium and mesenchyme in the development of teeth. Occurrence of dental anomalies is not very frequent; problems can arise with diagnosis of those affected teeth. It can be done using Orthopantomogram or Computed Tomography and 3D reconstruction. Some of the children with anomalies may have difficulties in treatment of affected teeth but in most cases the prognosis is good.

  7. State space modeling of reactor core in a pressurized water reactor

    Science.gov (United States)

    Ashaari, A.; Ahmad, T.; Shamsuddin, Mustaffa; M, Wan Munirah W.; Abdullah, M. Adib

    2014-07-01

    The power control system of a nuclear reactor is the key system that ensures a safe operation for a nuclear power plant. However, a mathematical model of a nuclear power plant is in the form of nonlinear process and time dependent that give very hard to be described. One of the important components of a Pressurized Water Reactor is the Reactor core. The aim of this study is to analyze the performance of power produced from a reactor core using temperature of the moderator as an input. Mathematical representation of the state space model of the reactor core control system is presented and analyzed in this paper. The data and parameters are taken from a real time VVER-type Pressurized Water Reactor and will be verified using Matlab and Simulink. Based on the simulation conducted, the results show that the temperature of the moderator plays an important role in determining the power of reactor core.

  8. State space modeling of reactor core in a pressurized water reactor

    Energy Technology Data Exchange (ETDEWEB)

    Ashaari, A.; Ahmad, T.; M, Wan Munirah W. [Department of Mathematical Science, Faculty of Science, Universiti Teknologi Malaysia, 81310 Skudai, Johor (Malaysia); Shamsuddin, Mustaffa [Institute of Ibnu Sina, Universiti Teknologi Malaysia, 81310 Skudai, Johor (Malaysia); Abdullah, M. Adib [Swinburne University of Technology, Faculty of Engineering, Computing and Science, Jalan Simpang Tiga, 93350 Kuching, Sarawak (Malaysia)

    2014-07-10

    The power control system of a nuclear reactor is the key system that ensures a safe operation for a nuclear power plant. However, a mathematical model of a nuclear power plant is in the form of nonlinear process and time dependent that give very hard to be described. One of the important components of a Pressurized Water Reactor is the Reactor core. The aim of this study is to analyze the performance of power produced from a reactor core using temperature of the moderator as an input. Mathematical representation of the state space model of the reactor core control system is presented and analyzed in this paper. The data and parameters are taken from a real time VVER-type Pressurized Water Reactor and will be verified using Matlab and Simulink. Based on the simulation conducted, the results show that the temperature of the moderator plays an important role in determining the power of reactor core.

  9. Verification of Remote Inspection Techniques for Reactor Internal Structures of Liquid Metal Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Joo, Young Sang; Lee, Jae Han

    2007-02-15

    The reactor internal structures and components of a liquid metal reactor (LMR) are submerged in hot sodium of reactor vessel. The division 3 of ASME code section XI specifies the visual inspection as major in-service inspection (ISI) methods of reactor internal structures and components. Reactor internals of LMR can not be visually examined due to opaque liquid sodium. The under-sodium viewing techniques using an ultrasonic wave should be applied for the visual inspection of reactor internals. Recently, an ultrasonic waveguide sensor with a strip plate has been developed for an application to the under-sodium inspection. In this study, visualization technique, ranging technique and monitoring technique have been suggested for the remote inspection of reactor internals by using the waveguide sensor. The feasibility of these remote inspection techniques using ultrasonic waveguide sensor has been evaluated by an experimental verification.

  10. Verification of Remote Inspection Techniques for Reactor Internal Structures of Liquid Metal Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Joo, Young Sang; Lee, Jae Han

    2007-02-15

    The reactor internal structures and components of a liquid metal reactor (LMR) are submerged in hot sodium of reactor vessel. The division 3 of ASME code section XI specifies the visual inspection as major in-service inspection (ISI) methods of reactor internal structures and components. Reactor internals of LMR can not be visually examined due to opaque liquid sodium. The under-sodium viewing techniques using an ultrasonic wave should be applied for the visual inspection of reactor internals. Recently, an ultrasonic waveguide sensor with a strip plate has been developed for an application to the under-sodium inspection. In this study, visualization technique, ranging technique and monitoring technique have been suggested for the remote inspection of reactor internals by using the waveguide sensor. The feasibility of these remote inspection techniques using ultrasonic waveguide sensor has been evaluated by an experimental verification.

  11. Scanning tunneling microscope assembly, reactor, and system

    Science.gov (United States)

    Tao, Feng; Salmeron, Miquel; Somorjai, Gabor A

    2014-11-18

    An embodiment of a scanning tunneling microscope (STM) reactor includes a pressure vessel, an STM assembly, and three spring coupling objects. The pressure vessel includes a sealable port, an interior, and an exterior. An embodiment of an STM system includes a vacuum chamber, an STM reactor, and three springs. The three springs couple the STM reactor to the vacuum chamber and are operable to suspend the scanning tunneling microscope reactor within the interior of the vacuum chamber during operation of the STM reactor. An embodiment of an STM assembly includes a coarse displacement arrangement, a piezoelectric fine displacement scanning tube coupled to the coarse displacement arrangement, and a receiver. The piezoelectric fine displacement scanning tube is coupled to the coarse displacement arrangement. The receiver is coupled to the piezoelectric scanning tube and is operable to receive a tip holder, and the tip holder is operable to receive a tip.

  12. Dynamic model of Fast Breeder Test Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Vaidyanathan, G., E-mail: vaidya@igcar.gov.i [Fast Reactor Technology Group, Indira Gandhi Center for Atomic Research, Kalpakkam (India); Kasinathan, N.; Velusamy, K. [Fast Reactor Technology Group, Indira Gandhi Center for Atomic Research, Kalpakkam (India)

    2010-04-15

    Fast Breeder Test Reactor (FBTR) is a 40 M Wt/13.2 MWe sodium cooled reactor operating since 1985. It is a loop type reactor. As part of the safety analysis the response of the plant to various transients is needed. In this connection a computer code named DYNAM was developed to model the reactor core, the intermediate heat exchanger, steam generator, piping, etc. This paper deals with the mathematical model of the various components of FBTR, the numerical techniques to solve the model, and comparison of the predictions of the code with plant measurements. Also presented is the benign response of the plant to a station blackout condition, which brings out the role of the various reactivity feedback mechanisms combined with a gradual coast down of reactor sodium flow.

  13. Reactivity control assembly for nuclear reactor. [LMFBR

    Science.gov (United States)

    Bollinger, L.R.

    1982-03-17

    This invention, which resulted from a contact with the United States Department of Energy, relates to a control mechanism for a nuclear reactor and, more particularly, to an assembly for selectively shifting different numbers of reactivity modifying rods into and out of the core of a nuclear reactor. It has been proposed heretofore to control the reactivity of a breeder reactor by varying the depth of insertion of control rods (e.g., rods containing a fertile material such as ThO/sub 2/) in the core of the reactor, thereby varying the amount of neutron-thermalizing coolant and the amount of neutron-capturing material in the core. This invention relates to a mechanism which can advantageously be used in this type of reactor control system.

  14. Power Control Method for Research Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Baang, Dane; Suh, Yongsuk; Park, Cheol [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2015-05-15

    Considering safety-oriented design concept and other control environment, we developed a simple controller that provides limiting function of power change- rate as well as fine tracking performance. The design result has been well-proven via simulation and actual application to a TRIGA-II type research reactor. The proposed controller is designed to track the PDM(Power Demand) from operator input as long as maintaining the power change rate lower than a certain value for stable reactor operation. A power control method for a TRIGA-II type research reactor has been designed, simulated, and applied to actual reactor. The control performance during commissioning test shows that the proposed controller provides fine control performance for various changes in reference values (PDM), even though there is large measurement noise from neutron detectors. The overshoot at low power level is acceptable in a sense of reactor operation.

  15. Precision spectroscopy with reactor anti-neutrinos

    CERN Document Server

    Huber, P; Huber, Patrick; Schwetz, Thomas

    2004-01-01

    In this work we present an accurate parameterization of the anti-neutrino flux produced by the isotopes 235U, 239Pu and 241Pu in nuclear reactors. We determine the coefficients of this parameterization, as well as their covariance matrix, by performing a fit to spectra inferred from experimentally measured beta spectra. Subsequently we show that flux shape uncertainties play only a minor role in the KamLAND experiment, however, we find that future reactor neutrino experiments to measure the mixing angle $\\theta_{13}$ are sensitive to the fine details of the reactor neutrino spectra. Finally, we investigate the possibility to determine the isotopic composition in nuclear reactors through an anti-neutrino measurement. We find that with a 3 month exposure of a one ton detector the isotope fractions and the thermal reactor power can be determined at a few percent accuracy, which may open the possibility of an application for safeguard or non-proliferation objectives.

  16. Reactor assessments of advanced bumpy torus configurations

    Energy Technology Data Exchange (ETDEWEB)

    Uckan, N.A.; Owen, L.W.; Spong, D.A.; Miller, R.L.; Ard, W.B.; Pipkins, J.F.; Schmitt, R.J.

    1984-02-01

    Recently, several innovative approaches were introduced for enhancing the performance of the basic ELMO Bumpy Torus (EBT) concept and for improving its reactor potential. These include planar racetrack and square geometries, Andreoletti coil systems, and bumpy torus-stellarator hybrids (which include twisted racetrack and helical axis stellarator - snakey torus). Preliminary evaluations of reactor implications of each approach have been carried out based on magnetics (vacuum) calculations, transport and scaling relationships, and stability properties deduced from provisional configurations that implement the approach but are not necessarily optimized. Further optimization is needed in all cases to evaluate the full potential of each approach. Results of these studies indicate favorable reactor projections with a significant reduction in reactor physical size as compared to conventional EBT reactor designs carried out in the past.

  17. Testing commercial catalysts in recycle reactors

    Energy Technology Data Exchange (ETDEWEB)

    Berty, J.M.

    1979-01-01

    Recycle reactors for quality control of catalyst production and for testing new catalysts for known or new processes have the following advantages over tubular reactors: they can reproduce the physical and chemical regime which surrounds the catalyst in a commercial reactor; they can achieve high mass and heat transfer; they exhibit uniform coke deposit; and they provide independence of mass velocity and space velocity. Their disadvantage is the unconventional specification of experiments in terms of discharge concentration which derives from the implicit nature of the basic mathematical relationships. Recycle reactor test methods are outlined for quality control and for testing catalysts, e.g., supported nickel from different manufacturers, for processes whose chemistry is well known. Approaches for testing catalysts for new processes are discussed. The standard recycle reactor developed at Union Carbide Corp. and manufactured by Autoclave Engineers, and several of its modifications are described.

  18. Ceramic oxygen transport membrane array reactor and reforming method

    Science.gov (United States)

    Kelly, Sean M.; Christie, Gervase Maxwell; Robinson, Charles; Wilson, Jamie R.; Gonzalez, Javier E.; Doraswami, Uttam R.

    2016-11-08

    The invention relates to a commercially viable modular ceramic oxygen transport membrane reforming reactor configured using repeating assemblies of oxygen transport membrane tubes and catalytic reforming reactors.

  19. Ceramic oxygen transport membrane array reactor and reforming method

    Energy Technology Data Exchange (ETDEWEB)

    Kelly, Sean M.; Christie, Gervase Maxwell; Robinson, Charles; Wilson, Jamie R.; Gonzalez, Javier E.; Doraswami, Uttam R.

    2016-11-08

    The invention relates to a commercially viable modular ceramic oxygen transport membrane reforming reactor configured using repeating assemblies of oxygen transport membrane tubes and catalytic reforming reactors.

  20. Fast Spectrum Molten Salt Reactor Options

    Energy Technology Data Exchange (ETDEWEB)

    Gehin, Jess C [ORNL; Holcomb, David Eugene [ORNL; Flanagan, George F [ORNL; Patton, Bruce W [ORNL; Howard, Rob L [ORNL; Harrison, Thomas J [ORNL

    2011-07-01

    During 2010, fast-spectrum molten-salt reactors (FS-MSRs) were selected as a transformational reactor concept for light-water reactor (LWR)-derived heavy actinide disposition by the Department of Energy-Nuclear Energy Advanced Reactor Concepts (ARC) program and were the subject of a preliminary scoping investigation. Much of the reactor description information presented in this report derives from the preliminary studies performed for the ARC project. This report, however, has a somewhat broader scope-providing a conceptual overview of the characteristics and design options for FS-MSRs. It does not present in-depth evaluation of any FS-MSR particular characteristic, but instead provides an overview of all of the major reactor system technologies and characteristics, including the technology developments since the end of major molten salt reactor (MSR) development efforts in the 1970s. This report first presents a historical overview of the FS-MSR technology and describes the innovative characteristics of an FS-MSR. Next, it provides an overview of possible reactor configurations. The following design features/options and performance considerations are described including: (1) reactor salt options-both chloride and fluoride salts; (2) the impact of changing the carrier salt and actinide concentration on conversion ratio; (3) the conversion ratio; (4) an overview of the fuel salt chemical processing; (5) potential power cycles and hydrogen production options; and (6) overview of the performance characteristics of FS-MSRs, including general comparative metrics with LWRs. The conceptual-level evaluation includes resource sustainability, proliferation resistance, economics, and safety. The report concludes with a description of the work necessary to begin more detailed evaluation of FS-MSRs as a realistic reactor and fuel cycle option.

  1. The research reactors their contribution to the reactors physics; Les reacteurs de recherche leur apport sur la physique des reacteurs

    Energy Technology Data Exchange (ETDEWEB)

    Barral, J.C. [Electricite de France (EDF), 75 - Paris (France); Zaetta, A. [CEA/Cadarache, Direction des Reacteurs Nucleaires, DRN, 13 - Saint-Paul-lez-Durance (France); Johner, J. [CEA/Cadarache, Dept. de Recherches sur la Fusion Controlee (DRFC), 13 - Saint Paul lez Durance (France); Mathoniere, G. [CEA/Saclay, DEN, 91 - Gif sur Yvette (France)] [and others

    2000-07-01

    The 19 october 2000, the french society of nuclear energy organized a day on the research reactors. This associated report of the technical session, reactors physics, is presented in two parts. The first part deals with the annual meeting and groups general papers on the pressurized water reactors, the fast neutrons reactors and the fusion reactors industry. The second part presents more technical papers about the research programs, critical models, irradiation reactors (OSIRIS and Jules Horowitz) and computing tools. (A.L.B.)

  2. Radiation protection at new reactors

    Energy Technology Data Exchange (ETDEWEB)

    Brissaud, A. [EDF INDUSTRY, Basic Design Department, EDF-SEPTEN, VILLEURBANNE Cedex (France)

    2000-05-01

    The theoritical knowledge and the feedback of operating experience concerning radiations in reactors is now considerable. It is available to the designer in the form of predictive softwares and data bases. Thus, it is possible to include the radiation protection component throughout all the design process. In France, the existing reactors have not been designed with quantified radiation protection targets, although considerable efforts have been made to reduce sources of radiation illustrated by the decrease of the average dose rates (typically a factor 5 between the first 900 MWe and the last 1300 MWe units). The EDF ALARA PROJECT has demonstrated that good practises, radiation protection awareness, careful work organization had a strong impact on operation and maintenance work volume. A decrease of the average collective dose by a factor 2 has been achieved without noticeable modifications of the units. In the case of new nuclear facilities projects (reactor, intermediate storage facility,...), or special operations (such as steam generator replacement), quantified radiation protection targets are included in terms of collective and average individual doses within the frame of a general optimization scheme. The target values by themselves are less important than the application of an optimization process throughout the design. This is because the optimization process requires to address all the components of the dose, particularly the work volume for operation and maintenance. A careful study of this parameter contributes to the economy of the project (suppression of unecessary tasks, time-saving ergonomy of work sites). This optimization process is currently applied to the design of the EPR. General radiation protection provisions have been addressed during the basic design phase by applying general rules aiming at the reduction of sources and dose rates. The basic design optimization phase has mainly dealt with the possibility to access the containment at full

  3. Membrane reactor technology for ultrapure hydrogen production

    Energy Technology Data Exchange (ETDEWEB)

    Patil, C.S.

    2005-11-17

    The main objectives of this thesis are (1) to compare different reactor types and assess the feasibility of operation; (2) to develop and design a novel reactor concept based on the integration of perm-selective hydrogen and oxygen membranes; and (3) to give an experimental proof of principle of the developed reactor concept. In Chapter 2, available perm-selective hydrogen and oxygen membranes are reviewed. The focus is on the reactor concepts using these membranes and commercial developments that have taken place. In Chapter 3, the feasibility of performing autothermal membrane reforming in a packed bed membrane reactor with perm-selective hydrogen membrane is investigated based on detailed two-dimensional non-isothermal reactor modelling. In Chapter 4, an alternative reactor concept is developed for the autothermal reforming of methane integrating both hydrogen and oxygen perm-selective membranes. In Chapter 5, experimental work on the perm-selective hydrogen membranes that are used in the top section of the proposed reactor concept has been elaborated. These membranes, procured from a commercial supplier, are tested for their perm-selectivity and the permeability of hydrogen at different temperature and hydrogen partial pressures. Using the flux data a lumped flux expression is developed which is subsequently used in the pilot scale reactor design (Chapter 7). In Chapter 6, the kinetic rate measurements for SRM on a highly active Shell CPO catalyst are described. A kinetic rate expression for the steam reforming/ water gas shift top section of the proposed novel reactor concept is developed. The bottom section of this reactor is essentially at thermodynamic equilibrium because of highly active CPO catalyst and high temperatures and hence a detailed kinetic investigation for this section is not undertaken. In Chapter 7, a single membrane prototype of the top section is tested experimentally followed by a scale-up and design to a pilot scale unit with 10 Pd

  4. (Meeting on fusion reactor materials)

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.H. (Pacific Northwest Lab., Richland, WA (USA)); Klueh, R.L.; Rowcliffe, A.F.; Wiffen, F.W. (Oak Ridge National Lab., TN (USA)); Loomis, B.A. (Argonne National Lab., IL (USA))

    1990-11-01

    During his visit to the KfK, Karlsruhe, F. W. Wiffen attended the IEA 12th Working Group Meeting on Fusion Reactor Materials. Plans were made for a low-activation materials workshop at Culham, UK, for April 1991, a data base workshop in Europe for June 1991, and a molecular dynamics workshop in the United States in 1991. At the 11th IEA Executive Committee on Fusion Materials, discussions centered on the recent FPAC and Colombo panel review in the United States and EC, respectively. The Committee also reviewed recent progress toward a neutron source in the United States (CWDD) and in Japan (ESNIT). A meeting with D. R. Harries (consultant to J. Darvas) yielded a useful overview of the EC technology program for fusion. Of particular interest to the US program is a strong effort on a conventional ferritic/martensitic steel for fist wall/blanket operation beyond NET/ITER.

  5. Reactor operation environmental information document

    Energy Technology Data Exchange (ETDEWEB)

    Wike, L.D.; Specht, W.L.; Mackey, H.E.; Paller, M.H.; Wilde, E.W.; Dicks, A.S.

    1989-12-01

    The Savannah River Site (SRS) is a large United States Department of Energy installation on the upper Atlantic Coastal Plain of South Carolina. The SRS contains diverse habitats, flora, and fauna. Habitats include upland terrestrial areas, varied wetlands including Carolina Bays, the Savannah River swamp system, and impoundment related and riparian wetlands, and the aquatic habitats of several stream systems, two large cooling reservoirs, and the Savannah River. These diverse habitats support a large variety of plants and animals including many commercially or recreational valuable species and several rare, threatened or endangered species. This volume describes the major habitats and their biota found on the SRS, and discuss the impacts of continued operation of the K, L, and P production reactors.

  6. Coacervates as prebiotic chemical reactors

    Science.gov (United States)

    Kolb, Vera M.; Swanson, Mercedes; Menger, Fredric M.

    2012-10-01

    Coacervates are colloidal systems that are comprised of two immiscible aqueous layers, the colloid-rich layer, so-called coacervate, and the colloid-poor layer, so-called equilibrium liquid. Although immiscible, the two phases are both water-rich. Coacervates are important for prebiotic chemistry, but also have various practical applications, notably as transport vehicles of personal care products and pharmaceuticals. Our objectives are to explore the potential of coacervates as prebiotic chemical reactors. Since the reaction medium in coacervates is water, this creates a challenge, since most organic reactants are not water-soluble. To overcome this challenge we are utilizing recent Green Chemistry examples of the organic reactions in water, such as the Passerini reaction. We have investigated this reaction in two coacervate systems, and report here our preliminary results.

  7. Dynamic analysis of process reactors

    Energy Technology Data Exchange (ETDEWEB)

    Shadle, L.J.; Lawson, L.O.; Noel, S.D.

    1995-06-01

    The approach and methodology of conducting a dynamic analysis is presented in this poster session in order to describe how this type of analysis can be used to evaluate the operation and control of process reactors. Dynamic analysis of the PyGas{trademark} gasification process is used to illustrate the utility of this approach. PyGas{trademark} is the gasifier being developed for the Gasification Product Improvement Facility (GPIF) by Jacobs-Siffine Engineering and Riley Stoker. In the first step of the analysis, process models are used to calculate the steady-state conditions and associated sensitivities for the process. For the PyGas{trademark} gasifier, the process models are non-linear mechanistic models of the jetting fluidized-bed pyrolyzer and the fixed-bed gasifier. These process sensitivities are key input, in the form of gain parameters or transfer functions, to the dynamic engineering models.

  8. Replacement reactor to revolutionise magnets

    CERN Document Server

    Atkins, G

    2002-01-01

    Electric motors, hearing aids and magnetic resonance imaging are only some of the applications that will benefit from the first advances in magnets in a quarter of a century. Magnets achieve their characteristics when electrons align themselves to produce a unified magnetic field. Neutrons can probe these magnetic structures. The focus is not just on making more powerful magnets, but also identifying the characteristics that make magnets cheaper and easier for industry to manufacture. Staff from the ANSTO's Neutron Scattering Group have already performed a number of studies on the properties of magnets using using HIFAR, but the Replacement Research Reactor that will produce cold neutrons would allow scientists to investigate the atomic properties of materials with large molecules. A suite of equipment will enable studies at different temperatures, pressures and magnetic fields

  9. Nuclear reactor composite fuel assembly

    Energy Technology Data Exchange (ETDEWEB)

    Burgess, Donn M. (Richland, WA); Marr, Duane R. (West Richland, WA); Cappiello, Michael W. (Richland, WA); Omberg, Ronald P. (Richland, WA)

    1980-01-01

    A core and composite fuel assembly for a liquid-cooled breeder nuclear reactor including a plurality of elongated coextending driver and breeder fuel elements arranged to form a generally polygonal bundle within a thin-walled duct. The breeder elements are larger in cross section than the driver elements, and each breeder element is laterally bounded by a number of the driver elements. Each driver element further includes structure for spacing the driver elements from adjacent fuel elements and, where adjacent, the thin-walled duct. A core made up of the fuel elements can advantageously include fissile fuel of only one enrichment, while varying the effective enrichment of any given assembly or core region, merely by varying the relative number and size of the driver and breeder elements.

  10. PCCF flow analysis -- DR Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Calkin, J.F.

    1961-04-26

    This report contains an analysis of PCCF tube flow and Panellit pressure relations at DR reactor. Supply curves are presented at front header pressures from 480 to 600 psig using cold water and the standard 0.236 inch orifice with taper down stream and the pigtail valve (plug or ball) open. Demand curves are presented for slug column lengths of 200 inches to 400 inches using 1.44 inch O.D. solid poison pieces (either Al or Pb-Cd) and cold water with a rear header pressure of 50 psig. Figure 1 is a graph of Panellit pressure vs. flow with the above supply and demand curves and clearly shows the effect of front header pressure and charge length on flow.

  11. The Swedish Zero Power Reactor R0

    Energy Technology Data Exchange (ETDEWEB)

    Landergaard, Olof; Cavallin, Kaj; Jonsson, Georg

    1961-05-15

    The reactor R0 is a critical facility built for heavy water and natural uranium or fuel of low enrichment,, The first criticality was achieved September 25, 1959. During a first period of more than two years the R0 will be operated as a bare reactor in order to simplify interpretation of results. The reactor tank is 3. 2 m high and 2. 25 m in diameter. The fuel suspension system is quite flexible in order to facilitate fuel exchange and lattice variations. The temperature of the water can be varied between about 10 and 90 C by means of a heater and a cooler placed in the external circulating system. The instrumentation of the reactor has to meet the safety requirements not only during operation but also during rearrangements of the core in the shut-down state. Therefore, the shut-down state is always defined by a certain low 'safe' moderator level in the reactor tank. A number of safety rods are normally kept above the moderator ready for action. For manual or automatic control of the reactor power a specially designed piston pump is needed, by which the moderator level is varied. The pump speed is controlled from the reactor power error by means of a Ward-Leonard system. Moderator level measurement is made by means of a water gauge with an accuracy of {+-} 0. 1 mm.

  12. Flexible Conversion Ratio Fast Reactor Systems Evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Neil Todreas; Pavel Hejzlar

    2008-06-30

    Conceptual designs of lead-cooled and liquid salt-cooled fast flexible conversion ratio reactors were developed. Both concepts have cores reated at 2400 MWt placed in a large-pool-type vessel with dual-free level, which also contains four intermediate heat exchanges coupling a primary coolant to a compact and efficient supercritical CO2 Brayton cycle power conversion system. Decay heat is removed passively using an enhanced Reactor Vessel Auxiliary Cooling System and a Passive Secondary Auxiliary Cooling System. The most important findings were that (1) it is feasible to design the lead-cooled and salt-cooled reactor with the flexible conversion ratio (CR) in the range of CR=0 and CR=1 n a manner that achieves inherent reactor shutdown in unprotected accidents, (2) the salt-cooled reactor requires Lithium thermal Expansion Modules to overcme the inherent salt coolant's large positive coolant temperature reactivity coefficient, (3) the preferable salt for fast spectrum high power density cores is NaCl-Kcl-MgCl2 as opposed to fluoride salts due to its better themal-hydraulic and neutronic characteristics, and (4) both reactor, but attain power density 3 times smaller than that of the sodium-cooled reactor.

  13. Bottom-mounted Reactor Shutdown Mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sanghaun; Lee, Jin Haeng; Cho, Yeonggarp; Yoo, Yeonsik; Kim, Dongmin; Kim, Jongin [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2013-05-15

    The CRDM acts as the first reactor shutdown mechanism and reactor regulating as well. The SSDM provides an alternate and independent means of reactor shutdown. The second shutdown rods (SSRs) of the SSDM are poised at the top of the core by the hydraulic system during the normal operation and drop by gravity within the specific time for a reactor trip. The SSR drop is actuated by the Reactor Protection System (RPS), Alternate Protection System (APS), Automatic Seismic Trip System (ASTS), or by the reactor operator in KJRR. Based on the proven technology of the design, operation and maintenance for HANARO and JRTR (Jordan Research and Training Reactor), the SSDM for the KJRR has been optimized by the design improvement from the experience and test. This paper aims for the introduction of the BM SSDM in the process of the basic design. The major differences of the shutdown mechanisms are comparatively analyzed between HANARO and KJRR. And the design features, system, structure and future works are also suggested. A basic design of the BM SSDM for the KJRR has been completed on the basis of the HANARO's SO unit or JRTR's SSDM. The SSR and its guide tube are designed and optimized according to the geometrical core configuration.

  14. Advanced Demonstration and Test Reactor Options Study

    Energy Technology Data Exchange (ETDEWEB)

    Petti, David Andrew [Idaho National Lab. (INL), Idaho Falls, ID (United States); Hill, R. [Argonne National Lab. (ANL), Argonne, IL (United States); Gehin, J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Gougar, Hans David [Idaho National Lab. (INL), Idaho Falls, ID (United States); Strydom, Gerhard [Idaho National Lab. (INL), Idaho Falls, ID (United States); Heidet, F. [Argonne National Lab. (ANL), Argonne, IL (United States); Kinsey, J. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Grandy, Christopher [Argonne National Lab. (ANL), Argonne, IL (United States); Qualls, A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Brown, Nicholas [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Powers, J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Hoffman, E. [Argonne National Lab. (ANL), Argonne, IL (United States); Croson, D. [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2017-01-01

    Global efforts to address climate change will require large-scale decarbonization of energy production in the United States and elsewhere. Nuclear power already provides 20% of electricity production in the United States (U.S.) and is increasing in countries undergoing rapid growth around the world. Because reliable, grid-stabilizing, low emission electricity generation, energy security, and energy resource diversity will be increasingly valued, nuclear power’s share of electricity production has a potential to grow. In addition, there are non electricity applications (e.g., process heat, desalination, hydrogen production) that could be better served by advanced nuclear systems. Thus, the timely development, demonstration, and commercialization of advanced nuclear reactors could diversify the nuclear technologies available and offer attractive technology options to expand the impact of nuclear energy for electricity generation and non-electricity missions. The purpose of this planning study is to provide transparent and defensible technology options for a test and/or demonstration reactor(s) to be built to support public policy, innovation and long term commercialization within the context of the Department of Energy’s (DOE’s) broader commitment to pursuing an “all of the above” clean energy strategy and associated time lines. This planning study includes identification of the key features and timing needed for advanced test or demonstration reactors to support research, development, and technology demonstration leading to the commercialization of power plants built upon these advanced reactor platforms. This planning study is consistent with the Congressional language contained within the fiscal year 2015 appropriation that directed the DOE to conduct a planning study to evaluate “advanced reactor technology options, capabilities, and requirements within the context of national needs and public policy to support innovation in nuclear energy

  15. Oxidation performance of graphite material in reactors

    Institute of Scientific and Technical Information of China (English)

    Xiaowei LUO; Xinli YU; Suyuan YU

    2008-01-01

    Graphite is used as a structural material and moderator for high temperature gas-cooled reactors (HTGR). When a reactor is in operation, graphite oxida-tion influences the safety and operation of the reactor because of the impurities in the coolant and/or the acci-dent conditions, such as water ingress and air ingress. In this paper, the graphite oxidation process is introduced, factors influencing graphite oxidation are analyzed and discussed, and some new directions for further study are pointed out.

  16. Monitoring and control of anaerobic reactors

    DEFF Research Database (Denmark)

    Pind, Peter Frode; Angelidaki, Irini; Ahring, Birgitte Kiær;

    2003-01-01

    measurements are reviewed in detail. In the sequel, possible manipulated variables, such as the hydraulic retention time, the organic loading rate, the sludge retention time, temperature, pH and alkalinity are evaluated with respect to the two main reactor types: high-rate and low-rate. Finally, the different......The current status in monitoring and control of anaerobic reactors is reviewed. The influence of reactor design and waste composition on the possible monitoring and control schemes is examined. After defining the overall control structure, and possible control objectives, the possible process...

  17. Reactor and method for production of nanostructures

    Energy Technology Data Exchange (ETDEWEB)

    Sunkara, Mahendra Kumar; Kim, Jeong H.; Kumar, Vivekanand

    2017-04-25

    A reactor and method for production of nanostructures, including metal oxide nanowires or nanoparticles, are provided. The reactor includes a regulated metal powder delivery system in communication with a dielectric tube; a plasma-forming gas inlet, whereby a plasma-forming gas is delivered substantially longitudinally into the dielectric tube; a sheath gas inlet, whereby a sheath gas is delivered into the dielectric tube; and a microwave energy generator coupled to the dielectric tube, whereby microwave energy is delivered into a plasma-forming gas. The method for producing nanostructures includes providing a reactor to form nanostructures and collecting the formed nanostructures, optionally from a filter located downstream of the dielectric tube.

  18. Packed fluidized bed blanket for fusion reactor

    Science.gov (United States)

    Chi, John W. H.

    1984-01-01

    A packed fluidized bed blanket for a fusion reactor providing for efficient radiation absorption for energy recovery, efficient neutron absorption for nuclear transformations, ease of blanket removal, processing and replacement, and on-line fueling/refueling. The blanket of the reactor contains a bed of stationary particles during reactor operation, cooled by a radial flow of coolant. During fueling/refueling, an axial flow is introduced into the bed in stages at various axial locations to fluidize the bed. When desired, the fluidization flow can be used to remove particles from the blanket.

  19. Pyrometric fuel particle measurements in pressurised reactors

    Energy Technology Data Exchange (ETDEWEB)

    Hernberg, R.; Joutsenoja, T. [Tampere Univ. of Technology (Finland)

    1996-12-01

    A fiberoptic two-colour pyrometric technique for fuel particle temperature and size measurement is modified and applied to three pressurized reactors of different type in Finland, Germany and France. A modification of the pyrometric method for simultaneous in situ measurement of the temperature and size of individual pulverized coal particles at the pressurized entrained flow reactor in Jyvaeskylae was developed and several series of measurements were made. In Orleans a fiberoptic pyrometric device was installed to a pressurised thermogravimetric reactor and the two-colour temperatures of fuel samples were measured. Some results of these measurements are presented. The project belongs to EU`s Joule 2 extension research programme. (author)

  20. ADVANCED CONTROL FOR A ETHYLENE REACTOR

    Directory of Open Access Journals (Sweden)

    Dumitru POPESCU

    2017-06-01

    Full Text Available The main objective of this work is the design and implementation of control solutions for petrochemical processes, namely the control and optimization of a pyrolysis reactor, the key-installation in the petrochemical industry. We present the technological characteristics of this petrochemical process and some aspects about the proposed control system solution for the ethylene plant. Finally, an optimal operating point for the reactor is found, considering that the process has a nonlinear multi-variable structure. The results have been implemented on an assembly of pyrolysis reactors on a petrochemical platform from Romania.

  1. Facility for a Low Power Research Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Chalker, R. G.

    1949-09-14

    Preliminary investigation indicates that a reactor facility with ample research provisions for use by University or other interested groups, featuring safety in design, can be economically constructed in the Los Angeles area. The complete installation, including an underground gas-tight reactor building, with associated storage and experiment assembly building, administration offices, two general laboratory buildings, hot latoratory and lodge, can be constructed for approxinately $1,500,000. This does not include the cost of the reactor itself or of its auxiliary equipment,

  2. Sistemas de salvaguardia en reactores EPR

    OpenAIRE

    2015-01-01

    En este documento se describe brevemente el funcionamiento de los diversos sistemas de una planta nuclear operada con un reactor de tipo PWR. Más concretamente, el proyecto se centra en una descripción exhaustiva de los sistemas de salvaguardia y seguridad que regulan el funcionamiento de un reactor de tipo EPR, así como la central nuclear que contiene a dicho reactor. El proceso ha consistido en clasificar y resumir los distintos sistemas que operan en dicha planta, estudiando sus caracterís...

  3. Transients in reactors for power systems compensation

    Science.gov (United States)

    Abdul Hamid, Haziah

    This thesis describes new models and investigations into switching transient phenomena related to the shunt reactors and the Mechanically Switched Capacitor with Damping Network (MSCDN) operations used for reactive power control in the transmission system. Shunt reactors and MSCDN are similar in that they have reactors. A shunt reactor is connected parallel to the compensated lines to absorb the leading current, whereas the MSCDN is a version of a capacitor bank designed as a C-type filter for use in the harmonic-rich environment. In this work, models have been developed and transient overvoltages due to shunt reactor deenergisation were estimated analytically using MathCad, a mathematical program. Computer simulations used the ATP/EMTP program to reproduce both single-phase and three-phase shunt reactor switching at 275 kV operational substations. The effect of the reactor switching on the circuit breaker grading capacitor was also examined by considering various switching conditions.. The main original achievement of this thesis is the clarification of failure mechanisms occurring in the air-core filter reactor due to MSCDN switching operations. The simulation of the MSCDN energisation was conducted using the ATP/EMTP program in the presence of surge arresters. The outcome of this simulation shows that extremely fast transients were established across the air-core filter reactor. This identified transient event has led to the development of a detailed air-core reactor model, which accounts for the inter-turn RLC parameters as well as the stray capacitances-to-ground. These parameters are incorporated into the transient simulation circuit, from which the current and voltage distribution across the winding were derived using electric field and equivalent circuit modelling. Analysis of the results has revealed that there are substantial dielectric stresses imposed on the winding insulation that can be attributed to a combination of three factors. (i) First, the

  4. Assessing Pretreatment Reactor Scaling Through Empirical Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Lischeske, James J.; Crawford, Nathan C.; Kuhn, Erik; Nagle, Nicholas J.; Schell, Daniel J.; Tucker, Melvin P.; McMillan, James D.; Wolfrum, Edward J.

    2016-12-01

    Pretreatment is a critical step in the biochemical conversion of lignocellulosic biomass to fuels and chemicals. Due to the complexity of the physicochemical transformations involved, predictively scaling up technology from bench- to pilot-scale is difficult. This study examines how pretreatment effectiveness under nominally similar reaction conditions is influenced by pretreatment reactor design and scale using four different pretreatment reaction systems ranging from a 3 g batch reactor to a 10 dry-ton/d continuous reactor. The reactor systems examined were an Automated Solvent Extractor (ASE), Steam Explosion Reactor (SER), ZipperClave(R) reactor (ZCR), and Large Continuous Horizontal-Screw Reactor (LHR). To our knowledge, this is the first such study performed on pretreatment reactors across a range of reaction conditions (time and temperature) and at different reactor scales. The comparative pretreatment performance results obtained for each reactor system were used to develop response surface models for total xylose yield after pretreatment and total sugar yield after pretreatment followed by enzymatic hydrolysis. Near- and very-near-optimal regions were defined as the set of conditions that the model identified as producing yields within one and two standard deviations of the optimum yield. Optimal conditions identified in the smallest-scale system (the ASE) were within the near-optimal region of the largest scale reactor system evaluated. A reaction severity factor modeling approach was shown to inadequately describe the optimal conditions in the ASE, incorrectly identifying a large set of sub-optimal conditions (as defined by the RSM) as optimal. The maximum total sugar yields for the ASE and LHR were 95%, while 89% was the optimum observed in the ZipperClave. The optimum condition identified using the automated and less costly to operate ASE system was within the very-near-optimal space for the total xylose yield of both the ZCR and the LHR, and was

  5. Passive compact molten salt reactor (PCMSR), modular thermal breeder reactor with totally passive safety system

    Energy Technology Data Exchange (ETDEWEB)

    Harto, Andang Widi [Engineering Physics Department, Faculty of Engineering, Gadjah Mada University (Indonesia)

    2012-06-06

    Design Study Passive Compact Molten Salt Reactor (PCMSR) with totally passive safety system has been performed. The term of Compact in the PCMSR name means that the reactor system is designed to have relatively small volume per unit power output by using modular and integral concept. In term of modular, the reactor system consists of three modules, i.e. reactor module, turbine module and fuel management module. The reactor module is an integral design that consists of reactor, primary and intermediate heat exchangers and passive post shutdown cooling system. The turbine module is an integral design of a multi heating, multi cooling, regenerative gas turbine. The fuel management module consists of all equipments related to fuel preparation, fuel reprocessing and radioactive handling. The preliminary calculations show that the PCMSR has negative temperature and void reactivity coefficient, passive shutdown characteristic related to fuel pump failure and possibility of using natural circulation for post shutdown cooling system.

  6. Progress of China Experimental Fast Reactor in 2011

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    1 Background Fast reactor is the reactor which realized the chain fission with fast neutron.As an optional type of generation Ⅳ reactor,fast reactor has three characters:1) It can change 238U to 239Pu and raise the uranium resource utilization

  7. Uncertainties in the Anti-neutrino Production at Nuclear Reactors

    OpenAIRE

    Djurcic, Z.(Argonne National Laboratory, Argonne, Illinois, 60439, U.S.A.); Detwiler, J. A.; Piepke, A.; Foster Jr., V. R.; Miller, L.; Gratta, G.

    2008-01-01

    Anti-neutrino emission rates from nuclear reactors are determined from thermal power measurements and fission rate calculations. The uncertainties in these quantities for commercial power plants and their impact on the calculated interaction rates in electron anti-neutrino detectors is examined. We discuss reactor-to-reactor correlations between the leading uncertainties and their relevance to reactor anti-neutrino experiments.

  8. Hydrodynamics of multi-phase packed bed micro-reactors

    NARCIS (Netherlands)

    Márquez Luzardo, N.M.

    2010-01-01

    Why to use packed bed micro-reactors for catalyst testing? Miniaturized packed bed reactors have a large surface-to-volume ratio at the reactor and particle level that favors the heat- and mass-transfer processes at all scales (intra-particle, inter-phase and inter-particle or reactor level). If the

  9. Hydrodynamics of multi-phase packed bed micro-reactors

    NARCIS (Netherlands)

    Márquez Luzardo, N.M.

    2010-01-01

    Why to use packed bed micro-reactors for catalyst testing? Miniaturized packed bed reactors have a large surface-to-volume ratio at the reactor and particle level that favors the heat- and mass-transfer processes at all scales (intra-particle, inter-phase and inter-particle or reactor level). If the

  10. Ex-vessel Steam Explosion Analysis for Pressurized Water Reactor and Boiling Water Reactor

    OpenAIRE

    Matjaž Leskovar; Mitja Uršič

    2016-01-01

    A steam explosion may occur during a severe accident, when the molten core comes into contact with water. The pressurized water reactor and boiling water reactor ex-vessel steam explosion study, which was carried out with the multicomponent three-dimensional Eulerian fuel–coolant interaction code under the conditions of the Organisation for Economic Co-operation and Development (OECD) Steam Explosion Resolution for Nuclear Applications project reactor exercise, is presented and discussed. In ...

  11. Advanced research reactor fuel development

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chang Kyu; Pak, H. D.; Kim, K. H. [and others

    2000-05-01

    The fabrication technology of the U{sub 3}Si fuel dispersed in aluminum for the localization of HANARO driver fuel has been launches. The increase of production yield of LEU metal, the establishment of measurement method of homogeneity, and electron beam welding process were performed. Irradiation test under normal operation condition, had been carried out and any clues of the fuel assembly breakdown was not detected. The 2nd test fuel assembly has been irradiated at HANARO reactor since 17th June 1999. The quality assurance system has been re-established and the eddy current test technique has been developed. The irradiation test for U{sub 3}Si{sub 2} dispersed fuels at HANARO reactor has been carried out in order to compare the in-pile performance of between the two types of U{sub 3}Si{sub 2} fuels, prepared by both the atomization and comminution processes. KAERI has also conducted all safety-related works such as the design and the fabrication of irradiation rig, the analysis of irradiation behavior, thermal hydraulic characteristics, stress analysis for irradiation rig, and thermal analysis fuel plate, for the mini-plate prepared by international research cooperation being irradiated safely at HANARO. Pressure drop test, vibration test and endurance test were performed. The characterization on powders of U-(5.4 {approx} 10 wt%) Mo alloy depending on Mo content prepared by rotating disk centrifugal atomization process was carried out in order to investigate the phase stability of the atomized U-Mo alloy system. The {gamma}-U phase stability and the thermal compatibility of atomized U-16at.%Mo and U-14at.%Mo-2at.%X(: Ru, Os) dispersion fuel meats at an elevated temperature have been investigated. The volume increases of U-Mo compatibility specimens were almost the same as or smaller than those of U{sub 3}Si{sub 2}. However the atomized alloy fuel exhibited a better irradiation performance than the comminuted alloy. The RERTR-3 irradiation test of nano

  12. A fast and flexible reactor physics model for simulating neutron spectra and depletion in fast reactors

    Science.gov (United States)

    Recktenwald, Geoff; Deinert, Mark

    2010-03-01

    Determining the time dependent concentration of isotopes within a nuclear reactor core is central to the analysis of nuclear fuel cycles. We present a fast, flexible tool for determining the time dependent neutron spectrum within fast reactors. The code (VBUDS: visualization, burnup, depletion and spectra) uses a two region, multigroup collision probability model to simulate the energy dependent neutron flux and tracks the buildup and burnout of 24 actinides, as well as fission products. While originally developed for LWR simulations, the model is shown to produce fast reactor spectra that show high degree of fidelity to available fast reactor benchmarks.

  13. Development of technology for next generation reactor - Development of next generation reactor in Korea -

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jong Kyun; Chang, Moon Heuy; Hwang, Yung Dong [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)] [and others

    1993-09-01

    The project, development of next generation reactor, aims overall related technology development and obtainment of related license in 2001. The development direction is to determine the reactor type and to build up the design concept in 1994. For development trend analysis of foreign next generation reactor, level-1 PSA, fuel cycle analysis and computer code development are performed on System 80+ and AP 600. Especially for design characteristics analysis and volume upgrade of AP 600, nuclear fuel and reactor core design analysis, coolant circuit design analysis, mechanical structure design analysis and safety analysis etc. are performed. (Author).

  14. Steady State Analysis of Small Molten Salt Reactor : Effect of Fuel Salt Flow on Reactor Characteristics

    OpenAIRE

    Yamamoto, Takahisa; MITACHI, Koshi; Suzuki, Takashi

    2005-01-01

    The Molten Salt Reactor (MSR) is a thermal neutron reactor with graphite moderation and operates on the thorium-uranium fuel cycle. The feature of the MSR is that fuel salt flows inside the reactor during the nuclear fission reaction. In the previous study, the authors developed numerical model with which to simulate the effects of fuel salt flow on the reactor characteristics. In this study, we apply the model to the steady-state analysis of a small MSR system and estimate the effects of fue...

  15. A Preliminary Analysis of Reactor Performance Test (LOEP) for a Research Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyeonil; Park, Su-Ki [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2015-10-15

    The final phase of commissioning is reactor performance test, which is to prove the integrated performance and safety of the research reactor at full power with fuel loaded such as neutron power calibration, Control Absorber Rod/Second Shutdown Rod drop time, InC function test, Criticality, Rod worth, Core heat removal with natural mechanism, and so forth. The last test will be safety-related one to assure the result of the safety analysis of the research reactor is marginal enough to be sure about the nuclear safety by showing the reactor satisfies the acceptance criteria of the safety functions such as for reactivity control, maintenance of auxiliaries, reactor pool water inventory control, core heat removal, and confinement isolation. After all, the fuel integrity will be ensured by verifying there is no meaningful change in the radiation levels. To confirm the performance of safety equipment, loss of normal electric power (LOEP), possibly categorized as Anticipated Operational Occurrence (AOO), is selected as a key experiment to figure out how safe the research reactor is before turning over the research reactor to the owner. This paper presents a preliminary analysis of the reactor performance test (LOEP) for a research reactor. The results showed how different the transient between conservative estimate and best estimate will look. Preliminary analyses have shown all probable thermal-hydraulic transient behavior of importance as to opening of flap valve, minimum critical heat flux ratio, the change of flow direction, and important values of thermal-hydraulic parameters.

  16. Hysteresis phenomenon in nuclear reactor dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Pirayesh, Behnam; Pazirandeh, Ali [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Dept. of Nuclear Engineering, Science and Research Branch; Akbari, Monireh [Shahid Rajaee Teacher Training Univ., Tehran (Iran, Islamic Republic of). Dept. of Mathematics

    2017-05-15

    This paper applies a nonlinear analysis method to show that hysteresis phenomenon, due to the Saddle-node bifurcation, may occur in the nuclear reactor. This phenomenon may have significant effects on nuclear reactor dynamics and can even be the beginning of a nuclear reactor accident. A system of four dimensional nonlinear ordinary differential equations was considered to study the hysteresis phenomenon in a typical nuclear reactor. It should be noted that the reactivity was considered as a nonlinear function of state variables. The condition for emerging hysteresis was investigated using Routh-Hurwitz criterion and Sotomayor's theorem for saddle node bifurcation. A numerical analysis is also provided to illustrate the analytical results.

  17. Optimization of a sequence of reactors

    DEFF Research Database (Denmark)

    Vidal, Rene Victor Valqui

    1991-01-01

    Concerns the optimal production of sulphuric acid in a sequence of reactors. Using a suitable approximation to the objective function, this problem can easily be solved using the maximum principle. A numerical example documents the applicability of the suggested approach...

  18. Interactions of Pellet with Reactor Relevant Plasma

    Institute of Scientific and Technical Information of China (English)

    PENGLilin; DENGBaiquan; YANJiancheng

    2003-01-01

    Extended algorithm has been developed for ablation rate calculations of Li, Be, B impurity pellets and five combinations of solid isotopic hydrogenic H2, HD, D2, DT, T2 pellets. Numerical calculations have been performed for reactor relevant plasma.

  19. Gas pollutant cleaning by a membrane reactor

    Directory of Open Access Journals (Sweden)

    Kaldis Sotiris

    2006-01-01

    Full Text Available An alternative technology for the removal of gas pollutants at the integrated gasification combined cycle process for power generation is the use of a catalytic membrane reactor. In the present study, ammonia decomposition in a catalytic reactor, with a simultaneous removal of hydrogen through a ceramic membrane, was investigated. A Ni/Al2O3 catalyst was prepared by the dry and wet impregnation method and characterized by the inductively coupled plasma method, scanning electron microscopy, X-ray diffraction, and N2 adsorption before and after activation. Commercially available a-Al2O3 membranes were also characterized and the permeabilities and permselectivities of H2, N2, and CO2 were measured by the variable volume method. In parallel with the experimental analysis, the necessary mathematical models were developed to describe the operation of the catalytic membrane reactor and to compare its performance with the conventional reactor. .

  20. Autonomous Control of Space Nuclear Reactors Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Nuclear reactors to support future lunar and Mars robotic and manned missions impose new and innovative technological requirements for their control and protection...

  1. EMERGING TECHNOLOGY BULLETIN: SPOUTED BED REACTOR

    Science.gov (United States)

    The Spouted Bed Reactor (SBR) technology utilizes the unique attributes of the "spouting " fluidization regime, which can provide heat transfer rates comparable to traditional fluid beds, while providing robust circulation of highly heterogeneous solids, concurrent with very agg...

  2. Molten salt reactors - safety options galore

    Energy Technology Data Exchange (ETDEWEB)

    Gat, U. [Oak Ridge National Lab., TN (United States); Dodds, H.L. [Univ. of Tennessee, Knoxville, TN (United States)

    1997-03-01

    Safety features and attributes of molten salt reactors (MSR) are described. The unique features of fluid fuel reactors of on-line continuous processing and the ability for so-called external cooling result in simple and safe designs with low excess reactivity, low fission product inventory, and small source term. These, in turn, make a criticality accident unlikely and reduce the severity of a loss of coolant to where they are no longer severe accidents. A melt down is not an accident for a reactor that uses molten fuel. The molten salts are stable, non-reactive and efficient heat transfer media that operate at high temperatures at low pressures and are highly compatible with selected structural materials. All these features reduce the accident plethora. Freeze valves can be used for added safety. An ultimate safe reactor (U.S.R) is described with safety features that are passive, inherent and non-tamperable (PINT).

  3. Dismantling decontamination of research reactor equipment

    Energy Technology Data Exchange (ETDEWEB)

    Voronik, N. I.; Davydov, Yu. P.; Shatilo, N. N. [Institute of Radioecological Problems Belarus Ac. Sci., Minsk-Sosny (Belarus)

    1999-07-01

    The purpose of the work was to check applicability of the existing and new compositions for decontamination and their adjustment to the specific conditions dealing with operation of the research reactor. (author)

  4. Chemical reactor modeling multiphase reactive flows

    CERN Document Server

    Jakobsen, Hugo A

    2014-01-01

    Chemical Reactor Modeling closes the gap between Chemical Reaction Engineering and Fluid Mechanics.  The second edition consists of two volumes: Volume 1: Fundamentals. Volume 2: Chemical Engineering Applications In volume 1 most of the fundamental theory is presented. A few numerical model simulation application examples are given to elucidate the link between theory and applications. In volume 2 the chemical reactor equipment to be modeled are described. Several engineering models are introduced and discussed. A survey of the frequently used numerical methods, algorithms and schemes is provided. A few practical engineering applications of the modeling tools are presented and discussed. The working principles of several experimental techniques employed in order to get data for model validation are outlined. The monograph is based on lectures regularly taught in the fourth and fifth years graduate courses in transport phenomena and chemical reactor modeling, and in a post graduate course in modern reactor m...

  5. Reactor Antineutrinos: From Confusion to Clarity

    Science.gov (United States)

    Dwyer, Dan

    2016-09-01

    Antineutrinos emitted by nuclear reactors have been a powerful tool for particle physics, demonstrating the existence of these weakly-interacting particles as well as their flavor oscillation. Despite these successes, our understanding of the total flux and energy spectra of reactor antineutrinos has been fraught with problems. I will give a brief overview of the unexpected developments in this field, and discuss upcoming measurements of antineutrinos, beta decays, and nuclear fission which are relevant to these questions. These measurements are expected to clarify many currently murky issues, including the hypothetical oscillation of reactor antineutrinos to sterile states. The results should also provide a unique perspective into the nuclear physics of fission reactors. DOE OHEP DE-AC02-05CH11231.

  6. The Bifurcation Behavior of CO Coupling Reactor

    Institute of Scientific and Technical Information of China (English)

    徐艳; 马新宾; 许根慧

    2005-01-01

    The bifurcation behavior of the CO coupling reactor was examined based on the one-dimensional pseudohomogeneous axial dispersion dynamic model. The method of finite difference was used for solving the boundary value problem; the continuation technique and the direct method were applied to determine the bifurcation diagram.The effects of dimensionless adiabatic temperature rise, Damkoehler number, activation energy, heat transfer coefficient and feed ratio on the bifurcation behavior were investigated. It was shown that there existed static bifurcation and the oscillations did not occur in the reactor. The result also revealed that the reactor exhibited at most 1-3-1 multiplilicity patterns within the range of practical possible parameters and the measures, such as weakening the axial dispersion of reactor, enhancing heat transfer, decreasing the concentration of ethyl nitrite, were efficient for avoiding the possible risk of multiple steady states.

  7. Heat pipe reactors for space power applications

    Science.gov (United States)

    Koenig, D. R.; Ranken, W. A.; Salmi, E. W.

    1977-01-01

    A family of heat pipe reactors design concepts has been developed to provide heat to a variety of electrical conversion systems. Three power plants are described that span the power range 1-500 kWe and operate in the temperature range 1200-1700 K. The reactors are fast, compact, heat-pipe cooled, high-temperature nuclear reactors fueled with fully enriched refractory fuels, UC-ZrC or UO2. Each fuel element is cooled by an axially located molybdenum heat pipe containing either sodium or lithium vapor. Virtues of the reactor designs are the avoidance of single-point failure mechanisms, the relatively high operating temperature, and the expected long lifetimes of the fuel element components.

  8. Corrosion Minimization for Research Reactor Fuel

    Energy Technology Data Exchange (ETDEWEB)

    Eric Shaber; Gerard Hofman

    2005-06-01

    Existing university research reactors are being converted to use low-enriched uranium fue to eliminate the use of highly-enriched uranium. These conversions require increases in fuel loading that will result in the use of elements with more fuel plates, resulting in a net decrease in the water annulus between fuel plates. The proposed decrease in the water annulus raises questions about the requirements and stability of the surface hydroxide on the aluminum fuel cladding and the potential for runaway corrosion resulting in fuel over-temperature incidents. The Nuclear Regulatory Commission (NRC), as regulator for these university reactors, must ensure that proposed fuel modifications will not result in any increased risk or hazard to the reactor operators or the public. This document reviews the characteristics and behavior of aluminum hydroxides, analyzes the drivers for fuel plate corrosion, reviews relevant historical incidents, and provides recommendations on fuel design, surface treatment, and reactor operational practices to avoid corrosion issues.

  9. µ-reactors for Heterogeneous Catalysis

    DEFF Research Database (Denmark)

    Jensen, Robert

    catalyst surface area by reacting off an adsorbed layer of oxygen with CO. This procedure can be performed at temperatures low enough that sintering of Pt nanoparticles is not an issue. Some results from the reactors are presented. In particular an unexpected oscillation phenomenon of CO-oxidation on Pt...... nanoparticles are presented in detail. The sensitivity of the reactors are currently being investigated with CO oxidation on Pt thin films as a test reaction, and the results so far are presented. We have at this point shown that we are able to reach full conversion with a catalyst area of 38 µm2 with a turn......This thesis is the summary of my work on the µ-reactor platform. The concept of µ-reactors is presented and some of the experimental challenges are outlined. The various experimental issues regarding the platform are discussed and the actual implementation of three generations of the setup...

  10. Microbial degradation of MTBE in reactors

    DEFF Research Database (Denmark)

    Waul, Christopher Kevin; Arvin, Erik; Schmidt, Jens Ejbye

    2007-01-01

    findings were: membrane bioreactors and fluidized bed reactors had the highest volumetric removal rates of all reactors studied, in the order of 1 000 mg/(l d); competition for oxygen, nutrients and occupancy between MTBE degraders and oxidisers of co-contaminants such as, ammonium and the group of benzene......, toluene, ethylbenzene and xylenes, may reduce the removal rates of MTBE, or prevent its removal in reactors. With mathematical modelling, the long startup time required for some MTBE degrading reactors could be predicted. Long startup times of up to 200 days were due to the low maximum growth rate...... of the MTBE degraders, in the order of 0.1 d−1 or less, at 25 °C. However, despite this, high volumetric MTBE removal rates were found to be possible after the startup period when the biomass concentration reached a steady state....

  11. Advanced Test Reactor National Scientific User Facility

    Energy Technology Data Exchange (ETDEWEB)

    Frances M. Marshall; Jeff Benson; Mary Catherine Thelen

    2011-08-01

    The Advanced Test Reactor (ATR), at the Idaho National Laboratory (INL), is a large test reactor for providing the capability for studying the effects of intense neutron and gamma radiation on reactor materials and fuels. The ATR is a pressurized, light-water, high flux test reactor with a maximum operating power of 250 MWth. The INL also has several hot cells and other laboratories in which irradiated material can be examined to study material irradiation effects. In 2007 the US Department of Energy (DOE) designated the ATR as a National Scientific User Facility (NSUF) to facilitate greater access to the ATR and the associated INL laboratories for material testing research by a broader user community. This paper highlights the ATR NSUF research program and the associated educational initiatives.

  12. Molecular ecology of anaerobic reactor systems

    DEFF Research Database (Denmark)

    Hofman-Bang, H. Jacob Peider; Zheng, D.; Westermann, Peter

    2003-01-01

    Anaerobic reactor systems are essential for the treatment of solid and liquid wastes and constitute a core facility in many waste treatment plants. Although much is known about the basic metabolism in different types of anaerobic reactors, little is known about the microbes responsible for these ...... specific nucleic acid probes are discussed and exemplified by studies of anaerobic granular sludge, biofilm and digester systems......Anaerobic reactor systems are essential for the treatment of solid and liquid wastes and constitute a core facility in many waste treatment plants. Although much is known about the basic metabolism in different types of anaerobic reactors, little is known about the microbes responsible...... and malfunctions of anaerobic digesters occasionally experienced, leading to sub-optimal methane production and wastewater treatment. Using a variety of molecular techniques, we are able to determine which microorganisms are active, where they are active, and when they are active, but we still need to determine...

  13. Developments and Tendencies in Fission Reactor Concepts

    Science.gov (United States)

    Adamov, E. O.; Fuji-Ie, Y.

    This chapter describes, in two parts, new-generation nuclear energy systems that are required to be in harmony with nature and to make full use of nuclear resources. The issues of transmutation and containment of radioactive waste will also be addressed. After a short introduction to the first part, Sect. 58.1.2 will detail the requirements these systems must satisfy on the basic premise of peaceful use of nuclear energy. The expected designs themselves are described in Sect. 58.1.3. The subsequent sections discuss various types of advanced reactor systems. Section 58.1.4 deals with the light water reactor (LWR) whose performance is still expected to improve, which would extend its application in the future. The supercritical-water-cooled reactor (SCWR) will also be shortly discussed. Section 58.1.5 is mainly on the high temperature gas-cooled reactor (HTGR), which offers efficient and multipurpose use of nuclear energy. The gas-cooled fast reactor (GFR) is also included. Section 58.1.6 focuses on the sodium-cooled fast reactor (SFR) as a promising concept for advanced nuclear reactors, which may help both to achieve expansion of energy sources and environmental protection thus contributing to the sustainable development of mankind. The molten-salt reactor (MSR) is shortly described in Sect. 58.1.7. The second part of the chapter deals with reactor systems of a new generation, which are now found at the research and development (R&D) stage and in the medium term of 20-30 years can shape up as reliable, economically efficient, and environmentally friendly energy sources. They are viewed as technologies of cardinal importance, capable of resolving the problems of fuel resources, minimizing the quantities of generated radioactive waste and the environmental impacts, and strengthening the regime of nonproliferation of the materials suitable for nuclear weapons production. Particular attention has been given to naturally safe fast reactors with a closed fuel cycle (CFC

  14. A comparison of radioactive waste from first generation fusion reactors and fast fission reactors with actinide recycling

    Energy Technology Data Exchange (ETDEWEB)

    Koch, M.; Kazimi, M.S.

    1991-04-01

    Limitations of the fission fuel resources will presumably mandate the replacement of thermal fission reactors by fast fission reactors that operate on a self-sufficient closed fuel cycle. This replacement might take place within the next one hundred years, so the direct competitors of fusion reactors will be fission reactors of the latter rather than the former type. Also, fast fission reactors, in contrast to thermal fission reactors, have the potential for transmuting long-lived actinides into short-lived fission products. The associated reduction of the long-term activation of radioactive waste due to actinides makes the comparison of radioactive waste from fast fission reactors to that from fusion reactors more rewarding than the comparison of radioactive waste from thermal fission reactors to that from fusion reactors. Radioactive waste from an experimental and a commercial fast fission reactor and an experimental and a commercial fusion reactor has been characterized. The fast fission reactors chosen for this study were the Experimental Breeder Reactor 2 and the Integral Fast Reactor. The fusion reactors chosen for this study were the International Thermonuclear Experimental Reactor and a Reduced Activation Ferrite Helium Tokamak. The comparison of radioactive waste parameters shows that radioactive waste from the experimental fast fission reactor may be less hazardous than that from the experimental fusion reactor. Inclusion of the actinides would reverse this conclusion only in the long-term. Radioactive waste from the commercial fusion reactor may always be less hazardous than that from the commercial fast fission reactor, irrespective of the inclusion or exclusion of the actinides. The fusion waste would even be far less hazardous, if advanced structural materials, like silicon carbide or vanadium alloy, were employed.

  15. Completion summary for borehole USGS 136 near the Advanced Test Reactor Complex, Idaho National Laboratory, Idaho

    Science.gov (United States)

    Twining, Brian V.; Bartholomay, Roy C.; Hodges, Mary K.V.

    2012-01-01

    carbon, volatile organic compounds, stable isotopes, and radionuclides. Water samples from borehole USGS 136 indicated that concentrations of tritium, sulfate, and chromium were affected by wastewater disposal practices at the Advanced Test Reactor Complex. Depth-discrete groundwater samples were collected in the open borehole USGS 136 near 965, 710, and 573 ft BLS using a thief sampler; on the basis of selected constituents, deeper groundwater samples showed no influence from wastewater disposal at the Advanced Test Reactor Complex.

  16. Genome-wide linkage and copy number variation analysis reveals 710 kb duplication on chromosome 1p31.3 responsible for autosomal dominant omphalocele

    Science.gov (United States)

    Radhakrishna, Uppala; Nath, Swapan K; McElreavey, Ken; Ratnamala, Uppala; Sun, Celi; Maiti, Amit K; Gagnebin, Maryline; Béna, Frédérique; Newkirk, Heather L; Sharp, Andrew J; Everman, David B; Murray, Jeffrey C; Schwartz, Charles E; Antonarakis, Stylianos E; Butler, Merlin G

    2017-01-01

    Background Omphalocele is a congenital birth defect characterised by the presence of internal organs located outside of the ventral abdominal wall. The purpose of this study was to identify the underlying genetic mechanisms of a large autosomal dominant Caucasian family with omphalocele. Methods and findings A genetic linkage study was conducted in a large family with an autosomal dominant transmission of an omphalocele using a genome-wide single nucleotide polymorphism (SNP) array. The analysis revealed significant evidence of linkage (non-parametric NPL = 6.93, p=0.0001; parametric logarithm of odds (LOD) = 2.70 under a fully penetrant dominant model) at chromosome band 1p31.3. Haplotype analysis narrowed the locus to a 2.74 Mb region between markers rs2886770 (63014807 bp) and rs1343981 (65757349 bp). Molecular characterisation of this interval using array comparative genomic hybridisation followed by quantitative microsphere hybridisation analysis revealed a 710 kb duplication located at 63.5–64.2 Mb. All affected individuals who had an omphalocele and shared the haplotype were positive for this duplicated region, while the duplication was absent from all normal individuals of this family. Multipoint linkage analysis using the duplication as a marker yielded a maximum LOD score of 3.2 at 1p31.3 under a dominant model. The 710 kb duplication at 1p31.3 band contains seven known genes including FOXD3, ALG6, ITGB3BP, KIAA1799, DLEU2L, PGM1, and the proximal portion of ROR1. Importantly, this duplication is absent from the database of genomic variants. Conclusions The present study suggests that development of an omphalocele in this family is controlled by overexpression of one or more genes in the duplicated region. To the authors’ knowledge, this is the first reported association of an inherited omphalocele condition with a chromosomal rearrangement. PMID:22499347

  17. Design of an Organic Simplified Nuclear Reactor

    OpenAIRE

    Koroush Shirvan; Eric Forrest

    2016-01-01

    Numerous advanced reactor concepts have been proposed to replace light water reactors ever since their establishment as the dominant technology for nuclear energy production. While most designs seek to improve cost competitiveness and safety, the implausibility of doing so with affordable materials or existing nuclear fuel infrastructure reduces the possibility of near-term deployment, especially in developing countries. The organic nuclear concept, first explored in the 1950s, offers an attr...

  18. Monitoring and control of anaerobic reactors

    DEFF Research Database (Denmark)

    Pind, Peter Frode; Angelidaki, Irini; Ahring, Birgitte Kiær;

    2003-01-01

    control approaches that have been used are comprehensively described. These include simple and adaptive controllers, as well as more recent developments such as fuzzy controllers, knowledge-based controllers and controllers based on neural networks.......The current status in monitoring and control of anaerobic reactors is reviewed. The influence of reactor design and waste composition on the possible monitoring and control schemes is examined. After defining the overall control structure, and possible control objectives, the possible process...

  19. COUPLED FAST-THERMAL POWER BREEDER REACTOR

    Science.gov (United States)

    Avery, R.

    1961-07-18

    A nuclear reactor having a region operating predominantly on fast neutrons and another region operating predominantly on slow neutrons is described. The fast region is a plutonium core and the slow region is a natural uranium blanket around the core. Both of these regions are free of moderator. A moderating reflector surrounds the uranium blanket. The moderating material and thickness of the reflector are selected so that fissions in the uranium blanket make a substantial contribution to the reactivity of the reactor.

  20. Environmental Information Document: L-reactor reactivation

    Energy Technology Data Exchange (ETDEWEB)

    Mackey, H.E. Jr. (comp.)

    1982-04-01

    Purpose of this Environmental Information Document is to provide background for assessing environmental impacts associated with the renovation, restartup, and operation of L Reactor at the Savannah River Plant (SRP). SRP is a major US Department of Energy installation for the production of nuclear materials for national defense. The purpose of the restart of L Reactor is to increase the production of nuclear weapons materials, such as plutonium and tritium, to meet projected needs in the nuclear weapons program.

  1. Short-baseline reactor neutrino oscillations

    Energy Technology Data Exchange (ETDEWEB)

    Mariani, C. [Department of Physics, Columbia University, New York, NY 10027 (United States)

    2011-08-15

    The neutrino mixing angle {theta}13 is currently a high-priority topic in the field of neutrino physics, with three different reactor neutrino experiments under way, searching for neutrino oscillations induced by this angle. A description of the reactor experiments searching for a non-zero value of {theta}13 is given, together with a discussion of their sensitivity within the next few years.

  2. The Daya Bay Reactor Neutrino Experiment

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    On Aug.15, 201l, a new large-scale scientific facility in China, Daya Bay Reactor Neutrino Experiment, started to operate. It is located in Daya Bay Nuclear Power Plant in Guangdong Province, around 50kin to both Hong Kong and Shenzhen City. The main scientific goal is to precisely determine the neutrino mixing angle 013 by detecting neutrinos from the reactors at different distances.

  3. Automatic safety rod for reactors. [LMFBR

    Science.gov (United States)

    Germer, J.H.

    1982-03-23

    An automatic safety rod for a nuclear reactor containing neutron absorbing material and designed to be inserted into a reactor core after a loss-of-flow. Actuation is based upon either a sudden decrease in core pressure drop or the pressure drop decreases below a predetermined minimum value. The automatic control rod includes a pressure regulating device whereby a controlled decrease in operating pressure due to reduced coolant flow does not cause the rod to drop into the core.

  4. Optimization of a sequence of reactors

    DEFF Research Database (Denmark)

    Vidal, Rene Victor Valqui

    1991-01-01

    Concerns the optimal production of sulphuric acid in a sequence of reactors. Using a suitable approximation to the objective function, this problem can easily be solved using the maximum principle. A numerical example documents the applicability of the suggested approach......Concerns the optimal production of sulphuric acid in a sequence of reactors. Using a suitable approximation to the objective function, this problem can easily be solved using the maximum principle. A numerical example documents the applicability of the suggested approach...

  5. Oscillation Parameters with forthcoming Reactor Neutrino Experiments

    CERN Document Server

    Lasserre, Thierry

    2010-01-01

    I review the status of the forthcoming reactor neutrino experiments that toe the cutting edge of neutrino oscillation research. Kilometer baseline oscillation experiments (Double Chooz, Daya Bay, and Reno) will soon play a relevant role providing clean information on the last undetermined neutrino mixing angle !13. A 50-70 km baseline reactor neutrino experiment could later provide the best sensitivity to the !12 mixing angle.

  6. Strengthening IAEA Safeguards for Research Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Reid, Bruce D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Anzelon, George A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Budlong-Sylvester, Kory [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-09-01

    During their December 10-11, 2013, workshop in Grenoble France, which focused on the history and future of safeguarding research reactors, the United States, France and the United Kingdom (UK) agreed to conduct a joint study exploring ways to strengthen the IAEA’s safeguards approach for declared research reactors. This decision was prompted by concerns about: 1) historical cases of non-compliance involving misuse (including the use of non-nuclear materials for production of neutron generators for weapons) and diversion that were discovered, in many cases, long after the violations took place and as part of broader pattern of undeclared activities in half a dozen countries; 2) the fact that, under the Safeguards Criteria, the IAEA inspects some reactors (e.g., those with power levels under 25 MWt) less than once per year; 3) the long-standing precedent of States using heavy water research reactors (HWRR) to produce plutonium for weapons programs; 4) the use of HEU fuel in some research reactors; and 5) various technical characteristics common to some types of research reactors that could provide an opportunity for potential proliferators to misuse the facility or divert material with low probability of detection by the IAEA. In some research reactors, for example, such characteristics include rapid on-line refueling, and a core design with room for such a large number of assemblies or targets that it is difficult to detect diversion or undeclared irradiation. In addition, infrastructure associated with research reactors, such as hot cells, where plutonium could be separated, could pose a safeguards challenge because, in some cases, they are not declared (because they are not located in the facility or because nuclear materials are not foreseen to be processed inside) and may not be accessible to inspectors in States without an Additional Protocol in force.

  7. Current status of fast reactor physics

    Energy Technology Data Exchange (ETDEWEB)

    Hummel, H.H.

    1979-01-01

    The subject of calculation of reactivity coefficients for fast reactors is developed, starting with a discussion of the status of relevant nuclear data and proceeding to the subjects of group cross section generation and of methods of obtaining reactivity coefficients from group cross sections. Reactivity coefficients measured in critical experiments are compared with calculated values. Dependence of reactivity coefficients on reactor design is discussed. Finally, results of the recent international comparison of calculated reactivity coefficients are presented.

  8. Advanced Reactors Transition Program Resource Loaded Schedule

    Energy Technology Data Exchange (ETDEWEB)

    GANTT, D.A.

    2000-01-12

    The Advanced Reactors Transition (ART) Resource Loaded Schedule (RLS) provides a cost and schedule baseline for managing the project elements within the ART Program. The Fast Flux Test Facility (FETF) activities are delineated through the end of FY 2000, assuming continued standby. The Nuclear Energy (NE) Legacies and Plutonium Recycle Test Reactor (PRTR) activities are delineated through the end of the deactivation process. This revision reflects the 19 Oct 1999 baseline.

  9. Advanced Reactors Transition Program Resource Loaded Schedule

    Energy Technology Data Exchange (ETDEWEB)

    BOWEN, W.W.

    1999-11-08

    The Advanced Reactors Transition (ART) Resource Loaded Schedule (RLS) provides a cost and schedule baseline for managing the project elements within the ART Program. The Fast Flux Test Facility (FFTF) activities are delineated through the end of FY 2000, assuming continued standby. The Nuclear Energy (NE) Legacies and Plutonium Recycle Test Reactor (PRTR) activities are delineated through the end of the deactivation process. This document reflects the 1 Oct 1999 baseline.

  10. Optimally moderated nuclear fission reactor and fuel source therefor

    Science.gov (United States)

    Ougouag, Abderrafi M.; Terry, William K.; Gougar, Hans D.

    2008-07-22

    An improved nuclear fission reactor of the continuous fueling type involves determining an asymptotic equilibrium state for the nuclear fission reactor and providing the reactor with a moderator-to-fuel ratio that is optimally moderated for the asymptotic equilibrium state of the nuclear fission reactor; the fuel-to-moderator ratio allowing the nuclear fission reactor to be substantially continuously operated in an optimally moderated state.

  11. Development of computer simulator for coal liquefaction reactor

    Energy Technology Data Exchange (ETDEWEB)

    Yawata, T.; Kobayashi, M.; Ohi, S.; Itho, H.; Hiraide, M. [Nippon Oil Co., Ltd., Tokyo (Japan)

    1995-12-31

    The computer simulator for a coal liquefaction reactor is a useful engineering tool to analyse the data of such reactors. The authors applied this technique to a reactor in the NEDOL process to predict the performance of the reactor, and to assist in the design of a reactor for demonstration plant. The development program of the simulator and its utilization plan are discussed. 4 figs., 2 tabs.

  12. Thermal-hydraulic interfacing code modules for CANDU reactors

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.S.; Gold, M.; Sills, H. [Ontario Hydro Nuclear, Toronto (Canada)] [and others

    1997-07-01

    The approach for CANDU reactor safety analysis in Ontario Hydro Nuclear (OHN) and Atomic Energy of Canada Limited (AECL) is presented. Reflecting the unique characteristics of CANDU reactors, the procedure of coupling the thermal-hydraulics, reactor physics and fuel channel/element codes in the safety analysis is described. The experience generated in the Canadian nuclear industry may be useful to other types of reactors in the areas of reactor safety analysis.

  13. Reactor Simulator Integration and Testing

    Science.gov (United States)

    Schoenfield, M. P.; Webster, K. L.; Pearson, J. B.

    2013-01-01

    As part of the Nuclear Systems Office Fission Surface Power Technology Demonstration Unit (TDU) project, a reactor simulator (RxSim) test loop was designed and built to perform integrated testing of the TDU components. In particular, the objectives of RxSim testing were to verify the operation of the core simulator, the instrumentation and control system, and the ground support gas and vacuum test equipment. In addition, it was decided to include a thermal test of a cold trap purification design and a pump performance test at pump voltages up to 150 V because the targeted mass flow rate of 1.75 kg/s was not obtained in the RxSim at the originally constrained voltage of 120 V. This Technical Memorandum summarizes RxSim testing. The gas and vacuum ground support test equipment performed effectively in NaK fill, loop pressurization, and NaK drain operations. The instrumentation and control system effectively controlled loop temperature and flow rates or pump voltage to targeted settings. The cold trap design was able to obtain the targeted cold temperature of 480 K. An outlet temperature of 636 K was obtained, which was lower than the predicted 750 K but 156 K higher than the cold temperature, indicating the design provided some heat regeneration. The annular linear induction pump tested was able to produce a maximum flow rate of 1.53 kg/s at 800 K when operated at 150 V and 53 Hz.

  14. Generic Magnetic Fusion Reactor Revisited

    Science.gov (United States)

    Sheffield, John; Milora, Stanley

    2015-11-01

    The original Generic Magnetic Fusion Reactor paper was published in 1986. This update describes what has changed in 30 years. Notably, the construction of ITER is providing important benchmark numbers for technologies and costs. In addition, we use a more conservative neutron wall flux and fluence. But these cost-increasing factors are offset by greater optimism on the thermal-electric conversion efficiency and potential availability. The main examples show the cost of electricity (COE) as a function of aspect ratio and neutron flux to the first wall. The dependence of the COE on availability, thermo-electric efficiency, electrical power output, and the present day's low interest rates is also discussed. Interestingly, at fixed aspect ratio there is a shallow minimum in the COE at neutron flux around 2.5 MW/m2. The possibility of operating with only a small COE penalty at even lower wall loadings (to 1.0 MW/m2 at larger plant size) and the use of niobium-titanium coils are also investigated. J. Sheffield was supported by ORNL subcontract 4000088999 with the University of Tennessee.

  15. Enzymatic processing in microfluidic reactors.

    Science.gov (United States)

    Miyazaki, Masaya; Honda, Takeshi; Yamaguchi, Hiroshi; Briones, Maria Portia P; Maeda, Hideaki

    2008-01-01

    Microreaction technology is an interdisciplinary area of science and engineering. It has attracted the attention of researchers from different fields in the past few years and consequently, several microreactors have been developed. Enzymes are organic catalysts used for the production useful substances in an environmentally friendly way, and have high potential for analytical applications. However, relatively few enzymatic processes have been commercialized because of problems in the stability of enzyme molecule, and the cost and efficiency of the reactions. Thus, there have been demands for innovation in process engineering particularly for enzymatic reactions, and microreaction devices can serve as efficient tools for the development of enzyme processes. In this review, we summarize the recent advances of microchannel reaction technologies and focus our discussion on enzyme microreactors. We discuss the manufacturing process of microreaction devices and the advantages of microreactors compared with the conventional reactors. Fundamental techniques for enzyme microreactors and important applications of this multidisciplinary technology in chemical processing are also included in our topics.

  16. Solid oxide electrochemical reactor science.

    Energy Technology Data Exchange (ETDEWEB)

    Sullivan, Neal P. (Colorado School of Mines, Golden, CO); Stechel, Ellen Beth; Moyer, Connor J. (Colorado School of Mines, Golden, CO); Ambrosini, Andrea; Key, Robert J. (Colorado School of Mines, Golden, CO)

    2010-09-01

    Solid-oxide electrochemical cells are an exciting new technology. Development of solid-oxide cells (SOCs) has advanced considerable in recent years and continues to progress rapidly. This thesis studies several aspects of SOCs and contributes useful information to their continued development. This LDRD involved a collaboration between Sandia and the Colorado School of Mines (CSM) ins solid-oxide electrochemical reactors targeted at solid oxide electrolyzer cells (SOEC), which are the reverse of solid-oxide fuel cells (SOFC). SOECs complement Sandia's efforts in thermochemical production of alternative fuels. An SOEC technology would co-electrolyze carbon dioxide (CO{sub 2}) with steam at temperatures around 800 C to form synthesis gas (H{sub 2} and CO), which forms the building blocks for a petrochemical substitutes that can be used to power vehicles or in distributed energy platforms. The effort described here concentrates on research concerning catalytic chemistry, charge-transfer chemistry, and optimal cell-architecture. technical scope included computational modeling, materials development, and experimental evaluation. The project engaged the Colorado Fuel Cell Center at CSM through the support of a graduate student (Connor Moyer) at CSM and his advisors (Profs. Robert Kee and Neal Sullivan) in collaboration with Sandia.

  17. Decommissioning of the Salaspils Research Reactor

    Directory of Open Access Journals (Sweden)

    Abramenkovs Andris

    2011-01-01

    Full Text Available In May 1995, the Latvian government decided to shut down the Salaspils Research Reactor and to dispense with nuclear energy in the future. The reactor has been out of operation since July 1998. A conceptual study on the decommissioning of the Salaspils Research Reactor was drawn up by Noell-KRC-Energie- und Umwelttechnik GmbH in 1998-1999. On October 26th, 1999, the Latvian government decided to start the direct dismantling to “green-field” in 2001. The upgrading of the decommissioning and dismantling plan was carried out from 2003-2004, resulting in a change of the primary goal of decommissioning. Collecting and conditioning of “historical” radioactive wastes from different storages outside and inside the reactor hall became the primary goal. All radioactive materials (more than 96 tons were conditioned for disposal in concrete containers at the radioactive wastes depository “Radons” at the Baldone site. Protective and radiation measurement equipment of the personnel was upgraded significantly. All non-radioactive equipment and materials outside the reactor buildings were released for clearance and dismantled for reuse or conventional disposal. Contaminated materials from the reactor hall were collected and removed for clearance measurements on a weekly basis.

  18. Uncertainty quantification approaches for advanced reactor analyses.

    Energy Technology Data Exchange (ETDEWEB)

    Briggs, L. L.; Nuclear Engineering Division

    2009-03-24

    The original approach to nuclear reactor design or safety analyses was to make very conservative modeling assumptions so as to ensure meeting the required safety margins. Traditional regulation, as established by the U. S. Nuclear Regulatory Commission required conservatisms which have subsequently been shown to be excessive. The commission has therefore moved away from excessively conservative evaluations and has determined best-estimate calculations to be an acceptable alternative to conservative models, provided the best-estimate results are accompanied by an uncertainty evaluation which can demonstrate that, when a set of analysis cases which statistically account for uncertainties of all types are generated, there is a 95% probability that at least 95% of the cases meet the safety margins. To date, nearly all published work addressing uncertainty evaluations of nuclear power plant calculations has focused on light water reactors and on large-break loss-of-coolant accident (LBLOCA) analyses. However, there is nothing in the uncertainty evaluation methodologies that is limited to a specific type of reactor or to specific types of plant scenarios. These same methodologies can be equally well applied to analyses for high-temperature gas-cooled reactors and to liquid metal reactors, and they can be applied to steady-state calculations, operational transients, or severe accident scenarios. This report reviews and compares both statistical and deterministic uncertainty evaluation approaches. Recommendations are given for selection of an uncertainty methodology and for considerations to be factored into the process of evaluating uncertainties for advanced reactor best-estimate analyses.

  19. Supply of enriched uranium for research reactors

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, H. [NUKEM GmbH, Alzenau (Germany)

    1997-08-01

    Since the RERTR-meeting In Newport/USA in 1990 the author delivered a series of papers in connection with the fuel cycle for research reactors dealing with its front-end. In these papers the author underlined the need for unified specifications for enriched uranium metal suitable for the production of fuel elements and made proposals with regard to the re-use of in Europe reprocessed highly enriched uranium. With regard to the fuel cycle of research reactors the research reactor community was since 1989 more concentrating on the problems of its back-end since the USA stopped the acceptance of spent research reactor fuel on December 31, 1988. Now, since it is apparent that these back-end problem have been solved by AEA`s ability to reprocess and the preparedness of the USA to again accept physically spent research reactor fuel the author is focusing with this paper again on the front-end of the fuel cycle on the question whether there is at all a safe supply of low and high enriched uranium for research reactors in the future.

  20. A nanoliter-scale open chemical reactor.

    Science.gov (United States)

    Galas, Jean-Christophe; Haghiri-Gosnet, Anne-Marie; Estévez-Torres, André

    2013-02-01

    An open chemical reactor is a container that exchanges matter with the exterior. Well-mixed open chemical reactors, called continuous stirred tank reactors (CSTR), have been instrumental for investigating the dynamics of out-of-equilibrium chemical processes, such as oscillations, bistability, and chaos. Here, we introduce a microfluidic CSTR, called μCSTR, that reduces reagent consumption by six orders of magnitude. It consists of an annular reactor with four inlets and one outlet fabricated in PDMS using multi-layer soft lithography. A monolithic peristaltic pump feeds fresh reagents into the reactor through the inlets. After each injection the content of the reactor is continuously mixed with a second peristaltic pump. The efficiency of the μCSTR is experimentally characterized using a bromate, sulfite, ferrocyanide pH oscillator. Simulations accounting for the digital injection process are in agreement with experimental results. The low consumption of the μCSTR will be advantageous for investigating out-of-equilibrium dynamics of chemical processes involving biomolecules. These studies have been scarce so far because a miniaturized version of a CSTR was not available.

  1. Moving hot cell for LMFBR type reactor

    Energy Technology Data Exchange (ETDEWEB)

    Kanbe, Mitsuru

    1994-09-16

    A moving hot cell for an LMFBR type reactor is made movable on a reactor operation floor between a position just above the reactor container and a position retreated therefrom. Further, it comprises an overhung portion which can incorporate a spent fuel just thereunder, and a crane for moving a fuel assembly between a spent fuel cask and a reactor container. Further, an opening/closing means having a shielding structure is disposed to the bottom portion and the overhung portion thereof, to provide a sealing structure, in which only the receiving port for the spent fuel cask faces to the inner side, and the cask itself is disposed at the outside. Upon exchange of fuels, the movable hot cell is placed just above the reactor to take out the spent fuels, so that a region contaminated with primary sodium is limited within the hot cell. On the other hand, upon maintenance and repair for equipments, the hot cell is moved, thereby enabling to provide a not contaminated reactor operation floor. (N.H.).

  2. MOX in reactors: present and future

    Energy Technology Data Exchange (ETDEWEB)

    Arslan, Marc; Gros, Jean Pierre [AREVA NC - 33 rue La Fayette, 75009 Paris (France); Niquille, Aurelie; Marincic, Alexis [AREVA NP - Tour AREVA, 1 Place Jean Millier 92084 Paris La Defense (France)

    2010-07-01

    In Europe, MOX fuel has been supplied by AREVA for more than 30 years, to 36 reactors: 21 in France, 10 in Germany, 3 in Switzerland, 2 in Belgium. For the present and future, recycling is compulsory in the frame of sustainable development of nuclear energy. By 2030 the overall volume of used fuel will reach about 400 000 t worldwide. Their plutonium and uranium content represents a huge resource of energy to recycle. That is the reason why, the European Utilities issued an EUR (European Utilities Requirement) demanding new builds reactors to be able of using MOX Fuel Assemblies in up to 50 % of the core. AREVA GEN3+ reactors, like EPR{sup TM} or ATMEA{sup TM} designed with MHI partnership, are designed to answer any utility need of MOX recycling. The example of the EPR{sup TM} reactor operated with 100 % MOX core optimized for MOX recycling will be presented. A standard EPR{sup TM} can be operated with 100 % MOX core using an advanced homogeneous MOX (single Pu content) with highly improved performances (burn-up and Cycle length). The adaptations needed and the main operating and safety reactor features will be presented. AREVA offers the utilities throughout the world, fuel supply (UO{sub 2}, ERU, MOX), and reactors designed with all the needed capability for recycling. For each country and each utility, an adapted global solution, competitive and non proliferant can be proposed. (authors)

  3. Antineutrino reactor safeguards - a case study

    CERN Document Server

    Christensen, Eric; Jaffke, Patrick

    2013-01-01

    Antineutrinos have been proposed as a means of reactor safeguards for more than 30 years and there has been impressive experimental progress in neutrino detection. In this paper we conduct, for the first time, a case study of the application of antineutrino safeguards to a real-world scenario - the North Korean nuclear crisis in 1994. We derive detection limits to a partial or full core discharge in 1989 based on actual IAEA safeguards access and find that two independent methods would have yielded positive evidence for a second core with very high confidence. To generalize our results, we provide detailed estimates for the sensitivity to the plutonium content of various types of reactors, including most types of plutonium production reactors, based on detailed reactor simulations. A key finding of this study is that a wide class of reactors with a thermal power of less than 0.1-1 GWth can be safeguarded achieving IAEA goals for quantitative sensitivity and timeliness with detectors right outside the reactor ...

  4. FBR and RBR particle bed space reactors

    Energy Technology Data Exchange (ETDEWEB)

    Powell, J.R.; Botts, T.E.

    1983-01-01

    Compact, high-performance nuclear reactor designs based on High-Temperature Gas Reactors (HTGRs) particulate fuel are investigated. The large surface area available with the small-diameter (approx. 500 microns) particulate fuel allows very high power densities (MW's/liter), small temperature differences between fuel and coolant (approx. 10/sup 0/K), high coolant-outlet temperatures (1500 to 3000/sup 0/K, depending on design), and fast reactor startup (approx. 2 to 3 seconds). Two reactor concepts are developed - the Fixed Bed Reactor (FBR), where the fuel particles are packed into a thin annular bed between two porous cylindrical drums, and the Rotating Bed Reactor (RBR), where the fuel particles are held inside a cold rotating (typically approx. 500 rpm) porous cylindrical drum. The FBR can operate steady-state in the closed-cycle He-cooled mode or in the open-cycle H/sub 2/-cooled mode. The RBR will operate only in the open-cycle H/sub 2/-cooled mode.

  5. Design options for a bunsen reactor.

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Robert Charles

    2013-10-01

    This work is being performed for Matt Channon Consulting as part of the Sandia National Laboratories New Mexico Small Business Assistance Program (NMSBA). Matt Channon Consulting has requested Sandia's assistance in the design of a chemical Bunsen reactor for the reaction of SO2, I2 and H2O to produce H2SO4 and HI with a SO2 feed rate to the reactor of 50 kg/hour. Based on this value, an assumed reactor efficiency of 33%, and kinetic data from the literature, a plug flow reactor approximately 1%E2%80%9D diameter and and 12 inches long would be needed to meet the specification of the project. Because the Bunsen reaction is exothermic, heat in the amount of approximately 128,000 kJ/hr would need to be removed using a cooling jacket placed around the tubular reactor. The available literature information on Bunsen reactor design and operation, certain support equipment needed for process operation and a design that meet the specification of Matt Channon Consulting are presented.

  6. Lessons Learned From Gen I Carbon Dioxide Cooled Reactors

    Energy Technology Data Exchange (ETDEWEB)

    David E. Shropshire

    2004-04-01

    This paper provides a review of early gas cooled reactors including the Magnox reactors originating in the United Kingdom and the subsequent development of the Advanced Gas-cooled Reactors (AGR). These early gas cooled reactors shared a common coolant medium, namely carbon dioxide (CO2). A framework of information is provided about these early reactors and identifies unique problems/opportunities associated with use of CO2 as a coolant. Reactor designers successfully rose to these challenges. After years of successful use of the CO2 gas cooled reactors in Europe, the succeeding generation of reactors, called the High Temperature Gas Reactors (HTGR), were designed with Helium gas as the coolant. Again, in the 21st century, with the latest reactor designs under investigation in Generation IV, there is a revived interest in developing Gas Cooled Fast Reactors that use CO2 as the reactor coolant. This paper provides a historical perspective on the 52 CO2 reactors and the reactor programs that developed them. The Magnox and AGR design features and safety characteristics were reviewed, as well as the technologies associated with fuel storage, reprocessing, and disposal. Lessons-learned from these programs are noted to benefit the designs of future generations of gas cooled nuclear reactors.

  7. Technology, Safety and Costs of Decommissioning Nuclear Reactors At Multiple-Reactor Stations

    Energy Technology Data Exchange (ETDEWEB)

    Wittenbrock, N. G.

    1982-01-01

    Safety and cost information is developed for the conceptual decommissioning of large (1175-MWe) pressurized water reactors (PWRs) and large (1155-MWe) boiling water reactors {BWRs) at multiple-reactor stations. Three decommissioning alternatives are studied: DECON (immediate decontamination), SAFSTOR (safe storage followed by deferred decontamination), and ENTOMB (entombment). Safety and costs of decommissioning are estimated by determining the impact of probable features of multiple-reactor-station operation that are considered to be unavailable at a single-reactor station, and applying these estimated impacts to the decommissioning costs and radiation doses estimated in previous PWR and BWR decommissioning studies. The multiple-reactor-station features analyzed are: the use of interim onsite nuclear waste storage with later removal to an offsite nuclear waste disposal facility, the use of permanent onsite nuclear waste disposal, the dedication of the site to nuclear power generation, and the provision of centralized services. Five scenarios for decommissioning reactors at a multiple-reactor station are investigated. The number of reactors on a site is assumed to be either four or ten; nuclear waste disposal is varied between immediate offsite disposal, interim onsite storage, and immediate onsite disposal. It is assumed that the decommissioned reactors are not replaced in one scenario but are replaced in the other scenarios. Centralized service facilities are provided in two scenarios but are not provided in the other three. Decommissioning of a PWR or a BWR at a multiple-reactor station probably will be less costly and result in lower radiation doses than decommissioning an identical reactor at a single-reactor station. Regardless of whether the light water reactor being decommissioned is at a single- or multiple-reactor station: • the estimated occupational radiation dose for decommissioning an LWR is lowest for SAFSTOR and highest for DECON • the estimated

  8. Reactor performances and microbial communities of biogas reactors: effects of inoculum sources.

    Science.gov (United States)

    Han, Sheng; Liu, Yafeng; Zhang, Shicheng; Luo, Gang

    2016-01-01

    Anaerobic digestion is a very complex process that is mediated by various microorganisms, and the understanding of the microbial community assembly and its corresponding function is critical in order to better control the anaerobic process. The present study investigated the effect of different inocula on the microbial community assembly in biogas reactors treating cellulose with various inocula, and three parallel biogas reactors with the same inoculum were also operated in order to reveal the reproducibility of both microbial communities and functions of the biogas reactors. The results showed that the biogas production, volatile fatty acid (VFA) concentrations, and pH were different for the biogas reactors with different inocula, and different steady-state microbial community patterns were also obtained in different biogas reactors as reflected by Bray-Curtis similarity matrices and taxonomic classification. It indicated that inoculum played an important role in shaping the microbial communities of biogas reactor in the present study, and the microbial community assembly in biogas reactor did not follow the niche-based ecology theory. Furthermore, it was found that the microbial communities and reactor performances of parallel biogas reactors with the same inoculum were different, which could be explained by the neutral-based ecology theory and stochastic factors should played important roles in the microbial community assembly in the biogas reactors. The Bray-Curtis similarity matrices analysis suggested that inoculum affected more on the microbial community assembly compared to stochastic factors, since the samples with different inocula had lower similarity (10-20 %) compared to the samples from the parallel biogas reactors (30 %).

  9. Strengthening IAEA Safeguards for Research Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Reid, Bruce D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Anzelon, George A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Budlong-Sylvester, Kory [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-09-01

    During their December 10-11, 2013, workshop in Grenoble France, which focused on the history and future of safeguarding research reactors, the United States, France and the United Kingdom (UK) agreed to conduct a joint study exploring ways to strengthen the IAEA’s safeguards approach for declared research reactors. This decision was prompted by concerns about: 1) historical cases of non-compliance involving misuse (including the use of non-nuclear materials for production of neutron generators for weapons) and diversion that were discovered, in many cases, long after the violations took place and as part of broader pattern of undeclared activities in half a dozen countries; 2) the fact that, under the Safeguards Criteria, the IAEA inspects some reactors (e.g., those with power levels under 25 MWt) less than once per year; 3) the long-standing precedent of States using heavy water research reactors (HWRR) to produce plutonium for weapons programs; 4) the use of HEU fuel in some research reactors; and 5) various technical characteristics common to some types of research reactors that could provide an opportunity for potential proliferators to misuse the facility or divert material with low probability of detection by the IAEA. In some research reactors it is difficult to detect diversion or undeclared irradiation. In addition, infrastructure associated with research reactors could pose a safeguards challenge. To strengthen the effectiveness of safeguards at the State level, this paper advocates that the IAEA consider ways to focus additional attention and broaden its safeguards toolbox for research reactors. This increase in focus on the research reactors could begin with the recognition that the research reactor (of any size) could be a common path element on a large number of technically plausible pathways that must be considered when performing acquisition pathway analysis (APA) for developing a State Level Approach (SLA) and Annual Implementation Plan (AIP). To

  10. Materials issues in fusion reactors

    Science.gov (United States)

    Suri, A. K.; Krishnamurthy, N.; Batra, I. S.

    2010-02-01

    The world scientific community is presently engaged in one of the toughest technological tasks of the current century, namely, exploitation of nuclear fusion in a controlled manner for the benefit of mankind. Scientific feasibility of controlled fusion of the light elements in plasma under magnetic confinement has already been proven. International efforts in a coordinated and co-operative manner are presently being made to build ITER - the International Thermonuclear Experimental Reactor - to test, in this first step, the concept of 'Tokamak' for net fusion energy production. To exploit this new developing option of making energy available through the route of fusion, India too embarked on a robust fusion programme under which we now have a working tokamak - the Aditya and a steady state tokamak (SST-1), which is on the verge of functioning. The programme envisages further development in terms of making SST-2 followed by a DEMO and finally the fusion power reactor. Further, with the participation of India in the ITER program in 2005, and recent allocation of half - a - port in ITER for placing our Lead - Lithium Ceramic Breeder (LLCB) based Test Blanket Module (TBM), meant basically for breeding tritium and extracting high grade heat, the need to understand and address issues related to materials for these complex systems has become all the more necessary. Also, it is obvious that with increasing power from the SST stages to DEMO and further to PROTOTYPE, the increasing demands on performance of materials would necessitate discovery and development of new materials. Because of the 14.1 MeV neutrons that are generated in the D+T reaction exploited in a tokamak, the materials, especially those employed for the construction of the first wall, the diverter and the blanket segments, suffer crippling damage due to the high He/dpa ratios that result due to the high energy of the neutrons. To meet this challenge, the materials that need to be developed for the tokamaks

  11. Technological status of reactor coolant pumps in generation III+ pressurized nuclear reactors

    Energy Technology Data Exchange (ETDEWEB)

    Brecht, Bernhard; Bross, Stephan [KSB Aktiengesellschaft, Frankenthal (Germany)

    2016-05-15

    KSB has been developing and producing pumps for thermal power plants for nearly 90 years. Consequently, KSB also started to develop and manufacture pumps for all kinds of nuclear power plants from the very beginning of the civil use of nuclear energy. This is especially true for reactor coolant pumps for pressurized water reactors. For the generation of advanced evolutionary reactors (Generation III+ reactors), KSB developed an advanced shaft seal system which is also able to fulfill the requirements of station blackout conditions. The tests in the KSB test rigs, which were successfully completed in December 2015, proved the full functionality of the new design. For generation III+ passive plant reactors KSB developed a new reactor coolant pump type called RUV, which is based on the experience of classic reactor coolant pumps and reactor internal pumps. It is a very compact, hermetically sealed vertical pump-motor unit with a wet winding motor. A full scale prototype successfully passed the 1st stage qualification test program in October 2015.

  12. Power distribution control of CANDU reactors based on modal representation of reactor kinetics

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Lingzhi, E-mail: lxia4@uwo.ca [Department of Electrical and Computer Engineering, The University of Western Ontario, London, Ontario N6A 5B9 (Canada); Jiang, Jin, E-mail: jjiang@eng.uwo.ca [Department of Electrical and Computer Engineering, The University of Western Ontario, London, Ontario N6A 5B9 (Canada); Luxat, John C., E-mail: luxatj@mcmaster.ca [Department of Engineering Physics, McMaster University, Hamilton, Ontario L8S 4L7 (Canada)

    2014-10-15

    Highlights: • Linearization of the modal synthesis model of neutronic kinetic equations for CANDU reactors. • Validation of the linearized dynamic model through closed-loop simulations by using the reactor regulating system. • Design of a LQR state feedback controller for CANDU core power distribution control. • Comparison of the results of this new controller against those of the conventional reactor regulation system. - Abstract: Modal synthesis representation of a neutronic kinetic model for a CANDU reactor core has been utilized in the analysis and synthesis for reactor control systems. Among all the mode shapes, the fundamental mode of the power distribution, which also coincides with the desired reactor power distribution during operation, is used in the control system design. The nonlinear modal models are linearized around desired operating points. Based on the linearized model, linear quadratic regulator (LQR) control approach is used to synthesize a state feedback controller. The performance of this controller has been evaluated by using the original nonlinear models under load-following conditions. It has been demonstrated that the proposed reactor control system can produce more uniform power distribution than the traditional reactor regulation systems (RRS); in particular, it is more effective in compensating the Xenon induced transients.

  13. Control of SHARON reactor for autotrophic nitrogen removal in two-reactor configuration

    DEFF Research Database (Denmark)

    Valverde Perez, Borja; Mauricio Iglesias, Miguel; Sin, Gürkan

    2012-01-01

    With the perspective of investigating a suitable control design for autotrophic nitrogen removal, this work explores the control design for a SHARON reactor. With this aim, a full model is developed, including the pH dependency, in order to simulate the reactor and determine the optimal operating...

  14. REVIEW OF REACTOR SAFETY ANALYSES OF FAST AND LIQUID METAL COOLED REACTORS

    Energy Technology Data Exchange (ETDEWEB)

    Shaver, R. E.; Wittenbrock, N. G.

    1967-11-01

    Safety analysis reports on United States fast and liquid metal cooled reactors were reviewed to gain a better understanding of the safety philosophy applied to the design of these facilities. This information was compiled to help guide the design and safety analysis of the Fast Flux Test Facility. No attempt was made to draw conclusions concerning the relative merit of different approaches and philosophies used by different reactor design teams. The facilities reviewed were; Enrico Fermi Atomic Power Plant (FERMI) Hallam Nuclear Power Facility (HALLAM) Southwest Experimental Fast Oxide Reactor (SEFOR) Fast Reactor Test Facility (FARET) Experimental Breeder Reactor No. 1 (EBR-I) Experimental Breeder Reactor No. 2 (EBR-II) Fast Reactor Zero Power Experiment (ZPR - III). The information gathered from the safety analysis reports is tabulated under these headings: Control and Safety Systems; Reactor Protection Systems; Backup Systems; Containment or Confinement Systems; Inherent Reactivity Effects and Important Physics Parameters; Fuel and Fuel Handling; Accidents Considered and Chemical Problems; Site; Exhaust Ventilation System; and Waste Effluents.

  15. Nuclear Energy Enabling Technologies (NEET) Reactor Materials: News for the Reactor Materials Crosscut, May 2016

    Energy Technology Data Exchange (ETDEWEB)

    Maloy, Stuart Andrew [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Materials Science in Radiation and Dynamics Extremes

    2016-09-26

    In this newsletter for Nuclear Energy Enabling Technologies (NEET) Reactor Materials, pages 1-3 cover highlights from the DOE-NE (Nuclear Energy) programs, pages 4-6 cover determining the stress-strain response of ion-irradiated metallic materials via spherical nanoindentation, and pages 7-8 cover theoretical approaches to understanding long-term materials behavior in light water reactors.

  16. Stationary Liquid Fuel Fast Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Won Sik [Purdue Univ., West Lafayette, IN (United States); Grandy, Andrew [Argonne National Lab. (ANL), Argonne, IL (United States); Boroski, Andrew [Argonne National Lab. (ANL), Argonne, IL (United States); Krajtl, Lubomir [Argonne National Lab. (ANL), Argonne, IL (United States); Johnson, Terry [Argonne National Lab. (ANL), Argonne, IL (United States)

    2015-09-30

    For effective burning of hazardous transuranic (TRU) elements of used nuclear fuel, a transformational advanced reactor concept named SLFFR (Stationary Liquid Fuel Fast Reactor) was proposed based on stationary molten metallic fuel. The fuel enters the reactor vessel in a solid form, and then it is heated to molten temperature in a small melting heater. The fuel is contained within a closed, thick container with penetrating coolant channels, and thus it is not mixed with coolant nor flow through the primary heat transfer circuit. The makeup fuel is semi- continuously added to the system, and thus a very small excess reactivity is required. Gaseous fission products are also removed continuously, and a fraction of the fuel is periodically drawn off from the fuel container to a processing facility where non-gaseous mixed fission products and other impurities are removed and then the cleaned fuel is recycled into the fuel container. A reference core design and a preliminary plant system design of a 1000 MWt TRU- burning SLFFR concept were developed using TRU-Ce-Co fuel, Ta-10W fuel container, and sodium coolant. Conservative design approaches were adopted to stay within the current material performance database. Detailed neutronics and thermal-fluidic analyses were performed to develop a reference core design. Region-dependent 33-group cross sections were generated based on the ENDF/B-VII.0 data using the MC2-3 code. Core and fuel cycle analyses were performed in theta-r-z geometries using the DIF3D and REBUS-3 codes. Reactivity coefficients and kinetics parameters were calculated using the VARI3D perturbation theory code. Thermo-fluidic analyses were performed using the ANSYS FLUENT computational fluid dynamics (CFD) code. Figure 0.1 shows a schematic radial layout of the reference 1000 MWt SLFFR core, and Table 0.1 summarizes the main design parameters of SLFFR-1000 loop plant. The fuel container is a 2.5 cm thick cylinder with an inner radius of 87.5 cm. The fuel

  17. Design guide for Category III reactors: pool type reactors. [US DOE

    Energy Technology Data Exchange (ETDEWEB)

    Brynda, W J; Lobner, P R; Powell, R W; Straker, E A

    1978-11-01

    The Department of Energy (DOE) in the ERDA Manual requires that all DOE-owned reactors be sited, designed, constructed, modified, operated, maintained, and decommissioned in a manner that gives adequate consideration to health and safety factors. Specific guidance pertinent to the safety of DOE-owned reactors is found in Chapter 0540 of the ERDA Manual. The purpose of this Design Guide is to provide additional guidance to aid the DOE facility contractor in meeting the requirement that the siting, design, construction, modification, operation, maintenance, and decommissioning of DOE-owned reactors be in accordance with generally uniform standards, guides, and codes which are comparable to those applied to similar reactors licensed by the Nuclear Regulatory Commission (NRC). This Design Guide deals principally with the design and functional requirement of Category III reactor structures, components, and systems.

  18. Design guide for category II reactors light and heavy water cooled reactors. [US DOE

    Energy Technology Data Exchange (ETDEWEB)

    Brynda, W J; Lobner, P R; Powell, R W; Straker, E A

    1978-05-01

    The Department of Energy (DOE), in the ERDA Manual, requires that all DOE-owned reactors be sited, designed, constructed, modified, operated, maintained, and decommissioned in a manner that gives adequate consideration to health and safety factors. Specific guidance pertinent to the safety of DOE-owned reactors is found in Chapter 0540 of the ERDA Manual. The purpose of this Design Guide is to provide additional guidance to aid the DOE facility contractor in meeting the requirement that the siting, design, construction, modification operation, maintainance, and decommissioning of DOW-owned reactors be in accordance with generally uniform standards, guide and codes which are comparable to those applied to similar reactors licensed by the Nuclear Regulatory Commission (NRC). This Design Guide deals principally with the design and functional requirements of Category II reactor structure, components, and systems.

  19. Exploring new coolants for nuclear breeder reactors

    Energy Technology Data Exchange (ETDEWEB)

    Lafuente, A., E-mail: anlafuente@etsii.upm.e [ETSII-UPM, c/Jose Gutierrez Abascal, 2, 28006 Madrid (Spain); Piera, M. [ETSII:UNED, c/Juan del Rosal, 12, 28040 Madrid (Spain)

    2010-06-15

    Breeder reactors are considered a unique tool for fully exploiting natural nuclear resources. In current Light Water Reactors (LWR), only 0.5% of the primary energy contained in the nuclei removed from a mine is converted into useful heat. The rest remains in the depleted uranium or spent fuel. The need to improve resource-efficiency has stimulated interest in Fast-Reactor-based fuel cycles, which can exploit a much higher fraction of the energy content of mined uranium by burning U-238, mainly after conversion into Pu-239. Thorium fuel cycles also offer several potential advantages over a uranium fuel cycle. The coolant initially selected for most of the FBR programs launched in the 1960s was sodium, which is still considered the best candidate for these reactors. However, Na-cooled FBRs have a positive void reactivity coefficient. Among other factors, this fundamental drawback has resulted in the canceled deployment of these reactors. Therefore, it seems reasonable to explore new options for breeder coolants. In this paper, a proposal is presented for a new molten salt (F{sub 2}Be) coolant that could overcome the safety issues related to the positive void reactivity coefficient of molten metal coolants. Although it is a very innovative proposal that would require an extensive R and D program, this paper presents the very appealing properties of this salt when using a specific type of fuel that is similar to that of pebble bed reactors. The F{sub 2}Be concept was studied over a typical MOX composition and extended to a thorium-based cycle. The general analysis took into account the requirements for criticality (opening the option of hybrid subcritical systems); the requirements for breeding; and the safety requirement of having a negative coolant void reactivity coefficient. A design window was found in the definition of a F{sub 2}Be cooled reactor where the safety requirement was met, unlike for molten metal-cooled reactors, which always have positive void

  20. Molten salt reactor: Deterministic safety evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Merle-Lucotte, Elsa; Heuer, Daniel; Mathieu, Ludovic; Le Brun, Christian [Laboratory for Subatomic Physics and Cosmology (LPSC), 53, Avenue des Marthyrs, F-38026 Grenoble (France)

    2006-07-01

    Molten Salt Reactors (MSRs) are one of the systems retained by Generation IV as a candidate for the next generation of nuclear reactors. This type of reactor is particularly well adapted to the thorium fuel cycle (Th- {sup 233}U) which has the advantage of producing less minor actinides than the uranium-plutonium fuel cycle ({sup 238}U- {sup 239}Pu). In the frame of a major re-evaluation of the MSR concept and concentrating on some major constraints such as feasibility, breeding capability and, above all, safety, we have considered a particular reactor configuration that we call the 'unique channel' configuration in which there is no moderator in the core, leading to a quasi fast neutron spectrum. This reactor is presented in the first section. MSRs benefit from several specific advantages which are listed in a second part of this work. Beyond these advantages of the MSR, the level of the deterministic safety in such a reactor has to be assessed precisely. In a third section, we first draw up a list of the reactivity margins in our reactor configuration. We then define and quantify the parameters characterizing the deterministic safety of any reactor: the fraction of delayed neutrons, and the system's feedback coefficients that are here negative. Finally, using a simple point-kinetic evaluation, we analyze how these safety parameters impact the system when the total reactivity margins are introduced in the MSR. The results of this last study are discussed, emphasizing the satisfactory behavior of the MSR and the excellent level of deterministic safety which can be achieved. This work is based on the coupling of a neutron transport code called MCNP with a materials evolution code. The former calculates the neutron flux and the reaction rates in all the cells while the latter solves the Bateman equations for the evolution of the materials composition within the cells. These calculations take into account the input parameters (power released