WorldWideScience

Sample records for 6-phosphate synthase gene

  1. Transcriptome analysis of potato leaves expressing the trehalose-6-phosphate synthase 1 gene of yeast.

    Science.gov (United States)

    Kondrák, Mihály; Marincs, Ferenc; Kalapos, Balázs; Juhász, Zsófia; Bánfalvi, Zsófia

    2011-01-01

    Transgenic lines of the potato cultivar White Lady expressing the trehalose-6-phosphate synthase (TPS1) gene of yeast exhibit improved drought tolerance, but grow slower and have a lower carbon fixation rate and stomatal density than the wild-type. To understand the molecular basis of this phenomenon, we have compared the transcriptomes of wild-type and TPS1-transgenic plants using the POCI microarray containing 42,034 potato unigene probes. We show that 74 and 25 genes were up-, and down-regulated, respectively, in the mature source leaves of TPS1-transgenic plants when compared with the wild-type. The differentially regulated genes were assigned into 16 functional groups. All of the seven genes, which were assigned into carbon fixation and metabolism group, were up-regulated, while about 42% of the assigned genes are involved in transcriptional and post-transcriptional regulation. Expression of genes encoding a 14-3-3 regulatory protein, and four transcription factors were down-regulated in the TPS1-transgenic leaves. To verify the microarray results, we used RNA gel blot analysis to examine the expression of eight genes and found that the RNA gel blot and microarray data correlated in each case. Using the putative Arabidopsis orthologs of the assigned potato sequences we have identified putative transcription binding sites in the promoter region of the differentially regulated genes, and putative protein-protein interactions involving some of the up- and down-regulated genes. We have also demonstrated that starch content is lower, while malate, inositol and maltose contents are higher in the TPS1-transgenic than in the wild-type leaves. Our results suggest that a complex regulatory network, involving transcription factors and other regulatory proteins, underpins the phenotypic alterations we have observed previously in potato when expressing the TPS1 gene of yeast.

  2. Transcriptome analysis of potato leaves expressing the trehalose-6-phosphate synthase 1 gene of yeast.

    Directory of Open Access Journals (Sweden)

    Mihály Kondrák

    Full Text Available Transgenic lines of the potato cultivar White Lady expressing the trehalose-6-phosphate synthase (TPS1 gene of yeast exhibit improved drought tolerance, but grow slower and have a lower carbon fixation rate and stomatal density than the wild-type. To understand the molecular basis of this phenomenon, we have compared the transcriptomes of wild-type and TPS1-transgenic plants using the POCI microarray containing 42,034 potato unigene probes. We show that 74 and 25 genes were up-, and down-regulated, respectively, in the mature source leaves of TPS1-transgenic plants when compared with the wild-type. The differentially regulated genes were assigned into 16 functional groups. All of the seven genes, which were assigned into carbon fixation and metabolism group, were up-regulated, while about 42% of the assigned genes are involved in transcriptional and post-transcriptional regulation. Expression of genes encoding a 14-3-3 regulatory protein, and four transcription factors were down-regulated in the TPS1-transgenic leaves. To verify the microarray results, we used RNA gel blot analysis to examine the expression of eight genes and found that the RNA gel blot and microarray data correlated in each case. Using the putative Arabidopsis orthologs of the assigned potato sequences we have identified putative transcription binding sites in the promoter region of the differentially regulated genes, and putative protein-protein interactions involving some of the up- and down-regulated genes. We have also demonstrated that starch content is lower, while malate, inositol and maltose contents are higher in the TPS1-transgenic than in the wild-type leaves. Our results suggest that a complex regulatory network, involving transcription factors and other regulatory proteins, underpins the phenotypic alterations we have observed previously in potato when expressing the TPS1 gene of yeast.

  3. Isolation and characterization of the trehalose-6-phosphate synthase gene from Locusta migratoria manflensis

    Institute of Scientific and Technical Information of China (English)

    Shu-Yan Cui; Yu-Xian Xia

    2009-01-01

    Trehalose plays an important role in protecting organisms from various stresses.Trehalose-6-phosphate synthase (TPS) is the key enzyme in trehalose synthesis, but in in-sects only a few TPS genes have been identified and their function has not been well characterized. To better understand the function of TPS in insects, a complete TPS com-plementary DNA (eDNA) clone was obtained from the fat body of the locust Locusta migratoria manilensis (GenBank accession number: EU 131894). The full-length cDNA is 2 806 bp, including an open reading frame of 2 442 bp, which encodes an 813 amino acids protein with a calculated molecular weight of 91 976 Daltons and an isoelectric point of 6.14. The deduced amino acid sequence is highly similar to other published insect TPS and its C-terminal also has a region homologous to trehalose phosphate phsophatase (TPP).Semi-quantitative analysis indicated that the TPS transcript was expressed not only in fat body, but also in gut, hemolymph and leg muscle. These data may facilitate studies of TPS function in insects and improve our understanding of trehalose metabolism.

  4. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo

    2015-06-01

    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme.

  5. Cloning and Characterization of a Salt Tolerance-Associated Gene Encoding Trehalose-6-Phosphate Synthase in Sweetpotato

    Institute of Scientific and Technical Information of China (English)

    JIANG Tao; ZHAI Hong; WANG Fei-bing; ZHOU Hua-nan; SI Zeng-zhi; HE Shao-zhen; LIU Qing-chang

    2014-01-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in a variety of organisms. In plants, its biosynthesis is catalyzed by two key enzymes:trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP). In the present study, a TPS gene, named IbTPS, was ifrst isolated from sweetpotato (Ipomoea batatas (L.) Lam.) cv. Lushu 3 by rapid ampliifcation of cDNA ends (RACE). The open reading frame (ORF) contained 2 580 nucleotides encoding 859 amino acids with a molecular weight of 97.433 kDa and an isoelectric point (pI) of 5.7. The deduced amino acid sequence showed high identities with TPS of other plants. Real-time quantitative PCR analysis revealed that the expression level of IbTPS gene was signiifcantly higher in stems of Lushu 3 than in its leaves and roots. Subcellular localization analysis in onion epidermal cells indicated that IbTPS gene was located in the nucleus. Transgenic tobacco (cv. Wisconsin 38) plants over-expressing IbTPS gene exhibited signiifcantly higher salt tolerance compared with the control plant. Trehalose and proline content was found to be signiifcantly more accumulated in transgenic tobacco plants than in the wild-type and several stress tolerance related genes were up-regulated. These results suggest that IbTPS gene may enhance salt tolerance of plants by increasing the amount of treahalose and proline and regulating the expression of stress tolerance related genes.

  6. Expression of the yeast trehalose-6-phosphate synthase gene in transgenic tobacco plants: pleiotropic phenotypes include drought tolerance.

    Science.gov (United States)

    Romero, C; Bellés, J M; Vayá, J L; Serrano, R; Culiáñez-Macià, F A

    1997-03-01

    The yeast trehalose-6-phosphate synthase gene (TPS1) was engineered under the control of the cauliflower mosaic virus regulatory sequences (CaMV35S) for expression in plants. Using Agrobacterium-mediated transfer, the gene was incorporated into the genomic DNA and constitutively expressed in Nicotiana tabacum L. plants. Trehalose was determined in the transformants, by anion-exchange chromatography coupled to pulsed amperometric detection. The non-reducing disaccharide accumulated up to 0.17 mg per g fresh weight in leaf extracts of transgenic plants. Trehaloseaccumulating plants exhibited multiple phenotypic alterations, including stunted growth, lancet-shaped leaves, reduced sucrose content and improved drought tolerance. These pleiotropic effects, and the fact that water loss from detached leaves was not significantly affected by trehalose accumulation, suggest that synthesis of this sugar, rather than leading to an osmoprotectant effect, had altered sugar metabolism and regulatory pathways affecting plant development and stress tolerance.

  7. Identification of the trehalose-6-phosphate synthase gene family in winter wheat and expression analysis under conditions of freezing stress

    Indian Academy of Sciences (India)

    D. W. Xie; X. N. Wang; L. S. Fu; J. Sun; W. Zheng; Z. F. Li

    2015-03-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are potentially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag sequence information from NCBI and two wheat genome databases, we identified 12 wheat TPS genes and performed a comprehensive study on their structural, evolutionary and functional properties. The estimated divergence time of wheat TPS gene pairs and wheat–rice orthologues suggested that wheat and rice have a common ancestor. The number of TPS genes in the wheat genome was estimated to be at least 12, which is close to the number found in rice, Arabidopsis and soybean. Moreover, it has been reported earlier in other plants that TPS genes respond to abiotic stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways. Taken together, the current study represents the first comprehensive study of TPS genes in winter wheat and provides a foundation for future functional studies of this important gene family in Triticeae.

  8. Genome-wide identification and evolution analysis of Trehalose-6-phosphate synthase gene family in Nelumbo nucifera

    Directory of Open Access Journals (Sweden)

    Qijiang Jin

    2016-09-01

    Full Text Available Trehalose-6-phosphate synthase (TPS plays a key role in plant carbohydrate metabolism and the perception of carbohydrate availability. In the present work, the publicly available Nelumbo nucifera (lotus genome sequence database was analyzed which led to identification of nine lotus TPS genes (NnTPS. It was found that at least two introns are included in the coding sequences of NnTPS genes. When the motif compositions were analyzed we found that NnTPS generally shared the similar motifs, implying that they have similar functions. The dN/dS ratios were always less than 1 for different domains and regions outside domains, suggesting purifying selection on the lotus TPS gene family. The regions outside TPS domain evolved relatively faster than NnTPS domains. A phylogenetic tree was constructed using all predicted coding sequences of lotus TPS genes, together with those from Arabidopsis, poplar, soybean and rice. The result indicated that those TPS genes could be clearly divided into two main subfamilies (I-II, where each subfamily could be further divided into 2 (I and 5 (II subgroups. Analyses of divergence and adaptive evolution show that purifying selection may have been the main force driving evolution of plant TPS genes. Some of the critical sites that contributed to divergence may have been under positive selection. Transcriptome data analysis revealed that most NnTPS genes were predominantly expressed in sink tissues. Expression pattern of NnTPS genes under copper and submergence stress indicated that NNU_014679 and NNU_022788 might play important roles in lotus energy metabolism and participate in stress response. Our results can facilitate further functional studies of TPS genes in lotus.

  9. The Class II trehalose 6-phosphate synthase gene PvTPS9 modulates trehalose metabolism in Phaseolus vulgaris nodules.

    Directory of Open Access Journals (Sweden)

    Aarón Barraza

    2016-11-01

    Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.

  10. Disruption of the Candida albicans TPS1 Gene Encoding Trehalose-6-Phosphate Synthase Impairs Formation of Hyphae and Decreases Infectivity†

    Science.gov (United States)

    Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos

    1998-01-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  11. Against All Odds: Trehalose-6-Phosphate Synthase and Trehalase Genes in the Bdelloid Rotifer Adineta vaga Were Acquired by Horizontal Gene Transfer and Are Upregulated during Desiccation.

    Directory of Open Access Journals (Sweden)

    Boris Hespeels

    Full Text Available The disaccharide sugar trehalose is essential for desiccation resistance in most metazoans that survive dryness; however, neither trehalose nor the enzymes involved in its metabolism have ever been detected in bdelloid rotifers despite their extreme resistance to desiccation. Here we screened the genome of the bdelloid rotifer Adineta vaga for genes involved in trehalose metabolism. We discovered a total of four putative trehalose-6-phosphate synthase (TPS and seven putative trehalase (TRE gene copies in the genome of this ameiotic organism; however, no trehalose-6-phosphate phosphatase (TPP gene or domain was detected. The four TPS copies of A. vaga appear more closely related to plant and fungi proteins, as well as to some protists, whereas the seven TRE copies fall in bacterial clades. Therefore, A. vaga likely acquired its trehalose biosynthesis and hydrolysis genes by horizontal gene transfers. Nearly all residues important for substrate binding in the predicted TPS domains are highly conserved, supporting the hypothesis that several copies of the genes might be functional. Besides, RNAseq library screening showed that trehalase genes were highly expressed compared to TPS genes, explaining probably why trehalose had not been detected in previous studies of bdelloids. A strong overexpression of their TPS genes was observed when bdelloids enter desiccation, suggesting a possible signaling role of trehalose-6-phosphate or trehalose in this process.

  12. Enhanced freeze tolerance of baker's yeast by overexpressed trehalose-6-phosphate synthase gene (TPS1) and deleted trehalase genes in frozen dough.

    Science.gov (United States)

    Tan, Haigang; Dong, Jian; Wang, Guanglu; Xu, Haiyan; Zhang, Cuiying; Xiao, Dongguang

    2014-08-01

    Several recombinant strains with overexpressed trehalose-6-phosphate synthase gene (TPS1) and/or deleted trehalase genes were obtained to elucidate the relationships between TPS1, trehalase genes, content of intracellular trehalose and freeze tolerance of baker's yeast, as well as improve the fermentation properties of lean dough after freezing. In this study, strain TL301(TPS1) overexpressing TPS1 showed 62.92 % higher trehalose-6-phosphate synthase (Tps1) activity and enhanced the content of intracellular trehalose than the parental strain. Deleting ATH1 exerted a significant effect on trehalase activities and the degradation amount of intracellular trehalose during the first 30 min of prefermentation. This finding indicates that acid trehalase (Ath1) plays a role in intracellular trehalose degradation. NTH2 encodes a functional neutral trehalase (Nth2) that was significantly involved in intracellular trehalose degradation in the absence of the NTH1 and/or ATH1 gene. The survival ratio, freeze-tolerance ratio and relative fermentation ability of strain TL301(TPS1) were approximately twice as high as those of the parental strain (BY6-9α). The increase in freeze tolerance of strain TL301(TPS1) was accompanied by relatively low trehalase activity, high Tps1 activity and high residual content of intracellular trehalose. Our results suggest that overexpressing TPS1 and deleting trehalase genes are sufficient to improve the freeze tolerance of baker's yeast in frozen dough. The present study provides guidance for the commercial baking industry as well as the research on the intracellular trehalose mobilization and freeze tolerance of baker's yeast.

  13. A trehalose 6-phosphate synthase gene of the hemocytes of the blue crab, Callinectes sapidus: cloning, the expression, its enzyme activity and relationship to hemolymph trehalose levels.

    Science.gov (United States)

    Chung, J Sook

    2008-12-12

    Trehalose in ectoderms functions in energy metabolism and protection in extreme environmental conditions. We structurally characterized trehalose 6-phosphate synthase (TPS) from hemocytes of the blue crab, Callinectes sapidus. C. sapidus Hemo TPS (CasHemoTPS), like insect TPS, encodes both TPS and trehalose phosphate phosphatase domains. Trehalose seems to be a major sugar, as it shows higher levels than does glucose in hemocytes and hemolymph. Increases in HemoTPS expression, TPS enzyme activity in hemocytes, and hemolymph trehalose levels were determined 24 h after lipopolysaccharide challenge, suggesting that both TPS and TPP domains of CasHemoTPS are active and functional. The TPS gene has a wide tissue distribution in C. sapidus, suggesting multiple biosynthetic sites. A correlation between TPS activity in hemocytes and hemolymph trehalose levels was found during the molt cycle. The current study provides the first evidence of presence of trehalose in hemocytes and TPS in tissues of C. sapidus and implicates its functional role in energy metabolism and physiological adaptation.

  14. Virus-Induced Gene Silencing-Based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato

    Science.gov (United States)

    Zhang, Huijuan; Hong, Yongbo; Huang, Lei; Liu, Shixia; Tian, Limei; Dai, Yi; Cao, Zhongye; Huang, Lihong; Li, Dayong; Song, Fengming

    2016-01-01

    Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development, and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs, and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs, and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst) DC3000 as well as to defense signaling hormones (e.g., salicylic acid, jasmonic acid, and a precursor of ethylene). Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4, or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7, or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7, and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato. PMID:27540389

  15. Glucosamine-6-phosphate synthase, a novel target for antifungal agents. Molecular modelling studies in drug design.

    Science.gov (United States)

    Wojciechowski, Marek; Milewski, Sławomir; Mazerski, Jan; Borowski, Edward

    2005-01-01

    Fungal infections are a growing problem in contemporary medicine, yet only a few antifungal agents are used in clinical practice. In our laboratory we proposed the enzyme L-glutamine: D-fructose-6-phosphate amidotransferase (EC 2.6.1.16) as a new target for antifungals. The structure of this enzyme consists of two domains, N-terminal and C-terminal ones, catalysing glutamine hydrolysis and sugar-phosphate isomerisation, respectively. In our laboratory a series of potent selective inhibitors of GlcN-6-P synthase have been designed and synthesised. One group of these compounds, including the most studied N3-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid (FMDP), behave like glutamine analogs acting as active-site-directed inactivators, blocking the N-terminal, glutamine-binding domain of the enzyme. The second group of GlcN-6-P synthase inhibitors mimic the transition state of the reaction taking place in the C-terminal sugar isomerising domain. Surprisingly, in spite of the fact that glutamine is the source of nitrogen for a number of enzymes it turned out that the glutamine analogue FMDP and its derivatives are selective against GlcN-6-P synthase and they do not block other enzymes, even belonging to the same family of glutamine amidotransferases. Our molecular modelling studies of this phenomenon revealed that even within the family of related enzymes substantial differences may exist in the geometry of the active site. In the case of the glutamine amidotransferase family the glutamine binding site of GlcN-6-P synthase fits a different region of the glutamine conformational space than other amidotransferases. Detailed analysis of the interaction pattern for the best known, so far, inhibitor of the sugar isomerising domain, namely 2-amino-2-deoxy-D-glucitol-6-phosphate (ADGP), allowed us to suggest changes in the structure of the inhibitor that should improve the interaction pattern. The novel ligand was designed and synthesised. Biological experiments confirmed

  16. Cloning and expression of trehalose-6-phosphate synthase 1 from Rhizopus oryzae.

    Science.gov (United States)

    Ozer Uyar, Ebru; Yücel, Meral; Hamamcı, Haluk

    2016-05-01

    Trehalose is a reducing disaccharide acting as a protectant against environmental stresses in many organisms. In fungi, Trehalose-6-phosphate synthase 1 (TPS1) plays a key role in the biosynthesis of trehalose. In this study, a full-length cDNA from Rhizopus oryzae encoding TPS1 (designated as RoTPS1) was isolated. The RoTPS1 cDNA is composed of 2505 nucleotides and encodes a protein of 834 amino acids with a molecular mass of 97.8 kDa. The amino acid sequence of RoTPS1 has a relatively high homology with the TPS1s in several other filamentous fungi. RoTPS1 was cloned into Saccharomyces cerevisiae and secretively expressed.

  17. Evaluation of synthase and hemisynthase activities of glucosamine-6-phosphate synthase by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Gaucher-Wieczorek, Florence; Guérineau, Vincent; Touboul, David; Thétiot-Laurent, Sophie; Pelissier, Franck; Badet-Denisot, Marie-Ange; Badet, Bernard; Durand, Philippe

    2014-08-01

    Glucosamine-6-phosphate synthase (GlmS, EC 2.6.1.16) catalyzes the first and rate-limiting step in the hexosamine biosynthetic pathway, leading to the synthesis of uridine-5'-diphospho-N-acetyl-D-glucosamine, the major building block for the edification of peptidoglycan in bacteria, chitin in fungi, and glycoproteins in mammals. This bisubstrate enzyme converts D-fructose-6-phosphate (Fru-6P) and L-glutamine (Gln) into D-glucosamine-6-phosphate (GlcN-6P) and L-glutamate (Glu), respectively. We previously demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) allows determination of the kinetic parameters of the synthase activity. We propose here to refine the experimental protocol to quantify Glu and GlcN-6P, allowing determination of both hemisynthase and synthase parameters from a single assay kinetic experiment, while avoiding interferences encountered in other assays. It is the first time that MALDI-MS is used to survey the activity of a bisubstrate enzyme.

  18. Monitoring the Dynamics of Monomer Exchange Using Electrospray Mass Spectrometry: The Case of the Dimeric Glucosamine-6-Phosphate Synthase

    Science.gov (United States)

    Chevreux, Guillaume; Atmanene, Cédric; Lopez, Philippe; Ouazzani, Jamal; Van Dorsselaer, Alain; Badet, Bernard; Badet-Denisot, Marie-Ange; Sanglier-Cianférani, Sarah

    2011-03-01

    Escherichia coli glucosamine-6-phosphate synthase (GlmS) is a dimeric enzyme from the glutamine-dependent amidotransferases family, which catalyses the conversion of D-fructose-6-phosphate (Fru6P) and glutamine (Gln) into D-glucosamine-6-phosphate (GlcN6P) and glutamate, respectively. Extensive X-ray crystallography investigations have been reported, highlighting the importance of the dimeric association to form the sugar active site as well as significant conformational changes of the protein upon substrate and product binding. In the present work, an approach based on time-resolved noncovalent mass spectrometry has been developed to study the dynamics of GlmS subunit exchange. Using 14N versus 15N labeled proteins, the kinetics of GlmS subunit exchange was monitored with the wild-type enzyme in the presence of different substrates and products as well as with the protein bearing a key amino acid mutation specially designed to weaken the dimer interface. Determination of rate constants of subunit exchange revealed important modifications of the protein dynamics: while glutamine, glutamate, and K603A mutation accelerates subunit exchange, Fru6P and GlcN6P totally prevent it. These results are described in light of the available structural information, providing additional useful data for both the characterization of GlmS catalytic process and the design of new GlmS inhibitors. Finally, time-resolved noncovalent MS can be proposed as an additional biophysical technique for real-time monitoring of protein dynamics.

  19. Molecular Docking Studies of Catechin and Its Derivatives as Anti-bacterial Inhibitor for Glucosamine-6-Phosphate Synthase

    Science.gov (United States)

    Fikrika, H.; Ambarsari, L.; Sumaryada, T.

    2016-01-01

    Molecular docking simulation of catechin and its derivatives on Glucosamine-6- Phosphate Synthase (GlmS) has been performed in this research. GlmS inhibition by a particular ligand will suppress the production of bacterial cell wall and significantly reduce the population of invading bacteria. In this study, catechin derivatives i.e epicatechin, galloatechin and epigalloatechin were found to have stronger binding affinities as compared to natural ligand of GlmS, Fructose-6-Phosphate (F6P). Those three ligands were docked on the same pocket in GlmS target as F6P, with 70% binding sites similarity. Based on the docking results, gallocatechin turns out to be the most potent ligand for anti-bacterial agent with ΔG= -8.00 kcal/mol. The docking between GlmS and catechin derivatives are characterized by a constant present of a strong hydrogen bond between functional group O3 and Ser-349. This hydrogen bond most likely plays a significant role in the docking mechanism and binding modes selection. The surprising result is catechin itself exhibited a quite strong binding with GlmS (ΔG= -7.80 kcal.mol), but docked on a completely different pocket compared to other ligands. This results suggest that catechin might still have a curing effect but with a completely different pathway and mechanism as compared to its derivatives.

  20. Molecular cloning and cold-induced expression of trehalose-6-phosphate synthase gene in Harmonia axyridis (Coleoptera: Coccinellidae)%异色瓢虫海藻糖合成酶基因的克隆及低温诱导表达分析

    Institute of Scientific and Technical Information of China (English)

    秦资; 王甦; 魏苹; 徐彩娣; 唐斌; 张帆

    2012-01-01

    海藻糖是昆虫的血糖,在昆虫体内主要通过海藻糖合成酶(trehalose-6-phosphate synthase,TPS)催化合成.本研究通过同源克隆和cDNA末端快速扩增(rapid-amplification of cDNA ends,RACE)技术,从异色瓢虫Harmonia axyridis中克隆得到了TPS基因的cDNA全长序列,命名为HaTPS(GenBank登录号:FJ501960),全长2949 bp,包含3′非翻译区为505 bp,5′非翻译区为26bp,开放阅读框长2418 bp,共编码805个氨基酸.软件分析显示该基因编码蛋白的分子量为90.58 kD,等电点为7.01,包含两个糖基化位点,无信号肽和跨膜结构.同源比对分析发现,昆虫中TPS基因高度保守,包含两个保守的结构域.同时,采用实时荧光定量PCR技术对异色瓢虫HaTPS在不同发育阶段、低温诱导条件下的表达量进行了研究.结果表明:HaTPS在预蛹期的表达量最高;在短时低温诱导条件下,HaTPS的表达量随着温度的降低而显著升高,在降温和升温处理条件下,HaTPS的表达最呈现先升高后下降的表达趋势.结果表明,TPS基因在昆虫抗逆中起到了重要的调节作用.昆虫经过低温诱导,其TPS基因的调控能力得到提升.%Trehalose, which is the blood sugar in insects, is synthesized mainly by trehalose-6-phosphate synthase (TPS) in insects. By homologous cloning and rapid-amplification of cDNA ends (RACE), the full cDNA of the TPS gene in Harmonia axyridis was cloned and named HaTPS (GenBanfc accession number; FJ501960). This gene with 5' and 3' non-coding region of 26 bp and 505 bp, respectively, contains an open reading frame of 2 418 nucleotides encoding a protein of 805 ammo acids with the predicted molecular weight of 90.58 kDa and pI of 7.01. The encoded protein contains two potential N-glycosylation sites, without signal peptide and transmembrane domain. The homology comparison showed that insect TPS was highly conserved with two conserved domains. Real-time fluorescent quantitative PCR was conducted at different

  1. Analysis of the Escherichia coli glucosamine-6-phosphate synthase activity by isothermal titration calorimetry and differential scanning calorimetry.

    Science.gov (United States)

    Valerio-Lepiniec, Marie; Aumont-Nicaise, Magali; Roux, Céline; Raynal, Bertrand; England, Patrick; Badet, Bernard; Badet-Denisot, Marie-Ange; Desmadril, Michel

    2010-06-15

    Glucosamine-6-phosphate synthase (GlmS) is responsible for the first and rate-limiting step in the hexosamine biosynthetic pathway. It catalyzes the conversion of D-fructose-6P (F6P) into D-glucosamine-6P (GlcN6P) using L-glutamine (Gln) as nitrogen donor (synthase activity) according to an ordered bi-bi process where F6P binds first. In the absence of F6P, the enzyme exhibits a weak hydrolyzing activity of Gln into Glu and ammonia (glutaminase activity), whereas the presence of F6P strongly stimulates it (hemi-synthase activity). Until now, these different activities were indirectly measured using either coupled enzyme or colorimetric methods. In this work, we have developed a direct assay monitoring the heat released by the reaction. Isothermal titration calorimetry and differential scanning calorimetry were used to determine kinetic and thermodynamic parameters of GlmS. The direct determination at 37 degrees C of kinetic parameters and affinity constants for both F6P and Gln demonstrated that part of the ammonia produced by Gln hydrolysis in the presence of both substrates is not used for the formation of the GlcN6P. The full characterization of this phenomenon allowed to identify experimental conditions where this leak of ammonia is negligible. Enthalpy measurements at 25 degrees C in buffers of various heats of protonation demonstrated that no proton exchange with the medium occurred during the enzyme-catalyzed glutaminase or synthase reaction suggesting for the first time that both products are released as a globally neutral pair composed by the Glu carboxylic side chain and the GlcN6P amine function. Finally we showed that the oligomerization state of GlmS is concentration-dependent. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  2. Ethanol-induced yeast flocculation directed by the promoter of TPS1 encoding trehalose-6-phosphate synthase 1 for efficient ethanol production.

    Science.gov (United States)

    Li, Qian; Zhao, Xin-Qing; Chang, Alan K; Zhang, Qiu-Mei; Bai, Feng-Wu

    2012-01-01

    Yeast flocculation is an important trait in the brewing industry as well as in ethanol production, through which biomass can be recovered by cost-effective sedimentation. However, mass transfer limitation may affect yeast growth and ethanol fermentation if the flocculation occurs earlier before fermentation is completed. In this article, a novel type of cell-cell flocculation induced by trehalose-6-phosphate synthase 1 (TPS1) promoter was presented. The linear cassette HO-P(TPS1)-FLO1(SPSC01)-KanMX4-HO was constructed to transform the non-flocculating industrial yeast S. cerevisiae 4126 by chromosome integration to obtain a new flocculating yeast strain, ZLH01, whose flocculation was induced by ethanol produced during fermentation. The experimental results illustrated that flocculation of ZLH01 was triggered by 3% (v/v) ethanol and enhanced as ethanol concentration increased till complete flocculation was achieved at ethanol concentration of 8% (v/v). Real time PCR analysis confirmed that the expression of FLO1(SPSC01) was dependent on ethanol concentration. The growth and ethanol fermentation of ZLH01 were improved significantly, compared with the constitutive flocculating yeast BHL01 engineered with the same FLO gene but directed by the constitutive 3-phosphoglycerate kinase promoter PGK1, particularly under high temperature conditions. These characteristics make the engineered yeast more suitable for ethanol production from industrial substrates under high gravity and temperature conditions. In addition, this strategy offers advantage in inducing differential expression of other genes for metabolic engineering applications of S. cerevisiae.

  3. Floridoside and isofloridoside are synthesized by trehalose 6-phosphate synthase-like enzymes in the red alga Galdieria sulphuraria.

    Science.gov (United States)

    Pade, Nadin; Linka, Nicole; Ruth, Wolfgang; Weber, Andreas P M; Hagemann, Martin

    2015-02-01

    Compatible solutes are small molecules that are involved in acclimation to various abiotic stresses, especially high salinity. Among the red algae, the main photosynthetic products floridoside and isofloridoside (galactosylglycerols) are known also to contribute to the osmotic acclimation of cells. However, the genes encoding (iso)floridoside biosynthetic enzymes are still unknown. To identify candidate genes, we examined the genome of the floridoside- and isofloridoside-accumulating extremophilic red alga Galdieria sulphuraria belonging to the Cyanidiales. We hypothesized that two candidate genes, Gasu_10960 and Gasu_26940, code for enzymes involved in floridoside and isofloridoside biosynthesis. These proteins comprise a sugar phosphate synthase and a sugar phosphate phosphatase domain. To verify their biochemical activity, both genes were in vitro translated into the entire proteins. The protein translation mixture containing Gasu_10960 synthesized small amounts of isofloridoside, whereas the Gasu_26940 translation mix also produced small amounts of floridoside. Moreover, the expression of Gasu_10960 in a salt-sensitive mutant of the cyanobacterium Synechocystis sp. PCC 6803 resulted in increased salt tolerance as a consequence of the presence of isofloridoside in the complemented cells. Thus, our experiments suggest that the Gasu_26940 and Gasu_10960 genes of G. sulphuraria encode the enzymatically active floridoside and isofloridoside phosphate synthase/phosphatase fusion proteins, respectively, crucial for salt acclimation. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  4. Structural basis for morpheein-type allosteric regulation of Escherichia coli glucosamine-6-phosphate synthase: equilibrium between inactive hexamer and active dimer.

    Science.gov (United States)

    Mouilleron, Stéphane; Badet-Denisot, Marie-Ange; Pecqueur, Ludovic; Madiona, Karine; Assrir, Nadine; Badet, Bernard; Golinelli-Pimpaneau, Béatrice

    2012-10-01

    The amino-terminal cysteine of glucosamine-6-phosphate synthase (GlmS) acts as a nucleophile to release and transfer ammonia from glutamine to fructose 6-phosphate through a channel. The crystal structure of the C1A mutant of Escherichia coli GlmS, solved at 2.5 Å resolution, is organized as a hexamer, where the glutaminase domains adopt an inactive conformation. Although the wild-type enzyme is active as a dimer, size exclusion chromatography, dynamic and quasi-elastic light scattering, native polyacrylamide gel electrophoresis, and ultracentrifugation data show that the dimer is in equilibrium with a hexameric state, in vitro and in cellulo. The previously determined structures of the wild-type enzyme, alone or in complex with glucosamine 6-phosphate, are also consistent with a hexameric assembly that is catalytically inactive because the ammonia channel is not formed. The shift of the equilibrium toward the hexameric form in the presence of cyclic glucosamine 6-phosphate, together with the decrease of the specific activity with increasing enzyme concentration, strongly supports product inhibition through hexamer stabilization. Altogether, our data allow us to propose a morpheein model, in which the active dimer can rearrange into a transiently stable form, which has the propensity to form an inactive hexamer. This would account for a physiologically relevant allosteric regulation of E. coli GlmS. Finally, in addition to cyclic glucose 6-phosphate bound at the active site, the hexameric organization of E. coli GlmS enables the binding of another linear sugar molecule. Targeting this sugar-binding site to stabilize the inactive hexameric state is therefore suggested for the development of specific antibacterial inhibitors.

  5. Engineering sorbitol-6-phosphate Dehydrogenase encoding gene in the lactose operon of Lactobacillus casei.

    OpenAIRE

    Nissen, Lorenzo; Yebra, María Jesús; Sgobarti, Barbara; Pérez Martínez, Gaspar

    2005-01-01

    Sorbitol is a sugar polyol claimed to have health-promoting properties. D-sorbitol-6-phosphate dehydrogeanse (StolPDh) is required for sorbose and sorbitol metabolism in Lactobacillus casei. StolPDh catalyzes the oxidation of Sorbitol-6-phosphate and also the reverse reaction, or reather, the reduction of fructose-6-phosphate with NAD+ regeneration. In order to test this function in vivo, a new food grade recombinant strain of L. casei was constructed by the integration of a StolPDh-encodi...

  6. Trehalose metabolism in the blue crab Callinectes sapidus: isolation of multiple structural cDNA isoforms of trehalose-6-phosphate synthase and their expression in muscles.

    Science.gov (United States)

    Shi, Q; Chung, J Sook

    2014-02-15

    Adult blue crab Callinectes sapidus exhibit behavioral and ecological dimorphisms: females migrating from the low salinity water to the high salinity area vs. males remaining in the same areas. The flesh basal muscle of the swimming paddle shows a dimorphic color pattern in that levator (Lev) and depressor (Dep) of females tend to be much darker than those of males, while both genders have the same light colored remoter (Rem) and promoter (Pro). The full-length cDNA sequence of four structural isoforms of trehalose-6-phosphate synthase (TPS) is isolated from chela muscles of an adult female, C. sapidus. Two isoforms of the C. sapidus TPS encode functional domains of TPS and trehalose-6-phosphorylase (TPP) in tandem as a fused gene product of Escherichia coli Ost A and Ost B. The other two isoforms contain only a single TPS domain. In both males and females, the darker (Lev+Dep) muscles exhibit greater amounts of trehalose, TPS and trehalase activities than the light colored (Rem+Pro). The fact that adult females show higher levels of trehalase activity in the basal muscles and of glucose in Lev+Dep than those of adult males suggests that there may be a metabolic dimorphism. Moreover, the involvement of trehalose in energy metabolism that was examined under the condition of strenuous swimming activity mimicked in adult females demonstrates the intrinsic trehalose metabolism in Lev+Dep, which subsequently results in hemolymphatic hyperglycemia and hyperlactemia. Our data support that trehalose serves as an additional carbohydrate source of hemolymphatic hyperglycemia in this species. Behavioral and ecological dimorphisms of C. sapidus adults may be supported by a functional dimorphism in energy metabolism. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Glucose-6-phosphate dehydrogenase

    Science.gov (United States)

    ... medlineplus.gov/ency/article/003671.htm Glucose-6-phosphate dehydrogenase test To use the sharing features on this page, please enable JavaScript. Glucose-6-phosphate dehydrogenase (G6PD) is a protein that helps red ...

  8. Regulation of hexokinase and glucose-6-phosphate dehydrogenase genes expression at norm and pathology

    Directory of Open Access Journals (Sweden)

    Marunych R. Yu.

    2013-03-01

    Full Text Available The increasing of glycolysis in tumors under aerobic conditions is known as Warburg phenomenon; the activity of the pentose phosphate pathway increases also significantly. The pentose phosphate pathway and glycolysis, especially their first steps, and the regulatory enzyme 6-phosphofrukto-2-kinase/fructose-2,6-bisphosphatase are influenced by cell signaling systems such as the system of circadian clock, the system of hypoxia-inducible factor and unfolded protein response system, that allow malignant cells to adapt to stress factors such as hypoxia, ischemia and influence of low molecular agents. The review enlightens the impact of signaling systems on the key enzymes of glycolysis and the pentose phosphate pathway gene expression in normal cells and in malignant cells, and their importance for survival of malignant cells under stress conditions.

  9. Effects of variant UDP-glucuronosyltransferase 1A1 gene,glucose-6-phosphate dehydrogenase deficiency and thalassemia on cholelithiasis

    Institute of Scientific and Technical Information of China (English)

    Yang-Yang Huang; Ching-Shui Huang; Sien-Sing Yang; Min-Shung Lin; May-Jen Huang; Ching-Shan Huang

    2005-01-01

    AIM: To test the hypothesis that the variant UDPglucuronosyltransferase 1A1 (UGT1A1) gene, glucose-6-phosphate dehydrogenase (G6PD) deficiency, and thalassemia influence bilirubin metabolism and play a role in the development of cholelithiasis.METHODS: A total of 372 Taiwan Chinese with cholelithiasis who had undergone cholecystectomy and 293 healthy individuals were divided into case and control groups,respectively. PCR and restriction fragment length polymorphism were used to analyze the promoter area and nucleotides 211, 686, 1 091, and 1 456 of the UGT1A1 gene for all subjects and the gene variants for thalassemia and G6PD deficiency.RESULTS: Variation frequencies for the cholelithiasis patients were 16.1%, 25.8%, 5.4%, and 4.3% for A(TA)6TAA/A(TA)7TAA (6/7), heterozygosity within the coding region, compound heterozygosity, and homozygosity of the UGT1A1 gene, respectively. Comparing the case and control groups, a statistically significant difference in frequency was demonstrated for the homozygous variation of the UGT1A1 gene (P = 0.012, χ2 test), but not for the other variations. Further, no difference was demonstrated in a between-group comparison of the incidence of G6PD deficiency and thalassemia (2.7% vs 2.4% and 5.1% vs 5.1%, respectively). The bilirubin levels for the cholelithiasis patients with the homozygous variant-UGT1A1 gene were significantly different from the control analog (18.0±6.5 and 12.7±2.9 μmol/L, respectively; P<0.001, Student's ttest).CONCLUSION: Our results show that the homozygous variation in the UGT1A1 gene is a risk factor for the development of cholelithiasis in Taiwan Chinese.

  10. Effects of variant UDP-glucuronosyltransferase 1A1 gene, glucose-6-phosphate dehydrogenase deficiency and thalassemia on cholelithiasis

    Science.gov (United States)

    Huang, Yang-Yang; Huang, Ching-Shui; Yang, Sien-Sing; Lin, Min-Shung; Huang, May-Jen; Huang, Ching-Shan

    2005-01-01

    AIM: To test the hypothesis that the variant UDP-glucuronosyltransferase 1A1 (UGT1A1) gene, glucose-6-phosphate dehydrogenase (G6PD) deficiency, and thalassemia influence bilirubin metabolism and play a role in the development of cholelithiasis. METHODS: A total of 372 Taiwan Chinese with cholelithiasis who had undergone cholecystectomy and 293 healthy individuals were divided into case and control groups, respectively. PCR and restriction fragment length polymorphism were used to analyze the promoter area and nucleotides 211, 686, 1 091, and 1 456 of the UGT1A1 gene for all subjects and the gene variants for thalassemia and G6PD deficiency. RESULTS: Variation frequencies for the cholelithiasis patients were 16.1%, 25.8%, 5.4%, and 4.3% for A(TA)6 TAA/A(TA)7TAA (6/7), heterozygosity within the coding region, compound heterozygosity, and homozygosity of the UGT1A1 gene, respectively. Comparing the case and control groups, a statistically significant difference in frequency was demonstrated for the homozygous variation of the UGT1A1 gene (P = 0.012, χ2 test), but not for the other variations. Further, no difference was demonstrated in a between-group comparison of the incidence of G6PD deficiency and thalassemia (2.7% vs 2.4% and 5.1% vs 5.1%, respectively). The bilirubin levels for the cholelithiasis patients with the homozygous variant-UGT1A1 gene were significantly different from the control analog (18.0 ± 6.5 and 12.7 ± 2.9 μmol/L, respectively; Pcholelithiasis in Taiwan Chinese. PMID:16237771

  11. Identification of point mutations in Glucose-6-Phosphate Dehydrogenase gene in Timor Island people : A preliminary report

    Directory of Open Access Journals (Sweden)

    Widanto Hardjowasito

    2001-12-01

    Full Text Available Glucose 6 phosphate dehydrogenase (G6PD deficiency is common in malaria endemic region, however no molecular study has been performed on G6PD deficiency in Timor Island, Indonesia a malarial hyperendemic area which Proto Malay is the majority of the people in that island. To observe the frequency and molecular type of mutations in G6PD deficient Proto Malay people, 118 native people were screened using formazan ring test. Mutation in the G6PD gene were determined by MPTP (Multiple PCR using Multiple Tandem Forward Primers and a common Reserve Pimer method and confirmed by automatic sequencer. This study shows that three males have lower G6PD activity. Using MPTP method, a point mutation could be indicated in the two cases. Sequencing of the amplified products in 2 G6PD patients disclosed mutations of T383C in exon 5 and C 592 T in exon 6 in respective case. Our result documents point mutations in exon 5 and exon 6 in the G6PD gene of two Proto Malay people in Timor. These mutations are common in Asia region. (Med J Indones 2001; 10: 210-3Keywords: mutations, G6PD, Proto Malay.

  12. Physical mapping of the human glutamine:fructose-6-phosphate amidotransferase gene (GFPT) to chromosome 2p13

    Energy Technology Data Exchange (ETDEWEB)

    Whitmore, T.E.; Mudri, S.L.; McKnight, G.L. [ZymoGenetics, Inc., Seattle, WA (United States)

    1995-03-20

    Diabetic hyperglycemia influences insulin resistance through a process termed glucose toxicity. Implicated as a source of the mediators of this toxicity is an increased intracellular glucose metabolism through the hexosamine pathway. The hexosamine pathway itself is controlled by the rate-limiting enzyme glutamine:fructose-6-phosphate amidotransferase (GFAT), which is the first enzyme of the pathway. It has been shown that there is a close correlation between the glucose-mediated reduction of GFAT activity and the onset of insulin desensitization of the glucose transport system, a condition associated with insulin-resistant states of non-insulin-dependent diabetes mellitus and obesity. To gain a better understanding of the molecular regulation of GFAT and its role in the induction of insulin resistance, we previously isolated and cloned the cDNA for the human form of this enzyme and expressed the functional protein in Escherichia coli. 9 refs., 1 fig.

  13. Glucose-6-phosphate dehydrogenase deficiency

    Science.gov (United States)

    ... medlineplus.gov/ency/article/000528.htm Glucose-6-phosphate dehydrogenase deficiency To use the sharing features on this page, please enable JavaScript. Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a condition in which ...

  14. High Level Expression of Glucose-6-phosphate Dehydrogenase Gene PsG6PDH from Populus suaveolens in E. coli

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    In order to investigate the functions of the gene PsG6PDH and the mechanisms underlying freezing tolerance of Populus suaveolens, the recombinant expression vector pET-G (pET30a-G6PDH), which contained full encoding region of PsG6PDH gene, was established. The recombinant was identified by lawn-PCR and double enzyme digestion and then transformed into expression host XA90 and induced by isopropyl-a-D-thiogalactoside (IPTG) to express 100 kD polypeptide of G6PDH fusion protein. The results showed that the expressed amount of the fusion protein culminated after 1 mmol·L-1 IPTG treatment for 4 h and that pET-G product was predominately soluble and not extra-cellular secreting.

  15. Cloning and Sequence Analysis of a Glucose-6-Phosphate Dehydrogenase Gene PsG6PDH from Freezing-tolerant Populus suaveolens

    Institute of Scientific and Technical Information of China (English)

    Lin Yuan-zhen; Lin Shan-zhi; Zhang Wei; Zhang Qian; Zhang Zhi-yi; Guo Huan

    2005-01-01

    A 1207 hp cDNA fragment (PsG6PDH) was amplified by PT-PCR from cold-induced total Pna of the freexing-tolerant P. Suaveolens, using primers based on the highly comserved region of published plant glucose-6-phosphate dehydrogenase (G6PDH)genes. The sepuence analysis showed that PsG6PDH coding region had 1 101 bp and encoded 367 predicted aminoacid residues. Moreover, the nucleotide sequence of psG6PDH showed 83%,82%,79%,79% and 78% identity, and the derived amino acid sequence shared 44.2%,44.7%,42.0%,40.5% and 43.9% identity with those of the Solanum tuberosum, Nicotiana tabacum, Triticum aestivum, Oryxa sativa and Arabidopsis thaliana, respectively. The results show that PsG6PDH is a new member of G6PDH gene family and belongs to cytosolic G6PDH gene. This is the first report on clonign of the G6PDH gene from woody plants.

  16. Identification of glucoselysine-6-phosphate deglycase, an enzyme involved in the metabolism of the fructation product glucoselysine.

    OpenAIRE

    Wiame, Elsa; Lamosa, Pedro; Santos, Helena; Van Schaftingen, Emile

    2005-01-01

    The metabolism of the glycation product fructose-epsilon-lysine in Escherichia coli involves its ATP-dependent phosphorylation by a specific kinase (FrlD), followed by the conversion of fructoselysine 6-phosphate into glucose 6-phosphate and lysine by fructoselysine-6-phosphate deglycase (FrlB), which is distantly related to the isomerase domain of glucosamine-6-phosphate synthase. As shown in the present work, several bacterial operons comprise: (1) a homologue of fructoselysine-6-phosphate ...

  17. Enhanced production of epsilon-caprolactone by overexpression of NADPH-regenerating glucose 6-phosphate dehydrogenase in recombinant Escherichia coli harboring cyclohexanone monooxygenase gene.

    Science.gov (United States)

    Lee, Won-Heong; Park, Jin-Byung; Park, Kyungmoon; Kim, Myoung-Dong; Seo, Jin-Ho

    2007-08-01

    Whole-cell conversion of cyclohexanone to epsilon-caprolactone was attempted by recombinant Escherichia coli BL21(DE3) expressing cyclohexanone monooxygenase (CHMO) of Acinetobacter calcoaceticus NCIMB 9871. High concentrations of cyclohexanone and epsilon-caprolactone reduced CHMO-mediated bioconversion of cyclohexanone to epsilon-caprolactone in the resting recombinant E. coli cells. Metabolically active cells were employed by adopting a fed-batch culture to improve the production of epsilon-caprolactone from cyclohexanone. A glucose-limited fed-batch Baeyer-Villiger oxidation where a cyclohexanone level was maintained less than 6 g/l resulted in a maximum epsilon-caprolactone concentration of 11.0 g/l. The maximum epsilon-caprolactone concentration was improved further to 15.3 g/l by coexpression of glucose-6-phosphate dehydrogenase, an NADPH-generating enzyme encoded by the zwf gene which corresponded to a 39% enhancement in epsilon-caprolactone concentration compared with the control experiment performed under the same conditions.

  18. Targeted disruption of the housekeeping gene encoding glucose 6-phosphate dehydrogenase (G6PD-null): G6PD is dispensable for pentose synthesis but essential for defense against oxidative stress.

    NARCIS (Netherlands)

    P.P. Pandolfi; F. Sonati; R. Rivi; P. Mason; F.G. Grosveld (Frank); L. Luzzatto

    1995-01-01

    textabstractGlucose 6-phosphate dehydrogenase (G6PD) is a housekeeping enzyme encoded in mammals by an X-linked gene. It has important functions in intermediary metabolism because it catalyzes the first step in the pentose phosphate pathway and provides reductive potential in the form of NADPH. In h

  19. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  20. Mutational Analyses of Glucose Dehydrogenase and Glucose-6-Phosphate Dehydrogenase Genes in Pseudomonas fluorescens Reveal Their Effects on Growth and Alginate Production.

    Science.gov (United States)

    Maleki, Susan; Mærk, Mali; Valla, Svein; Ertesvåg, Helga

    2015-05-15

    The biosynthesis of alginate has been studied extensively due to the importance of this polymer in medicine and industry. Alginate is synthesized from fructose-6-phosphate and thus competes with the central carbon metabolism for this metabolite. The alginate-producing bacterium Pseudomonas fluorescens relies on the Entner-Doudoroff and pentose phosphate pathways for glucose metabolism, and these pathways are also important for the metabolism of fructose and glycerol. In the present study, the impact of key carbohydrate metabolism enzymes on growth and alginate synthesis was investigated in P. fluorescens. Mutants defective in glucose-6-phosphate dehydrogenase isoenzymes (Zwf-1 and Zwf-2) or glucose dehydrogenase (Gcd) were evaluated using media containing glucose, fructose, or glycerol. Zwf-1 was shown to be the most important glucose-6-phosphate dehydrogenase for catabolism. Both Zwf enzymes preferred NADP as a coenzyme, although NAD was also accepted. Only Zwf-2 was active in the presence of 3 mM ATP, and then only with NADP as a coenzyme, indicating an anabolic role for this isoenzyme. Disruption of zwf-1 resulted in increased alginate production when glycerol was used as the carbon source, possibly due to decreased flux through the Entner-Doudoroff pathway rendering more fructose-6-phosphate available for alginate biosynthesis. In alginate-producing cells grown on glucose, disruption of gcd increased both cell numbers and alginate production levels, while this mutation had no positive effect on growth in a non-alginate-producing strain. A possible explanation is that alginate synthesis might function as a sink for surplus hexose phosphates that could otherwise be detrimental to the cell.

  1. The tomato terpene synthase gene family

    NARCIS (Netherlands)

    Falara, V.; Akhtar, T.A.; Nguyen, T.T.H.; Spyropoulou, E.A.; Bleeker, P.M.; Schauvinhold, I.; Matsuba, Y.; Bonini, M.E.; Schilmiller, A.L.; Last, R.L.; Schuurink, R.C.; Pichersky, E.

    2011-01-01

    Compounds of the terpenoid class play many roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of Solanum lycopersicum (cultivated tomato) contains 40 terpene synthase (TPS) genes, including 28

  2. A novel R198H mutation in the glucose-6-phosphate dehydrogenase gene in the tribal groups of the Nilgiris in Southern India.

    Science.gov (United States)

    Chalvam, R; Kedar, P S; Colah, R B; Ghosh, K; Mukherjee, M B

    2008-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common red cell enzymopathy among humans. In India, G6PD Mediterranean, G6PD Orissa, and G6PD Kerala-Kalyan are the three common mutations which account almost 90% of G6PD deficiency. Here we describe G6PD Coimbra, an unreported variant from India, and a novel 593 G --> A mutation in exon 6 with an amino acid change of Arg 198 His, among the tribal groups of the Nilgiris in Southern India. Further, this novel mutation was structurally characterized and it was found that the mutation is located at the end of the coenzyme domain, which may cause enzyme instability.

  3. Molecular evolution and sequence divergence of plant chalcone synthase and chalcone synthase-Like genes.

    Science.gov (United States)

    Han, Yingying; Zhao, Wenwen; Wang, Zhicui; Zhu, Jingying; Liu, Qisong

    2014-06-01

    Plant chalcone synthase (CHS) and CHS-Like (CHSL) proteins are polyketide synthases. In this study, we evaluated the molecular evolution of this gene family using representative types of CHSL genes, including stilbene synthase (STS), 2-pyrone synthase (2-PS), bibenzyl synthase (BBS), acridone synthase (ACS), biphenyl synthase (BIS), benzalacetone synthase, coumaroyl triacetic acid synthase (CTAS), and benzophenone synthase (BPS), along with their CHS homologs from the same species of both angiosperms and gymnosperms. A cDNA-based phylogeny indicated that CHSLs had diverse evolutionary patterns. STS, ACS, and 2-PS clustered with CHSs from the same species (late diverged pattern), while CTAS, BBS, BPS, and BIS were distant from their CHS homologs (early diverged pattern). The amino-acid phylogeny suggested that CHS and CHSL proteins formed clades according to enzyme function. The CHSs and CHSLs from Polygonaceae and Arachis had unique evolutionary histories. Synonymous mutation rates were lower in late diverged CHSLs than in early diverged ones, indicating that gene duplications occurred more recently in late diverged CHSLs than in early diverged ones. Relative rate tests proved that late diverged CHSLs had unequal rates to CHSs from the same species when using fatty acid synthase, which evolved from the common ancestor with the CHS superfamily, as the outgroup, while the early diverged lineages had equal rates. This indicated that late diverged CHSLs experienced more frequent mutation than early diverged CHSLs after gene duplication, allowing obtaining new functions in relatively short period of time.

  4. Evaluation on the effectiveness of 2-deoxyglucose-6-phosphate phosphatase (DOGR1) gene as a selectable marker for oil palm (Elaeis guineensis Jacq.) embryogenic calli transformation mediated by Agrobacterium tumefaciens

    Science.gov (United States)

    Izawati, Abang Masli Dayang; Masani, Mat Yunus Abdul; Ismanizan, Ismail; Parveez, Ghulam Kadir Ahmad

    2015-01-01

    DOGR1, which encodes 2-deoxyglucose-6-phosphate phosphatase, has been used as a selectable marker gene to produce transgenic plants. In this study, a transformation vector, pBIDOG, which contains the DOGR1 gene, was transformed into oil palm embryogenic calli (EC) mediated by Agrobacterium tumefaciens strain LBA4404. Transformed EC were exposed to 400 mg l-1 2-deoxyglucose (2-DOG) as the selection agent. 2-DOG resistant tissues were regenerated into whole plantlets on various regeneration media containing the same concentration of 2-DOG. The plantlets were later transferred into soil and grown in a biosafety screenhouse. PCR and subsequently Southern blot analyses were carried out to confirm the integration of the transgene in the plantlets. A transformation efficiency of about 1.0% was obtained using DOGR1 gene into the genome of oil palm. This result demonstrates the potential of using combination of DOGR1 gene and 2-DOG for regenerating transgenic oil palm. PMID:26442041

  5. Trichinella pseudospiralis vs. T. spiralis thymidylate synthase gene structure and T. pseudospiralis thymidylate synthase retrogene sequence.

    Science.gov (United States)

    Jagielska, Elżbieta; Płucienniczak, Andrzej; Dąbrowska, Magdalena; Dowierciał, Anna; Rode, Wojciech

    2014-04-09

    Thymidylate synthase is a housekeeping gene, designated ancient due to its role in DNA synthesis and ubiquitous phyletic distribution. The genomic sequences were characterized coding for thymidylate synthase in two species of the genus Trichinella, an encapsulating T. spiralis and a non-encapsulating T. pseudospiralis. Based on the sequence of parasitic nematode Trichinella spiralis thymidylate synthase cDNA, PCR techniques were employed. Each of the respective gene structures encompassed 6 exons and 5 introns located in conserved sites. Comparison with the corresponding gene structures of other eukaryotic species revealed lack of common introns that would be shared among selected fungi, nematodes, mammals and plants. The two deduced amino acid sequences were 96% identical. In addition to the thymidylate synthase gene, the intron-less retrocopy, i.e. a processed pseudogene, with sequence identical to the T. spiralis gene coding region, was found to be present within the T. pseudospiralis genome. This pseudogene, instead of the gene, was confirmed by RT-PCR to be expressed in the parasite muscle larvae. Intron load, as well as distribution of exon and intron phases in thymidylate synthase genes from various sources, point against the theory of gene assembly by the primordial exon shuffling and support the theory of evolutionary late intron insertion into spliceosomal genes. Thymidylate synthase pseudogene expressed in T. pseudospiralis muscle larvae is designated a retrogene.

  6. Evaluation on the effectiveness of 2-deoxyglucose-6-phosphate phosphatase (DOG(R)1) gene as a selectable marker for oil palm (Elaeis guineensis Jacq.) embryogenic calli transformation mediated by Agrobacterium tumefaciens.

    Science.gov (United States)

    Izawati, Abang Masli Dayang; Masani, Mat Yunus Abdul; Ismanizan, Ismail; Parveez, Ghulam Kadir Ahmad

    2015-01-01

    DOG(R)1, which encodes 2-deoxyglucose-6-phosphate phosphatase, has been used as a selectable marker gene to produce transgenic plants. In this study, a transformation vector, pBIDOG, which contains the DOG(R)1 gene, was transformed into oil palm embryogenic calli (EC) mediated by Agrobacterium tumefaciens strain LBA4404. Transformed EC were exposed to 400 mg l(-1) 2-deoxyglucose (2-DOG) as the selection agent. 2-DOG resistant tissues were regenerated into whole plantlets on various regeneration media containing the same concentration of 2-DOG. The plantlets were later transferred into soil and grown in a biosafety screenhouse. PCR and subsequently Southern blot analyses were carried out to confirm the integration of the transgene in the plantlets. A transformation efficiency of about 1.0% was obtained using DOG(R)1 gene into the genome of oil palm. This result demonstrates the potential of using combination of DOG(R)1 gene and 2-DOG for regenerating transgenic oil palm.

  7. Evaluation on the Effectiveness of 2-Deoxyglucose-6-phosphate phosphatase (DOGR1 Gene as a Selectable Marker for Oil Palm (Elaeis guineensis Jacq. Embryogenic Calli Transformation Mediated by Agrobacterium tumefaciens.

    Directory of Open Access Journals (Sweden)

    Abang Masli eDayang Izawati

    2015-09-01

    Full Text Available DOGR1, which encodes for 2-deoxyglucose-6-phosphate phosphatase, has been used as a selectable marker gene to produce transgenic plants. In this study, a transformation vector, pBIDOG, which contains the DOGR1 gene, was transformed into oil palm embryogenic calli mediated by Agrobacterium tumefaciens strain LBA4404. Transformed embryogenic calli were exposed to 400 mg l–1 2-deoxyglucose (2-DOG as the selection agent. 2-DOG resistant tissues were regenerated into whole plantlets on various regeneration media containing the same concentration of 2-DOG. The plantlets were later transferred into soil and grown in a biosafety screenhouse. PCR and subsequently Southern blot analyses were carried out to confirm the integration of the transgene in the plantlets. A transformation efficiency of about 1.0% was obtained using DOGR1 gene into the genome of oil palm. This result demonstrates the potential of using combination of DOGR1 gene and 2-DOG for regenerating transgenic oil palm.

  8. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... 1Department of Environmental Biotechnology, Bharathidasan University, ... script and UA cloning vector (QIAGEN PCR Cloning Kit) was used to clone ..... Expression of a Arabidopsis sucrose synthase gene indicates a role.

  9. Glusoce-6-phosphate dehydrogenase- History and diagnosis

    Directory of Open Access Journals (Sweden)

    K Gautam

    2016-09-01

    Full Text Available Glucose-6-phosphate dehydrogenase deficiency is the most common enzymatic defect of red blood cells, which increases the vulnerability of erythrocytes to oxidative stress leading to hemolytic anemia. Since its identification more than 60 years ago, much has been done with respect to its clinical diagnosis, laboratory diagnosis and treatment. Association of G6PD is not just limited to anti malarial drugs, but a vast number of other diseases. In this article, we aimed to review the history of Glucose-6-phosphate dehydrogenase, the diagnostic methods available along with its association with other noncommunicable diseases. 

  10. L-Ribose production from L-arabinose by immobilized recombinant Escherichia coli co-expressing the L-arabinose isomerase and mannose-6-phosphate isomerase genes from Geobacillus thermodenitrificans.

    Science.gov (United States)

    Kim, Kyoung-Rok; Seo, Eun-Sun; Oh, Deok-Kun

    2014-01-01

    L-Ribose is an important precursor for antiviral agents, and thus its high-level production is urgently demanded. For this aim, immobilized recombinant Escherichia coli cells expressing the L-arabinose isomerase and variant mannose-6-phosphate isomerase genes from Geobacillus thermodenitrificans were developed. The immobilized cells produced 99 g/l L-ribose from 300 g/l L-arabinose in 3 h at pH 7.5 and 60 °C in the presence of 1 mM Co(2+), with a conversion yield of 33 % (w/w) and a productivity of 33 g/l/h. The immobilized cells in the packed-bed bioreactor at a dilution rate of 0.2 h(-1) produced an average of 100 g/l L-ribose with a conversion yield of 33 % and a productivity of 5.0 g/l/h for the first 12 days, and the operational half-life in the bioreactor was 28 days. Our study is first verification for L-ribose production by long-term operation and feasible for cost-effective commercialization. The immobilized cells in the present study also showed the highest conversion yield among processes from L-arabinose as the substrate.

  11. Bacillus caldolyticus prs gene encoding phosphoribosyl-diphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-1-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  12. Glucose-6-phosphate dehydrogenase-derived NADPH fuels superoxide production in the failing heart

    Science.gov (United States)

    In the failing heart, NADPH oxidase and uncoupled NO synthase utilize cytosolic NADPH to form superoxide. NADPH is supplied principally by the pentose phosphate pathway, whose rate-limiting enzyme is glucose 6-phosphate dehydrogenase (G6PD). Therefore, we hypothesized that cardiac G6PD activation dr...

  13. Trehalose-6-phosphate synthase and stabilization of yeast glycolysis

    DEFF Research Database (Denmark)

    Fraenkel, Dan; Nielsen, Jens

    2016-01-01

    ‘Lost in transition: Startup of glycolysis yields subpopulations of nongrowing cells…’ (‘LIT’, van Heerden et al. 2014) is a massive paper from groups in Amsterdam and Delft, which deals with broad issues in metabolism and cell heterogeneity, as addressed for the predominant metabolic pathway......, glycolysis, in the context of a long studied but incompletely understood yeast mutant which is impaired in use of glucose without evident direct defects in the pathway. The primary approach is the quite original one of predicting, for the mutant, the dynamics of metabolism upon glucose addition, based...

  14. Characterization of a Mannose-6-Phosphate Isomerase from Bacillus amyloliquefaciens and Its Application in Fructose-6-Phosphate Production.

    Directory of Open Access Journals (Sweden)

    Sujan Sigdel

    Full Text Available The BaM6PI gene encoding a mannose-6-phosphate isomerase (M6PI, EC 5.3.1.8 was cloned from Bacillus amyloliquefaciens DSM7 and overexpressed in Escherichia coli. The enzyme activity of BaM6PI was optimal at pH and temperature of 7.5 and 70°C, respectively, with a kcat/Km of 13,900 s-1 mM-1 for mannose-6-phosphate (M6P. The purified BaM6PI demonstrated the highest catalytic efficiency of all characterized M6PIs. Although M6PIs have been characterized from several other sources, BaM6PI is distinguished from other M6PIs by its wide pH range and high catalytic efficiency for M6P. The binding orientation of the substrate M6P in the active site of BaM6PI shed light on the molecular basis of its unusually high activity. BaM6PI showed 97% substrate conversion from M6P to fructose-6-phosphate demonstrating the potential for using BaM6PI in industrial applications.

  15. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B;

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  16. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  17. Cryptic Polyketide Synthase Genes in Non-Pathogenic Clostridium SPP

    Science.gov (United States)

    Behnken, Swantje; Hertweck, Christian

    2012-01-01

    Modular type I polyketide synthases (PKS) produce a vast array of bacterial metabolites with highly diverse biological functions. Notably, all known polyketides were isolated from aerobic bacteria, and yet no example has been reported for strict anaerobes. In this study we explored the diversity and distribution of PKS genes in the genus Clostridium. In addition to comparative genomic analyses combined with predictions of modular type I polyketide synthase (PKS) gene clusters in sequenced genomes of Clostridium spp., a representative selection of other species inhabiting a variety of ecological niches was investigated by PCR screening for PKS genes. Our data reveal that all studied pathogenic Clostridium spp. are devoid of putative PKS genes. In stark contrast, cryptic PKS genes are widespread in genomes of non-pathogenic Clostridium species. According to phylogenetic analyses, the Clostridium PKS genes have unusual and diverse origins. However, reverse transcription quantitative PCR demonstrates that these genes are silent under standard cultivation conditions, explaining why the related metabolites have been overlooked until now. This study presents clostridia as a putative source for novel bioactive polyketides. PMID:22235310

  18. Glucose 6-phosphate regulates hepatic glycogenolysis through inactivation of phosphorylase.

    Science.gov (United States)

    Aiston, Susan; Andersen, Birgitte; Agius, Loranne

    2003-06-01

    High glucose concentration suppresses hepatic glycogenolysis by allosteric inhibition and dephosphorylation (inactivation) of phosphorylase-a. The latter effect is attributed to a direct effect of glucose on the conformation of phosphorylase-a. Although glucose-6-phosphate (G6P), like glucose, stimulates dephosphorylation of phosphorylase-a by phosphorylase phosphatase, its physiological role in regulating glycogenolysis in intact hepatocytes has not been tested. We show in this study that metabolic conditions associated with an increase in G6P, including glucokinase overexpression and incubation with octanoate or dihydroxyacetone, cause inactivation of phosphorylase. The latter conditions also inhibit glycogenolysis. The activity of phosphorylase-a correlated inversely with the G6P concentration within the physiological range. The inhibition of glycogenolysis and inactivation of phosphorylase-a caused by 10 mmol/l glucose can be at least in part counteracted by inhibition of glucokinase with 5-thioglucose, which lowers G6P. In conclusion, metabolic conditions that alter the hepatic G6P content affect glycogen metabolism not only through regulation of glycogen synthase but also through regulation of the activation state of phosphorylase. Dysregulation of G6P in diabetes by changes in activity of glucokinase or glucose 6-phosphatase may be a contributing factor to impaired suppression of glycogenolysis by hyperglycemia.

  19. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    Science.gov (United States)

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  20. Cloning and Identification of Methionine Synthase Gene from Pichia pastoris

    Institute of Scientific and Technical Information of China (English)

    Lan HUANG; Dong-Yang LI; Shao-Xiao WANG; Shi-Ming ZHANG; Jun-Hui CHEN; Xiang-Fu WU

    2005-01-01

    Methionine synthase (MS) is grouped into two classes. Class One MS (MetH) and Class Two MS (MetE) share no homology and differ in their catalytic model. Based on the conserved sequences of metE genes from different organisms, a segment of the metE gene was first cloned from Pichia pastoris genomic DNA by PCR, and its 5' and 3' regions were further cloned by 5'- and 3'-rapid amplification of cDNA ends (RACE), respectively. The assembled sequence reveals an open reading frame encoding a polypeptide of 768 residues, and the deduced product shares 76% identity with MetE of Saccharomyces cerevisiae. P. pastoris methionine synthase (PpMetE) consists of two domains common to MetEs. The active site is located in the C-terminal domain, in which the residues involved in the interaction of zinc with substrates are conserved. Homologous expression of PpMetE in P. pastoris was achieved, and the heterologous expression of PpMetE in the S. cerevisiae strain XJB3-1D that is MetE-defective restored the growth of the mutant on methionine-free minimal media. The gene sequence has been submitted to GenBank/EMBL/DDBJ under accession No. AY601648.

  1. Expression of the Grifola frondosa Trehalose Synthase Gene and Improvement of Drought-Tolerance in Sugarcane (Saccharum officinarum L.)

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Trehalose is a nonreducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances stress tolerance to abiotic stresses in organisms. We report here the expression of a Grifola frondosa trehalose synthase (TSase) gene for improving drought tolerance in sugarcane (Saccharum officinarum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and transferred into sugarcane by Agrobacterium tumefaciens EHA105. The transgenic plants accumulated high levels of trehalose, up to 8.805-12.863 mg/g fresh weight, whereas it was present at undetectable level in nontransgenic plants. It has been reported that transgenic plants transformed with Escherichia coli TPS (trehalose-6-phosphatesynthase) and/or TPP (trehalose-6-phosphate phosphatase) are severely stunted and have root morphologic alterations. Interestingly, our transgenic sugarcane plants had no obvious morphological changes and no growth inhibition in the field. Trehalose accumulation in 35S-35S: TSase plants resulted in increased drought tolerance, as shown by the drought and the drought physiological indexes, such as the rate of bound water/free water, plasma membrane permeability, malondialdehyde content, chlorophyll a and b contents,and activity of SOD and POD of the excised leaves. These results suggest that transgenic plants transformed with the TSase gene can accumulate high levels of trehalose and have enhanced tolerance to drought.

  2. Cloning and characterization of a glucose 6-phosphate/phosphate translocator from Oryza sativa

    Institute of Scientific and Technical Information of China (English)

    姜华武; 佃蔚敏; 刘非燕; 吴平

    2003-01-01

    Plastids of nongreen tissues import carbon as a source of biosynthetic pathways and energy, and glucose 6-phosphate is the preferred hexose phosphate taken up by nongreen plastids. A cDNA clone encoding glucose 6-phosphate/phosphate translocator (GPT) was isolated from a cDNA library of immature seeds of rice and named as OsGPT. The cDNA has one uninterrupted open reading frame encoding a 42 kDa polypeptide possessing transit peptide consisting of 70 amino acid residues. The OsGPT gene maps on chromosome 8 of rice and is linked to the quantitative trait locus for 1000-grain weight. The expression of OsGPT is mainly restricted to heterotrophic tissues. These results suggest that glucose 6-phosphate imported via GPT can be used for starch biosynthesis in rice nongreen plastids.

  3. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    Pneumocystis pneumonia (PCP) remains a major cause of illness and death in HIV-infected persons. Sulfa drugs, trimethoprim-sulfamethoxazole (TMP-SMX) and dapsone are mainstays of PCP treatment and prophylaxis. While prophylaxis has reduced the incidence of PCP, its use has raised concerns about...... in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...... for PCP treatment remains unclear. We review studies of DHPS mutations in P. jirovecii and summarize the evidence for resistance to sulfamethoxazole and dapsone....

  4. Priapism and glucose-6-phosphate dehydrogenase deficiency: An underestimated correlation?

    Directory of Open Access Journals (Sweden)

    Aldo Franco De Rose

    2016-10-01

    Full Text Available Priapism is a rare clinical condition characterized by a persistent erection unrelated to sexual excitement. Often the etiology is idiopathic. Three cases of priapism in glucose-6-phosphate dehydrogenase (G6PD deficiency patients have been described in literature. We present the case of a 39-year-old man with glucose- 6-phosphate dehydrogenase deficiency, who reached out to our department for the arising of a non-ischemic priapism without arteriolacunar fistula. We suggest that the glucose-6-phosphate dehydrogenase deficiency could be an underestimated risk factor for priapism.

  5. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  6. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  7. Phylogenetic analysis of uroporphyrinogen III synthase (UROS) gene.

    Science.gov (United States)

    Shaik, Abjal Pasha; Alsaeed, Abbas H; Sultana, Asma

    2012-01-01

    The uroporphyrinogen III synthase (UROS) enzyme (also known as hydroxymethylbilane hydrolyase) catalyzes the cyclization of hydroxymethylbilane to uroporphyrinogen III during heme biosynthesis. A deficiency of this enzyme is associated with the very rare Gunther's disease or congenital erythropoietic porphyria, an autosomal recessive inborn error of metabolism. The current study investigated the possible role of UROS (Homo sapiens [EC: 4.2.1.75; 265 aa; 1371 bp mRNA; Entrez Pubmed ref NP_000366.1, NM_000375.2]) in evolution by studying the phylogenetic relationship and divergence of this gene using computational methods. The UROS protein sequences from various taxa were retrieved from GenBank database and were compared using Clustal-W (multiple sequence alignment) with defaults and a first-pass phylogenetic tree was built using neighbor-joining method as in DELTA BLAST 2.2.27+ version. A total of 163 BLAST hits were found for the uroporphyrinogen III synthase query sequence and these hits showed putative conserved domain, HemD superfamily (as on 14(th) Nov 2012). We then narrowed down the search by manually deleting the proteins which were not UROS sequences and sequences belonging to phyla other than Chordata were deleted. A repeat phylogenetic analysis of 39 taxa was performed using PhyML and TreeDyn software to confirm that UROS is a highly conserved protein with approximately 85% conserved sequences in almost all chordate taxons emphasizing its importance in heme synthesis.

  8. Transcriptional regulation of human thromboxane synthase gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Lee, K.D.; Baek, S.J.; Fleischer, T [Univ. of Maryland Medical School, Baltimore, MD (United States)] [and others

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  9. Genetics Home Reference: glucose-6-phosphate dehydrogenase deficiency

    Science.gov (United States)

    ... enzyme is involved in the normal processing of carbohydrates. It also protects red blood cells from the ... of glucose-6-phosphate dehydrogenase or alter its structure, this enzyme can no longer play its protective ...

  10. Prevalence of glucose-6-phosphate dehydrogenase deficiency in ...

    African Journals Online (AJOL)

    Pradeep Kumar

    2016-02-06

    Feb 6, 2016 ... for studies that investigated G6PD deficiency in Indian population. If any author studied .... analyses, (2) case reports, and (3) reviews and editorials. 2.3. ..... Beutler E, editors. Glucose-6-phosphate dehydrogenase. Orlando,.

  11. Characterisation of glutamine fructose-6-phosphate amidotransferase (EC 2.6.1.16) and N-acetylglucosamine metabolism in Bifidobacterium.

    Science.gov (United States)

    Foley, Sophie; Stolarczyk, Emilie; Mouni, Fadoua; Brassart, Colette; Vidal, Olivier; Aïssi, Eliane; Bouquelet, Stéphane; Krzewinski, Frédéric

    2008-02-01

    Bifidobacterium bifidum, in contrast to other bifidobacterial species, is auxotrophic for N-acetylglucosamine. Growth experiments revealed assimilation of radiolabelled N-acetylglucosamine in bacterial cell walls and in acetate, an end-product of central metabolism via the bifidobacterial D: -fructose-6-phosphate shunt. While supplementation with fructose led to reduced N-acetylglucosamine assimilation via the D: -fructose-6-phosphate shunt, no significant difference was observed in levels of radiolabelled N-acetylglucosamine incorporated into cell walls. Considering the central role played by glutamine fructose-6-phosphate transaminase (GlmS) in linking the biosynthetic pathway for N-acetylglucosamine to hexose metabolism, the GlmS of Bifidobacterium was characterized. The genes encoding the putative GlmS of B. longum DSM20219 and B. bifidum DSM20082 were cloned and sequenced. Bioinformatic analyses of the predicted proteins revealed 43% amino acid identity with the Escherichia coli GlmS, with conservation of key amino acids in the catalytic domain. The B. longum GlmS was over-produced as a histidine-tagged fusion protein. The purified C-terminal His-tagged GlmS possessed glutamine fructose-6-phosphate amidotransferase activity as demonstrated by synthesis of glucosamine-6-phosphate from fructose-6-phosphate and glutamine. It also possesses an independent glutaminase activity, converting glutamine to glutamate in the absence of fructose-6-phosphate. This is of interest considering the apparently reduced coding potential in bifidobacteria for enzymes associated with glutamine metabolism.

  12. Adenovirus-mediated nitric oxide synthase gene transfer.

    Science.gov (United States)

    Raman, Kathleen G; Shapiro, Richard A; Tzeng, Edith; Kibbe, Melina R

    2004-01-01

    The varied biological effects of nitric oxide (NO) have led to intense research into its diverse physiologic and pathophysiologic roles in multiple disease processes. It has been implicated in the development of altered vasomotor tone, intimal hyperplasia, atherosclerosis, impotence, host defense, and wound healing. Using the modern technologies of recombinant DNA and gene transfer using adenoviral vectors, the effects of NO derived from various NO synthase (NOS) enzymes can be studied in a variety of tissues and the therapeutic applications of NOS is possible. Such uses of NOS gene transfer have been investigated extensively in the vasculature where NO is critical to regulating vascular homeostasis. NOS gene therapy has the theoretical advantage of allowing NO delivery to be localized, thereby limiting potential adverse effects of NO. The benefits of adenoviral vectors in gene transfer include relatively high transduction efficiencies, both replicating and nonreplicating cells may be infected, and the high titers of adenovirus that can be produced. The methods described in this chapter include the cloning of the iNOS cDNA into a recombinant adenoviral vector, large-scale production of that vector AdiNOS preparation, and the use of the vector to transduce tissue in vitro and in vivo.

  13. Virus-induced silencing of a tobacco deoxyhypusine synthase gene

    Institute of Scientific and Technical Information of China (English)

    WANG Hongzhi; MA Rongcai; LI Ruifen; WANG Guoying; WEI Jianhua

    2005-01-01

    A cDNA fragment corresponding to deoxyhypusine synthase gene NbDHS was isolated and cloned into potato virus X (PVX) vector for functional analysis in Nicotiana benthamiana by using virus-induced gene silencing (VIGS). Plants agroinfected with recombinant virus vector PVX-NbDHS exhibited an increase in leaf biomass, delay in natural leaf senescence and flowering time, and decrease in leaf chlorophyll content. Semi-quantitative RT-PCR and Northern analysis showed that the transcript level of DHS was significantly lower in PVX-NbDHS infected plants. At the same time, the expression for eIF-5A, the target proteins of DHS in N. benthamiana, was concomitantly suppressed by semi-quantitative RT-PCR and Western analysis. From the phenotypic feature of the infected plants and the reduced expression abundance of DHS and eIF-5A, we concluded that NbDHS plays important roles in plant growth, development and senescence. The possible application of DHS gene in genetic modification of crops and horticultural plants was discussed.

  14. Two branches of the lupeol synthase gene in the molecular evolution of plant oxidosqualene cyclases.

    Science.gov (United States)

    Shibuya, M; Zhang, H; Endo, A; Shishikura, K; Kushiro, T; Ebizuka, Y

    1999-11-01

    Two new triterpene synthase cDNAs, named as OEW and TRW, were cloned from olive leaves (Olea europaea) and from dandelion roots (Taraxacum officinale), respectively, by the PCR method with primers designed from the conserved sequences found in the known oxidosqualene cyclases. Their ORFs consisted of 2274 bp nucleotides and coded for 758 amino acid long polypeptides. They shared high sequence identity (78%) to each other, while they showed only about 60% identities to the known triterpene synthases LUPI (lupeol synthase clone from Arabidopsis thaliana) and PNY (beta-amyrin synthase clone from Panax ginseng) at amino acid level. To determine the enzyme functions of the translates, they were expressed in an ERG7 deficient yeast mutant. Accumulation of lupeol in the cells of yeast transformants proved both of these clones code for lupeol synthase proteins. An EST (expression sequence tag) clone isolated from Medicago truncatula roots as a homologue of cycloartenol synthase gene, exhibits high sequence identity (75-77%) to these two lupeol synthase cDNAs, suggesting it to be another lupeol synthase clone. Comparatively low identity (approximately 57%) of LUP1 from Arabidopsis thaliana to either one of these clones leaves LUP1 as a distinct clone among lupeol synthases. From these sequence comparisons, now we propose that two branches of lupeol synthase gene have been generated in higher plants during the course of evolution.

  15. The y1 gene of maize codes for phytoene synthase.

    Science.gov (United States)

    Buckner, B; Miguel, P S; Janick-Buckner, D; Bennetzen, J L

    1996-05-01

    The cloned y1 locus of maize was sequenced and found to encode phytoene synthase. Different "wild-type" alleles of the locus were found to differ by the insertion of transposable elements in their promoter and polyA addition regions, and by the length of a CCA tandem repeat series, without any obvious effect on function of the gene. A dominant Y1 ("wild-type") allele was observed to be expressed at highest levels in the seedling but also in the embryo and endosperm. The Mu3 transposable element insertion responsible for a pastel allele of y1, which gives lowered levels of carotenoids in the endosperm of kernels and seedlings grown at high temperatures, was located in the 5' end of the gene. Although the size of the transcript from this y1 mutation suggests that the Mu3 element provides the promoter for this allele, leaf tissue in this mutant line contained approximately normal amounts of y1 mRNA. A recessive allele of y1, which conditions normal levels of carotenoids in the embryo and seedling, but almost no carotenoids in the endosperm, was found to accumulate normal amounts of y1 mRNA in the seedling and embryo, while y1 transcripts were not detected in the endosperm.

  16. Transcriptional Modulation of Squalene Synthase Genes in Barley Treated with PGPR

    OpenAIRE

    Anam eYousaf; Abdul eQadir; Tehmina eAnjum; Aqeel eAhmad

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene Squalene Synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27±3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analysed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of squalene synthase. Results revealed that among four ...

  17. Red Algal Bromophenols as Glucose 6-Phosphate Dehydrogenase Inhibitors

    Directory of Open Access Journals (Sweden)

    Koretaro Takahashi

    2013-10-01

    Full Text Available Five bromophenols isolated from three Rhodomelaceae algae (Laurencia nipponica, Polysiphonia morrowii, Odonthalia corymbifera showed inhibitory effects against glucose 6-phosphate dehydrogenase (G6PD. Among them, the symmetric bromophenol dimer (5 showed the highest inhibitory activity against G6PD.

  18. Glucose-6-phosphate dehydrogenase mutations and haplotypes in Mexican Mestizos.

    Science.gov (United States)

    Arámbula, E; Aguilar L, J C; Vaca, G

    2000-08-01

    In a screening for glucose-6-phosphate dehydrogenase (G-6-PD) deficiency in 1985 unrelated male subjects from the general population (Groups A and B) belonging to four states of the Pacific coast, 21 G-6-PD-deficient subjects were detected. Screening for mutations at the G-6-PD gene by PCR-restriction enzyme in these 21 G-6-PD-deficient subjects as well as in 14 G-6-PD-deficient patients with hemolytic anemia belonging to several states of Mexico showed two common G-6-PD variants: G-6-PD A-(202A/376G) (19 cases) and G-6-PD A-(376G/968C) (9 cases). In 7 individuals the mutations responsible for the enzyme deficiency remain to be determined. Furthermore, four silent polymorphic sites at the G-6-PD gene (PvuII, PstI, 1311, and NlaIII) were investigated in the 28 individuals with G-6-PD A- variants and in 137 G-6-PD normal subjects. As expected, only 10 different haplotypes were observed. To date, in our project aiming to determine the molecular basis of G-6-PD deficiency in Mexico, 60 unrelated G-6-PD-deficient Mexican males-25 in previous studies and 35 in the present work-have been studied. More than 75% of these individuals are from states of the Pacific coast (Sinaloa, Nayarit, Jalisco, Michoacán, Guerrero, Oaxaca, and Chiapas). The results show that although G-6-PD deficiency is heterogeneous at the DNA level in Mexico, only three polymorphic variants have been observed: G-6-PD A-(202A/376G) (36 cases), G-6-PD A-(376G/968C) (13 cases), and G-6-PD Seattle(844C) (2 cases). G-6-PD A- variants are relatively distributed homogeneously and both variants explain 82% of the overall prevalence of G-6-PD deficiency. The variant G-6-PD A-(202A/376G) represents 73% of the G-6-PD A- alleles. Our data also show that the variant G-6-PD A-(376G/968C)-which has been observed in Mexico in the context of two different haplotypes-is more common than previously supposed. The three polymorphic variants that we observed in Mexico are on the same haplotypes as found in subjects from

  19. Molecular evolution and functional divergence of soluble starch synthase genes in cassava (manihot esculenta crantz).

    Science.gov (United States)

    Yang, Zefeng; Wang, Yifan; Xu, Shuhui; Xu, Chenwu; Yan, Changjie

    2013-01-01

    Soluble starch synthases (SSs) are major enzymes involved in starch biosynthesis in plants. Cassava starch has many remarkable characteristics, which should be influenced by the evolution of SS genes in this starchy root crop. In this work, we performed a comprehensive phylogenetic and evolutionary analysis of the soluble starch synthases in cassava. Genome-wide identification showed that there are 9 genes encoding soluble starch synthases in cassava. All of the soluble starch synthases encoded by these genes contain both Glyco_transf_5 and Glycos_transf_1 domains, and a correlation analysis showed evidence of coevolution between these 2 domains in cassava SS genes. The SS genes in land plants can be divided into 6 subfamilies that were formed before the origin of seed plants, and species-specific expansion has contributed to the evolution of this family in cassava. A functional divergence analysis for this family provided statistical evidence for shifted evolutionary rates between the subfamilies of land plant soluble starch synthases. Although the main selective pressure acting on land plant SS genes was purifying selection, our results also revealed that point mutation with positive selection contributed to the evolution of 2 SS genes in cassava. The remarkable cassava starch characteristics might be the result of both the duplication and adaptive selection of SS genes.

  20. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan

    2001-01-01

    The pyrG gene of Lactococcus lactis subsp. cremoris, encoding CTP synthase, has been cloned and sequenced. It is flanked upstream by an open reading frame showing homology to several aminotransferases and downstream by an open reading frame of unknown function. L. lactis strains harboring disrupted...... of a functional cdd gene encoding cytidine deaminase. A characterization of the enzyme revealed similar properties as found for CTP synthases from other organisms. However, unlike the majority of CTP synthases the lactococcal enzyme can convert dUTP to dCTP, although a half saturation concentration of 0.6 m...

  1. Crystal structure and substrate specificity of D-galactose-6-phosphate isomerase complexed with substrates.

    Directory of Open Access Journals (Sweden)

    Woo-Suk Jung

    Full Text Available D-Galactose-6-phosphate isomerase from Lactobacillus rhamnosus (LacAB; EC 5.3.1.26, which is encoded by the tagatose-6-phosphate pathway gene cluster (lacABCD, catalyzes the isomerization of D-galactose-6-phosphate to D-tagatose-6-phosphate during lactose catabolism and is used to produce rare sugars as low-calorie natural sweeteners. The crystal structures of LacAB and its complex with D-tagatose-6-phosphate revealed that LacAB is a homotetramer of LacA and LacB subunits, with a structure similar to that of ribose-5-phosphate isomerase (Rpi. Structurally, LacAB belongs to the RpiB/LacAB superfamily, having a Rossmann-like αβα sandwich fold as has been identified in pentose phosphate isomerase and hexose phosphate isomerase. In contrast to other family members, the LacB subunit also has a unique α7 helix in its C-terminus. One active site is distinctly located at the interface between LacA and LacB, whereas two active sites are present in RpiB. In the structure of the product complex, the phosphate group of D-tagatose-6-phosphate is bound to three arginine residues, including Arg-39, producing a different substrate orientation than that in RpiB, where the substrate binds at Asp-43. Due to the proximity of the Arg-134 residue and backbone Cα of the α6 helix in LacA to the last Asp-172 residue of LacB with a hydrogen bond, a six-carbon sugar-phosphate can bind in the larger pocket of LacAB, compared with RpiB. His-96 in the active site is important for ring opening and substrate orientation, and Cys-65 is essential for the isomerization activity of the enzyme. Two rare sugar substrates, D-psicose and D-ribulose, show optimal binding in the LacAB-substrate complex. These findings were supported by the results of LacA activity assays.

  2. Cloning and Characterization of Cheilanthifoline and Stylopine Synthase Genes from Chelidonium majus.

    Science.gov (United States)

    Yahyazadeh, Mahdi; Ratmoyo, Purwanto; Bittner, Florian; Sato, Fumihiko; Selmar, Dirk

    2017-06-19

    The most prominent alkaloid of Chelidonium majus is dihydrocoptisine, revealing the characteristical benzophenanthridine skeleton. Up to now, any information about the enzymes responsible for its biosynthesis in C. majus and the related genes respectively, is lacking. Based on sequence similarities to the corresponding methylenedioxy bridge-forming cytochrome P450-enzymes involved in the isoquinoline alkaloid biosynthesis in Eschscholzia californica, genes for a cheilanthifoline synthase and a stylopine synthase from C. majus were isolated, sequenced and heterologously expressed in yeast.The activity of the heterologously expressed cytochrome P450-enzymes was determined in situ as well as on the basis of microsomal fractions. It was shown that the cheilanthifoline synthase (c8931) converts scoulerine into cheilanthifoline, the latter subsequently being converted to stylopine by the action of a stylopine synthase (c1128). Based on the well-known instability of stylopine, it can be assumed that in vivo - under the acidic conditions in the vacuole - this alkaloid is converted to dihydrocoptisine, which accumulates in C. majus leaves. Both methylenedioxy bridge-forming cytochrome P450-enzymes from C. majus are characterized by their high substrate specificity. Apart from their genuine substrates, i.e. scoulerine and cheilanthifoline, cheilanthifoline synthase and stylopine synthase do not accept other substrates tested; the only alternative substrate identified was scoulerine, which is converted by stylopine synthase to yield minor amounts of nandinine.Quantitative RT-PCR revealed that the expression of cheilanthifoline synthase and stylopine synthase genes is very similar in both, in roots and leaves from C. majus, although the alkaloid accumulation pattern in these organs are quite different. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  3. Mass-array芯片技术在葡萄糖-6-磷酸脱氢酶基因突变位点检测中的应用%Application of Mass-array gene chip to detect glucose-6-phosphate dehydrogenase gene mutations

    Institute of Scientific and Technical Information of China (English)

    陈瑶; 苏跃青; 周进福; 王旌; 赵红; 曾颖琳; 林庆颖; 林枫; 张洪华

    2015-01-01

    目的 探讨应用Mass-array基因芯片技术检测葡萄糖-6-磷酸脱氢酶(G6PD)基因突变位点的价值,并对其进行质量评价.方法 收集2006至2013年在福建省妇幼保健院新生儿疾病筛查中心进行G6PD筛查的婴儿,根据化学筛查结果分成2组:G6PD缺乏症患儿和正常儿童,随机抽取患儿和正常对照儿童各300例.采用基因分析工具(Genotyping Tools)与Mass-array Design软件,利用中国人群已报道的G6PD基因33个突变位点芯片,应用Mass-array基因技术检测G6PD基因突变位点,并通过DNASanger测序法验证基因芯片检测结果的准确性.结果 在300例G6PD患儿中,共检出单纯型单点突变9种:1376G>T、1388G>A、95A>G、1024C>T、392G>T、1360C>T、487G>A、517T>C、1365-13T>C;复合突变型7种:871G> A/1365-13T> C/1311C>T、1004C> A/1311C> T/1365-13T>C、1376G >T/1365-13T>C/1311C>T、1365-13T >C/1311C >T、1376G> T/1365-13T>C、95A> G/1365-13T> C/1311C>T、1388G> A/1365-13T>C;300名正常对照儿童中未检测到G6PD基因突变.进一步所有样本的Sanger DNA测序结果与基因芯片检测结果完全一致.结论 采用Massarray基因芯片技术检测G6PD基因突变方法是一种准确、高效的G6PD基因突变筛查方法.%Objective To develop the Mass-array gene chip to detect glucose-6-phosphate dehydrogenase (G6PD) gene mutations,and to evaluate its quality.Methods Randomly choosing the children who perform neonatal screening in Neonatal Screening Center of Fujian Maternity and Children Health Hospital from 2006 to 2013.Children were divided into control group and G6PD patient group.Using Genotyping Tools from Sequenom company and the software of Mass-array Assay Design to design the PCR amplification primer of 33 G6PD gene mutations which were well-known in Chinese.Then depending on Mass-array gene chip technology to detect glucose-6-phosphate dehydrogenase gene mutations.DNA Sanger sequencing was

  4. Gold Nanoparticles Decorated with Mannose-6-phosphate Analogues

    Directory of Open Access Journals (Sweden)

    Stéphanie Combemale

    2014-01-01

    Full Text Available Herein, the preparation of neoglycoconjugates bearing mannose-6-phosphate analogues is described by: (a synthesis of a cyclic sulfate precursor to access the carbohydrate head-group by nucleophilic displacement with an appropriate nucleophile; (b introduction of spacers on the mannose-6-phosphate analogues via Huisgen’s cycloaddition, the Julia reaction, or the thiol-ene reaction under ultrasound activation. With the resulting compounds in hand, gold nanoparticles could be functionalized with various carbohydrate derivatives (glycoconjugates and then tested for angiogenic activity. It was observed that the length and flexibility of the spacer separating the sugar analogue from the nanoparticle have little influence on the biological response. One particular nanoparticle system substantially inhibits blood vessel growth in contrast to activation by the corresponding monomeric glycoconjugate, thereby demonstrating the importance of multivalency in angiogenic activity.

  5. Cloning and expression pattern of chitin synthase (CHS) gene in ...

    African Journals Online (AJOL)

    USER

    2010-08-16

    Aug 16, 2010 ... African Journal of Biotechnology Vol. 9(33), pp. 5297-5308, 16 ... Chitin synthase (CHS) plays an important role in biosynthesis of chitin .... strand cDNA Synthesis kit, 5'/3' RACE kit and pMD18-T vector were purchased from ...

  6. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  7. Characterization of Two Polyketide Synthase Genes Involved in Zearalenone Biosynthesis in Gibberella zeae

    Science.gov (United States)

    Gaffoor, Iffa; Trail, Frances

    2006-01-01

    Zearalenone, a mycotoxin produced by several Fusarium spp., is most commonly found as a contaminant in stored grain and has chronic estrogenic effects on mammals. Zearalenone is a polyketide derived from the sequential condensation of multiple acetate units by a polyketide synthase (PKS), but the genetics of its biosynthesis are not understood. We cloned two genes, designated ZEA1 and ZEA2, which encode polyketide synthases that participate in the biosynthesis of zearalenone by Gibberella zeae (anamorph Fusarium graminearum). Disruption of either gene resulted in the loss of zearalenone production under inducing conditions. ZEA1 and ZEA2 are transcribed divergently from a common promoter region. Quantitative PCR analysis of both PKS genes and six flanking genes supports the view that the two polyketide synthases make up the core biosynthetic unit for zearalenone biosynthesis. An appreciation of the genetics of zearalenone biosynthesis is needed to understand how zearalenone is synthesized under field conditions that result in the contamination of grain. PMID:16517624

  8. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  9. Characterization of three putative xylulose 5-phosphate/fructose 6-phosphate phosphoketolases in the cyanobacterium Anabaena sp. PCC 7120.

    Science.gov (United States)

    Moriyama, Takashi; Tajima, Naoyuki; Sekine, Kohsuke; Sato, Naoki

    2015-01-01

    Xylulose 5-phosphate/fructose 6-phosphate phosphoketolase (Xfp) is a key enzyme in the central carbohydrate metabolism in heterofermentative bacteria, in which enzymatic property of Xfps is well characterized. This is not the case in other microbes. The cyanobacterium Anabaena sp. PCC 7120 possesses three putative genes encoding Xfp, all1483, all2567, and alr1850. We purified three putative Xfps as recombinant proteins. The results of gel filtration indicated that these proteins form homomultimer complex. All1483 and All2567 showed phosphoketolase activity, whereas Alr1850 did not show the activity. Kinetic analyses demonstrated that substrates, fructose 6-phosphate and inorganic phosphate, are cooperatively bound to enzymes positively and negatively, respectively.

  10. Differential expression of two genes for 1-aminocyclopropane-1-carboxylate synthase in tomato fruits

    Energy Technology Data Exchange (ETDEWEB)

    Olson, D.C.; White, J.A.; Edelman, L.; Kende, H. (Michigan State Univ., East Lansing (United States)); Harkins, R.N. (Berlex Biosciences, Alameda, CA (United States))

    1991-06-15

    1-Aminocyclopropane-1-carboxylate synthase is the regulated enzyme in the biosynthetic pathway of the plant hormone ethylene. A full-length cDNA encoding this enzyme has been cloned from tomato fruits. The authors report here the complete nucleotide and derived amino acid sequences of a cDNA encoding a second isoform of ACC synthase from tomato fruits. The cDNAs coding for both isoforms contain highly conserved regions that are surrounded by regions of low homology, especially at the 5{prime} and 3{prime} ends. Gene-specific probes were constructed to examine the expression of transcripts encoding the two ACC synthase isoforms under two conditions of enhanced ethylene formation--namely, during fruit ripening and in response to mechanical stress (wounding). The level of mRNA encoding both isoforms, ACC synthase 1 and 2, increased during ripening. In contrast, wounding caused an increase in only the level of mRNA coding for ACC synthase 1. Blot analysis of genomic DNA digested with restriction enzymes confirmed that ACC synthase 1 and 2 are encoded by different genes.

  11. RNAi-mediated silencing of the myo-inositol-1-phosphate synthase gene (GmMIPS1) in transgenic soybean inhibited seed development and reduced phytate content.

    Science.gov (United States)

    Nunes, Aline C S; Vianna, Giovanni R; Cuneo, Florencia; Amaya-Farfán, Jaime; de Capdeville, Guy; Rech, Elíbio L; Aragão, Francisco J L

    2006-06-01

    Inositol plays a role in membrane trafficking and signaling in addition to regulating cellular metabolism and controlling growth. In plants, the myo-inositol-1-phosphate is synthesized from glucose 6-phosphate in a reaction catalyzed by the enzyme myo-inositol-1-phosphate synthase (EC 5.5.1.4). Inositol can be converted into phytic acid (phytate), the most abundant form of phosphate in seeds. The path to phytate has been suggested to proceed via the sequential phosphorylation of inositol phosphates, and/or in part via phosphatidylinositol phosphate. Soybean [Glycine max (L.) Merrill] lines were produced using interfering RNA (RNAi) construct in order to silence the myo-inositol-1-phosphate (GmMIPS1) gene. We have observed an absence of seed development in lines in which the presence of GmMIPS1 transcripts was not detected. In addition, a drastic reduction of phytate (InsP6) content was achieved in transgenic lines (up to 94.5%). Our results demonstrated an important correlation between GmMIPS1 gene expression and seed development.

  12. Functional characterization of annotated trehalose-6-phosphate synthase gene in Xanthmonas campestris%野油菜黄单胞菌中6-磷酸海藻糖合成酶注释基因的功能鉴定

    Institute of Scientific and Technical Information of China (English)

    姚裕群; 谌立峰; 梁晓夏; 姜伟; 姜伯乐; 唐纪良

    2007-01-01

    6-磷酸海藻糖在微生物碳代谢调节及抗逆生理中起着极其重要的作用.在野油菜黄单胞菌野油菜致病变种(Xanthomonas campestris pv.campestris,Xcc)8004菌株的基因组中,XC1076注释为6-磷酸海藻糖合成酶.利用突变和表型检测技术,对 XC1076进行功能鉴定,结果显示,XC1076的Tn5gusA5插入突变体006B12,在含3% NaCl的NYGB培养基中生长明显缓慢,在含葡萄糖为惟一碳源的NCM培养基中几乎不能生长,反式互补能够基本恢复野生型表型,这说明XC1076与碳代谢调控和抗高渗有关.这些表型实验结果揭示,XC1076的ORF编码的蛋白具有6-磷酸海藻糖合成酶活性.致病生化因子检测显示,XC1076与Xcc胞外酶和胞外多糖的分泌无关.

  13. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  14. Malaria, favism and glucose-6-phosphate dehydrogenase deficiency.

    Science.gov (United States)

    Huheey, J E; Martin, D L

    1975-10-15

    Although glucose-6-phosphate dehydrogenase deficient individuals may suffer (sometimes fatally) from favism, a high incidence of this trait occurs in many Mediterranean populations. This apparent paradox is explained on the basis of a synergistic interaction between favism and G-6-PD deficiency that provides increased protection against malaria compared to that of the G-6-PD deficiency alone. This relationship is analogous to that between various hemoglobins and malaria in that there is selection for a more severe trait if it provides more protection against malaria.

  15. The role of 1-deoxy-d-xylulose-5-phosphate synthase and phytoene synthase gene family in citrus carotenoid accumulation.

    Science.gov (United States)

    Peng, Gang; Wang, Chunyan; Song, Song; Fu, Xiumin; Azam, Muhammad; Grierson, Don; Xu, Changjie

    2013-10-01

    Three 1-deoxy-D-xylulose-5-phosphate synthases (DXS) and three phytoene synthases (PSY) were identified in citrus, from Affymetrix GeneChip Citrus Genome Array, GenBank and public orange genome databases. Tissue-specific expression analysis of these genes was carried out on fruit peel and flesh, flower and leaf of Satsuma mandarin (Citrus unshiu Marc.) in order to determine their roles in carotenoid accumulation in different tissues. Expression of CitDXS1 and CitPSY1 was highest in all test tissues, while that of CitDXS2 and CitPSY2 was lower, and that of CitDXS3 and CitPSY3 undetectable. The transcript profiles of CitDXS1 and CitPSY1 paralleled carotenoid accumulation in flesh of Satsuma mandarin and orange (Citrus sinensis Osbeck) during fruit development, and CitPSY1 expression was also associated with carotenoid accumulation in peel, while the CitDXS1 transcript level was only weakly correlated with carotenoid accumulation in peel. Similar results were obtained following correlation analysis between expression of CitDXS1 and CitPSY1 and carotenoid accumulation in peel and flesh of 16 citrus cultivars. These findings identify CitPSY1 and CitDXS1 as the main gene members controlling carotenoid biosynthesis in citrus fruit. Furthermore, chromoplasts were extracted from flesh tissue of these citrus, and chromoplasts of different shape (spindle or globular), different size, and color depth were observed in different cultivars, indicating chromoplast abundance, number per gram tissue, size and color depth were closely correlated with carotenoid content in most cultivars. The relationship between carotenoid biosynthesis and chromoplast development was discussed. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  16. Glucose-6-Phosphate Dehydrogenase Deficiency and Haemoglobinophaties in Resident of Arso PIR, Irian Jaya

    Science.gov (United States)

    1990-01-01

    and drug treatment . Another factor is play a part in innate resistance. 0-6-PD the ’internal environment’ of the host and deficiency can also complicate...response to and treatment of glucose-6-phosphate. The amount of of malaria, epidemiologic and immuno- NADPH produced is detected spectropho- logic...Ohio inherited along with a B- thalassemia gene 9-66. producing Hb-E thalassemia . Although 2. Kellermeyer, R.W., A.R. Tarlov, G.J. this condition can

  17. Cloning and Bioinformatic Analysis of Glucose-6-phosphate 1-dehydrogenase Gene(gsdA) from Aspergillus oryzae%米曲霉6-磷酸葡萄糖脱氢酶基因 gsdA 的克隆及生物信息学分析

    Institute of Scientific and Technical Information of China (English)

    刘薇; 吴晶晶; 陈宏文

    2012-01-01

      6-磷酸葡萄糖脱氢酶催化6-磷酸葡萄糖生成6-磷酸葡萄糖酸,并生成NADPH,是微生物胞内磷酸戊糖途径(PPP)的关键酶。本研究以食品安全菌米曲霉CICC2012为材料,克隆获得6-磷酸葡萄糖脱氢酶基因(GenBank登录号:JN123468)。序列分析表明,该酶是由222个氨基酸组成的亲水性蛋白;128~134位氨基酸序列DHYLGKE为活性区域;170~176位氨基酸序列GTEGRGG可能为辅因子结合位点。进化树分析表明,米曲霉6-磷酸葡萄糖脱氢酶同其他丝状真菌及酵母的G6PDH较相似%  Glucose-6-phosphate 1-dehydrogenase(G6PDH) is one of the key enzymes in pentose phosphate pathway(PPP). Here, the gene encoding G6PDH is cloned from Aspergillus oryzae CICC2012. This gene was sequenced and submitted to GenBank(accession number: JN123468). The sequence was analyzed bioinformatically. The results show that G6PDH from A. oryzae is a hydrophilic enzyme consisting of 222 amino acids. The sequence from 128 to 134(DHYLGKE) is the active site, and the sequences from 170 to 176(GTEGRGG) is the possible site of coenzyme binding. The phylogenetic tree shows that G6PDH of A. oryzae is similar to other filamentous fungi and the yeast one, while distinguished from the bacterial type, the plant one, and the human one.

  18. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    OpenAIRE

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e...

  19. Characterization of fructose 6 phosphate phosphoketolases purified from Bifidobacterium species.

    Science.gov (United States)

    Grill, J P; Crociani, J; Ballongue, J

    1995-07-01

    Fructose 6 phosphate phosphoketolases (F6PPKs) were purified from Bifidobacterium longum BB536, B. dentium ATCC 27534, B. globosum ATCC 25864, and Bifidobacterium animalis ATCC 25527. Concerning ions (Cu++, Zn++, Ca++, Mg++, Fe++, Co++, Mn++) and common enzyme inhibitors (fructose, ammonium sulfate, iodoacetate, and parachloromercuribenzoic acid), no difference appeared between the enzymes. Cu++, parachloromercuribenzoic acid (pCMB), and mercuric acetate induced high enzymatic inhibition. The study of pCMB demonstrated a noncompetitive inhibition. Additional results showed that the sulfhydryl group was not involved in catalytic reaction. Photooxidation experiments and determination of ionizable group pKas (5.16-7.17) suggested the presence of one or more histidines necessary for the catalytic reaction and explained the inhibition observed with pCMB. In light of the noncompetitive inhibition, this group was not directly involved in substrate binding. Determination of Km demonstrated that the affinities for fructose 6 phosphate in the case of animal and human origin strains were close. In addition, the same enzymatic efficiency (Kcat/Km) was obtained for each strain. The F6PPK activity was regulated by sodium pyrophosphate, ATP, and especially by ADP.

  20. The maize auxotrophic mutant orange pericarp is defective in duplicate genes for tryptophan synthase beta.

    Science.gov (United States)

    Wright, A D; Moehlenkamp, C A; Perrot, G H; Neuffer, M G; Cone, K C

    1992-06-01

    orange pericarp (orp) is a seedling lethal mutant of maize caused by mutations in the duplicate unlinked recessive loci orp1 and orp2. Mutant seedlings accumulate two tryptophan precursors, anthranilate and indole, suggesting a block in tryptophan biosynthesis. Results from feeding studies and enzyme assays indicate that the orp mutant is defective in tryptophan synthase beta activity. Thus, orp is one of only a few amino acid auxotrophic mutants to be characterized in plants. Two genes encoding tryptophan synthase beta were isolated from maize and sequenced. Both genes encode polypeptides with high homology to tryptophan synthase beta enzymes from other organisms. The cloned genes were mapped by restriction fragment length polymorphism analysis to approximately the same chromosomal locations as the genetically mapped factors orp1 and orp2. RNA analysis indicates that both genes are expressed in all tissues examined from normal plants. Together, the biochemical, genetic, and molecular data verify the identity of orp1 and orp2 as duplicate structural genes for the beta subunit of tryptophan synthase.

  1. Characterization of a sabinene synthase gene from rough lemon (Citrus jambhiri).

    Science.gov (United States)

    Kohzaki, Keisuke; Gomi, Kenji; Yamasaki-Kokudo, Yumiko; Ozawa, Rika; Takabayashi, Junji; Akimitsu, Kazuya

    2009-10-15

    We previously isolated two putative monoterpene synthase genes, RlemTPS1 and RlemTPS2, from rough lemon (Citrus jambhiri) and showed that gene expression of RlemTPS2 was induced by microbial attack. The protein product of RlemTPS2 was obtained using a prokaryotic expression system, and GC and GC-MS of monoterpene synthesis by RlemTPS2 determined that RlemTPS2 encodes a sabinene synthase. Sabinene has antifungal activity toward Alternaria alternata. Furthermore, site-directed mutagenesis identified one amino acid, Ile, located at the front of the metal ion binding motif as an important residue for the product specificity of sabinene synthase.

  2. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host.

    Science.gov (United States)

    Yamada, Yuuki; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin-ya, Kazuo; Cane, David E; Ikeda, Haruo

    2015-06-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match with any known compounds in spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowed assignment of the structures of 13 new cyclic terpenes. Among these newly identified compounds, two were found to be linear triquinane sesquiterpenes that have never previously been isolated from bacteria or any other source. The remaining 11 new compounds were shown to be diterpene hydrocarbons and alcohol, including hydropyrene (1), hydropyrenol (2), tsukubadiene (11) and odyverdienes A (12) and B (13) each displaying a novel diterpene skeleton that had not previously been reported.

  3. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  4. Molecular and phylogenetic characterization of the homoeologous EPSP Synthase genes of allohexaploid wheat, Triticum aestivum (L.)

    Science.gov (United States)

    Background: 5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the wheat EPSPS gen...

  5. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

    DEFF Research Database (Denmark)

    Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

    2008-01-01

    Endothelial dysfunction plays a key role in the pathogenesis of diabetic vascular disease, including diabetic nephropathy. Endothelial-derived nitric oxide synthase (eNOS) gene polymorphisms affect eNOS activity and are associated with endothelial dysfunction. We evaluated the association of the ...

  6. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg;

    Filamentous fungi possess an advanced secondary metabolism that is regulated and coordinated in a complex manner depending on environmental challenges. The number of known and putative polyketide synthase genes greatly exceeds the number of polyketides (PKs) that these fungi are known to produce....

  7. Source/sink interactions underpin crop yield: the case for trehalose 6-phosphate/SnRK1 in improvement of wheat.

    Science.gov (United States)

    Lawlor, David W; Paul, Matthew J

    2014-01-01

    Considerable interest has been evoked by the analysis of the regulatory pathway in carbohydrate metabolism and cell growth involving the non-reducing disaccharide trehalose (TRE). TRE is at small concentrations in mesophytes such as Arabidopsis thaliana and Triticum aestivum, excluding a role in osmoregulation once suggested for it. Studies of TRE metabolism, and genetic modification of it, have shown a very wide and more important role of the pathway in regulation of many processes in development, growth, and photosynthesis. It has now been established that rather than TRE, it is trehalose 6-phosphate (T6P) which has such profound effects. T6P is the intermediary in TRE synthesis formed from glucose-6-phosphate and UDP-glucose, derived from sucrose, by the action of trehalose phosphate synthase. The concentration of T6P is determined both by the rate of synthesis, which depends on the sucrose concentration, and also by the rate of breakdown by trehalose-6-phosphate phosphatase which produces TRE. Changing T6P concentrations by genetically modifying the enzymes of synthesis and breakdown has altered photosynthesis, sugar metabolism, growth, and development which affect responses to, and recovery from, environmental factors. Many of the effects of T6P on metabolism and growth occur via the interaction of T6P with the SnRK1 protein kinase system. T6P inhibits the activity of SnRK1, which de-represses genes encoding proteins involved in anabolism. Consequently, a large concentration of sucrose increases T6P and thereby inhibits SnRK1, so stimulating growth of cells and their metabolic activity. The T6P/SnRK1 mechanism offers an important new view of how the distribution of assimilates to organs, such as developing grains in cereal plants, is achieved. This review briefly summarizes the factors determining, and limiting, yield of wheat (particularly mass/grain which is highly conserved) and considers how T6P/SnRK1 might function to determine grain yield and might be

  8. Allotopic Expression of a Gene Encoding FLAG Tagged-subunit 8 of Yeast Mitochondrial ATP Synthase

    Directory of Open Access Journals (Sweden)

    I MADE ARTIKA

    2006-03-01

    Full Text Available Subunit 8 of yeast mitochondrial ATP synthase is a polypeptide of 48 amino acids encoded by the mitochondrial ATP8 gene. A nuclear version of subunit 8 gene has been designed to encode FLAG tagged-subunit 8 fused with a mitochondrial signal peptide. The gene has been cloned into a yeast expression vector and then expressed in a yeast strain lacking endogenous subunit 8. Results showed that the gene was successfully expressed and the synthesized FLAG tagged-subunit 8 protein was imported into mitochondria. Following import, the FLAG tagged-subunit 8 protein assembled into functional mitochondrial ATP synthase complex. Furthermore, the subunit 8 protein could be detected using anti-FLAG tag monoclonal antibody.

  9. Glucose-6 phosphate dehydrogenase deficiency and psychotic illness

    Directory of Open Access Journals (Sweden)

    Vijender Singh

    2012-01-01

    Full Text Available Mr. T, a 28-year-old unmarried male, a diagnosed case of Glucose-6 Phosphate Dehydrogenase (G6PD deficiency since childhood, presented with 13 years of psychotic illness and disturbed biological functions. He showed poor response to antipsychotics and mood stabilizers and had three prior admissions to Psychiatry. There was a family history of psychotic illness. The General Physical Examination and Systemic Examination were unremarkable. Mental Status Examination revealed increased psychomotor activity, pressure of speech, euphoric affect, prolixity, delusion of persecution, delusion of grandiosity, delusion of control, thought withdrawal and thought insertion, and second and third person auditory hallucinations, with impaired judgment and insight. A diagnosis of schizophrenia paranoid type, with a differential diagnosis of schizoaffective disorder manic subtype, was made. This case is being reported for its rarity and atypicality of clinical presentation, as well as a course of psychotic illness in the G6PD Deficiency state,with its implications on management.

  10. Conjugated bilirubin in neonates with glucose-6-phosphate dehydrogenase deficiency.

    Science.gov (United States)

    Kaplan, M; Rubaltelli, F F; Hammerman, C; Vilei, M T; Leiter, C; Abramov, A; Muraca, M

    1996-05-01

    We used a system capable of measuring conjugated bilirubin and its monoconjugated and diconjugated fractions in serum to assess bilirubin conjugation in 29 glucose-6-phosphate dehydrogenase (G6PD)-deficient, term, male newborn infants and 35 control subjects; all had serum bilirubin levels > or = 256 mumol/L (15 mg/dI). The median value for diconjugated bilirubin was lower in the G6PD-deficient neonates than in control subjects (0.06 (range 0.00 to 1.84) vs 0.21 (range 0.00 to 1.02) mumol/L, p = 0.006). Diglucuronide was undetectable in 11 (38.9%) of the G6PD-deficient infants versus 3 (8.6%) of the control subjects (p = 0.015). These findings imply a partial defect of bilirubin conjugation not previously demonstrated in G6PD-deficient newborn infants.

  11. Crystal structure and functional characterization of a glucosamine-6-phosphate N-acetyltransferase from Arabidopsis thaliana.

    Science.gov (United States)

    Riegler, Heike; Herter, Thomas; Grishkovskaya, Irina; Lude, Anja; Ryngajllo, Malgorzata; Bolger, Marie E; Essigmann, Bernd; Usadel, Björn

    2012-04-15

    GlcNAc (N-acetylglucosamine) is an essential part of the glycan chain in N-linked glycoproteins. It is a building block for polysaccharides such as chitin, and several glucosaminoglycans and proteins can be O-GlcNAcylated. The deacetylated form, glucosamine, is an integral part of GPI (glycosylphosphatidylinositol) anchors. Both are incorporated into polymers by glycosyltransferases that utilize UDP-GlcNAc. This UDP-sugar is synthesized in a short pathway comprising four steps starting from fructose 6-phosphate. GNA (glucosamine-6-phosphate N-acetyltransferase) catalyses the second of these four reactions in the de novo synthesis in eukaryotes. A phylogenetic analysis revealed that only one GNA isoform can be found in most of the species investigated and that the most likely Arabidopsis candidate is encoded by the gene At5g15770 (AtGNA). qPCR (quantitative PCR) revealed the ubiquitous expression of AtGNA in all organs of Arabidopsis plants. Heterologous expression of AtGNA showed that it is highly active between pH 7 and 8 and at temperatures of 30-40°C. It showed Km values of 231 μM for glucosamine 6-phosphate and 33 μM for acetyl-CoA respectively and a catalytic efficiency comparable with that of other GNAs characterized. The solved crystal structure of AtGNA at a resolution of 1.5 Å (1 Å=0.1 nm) revealed a very high structural similarity to crystallized GNA proteins from Homo sapiens and Saccharomyces cerevisiae despite less well conserved protein sequence identity.

  12. Erythrocyte glucose-6-phosphate dehydrogenase from Brazilian opossum Didelphis marsupialis

    Directory of Open Access Journals (Sweden)

    Barretto O.C. de O.

    2006-01-01

    Full Text Available In a comparative study of erythrocyte metabolism of vertebrates, the specific activity of glucose-6-phosphate dehydrogenase (G6PD of the Brazilian opossum Didelphis marsupialis in a hemolysate was shown to be high, 207 ± 38 IU g-1 Hb-1 min-1 at 37ºC, compared to the human erythrocyte activity of 12 ± 2 IU g-1 Hb-1 min-1 at 37ºC. The apparent high specific activity of the mixture led us to investigate the physicochemical properties of the opossum enzyme. We report that reduced glutathione (GSH in the erythrocytes was only 50% higher than in human erythrocytes, a value lower than expected from the high G6PD activity since GSH is maintained in a reduced state by G6PD activity. The molecular mass, determined by G-200 Sephadex column chromatography at pH 8.0, was 265 kDa, which is essentially the same as that of human G6PD (260 kDa. The Michaelis-Menten constants (Km: 55 µM for glucose-6-phosphate and nicotinamide adenine dinucleotide phosphate (Km: 3.3 µM were similar to those of the human enzyme (Km: 50-70 and Km: 2.9-4.4, respectively. A 450-fold purification of the opossum enzyme was achieved and the specific activity of the purified enzyme, 90 IU/mg protein, was actually lower than the 150 IU/mg protein observed for human G6PD. We conclude that G6PD after purification from the hemolysate of D. marsupialis does not have a high specific activity. Thus, it is quite probable that the red cell hyperactivity reported may be explained by increased synthesis of G6PD molecules per unit of hemoglobin or to reduced inactivation in the RBC hemolysate.

  13. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis

    OpenAIRE

    Noar, Roslyn D.; Daub, Margaret E.

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the numb...

  14. EXPRESSION OF THE GEOSMIN SYNTHASE GENE IN THE CYANOBACTERIUM ANABAENA CIRCINALIS AWQC318(1).

    Science.gov (United States)

    Giglio, Steven; Saint, Christopher P; Monis, Paul T

    2011-12-01

    The occurrence of taste and odor episodes attributed to geosmin continues to trouble water utilities worldwide, and only recently have advances been made in our fundamental understanding of the biochemical and genetic mechanisms responsible for the production of geosmin in microorganisms. For the first time, we have examined the expression of the geosmin synthase gene and corresponding geosmin production by Anabaena circinalis Rabenh. ex Bornet et Flahault AWQC318 under conditions of continuous light illumination and the removal of light as a stimulus and demonstrate that the expression of geosmin synthase appears to be constitutive under these conditions. The decrease in geosmin synthase transcription post maximum cell numbers and stationary phase suggests that a decrease in isoprenoid synthesis may occur before a decrease in the transcription of ribosomal units as the process of cell death is initiated.

  15. Morphology engineering of Penicillium chrysogenum by RNA silencing of chitin synthase gene.

    Science.gov (United States)

    Liu, Hui; Wang, Peng; Gong, Guohong; Wang, Li; Zhao, Genhai; Zheng, Zhiming

    2013-03-01

    Chitin synthases, that catalyze the formation of chitin the major component of cell walls in most filamentous fungi, play crucial roles in the growth and morphogenesis. To investigate the roles of chitin synthase in Penicillium chrysogenum, we developed an RNAi system to silence the class III chitin synthase gene chs4. After transformation, mutants had a slow growth rate and shorter but highly branched hyphae. All transformants either were unable to form conidia or could form only a few. Changes in chs4 expression could lead to a completely different morphology and eventually cause distinct penicillin yields. In particular, the yield of one transformant was 41 % higher than that of the original strain.

  16. Isolation and Expression Analysis of Plastidic Glucose-6-phosphate Dehydrogenase Gene from Rice (Oryza sativa L.)%水稻质体葡萄糖-6-磷酸脱氢酶基因的克隆与表达研究

    Institute of Scientific and Technical Information of China (English)

    侯夫云; 黄骥; 陆驹飞; 王州飞; 张红生

    2006-01-01

    Glucose-6-phosphate dehydrogenase is a rate-limiting enzyme of pentose phosphate pathway, existing in cytosolic and plastidic compartments of higher plants. A novel gene encoding plastidic glucose-6-phosphate dehydrogenase was isolated from rice (Oryza sativa L.) and designated OsG6PDH2 in this article. Through semiquantitative RT-PCR approach it was found that OsG6PDH2 mRNA was weakly expressed in rice leaves, stems, immature spikes or flowered spikes, and a little higher in roots.However, the expression of OsG6PDH2 in rice seedlings was significantly induced by dark treatment. The complete opening reading frame (ORF) of OsG6PDH2 was inserted into pET30a (+), and expressed in Escherichia coli strain BL21 (DE3). The enzyme activity assay of transformed bacterial cells indicated that OsG6PDH2 encoding product had a typical function of glucose-6-phosphate dehydrogenase.%戊糖磷酸途径是高等植物中重要的代谢途径,主要生理功能是产生NADPH以及供核酸代谢的磷酸戊糖.葡萄糖-6-磷酸脱氢酶(G6PDH)是戊糖磷酸途径的关键酶,广泛存在于高等植物细胞的细胞质和质体中.本研究首次从水稻(Oryzasativa L.)幼苗中分离了核编码的质体G6PDH基因OsG6PDH2,序列分析表明OsG6PDH2编码一个具有588个氨基酸残基的多肽,等电点为8.5,分子量66 kDa.OsG6PDH2的N端有1个70个氨基酸的信号肽,推测的裂解位点为Gly55和Val56,表明OsG6PDH2编码产物可能定位于质体.多序列比较的结果表明OsG6PDH2与拟南芥、烟草、马铃薯质体G6PDH的一致性分别达81%、87%、83%.进化关系说明水稻OsG6PDH2与拟南芥(AtG6PDH3)、马铃薯(StG6PDH1)处于高等植物P2型质体G6PDH分支上,暗示了OsG6PDH2可能是一个P2型的质体蛋白.Matinspector程序分析表明,OsG6PDH2在起始密码子上游含有一个bZIP转录因子识别位点、一个ABA应答元件、一个CRT/DRE元件和1个W-box元件.半定量RT-PCR分析表明,OsG6PDH2在水稻根、茎、叶和幼

  17. Solanapyrone synthase, a possible Diels-Alderase and iterative type I polyketide synthase encoded in a biosynthetic gene cluster from Alternaria solani.

    Science.gov (United States)

    Kasahara, Ken; Miyamoto, Takanori; Fujimoto, Takashi; Oguri, Hiroki; Tokiwano, Tetsuo; Oikawa, Hideaki; Ebizuka, Yutaka; Fujii, Isao

    2010-06-14

    The solanapyrone biosynthetic gene cluster was cloned from Alternaria solani. It consists of six genes-sol1-6-coding for a polyketide synthase, an O-methyltransferase, a dehydrogenase, a transcription factor, a flavin-dependent oxidase, and cytochrome P450. The prosolanapyrone synthase (PSS) encoded by sol1 was expressed in Aspergillus oryzae and its product was identified as desmethylprosolanapyrone I (8). Although PSS is closely related to the PKSs/Diels-Alderases LovB and MlcA of lovastatin and compactin biosynthesis, it did not catalyze cycloaddition. Sol5, encoding a flavin-dependent oxidase (solanapyrone synthase, SPS), was expressed in Pichia pastoris and purified. The purified recombinant SPS showed activity for the formation of (-)-solanapyrone A (1) from achiral prosolanapyrone II (2), establishing that this single enzyme catalyzes both the oxidation and the subsequent cycloaddition reaction, possibly as a Diels-Alder enzyme.

  18. Glucose-6-phosphate mediates activation of the carbohydrate responsive binding protein (ChREBP)

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming V. [Program of Cardiovascular Sciences, Houston, TX 77030 (United States); Departments of Medicine and Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030 (United States); Chen, Weiqin [Departments of Medicine and Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030 (United States); Harmancey, Romain N. [Division of Cardiology, The University of Texas Health Science Center at Houston, Houston, TX 77030 (United States); Nuotio-Antar, Alli M.; Imamura, Minako; Saha, Pradip [Departments of Medicine and Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030 (United States); Taegtmeyer, Heinrich [Division of Cardiology, The University of Texas Health Science Center at Houston, Houston, TX 77030 (United States); Chan, Lawrence, E-mail: lchan@bcm.tmc.edu [Program of Cardiovascular Sciences, Houston, TX 77030 (United States); Departments of Medicine and Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030 (United States); St. Luke' s Episcopal Hospital, Houston, TX 77030 (United States)

    2010-05-07

    Carbohydrate response element binding protein (ChREBP) is a Mondo family transcription factor that activates a number of glycolytic and lipogenic genes in response to glucose stimulation. We have previously reported that high glucose can activate the transcriptional activity of ChREBP independent of the protein phosphatase 2A (PP2A)-mediated increase in nuclear entry and DNA binding. Here, we found that formation of glucose-6-phosphate (G-6-P) is essential for glucose activation of ChREBP. The glucose response of GAL4-ChREBP is attenuated by D-mannoheptulose, a potent hexokinase inhibitor, as well as over-expression of glucose-6-phosphatase (G6Pase); kinetics of activation of GAL4-ChREBP can be modified by exogenously expressed GCK. Further metabolism of G-6-P through the two major glucose metabolic pathways, glycolysis and pentose-phosphate pathway, is not required for activation of ChREBP; over-expression of glucose-6-phosphate dehydrogenase (G6PD) diminishes, whereas RNAi knockdown of the enzyme enhances, the glucose response of GAL4-ChREBP, respectively. Moreover, the glucose analogue 2-deoxyglucose (2-DG), which is phosphorylated by hexokinase, but not further metabolized, effectively upregulates the transcription activity of ChREBP. In addition, over-expression of phosphofructokinase (PFK) 1 and 2, synergistically diminishes the glucose response of GAL4-ChREBP. These multiple lines of evidence support the conclusion that G-6-P mediates the activation of ChREBP.

  19. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria x ananassa).

    Science.gov (United States)

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria x ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus.

  20. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  1. carboxylate synthase gene family in Arabidopsis, rice, grapevine ...

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... mungbean, rose (Johnson et al., 1998; Ge et al., 2000) etc. Though .... of molecular evolution that follows gene duplications (Martinez-. Castilla et al. ..... Dong J, Kim W, Yip W, Thompson G, Li L, Bennett A (1991). Cloning of.

  2. Isolation and Molecular Characterization of 1-Aminocyclopropane-1-carboxylic Acid Synthase Genes in Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Jia-Hong Zhu

    2015-02-01

    Full Text Available Ethylene is an important factor that stimulates Hevea brasiliensis to produce natural rubber. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS is a rate-limiting enzyme in ethylene biosynthesis. However, knowledge of the ACS gene family of H. brasiliensis is limited. In this study, nine ACS-like genes were identified in H. brasiliensis. Sequence and phylogenetic analysis results confirmed that seven isozymes (HbACS1–7 of these nine ACS-like genes were similar to ACS isozymes with ACS activity in other plants. Expression analysis results showed that seven ACS genes were differentially expressed in roots, barks, flowers, and leaves of H. brasiliensis. However, no or low ACS gene expression was detected in the latex of H. brasiliensis. Moreover, seven genes were differentially up-regulated by ethylene treatment. These results provided relevant information to help determine the functions of the ACS gene in H. brasiliensis, particularly the functions in regulating ethylene stimulation of latex production.

  3. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  4. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  5. Genetic Transformation of Tobacco with the Trehalose Synthase Gene from Grifola frondosa Fr. Enhances the Resistance to Drought and Salt in Tobacco

    Institute of Scientific and Technical Information of China (English)

    Shu-Zhen ZHANG; Ben-Peng YANG; Cui-Lian FENG; Huo-Long TANG

    2005-01-01

    Trehalose is a non-reducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances the tolerance of organisms to abiotic stress. In the present study, we report on the expression of the Grifolafrondosa Fr. trehalose synthase (TSase) gene for manipulating abiotic stress tolerance in tobacco (Nicotiana tabaccum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and was transferred into tobacco by Agrobacterium tumefaciens EHA105. Compared with non-transgenic plants, transgenic plants were able to accumulate high levels of products of trehalose, which were increased up to 2.126-2.556 mg/g FW, although levels were undetectable in non-transgenic plants. This level of trehalose in transgenic plants was 400-fold higher than that of transgenic tobacco plants cotransformed with Escherichia coli TPS and TPP on independent expression cassettes, twofold higher than that of transgenic rice plants transformed with a bifunctional fusion gene (TPSP) of the trehalose-6-phosphate (T-6-P) synthase (TPS) and T-6-P phosphatase (TPP) of E. coli, and 12-fold higher than that of transgenic tobacco plants transformed the yeast TPS1 gene.It has been reported that transgenic plants with E. coli TPS and/or TPP were severely stunted and had morphological alterations of their roots. Interestingly, our transgenic plants have obvious morphological changes, including thick and deep-coloured leaves, but show no growth inhibition; moreover, these morphological changes can restore to normal type in T2 progenies. Trehalose accumulation in 35S-35S:TSase plants resulted in increased tolerance to drought and salt, as shown by the results of tests on drought, salt tolerance, and drought physiological indices, such as water content in excised leaves, malondialdehyde content, chlorophyll a and b contents, and the activity of superoxide dismutase and peroxidase in excised leaves. These results

  6. Expression pattern of the coparyl diphosphate synthase gene in developing rice anthers.

    Science.gov (United States)

    Fukuda, Ari; Nemoto, Keisuke; Chono, Makiko; Yamaguchi, Shinjiro; Nakajima, Masatoshi; Yamagishi, Junko; Maekawa, Masahiko; Yamaguchi, Isomaro

    2004-08-01

    Rice anthers contain high concentrations of gibberellins A(4) and A(7). To understand their physiological roles, we examined the site of their biosynthesis by analyzing the expression pattern of a gene (OsCPS) encoding coparyl diphosphate synthase in developing rice flowers. Expression was apparent in the anthers 1-2 days before flowering, and CPS mRNA accumulated in the maturing pollen.

  7. Polymorphisms in Chlamydia trachomatis tryptophan synthase genes differentiate between genital and ocular isolates

    Science.gov (United States)

    Caldwell, Harlan D.; Wood, Heidi; Crane, Debbie; Bailey, Robin; Jones, Robert B.; Mabey, David; Maclean, Ian; Mohammed, Zeena; Peeling, Rosanna; Roshick, Christine; Schachter, Julius; Solomon, Anthony W.; Stamm, Walter E.; Suchland, Robert J.; Taylor, Lacey; West, Sheila K.; Quinn, Tom C.; Belland, Robert J.; McClarty, Grant

    2003-01-01

    We previously reported that laboratory reference strains of Chlamydia trachomatis differing in infection organotropism correlated with inactivating mutations in the pathogen’s tryptophan synthase (trpBA) genes. Here, we have applied functional genomics to extend this work and find that the paradigm established for reference serovars also applies to clinical isolates — specifically, all ocular trachoma isolates tested have inactivating mutations in the synthase, whereas all genital isolates encode a functional enzyme. Moreover, functional enzyme activity was directly correlated to IFN-γ resistance through an indole rescue mechanism. Hence, a strong selective pressure exists for genital strains to maintain a functional synthase capable of using indole for tryptophan biosynthesis. The fact that ocular serovars (serovar B) isolated from the genital tract were found to possess a functional synthase provided further persuasive evidence of this association. These results argue that there is an important host-parasite relationship between chlamydial genital strains and the human host that determines organotropism of infection and the pathophysiology of disease. We speculate that this relationship involves the production of indole by components of the vaginal microbial flora, allowing chlamydiae to escape IFN-γ–mediated eradication and thus establish persistent infection. PMID:12782678

  8. [Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

    Science.gov (United States)

    Boris, K V; Kochieva, E Z; Kudryavtsev, A M

    2014-12-01

    The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

  9. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  10. Rapid screening for glucose-6-phosphate dehydrogenase deficiency and haemoglobin polymorphisms in Africa by a simple high-throughput SSOP-ELISA method

    DEFF Research Database (Denmark)

    Enevold, Anders; Vestergaard, Lasse S; Lusingu, John

    2005-01-01

    BACKGROUND: Mutations in the haemoglobin beta-globin (HbB) and glucose-6-phosphate dehydrogenase (G6PD) genes cause widespread human genetic disorders such as sickle cell diseases and G6PD deficiency. In sub-Saharan Africa, a few predominant polymorphic variants of each gene account for a majority...

  11. Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Guan-Jing; Li, Lan-Fen; Li, Dan; Liu, Cong [National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871 (China); Wei, Shi-Cheng, E-mail: kqsc-wei@bjmu.edu.cn [Peking University School of Stomatology, Beijing 100081 (China); Liang, Yu-He, E-mail: kqsc-wei@bjmu.edu.cn; Su, Xiao-Dong [National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871 (China)

    2007-09-01

    A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.

  12. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Cloning and analysis of valerophenone synthase gene expressed specifically in lupulin gland of hop (Humulus lupulus L.).

    Science.gov (United States)

    Okada, Y; Ito, K

    2001-01-01

    Resin and essential oil derived from hop (Humulus lupulus L.) cones are very important compounds for beer brewing, and they specifically accumulate in the lupulin gland of hop cones. In order to identify the genes responsible for the biosynthetic pathway of these compounds and use the identified genes for hop breeding using Marker Assisted Selection and transformation techniques, genes expressed specifically in the lupulin gland were cloned and sequenced. One of them was suggested to be similar to the chalcone synthase gene from the DNA sequence. The translation product of the gene had the activity of valerophenone synthase, which catalyzes a part of the synthesis reaction of alpha-acid and beta-acid. Northern analysis showed that the valerophenone synthase gene seemed to be expressed specifically in the lupulin gland.

  14. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses1[OPEN

    Science.gov (United States)

    Schwerdt, Julian G.; Wright, Frank; Oehme, Daniel; Wagner, John M.; Shirley, Neil J.; Burton, Rachel A.; Schreiber, Miriam; Zimmer, Jochen; Marshall, David F.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  15. Differential expression of biphenyl synthase gene family members in fire-blight-infected apple 'Holsteiner Cox'.

    Science.gov (United States)

    Chizzali, Cornelia; Gaid, Mariam M; Belkheir, Asma K; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-02-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple 'Golden Delicious', nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple 'Holsteiner Cox,' heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple 'Cox Orange,' expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells.

  16. Adaptive evolution of the chrysanthemyl diphosphate synthase gene involved in irregular monoterpene metabolism

    Directory of Open Access Journals (Sweden)

    Liu Ping-Li

    2012-11-01

    Full Text Available Abstract Background Chrysanthemyl diphosphate synthase (CDS is a key enzyme in biosynthetic pathways producing pyrethrins and irregular monoterpenes. These compounds are confined to plants of the tribe Anthemideae of the Asteraceae, and play an important role in defending the plants against herbivorous insects. It has been proposed that the CDS genes arose from duplication of the farnesyl diphosphate synthase (FDS gene and have different function from FDSs. However, the duplication time toward the origin of CDS and the evolutionary force behind the functional divergence of the CDS gene are still unknown. Results Two duplication events were detected in the evolutionary history of the FDS gene family in the Asteraceae, and the second duplication led to the origin of CDS. CDS occurred after the divergence of the tribe Mutisieae from other tribes of Asteraceae but before the birth of the Anthemideae tribe. After its origin, CDS accumulated four mutations in sites homologous to the substrate-binding and catalysis sites of FDS. Of these, two sites were involved in the binding of the nucleophilic substrate isopentenyl diphosphate in FDS. Maximum likelihood analyses showed that some sites in CDS were under positive selection and were scattered throughout primary sequences, whereas in the three-dimensional structure model they clustered in the large central cavity. Conclusion Positive selection associated with gene duplication played a major role in the evolution of CDS.

  17. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    Science.gov (United States)

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity.

  18. Glucose-6-phosphate dehydrogenase deficiency in Nigerian children.

    Directory of Open Access Journals (Sweden)

    Olatundun Williams

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD deficiency is the most common human enzymopathy and in Sub-Saharan Africa, is a significant cause of infection- and drug-induced hemolysis and neonatal jaundice. Our goals were to determine the prevalence of G6PD deficiency among Nigerian children of different ethnic backgrounds and to identify predictors of G6PD deficiency by analyzing vital signs and hematocrit and by asking screening questions about symptoms of hemolysis. We studied 1,122 children (561 males and 561 females aged 1 month to 15 years. The mean age was 7.4 ± 3.2 years. Children of Yoruba ethnicity made up the largest group (77.5% followed by those Igbo descent (10.6% and those of Igede (10.2% and Tiv (1.8% ethnicity. G6PD status was determined using the fluorescent spot method. We found that the overall prevalence of G6PD deficiency was 15.3% (24.1% in males, 6.6% in females. Yoruba children had a higher prevalence (16.9% than Igede (10.5%, Igbo (10.1% and Tiv (5.0% children. The odds of G6PD deficiency were 0.38 times as high in Igbo children compared to Yoruba children (p=0.0500. The odds for Igede and Tiv children were not significantly different from Yoruba children (p=0.7528 and 0.9789 respectively. Mean oxygen saturation, heart rate and hematocrit were not significantly different in G6PD deficient and G6PD sufficient children. The odds of being G6PD deficient were 2.1 times higher in children with scleral icterus than those without (p=0.0351. In conclusion, we determined the prevalence of G6PD deficiency in Nigerian sub-populations. The odds of G6PD deficiency were decreased in Igbo children compared to Yoruba children. There was no association between vital parameters or hematocrit and G6PD deficiency. We found that a history of scleral icterus may increase the odds of G6PD deficiency, but we did not exclude other common causes of icterus such as sickle cell disease or malarial infection.

  19. Diagnostic value of glucose-6-phosphate isomerase in rheumatoid arthritis.

    Science.gov (United States)

    Fan, Lie Ying; Zong, Ming; Wang, Qiang; Yang, Lin; Sun, Li Shan; Ye, Qin; Ding, Yuan Yuan; Ma, Jian Wei

    2010-12-14

    Although glucose-6-phosphate isomerase (G6PI), anti-G6PI antibodies and G6PI-containing immune complexes (G6PI-CIC) have proved high expression in patients with rheumatoid arthritis (RA), comprehensive evaluation of the G6PI-derived markers, G6PI antigen, anti-G6PI Abs, G6PI-CIC and G6PI mRNA, in the diagnosis of RA remains necessary. We measured G6PI antigen, anti-G6PI Abs, C1q/G6PI-CIC as well as anti-cyclic citrullinated peptide antibodies (anti-CCP Abs) in serum and concomitantly synovial fluid (SF) by ELISA in RA, other rheumatic diseases and healthy controls. The G6PI mRNA expression in peripheral blood mononuclear cells (PBMCs) was assessed with real-time PCR. As compared with non-RA patients, RA patients had increased levels of G6PI antigen, anti-G6PI Abs, C1q/G6PI-CIC and G6PI mRNA expression in sera or PBMCs, and increased levels of G6PI and C1q/G6PI-CIC in SF. The serum G6PI levels in RA patients positively correlated with anti-G6PI Abs, C1q/G6PI-CIC, G6PI mRNA, anti-CCP Abs, RF, CRP and ESR, respectively. The area under curve analyses demonstrated that serum G6PI had the best discriminating power for RA and active RA followed by C1q/G6PI-CIC, anti-G6PI Abs and G6PI mRNA. The simultaneous use of serum G6PI and anti-CCP Abs assays in the form of either of them tested positive gave improved sensitivities of 88.1% for RA and 95.8% for active RA. Despite the elevated expression of all G6PI-derived markers in RA, the serum G6PI has the best discriminating power among the four G6PI-derived markers. The serum G6PI determination either alone or in combination with anti-CCP Abs improves the diagnosis of RA. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Functional characterization of the Xanthophyllomyces dendrorhous farnesyl pyrophosphate synthase and geranylgeranyl pyrophosphate synthase encoding genes that are involved in the synthesis of isoprenoid precursors.

    Directory of Open Access Journals (Sweden)

    Jennifer Alcaíno

    Full Text Available The yeast Xanthophyllomyces dendrorhous synthesizes the carotenoid astaxanthin, which has applications in biotechnology because of its antioxidant and pigmentation properties. However, wild-type strains produce too low amounts of carotenoids to be industrially competitive. Considering this background, it is indispensable to understand how the synthesis of astaxanthin is controlled and regulated in this yeast. In this work, the steps leading to the synthesis of the carotenoid precursor geranylgeranyl pyrophosphate (GGPP, C20 in X. dendrorhous from isopentenyl pyrophosphate (IPP, C5 and dimethylallyl pyrophosphate (DMAPP, C5 was characterized. Two prenyl transferase encoding genes, FPS and crtE, were expressed in E. coli. The enzymatic assays using recombinant E. coli protein extracts demonstrated that FPS and crtE encode a farnesyl pyrophosphate (FPP, C15 synthase and a GGPP-synthase, respectively. X. dendrorhous FPP-synthase produces geranyl pyrophosphate (GPP, C10 from IPP and DMAPP and FPP from IPP and GPP, while the X. dendrorhous GGPP-synthase utilizes only FPP and IPP as substrates to produce GGPP. Additionally, the FPS and crtE genes were over-expressed in X. dendrorhous, resulting in an increase of the total carotenoid production. Because the parental strain is diploid, the deletion of one of the alleles of these genes did not affect the total carotenoid production, but the composition was significantly altered. These results suggest that the over-expression of these genes might provoke a higher carbon flux towards carotenogenesis, most likely involving an earlier formation of a carotenogenic enzyme complex. Conversely, the lower carbon flux towards carotenogenesis in the deletion mutants might delay or lead to a partial formation of a carotenogenic enzyme complex, which could explain the accumulation of astaxanthin carotenoid precursors in these mutants. In conclusion, the FPS and the crtE genes represent good candidates to manipulate to

  1. Functional characterization of the Xanthophyllomyces dendrorhous farnesyl pyrophosphate synthase and geranylgeranyl pyrophosphate synthase encoding genes that are involved in the synthesis of isoprenoid precursors.

    Science.gov (United States)

    Alcaíno, Jennifer; Romero, Ignacio; Niklitschek, Mauricio; Sepúlveda, Dionisia; Rojas, María Cecilia; Baeza, Marcelo; Cifuentes, Víctor

    2014-01-01

    The yeast Xanthophyllomyces dendrorhous synthesizes the carotenoid astaxanthin, which has applications in biotechnology because of its antioxidant and pigmentation properties. However, wild-type strains produce too low amounts of carotenoids to be industrially competitive. Considering this background, it is indispensable to understand how the synthesis of astaxanthin is controlled and regulated in this yeast. In this work, the steps leading to the synthesis of the carotenoid precursor geranylgeranyl pyrophosphate (GGPP, C20) in X. dendrorhous from isopentenyl pyrophosphate (IPP, C5) and dimethylallyl pyrophosphate (DMAPP, C5) was characterized. Two prenyl transferase encoding genes, FPS and crtE, were expressed in E. coli. The enzymatic assays using recombinant E. coli protein extracts demonstrated that FPS and crtE encode a farnesyl pyrophosphate (FPP, C15) synthase and a GGPP-synthase, respectively. X. dendrorhous FPP-synthase produces geranyl pyrophosphate (GPP, C10) from IPP and DMAPP and FPP from IPP and GPP, while the X. dendrorhous GGPP-synthase utilizes only FPP and IPP as substrates to produce GGPP. Additionally, the FPS and crtE genes were over-expressed in X. dendrorhous, resulting in an increase of the total carotenoid production. Because the parental strain is diploid, the deletion of one of the alleles of these genes did not affect the total carotenoid production, but the composition was significantly altered. These results suggest that the over-expression of these genes might provoke a higher carbon flux towards carotenogenesis, most likely involving an earlier formation of a carotenogenic enzyme complex. Conversely, the lower carbon flux towards carotenogenesis in the deletion mutants might delay or lead to a partial formation of a carotenogenic enzyme complex, which could explain the accumulation of astaxanthin carotenoid precursors in these mutants. In conclusion, the FPS and the crtE genes represent good candidates to manipulate to favor

  2. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    Science.gov (United States)

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  3. Human gene encoding prostacyclin synthase (PTGIS): Genomic organization, chromosomal localization, and promoter activity

    Energy Technology Data Exchange (ETDEWEB)

    Yokoyama, Chieko; Yabuki, Tomoko; Inoue, Hiroyasu [National Cardiovascular Center Research Institute, Osaka (Japan)] [and others

    1996-09-01

    The prostacyclin synthase gene isolated from human genomic libraries (PTGIS) consists of 10 exons spanning approximately 60 kb. All the splice donor and acceptor sites conform to the GT/AG rule. Genomic Southern blot and fluorescence in situ hybridization analyses revealed that the human prostacyclin synthase gene is present as a single copy per haploid genome and is localized on chromosome 20q13.11-q13.13. The 1.5-kb sequence of the 5{prime} of the translational initiation site contained both GC-rich and pyrimidine-rich regions and consensus sequences of the transcription factor recognition sites such as Sp1, AP-2, the interferon-{gamma} response element, GATA, NF-{kappa}B, the CACCC box, and the glucocorticoid response element. The core binding sequence (GAGACC) of the shear stress responsive element was also found in the 5{prime}-flanking region of the gene. The major product of the primer extension analysis suggested that the transcription of the gene started from the positions around 49 bp upstream of the translational initiation codon. Transient transfection experiments using human aortic and bovine arterial endothelial cells demonstrated that the GC-rich region (positions -145 to -10) possessed a significant promoter activity. The 6-kb downstream sequence of the translational termination codon contained multiple polyadenylation signals, Alu repeat sequences, and the consensus sequence of the primate-repetitive DNA element, MER1. Two sizes of the prostacyclin synthase mRNAs (approximately 6 and 3.3 kb) were detected with the human aorta and lung. RNA blot hybridization analysis using the 3{prime}-untranslated region as probe indicated that the sizes of the 3{prime}-flanking regions were different in the major 6-kb and minor 3.3-kb mRNAs. 54 refs., 7 figs.

  4. Phosphatase-inert glucosamine 6-phosphate mimics serve as actuators of the glmS riboswitch.

    Science.gov (United States)

    Fei, Xiang; Holmes, Thomas; Diddle, Julianna; Hintz, Lauren; Delaney, Dan; Stock, Alex; Renner, Danielle; McDevitt, Molly; Berkowitz, David B; Soukup, Juliane K

    2014-12-19

    The glmS riboswitch is unique among gene-regulating riboswitches and catalytic RNAs. This is because its own metabolite, glucosamine-6-phosphate (GlcN6P), binds to the riboswitch and catalytically participates in the RNA self-cleavage reaction, thereby providing a novel negative feedback mechanism. Given that a number of pathogens harbor the glmS riboswitch, artificial actuators of this potential RNA target are of great interest. Structural/kinetic studies point to the 2-amino and 6-phosphate ester functionalities in GlcN6P as being crucial for this actuation. As a first step toward developing artificial actuators, we have synthesized a series of nine GlcN6P analogs bearing phosphatase-inert surrogates in place of the natural phosphate ester. Self-cleavage assays with the Bacillus cereus glmS riboswitch give a broad SAR. Two analogs display significant activity, namely, the 6-deoxy-6-phosphonomethyl analog (5) and the 6-O-malonyl ether (13). Kinetic profiles show a 22-fold and a 27-fold higher catalytic efficiency, respectively, for these analogs vs glucosamine (GlcN). Given their nonhydrolyzable phosphate surrogate functionalities, these analogs are arguably the most robust artificial glmS riboswitch actuators yet reported. Interestingly, the malonyl ether (13, extra O atom) is much more effective than the simple malonate (17), and the "sterically true" phosphonate (5) is far superior to the chain-truncated (7) or chain-extended (11) analogs, suggesting that positioning via Mg coordination is important for activity. Docking results are consistent with this view. Indeed, the viability of the phosphonate and 6-O-malonyl ether mimics of GlcN6P points to a potential new strategy for artificial actuation of the glmS riboswitch in a biological setting, wherein phosphatase-resistance is paramount.

  5. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Indian Academy of Sciences (India)

    Meng-Jun Li; Ai-Qin Li; Han Xia; Chuan-Zhi Zhao; Chang-Sheng Li; Shu-Bo Wan; Yu-Ping Bi; Xing-Jun Wang

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, -ketoacyl-ACP synthase (I, II, III), -ketoacyl-ACP reductase, -hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  6. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Science.gov (United States)

    Li, Meng-Jun; Li, Ai-Qin; Xia, Han; Zhao, Chuan-Zhi; Li, Chang-Sheng; Wan, Shu-Bo; Bi, Yu-Ping; Wang, Xing-Jun

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, beta-ketoacyl-ACP synthase (I, II, III), beta-ketoacyl-ACP reductase, beta-hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  7. Congenital hyperreninemic hypoaldosteronism unlinked to the aldosterone synthase (CYP11B2) gene.

    Science.gov (United States)

    Kayes-Wandover, K M; Tannin, G M; Shulman, D; Peled, D; Jones, K L; Karaviti, L; White, P C

    2001-11-01

    Isolated hyperreninemic hypoaldosteronism presenting in infancy is usually caused by mutations in the CYP11B2 gene encoding aldosterone synthase. We studied five patients in four unrelated kindreds with hyperreninemic hypoaldosteronism, in whom we were unable to find such mutations. All presented in infancy with failure to thrive, hyponatremia, hyperkalemia, markedly elevated plasma renin activity, and low or inappropriately normal aldosterone levels. All had normal cortisol levels and no signs or symptoms of congenital adrenal hyperplasia. All responded to fludrocortisone treatment. There were no mutations detected in exons or splice junctions of CYP11B2. Linkage of the disorder to CYP11B2 was studied in two unrelated consanguineous patients and in an affected sib pair. The consanguineous patients were each heterozygous for at least one of three polymorphic microsatellite markers near CYP11B2, excluding linkage to CYP11B2. However, linkage of the disease to CYP11B2 could not be excluded in the affected sib pair. Genes involved in the regulation of aldosterone biosynthesis, including those encoding angiotensinogen, angiotensin-converting enzyme, and the AT1 angiotensin II receptor were similarly excluded from linkage. These results demonstrate the existence of an inherited form of hyperreninemic hypoaldosteronism distinct from aldosterone synthase deficiency. The affected gene(s) remain to be determined.

  8. Function of resveratrol de- rived from transgenic plant expressing resveratrol synthase gene

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Two genes from grapevine coding for resveratrol synthase, named RS1 and RS2, were cloned by RT-PCR. An Escherichia coli expression vector was constructed by insertion of RS1 into pBV221. A specific protein with the same molecular weight (42 ku) as the resveratrol synthase was expressed and used to prepare the rabbit antiserum. A plant expression vector was constructed by inserting the RS1 gene into pBin438 downstream of the doubled CaMV 35S promoter and TMV-W fragment. PCR-positive transgenic tobacco plants were obtained after transformation with Agrobacterium tumefaciens LBA4404 harboring the plant expression vector. Southern blot analysis demonstrated that the foreign gene was integrated into the tobacco genome. The results of RT-PCR and Western blot indicated that the RS1 gene was transcribed and expressed. Formation of resvera-trol in transgenic tobacco was further determined by thin-layer chromatography of silica gel and HPLC. Increased accumulation of human breast adenocarcinoma cells in G0 and G1 phases of cell cycle was observed in cells treated with resveratrol purified from transgenic tobacco as compared to the untreated cells.

  9. Glucose-6-Phosphate Dehydrogenase: Update and Analysis of New Mutations around the World

    Science.gov (United States)

    Gómez-Manzo, Saúl; Marcial-Quino, Jaime; Vanoye-Carlo, America; Serrano-Posada, Hugo; Ortega-Cuellar, Daniel; González-Valdez, Abigail; Castillo-Rodríguez, Rosa Angélica; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) is a key regulatory enzyme in the pentose phosphate pathway which produces nicotinamide adenine dinucleotide phosphate (NADPH) to maintain an adequate reducing environment in the cells and is especially important in red blood cells (RBC). Given its central role in the regulation of redox state, it is understandable that mutations in the gene encoding G6PD can cause deficiency of the protein activity leading to clinical manifestations such as neonatal jaundice and acute hemolytic anemia. Recently, an extensive review has been published about variants in the g6pd gene; recognizing 186 mutations. In this work, we review the state of the art in G6PD deficiency, describing 217 mutations in the g6pd gene; we also compile information about 31 new mutations, 16 that were not recognized and 15 more that have recently been reported. In order to get a better picture of the effects of new described mutations in g6pd gene, we locate the point mutations in the solved three-dimensional structure of the human G6PD protein. We found that class I mutations have the most deleterious effects on the structure and stability of the protein. PMID:27941691

  10. Glucose-6-Phosphate Dehydrogenase: Update and Analysis of New Mutations around the World

    Directory of Open Access Journals (Sweden)

    Saúl Gómez-Manzo

    2016-12-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD is a key regulatory enzyme in the pentose phosphate pathway which produces nicotinamide adenine dinucleotide phosphate (NADPH to maintain an adequate reducing environment in the cells and is especially important in red blood cells (RBC. Given its central role in the regulation of redox state, it is understandable that mutations in the gene encoding G6PD can cause deficiency of the protein activity leading to clinical manifestations such as neonatal jaundice and acute hemolytic anemia. Recently, an extensive review has been published about variants in the g6pd gene; recognizing 186 mutations. In this work, we review the state of the art in G6PD deficiency, describing 217 mutations in the g6pd gene; we also compile information about 31 new mutations, 16 that were not recognized and 15 more that have recently been reported. In order to get a better picture of the effects of new described mutations in g6pd gene, we locate the point mutations in the solved three-dimensional structure of the human G6PD protein. We found that class I mutations have the most deleterious effects on the structure and stability of the protein.

  11. Cloning, Expression and Identification of a New Trehalose Synthase Gene from Thermobifida fusca Genome

    Institute of Scientific and Technical Information of China (English)

    Yu-Tuo WEI; Ri-Bo HUANG; Qi-Xia ZHU; Zhao-Fei LUO; Fu-Shen LU; Fa-Zhong CHEN; Qing-Yan WANG; Kun HUANG; Jian-Zhong MENG; Rong WANG

    2004-01-01

    A new open reading frame in Thermobifida fusca sequenced genome was identified to encode a new trehalose synthase, annotated as "glycosidase" in the GenBank database, by bioinformatics searching and experimental validation. The gene had a length of 1830 bp with about 65% GC content and encoded for a new trehalose synthase with 610 amino acids and deduced molecular weight of 66 kD. The high GC content seemed not to affect its good expression in E. coli BL21 in which the target protein could account for as high as 15% of the total cell proteins. The recombinant enzyme showed its optimal activities at 25 ℃ and pH 6.5 when it converted substrate maltose into trehalose. However it would divert a high proportion of its substrate into glucose when the temperature was increased to 37 ℃, or when the enzyme concentration was high Its activity was not inhibited by 5 mM heavy metals such as Cu2+, Mn2+, and Zn2+ but affected by high concentration of glucose. Blasting against the database indicated that amino acid sequence of this protein had maximal 69% homology with the known trehalose synthases, and two highly conserved segments of the protein sequence were identified and their possible linkage with functions was discussed.

  12. A CELLULOSE SYNTHASE (CESA) GENE FROM THE RED ALGA PORPHYRA YEZOENSIS (RHODOPHYTA)(1).

    Science.gov (United States)

    Roberts, Eric; Roberts, Alison W

    2009-02-01

    The cell walls of Porphyra species, like those of land plants, contain cellulose microfibrils that are synthesized by clusters of cellulose synthase enzymes ("terminal complexes"), which move in the plasma membrane. However, the morphologies of the Porphyra terminal complexes and the cellulose microfibrils they produce differ from those of land plants. To characterize the genetic basis for these differences, we have identified, cloned, and sequenced a cellulose synthase (CESA) gene from Porphyra yezoensis Ueda strain TU-1. A partial cDNA sequence was identified in the P. yezoensis expressed sequence tag (EST) index using a land plant CESA sequence as a query. High-efficiency thermal asymmetric interlaced PCR was used to amplify sequences upstream of the cDNA sequence from P. yezoensis genomic DNA. Using the resulting genomic sequences as queries, we identified additional EST sequences and a full-length cDNA clone, which we named PyCESA1. The conceptual translation of PyCESA1 includes the four catalytic domains and the N- and C-terminal transmembrane domains that characterize CESA proteins. Genomic PCR demonstrated that PyCESA1 contains no introns. Southern blot analysis indicated that P. yezoensis has at least three genomic sequences with high similarity to the cloned gene; two of these are pseudogenes based on analysis of amplified genomic sequences. The P. yezoensis CESA peptide sequence is most similar to cellulose synthase sequences from the oomycete Phytophthora infestans and from cyanobacteria. Comparing the CESA genes of P. yezoensis and land plants may facilitate identification of sequences that control terminal complex and cellulose microfibril morphology.

  13. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    OpenAIRE

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  14. A transgenic wheat with a stilbene synthase gene resistant to powdery mildew obtained by biolistic method

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Stilbene, a kind of phytoalexin, plays an important role in resistance to fungal and bacterial infection in plants. It strongly inhibits the growth of fungi and sprout of spore. Stilbene synthase gene (Vst1) obtained from grapevine has been transferred into common spring wheat Jinghong 5 by using the biolistic transformation method. Five transgenic plants (T0) were obtained from the bombarded 2014 immature embryos. One immune plantlet and 3 plantlets with mid-resistance to powdery mildew were identified from the transgenic plants of T3 generation which came from 2 T0 transgenic plants.

  15. Cloning,Characterization,and Gene Annotation of Cellulose Synthase Genes from Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    BALASUBRAMANI G; AMUDHA J; KATEGERI I S; KHADI B M

    2008-01-01

    @@ The mechanistic basis of cellulose biosynthesis in plants has gained ground during last decade or so.The isolation of plant eDNA clones encoding cotton homologs of the bacterial cellulose synthase catalytic subunit was a significant achievement,which promises the elucidation of cellulose biosynthesis.

  16. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  17. A polyketide synthase-peptide synthetase gene cluster from an uncultured bacterial symbiont of Paederus beetles.

    Science.gov (United States)

    Piel, Jörn

    2002-10-29

    Many drug candidates from marine and terrestrial invertebrates are suspected metabolites of uncultured bacterial symbionts. The antitumor polyketides of the pederin family, isolated from beetles and sponges, are an example. Drug development from such sources is commonly hampered by low yields and the difficulty of sustaining invertebrate cultures. To obtain insight into the true producer and find alternative supplies of these rare drug candidates, the putative pederin biosynthesis genes were cloned from total DNA of Paederus fuscipes beetles, which use this compound for chemical defense. Sequence analysis of the gene cluster and adjacent regions revealed the presence of ORFs with typical bacterial architecture and homologies. The ped cluster, which is present only in beetle specimens with high pederin content, is located on a 54-kb region bordered by transposase pseudogenes and encodes a mixed modular polyketide synthase/nonribosomal peptide synthetase. Notably, none of the modules contains regions with homology to acyltransferase domains, but two copies of isolated monodomain acyltransferase genes were found at the upstream end of the cluster. In line with an involvement in pederin biosynthesis, the upstream cluster region perfectly mirrors pederin structure. The unexpected presence of additional polyketide synthase/nonribosomal peptide synthetase modules reveals surprising insights into the evolutionary relationship between pederin-type pathways in beetles and sponges.

  18. Molecular cloning and in vitro expression of a silent phenoxazinone synthase gene from Streptomyces lividans.

    Science.gov (United States)

    Madu, A C; Jones, G H

    1989-12-14

    Phenoxazinone synthase (PHS) catalyzes a step in actinomycin D biosynthesis in Streptomyces antibioticus. Two sequences from Streptomyces lividans that hybridize to the phs gene of S. antibioticus have been cloned in Escherichia coli K-12 using the plasmid pBR322. Although there was some similarity in the restriction maps of the two cloned fragments, neither insert appeared to be a direct subset of the other nor of the S. antibioticus phs gene. In vitro expression studies, in a streptomycete coupled transcription-translation system, showed that a 3.98-kb SphI fragment encoded a PHS-related protein. These observations provide additional support for the existence of silent genes for antibiotic production in streptomycetes.

  19. Chitin synthase 1 (Chs1) gene sequences of Microsporum equinum and Trichophyton equinum.

    Science.gov (United States)

    Kano, R; Aihara, S; Nakamura, Y; Watanabe, S; Hasegawa, A

    2001-01-05

    Chitin synthase 1 (Chs1) genes from Microsporum equinum and Trichophyton equinum were compared with those of the other dermatophytes. The Chs1 nucleotide sequences of these dermatophytes from horses showed more than 80% similarity to those of Arthroderma benhamiae, A. fulvum, A. grubyi, A. gypseum, A. incruvatum, A. otae, A. simii, A. vanbreuseghemii, Epidermophyton floccosum, T. mentagrophytes var. interdigitale (T. interdigitale), T. rubrum and T. violaceum. Especially high degree of nucleotide sequence similarity of more than 99% was noted between the Chs1 gene fragments of M. equinum and A. otae, and those of T. equinum, T. interdigitale and A. vanbreuseghemii, respectively. The phylogenetic analysis of their sequences revealed that M. equinum was genetically very close to A. otae and T. equinum to A. vanbreuseghemii. A molecular analysis of Chs1 genes will provide useful information for the genetic relatedness of M. equinum and T. equinum and confirm the value of DNA sequencing in identification of these two dermatophytes.

  20. An anther-specific chalcone synthase-like gene D5 related to rice pollen development

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    It was shown in a previous analysis that D5 gene from rice (Oryza sativa L.) was an anther-specific gene encoding a chalcone synthase-related protein. In this study, D5 gene was found specifically expressed in tapetum cells as well as in the peripheral cells of the vascular bundle of rice anthers by RNA in situ hybridization. In order to study its function, D5 was transformed into rice in both sense and antisense directions driven by a rice Actin 1 promoter. It has been observed that the pollen grains from the antisense D5 transgenic rice plants are abnormal, indicating that D5 plays a critical role in rice pollen development.

  1. Exploration of geosmin synthase from Streptomyces peucetius ATCC 27952 by deletion of doxorubicin biosynthetic gene cluster.

    Science.gov (United States)

    Singh, Bijay; Oh, Tae-Jin; Sohng, Jae Kyung

    2009-10-01

    Thorough investigation of Streptomyces peucetius ATCC 27952 genome revealed a sesquiterpene synthase, named spterp13, which encodes a putative protein of 732 amino acids with significant similarity to S. avermitilis MA-4680 (SAV2163, GeoA) and S. coelicolor A3(2) (SCO6073). The proteins encoded by SAV2163 and SCO6073 produce geosmin in the respective strains. However, the spterp13 gene seemed to be silent in S. peucetius. Deletion of the doxorubicin gene cluster from S. peucetius resulted in increased cell growth rate along with detectable production of geosmin. When we over expressed the spterp13 gene in S. peucetius DM07 under the control of an ermE* promoter, 2.4 +/- 0.4-fold enhanced production of geosmin was observed.

  2. A comparative analysis of the plant cellulose synthase (CesA) gene family.

    Science.gov (United States)

    Holland, N; Holland, D; Helentjaris, T; Dhugga, K S; Xoconostle-Cazares, B; Delmer, D P

    2000-08-01

    CesA genes are believed to encode the catalytic subunit of cellulose synthase. Identification of nine distinct CesA cDNAs from maize (Zea mays) has allowed us to initiate comparative studies with homologs from Arabidopsis and other plant species. Mapping studies show that closely related CesA genes are not clustered but are found at different chromosomal locations in both Arabidopsis and maize. Furthermore, sequence comparisons among the CesA-deduced proteins show that these cluster in groups wherein orthologs are often more similar than paralogs, indicating that different subclasses evolved prior to the divergence of the monocot and dicot lineages. Studies using reverse transcriptase polymerase chain reaction with gene-specific primers for six of the nine maize genes indicate that all genes are expressed to at least some level in all of the organs examined. However, when expression patterns for a few selected genes from maize and Arabidopsis were analyzed in more detail, they were found to be expressed in unique cell types engaged in either primary or secondary wall synthesis. These studies also indicate that amino acid sequence comparisons, at least in some cases, may have value for prediction of such patterns of gene expression. Such analyses begin to provide insights useful for future genetic engineering of cellulose deposition, in that identification of close orthologs across species may prove useful for prediction of patterns of gene expression and may also aid in prediction of mutant combinations that may be necessary to generate severe phenotypes.

  3. Cloning and functional analysis of the second geranylgeranyl diphosphate synthase gene influencing helvolic acid biosynthesis in Metarhizium anisopliae.

    Science.gov (United States)

    Singkaravanit, Suthitar; Kinoshita, Hiroshi; Ihara, Fumio; Nihira, Takuya

    2010-07-01

    A gene (ggs2) having high similarity to the geranylgeranyl diphosphate synthase (GGPP synthase) gene was cloned from Metarhizium anisopliae NAFF635007. The ggs2 gene (1,239-bp open reading frame with no intron) encoded a protein of 412 amino acids, and the transcription occurred only after late log-phase during the growth. Gene disruption of ggs2, performed to clarify the function in M. anisopliae, resulted in decreased GGPP synthase activity together with a slight delay of sporulation. An high performance liquid chromatography (HPLC) comparison of compound profiles between the wild-type strain and the disruptant revealed that a compound was abolished by the ggs2 disruption. Purification and structural elucidation by 1H-NMR and mass spectrometry analyses revealed that the lost compound is helvolic acid. Furthermore, the pathogenicity assay against two species of insect larvae revealed that the ggs2-disruptant possessed much weaker toxicity than the wild-type strain. Based on these results, it was concluded that ggs2 encodes the GGPP synthase influencing the biosynthesis of secondary metabolites in various species, including helvolic acid in M. anisopliae. To the best of our knowledge, this is the first report to identify a GGPP synthase gene related to secondary metabolism in entomopathogenic fungi.

  4. NMR studies on mechanism of isomerisation of fructose 6-phosphate to glucose 6-phosphate catalysed by phosphoglucose isomerase from Thermococcus kodakarensis.

    Science.gov (United States)

    Abbas, Shahzada Nadeem; Mok, Kenneth Hun; Rashid, Naeem; Xie, Yongjing; Ruether, Manuel; O'Brien, John; Akhtar, Muhammad

    2016-06-01

    The fate of hydrogen atoms at C-2 of glucose 6-phosphate (G6P) and C-1 of fructose 6-phosphate (F6P) was studied in the reaction catalysed by phosphoglucose isomerase from Thermococcus kodakarensis (TkPGI) through 1D and 2D NMR methods. When the reaction was performed in (2)H2O the hydrogen atoms in the aforementioned positions were exchanged with deuterons indicating that the isomerization occurred by a cis-enediol intermediate involving C-1 pro-R hydrogen of F6P. These features are similar to those described for phosphoglucose isomerases from rabbit muscle and Pyrococcus furiosus.

  5. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae: combinatorial expression of the five PRS genes in Escherichia coli.

    Science.gov (United States)

    Hove-Jensen, Bjarne

    2004-09-24

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS gene product had no PRPP synthase activity. In contrast, expression of five pairwise combinations of PRS genes resulted in the formation of active PRPP synthase. These combinations were PRS1 PRS2, PRS1 PRS3, and PRS1 PRS4, as well as PRS5 PRS2 and PRS5 PRS4. None of the remaining five possible pairwise combinations of PRS genes appeared to produce active enzyme. Extract of an E. coli strain containing a plasmid-borne PRS1 gene and a chromosome-borne PRS3 gene contained detectable PRPP synthase activity, whereas extracts of strains containing PRS1 PRS2, PRS1 PRS4, PRS5 PRS2, or PRS5 PRS4 contained no detectable PRPP synthase activity. In contrast PRPP could be detected in growing cells containing PRS1 PRS2, PRS1 PRS3, PRS5 PRS2, or PRS5 PRS4. These apparent conflicting results indicate that, apart from the PRS1 PRS3-specified enzyme, PRS-specified enzyme is functional in vivo but unstable when released from the cell. Certain combinations of three PRS genes appeared to produce an enzyme that is stable in vitro. Thus, extracts of strains harboring PRS1 PRS2 PRS5, PRS1 PRS4 PRS5, or PRS2 PRS4 PRS5 as well as extracts of strains harboring combinations with PRS1 PRS3 contained readily assayable PRPP synthase activity. The data indicate that although certain pairwise combinations of subunits produce an active enzyme, yeast PRPP synthase requires at least three different subunits to be stable in vitro. The activity of PRPP synthases containing subunits 1 and 3 or subunits 1, 2, and 5 was found to be dependent on Pi, to be temperature-sensitive, and inhibited by ADP.

  6. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Evolution of the chitin synthase gene family correlates with fungal morphogenesis and adaption to ecological niches

    Science.gov (United States)

    Liu, Ran; Xu, Chuan; Zhang, Qiangqiang; Wang, Shiyi; Fang, Weiguo

    2017-01-01

    The fungal kingdom potentially has the most complex chitin synthase (CHS) gene family, but evolution of the fungal CHS gene family and its diversification to fulfill multiple functions remain to be elucidated. Here, we identified the full complement of CHSs from 231 fungal species. Using the largest dataset to date, we characterized the evolution of the fungal CHS gene family using phylogenetic and domain structure analysis. Gene duplication, domain recombination and accretion are major mechanisms underlying the diversification of the fungal CHS gene family, producing at least 7 CHS classes. Contraction of the CHS gene family is morphology-specific, with significant loss in unicellular fungi, whereas family expansion is lineage-specific with obvious expansion in early-diverging fungi. ClassV and ClassVII CHSs with the same domain structure were produced by the recruitment of domains PF00063 and PF08766 and subsequent duplications. Comparative analysis of their functions in multiple fungal species shows that the emergence of ClassV and ClassVII CHSs is important for the morphogenesis of filamentous fungi, development of pathogenicity in pathogenic fungi, and heat stress tolerance in Pezizomycotina fungi. This work reveals the evolution of the fungal CHS gene family, and its correlation with fungal morphogenesis and adaptation to ecological niches. PMID:28300148

  8. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.

    Science.gov (United States)

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-02-01

    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  9. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.)

    Indian Academy of Sciences (India)

    Fupeng Li; Chaoyun Hao; Lin Yan; Baoduo Wu; Xiaowei Qin; Jianxiong Lai; Yinghui Song

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  10. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  11. (E)-β-farnesene synthase genes affect aphid (Myzus persicae) infestation in tobacco (Nicotiana tabacum).

    Science.gov (United States)

    Yu, Xiudao; Jones, Huw D; Ma, Youzhi; Wang, Genping; Xu, Zhaoshi; Zhang, Baoming; Zhang, Yongjun; Ren, Guangwei; Pickett, John A; Xia, Lanqin

    2012-03-01

    Aphids are major agricultural pests which cause significant yield losses of the crop plants each year. (E)-β-farnesene (EβF) is the alarm pheromone involved in the chemical communication between aphids and particularly in the avoidance of predation. In the present study, two EβF synthase genes were isolated from sweet wormwood and designated as AaβFS1 and AaβFS2, respectively. Overexpression of AaβFS1 or AaβFS2 in tobacco plants resulted in the emission of EβF ranging from 1.55 to 4.65 ng/day/g fresh tissues. Tritrophic interactions involving the peach aphids (Myzus persicae), predatory lacewings (Chrysopa septempunctata) demonstrated that the transgenic tobacco expressing AaβFS1 and AaβFS2 could repel peach aphids, but not as strongly as expected. However, AaβFS1 and AaβFS2 lines exhibited strong and statistically significant attraction to lacewings. Further experiments combining aphids and lacewing larvae in an octagon arrangement showed transgenic tobacco plants could repel aphids and attract lacewing larvae, thus minimizing aphid infestation. Therefore, we demonstrated a potentially valuable strategy of using EβF synthase genes from sweet wormwood for aphid control in tobacco or other economic important crops in an environmentally benign way.

  12. Tracking sesamin synthase gene expression through seed maturity in wild and cultivated sesame species--a domestication footprint.

    Science.gov (United States)

    Pathak, N; Bhaduri, A; Bhat, K V; Rai, A K

    2015-09-01

    Sesamin and sesamolin are the major oil-soluble lignans present in sesame seed, having a wide range of biological functions beneficial to human health. Understanding sesame domestication history using sesamin synthase gene expression could enable delineation of the sesame putative progenitor. This report examined the functional expression of sesamin synthase (CYP81Q1) during capsule maturation (0-40 days after flowering) in three wild Sesamum species and four sesame cultivars. Among the cultivated accessions, only S. indicum (CO-1) exhibited transcript abundance of sesamin synthase along with high sesamin content similar to S. malabaricum, while the other cultivated sesame showed low expression. The sesamin synthase expression analysis, coupled with quantification of sesamin level, indicates that sesamin synthase was not positively favoured during domestication. The sesamin synthase expression pattern and lignan content, along with phylogenetic analysis suggested a close relationship of cultivated sesame and the wild species S. malabaricum. The high genetic identity between the two species S. indicum and S. malabaricum points towards the role of the putative progenitor S. malabaricum in sesame breeding programmes to broaden the genetic base of sesame cultivars. This study emphasises the need to investigate intraspecific and interspecific variation in the primary, secondary and tertiary gene pools to develop superior sesame genotypes. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.

  13. Insect attack and wounding induce traumatic resin duct development and gene expression of (-)-pinene synthase in Sitka spruce.

    Science.gov (United States)

    McKay, S Ashley Byun; Hunter, William L; Godard, Kimberley-Ann; Wang, Shawn X; Martin, Diane M; Bohlmann, Jörg; Plant, Aine L

    2003-09-01

    Conifers possess inducible terpenoid defense systems. These systems are associated with the formation of traumatic resin ducts (TRD) and are underpinned by enhanced gene expression and activity of terpene synthases (TPS), enzymes responsible for oleoresin formation. We first determined that Sitka spruce (Picea sitchensis [Bong.] Carriere) had the capacity for TRD formation by mechanically wounding representative trees. We then proceeded to investigate whether the white pine weevil (Pissodes strobi Peck.), a stem-boring insect, can influence the expression of genes encoding monoterpene synthases (mono-tps) in Sitka spruce. We went on to compare this response with the effects of a simulated insect attack by drill wounding. A significant increase in mono-tps transcript level was observed in the leaders of lateral branches of weevil-attacked and mechanically wounded trees. In this study, weevils induced a more rapid enhancement of mono-tps gene expression. A full-length Sitka spruce mono-tps cDNA (PsTPS2) was isolated, expressed in Escherichia coli, and functionally identified as (-)-pinene synthase. The recombinant (-)-pinene synthase catalyzes the formation of (-)-alpha-pinene and (-)-beta-pinene, both of which are known constituents of stem oleoresin in Sitka spruce and increase in abundance after weevil attack. These data suggest that increased (-)-pinene synthase gene expression is an important element of the direct defense system deployed in Sitka spruce after insect attack.

  14. Comparative Genomic Analysis Revealed a Gene for Monoglucosyldiacylglycerol Synthase, an Enzyme for Photosynthetic Membrane Lipid Synthesis in Cyanobacteria1

    Science.gov (United States)

    Awai, Koichiro; Kakimoto, Takatoshi; Awai, Chie; Kaneko, Takakazu; Nakamura, Yuki; Takamiya, Ken-ichiro; Wada, Hajime; Ohta, Hiroyuki

    2006-01-01

    Cyanobacteria have a thylakoid lipid composition very similar to that of plant chloroplasts, yet cyanobacteria are proposed to synthesize monogalactosyldiacylglycerol (MGDG), a major membrane polar lipid in photosynthetic membranes, by a different pathway. In addition, plant MGDG synthase has been cloned, but no ortholog has been reported in cyanobacterial genomes. We report here identification of the gene for monoglucosyldiacylglycerol (MGlcDG) synthase, which catalyzes the first step of galactolipid synthesis in cyanobacteria. Using comparative genomic analysis, candidates for the gene were selected based on the criteria that the enzyme activity is conserved between two species of cyanobacteria (unicellular [Synechocystis sp. PCC 6803] and filamentous [Anabaena sp. PCC 7120]), and we assumed three characteristics of the enzyme; namely, it harbors a glycosyltransferase motif, falls into a category of genes with unknown function, and shares significant similarity in amino acid sequence between these two cyanobacteria. By a motif search of all genes of Synechocystis, BLAST searches, and similarity searches between these two cyanobacteria, we identified four candidates for the enzyme that have all the characteristics we predicted. When expressed in Escherichia coli, one of the Synechocystis candidate proteins showed MGlcDG synthase activity in a UDP-glucose-dependent manner. The ortholog in Anabaena also showed the same activity. The enzyme was predicted to require a divalent cation for its activity, and this was confirmed by biochemical analysis. The MGlcDG synthase and the plant MGDG synthase shared low similarity, supporting the presumption that cyanobacteria and plants utilize different pathways to synthesize MGDG. PMID:16714404

  15. Transcriptional regulation of the genes encoding chitin and β-1,3-glucan synthases from Ustilago maydis.

    Science.gov (United States)

    Robledo-Briones, Mariana; Ruiz-Herrera, José

    2012-07-01

    Transcriptional regulation of genes encoding chitin synthases (CHS) and β-1,3-glucan synthase (GLS) from Ustilago maydis was studied. Transcript levels were measured during the growth curve of yeast and mycelial forms, in response to ionic and osmotic stress, and during infection of maize plants. Expression of the single GLS gene was constitutive. In contrast, CHS genes expression showed differences depending on environmental conditions. Transcript levels were slightly higher in the mycelial forms, the highest levels occurring at the log phase. Ionic and osmotic stress induced alterations in the expression of CHS genes, but not following a defined pattern, some genes were induced and others repressed by the tested compounds. Changes in transcripts were more apparent during the pathogenic process. At early infection stages, only CHS6 gene showed significant transcript levels, whereas at the period of tumor formation CHS7 and CHS8 genes were also were induced.

  16. Morphological changes induced by class III chitin synthase gene silencing could enhance penicillin production of Penicillium chrysogenum.

    Science.gov (United States)

    Liu, Hui; Zheng, Zhiming; Wang, Peng; Gong, Guohong; Wang, Li; Zhao, Genhai

    2013-04-01

    Chitin synthases catalyze the formation of β-(1,4)-glycosidic bonds between N-acetylglucosamine residues to form the unbranched polysaccharide chitin, which is the major component of cell walls in most filamentous fungi. Several studies have shown that chitin synthases are structurally and functionally divergent and play crucial roles in the growth and morphogenesis of the genus Aspergillus although little research on this topic has been done in Penicillium chrysogenum. We used BLAST to find the genes encoding chitin synthases in P. chrysogenum related to chitin synthase genes in Aspergillus nidulans. Three homologous sequences coding for a class III chitin synthase CHS4 and two hypothetical proteins in P. chrysogenum were found. The gene which product showed the highest identity and encoded the class III chitin synthase CHS4 was studied in detail. To investigate the role of CHS4 in P. chrysogenum morphogenesis, we developed an RNA interference system to silence the class III chitin synthase gene chs4. After transformation, mutants exhibited a slow growth rate and shorter and more branched hyphae, which were distinct from those of the original strain. The results also showed that the conidiation efficiency of all transformants was reduced sharply and indicated that chs4 is essential in conidia development. The morphologies of all transformants and the original strain in penicillin production were investigated by light microscopy, which showed that changes in chs4 expression led to a completely different morphology during fermentation and eventually caused distinct penicillin yields, especially in the transformants PcRNAi1-17 and PcRNAi2-1 where penicillin production rose by 27 % and 41 %, respectively.

  17. Multiple independent fusions of glucose-6-phosphate dehydrogenase with enzymes in the pentose phosphate pathway.

    Directory of Open Access Journals (Sweden)

    Nicholas A Stover

    Full Text Available Fusions of the first two enzymes in the pentose phosphate pathway, glucose-6-phosphate dehydrogenase (G6PD and 6-phosphogluconolactonase (6PGL, have been previously described in two distant clades, chordates and species of the malarial parasite Plasmodium. We have analyzed genome and expressed sequence data from a variety of organisms to identify the origins of these gene fusion events. Based on the orientation of the domains and range of species in which homologs can be found, the fusions appear to have occurred independently, near the base of the metazoan and apicomplexan lineages. Only one of the two metazoan paralogs of G6PD is fused, showing that the fusion occurred after a duplication event, which we have traced back to an ancestor of choanoflagellates and metazoans. The Plasmodium genes are known to contain a functionally important insertion that is not seen in the other apicomplexan fusions, highlighting this as a unique characteristic of this group. Surprisingly, our search revealed two additional fusion events, one that combined 6PGL and G6PD in an ancestor of the protozoan parasites Trichomonas and Giardia, and another fusing G6PD with phosphogluconate dehydrogenase (6PGD in a species of diatoms. This study extends the range of species known to contain fusions in the pentose phosphate pathway to many new medically and economically important organisms.

  18. A New Farnesyl Diphosphate Synthase Gene from Taxus media Rehder: Cloning, Characterization and Functional Complementation

    Institute of Scientific and Technical Information of China (English)

    Zhi-Hua Liao; Min Chen; Yi-Fu Gong; Zhu-Gang Li; Kai-Jing Zuo; Peng Wang; Feng Tan; Xiao-Fen Sun; Ke-Xuan Tang

    2006-01-01

    Farnesyl diphosphate synthase (FPS; EC 2.5.1.10) catalyzes the production of 15-carbon farnesyl diphosphate which is a branch-point intermediate for many terpenoids. This reaction is considered to be a ratelimiting step in terpenoid biosynthesis. Here we report for the first time the cloning of a new full-length cDNA encoding farnesyl diphosphate synthase from a gymnosperm plant species, Taxus media Rehder,designated as TmFPS1. The full-length cDNA of TmFPS1 (GenBank accession number: AY461811) was 1 464bp with a 1 056-bp open reading frame encoding a 351-amino acid polypeptide with a calculated molecular weight of 40.3 kDa and a theoretical pl of 5.07. Bioinformatic analysis revealed that TmFPS1 contained all five conserved domains of prenyltransferases, and showed homology to other FPSs of plant origin. Phylogenetic analysis showed that farnesyl diphosphate synthases can be divided into two groups: one of prokaryotic origin and the other of eukaryotic origin. TmFPS1 was grouped with FPSs of plant origin. Homologybased structural modeling showed that TmFPS1 had the typical spatial structure of FPS, whose most prominent structural feature is the arrangement of 13 core helices around a large central cavity in which the catalytic reaction takes place. Our bioinformatic analysis strongly suggests that TmFPS1 is a functional gene. Southern blot analysis revealed that TmFPS1 belongs to a small FPS gene family in T. media. Northern blot analysis indicated that TmFPS1 is expressed in all tested tissues, including the needles, stems and roots of T. media. Subsequently, functional complementation with TmFPS1 in a FPS-deficient mutant yeast demonstrated that TmFPS1 did encode farnesyl diphosphate synthase, which rescued the yeast mutant.This study will be helpful in future investigations aiming at understanding the detailed role of FPS in terpenoid biosynthesis flux control at the molecular genetic level.

  19. Mutant acetolactate synthase (ALS) gene as a selectable marker for Agrobacterium-mediated transformation of soybean

    Institute of Scientific and Technical Information of China (English)

    Chen Shiyun; Zhang Yong

    2006-01-01

    Soybean is one of the crops most difficult to be manipulated in vitro. Although several soybean transformation systems with different selectable marker genes have been reported, e.g. antibiotic (kanamycin or hygromycin) resistant genes and herbicide ( glufosinate, glyphosate) resistant selectable marker genes, all the selectable markers used were from bacteria origin. To find suitable selectable marker gene from plant origin for soybean transformation, a mutant acetolactate synthase (ALS) gene from Arabidopsis thaliana was tested for Agrobacterium-mediated soybean embryo axis transformation with the herbicide Arsenal as the selective agent. Transgenic soybean plants were obtained after the herbicide selection and the To transgenic lines showed resistance to the herbicide at a concentration of 100 g/ha. ALS enzyme assay of To transgenic line also showed higher activity compared to the wild type control plant.PCR analysis of the T1 transgenic lines confirmed the integration and segregation of the transgene. Taken together, our results showed that the mutant ALS gene is a suitable selectable marker for soybean transformation.

  20. Glucose-6-Phosphate Dehydrogenase deficiency presented with convulsion: a rare case

    Directory of Open Access Journals (Sweden)

    Alparslan Merdin

    2014-03-01

    Full Text Available Red blood cells carry oxygen in the body and Glucose-6-Phosphate Dehydrogenase protects these cells from oxidative chemicals. If there is a lack of Glucose-6-Phosphate Dehydrogenase, red blood cells can go acute hemolysis. Convulsion is a rare presentation for acute hemolysis due to Glucose-6-Phosphate Dehydrogenase deficiency. Herein, we report a case report of a Glucose-6-Phosphate Dehydrogenase deficiency diagnosed patient after presentation with convulsion. A 70 year-old woman patient had been hospitalized because of convulsion and fatigue. She has not had similar symptoms before. She had ingested fava beans in the last two days. Her hypophyseal and brain magnetic resonance imaging were normal. Blood transfusion was performed and the patient recovered.

  1. Characterization of a Chitin Synthase Encoding Gene and Effect of Diflubenzuron in Soybean Aphid, Aphis Glycines

    Directory of Open Access Journals (Sweden)

    Raman Bansal, M. A. Rouf Mian, Omprakash Mittapalli, Andy P. Michel

    2012-01-01

    Full Text Available Chitin synthases are critical enzymes for synthesis of chitin and thus for subsequent growth and development in insects. We identified the cDNA of chitin synthase gene (CHS in Aphis glycines, the soybean aphid, which is a serious pest of soybean. The full-length cDNA of CHS in A. glycines (AyCHS was 5802 bp long with an open reading frame of 4704 bp that encoded for a 1567 amino acid residues protein. The predicted AyCHS protein had a molecular mass of 180.05 kDa and its amino acid sequence contained all the signature motifs (EDR, QRRRW and TWGTR of chitin synthases. The quantitative real-time PCR (qPCR analysis revealed that AyCHS was expressed in all major tissues (gut, fat body and integument; however, it had the highest expression in integument (~3.5 fold compared to gut. Interestingly, the expression of AyCHS in developing embryos was nearly 7 fold higher compared to adult integument, which probably is a reflection of embryonic molts in hemimetabolus insects. Expression analysis in different developmental stages of A. glycines revealed a consistent AyCHS expression in all stages. Further, through leaf dip bioassay, we tested the effect of diflubenzuron (DFB, Dimilin ®, a chitin-synthesis inhibitor, on A. glycines' survival, fecundity and body weight. When fed with soybean leaves previously dipped in 50 ppm DFB solution, A. glycines nymphs suffered significantly higher mortality compared to control. A. glycines nymphs feeding on diflubenzuron treated leaves showed a slightly enhanced expression (1.67 fold of AyCHS compared to nymphs on untreated leaves. We discussed the potential applications of the current study to develop novel management strategies using chitin-synthesis inhibitors and using RNAi by knocking down AyCHS expression.

  2. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    Science.gov (United States)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-07

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  3. Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

    Directory of Open Access Journals (Sweden)

    Chen Aiqun

    2012-06-01

    Full Text Available Abstract Background In plants, sucrose synthase (Sus is widely considered as a key enzyme involved in sucrose metabolism. Several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, while limited information of Sus genes is available to date for cotton. Results Here, we report the molecular cloning, structural organization, phylogenetic evolution and expression profiles of seven Sus genes (GaSus1 to 7 identified from diploid fiber cotton (Gossypium arboreum. Comparisons between cDNA and genomic sequences revealed that the cotton GaSus genes were interrupted by multiple introns. Comparative screening of introns in homologous genes demonstrated that the number and position of Sus introns are highly conserved among Sus genes in cotton and other more distantly related plant species. Phylogenetic analysis showed that GaSus1, GaSus2, GaSus3, GaSus4 and GaSus5 could be clustered together into a dicot Sus group, while GaSus6 and GaSus7 were separated evenly into other two groups, with members from both dicot and monocot species. Expression profiles analyses of the seven Sus genes indicated that except GaSus2, of which the transcripts was undetectable in all tissues examined, and GaSus7, which was only expressed in stem and petal, the other five paralogues were differentially expressed in a wide ranges of tissues, and showed development-dependent expression profiles in cotton fiber cells. Conclusions This is a comprehensive study of the Sus gene family in cotton plant. The results presented in this work provide new insights into the evolutionary conservation and sub-functional divergence of the cotton Sus gene family in response to cotton fiber growth and development.

  4. Tissue specificity and diurnal change in gene expression of the sucrose phosphate synthase gene family in rice.

    Science.gov (United States)

    Okamura, Masaki; Aoki, Naohiro; Hirose, Tatsuro; Yonekura, Madoka; Ohto, Chikara; Ohsugi, Ryu

    2011-08-01

    The rice genome contains 5 isogenes for sucrose phosphate synthase (SPS), the key enzyme in sucrose synthesis; however, little is known about their transcriptional regulation. In order to determine the expression patterns of the SPS gene family in rice plants, we conducted an expression analysis in various tissues and developmental stages by real-time quantitative RT-PCR. At the transcript level, the rice SPS genes, particularly SPS1, were preferentially expressed in source tissues, whereas SPS2, SPS6, and SPS8 were expressed equally in source and sink tissues. We also investigated diurnal changes in SPS gene expression, SPS activity, and soluble sugar content in leaf blades. Interestingly, the expression of all the SPS genes, particularly that of SPS1 and SPS11, tended to be higher at night when the activation state of the SPS proteins was low, and the mRNA levels of SPS1 and SPS6 were negatively correlated with sucrose content. Furthermore, the temporal patterns of SPS gene expression and sugar content under continuous light conditions suggested the involvement of endogenous rhythm and/or sucrose sensing in the transcriptional regulation of SPS genes. Our data revealed differential expression patterns in the rice SPS gene family and part of the complex mechanisms of their transcriptional control.

  5. Differential expression of fatty acid synthase genes, Acl, Fat and Kas, in Capsicum fruit.

    Science.gov (United States)

    Aluru, Maneesha R; Mazourek, Michael; Landry, Laurie G; Curry, Jeanne; Jahn, Molly; O'Connell, Mary A

    2003-07-01

    The biosynthesis of capsaicinoids in the placenta of chilli fruit is modelled to require components of the fatty acid synthase (FAS) complex. Three candidate genes for subunits in this complex, Kas, Acl, and Fat, isolated based on differential expression, were characterized. Transcription of these three genes was placental-specific and RNA abundance was positively correlated with degree of pungency. Kas and Acl were mapped to linkage group 1 and Fat to linkage group 6. None of the genes is linked to the pungency locus, C, on linkage group 2. KAS accumulation was positively correlated with pungency. Western blots of placental extracts and histological sections both demonstrated that the accumulation of this enzyme was correlated with fruit pungency and KAS was immunolocalized to the expected cell layer, the placental epidermis. Enzyme activity of the recombinant form of the placental-specific KAS was confirmed using crude cell extracts. These FAS components are fruit-specific members of their respective gene families. These genes are predicted to be associated with Capsicum fruit traits, for example, capsaicinoid biosynthesis or fatty acid biosynthesis necessary for placental development.

  6. Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

    Science.gov (United States)

    Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi, Naoki; Shigyo, Masayoshi

    2012-06-01

    Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum-shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F(2) mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5.

  7. Identification of regulatory sequences in the gene for 5-aminolevulinate synthase from rat.

    Science.gov (United States)

    Braidotti, G; Borthwick, I A; May, B K

    1993-01-15

    The housekeeping enzyme 5-aminolevulinate synthase (ALAS) regulates the supply of heme for respiratory cytochromes. Here we report on the isolation of a genomic clone for the rat ALAS gene. The 5'-flanking region was fused to the chloramphenicol acetyltransferase gene and transient expression analysis revealed the presence of both positive and negative cis-acting sequences. Expression was substantially increased by the inclusion of the first intron located in the 5'-untranslated region. Sequence analysis of the promoter identified two elements at positions -59 and -88 bp with strong similarity to the binding site for nuclear respiratory factor 1 (NRF-1). Gel shift analysis revealed that both NRF-1 elements formed nucleoprotein complexes which could be abolished by an authentic NRF-1 oligomer. Mutagenesis of each NRF-1 motif in the ALAS promoter gave substantially lowered levels of chloramphenicol acetyltransferase expression, whereas mutagenesis of both NRF-1 motifs resulted in the almost complete loss of expression. These results establish that the NRF-1 motifs in the ALAS promoter are critical for promoter activity. NRF-1 binding sites have been identified in the promoters of several nuclear genes encoding mitochondrial proteins concerned with oxidative phosphorylation. The present studies suggest that NRF-1 may co-ordinate the supply of mitochondrial heme with the synthesis of respiratory cytochromes by regulating expression of ALAS. In erythroid cells, NRF-1 may be less important for controlling heme levels since an erythroid ALAS gene is strongly expressed and the promoter for this gene apparently lacks NRF-1 binding sites.

  8. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  9. Gene expression of two kinds of constitutive nitric oxide synthase in injured spinal cord tissue

    Institute of Scientific and Technical Information of China (English)

    刘成龙; 靳安民; 周初松; 闵少雄

    2002-01-01

    Objective: To investigate the gene expression of two kinds of constitutive nitric oxide synthase (cNOS): neuronal NOS (nNOS) and endothelial NOS (eNOS) in injured spinal cord tissue.   Methods: Thirty-six adult Sprague-Dawley rats were divided randomly into six groups: the normal group and the injury groups (2, 6, 12, 24, 48 h after injury, respectively). A compression injury model of the spinal cord was made and gene expression of nNOS and eNOS were examined by reverse transcription polymerase chain reaction (RT-PCR).   Results: The gene expression of nNOS and eNOS was detected in the normal group and they were up-regulated quickly after injury, reaching the maximum at 6 h. There was no difference between gene expression of nNOS and eNOS in the normal group, but in each injury group the gene expression of eNOS was much higher than that of nNOS.   Conclusions: Expression of constitutive NOS (cNOS) in spinal cord tissue was up-regulated after injury mainly in the early stage. cNOS as a whole offers protection in spinal cord injury, but different cNOS may play different roles.

  10. The cellulose synthase (CESA) gene superfamily of the moss Physcomitrella patens.

    Science.gov (United States)

    Roberts, Alison W; Bushoven, John T

    2007-01-01

    The CESA gene superfamily of Arabidopsis and other seed plants comprises the CESA family, which encodes the catalytic subunits of cellulose synthase, and eight families of CESA-like (CSL) genes whose functions are largely unknown. The CSL genes have been proposed to encode processive beta-glycosyl transferases that synthesize noncellulosic cell wall polysaccharides. BLAST searches of EST and shotgun genomic sequences from the moss Physcomitrella patens (Hedw.) B.S.G. were used to identify genes with high similarity to vascular plant CESAs, CSLAs, CSLCs, and CSLDs. However, searches using Arabidopsis CSLBs, CSLEs, and CSLGs or rice CSLFs or CSLHs as queries identified no additional CESA superfamily members in P. patens, indicating that this moss lacks representatives of these families. Intron insertion sites are highly conserved between Arabidopsis and P. patens in all four shared gene families. However, phylogenetic analysis strongly supports independent diversification of the shared families in mosses and vascular plants. The lack of orthologs of vascular plant CESAs in the P. patens genome indicates that the divergence of mosses and vascular plants predated divergence and specialization of CESAs for primary and secondary cell wall syntheses and for distinct roles within the rosette terminal complexes. In contrast to Arabidopsis, the CSLD family is highly represented among P. patens ESTs. This is consistent with the proposed function of CSLDs in tip growth and the central role of tip growth in the development of the moss protonema.

  11. Positive selection and functional divergence of farnesyl pyrophosphate synthase genes in plants.

    Science.gov (United States)

    Qian, Jieying; Liu, Yong; Chao, Naixia; Ma, Chengtong; Chen, Qicong; Sun, Jian; Wu, Yaosheng

    2017-02-04

    Farnesyl pyrophosphate synthase (FPS) belongs to the short-chain prenyltransferase family, and it performs a conserved and essential role in the terpenoid biosynthesis pathway. However, its classification, evolutionary history, and the forces driving the evolution of FPS genes in plants remain poorly understood. Phylogeny and positive selection analysis was used to identify the evolutionary forces that led to the functional divergence of FPS in plants, and recombinant detection was undertaken using the Genetic Algorithm for Recombination Detection (GARD) method. The dataset included 68 FPS variation pattern sequences (2 gymnosperms, 10 monocotyledons, 54 dicotyledons, and 2 outgroups). This study revealed that the FPS gene was under positive selection in plants. No recombinant within the FPS gene was found. Therefore, it was inferred that the positive selection of FPS had not been influenced by a recombinant episode. The positively selected sites were mainly located in the catalytic center and functional areas, which indicated that the 98S and 234D were important positively selected sites for plant FPS in the terpenoid biosynthesis pathway. They were located in the FPS conserved domain of the catalytic site. We inferred that the diversification of FPS genes was associated with functional divergence and could be driven by positive selection. It was clear that protein sequence evolution via positive selection was able to drive adaptive diversification in plant FPS proteins. This study provides information on the classification and positive selection of plant FPS genes, and the results could be useful for further research on the regulation of triterpenoid biosynthesis.

  12. A transgenic Neospora caninum strain based on mutations of the dihydrofolate reductase-thymidylate synthase gene.

    Science.gov (United States)

    Pereira, Luiz Miguel; Baroni, Luciana; Yatsuda, Ana Patrícia

    2014-03-01

    Neospora caninum is an Apicomplexa parasite related to abortion and losses of fertility in cattle. The amenability of Toxoplasma gondii and Plasmodium to genetic manipulation offers several tools to determine the invasion and replication processes, which support posterior strategies related to the combat of these diseases. For Plasmodium the use of pyrimethamine as an auxiliary drug on malaria treatment has been affected by the rise of resistant strains and the analyses on Dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene indicated several point mutations. In this work we developed a method for stable insertion of genes based on resistance to pyrimethamine. For that, the coding sequence of NcDHFR-TS (Dihydrofolate reductase-thymidylate synthase) was point mutated in two amino acids, generating DHFRM2M3. The DHFRM2M3 flanked by the promoter and 3'UTR of Ncdhfr-ts (Ncdhfr-DHFRM2M3) conferred resistance to pyrimethamine after transfection. For illustration of stability and expression, the cassette Ncdhfr-DHFRM2M3 was ligated to the reporter gene Lac-Z (β-galactosidase enzyme) controlled by the N. caninum tubulin promoter and was transfected and selected in N. caninum. The cassette was integrated into the genome and the selected tachyzoites expressed Lac-Z, allowing the detection of tachyzoites by the CPRG reaction and X-gal precipitation. The obtainment of transgenic N. caninum resistant to pyrimethamine confirms the effects on DHFR-TS among the Apicomplexa members and will support future approaches on pholate inhibitors for N. caninum prophylaxis. The construction of stable tachyzoites based on vectors with N. caninum promoters initiates the molecular manipulation of this parasite independently of T. gondii.

  13. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  14. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice.

    Science.gov (United States)

    Wang, Meng; Gruissem, Wilhelm; Bhullar, Navreet K

    2013-01-01

    Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  15. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice.

    Directory of Open Access Journals (Sweden)

    Shigang Zheng

    Full Text Available Resveratrol (Res is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS, existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering.

  16. Associations between nitric oxide synthase genes and exhaled NO-related phenotypes according to asthma status.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Bouzigon

    Full Text Available BACKGROUND: The nitric oxide (NO pathway is involved in asthma, and eosinophils participate in the regulation of the NO pool in pulmonary tissues. We investigated associations between single nucleotide polymorphisms (SNPs of NO synthase genes (NOS and biological NO-related phenotypes measured in two compartments (exhaled breath condensate and plasma and blood eosinophil counts. METHODOLOGY: SNPs (N = 121 belonging to NOS1, NOS2 and NOS3 genes were genotyped in 1277 adults from the French Epidemiological study on the Genetics and Environment of Asthma (EGEA. Association analyses were conducted on four quantitative phenotypes: the exhaled fraction of NO (Fe(NO, plasma and exhaled breath condensate (EBC nitrite-nitrate levels (NO2-NO3 and blood eosinophils in asthmatics and non-asthmatics separately. Genetic heterogeneity of these phenotypes between asthmatics and non-asthmatics was also investigated. PRINCIPAL FINDINGS: In non-asthmatics, after correction for multiple comparisons, we found significant associations of Fe(NO levels with three SNPs in NOS3 and NOS2 (P ≤ 0.002, and of EBC NO2-NO3 level with NOS2 (P = 0.002. In asthmatics, a single significant association was detected between Fe(NO levels and one SNP in NOS3 (P = 0.004. Moreover, there was significant heterogeneity of NOS3 SNP effect on Fe(NO between asthmatics and non-asthmatics (P = 0.0002 to 0.005. No significant association was found between any SNP and NO2-NO3 plasma levels or blood eosinophil counts. CONCLUSIONS: Variants in NO synthase genes influence Fe(NO and EBC NO2-NO3 levels in adults. These genetic determinants differ according to asthma status. Significant associations were only detected for exhaled phenotypes, highlighting the critical relevance to have access to specific phenotypes measured in relevant biological fluid.

  17. Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

    Directory of Open Access Journals (Sweden)

    Bhubalan, K.

    2010-01-01

    Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

  18. Heteroexpression of the wheat phytochelatin synthase gene (TaPCS1) in rice enhances cadmium sensitivity

    Institute of Scientific and Technical Information of China (English)

    Feijuan Wang; Zhubing Wang; Cheng Zhu

    2012-01-01

    Phytochelatin synthase (PCS) (EC 2.3.2.15) catalyzes the final step of phytochelatins (PCs) biosynthesis.PCs are a family of cysteine-rich thiol-reactive and heavy metalbinding peptides that play an important role in sequestration and detoxification of heavy metals in plants.Previous studies have indicated that plants that overexpressed PCS displayed contrasting phenotypes,ranging from enhanced cadmium (Cd) tolerance to Cd hypersensitivity in Arabidopsis thaliana.In this study,the wheat phytochelatin synthase gene,TaPCS1,was heteroexpressed in wildtype rice (Oryza sativa L.,cv.Zhonghua 11) to evaluate the relationship between synthesis of PCs and Cd tolerance in rice.Data showed that the heteroexpression of TaPCS1 in rice enhanced Cd sensitivity and significantly increased Cd accumulation in shoots,but not in roots.Additionally,the PCS line exhibited a much higher content of PCs and non-protein thiols (NPTs) in shoots.Prominent changes in NPT composition led to reduced glutathione pool depletion and higher Cd content in cell organelles in shoots,followed by higher oxidative stress,which might result in Cd sensitivity.Therefore,the heteroexpression of TaPCS1 in rice is capable of increasing Cd accumulation in rice shoots and enhancing Cd sensitivity.

  19. HIV-1 Nef binds with human GCC185 protein and regulates mannose 6 phosphate receptor recycling

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Manjeet; Kaur, Supinder; Nazir, Aamir; Tripathi, Raj Kamal, E-mail: rajkamalcdri@gmail.com

    2016-05-20

    HIV-1 Nef modulates cellular function that enhances viral replication in vivo which culminate into AIDS pathogenesis. With no enzymatic activity, Nef regulates cellular function through host protein interaction. Interestingly, trans-cellular introduction of recombinant Nef protein in Caenorhabditis elegans results in AIDS like pathogenesis which might share common pathophysiology because the gene sequence of C. elegans and humans share considerable homology. Therefore employing C. elegans based initial screen complemented with sequence based homology search we identified GCC185 as novel host protein interacting with HIV-1 Nef. The detailed molecular characterization revealed N-terminal EEEE{sub 65} acidic domain of Nef as key region for interaction. GCC185 is a tethering protein that binds with Rab9 transport vesicles. Our results show that Nef-GCC185 interaction disrupts Rab9 interaction resulting in delocalization of CI-MPR (cation independent Mannose 6 phosphate receptor) resulting in elevated secretion of hexosaminidase. In agreement with this, our studies identified novel host GCC185 protein that interacts with Nef EEEE65 acidic domain interfering GCC185-Rab9 vesicle membrane fusion responsible for retrograde vesicular transport of CI-MPR from late endosomes to TGN. In light of existing report suggesting critical role of Nef-GCC185 interaction reveals valuable mechanistic insights affecting specific protein transport pathway in docking of late endosome derived Rab9 bearing transport vesicle at TGN elucidating role of Nef during viral pathogenesis. -- Highlights: •Nef, an accessory protein of HIV-1 interacts with host factor and culminates into AIDS pathogenesis. •Using Caenorhabditis elegans based screen system, novel Nef interacting cellular protein GCC185 was identified. •Molecular characterization of Nef and human protein GCC185 revealed Nef EEEE{sub 65} key region interacted with full length GCC185. •Nef impeded the GCC185-Rab 9 interaction and

  20. Hypersensitive Response of Plasmid-Encoded AHL Synthase Gene to Lifestyle and Nutrient by Ensifer adhaerens X097

    Directory of Open Access Journals (Sweden)

    Yanhua Zeng

    2017-06-01

    Full Text Available It is known that some bacteria, especially members of the family Rhizobiaceae, have multiple N-acyl homoserine lactones (AHL synthase genes and produce multiple AHL signals. However, how bacteria selectively utilize these multiple genes and signals to cope with changing environments is poorly understood. Ensifer adhaerens is an important microorganism in terms of biotechnology, ecology and evolutionary. In this study, we investigated the AHL-based QS system of E. adhaerens X097 and its response to different lifestyles or nutrients. Draft genome sequence data indicated that X097 harbored three distinct AHL synthase genes (ensI1, 2, 3 and seven luxR homologs, which was different from other E. adhaerens strains. In vitro expression indicated that plasmid-encoded ensI1 and ensI2 directed production of multiple AHLs, while chromosome-encoded ensI3 only directed production of C14-HSL. Predicted three dimensional structure of EnsI3 was quite different from that of EnsI1 and EnsI2. X097 produced different AHL profiles in Luria-Bertani (LB and NFB medium, under biofilm and planktonic lifestyle, respectively. Notably, expression of ensI1 and ensI2 but not ensI3 is hypersensitive to different lifestyles and nutrients. The hypersensitive response of plasmid-encoded AHL synthase genes to different culture conditions may shed a light on the phylogenetic development of AHL synthase genes in Rhizobiaceae family.

  1. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency in south-east Sicily.

    Science.gov (United States)

    Cittadella, R; Civitelli, D; Manna, I; Azzia, N; Di Cataldo, A; Schilirò, G; Brancati, C

    1997-05-01

    In order to explore the nature of glucose-6-phosphate dehydrogenase (G6PD) deficiency in south-east Sicily, we have analysed the G6PD gene in 25 unrelated males with abnormal G6PD activity and/or electrophoretic mobility, by using the analysis of the appropriate PCR-amplified fragment of DNA and subsequent digestion by appropriate restriction-enzymes, looking for the presence of certain known G6PD mutations. We amplified the entire G6PD coding sequence into eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis and sequencing of those individual fragments that were found to be abnormal by SSCP. Through these methods we found a total of twelve G6PD Mediterranean variants with the association of a silent mutation 1311 (also known as polymorphic site Bcl I), one G6PD Mediterranean without this association, four G6PD A-Val 68 and two G6PD Santamaria and five G6PD Chatham. In a subject with normal activity a mutation was found in exon 5, designated as G6PD Sao Borja. This is the first report on the molecular analysis of G6PD mutations in Sicily and we have obtained evidence for four distinct classes of variants.

  2. Overexpression of glucose-6-phosphate dehydrogenase is associated with lipid dysregulation and insulin resistance in obesity.

    Science.gov (United States)

    Park, Jiyoung; Rho, Ho Kyung; Kim, Kang Ho; Choe, Sung Sik; Lee, Yun Sok; Kim, Jae Bum

    2005-06-01

    Glucose-6-phosphate dehydrogenase (G6PD) produces cellular NADPH, which is required for the biosynthesis of fatty acids and cholesterol. Although G6PD is required for lipogenesis, it is poorly understood whether G6PD in adipocytes is involved in energy homeostasis, such as lipid and glucose metabolism. We report here that G6PD plays a role in adipogenesis and that its increase is tightly associated with the dysregulation of lipid metabolism and insulin resistance in obesity. We observed that the enzymatic activity and expression levels of G6PD were significantly elevated in white adipose tissues of obese models, including db/db, ob/ob, and diet-induced obesity mice. In 3T3-L1 cells, G6PD overexpression stimulated the expression of most adipocyte marker genes and elevated the levels of cellular free fatty acids, triglyceride, and FFA release. Consistently, G6PD knockdown via small interfering RNA attenuated adipocyte differentiation with less lipid droplet accumulation. Surprisingly, the expression of certain adipocytokines such as tumor necrosis factor alpha and resistin was increased, whereas that of adiponectin was decreased in G6PD overexpressed adipocytes. In accordance with these results, overexpression of G6PD impaired insulin signaling and suppressed insulin-dependent glucose uptake in adipocytes. Taken together, these data strongly suggest that aberrant increase of G6PD in obese and/or diabetic subjects would alter lipid metabolism and adipocytokine expression, thereby resulting in failure of lipid homeostasis and insulin resistance in adipocytes.

  3. Glucosamine and glucosamine-6-phosphate derivatives: catalytic cofactor analogues for the glmS ribozyme.

    Science.gov (United States)

    Posakony, Jeffrey J; Ferré-D'Amaré, Adrian R

    2013-05-17

    Two analogues of glucosamine-6-phosphate (GlcN6P, 1) and five of glucosamine (GlcN, 2) were prepared for evaluation as catalytic cofactors of the glmS ribozyme, a bacterial gene-regulatory RNA that controls cell wall biosynthesis. Glucosamine and allosamine with 3-azido substitutions were prepared by SN2 reactions of the respective 1,2,4,6-protected sugars; final acidic hydrolysis afforded the fully deprotected compounds as their TFA salts. A 6-phospho-2-aminoglucolactam (31) was prepared from glucosamine in a 13-step synthesis, which included a late-stage POCl3-phosphorylation. A simple and widely applicable 2-step procedure with the triethylsilyl (TES) protecting group was developed to selectively expose the 6-OH group in N-protected glucosamine analogues, which provided another route to chemical phosphorylation. Mitsunobu chemistry afforded 6-cyano (35) and 6-azido (36) analogues of GlcN-(Cbz), and the selectivity for the 6-position was confirmed by NMR (COSY, HMBC, HMQC) experiments. Compound 36 was converted to the fully deprotected 6-azido-GlcN (37) and 2,6-diaminoglucose (38) analogues. A 2-hydroxylamino glucose (42) analogue was prepared via an oxaziridine (41). Enzymatic phosphorylation of 42 and chemical phosphorylation of its 6-OH precursor (43) were possible, but 42 and the 6-phospho product (44) were unstable under neutral or basic conditions. Chemical phosphorylation of the previously described 2-guanidinyl-glucose (46) afforded its 6-phospho analogue (49) after final deprotection.

  4. Metabolic impact of an NADH-producing glucose-6-phosphate dehydrogenase in Escherichia coli

    DEFF Research Database (Denmark)

    Olavarria, K.; De Ingeniis, J.; Zielinski, D. C.

    2014-01-01

    PDH(R46E,Q47E). Through homologous recombination, the zwf loci (encoding G6PDH) in the chromosomes of WT and Δpgi E. coli strains were replaced by DNA encoding LmG6PDH(R46E,Q47E). Contrary to some predictions performed with flux balance analysis, the replacements caused a substantial effect......, we studied the metabolic response of this bacterium to the replacement of its glucose-6-phosphate dehydrogenase (G6PDH) by an NADH-producing variant. The homologous enzyme from Leuconostoc mesenteroides was studied by molecular dynamics and site-directed mutagenesis to obtain the NAD-preferring LmG6...... on the growth rates, increasing 59 % in the Δpgi strain, while falling 44 % in the WT. Quantitative PCR (qPCR) analysis of the zwf locus showed that the expression level of the mutant enzyme was similar to the native enzyme and the expression of genes encoding key enzymes of the central pathways also showed...

  5. Molecular characterization of a German variant of glucose-6-phosphate dehydrogenase deficiency (G6PD Aachen).

    Science.gov (United States)

    Efferth, T; Osieka, R; Beutler, E

    2000-02-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-chromosome-linked hereditary disorder. Clinically, patients with G6PD deficiency often present with drug- or food-induced hemolytic crises or neonatal jaundice. G6PD is involved in the generation of NADPH and reduced glutathione. In contrast to American, Mediterranean, and African ancestries, only few variants are known from Middle and Northern Europe. We describe the molecular characterization of a distinct variant from the northwestern area of Germany, G6PD Aachen. The sequence of the G6PD gene from three afflicted males was found to be hemizygous at cDNA residue 1089 for a C-->G mutation with a predicted amino acid change of Asn363Lys. The 1089 C-->G point mutation is unique, but produces the identical amino acid change found in a Mexican variant of G6PD deficiency, G6PD Loma Linda. This G6PD-deficient variant is caused by a 1089 C-->A mutation. The 363-amino-acid replacement is located outside a known mutation cluster region between amino acid residues 380 and 450, but may disrupt or weaken dimer interactions of G6PD enzyme subunits. Copyright 2000 Academic Press.

  6. The Production and Utilization of GDP-glucose in the Biosynthesis of Trehalose 6-Phosphate by Streptomyces venezuelae*

    Science.gov (United States)

    Asención Diez, Matías D.; Miah, Farzana; Stevenson, Clare E. M.; Lawson, David M.; Iglesias, Alberto A.; Bornemann, Stephen

    2017-01-01

    Trehalose-6-phosphate synthase OtsA from streptomycetes is unusual in that it uses GDP-glucose as the donor substrate rather than the more commonly used UDP-glucose. We now confirm that OtsA from Streptomyces venezuelae has such a preference for GDP-glucose and can utilize ADP-glucose to some extent too. A crystal structure of the enzyme shows that it shares twin Rossmann-like domains with the UDP-glucose-specific OtsA from Escherichia coli. However, it is structurally more similar to Streptomyces hygroscopicus VldE, a GDP-valienol-dependent pseudoglycosyltransferase enzyme. Comparison of the donor binding sites reveals that the amino acids associated with the binding of diphosphoribose are almost all identical in these three enzymes. By contrast, the amino acids associated with binding guanine in VldE (Asn, Thr, and Val) are similar in S. venezuelae OtsA (Asp, Ser, and Phe, respectively) but not conserved in E. coli OtsA (His, Leu, and Asp, respectively), providing a rationale for the purine base specificity of S. venezuelae OtsA. To establish which donor is used in vivo, we generated an otsA null mutant in S. venezuelae. The mutant had a cell density-dependent growth phenotype and accumulated galactose 1-phosphate, glucose 1-phosphate, and GDP-glucose when grown on galactose. To determine how the GDP-glucose is generated, we characterized three candidate GDP-glucose pyrophosphorylases. SVEN_3027 is a UDP-glucose pyrophosphorylase, SVEN_3972 is an unusual ITP-mannose pyrophosphorylase, and SVEN_2781 is a pyrophosphorylase that is capable of generating GDP-glucose as well as GDP-mannose. We have therefore established how S. venezuelae can make and utilize GDP-glucose in the biosynthesis of trehalose 6-phosphate. PMID:27903647

  7. The Production and Utilization of GDP-glucose in the Biosynthesis of Trehalose 6-Phosphate by Streptomyces venezuelae.

    Science.gov (United States)

    Asención Diez, Matías D; Miah, Farzana; Stevenson, Clare E M; Lawson, David M; Iglesias, Alberto A; Bornemann, Stephen

    2017-01-20

    Trehalose-6-phosphate synthase OtsA from streptomycetes is unusual in that it uses GDP-glucose as the donor substrate rather than the more commonly used UDP-glucose. We now confirm that OtsA from Streptomyces venezuelae has such a preference for GDP-glucose and can utilize ADP-glucose to some extent too. A crystal structure of the enzyme shows that it shares twin Rossmann-like domains with the UDP-glucose-specific OtsA from Escherichia coli However, it is structurally more similar to Streptomyces hygroscopicus VldE, a GDP-valienol-dependent pseudoglycosyltransferase enzyme. Comparison of the donor binding sites reveals that the amino acids associated with the binding of diphosphoribose are almost all identical in these three enzymes. By contrast, the amino acids associated with binding guanine in VldE (Asn, Thr, and Val) are similar in S. venezuelae OtsA (Asp, Ser, and Phe, respectively) but not conserved in E. coli OtsA (His, Leu, and Asp, respectively), providing a rationale for the purine base specificity of S. venezuelae OtsA. To establish which donor is used in vivo, we generated an otsA null mutant in S. venezuelae The mutant had a cell density-dependent growth phenotype and accumulated galactose 1-phosphate, glucose 1-phosphate, and GDP-glucose when grown on galactose. To determine how the GDP-glucose is generated, we characterized three candidate GDP-glucose pyrophosphorylases. SVEN_3027 is a UDP-glucose pyrophosphorylase, SVEN_3972 is an unusual ITP-mannose pyrophosphorylase, and SVEN_2781 is a pyrophosphorylase that is capable of generating GDP-glucose as well as GDP-mannose. We have therefore established how S. venezuelae can make and utilize GDP-glucose in the biosynthesis of trehalose 6-phosphate. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  9. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis

    Indian Academy of Sciences (India)

    Sepideh Sanjari; Zahra Sadat Shobbar; Mohsen Ebrahimi; Tahereh Hasanloo; Seyed-Ahmad Sadat-Noor; Soodeh Tirnaz

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of gene family, 1 and 2. Third member, full-length cDNA (3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants. Real-time PCR analysis indicated that 1 and 3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis.

  10. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism

    Directory of Open Access Journals (Sweden)

    Lin Yao

    2016-06-01

    Full Text Available Abstract Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669 bp and pksT-2 (7901 bp suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase–acyltransferase domains through Agrobacterium -mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88.

  11. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    Energy Technology Data Exchange (ETDEWEB)

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. (Vanderbilt Univ., Nashville, TN (United States))

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  12. Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2006-02-01

    Full Text Available Abstract Background The glycogen synthase kinase 3 (GSK3/SHAGGY-like kinases (GSKs are non-receptor serine/threonine protein kinases that are involved in a variety of biological processes. In contrast to the two members of the GSK3 family in mammals, plants appear to have a much larger set of divergent GSK genes. Plant GSKs are encoded by a multigene family; analysis of the Arabidopsis genome revealed the existence of 10 GSK genes that fall into four major groups. Here we characterized the structure of Arabidopsis and rice GSK genes and conducted the first broad phylogenetic analysis of the plant GSK gene family, covering a taxonomically diverse array of algal and land plant sequences. Results We found that the structure of GSK genes is generally conserved in Arabidopsis and rice, although we documented examples of exon expansion and intron loss. Our phylogenetic analyses of 139 sequences revealed four major clades of GSK genes that correspond to the four subgroups initially recognized in Arabidopsis. ESTs from basal angiosperms were represented in all four major clades; GSK homologs from the basal angiosperm Persea americana (avocado appeared in all four clades. Gymnosperm sequences occurred in clades I, III, and IV, and a sequence of the red alga Porphyra was sister to all green plant sequences. Conclusion Our results indicate that (1 the plant-specific GSK gene lineage was established early in the history of green plants, (2 plant GSKs began to diversify prior to the origin of extant seed plants, (3 three of the four major clades of GSKs present in Arabidopsis and rice were established early in the evolutionary history of extant seed plants, and (4 diversification into four major clades (as initially reported in Arabidopsis occurred either just prior to the origin of the angiosperms or very early in angiosperm history.

  13. Molecular cloning and expression profiling of a chalcone synthase gene from Lamiophlomis rotata

    Indian Academy of Sciences (India)

    Qiao Feng; Geng Gui-Gong; Zeng Yang; Xie Hui-Chun; Jin Lan; Shang Jun; Chen Zhi

    2015-06-01

    Lamiophlomis rotata is a renowned Chinese medicinal plant. Chalcone synthase (CHS) is important in flavonoid and isoflavonoid biosynthesis, catalysing the formation of naringenin chalcone in plants. A full-length cDNA encoding the CHS gene was cloned from L. rotata based on the highly conserved CHS gene sequences of Labiatae plants. A blast search showed its homology (named LrCHS) with other CHS genes of Labiate plants. The full-length genomic DNA of LrCHS was 2026 bp with one intron of 651 bp, two exons of 178 bp and 998 bp, flanked by a 73 bp $5'$-UTR and a 126 bp $3'$-UTR. The cDNA sequence of the LrCHS gene had an 1176 bp open reading frame encoding a 391 amino acid protein of 42,798 Da. The CHS protein predicted from L. rotata showed 79–86% identity with CHS of other plant species. We conducted a phylogenetic analysis of nine families containing 48 plants and L. rotata based on the full amino acid sequences of CHS proteins. Consequently, LrCHS was located in the Labiatae branch. Additionally, we examined LrCHS gene expression patterns in different tissues by quantitative real-time PCR with specific primers. The expression analysis showed preferential expression of LrCHS in flowers and leaves during the flowering stage. Total flavonoid content and CHS gene expression exhibited similar patterns during L. rotata organ development. In agreement with its function as an elicitor-responsive gene, LrCHS expression was coordinated by methyl jasmonate and UV light, and induced between 6 and 18 h. These results provide a molecular basis for additional functional studies of LrCHS in L. rotata.

  14. Lack of association between endothelial nitric oxide synthase (NOS3 gene polymorphisms and suicide attempts

    Directory of Open Access Journals (Sweden)

    Bousoño Manuel

    2007-07-01

    Full Text Available Abstract Objective The aim of this study is to investigate the association between two polymorphisms of endothelial nitric oxide synthase (NOS3 and suicide attempts. Methods We genotyped 186 suicide attempters and 420 unrelated healthy controls. The following polymorphisms were analysed: T-786C and 27-bp repeat in intron 4. Results No significant differences were found in genotype or in allelic distribution of the aforesaid polymorphisms. There were also no differences in the genotype distribution or allelic frequencies when separately assessing males and females or impulsive and non-impulsive attempters and normal controls. Estimated haplotype frequencies were similar in both groups. Conclusion Our data do not support the hypothesis that genetically determined changes in the NOS3 gene confer increased susceptibility for suicidal behavior.

  15. Effects of homoeologous wheat starch synthase IIa genes on starch properties.

    Science.gov (United States)

    Shimbata, Tomoya; Ai, Yongfeng; Fujita, Masaya; Inokuma, Takayuki; Vrinten, Patricia; Sunohara, Ai; Saito, Mika; Takiya, Toshiyuki; Jane, Jay-lin; Nakamura, Toshiki

    2012-12-05

    Near-isogenic lines (NILs) of the eight haplotypes of starch synthase IIa (SSIIa) were used to analyze the effects of SSIIa gene dosage on branch chain length, gelatinization, pasting, retrogradation, and enzymatic hydrolysis of starches. Compared to wild-type, the amylopectin of lines missing one or more active SSIIa enzymes had increases in the proportion of short branch chains (DP6-10) and decreases in midlength chains (DP11-24), and the size of these differences depended on the dosage of active SSIIa enzymes. Of the three loci, SSIIa-A1 had the smallest contribution to amylopectin structure and SSIIa-B1 the largest. The different effects of the three SSIIa enzymes on starch properties were also seen in gelatinization, retrogradation, pasting, and enzymatic hydrolysis properties. Such differences in starch properties might be useful in influencing the texture and shelf life of food products.

  16. Molecular Cloning and Characterization of Citrate Synthase Gene in Rice( Oryza sativa)

    Institute of Scientific and Technical Information of China (English)

    ZHANG Shan-shan; MING Feng; LU Qun; GUO Bin; SHEN Da-leng

    2005-01-01

    The full-length OsCS encoding citrate synthase was isolated from rice (Oryza sativa L. subsp. japonica). OsCS is 1477-bp long and encodes a 474 amino acid polypeptide. Its putative protein sequence is highly identical to Daucus carota, Nicotiana tabacum,Beta vulgaris subsp., Arabidopsis thaliana, and Citrus junos (>70%). The deduced amino-terminal sequence of OsCS showes characteristics of mitochondrial targeting signal. Southern blot analysis using ORF of the OsCS as the probe indicated that this gene exists in multiple copies in rice genome. The band with predicated size of 82 kD was detected by Western blot after being induced by 0.4 mmol/L IPTG.

  17. Diversity in expression of glucose-6-phosphate dehydrogenase deficiency in females.

    Science.gov (United States)

    Abdulrazzaq, Y M; Micallef, R; Qureshi, M; Dawodu, A; Ahmed, I; Khidr, A; Bastaki, S M; Al-Khayat, A; Bayoumi, R A

    1999-01-01

    The aims of this study were to determine the prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency in the United Arab Emirates (UAE), to describe the different mutations in the population, to determine its prevalence, and to study inheritance patterns in families of G6PD-deficient individuals. All infants born at Tawam Hospital, Al-Ain, UAE from January 1994 to September 1996 were screened at birth for their G6PD status. In addition, those attending well-baby clinics during the period were also screened for the disorder. Families of 40 known G6PD-deficient individuals, selected randomly from the records of three hospitals in the country, were assessed for G6PD deficiency. Where appropriate, this was followed by definition of G6PD mutations. Of 8198 infants, 746 (9.1%), comprising 15% of males and 5% of females tested, were found to be G6PD deficient. A total of 27 families were further assessed: of these, all but one family had the nt563 Mediterranean mutation. In one family, two individuals had the nt202 African mutation. The high manifestation of G6PD deficiency in women may be due to the preferential expression of the G6PD-deficient gene and X-inactivation of the normal gene, and/or to the presence of an 'enhancer' gene that makes the expression of the G6PD deficiency more likely. The high level of consanguinity which, theoretically, should result in a high proportion of homozygotes and consequently a higher proportion of females with the deficiency, was not found to be a significant factor.

  18. Differential expression of cellulose synthase (CesA) gene transcripts in potato as revealed by QRT-PCR

    NARCIS (Netherlands)

    Olawole, O.; Jacobsen, E.; Vincken, J.P.; Visser, R.G.F.

    2009-01-01

    Two transgenic potato lines, csr2–1 and csr4–8 that contained two different antisense cellulose synthase (CesA) genes, csr2 and csr4, respectively were crossed. The aim, amongst others, was to investigate the possibility of generating double transformants to validate a hypothetical presence of the p

  19. Gene variations of nitric oxide synthase regulate the effects of a saturated fat rich meal on endothelial function

    Science.gov (United States)

    Objective: Endothelial nitric oxide synthase gene variations have been linked to a higher risk for cardiovascular diseases by unknown mechanisms. Our aim was to determine if two SNPs located in NOS3 (E298D and i19342) interfere with microvascular endothelial function (MEF) and/or oxidative stress du...

  20. Polymorphisms of the endothelial nitric oxide synthase (NOS3 gene in preeclampsia: a candidate-gene association study

    Directory of Open Access Journals (Sweden)

    Messinis Ioannis E

    2011-11-01

    Full Text Available Abstract Background The endothelial nitric oxide synthase gene (NOS3 has been proposed as a candidate gene for preeclampsia. However, studies so far have produced conflicting results. This study examines the specific role of variants and haplotypes of the NOS3 gene in a population of Caucasian origin. Methods We examined the association of three common variants of the NOS3 gene (4b/a, T-786C and G894T and their haplotypes in a case-control sample of 102 patients with preeclampsia and 176 women with a history of uncomplicated pregnancies. Genotyping for the NOS3 variants was performed and odds ratios and 95% confidence intervals were obtained to evaluate the association between NOS3 polymorphisms and preeclampsia. Results The single locus analysis for the three variants using various genetic models and a model-free approach revealed no significant association in relation to clinical status. The analysis of haplotypes also showed lack of significant association. Conclusions Given the limitations of the candidate-gene approach in investigating complex traits, the evidence of our study does not support the major contributory role of these common NOS3 variants in preeclampsia. Future larger studies may help in elucidating the genetics of preeclampsia further.

  1. Polymorphisms of the endothelial nitric oxide synthase (NOS3) gene in preeclampsia: a candidate-gene association study.

    Science.gov (United States)

    Zdoukopoulos, Nikos; Doxani, Chrysa; Messinis, Ioannis E; Stefanidis, Ioannis; Zintzaras, Elias

    2011-11-03

    The endothelial nitric oxide synthase gene (NOS3) has been proposed as a candidate gene for preeclampsia. However, studies so far have produced conflicting results. This study examines the specific role of variants and haplotypes of the NOS3 gene in a population of Caucasian origin. We examined the association of three common variants of the NOS3 gene (4b/a, T-786C and G894T) and their haplotypes in a case-control sample of 102 patients with preeclampsia and 176 women with a history of uncomplicated pregnancies. Genotyping for the NOS3 variants was performed and odds ratios and 95% confidence intervals were obtained to evaluate the association between NOS3 polymorphisms and preeclampsia. The single locus analysis for the three variants using various genetic models and a model-free approach revealed no significant association in relation to clinical status. The analysis of haplotypes also showed lack of significant association. Given the limitations of the candidate-gene approach in investigating complex traits, the evidence of our study does not support the major contributory role of these common NOS3 variants in preeclampsia. Future larger studies may help in elucidating the genetics of preeclampsia further.

  2. Effects of Nephritis No. 3 Recipe on Nitric Oxide, Nitric Oxide Synthase Secreted by Cultured Mesangial Cells in Rats and the Gene Expression of Inducible Nitric Oxide Synthase

    Institute of Scientific and Technical Information of China (English)

    陈志强; 黄怀鹏; 黄文政; 朱小棣; 林清棋

    2003-01-01

    Objective: To explore the effect of the Nephritis No. 3 (N-3) recipe on nitric oxide (NO),nitric oxide synthase (NOS) secreted by cultured mesangial cells (MC) and its gene expression of the inducible nitric oxide synthase (iNOS). Methods: The drug (nephritis No. 3)-containing serum was prepared with serum pharmacological technique, and then was applied to react on mesangial cells cultured in fetal calf serum (FCS) and cells cultured in FCS plus lipopolysaccharide. To observe the secretion of NO and NOS and the gene expression of iNOS by means of RT-PCR. Results: Under the two kinds of culture conditions, the content of NO and NOS in the groups with drug-containing serum were higher than those without drug-containing serum (P<0.05, P<0.01), and the expression of iNOS mRNA was up-regulated too. Conclusion: The N-3 could significantly promote the secretion of NO and NOS and the mRNA expression of iNOS in rats.

  3. Effect of estrogen on gene expression of fatty acid synthase in periosteum

    Institute of Scientific and Technical Information of China (English)

    ZHENG Rui-min; LIN Shou-qing; LIU Yong; HUANG Man-ting; GONG Wei-yan; WU Zhi-hong

    2009-01-01

    Background Estrogen deficiency contributes to postmenopausal osteoporosis.Periosteum might be a potential target of estrogen,but the underlying mechanism at gene level is far from being elucidated.The objective of this study was to investigate the correlation between estrogen and fatty acid synthase(FAS)expression in periosteum.Methods Human periosteum cells were cultured in vitro.Expressed genes in the substrated cDNA library were verified using semi-quantitative PCR and real-time PCR.The expression of FAS in periosteum of ovarectomized(OVX)SD rats was investigated.Results FAS gene was most significantly expressed in the subtracted cDNA library of periosteal cells screened by semi-quantitative PCR.Low FAS expression was verified by real-time PCR in the estrogen exposed human periosteum rather than in the control.The estradiol levels were(20.81±12.62)pg/ml,(19.64±4.35)pg/ml and(13.47+1.84)pg/ml in the sham group,the control,and the OVX group,respectively.The estradiol levels in the OVX group was significantly lower(P=0.0386).The FAS gene expression in periosteum in the OVX group,sham group,and control group was 3.09±1.97,1.33±0.47 and 1.51±1.32,respectively.The gene expression in the OVX group was significantly higher (P=0.0372).Conclusion Estrogen modulates FAS gene expression in in vitro human perisoteum as well as in in vivo rat periosteum.

  4. Cellulose synthase (CesA) genes in the green alga Mesotaenium caldariorum.

    Science.gov (United States)

    Roberts, Alison W; Roberts, Eric M; Delmer, Deborah P

    2002-12-01

    Cellulose, a microfibrillar polysaccharide consisting of bundles of beta-1,4-glucan chains, is a major component of plant and most algal cell walls and is also synthesized by some prokaryotes. Seed plants and bacteria differ in the structures of their membrane terminal complexes that make cellulose and, in turn, control the dimensions of the microfibrils produced. They also differ in the domain structures of their CesA gene products (the catalytic subunit of cellulose synthase), which have been localized to terminal complexes and appear to help maintain terminal complex structure. Terminal complex structures in algae range from rosettes (plant-like) to linear forms (bacterium-like). Thus, algal CesA genes may reveal domains that control terminal complex assembly and microfibril structure. The CesA genes from the alga Mesotaenium caldariorum, a member of the order Zygnematales, which have rosette terminal complexes, are remarkably similar to seed plant CesAs, with deduced amino acid sequence identities of up to 59%. In addition to the putative transmembrane helices and the D-D-D-QXXRW motif shared by all known CesA gene products, M. caldariorum and seed plant CesAs share a region conserved among plants, an N-terminal zinc-binding domain, and a variable or class-specific region. This indicates that the domains that characterize seed plant CesAs arose prior to the evolution of land plants and may play a role in maintaining the structures of rosette terminal complexes. The CesA genes identified in M. caldariorum are the first reported for any eukaryotic alga and will provide a basis for analyzing the CesA genes of algae with different types of terminal complexes.

  5. Cloning of genomic DNA of rice 5-enolpyruvylshikimate 3-phosphate synthase gene and chromosomal localization of the gene

    Institute of Scientific and Technical Information of China (English)

    徐军望; 冯德江; 李旭刚; 常团结; 朱祯

    2002-01-01

    The shikimate pathway enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSPs) is the target of nonselective herbicide glyphosate. A partial rice epsps cDNA was generated by RT-PCR with primers designed according to EST sequence in GenBank and used as probe for rice genomic library screening. In a screen of approximately 8.0×104 clones from the rice genomic library, sixteen positive clones were obtained, which strongly hybridized to the probe. One clone, E11, was selected for further analysis and the full-length 3661 bp rice epsps genomic sequence was obtained. Sequence analysis and homologous comparison revealed that epsps gene is composed of 8 exons and 7 introns. Analysis by restriction fragment length polymorphism with the probe of rice epsps cDNA fragment confirmed that rice epsps is located on chromosome 6 with an indica-japonica (ZYQ8-JX17) double-haploid (DH) population. This is the first report on the EPSP synthase from monocotyledons.

  6. Cloning and characterization of squalene synthase gene from Poria cocos and its up-regulation by methyl jasmonate.

    Science.gov (United States)

    Wang, Jian-Rong; Lin, Jun-Fang; Guo, Li-Qiong; You, Lin-Feng; Zeng, Xian-Lu; Wen, Jia-Ming

    2014-02-01

    Squalene synthase (SQS) catalyzes the condensation of two molecules of farnesyl diphosphate to give presqualene diphosphate and the subsequent rearrangement to form squalene. The gene encoding squalene synthase was cloned from Poria cocos by degenerate PCR and inverse PCR. The open reading frame of the gene is 1,497 bp, which encodes 499 amino acid residues. A phylogenetic analysis revealed that P. cocos SQS belonged to the fungus group, and was more closely related to the SQS of Ganoderma lucidum than other fungi. The treatment of P. cocos with methyl jasmonate (MeJA) significantly enhanced the transcriptional level of P. cocos sqs gene and the content of squalene in P. cocos. The transcriptional level of sqs gene was approximately fourfold higher than the control sample and the squalene content reached 128.62 μg/g, when the concentration of MeJA was 300 μM after 72 h induction.

  7. Natural biocombinatorics in the polyketide synthase genes of the actinobacterium Streptomyces avermitilis.

    Directory of Open Access Journals (Sweden)

    Holger Jenke-Kodama

    2006-10-01

    Full Text Available Modular polyketide synthases (PKSs of bacteria provide an enormous reservoir of natural chemical diversity. Studying natural biocombinatorics may aid in the development of concepts for experimental design of genes for the biosynthesis of new bioactive compounds. Here we address the question of how the modularity of biosynthetic enzymes and the prevalence of multiple gene clusters in Streptomyces drive the evolution of metabolic diversity. The phylogeny of ketosynthase (KS domains of Streptomyces PKSs revealed that the majority of modules involved in the biosynthesis of a single compound evolved by duplication of a single ancestor module. Using Streptomyces avermitilis as a model organism, we have reconstructed the evolutionary relationships of different domain types. This analysis suggests that 65% of the modules were altered by recombinational replacements that occurred within and between biosynthetic gene clusters. The natural reprogramming of the biosynthetic pathways was unambiguously confined to domains that account for the structural diversity of the polyketide products and never observed for the KS domains. We provide examples for natural acyltransferase (AT, ketoreductase (KR, and dehydratase (DH-KR domain replacements. Potential sites of homologous recombination could be identified in interdomain regions and within domains. Our results indicate that homologous recombination facilitated by the modularity of PKS architecture is the most important mechanism underlying polyketide diversity in bacteria.

  8. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  9. Cloning and characterization of farnesyl diphosphate synthase gene involved in triterpenoids biosynthesis from Poria cocos.

    Science.gov (United States)

    Wang, Jianrong; Li, Yangyuan; Liu, Danni

    2014-12-02

    Poria cocos (P. cocos) has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS) is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%). The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP) from geranyl diphosphate (GPP) and isopentenyl diphosphate (IPP). Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  10. Influence of Different Levels of Lipoic Acid Synthase Gene Expression on Diabetic Nephropathy

    Science.gov (United States)

    Xu, Longquan; Hiller, Sylvia; Simington, Stephen; Nickeleit, Volker; Maeda, Nobuyo; James, Leighton R.; Yi, Xianwen

    2016-01-01

    Oxidative stress is implicated in the pathogenesis of diabetic nephropathy (DN) but outcomes of many clinical trials are controversial. To define the role of antioxidants in kidney protection during the development of diabetic nephropathy, we have generated a novel genetic antioxidant mouse model with over- or under-expression of lipoic acid synthase gene (Lias). These models have been mated with Ins2Akita/+ mice, a type I diabetic mouse model. We compare the major pathologic changes and oxidative stress status in two new strains of the mice with controls. Our results show that Ins2Akita/+ mice with under-expressed Lias gene, exhibit higher oxidative stress and more severe DN features (albuminuria, glomerular basement membrane thickening and mesangial matrix expansion). In contrast, Ins2Akita/+ mice with highly-expressed Lias gene display lower oxidative stress and less DN pathologic changes. Our study demonstrates that strengthening endogenous antioxidant capacity could be an effective strategy for prevention and treatment of DN. PMID:27706190

  11. Gene expression of inducible nitric oxide synthase in injured spinal cord tissue

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective: To investigate gene expression of inducible nitric oxide synthase (iNOS) in injured spinal cord tissue of rats.Methods: Thirty-six adult Sprague-Dawley rats were divided randomly into six groups: a normal group and five injury groups, six animals in each group. Animals in the injury groups were killed at 2, 6, 12, 24, 48 hours after injury, respectively. A compression injury model of spinal cord was established according to Nystrom B et al, and gene expression of iNOS in spinal cord tissue was examined by means of reverse transcription polymerase chain reaction (RT-PCR).Results: Gene expression of iNOS was not detectable in normal spinal cord tissue but was seen in the injury groups. The expression was gradually up-regulated, reaching the maximum at 24 hours. The expression at 48hours began to decrease but was still significantly higher than that at 2 hours.Conclusions: iNOS is not involved in the normal physiological activities of spinal cord. Expression of iNOS is up-regulated in spinal cord tissue in response to injury and the up-regulation exists mainly in the late stage after injury. Over-expression of iNOS may contribute to the late injury of spinal cord.

  12. Relationship Between Polymorphism of Cystathionine beta Synthase Gene and Congenital Heart Disease in Chinese Nuclear Families

    Institute of Scientific and Technical Information of China (English)

    XIAO-MING SONG; XIAO-YING ZHENG; WEN-LI ZHU; LEI HUANG; YONG LI

    2006-01-01

    Objective To study the relationship between polymorphism of cystathionine beta synthase (CBS) gene and development of congenital heart disease (CHD). Methods One hundred and twenty-seven CHD case-parent triads were recruited from Liaoning Province as patient group, and 129 healthy subjects without family history of birth defect were simultaneously recruited as control group together with their biological parents. For all subjects the polymorphism of CBS gene G919A locus was examined by PCR-ARMS method. Results The frequencies of three genotypes (w/w, w/m, and m/m) in control group were 27.2%, 58.4%, and 14.4%, respectively, with no significant difference in gender. A significant difference in the allele frequency was found between CHD patients and controls, the wild allele frequency was 67.9% in patients and 55.7% in controls.CHD parents' genotype distribution was significantly different from that in controls. Further comparison of each type of CHD showed that genotype frequencies in several CHD subtypes were significantly different from those in their corresponding controls. The results of TDT analysis showed that no allele transmission disequilibrium existed in CHD nuclear families.Conclusions CBS gene G919A mutation is associated with the development of CHD, and the mutated allele may decrease the risk of CHD.

  13. Homologous recombination and gene replacement at the dihydrofolate reductase-thymidylate synthase locus in Toxoplasma gondii.

    Science.gov (United States)

    Donald, R G; Roos, D S

    1994-02-01

    To investigate the feasibility of genomic transgene expression and gene targeting in Toxoplasma gondii, parasites have been transfected with constructs differing in the length of contiguous genomic sequence spanning the dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene. We have previously reported that vectors derived from a DHFR-TS cDNA 'minigene' containing mutations in the DHFR coding sequence confer pyrimethamine resistance to transfected parasites (Donald and Roos, 1993). Stably resistant parasite clones arise at high frequency, generally by virtue of transgene integration into parasite chromosomes at locations scattered throughout the genome. In contrast, using a vector which contains 8 kb of contiguous genomic sequence (vs. homologous recombination. Homologous recombination appears to occur at even higher frequency when a 16 kb genomic clone is used. Circular plasmids were more efficient than linearized molecules at producing homologous recombination in this system, integrating by reciprocal crossing-over to produce a duplication of the DHFR-TS locus. Double crossing-over (or gene conversion) was also observed at low frequency, resulting in complete allelic replacement in this haploid stage of the parasite. The ability to produce either homologous or non-homologous recombinants, by the selection of appropriate transformation constructs, has considerable genetic potential.

  14. Nonsense mutation inside anthocyanidin synthase gene controls pigmentation in yellow raspberry (Rubus idaeus L..

    Directory of Open Access Journals (Sweden)

    Muhammad Zubair Rafique

    2016-12-01

    Full Text Available Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry (Anne. A 5-bp insertion in the coding region was identified and designated as ans+5. The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect i.e. nonsense-mRNA mediated decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans+5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  15. Nonsense Mutation Inside Anthocyanidin Synthase Gene Controls Pigmentation in Yellow Raspberry (Rubus idaeus L.).

    Science.gov (United States)

    Rafique, Muhammad Z; Carvalho, Elisabete; Stracke, Ralf; Palmieri, Luisa; Herrera, Lorena; Feller, Antje; Malnoy, Mickael; Martens, Stefan

    2016-01-01

    Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase (Ans) catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry ("Anne"). A 5 bp insertion in the coding region was identified and designated as ans(+5). The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild-type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect, i.e., nonsense-mediated mRNA decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans(+5) and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  16. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  17. Overexpression of Citrus junos mitochondrial citrate synthase gene in Nicotiana benthamiana confers aluminum tolerance.

    Science.gov (United States)

    Deng, Wei; Luo, Keming; Li, Zhengguo; Yang, Yingwu; Hu, Nan; Wu, Yu

    2009-07-01

    Aluminum (Al) toxicity is one of the major factors that limit plant growth in acid soils. Al-induced release of organic acids into rhizosphere from the root apex has been identified as a major Al-tolerance mechanism in many plant species. In this study, Al tolerance of Yuzu (Citrus Junos Sieb. ex Tanaka) was tested on the basis of root elongation and the results demonstrated that Yuzu was Al tolerant compared with other plant species. Exposure to Al triggered the exudation of citrate from the Yuzu root. Thus, the mechanism of Al tolerance in Yuzu involved an Al-inducible increase in citrate release. Aluminum also elicited an increase of citrate content and increased the expression level of mitochondrial citrate synthase (CjCS) gene and enzyme activity in Yuzu. The CjCS gene was cloned from Yuzu and overexpressed in Nicotiana benthamiana using Agrobacterium tumefaciens-mediated methods. Increased expression level of the CjCS gene and enhanced enzyme activity were observed in transgenic plants compared with the wild-type plants. Root growth experiments showed that transgenic plants have enhanced levels of Al tolerance. The transgenic Nicotiana plants showed increased levels of citrate in roots compared to wild-type plants. The exudation of citrate from roots of the transgenic plants significantly increased when exposed to Al. The results with transgenic plants suggest that overexpression of mitochondrial CS can be a useful tool to achieve Al tolerance.

  18. Five novel glucose-6-phosphate dehydrogenase deficiency haplotypes correlating with disease severity

    Directory of Open Access Journals (Sweden)

    Dallol Ashraf

    2012-09-01

    Full Text Available Abstract Background Glucose-6-phosphate dehydrogenase (G6PD, EC 1.1.1.49 deficiency is caused by one or more mutations in the G6PD gene on chromosome X. An association between enzyme levels and gene haplotypes remains to be established. Methods In this study, we determined G6PD enzyme levels and sequenced the coding region, including the intron-exon boundaries, in a group of individuals (163 males and 86 females who were referred to the clinic with suspected G6PD deficiency. The sequence data were analysed by physical linkage analysis and PHASE haplotype reconstruction. Results All previously reported G6PD missense changes, including the AURES, MEDITERRANEAN, A-, SIBARI, VIANGCHAN and ANANT, were identified in our cohort. The AURES mutation (p.Ile48Thr was the most common variant in the cohort (30% in males patients followed by the Mediterranean variant (p.Ser188Phe detectable in 17.79% in male patients. Variant forms of the A- mutation (p.Val68Met, p.Asn126Asp or a combination of both were detectable in 15.33% of the male patients. However, unique to this study, several of such mutations co-existed in the same patient as shown by physical linkage in males or PHASE haplotype reconstruction in females. Based on 6 non-synonymous variants of G6PD, 13 different haplotypes (13 in males, 8 in females were identified. Five of these were previously unreported (Jeddah A, B, C, D and E and were defined by previously unreported combinations of extant mutations where patients harbouring these haplotypes exhibited severe G6PD deficiency. Conclusions Our findings will help design a focused population screening approach and provide better management for G6PD deficiency patients.

  19. Glucose-6-Phosphate Dehydrogenase Deficiency Improves Insulin Resistance With Reduced Adipose Tissue Inflammation in Obesity.

    Science.gov (United States)

    Ham, Mira; Choe, Sung Sik; Shin, Kyung Cheul; Choi, Goun; Kim, Ji-Won; Noh, Jung-Ran; Kim, Yong-Hoon; Ryu, Je-Won; Yoon, Kun-Ho; Lee, Chul-Ho; Kim, Jae Bum

    2016-09-01

    Glucose-6-phosphate dehydrogenase (G6PD), a rate-limiting enzyme of the pentose phosphate pathway, plays important roles in redox regulation and de novo lipogenesis. It was recently demonstrated that aberrant upregulation of G6PD in obese adipose tissue mediates insulin resistance as a result of imbalanced energy metabolism and oxidative stress. It remains elusive, however, whether inhibition of G6PD in vivo may relieve obesity-induced insulin resistance. In this study we showed that a hematopoietic G6PD defect alleviates insulin resistance in obesity, accompanied by reduced adipose tissue inflammation. Compared with wild-type littermates, G6PD-deficient mutant (G6PD(mut)) mice were glucose tolerant upon high-fat-diet (HFD) feeding. Intriguingly, the expression of NADPH oxidase genes to produce reactive oxygen species was alleviated, whereas that of antioxidant genes was enhanced in the adipose tissue of HFD-fed G6PD(mut) mice. In diet-induced obesity (DIO), the adipose tissue of G6PD(mut) mice decreased the expression of inflammatory cytokines, accompanied by downregulated proinflammatory macrophages. Accordingly, macrophages from G6PD(mut) mice greatly suppressed lipopolysaccharide-induced proinflammatory signaling cascades, leading to enhanced insulin sensitivity in adipocytes and hepatocytes. Furthermore, adoptive transfer of G6PD(mut) bone marrow to wild-type mice attenuated adipose tissue inflammation and improved glucose tolerance in DIO. Collectively, these data suggest that inhibition of macrophage G6PD would ameliorate insulin resistance in obesity through suppression of proinflammatory responses. © 2016 by the American Diabetes Association.

  20. Identification and characterization of three putative genes for 1-aminocyclopropane-1-carboxylate synthase from etiolated mung bean hypocotyl segments.

    Science.gov (United States)

    Botella, J R; Schlagnhaufer, C D; Arteca, R N; Phillips, A T

    1992-02-01

    The polymerase chain reaction (PCR) was used to produce 3 putative clones for ACC synthase from etiolated mung bean (Vigna radiata Rwilcz cv. Berken) hypocotyls. This was accomplished by utilizing genomic DNA from mung bean and degenerate primers made from information derived from highly conserved regions of ACC synthase from different plant tissues. The total length of pMAC-1, pMAC-2 and pMAC-3 are 308, 321, and 326 bp, respectively, all of which code for 68 amino acids. The introns for pMAC-1, pMAC-2 and pMAC-3 are 92, 105, and 110 bp, respectively. The degrees of homology at the DNA level for each of these clones is ca. 80% in their coding region and ca. 50% in their respective introns. This is the first report providing evidence that there are at least 3 genes for ACC synthase in etiolated mung bean.

  1. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C

    1995-01-01

    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... treatment. Ten obese patients with NIDDM were studied before and after 8 weeks of treatment with a weight-maintaining diet in combination with the sulphonylurea gliclazide. Gliclazide treatment was associated with significant reductions in HbA1C (p=0.001) and fasting plasma glucose (p=0.005) as well...... metabolism (p=0.02) was demonstrated in teh gliclazide-treated patients when compared to pre-treatment values. In biopsies obtained from vastus lateralis muscle during insulin infusion, the half-maximal activation of glycogen synthase was achieved at a significantly lower concentration of the allosteric...

  2. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites

    Institute of Scientific and Technical Information of China (English)

    Ya-e ZHAO; Zheng-hang WANG; Yang XU; Ji-ru XU; Wen-yan LIU; Meng WEI; Chu-ying WANG

    2012-01-01

    To our knowledge,few reports on Demodex studied at the molecular level are available at present.In this study our group,for the first time,cloned,sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum,Demodex brevis,and Demodex canis (three isolates from each species) from Xi'an China,by designing specific primers based on the only partial sequence of the CHS gene of D.canis from Japan,retrieved from GenBank.Results show that amplification was successful only in three D.canis isolates and one D.brevis isolate out of the nine Demodex isolates.The obtained fragments were sequenced to be 339 bp for D.canis and 338 bp for D.brevis.The CHS gene sequence similarities between the three Xi'an D.canis isolates and one Japanese D.canis isolate ranged from 99.7% to 100.0%,and those between four D.canis isolates and one D.brevis isolate were 99.1%-99.4%.Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters,according with the traditional classification.Two open reading frames (ORFs) were identified in each CHS gene sequenced,and their corresponding amino acid sequences were located at the catalytic domain.The relatively conserved sequences could be deduced to be a CHS class A gene,which is associated with chitin synthesis in the integument of Demodex mites.

  3. Association of methionine synthase gene polymorphisms with wool production and quality traits in Chinese Merino population.

    Science.gov (United States)

    Rong, E G; Yang, H; Zhang, Z W; Wang, Z P; Yan, X H; Li, H; Wang, N

    2015-10-01

    Methionine synthase (MTR) plays a crucial role in maintaining homeostasis of intracellular methionine, folate, and homocysteine, and its activity correlates with DNA methylation in many mammalian tissues. Our previous genomewide association study identified that 1 SNP located in the gene was associated with several wool production and quality traits in Chinese Merino. To confirm the potential involvement of the gene in sheep wool production and quality traits, we performed sheep tissue expression profiling, SNP detection, and association analysis with sheep wool production and quality traits. The semiquantitative reverse transcription PCR analysis showed that the gene was differentially expressed in skin from Merino and Kazak sheep. The sequencing analysis identified a total of 13 SNP in the gene from Chinese Merino sheep. Comparison of the allele frequencies revealed that these 13 identified SNP were significantly different among the 6 tested Chinese Merino strains ( < 0.001). Linkage disequilibrium analysis showed that SNP 3 to 11 were strongly linked in a single haplotype block in the tested population. Association analysis showed that SNP 2 to 11 were significantly associated with the average wool fiber diameter and the fineness SD and that SNP 4 to 11 were significantly associated with the CV of fiber diameter trait ( < 0.05). Single nucleotide polymorphism 2 and SNP 5 to 12 were weakly associated with wool crimp. Similarly, the haplotypes derived from these 13 identified SNP were also significantly associated with the average wool fiber diameter, fineness SD, and the CV of fiber diameter ( < 0.05). Our results suggest that is a candidate gene for sheep wool production and quality traits, and the identified SNP might be used in sheep breeding.

  4. Endothelial nitric oxide synthase gene polymorphism is associated with sickle cell disease patients in India.

    Science.gov (United States)

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv; Gupta, Rasik Bihari; Gadge, Vijay Sadashiv; Gwal, Anil

    2013-12-01

    Patients with sickle cell disease (SCD) produce significantly low levels of plasma nitric oxide (NO) during acute vaso-occlusive crisis. In transgenic sickle cell mice, NO synthesized by endothelial nitric oxide synthase (eNOS) enzyme of vascular endothelial cells has been found to protect the mice from vaso-occlusive events. Therefore, the present study aims to explore possible association of eNOS gene polymorphism as a potential genetic modifier in SCD patients. A case control study involving 150 SCD patients and age- and ethnicity-matched 150 healthy controls were genotyped by PCR-restriction fragment length polymorphism techniques for three important eNOS gene polymorphisms-eNOS 4a/b, eNOS 894G>T and eNOS -786T>C. It was observed that SCD patients had significantly higher frequencies of mutant alleles besides heterozygous and homozygous mutant genotypes of these three eNOS gene polymorphisms and low levels of plasma nitrite (NO2) as compared with control groups. The SCD severe group had significantly lower levels of plasma NO2 and higher frequencies of mutant alleles of these three SNPs of eNOS gene in contrast to the SCD mild group of patients. Haplotype analysis revealed that frequencies of one mutant haplotype '4a-T-C' (alleles in order of eNOS 4a/b, eNOS 894G>T and eNOS -786T>C) were significantly high in the severe SCD patients (Phaplotype '4b-G-T' was found to be significantly high (P<0.0001) in the SCD mild patients, which indicates that eNOS gene polymorphisms are associated with SCD patients in India and may act as a genetic modifier of the phenotypic variation of SCD patients.

  5. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  6. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  7. Association Analysis for Neuronal Nitric Oxide Synthase Gene Polymorphism with Plasma Nitrite/Nitrate Concentration in Schizophrenia

    Directory of Open Access Journals (Sweden)

    Đorđević Vladimir V.

    2014-09-01

    Full Text Available Background: Single nucleotide polymorphisms (SNP of many genes, including the gene for neuronal nitric oxide syn-thase (NOS1, were found significantly associated with schizo-phrenia. According to our previously published results of increased plasma nitric oxide concentration in patients with schizophrenia, we hypothesized that the NOS1 gene polymorphism might be a cause of increased nitric oxide production in patients with schizophrenia and tested the interdependence between plasma nitrite/nitrate concentrations and SNP (a CT transition located in exon 29 of the human NOS1 gene.

  8. Molecular cloning, characteristics and low temperature response of raffinose synthase gene in Cucumis sativus L.

    Science.gov (United States)

    Sui, Xiao-lei; Meng, Fan-zhen; Wang, Hong-yun; Wei, Yu-xia; Li, Rui-fu; Wang, Zhen-yu; Hu, Li-ping; Wang, Shao-hui; Zhang, Zhen-xian

    2012-12-15

    Raffinose synthase (RS, EC2.4.1.82) is one of the key enzymes that channels sucrose into the raffinose family oligosaccharides (RFOs) biosynthetic pathway. However, the gene encoding RS is poorly characterized in cucumber (Cucumis sativus L.), which is a typical RFOs-translocating plant species. Here we isolated the gene encoding RS (CsRS) from the leaves of cucumber plants. The complete cDNA of CsRS consisted of 2552 nucleotides with an open reading frame encoding a polypeptide of 784 amino acid residues. Reverse transcription-polymerase chain reaction and RNA hybridization analysis revealed that expression of CsRS was the highest in leaves followed by roots, fruits, and stems. The RS activity was up-regulated and the raffinose content was high in the leaves of transgenic tobacco with over-expression of CsRS, while both the RS activity and the raffinose content decreased in the transgenic cucumber plants with anti-sense expression of CsRS. The expression of CsRS could be induced by low temperature and exogenous phytohormone abscisic acid (ABA). In cucumber growing under low temperature stress, CsRS expression, RS activity and raffinose content increased gradually in the leaves, the fruits, the stems and the roots. The most notable increase was observed in the leaves. Similarly, the expression of CsRS was induced in cucumber leaves and fruits with 200 μM and 150 μM ABA treatments, respectively.

  9. Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk

    2011-07-01

    Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

  10. An evolutionary analysis of lateral gene transfer in thymidylate synthase enzymes.

    Science.gov (United States)

    Stern, Adi; Mayrose, Itay; Penn, Osnat; Shaul, Shaul; Gophna, Uri; Pupko, Tal

    2010-03-01

    Thymidylate synthases (Thy) are key enzymes in the synthesis of deoxythymidylate, 1 of the 4 building blocks of DNA. As such, they are essential for all DNA-based forms of life and therefore implicated in the hypothesized transition from RNA genomes to DNA genomes. Two evolutionally unrelated Thy enzymes, ThyA and ThyX, are known to catalyze the same biochemical reaction. Both enzymes are sporadically distributed within each of the 3 domains of life in a pattern that suggests multiple nonhomologous lateral gene transfer (LGT) events. We present a phylogenetic analysis of the evolution of the 2 enzymes, aimed at unraveling their entangled evolutionary history and tracing their origin back to early life. A novel probabilistic evolutionary model was developed, which allowed us to compute the posterior probabilities and the posterior expectation of the number of LGT events. Simulation studies were performed to validate the model's ability to accurately detect LGT events, which have occurred throughout a large phylogeny. Applying the model to the Thy data revealed widespread nonhomologous LGT between and within all 3 domains of life. By reconstructing the ThyA and ThyX gene trees, the most likely donor of each LGT event was inferred. The role of viruses in LGT of Thy is finally discussed.

  11. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    Science.gov (United States)

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-12-22

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots.

  12. Mutations and polymorphisms in the human N-acetylglutamate synthase (NAGS) gene.

    Science.gov (United States)

    Caldovic, Ljubica; Morizono, Hiroki; Tuchman, Mendel

    2007-08-01

    N-acetylglutamate synthase (NAGS) deficiency, an autosomal recessive disorder, is the last urea cycle disorder for which molecular testing became available. This is the first comprehensive report of 21 mutations that cause NAGS deficiency and of commonly found polymorphisms in the NAGS gene. Five mutations are reported here for the first time. A total of 10 disease-causing mutations are associated with acute neonatal hyperammonemia; the remaining mutations were found in patients with late onset disease. Residual enzymatic activities are included in this report and the deleterious effects of eight mutations were confirmed by expression studies. Mutations in the NAGS gene are distributed throughout its reading frame. No mutations have been found in exon 1, which encodes for the putative mitochondrial targeting signal and variable segment of NAGS. Three polymorphisms have been found. Early, accurate, and specific diagnosis of NAGS deficiency is critical since this condition can be successfully treated with N-carbamylglutamate (NCG, Carbaglu; Orphan Europe). Treatment with NCG should be initiated as soon as a patient is suspected of having NAGS deficiency. Molecular testing represents the most reliable method of diagnosis.

  13. Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions.

    Science.gov (United States)

    Luo, Chuping; Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu; Chen, Zhiyi

    2015-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way.

  14. Linkage of the human inducible nitric oxide synthase gene to type 1 diabetes.

    Science.gov (United States)

    Johannesen, J; Pie, A; Pociot, F; Kristiansen, O P; Karlsen, A E; Nerup, J

    2001-06-01

    Exposure of human pancreatic islets to a mixture of cytokines induces expression of the inducible nitric oxide synthase (iNOS), impairs beta-cell function, and induces apoptosis. We performed a mutational scanning of all 27 exons of the human NOS2 gene and linkage transmission disequilibrium testing of identified NOS2 polymorphisms in a Danish nationwide type 1 diabetes mellitus (IDDM) family collection. Mutational screening was performed using PCR-amplified exons, followed by single stranded conformation polymorphism and verification of potential polymorphisms by sequencing. The transmission disequilibrium test was performed in an IDDM family material comprising 257 Danish families; 154 families were affected sibling pair families, and 103 families were simplex families. In total, 10 polymorphisms were identified in 8 exons, of which 4 were tested in the family material. A C/T single nucleotide polymorphism in exon 16 resulting in an amino acid substitution, Ser(608)Leu, showed linkage to IDDM in human leukocyte antigen DR3/4-positive affected offspring (P = 0.008; corrected P = 0.024). No other distorted transmission patterns were found for any other tested single nucleotide polymorphism or constructed haplotypes with the exception of those including data from exon 16. In conclusion, linkage of the human NOS2 gene to IDDM in a subset of patients supports a pathogenic role of nitric oxide in human IDDM.

  15. Enhanced Cadmium Accumulation in Transgenic Tobacco Expressing the Phytochelatin Synthase Gene of Cynodon dactylon L.

    Institute of Scientific and Technical Information of China (English)

    Jiangchuan Li; Jiangbo Guo; Wenzhong Xu; Mi Ma

    2006-01-01

    Bermudagrass (Cynodon dactylon L. cv. Goldensun) is highly resistant to and accumulates large amounts of cadmium (Cd). A phytochelatin synthase (PCS) cDNA (CdPCS1) was isolated from this grass by rapid amplification of cDNA ends. The putative CdPCS1 protein shared a high homology with PCS from other plants, with 79% homology at the N-terminal and 47% homology at the C-terminal. However, 16 Cys residues were found at the C-terminal of CdPCS1, and among these residues, three positions were different from other PCS proteins. Semiquantitative reverse transcription-polymerase chain reaction analysis showed that Cd stress induced CdPCS1 expression in both roots and leaves in Bermudagrass. We verified that CdPCS1 plays an important role in Cd tolerance in yeast cells by expressing the gene in ABDE1, a Cd-sensitive mutant. CdPCS1 was then introduced into tobacco plants. The phytochelatin level in some transgenic tobacco lines increased 3.88-fold more than in wild type plants and Cd accumulation in these transgenic plants was enhanced 3.21-fold accordingly. The results suggested that CdPCS1 could be used as a gene element for phytoremediation in the future.

  16. Characterization of the Sesbania rostrata Phytochelatin Synthase Gene: Alternative Splicing and Function of Four Isoforms

    Directory of Open Access Journals (Sweden)

    Zeng-Fu Xu

    2009-07-01

    Full Text Available Phytochelatins (PCs play an important role in detoxification of heavy metals in plants. PCs are synthesized from glutathione by phytochelatin synthase (PCS, a dipeptidyltransferase. Sesbania rostrata is a tropical legume plant that can tolerate high concentrations of Cd and Zn. In this study, the S. rostrata PCS gene (SrPCS and cDNAs were isolated and characterized. Southern blot and sequence analysis revealed that a single copy of the SrPCS gene occurs in the S. rostrata genome, and produces four different SrPCS mRNAs and proteins, SrPCS1-SrPCS4, by alternative splicing of the SrPCS pre-mRNA. The SrPCS1 and SrPCS3 proteins conferred Cd tolerance when expressed in yeast cells, whereas the SrPCS2 and SrPCS4 proteins, which lack the catalytic triad and the N-terminal domains, did not. These results suggested that SrPCS1 and SrPCS3 have potential applications in genetic engineering of plants for enhancing heavy metal tolerance and phytoremediation of contaminated soils.

  17. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    Science.gov (United States)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-09-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( Pcloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  18. Fluorometric determination of free glucose and glucose 6-phosphate in cows' milk and other opaque matrices

    DEFF Research Database (Denmark)

    Larsen, Torben

    2015-01-01

    Analyses of free glucose and glucose 6-phosphate in milk have until now been dependent upon several time consuming and troublesome procedures. This has limited investigations in the area. The present article presents a new, reliable, analytical procedure, based on enzymatic degradation...... and fluorometric detection. Standards and control materials were based on milk that was stripped of intrinsic glucose and glucose 6-phosphate in order to obtain standards and samples based on the same matrix. The analysis works without pre-treatment of the samples, e.g. without centrifugation and precipitation...

  19. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Science.gov (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

  20. An ancient repeat sequence in the ATP synthase beta-subunit gene of forcipulate sea stars.

    Science.gov (United States)

    Foltz, David W

    2007-11-01

    A novel repeat sequence with a conserved secondary structure is described from two nonadjacent introns of the ATP synthase beta-subunit gene in sea stars of the order Forcipulatida (Echinodermata: Asteroidea). The repeat is present in both introns of all forcipulate sea stars examined, which suggests that it is an ancient feature of this gene (with an approximate age of 200 Mya). Both stem and loop regions show high levels of sequence constraint when compared to flanking nonrepetitive intronic regions. The repeat was also detected in (1) the family Pterasteridae, order Velatida and (2) the family Korethrasteridae, order Velatida. The repeat was not detected in (1) the family Echinasteridae, order Spinulosida, (2) the family Astropectinidae, order Paxillosida, (3) the family Solasteridae, order Velatida, or (4) the family Goniasteridae, order Valvatida. The repeat lacks similarity to published sequences in unrestricted GenBank searches, and there are no significant open reading frames in the repeat or in the flanking intron sequences. Comparison via parametric bootstrapping to a published phylogeny based on 4.2 kb of nuclear and mitochondrial sequence for a subset of these species allowed the null hypothesis of a congruent phylogeny to be rejected for each repeat, when compared separately to the published phylogeny. In contrast, the flanking nonrepetitive sequences in each intron yielded separate phylogenies that were each congruent with the published phylogeny. In four species, the repeat in one or both introns has apparently experienced gene conversion. The two introns also show a correlated pattern of nucleotide substitutions, even after excluding the putative cases of gene conversion.

  1. The oxidative pentose phosphate pathway in the haloarchaeon Haloferax volcanii involves a novel type of glucose-6-phosphate dehydrogenase--The archaeal Zwischenferment.

    Science.gov (United States)

    Pickl, Andreas; Schönheit, Peter

    2015-04-28

    The oxidative pentose phosphate pathway (OPPP), catalyzing the oxidation of glucose-6-phosphate to ribulose-5-phosphate is ubiquitous in eukarya and bacteria but has not yet been reported in archaea. In haloarchaea a putative 6-phosphogluconate dehydrogenase (6PGDH) is annotated, whereas a gene coding for glucose-6-phosphate dehydrogenase (Glc6PDH) could not be identified. Here we report the purification and characterization of a novel type of Glc6PDH in Haloferax volcanii that is not related to bacterial and eukaryal Glc6PDHs and the encoding gene is designated as azf (archaeal zwischenferment). Further, recombinant H. volcanii 6PGDH was characterized. Deletion mutant analyses indicate that both, Glc6PDH and 6PGDH, are functionally involved in pentose phosphate formation in vivo. This is the first report on the operation of the OPPP in the domain of archaea.

  2. The Prevalence of Mediterranean Mutation of Glucose-6-Phosphate Dehydrogenase (G6PD in Zahedan

    Directory of Open Access Journals (Sweden)

    Alireza Nakhaee

    2012-03-01

    Full Text Available Background: glucose-6-phosphate dehydrogenase (G6PD deficiency is the most common genetic defects in the world, so that more than 400 million people in worldwide are affected with it, but its prevalence varies from 1-65% in different populations. Clinical manifestation of this defect is acute hemolytic anemia, neonatal hyperbilirubinemia and chronic nonspherocytic haemolytic anaemia. So far, almost 140 mutations have been identified in the gene of G6PD enzyme. Mediterranean is the most common mutation. The purpose of this study is to determine the prevalence of G6PD Mediterranean mutation in the deficient people in the city of Zahedan.Materials and Methods: In this descriptive cross-sectional study, blood samples of 1440 male individuals, who were referred to Zahedan Reference Laboratory for premarital testing, were examined for G6PD deficiency using fluorescent spot test. Genomic DNA from blood of people with G6PD deficiency was extracted by DNA extraction kit. Mediterranean mutation was identified using PCR-RFLP method.Results: 101 out of 1440 subjects had G6PD deficiency. Therefore prevalence of G6PD deficiency in Zahedan city was estimated about 7%. Mediterranean mutation frequency in patients with defect of G6PD was estimated 84.2% (85 out of 101 patients and 15.8% (16 out of 101 patients did not have mutation Mediterranean. The frequency of G6PD deficiency was expressed as a percentage of total cases and Mediterranean mutation prevalence was expressed as a percentage of total impaired individuals.Conclusion: The result of this study showed that the frequency of G6PD deficiency in Zahedan city is lower than other cities of sistan and baluchestan province. Dominant mutation in present study was Mediterranean type and its frequency was very similar with prevalence of this mutation in other parts of Iran.

  3. Importance of glucose-6-phosphate dehydrogenase (G6PDH) for vanillin tolerance in Saccharomyces cerevisiae.

    Science.gov (United States)

    Nguyen, Trinh Thi My; Kitajima, Sakihito; Izawa, Shingo

    2014-09-01

    Vanillin is derived from lignocellulosic biomass and, as one of the major biomass conversion inhibitors, inhibits yeast growth and fermentation. Vanillin was recently shown to induce the mitochondrial fragmentation and formation of mRNP granules such as processing bodies and stress granules in Saccharomyces cerevisiae. Furfural, another major biomass conversion inhibitor, also induces oxidative stress and is reduced in an NAD(P)H-dependent manner to its less toxic alcohol derivative. Therefore, the pentose phosphate pathway (PPP), through which most NADPH is generated, plays a role in tolerance to furfural. Although vanillin also induces oxidative stress and is reduced to vanillyl alcohol in a NADPH-dependent manner, the relationship between vanillin and PPP has not yet been investigated. In the present study, we examined the importance of glucose-6-phosphate dehydrogenase (G6PDH), which catalyzes the rate-limiting NADPH-producing step in PPP, for yeast tolerance to vanillin. The growth of the null mutant of G6PDH gene (zwf1Δ) was delayed in the presence of vanillin, and vanillin was efficiently reduced in the culture of wild-type cells but not in the culture of zwf1Δ cells. Furthermore, zwf1Δ cells easily induced the activation of Yap1, an oxidative stress responsive transcription factor, mitochondrial fragmentation, and P-body formation with the vanillin treatment, which indicated that zwf1Δ cells were more susceptible to vanillin than wild type cells. These findings suggest the importance of G6PDH and PPP in the response of yeast to vanillin.

  4. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available BACKGROUND: RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail. METHODOLOGY/PRINCIPAL FINDINGS: In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought. CONCLUSIONS/SIGNIFICANCE: RDR1 is regulated by a much broader range of phytohormones than previously thought

  5. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  6. Analysis of methionine synthase (rs1805087) gene polymorphism in autism patients in Northern Iran.

    Science.gov (United States)

    Haghiri, Rosa; Mashayekhi, Farhad; Bidabadi, Elham; Salehi, Zivar

    2016-01-01

    Autism is characterized by impairment in reciprocal communication and speech, repetitive behaviors, and social communication. The genetic and environmental factors play roles in the pathogenesis of autism. It was recently shown that the genes involved in the folate/homocysteine pathway may be risk factors for autistic children. One of the genes that may be the risk factor for autism is Methionine synthase (MTR). MTR is responsible for the regeneration of methionine from homocysteine. The aim of this study was to analyze the association of MTR A2756G gene polymorphism (rs1805087) and the risk of autism in a population in northern Iran. The prevalence of MTR A2756G polymorphism was determined in 108 children with autism and 130 controls in northern Iran. Genotypes and allele frequencies were determined in patients and controls by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The prevalence of genotype frequencies of AA, AG and GG in autistic children were 57.41%, 22.22% and 20.37%, respectively, while in controls were 61.54%, 32.31% and 6.15%, respectively. There was significant difference between the MTR polymorphism distribution in control and patient groups. The prevalence of allele frequencies of A and G in autistic children were 0.69 and 0.31, respectively and in controls were 0.78 and 0.22, respectively (P=0.03). The MTR G allele conferred a 1.6-fold increased risk to autism relative to the A allele (95% CI=1.06-2.41, P=0.02). The present study suggests that the G allele of MTR A2756G polymorphism is associated with an increased risk of autism.

  7. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  8. Polymorphism of Methionine Synthase Gene in Nuclear Families of Congenital Heart Disease

    Institute of Scientific and Technical Information of China (English)

    WEN-LI ZHU; JUN CHENG; JING-JING DAO; RU-BING ZHAO; LI-YING YAN; SHU-QING LI; AND YONG LI

    2004-01-01

    Objective To investgate the relation of methionine synthase (MS) gene variation with congenital heart disease (CHD) phenotype. Methods One hundred and ninety three CHD patients (94 males and 99 females) and their biological parents (nuclear families) in Liaoning Province were selected as the case group, and another 104 normal persons (60 males and 44 females) and their parents without family history of birth defects as the control group. For all subjects the polymorphism of MS gene A2756G locus was examined by PCR-RFLP method. Results In offspring of the control group the frequencies of MS genotype (+/-) and allele (+) were 10.7% and 5.3%, without existence of homozygote. The MS genotype distribution and allele frequencies of CHD patients and their mothers were not significantly different from the control (P > 0.05). The frequency of allele (+)in case fathers (5.0 %) was apparently lower than that in the control (9.1%, P=0.060), and the odds ratio (OR) was 0.53 (95% CI: 0.25-1.09). There was no difference in parents' genotype combination between the two groups, and in genotype distribution among different types of CHD. Analysis of genetic transmission indicated that mutation allele (+) existed transmission disequilibrium in CHD nuclear families. The percentage of allele (+) transmitted from parents was lower than that allele (-)with OR 0.26 (95% CI: 0.11-0.60). Conclusion MS gene variation in parents is associated with occurrence of CHD in offspring, and mutation allele (+) in parents may be related with the decrease of CHD risk in offspring.

  9. Identification and characterization of the Arabidopsis gene encoding the tetrapyrrole biosynthesis enzyme uroporphyrinogen III synthase.

    Science.gov (United States)

    Tan, Fui-Ching; Cheng, Qi; Saha, Kaushik; Heinemann, Ilka U; Jahn, Martina; Jahn, Dieter; Smith, Alison G

    2008-03-01

    UROS (uroporphyrinogen III synthase; EC 4.2.1.75) is the enzyme responsible for the formation of uroporphyrinogen III, the precursor of all cellular tetrapyrroles including haem, chlorophyll and bilins. Although UROS genes have been cloned from many organisms, the level of sequence conservation between them is low, making sequence similarity searches difficult. As an alternative approach to identify the UROS gene from plants, we used functional complementation, since this does not require conservation of primary sequence. A mutant of Saccharomyces cerevisiae was constructed in which the HEM4 gene encoding UROS was deleted. This mutant was transformed with an Arabidopsis thaliana cDNA library in a yeast expression vector and two colonies were obtained that could grow in the absence of haem. The rescuing plasmids encoded an ORF (open reading frame) of 321 amino acids which, when subcloned into an Escherichia coli expression vector, was able to complement an E. coli hemD mutant defective in UROS. Final proof that the ORF encoded UROS came from the fact that the recombinant protein expressed with an N-terminal histidine-tag was found to have UROS activity. Comparison of the sequence of AtUROS (A. thaliana UROS) with the human enzyme found that the seven invariant residues previously identified were conserved, including three shown to be important for enzyme activity. Furthermore, a structure-based homology search of the protein database with AtUROS identified the human crystal structure. AtUROS has an N-terminal extension compared with orthologues from other organisms, suggesting that this might act as a targeting sequence. The precursor protein of 34 kDa translated in vitro was imported into isolated chloroplasts and processed to the mature size of 29 kDa. Confocal microscopy of plant cells transiently expressing a fusion protein of AtUROS with GFP (green fluorescent protein) confirmed that AtUROS was targeted exclusively to chloroplasts in vivo.

  10. Hereditary sideroblastic anemia and glucose-6-phosphate dehydrogenase deficiency in a Negro family.

    Science.gov (United States)

    Prasad, A S; Tranchida, L; Konno, E T; Berman, L; Albert, S; Sing, C F; Brewer, G J

    1968-06-01

    Detailed clinical and genetic studies have been performed in a Negro family, which segregated for sex-linked sideroblastic anemia and glucose-6-phosphate dehydrogenase (G-6-DP) deficiency. This is the first such pedigree reported. Males affected with sideroblastic anemia had growth retardation, hypochromic microcytic anemia, elevated serum iron, decreased unsaturated iron-binding capacity, increased (59)Fe clearance, low (59)Fe incorporation into erythrocytes, normal erythrocyte survival ((51)Cr), normal hemoglobin electrophoretic pattern, erythroblastic hyperplasia of marrow with increased iron, and marked increase in marrow sideroblasts, particularly ringed sideroblasts. Perinuclear deposition of ferric aggregates was demonstrated to be intramitochondrial by electron microscopy. Female carriers of the sideroblastic gene were normal but exhibited a dimorphic population of erythrocytes including normocytic and microcytic cells. The bone marrow studies in the female (mother) showed ringed marrow sideroblasts. Studies of G-6-PD involved the methemoglobin elution test for G-6-PD activity of individual erythrocytes, quantitative G-6-PD assay, and electrophoresis. In the pedigree, linkage information was obtained from a doubly heterozygous woman, four of her sons, and five of her daughters. Three sons were doubly affected, and one was normal. One daughter appeared to be a recombinant. The genes appeared to be linked in the coupling phase in the mother. The maximum likelihood estimate of the recombination value was 0.14. By means of Price-Jones curves, the microcytic red cells in peripheral blood were quantitated in female carriers. The sideroblast count in the bone marrow in the mother corresponded closely to the percentage of microcytic cells in peripheral blood. This is the second example in which the cellular expression of a sex-linked trait has been documented in the human red cells, the first one being G-6-PD deficiency. The coexistence of the two genes in doubly

  11. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  12. A third phytoene synthase is devoted to abiotic stress-induced abscisic acid formation in rice and defines functional diversification of phytoene synthase genes.

    Science.gov (United States)

    Welsch, Ralf; Wüst, Florian; Bär, Cornelia; Al-Babili, Salim; Beyer, Peter

    2008-05-01

    We here report on the characterization of a novel third phytoene synthase gene (PSY) in rice (Oryza sativa), OsPSY3, and on the differences among all three PSY genes with respect to the tissue-specific expression and regulation upon various environmental stimuli. The two already known PSYs are under phytochrome control and involved in carotenoid biosynthesis in photosynthetically active tissues and exhibit different expression patterns during chloroplast development. In contrast, OsPSY3 transcript levels are not affected by light and show almost no tissue-specific differences. Rather, OsPSY3 transcripts are up-regulated during increased abscisic acid (ABA) formation upon salt treatment and drought, especially in roots. The simultaneous induction of genes encoding 9-cis-epoxycarotenoid dioxygenases (NCEDs), involved in the initial steps of ABA biosynthesis, indicate that decreased xanthophyll levels are compensated by the induction of the third PSY gene. Furthermore, OsPSY3 and the OsNCEDs investigated were also induced by the application of ABA, indicating positive feedback regulation. The regulatory differences are mirrored by cis-acting elements in the corresponding promoter regions, with light-responsive elements for OsPSY1 and OsPSY2 and an ABA-response element as well as a coupling element for OsPSY3. The investigation of the gene structures and 5' untranslated regions revealed that OsPSY1 represents a descendant of an ancient PSY gene present in the common ancestor of monocots and dicots. Since the genomic structures of OsPSY2 and OsPSY3 are comparable, we conclude that they originated from the most recent common ancestor, OsPSY1.

  13. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Science.gov (United States)

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  14. Molecular cloning of the human UMP synthase gene and characterization of point mutations in two hereditary orotic aciduria families

    Energy Technology Data Exchange (ETDEWEB)

    Suchi, Mariko; Mizuno, Haruo; Tsuboi, Takashi [Nagoya City Univ. Medical School (Japan)] [and others

    1997-03-01

    Uridine monophosphate (UMP) synthase is a bifunctional enzyme catalyzing the last two steps of de novo pyrimidine biosynthesis, orotate phosphoribosyltransferase (OPRT) and orotidine-5{prime}-monophosphate decarboxylase (ODC). Loss of either enzymatic activity results in hereditary orotic aciduria, a rare autosomal recessive disorder characterized by retarded growth, anemia, and excessive urinary excretion of orotic acid. We have isolated the UMP synthase chromosomal gene from a {lambda}EMBL-3 human genomic library and report a single-copy gene spanning {approximately}15 kb. The UMP synthase genomic structure encodes six exons ranging in size from 115 bp to 672 bp, and all splicing junctions adhere to the canonical GT/AG rule. Cognate promoter elements implicated in glucocorticoid- and cAMP-mediated regulation as well as in liver-, myeloid-, and lymphocyte-specific expression are located within the 5{prime} flanking sequence. Molecular investigation of UMP synthase deficiency in a Japanese orotic aciduria patient revealed mutations R96G (A- to-G transition; nt 286) and G429R (G-to-C transversion; nt 1285) in one allele and V109G (T-to-G transversion; nt 326) in the other allele. Expression of human UMP synthase cDNAs containing these mutations in pyrimidine auxotrophic Escherichia coli and in recombinant baculovirus-infected Sf21 cells demonstrates impaired activity presumably associated with the urinary orotic acid substrate accumulations observed in vivo. We further establish the identity of two polymorphisms, G213A ({nu} = .26) and 440 Gpoly ({nu} = .27) located in exons 3 and 6, respectively, which did not significantly compromise either OPRT or ODC function. 76 refs., 5 figs., 7 tabs.

  15. Identification and characterization of the alpha-acetolactate synthase gene from Lactococcus lactis subsp. lactis biovar diacetylactis.

    Science.gov (United States)

    Marugg, J D; Goelling, D; Stahl, U; Ledeboer, A M; Toonen, M Y; Verhue, W M; Verrips, C T

    1994-01-01

    The conversion of 3-13C-labelled pyruvate in an acetoin-producing clone from a Lactococcus lactis subsp. lactis biovar diacetylactis strain DSM 20384 plasmid bank in Escherichia coli was studied by 13C nuclear magnetic resonance analysis. The results showed that alpha-acetolactate was the first metabolic product formed from pyruvate, whereas acetoin appeared at a much slower rate and reached only low concentrations. This alpha-acetolactate production shows that the cells express the gene for alpha-acetolactate synthase (als). Nucleotide sequence analysis identified an open reading frame encoding a protein of 554 amino acids. The deduced amino acid sequence exhibits extensive similarities to those of known alpha-acetolactate synthases from both prokaryotes and eukaryotes. The als gene is expressed on a monocistronic transcriptional unit, which is transcribed from a promoter located just upstream of the coding region. Images PMID:8017926

  16. An update to polyketide synthase and non-ribosomal synthetase genes and nomenclature in Fusarium.

    Science.gov (United States)

    Hansen, Frederik T; Gardiner, Donald M; Lysøe, Erik; Fuertes, Patricia Romans; Tudzynski, Bettina; Wiemann, Philipp; Sondergaard, Teis Esben; Giese, Henriette; Brodersen, Ditlev E; Sørensen, Jens Laurids

    2015-02-01

    Members of the genus Fusarium produce a plethora of bioactive secondary metabolites, which can be harmful to humans and animals or have potential in drug development. In this study we have performed comparative analyses of polyketide synthases (PKSs) and non-ribosomal peptide synthetases (NRPSs) from ten different Fusarium species including F. graminearum (two strains), F. verticillioides, F. solani, F. culmorum, F. pseudograminearum, F. fujikuroi, F. acuminatum, F. avenaceum, F. equiseti, and F. oxysporum (12 strains). This led to identification of 52 NRPS and 52 PKSs orthology groups, respectively, and although not all PKSs and NRPSs are assumed to be intact or functional, the analyses illustrate the huge secondary metabolite potential in Fusarium. In our analyses we identified a core collection of eight NRPSs (NRPS2-4, 6, 10-13) and two PKSs (PKS3 and PKS7) that are conserved in all strains analyzed in this study. The identified PKSs and NRPSs were named based on a previously developed classification system (www.FusariumNRPSPKS.dk). We suggest this system be used when PKSs and NRPSs have to be classified in future sequenced Fusarium strains. This system will facilitate identification of orthologous and non-orthologous NRPSs and PKSs from newly sequenced Fusarium genomes and will aid the scientific community by providing a common nomenclature for these two groups of genes/enzymes.

  17. Cloning and expression analysis of chalcone synthase gene from Coleus forskohlii

    Indian Academy of Sciences (India)

    PRAVEEN AWASTHI; VIDUSHI MAHAJAN; VIJAY LAKSHMI JAMWAL; NITIKA KAPOOR; SHAFAQ RASOOL; YASHBIR S. BEDI; SUMIT G. GANDHI

    2016-09-01

    Flavonoids are an important class of secondary metabolites that play various roles in plants such as mediating defense, floral pigmentation and plant–microbe interaction. Flavonoids are also known to possess antioxidant and antimicrobial activities. Coleus forskohlii (Willd.) Briq. (Lamiaceae) is an important medicinal herb with a diverse metabolic profile, including production of a flavonoid, genkwanin. However, components of the flavonoid pathway have not yet been studied in this plant. Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plantCHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it encodes a protein of 391 amino acids with a molecular weight of 42.75 kDa and pI 6.57. Expression analysis of CfCHS in different tissues and elicitor treatments showed that methyl jasmonate (MeJA) strongly induced its expression. Total flavonoids content and antioxidant activity of C.forskohlii also got enhanced in response to MeJA, which correlated with increased CfCHS expression. Induction ofCfCHS by MeJA suggest its involvement in production of flavonoids, providing protection from microbes during herbivory or mechanical wounding. Further, ourin silico predictions and experimental data suggested that CfCHS may be posttranscriptionally regulated by miR34.

  18. RNA Interference-mediated Silencing of Phytochelatin Synthase Gene Reduce Cadmium Accumulation in Rice Seeds

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Phytochelatins (PCs) play an important role in heavy metal resistance and accumulation. To reduce the accumulation of cadmium (Cd) in rice seeds, the expression of phytochelatin synthase (PCS) gene OsPCS1 was suppressed by RNA interference (RNAi). A hairpin construct of a PCS fragment was designed in the pRNAi-OsPCS1 under the control of ZMM1, a seed-specific promoter from maize. The construct was introduced into rice (japonica) through Agrobacterium tumefaciens. The RNAi rice plantlets were selected and cultivated in pots exposured to 10 mg/kg Cd. The transcriptional level of OsPCS1 declined in seeds of some RNAi rice compared to the wild type. As a result Cd accumulation was reduced by about half in the seeds of RNAi rice. As expected, no apparent difference of growth appeared between RNAi and wild-type plants. The results suggest that this new approach can be used to control heavy metal accumulation in crops.

  19. Analysis of genetic variability and relationships among Mentha L. using the limonene synthase gene, LS.

    Science.gov (United States)

    Wang, Hai Tang; Yu, Xu; Liu, Yan; Liang, Cheng-Yuan; Li, Wei-Lin

    2013-07-25

    The genus Mentha comprises a group of aromatic plants with worldwide distribution. Because of frequent interspecific hybridization, the genetic relationships within the genus are not clearly understood. Limonene synthase, which catalyses the first committed step in the essential oil monoterpene biosynthetic pathway, is considered to be a possible rate limiting enzyme. With the homology-based cloning method, primers were designed according to cDNA sequence to amplify full-length DNA sequences in 13 Mentha samples from five species, using Perilla as an outgroup. Analyses of gene structure, length variation, GC-content, Ts/Tv ratio and evolutionary diversity were carried out. Consensus phylogenetic trees were obtained using maximum likelihood, neighbor-joining, and maximum parsimony, respectively, based on the full-length genomic DNA sequences, complete ORF coding sequences and predicted amino acid sequences. The results presented here based on the sequence of MhLS provide the first credibly supported genetic relationships for Mentha, which enables a basis for further mint taxonomy, cultivation and breeding.

  20. Cloning and expression analysis of chalcone synthase gene from Coleus forskohlii.

    Science.gov (United States)

    Awasthi, Praveen; Mahajan, Vidushi; Jamwal, Vijay Lakshmi; Kapoor, Nitika; Rasool, Shafaq; Bedi, Yashbir S; Gandhi, Sumit G

    2016-09-01

    Flavonoids are an important class of secondary metabolites that play various roles in plants such as mediating defense, floral pigmentation and plant-microbe interaction. Flavonoids are also known to possess antioxidant and antimicrobial activities. Coleus forskohlii (Willd.) Briq. (Lamiaceae) is an important medicinal herb with a diverse metabolic profile, including production of a flavonoid, genkwanin. However, components of the flavonoid pathway have not yet been studied in this plant. Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plant CHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it encodes a protein of 391 amino acids with a molecular weight of 42.75 kDa and pI 6.57. Expression analysis of CfCHS in different tissues and elicitor treatments showed that methyl jasmonate (MeJA) strongly induced its expression. Total flavonoids content and antioxidant activity of C. forskohlii also got enhanced in response to MeJA, which correlated with increased CfCHS expression. Induction of CfCHS by MeJA suggest its involvement in production of flavonoids, providing protection from microbes during herbivory or mechanical wounding. Further, our in silico predictions and experimental data suggested that CfCHS may be posttranscriptionally regulated by miR34.

  1. A CELLULOSE SYNTHASE (CESA) gene essential for gametophore morphogenesis in the moss Physcomitrella patens.

    Science.gov (United States)

    Goss, Chessa A; Brockmann, Derek J; Bushoven, John T; Roberts, Alison W

    2012-06-01

    In seed plants, different groups of orthologous genes encode the CELLULOSE SYNTHASE (CESA) proteins that are responsible for cellulose biosynthesis in primary and secondary cell walls. The seven CESA sequences of the moss Physcomitrella patens (Hedw.) B. S. G. form a monophyletic sister group to seed plant CESAs, consistent with independent CESA diversification and specialization in moss and seed plant lines. The role of PpCESA5 in the development of P. patens was investigated by targeted mutagenesis. The cesa5 knockout lines were tested for cellulose deficiency using carbohydrate-binding module affinity cytochemistry and the morphology of the leafy gametophores was analyzed by 3D reconstruction of confocal images. No defects were identified in the development of the filamentous protonema or in production of bud initials that normally give rise to the leafy gametophores. However, the gametophore buds were cellulose deficient and defects in subsequent cell expansion, cytokinesis, and leaf initiation resulted in the formation of irregular cell clumps instead of leafy shoots. Analysis of the cesa5 knockout phenotype indicates that a biophysical model of organogenesis can be extended to the moss gametophore shoot apical meristem.

  2. Phytoene Synthase Gene Cloning from Citrus sinensis Osbeck cv.Cara Cara and Its Prokaryotic Expression

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jian-cheng; TAO Neng-guo; TONG Zhu; DENG Xiu-xin

    2008-01-01

    Using the mRNA from the fruit of Cara Cara as the template,the cDNA of phytoene synthase(PSY)gene was amplified by reverse transcription polymerse chain reaction(RT-PCR).Sequence analysis indicated that the eDNA was of 1 520 bp,which had an open reading frame of 1 308 bp and encoded a protein of 436 amino acids.The homology analysis showed that PSY of Cara Cara shared high similarities of nucleotides and deduced amino acids with those in other plants up to more than 75 and 70%,respectively.A putative signal transit peptide for plastid targeting was found in the N-terminal region of PSY.The mature forms of PSY included a transmembrane(TM) domain.The recombinant plasmid pET-CitPSY was constructed by subeloning the full coding sequence of PSY eDNA into pET-28(+).After transformation of E.coil BL21 and induced by 1 mmol L-1 isopropyl-a-D-thiogalacropyranoside(IPTG),the fusion protein(6×His-PSY)with 52 kD was produced at a high level by prokaryotic expression system.The results of Western blot demonstrated that the fusion protein(6xHis-PSY)could be recognized by anti-6×His monoclonal antibody.The study could establish a basis for molecular improvement of Citrus fruit colors.

  3. Expression of monoamine transporters, nitric oxide synthase 3 and neurotrophin genes in antidepressant-stimulated astrocytes

    Directory of Open Access Journals (Sweden)

    Sarah eKittel-Schneider

    2012-04-01

    Full Text Available Background: There is increasing evidence that glial cells play a role in the pathomechanisms of mood disorders and the mode of action of antidepressant drugs. Methods: To examine whether there is a direct effect on the expression of different genes encoding proteins that have been implicated in the pathophysiology of affective disorders, primary astrocyte cell cultures from rats were treated with two different antidepressant drugs, imipramine and escitalopram, and the mRNA expression of brain derived neurotrophic factor (Bdnf, serotonin transporter (5Htt, dopamine transporter (Dat and endothelial nitric oxide synthase (Nos3 was examined. Results: Stimulation of astroglial cell culture with imipramine, a tricyclic antidepressant, lead to a significant increase of the Bdnf mRNA level whereas treatment with escitalopram did not. In contrast, 5Htt was not differentially expressed after antidepressant treatment. Finally, neither Dat nor Nos3 mRNA expression was detected in cultured astrocytes. Conclusions: These data provide further evidence for a role of astroglial cells in the molecular mechanisms of action of antidepressants.

  4. Endothelial nitric oxide synthase: From biochemistry and gene structure to clinical implications of NOS3 polymorphisms.

    Science.gov (United States)

    Oliveira-Paula, Gustavo H; Lacchini, Riccardo; Tanus-Santos, Jose E

    2016-01-10

    Nitric oxide (NO) is an important vasodilator with a well-established role in cardiovascular homeostasis. While mediator is synthesized from L-arginine by neuronal, endothelial, and inducible nitric oxide synthases (NOS1,NOS3 and NOS2 respectively), NOS3 is the most important isoform for NO formation in the cardiovascular system. NOS3 is a dimeric enzyme whose expression and activity are regulated at transcriptional, posttranscriptional,and posttranslational levels. The NOS3 gene, which encodes NOS3, exhibits a number of polymorphic sites including single nucleotide polymorphisms (SNPs), variable number of tandem repeats (VNTRs), microsatellites, and insertions/deletions. Some NOS3 polymorphisms show functional effects on NOS3 expression or activity, thereby affecting NO formation. Interestingly, many studies have evaluated the effects of functional NOS3 polymorphisms on disease susceptibility and drug responses. Moreover, some studies have investigated how NOS3 haplotypes may impact endogenous NO formation and disease susceptibility. In this article,we carried out a comprehensive review to provide a basic understanding of biochemical mechanisms involved in NOS3 regulation and how genetic variations in NOS3 may translate into relevant clinical and pharmacogenetic implications.

  5. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    Science.gov (United States)

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  6. Endothelial nitric oxide synthase gene polymorphism and elite endurance athlete status: the Genathlete study.

    Science.gov (United States)

    Wolfarth, B; Rankinen, T; Mühlbauer, S; Ducke, M; Rauramaa, R; Boulay, M R; Pérusse, L; Bouchard, C

    2008-08-01

    In the Genathlete study, we examined the contribution of three polymorphisms in the endothelial nitric oxide synthase (NOS3) gene to discriminate elite endurance athletes (EEA) from sedentary controls (SC). The EEA group included a total of 316 Caucasian males with a VO2max >75 mL/kg. The SC group comprised 299 unrelated sedentary Caucasian males who had VO2max values below 50 mL/kg. The polymerase chain reaction technique was used to amplify a microsatellite (CA)(n) repeat in intron 13, a 27 bp repeat in intron 4 and a third fragment in exon 7 containing the Glu298Asp SNP. No difference was found between the EEA and SC groups for the 27 bp repeat and the Glu298Asp polymorphism. Chi-square analysis of the overall allelic distribution of the (CA)(n) repeat revealed no significant difference between the two groups (P=0.135). However, comparing carriers and non-carriers for the most common (CA)(n) repeat alleles, we found significant differences between SC and EEA, with more EEA subjects carrying the 164 bp allele (P=0.007). In summary, we found suggestive evidence that the 164 bp allele of the (CA)(n) repeat in intron 13 is associated with EEA status and may account for some of the differences between EEA and SC.

  7. Clinical Significance of a Myeloperoxidase Gene Polymorphism and Inducible Nitric Oxide Synthase Expression in Cirrhotic Patients with Hepatopulmonary Syndrome

    Institute of Scientific and Technical Information of China (English)

    王燕颖; 王文多; 张艳霞; 赵欣; 杨东亮

    2010-01-01

    The clinical significance of a myeloperoxidase (MPO) gene polymorphism and inducible nitric oxide synthase (iNOS) expression in cirrhotic patients with hepatopulmonary syndrome (HPS) was explored. Enrolled subjects were divided into three groups according to their disease/health conditions: the HPS group (cirrhotic patients with HPS; n=63), the non-HPS group (cirrhotic patients without HPS; n=182), and the control group (healthy subjects without liver disease; n=35). The distribution of the MPO-463 G/A geno...

  8. Rapid screening of an ordered fosmid library to clone multiple polyketide synthase genes of the phytopathogenic fungus Cladosporium phlei.

    Science.gov (United States)

    So, Kum-Kang; Kim, Jung-Mi; Nguyen, Ngoc-Luong; Park, Jin-Ah; Kim, Beom-Tae; Park, Seung-Moon; Hwang, Ki-Jun; Kim, Dae-Hyuk

    2012-12-01

    In previous studies, the biological characteristics of the fungus Cladosporium phlei and its genetic manipulation by transformation were assessed to improve production of the fungal pigment, phleichrome, which is a fungal perylenequinone that plays an important role in the production of a photodynamic therapeutic agent. However, the low production of this metabolite by the wild-type strain has limited its application. Thus, we attempted to clone and characterize the genes that encode polyketide synthases (PKS), which are responsible for the synthesis of fungal pigments such as perylenequinones including phleichrome, elsinochrome and cercosporin. Thus, we performed genomic DNA PCR using 11 different combinations of degenerate primers targeting conserved domains including β-ketoacyl synthase and acyltransferase domains. Sequence comparison of the PCR amplicons revealed a high homology to known PKSs, and four different PKS genes showing a high similarity to three representative types of PKS genes were amplified. To obtain full-length PKS genes, an ordered gene library of a phleichrome-producing C. phlei strain (ATCC 36193) was constructed in a fosmid vector and 4800 clones were analyzed using a simple pyramidal arrangement system. This hierarchical clustering method combines the efficiency of PCR with enhanced specificity. Among the three representative types of PKSs, two reducing, one partially reducing, and one non-reducing PKS were identified. These genes were subsequently cloned, sequenced, and characterized. Biological characterization of these genes to determine their roles in phleichrome production is underway, with the ultimate aim of engineering this pathway to overproduce the desired substance.

  9. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Deqiang Tai

    Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

  10. Association of Nitric Oxide Synthase2 gene polymorphisms with leprosy reactions in northern Indian population.

    Science.gov (United States)

    Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja

    2017-07-01

    The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Late-onset cutaneous porphyria in a patient heterozygous for a uroporphyrinogen III synthase gene mutation.

    Science.gov (United States)

    Aguilera, P; Badenas, C; Whatley, S D; To-Figueras, J

    2016-12-01

    Deficiency of uroporphyrinogen III synthase (UROS) causes congenital erythropoietic porphyria (CEP). The disease, originating from the inheritance of mutations within the UROS gene, presents a recessive form of transmission. In a few patients, a late-onset CEP-like phenotype without UROS mutations appears to be associated with a myelodysplastic syndrome. We report a 60-year-old man with late-onset signs of cutaneous porphyria and accumulation in urine, plasma and faeces of type I porphyrin isomers characteristic of CEP. Analysis of DNA from peripheral leucocytes, skin and bone marrow aspirate showed that he was a heterozygous carrier of a Cys73Arg (c.217 T>C) mutation within UROS. Sequencing of cDNA from peripheral blood confirmed heterozygosity and expression of the normal allele. Measurement of UROS enzymatic activity in erythrocytes showed values ~70% of normal, indirectly indicating expression of the normal allele. Differently from other cases of late-onset uroporphyria, the patient did not present thrombocytopenia or any evidence of a myelodysplastic syndrome. Five years of clinical follow-up showed persistence of skin signs and increased excretion of porphyrins, independently of lifestyle factors or changes in medication regimes. We hypothesize acquired mosaicism (in the bone marrow) affecting the UROS gene. Thus, unstable cellular clones initiated overproduction of isomer I porphyrins leading to a CEP phenotype. This could be explained either by a clonal expansion of the porphyric (Cys73Arg) allele or by loss of function of the normal allele. Cellular turnover would facilitate release of uroporphyrins into circulation and subsequent skin lesions. This is the first case of a CEP heterozygous carrier presenting clinical manifestations.

  12. Molecular cloning and characterization of three isoprenyl diphosphate synthase genes from alfalfa.

    Science.gov (United States)

    Sun, Yan; Long, Ruicai; Kang, Junmei; Zhang, Tiejun; Zhang, Ze; Zhou, He; Yang, Qingchuan

    2013-02-01

    Isoprenoid is the precursor for the biosynthesis of saponins, abscisic acid, gibberellins, chlorophylls and many other products in plants. Saponins are an important group of bioactive plant natural products. The alfalfa (Medicago sativa L.) saponins are glycosides of different triterpene aglycones and possess many biological activities. We isolated three genes (MsFPPS, MsGPPS and MsGGPPS) encoding isoprenyl diphosphate synthases (IDS) from alfalfa via a homology-based PCR approach. The enzyme activity assay of purified recombined MsFPPS and MsGGPPS expressed in Escherichia coli indicated that they all had IDS activity. Expression analysis of the three genes in different alfalfa tissues using real time PCR displayed that they were expressed in all tissues although they had a different expression patterns. MsFPPS and MsGPS displayed a significant increase in transcript level in response to methyl jasmonate, but the transcript level of MsGGPPS decreased obviously. To elucidate the functions of the three IDSs, their overexpression driven by a constitutive cauliflower mosaic virus-35S promoter in tobacco plants was applied and analyzed. The T(0) transgenic plants of MsFPPS showed high levels of squalene content when compared with control. However, no differences were detected in T(0) transgenic plants of MsGPPS and MsGGPPS. In addition, the overexpression of MsFPPS induced senescence response in transgenic plant leaves. This result may indicate that MsFPPS performs a role not only in phytosterol and triterpene biosynthesis, but also in growth regulation.

  13. The level of glucose-6-phosphate dehydrogenase activity strongly influences xylose fermentation and inhibitor sensitivity in recombinant Saccharomyces cerevisiae strains

    DEFF Research Database (Denmark)

    Jeppsson, M.; Johansson, B.; Jensen, Peter Ruhdal

    2003-01-01

    Disruption of the ZWF1 gene encoding glucose-6-phosphate dehydrogenase (G6PDH) has been shown to reduce the xylitol yield and the xylose consumption in the xylose-utilizing recombinant Saccharomyces cerevisiae strain TMB3255. In the present investigation we have studied the influence of different...... consumption, respectively, compared with the ZWF1-disrupted strain. Both strains exhibited decreased xylitol yields (0.13 and 0.19 g/g xylose) and enhanced ethanol yields (0.36 and 0.34 g/g xylose) compared with the control strain TMB3001 (0.29 g xylitol/g xylose, 0.31 g ethanol/g xylose). Cytoplasmic...... than the strain with wild-type G6PDH-activity, which suggested that the availability of intracellular NADPH correlated with tolerance towards lignocellulose-derived inhibitors. Low G6PDH-activity strains were also more sensitive to H2O2 than the control strain TMB3001....

  14. Glucose-6-phosphate-dehydrogenase deficiency and its correlation with other risk factors in jaundiced newborns in Southern Brazil

    Institute of Scientific and Technical Information of China (English)

    Clarissa Gutirrez Carvalho; Simone Martins Castro; Ana Paula Santin; Carina Zaleski; Felipe Gutirrez Carvalho; Roberto Giugliani

    2011-01-01

    Objective:To evaluate the correlation between glucose-6-phosphate-dehydrogenase (G6PD) deficiency and neonatal jaundice.Methods: Prospective, observational case-control study was conducted on490 newborns admitted to Hospital de Clínicas de Porto Alegre for phototherapy, who all experienced35 or more weeks of gestation, from March to December2007. Enzymatic screening ofG6PD activity was performed, followed byPCR.Results:There was prevalence of4.6% and a boy-girl ratio of3:1 in jaundiced newborns. No jaundiced neonate withABO incompatibility presented G6PD deficiency, and no Mediterranean mutation was found. A higher proportion of deficiency was observed in Afro-descendants. There was no association withUGT1A1 variants. Conclusions:G6PD deficiency is not related to severe hyperbilirubinemia and considering the high miscegenation in this area of Brazil, other gene interactions should be investigated.

  15. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Directory of Open Access Journals (Sweden)

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  16. Expression of an(E)-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Institute of Scientific and Technical Information of China (English)

    Xiudao; Yu; Yongjun; Zhang; Youzhi; Ma; Zhaoshi; Xu; Genping; Wang; Lanqin; Xia

    2013-01-01

    Aphids are major agricultural pests that cause significant yield losses in crop plants each year.(E)-β-farnesene(EβF) is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint(Mentha × piperita), two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint(Mentha asiatica). Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d-1g-1of fresh tissue. Tritrophic interactions involving peach aphids(Myzus persicae), and predatory lacewing(Chrysopa septempunctata) larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  17. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  18. The reversed terminator of octopine synthase gene on the Agrobacterium Ti plasmid has a weak promoter activity in prokaryotes.

    Science.gov (United States)

    Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu

    2010-06-01

    Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.

  19. Beta-D-glycan synthases and the CesA gene family: lessons to be learned from the mixed-linkage (1-->3),(1-->4)beta-D-glucan synthase.

    Science.gov (United States)

    Vergara, C E; Carpita, N C

    2001-09-01

    Cellulose synthase genes (CesAs) encode a broad range of processive glycosyltransferases that synthesize (1-->4)beta-D-glycosyl units. The proteins predicted to be encoded by these genes contain up to eight membrane-spanning domains and four 'U-motifs' with conserved aspartate residues and a QxxRW motif that are essential for substrate binding and catalysis. In higher plants, the domain structure includes two plant-specific regions, one that is relatively conserved and a second, so-called 'hypervariable region' (HVR). Analysis of the phylogenetic relationships among members of the CesA multi-gene families from two grass species, Oryza sativa and Zea mays, with Arabidopsis thaliana and other dicotyledonous species reveals that the CesA genes cluster into several distinct sub-classes. Whereas some sub-classes are populated by CesAs from all species, two sub-classes are populated solely by CesAs from grass species. The sub-class identity is primarily defined by the HVR, and the sequence in this region does not vary substantially among members of the same sub-class. Hence, we suggest that the region is more aptly termed a 'class-specific region' (CSR). Several motifs containing cysteine, basic, acidic and aromatic residues indicate that the CSR may function in substrate binding specificity and catalysis. Similar motifs are conserved in bacterial cellulose synthases, the Dictyostelium discoideum cellulose synthase, and other processive glycosyltransferases involved in the synthesis of non-cellulosic polymers with (1-->4)beta-linked backbones, including chitin, heparan, and hyaluronan. These analyses re-open the question whether all the CesA genes encode cellulose synthases or whether some of the sub-class members may encode other non-cellulosic (1-->4)beta-glycan synthases in plants. For example, the mixed-linkage (1-->3)(1-->4)beta-D-glucan synthase is found specifically in grasses and possesses many features more similar to those of cellulose synthase than to those of

  20. Nitric oxide synthase 3 gene variants and colorectal cancer: a meta-analysis.

    Science.gov (United States)

    Chen, Yang; Li, Jie; Guo, Yun; Guo, Xiao-Yun

    2014-01-01

    Colorectal cancer (CRC) is the worldwide disease which causes enormous losses every year. Recent studies suggested that environmental and gene factors might be the etiologies in increasing the risk of morbidity. Nitric oxide synthase 3 (NOS3) gene polymorphisms are said to be associated with CRC risk but the conclusion is still controversial. Pubmed and HuGENet databases up to December 2013 were used in this meta-analysis. Three different certain genotypic models were applied, namely dominant (AA+AC versus CC), recessive (AA versus AC+CC), per-allele analysis (A vs C). In addition, information on tumor sites and pathologic stages was collected. The strength of associations was assessed through combining odds ratio (OR) and 95% confidence interval (CI). Finally, five and three studies about the rs1799983 and rs2070744 were covered in the analysis with 2,745 cases and 2,478 controls. Three models were applied, but no significant association was found for NOS3 G894T/rs1799983 (dominant: OR=0.999, 95%CI=0.797-1.253, I2=63.8%; recessive: OR=0.924, 95%CI=0.589-1.450, I2=59.3%; allele analysis: OR=0.979, 95%CI=0.788-1.216, I2=74.9%) and T-786C/rs2070744 (dominant: OR=1.138, 95%CI=0.846-1.530, I2=67.9%; recessive: OR=0.956, 95%CI=0.708-1.291, I2=0.0%; allele analysis: OR=1.110, 95%CI=0.865-1.425, I2=69.4%). The same results were also obtained for tumor sites and pathologic stage subgroups. After further analyzing the NOS3 gene, rs1799983 as the tag- and functional SNP was presented. On the basis of this meta-analysis and the characteristics of the NOS3 gene, we suggested rs1799983 might be a key locus associated with CRC risk. Further prospective studies were needed to make more comprehensive explanation of the associations.

  1. N-acetylglucosamine 6-phosphate deacetylase (nagA is required for N-acetyl glucosamine assimilation in Gluconacetobacter xylinus.

    Directory of Open Access Journals (Sweden)

    Vikas Yadav

    Full Text Available Metabolic pathways for amino sugars (N-acetylglucosamine; GlcNAc and glucosamine; Gln are essential and remain largely conserved in all three kingdoms of life, i.e., microbes, plants and animals. Upon uptake, in the cytoplasm these amino sugars undergo phosphorylation by phosphokinases and subsequently deacetylation by the enzyme N-acetylglucosamine 6-phosphate deacetylase (nagA to yield glucosamine-6-phosphate and acetate, the first committed step for both GlcNAc assimilation and amino-sugar-nucleotides biosynthesis. Here we report the cloning of a DNA fragment encoding a partial nagA gene and its implications with regard to amino sugar metabolism in the cellulose producing bacterium Glucoacetobacter xylinus (formally known as Acetobacter xylinum. For this purpose, nagA was disrupted by inserting tetracycline resistant gene (nagA::tet(r; named as ΔnagA via homologous recombination. When compared to glucose fed conditions, the UDP-GlcNAc synthesis and bacterial growth (due to lack of GlcNAc utilization was completely inhibited in nagA mutants. Interestingly, that inhibition occured without compromising cellulose production efficiency and its molecular composition under GlcNAc fed conditions. We conclude that nagA plays an essential role for GlcNAc assimilation by G. xylinus thus is required for the growth and survival for the bacterium in presence of GlcNAc as carbon source. Additionally, G. xylinus appears to possess the same molecular machinery for UDP-GlcNAc biosynthesis from GlcNAc precursors as other related bacterial species.

  2. Control of Enzyme IIscr and Sucrose-6-Phosphate Hydrolase Activities in Streptococcus mutans by Transcriptional Repressor ScrR Binding to the cis-Active Determinants of the scr Regulon

    OpenAIRE

    Wang, Bing; Kuramitsu, Howard K.

    2003-01-01

    In Streptococcus mutans, enzyme IIscr and sucrose-6-phosphate hydrolase are two important enzymes in the transport and metabolism of dietary sucrose. The scr regulon of S. mutans is composed of three genes, scrA and scrB, which code for enzyme IIscr and sucrose-6-phosphate hydrolase, respectively, and scrR, which codes for a GalR-LacI-type transcription regulator. It was previously shown that expression of both scrA and scrB is similarly induced by sucrose. Mutation in the scrR gene resulted ...

  3. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    Science.gov (United States)

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively).

  4. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  5. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  6. Three nicotianamine synthase genes isolated from maize are differentially regulated by iron nutritional status.

    Science.gov (United States)

    Mizuno, Daichi; Higuchi, Kyoko; Sakamoto, Tatsuya; Nakanishi, Hiromi; Mori, Satoshi; Nishizawa, Naoko K

    2003-08-01

    Nicotianamine synthase (NAS) is an enzyme that is critical for the biosynthesis of the mugineic acid family of phytosiderophores in graminaceous plants, and for the homeostasis of metal ions in nongraminaceous plants. We isolated one genomic NAS clone, ZmNAS3, and two cDNA NAS clones, ZmNAS1 and ZmNAS2, from maize (Zea mays cv Alice). In agreement with the increased secretion of phytosiderophores with Fe deficiency, ZmNAS1 and ZmNAS2 were positively expressed only in Fe-deficient roots. In contrast, ZmNAS3 was expressed under Fe-sufficient conditions, and was negatively regulated by Fe deficiency. This is the first report describing down-regulation of NAS gene expression in response to Fe deficiency in plants, shedding light on the role of nicotianamine in graminaceous plants, other than as a precursor in phytosiderophore production. ZmNAS1-green fluorescent protein (sGFP) and ZmNAS2-sGFP were localized at spots in the cytoplasm of onion (Allium cepa) epidermal cells, whereas ZmNAS3-sGFP was distributed throughout the cytoplasm of these cells. ZmNAS1 and ZmNAS3 showed NAS activity in vitro, whereas ZmNAS2 showed none. Due to its duplicated structure, ZmNAS2 was much larger (65.8 kD) than ZmNAS1, ZmNAS3, and previously characterized NAS proteins (30-38 kD) from other plant species. We reveal that maize has two types of NAS proteins based on their expression pattern and subcellular localization.

  7. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    Science.gov (United States)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P polymorphism on the glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  8. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

    1999-01-01

    Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth......Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....

  9. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus tereticornis

    Indian Academy of Sciences (India)

    Balachandran Karpaga Raja Sundari; Modhumita Ghosh Dasgupta

    2014-08-01

    Cellulose synthases (CesA) represent a group of -1, 4 glycosyl transferases involved in cellulose biosynthesis. Recent reports in higher plants have revealed that two groups of CesA gene families exist, which are associated with either primary or secondary cell wall deposition. The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative expression in developing secondary xylem tissues. Three full length gene sequences of EtCesA1, EtCesA2 and EtCesA3 were isolated with the size of 2940, 3114 and 3123 bp, respectively. Phytohormone regulation of all three EtCesA genes were studied by exogenous application of gibberellic acid, naphthalene acetic acid, indole acetic acid and 2, 4-epibrassinolide in internode tissues derived from three-month-old rooted cuttings. All three EtCesA transcripts were upregulated by indole acetic acid and gibberellic acid. This study demonstrates that the increased cellulose deposition in the secondary wood induced by hormones can be attributed to the upregulation of xylem specific CesAs.

  10. Silencing of the ACC synthase gene ACACS2 causes delayed flowering in pineapple [Ananas comosus (L.) Merr.].

    Science.gov (United States)

    Trusov, Yuri; Botella, José Ramón

    2006-01-01

    Flowering is a crucial developmental stage in the plant life cycle. A number of different factors, from environmental to chemical, can trigger flowering. In pineapple, and other bromeliads, it has been proposed that flowering is triggered by a small burst of ethylene production in the meristem in response to environmental cues. A 1-amino-cyclopropane-1-carboxylate synthase (ACC synthase) gene has been cloned from pineapple (ACACS2), which is induced in the meristem under the same environmental conditions that induce flowering. Two transgenic pineapple lines have been produced containing co-suppression constructs designed to down-regulate the expression of the ACACS2 gene. Northern analysis revealed that the ACACS2 gene was silenced in a number of transgenic plants in both lines. Southern hybridization revealed clear differences in the methylation status of silenced versus non-silenced plants by the inability of a methylation-sensitive enzyme to digest within the ACACS2 DNA extracted from silenced plants, indicating that methylation is the cause of the observed co-suppression of the ACACS2 gene. Flowering characteristics of the transgenic plants were studied under field conditions in South East Queensland, Australia. Flowering dynamics studies revealed significant differences in flowering behaviour, with transgenic plants exhibiting silencing showing a marked delay in flowering when compared with non-silenced transgenic plants and control non-transformed plants. It is argued that the ACACS2 gene is one of the key contributors towards triggering 'natural flowering' in mature pineapples under commercial field conditions.

  11. Differential expression of cellulose synthase (CesA) gene transcripts in potato as revealed by QRT-PCR.

    Science.gov (United States)

    Obembe, Olawole O; Jacobsen, Evert; Vincken, Jean-Paul; Visser, Richard G F

    2009-01-01

    Two transgenic potato lines, csr2-1 and csr4-8 that contained two different antisense cellulose synthase (CesA) genes, csr2 and csr4, respectively were crossed. The aim, amongst others, was to investigate the possibility of generating double transformants to validate a hypothetical presence of the proteins of the two CesA genes in the same cellulose synthase enzyme complex. SYBR-Green quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) assays were carried out on four CesA gene transcripts (CesA1, 2, 3, and 4) in the wild type genetic background, and on the two antisense CesA gene transcripts (CesA2 and 4) in the progeny resulting from the cross between the two transgenic potato lines. The quantitative RT-PCR analyses revealed different expression patterns of the two CesA genes. The CesA2 mRNA was shown to be relatively more abundant than CesA4 mRNA, regardless of the genetic background, suggesting that the two proteins are not present in the same enzyme complex.

  12. Lentivirus-mediated gene transfer of uroporphyrinogen III synthase fully corrects the porphyric phenotype in human cells.

    Science.gov (United States)

    Géronimi, F; Richard, E; Lamrissi-Garcia, I; Lalanne, M; Ged, C; Redonnet-Vernhet, I; Moreau-Gaudry, F; de Verneuil, H

    2003-05-01

    Congenital erythropoietic porphyria (CEP) is an inherited disease due to a deficiency in the uroporphyrinogen III synthase, the fourth enzyme of the heme biosynthesis pathway. It is characterized by accumulation of uroporphyrin I in the bone marrow, peripheral blood and other organs. The prognosis of CEP is poor, with death often occurring early in adult life. For severe transfusion-dependent cases, when allogeneic cell transplantation cannot be performed, the autografting of genetically modified primitive/stem cells may be the only alternative. In vitro gene transfer experiments have documented the feasibility of gene therapy via hematopoietic cells to treat this disease. In the present study lentiviral transduction of porphyric cell lines and primary CD34(+) cells with the therapeutic human uroporphyrinogen III synthase (UROS) cDNA resulted in both enzymatic and metabolic correction, as demonstrated by the increase in UROS activity and the suppression of porphyrin accumulation in transduced cells. Very high gene transfer efficiency (up to 90%) was achieved in both cell lines and CD34(+) cells without any selection. Expression of the transgene remained stable over long-term liquid culture. Furthermore, gene expression was maintained during in vitro erythroid differentiation of CD34(+) cells. Therefore the use of lentiviral vectors is promising for the future treatment of CEP patients by gene therapy.

  13. Apparent role of dynein in glucose-6-phosphate dehydrogenase trafficking in neutrophils from pregnant women.

    Science.gov (United States)

    Huang, Ji-Biao; Espinoza, Jimmy; Romero, Roberto; Petty, Howard R

    2006-03-01

    To better understand the mechanisms of metabolic microcompartmentalization associated with neutrophil hexose monophosphate shunt activity during pregnancy, we have studied the intracellular trafficking of glucose-6-phosphate dehydrogenase (G6PDase). Microtubule motor proteins colocalize with G6PDase. Dynein inhibitors block G6PDase accumulation at the microtubule-organizing center in pregnancy cells. On this basis, we conclude that microtubule motor proteins participate in hexose monophosphate shunt enzyme transport within leukocytes.

  14. Glucose-6-phosphate Reduces Calcium Accumulation in Rat Brain Endoplasmic Reticulum

    Science.gov (United States)

    2012-04-01

    clinically relevant neu- ropathologies. For example, diabetes and hyperglycemia are well- documented to cause significantly worse outcome for patients who...enhanced in microsomes from liver, brain, and heart. Diabetes 47, 874. Dong, Z., Saikumar, P., Weinberg, J. M., and Venkatachalam, M. A. (2006...Pompella, A., and Benedetti, A. (1990). Glucose 6-phosphate stimulation of MgATP- dependent Ca2+ uptake by rat kid - ney microsomes. Biochim. Biophys. Acta

  15. Hexose-6-phosphate dehydrogenase contributes to skeletal muscle homeostasis independent of 11β-hydroxysteroid dehydrogenase type 1.

    LENUS (Irish Health Repository)

    Semjonous, Nina M

    2011-01-01

    Glucose-6-phosphate (G6P) metabolism by the enzyme hexose-6-phosphate dehydrogenase (H6PDH) within the sarcoplasmic reticulum lumen generates nicotinamide adenine dinucleotide phosphate (reduced) to provide the redox potential for the enzyme 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) to activate glucocorticoid (GC). H6PDH knockout (KO) mice have a switch in 11β-HSD1 activity, resulting in GC inactivation and hypothalamic-pituitary-adrenal axis activation. Importantly, H6PDHKO mice develop a type II fiber myopathy with abnormalities in glucose metabolism and activation of the unfolded protein response (UPR). GCs play important roles in muscle physiology, and therefore, we have examined the importance of 11β-HSD1 and GC metabolism in mediating aspects of the H6PDHKO myopathy. To achieve this, we examined 11β-HSD1\\/H6PDH double-KO (DKO) mice, in which 11β-HSD1 mediated GC inactivation is negated. In contrast to H6PDHKO mice, DKO mice GC metabolism and hypothalamic-pituitary-adrenal axis set point is similar to that observed in 11β-HSD1KO mice. Critically, in contrast to 11β-HSD1KO mice, DKO mice phenocopy the salient features of the H6PDHKO, displaying reduced body mass, muscle atrophy, and vacuolation of type II fiber-rich muscle, fasting hypoglycemia, increased muscle glycogen deposition, and elevated expression of UPR genes. We propose that muscle G6P metabolism through H6PDH may be as important as changes in the redox environment when considering the mechanism underlying the activation of the UPR and the ensuing myopathy in H6PDHKO and DKO mice. These data are consistent with an 11β-HSD1-independent function for H6PDH in which sarcoplasmic reticulum G6P metabolism and nicotinamide adenine dinucleotide phosphate-(oxidized)\\/nicotinamide adenine dinucleotide phosphate (reduced) redox status are important for maintaining muscle homeostasis.

  16. The genome sequence of black cottonwood (Populus trichocarpa) reveals 18 conserved cellulose synthase (CesA) genes.

    Science.gov (United States)

    Djerbi, Soraya; Lindskog, Mats; Arvestad, Lars; Sterky, Fredrik; Teeri, Tuula T

    2005-07-01

    The genome sequence of Populus trichocarpa was screened for genes encoding cellulose synthases by using full-length cDNA sequences and ESTs previously identified in the tissue specific cDNA libraries of other poplars. The data obtained revealed 18 distinct CesA gene sequences in P. trichocarpa. The identified genes were grouped in seven gene pairs, one group of three sequences and one single gene. Evidence from gene expression studies of hybrid aspen suggests that both copies of at least one pair, CesA3-1 and CesA3-2, are actively transcribed. No sequences corresponding to the gene pair, CesA6-1 and CesA6-2, were found in Arabidopsis or hybrid aspen, while one homologous gene has been identified in the rice genome and an active transcript in Populus tremuloides. A phylogenetic analysis suggests that the CesA genes previously associated with secondary cell wall synthesis originate from a single ancestor gene and group in three distinct subgroups. The newly identified copies of CesA genes in P. trichocarpa give rise to a number of new questions concerning the mechanism of cellulose synthesis in trees.

  17. Effects of some drugs on human erythrocyte glucose 6-phosphate dehydrogenase: an in vitro study.

    Science.gov (United States)

    Akkemik, Ebru; Budak, Harun; Ciftci, Mehmet

    2010-12-01

    Inhibitory effects of some drugs on glucose 6-phosphate dehydrogenase from the erythrocytes of human have been investigated. For this purpose, at the beginning, erythrocyte glucose 6-phosphate dehydrogenase was purified 2256 times in a yield of 44.22% by using ammonium sulphate precipitation and 2', 5'-ADP Sepharose 4B affinity gel. Temperature of +4°C was maintained during the purification process. Enzyme activity was determined with the Beutler method by using a spectrophotometer at 340 nm. This method was utilized for all kinetic studies. Ketotifen, dacarbazine, thiocolchicoside, meloxicam, methotrexate, furosemide, olanzapine, methylprednizolone acetate, paricalcitol, ritodrine hydrochloride, and gadobenate-dimeglumine were used as drugs. All the drugs indicated the inhibitory effects on the enzyme. Ki constants for glucose 6-phosphate dehydrogenase were found by means of Lineweaver-Burk graphs. While methylprednizolone acetate showed competitive inhibition, the others displayed non-competitive inhibition. In addition, IC(50) values of the drugs were determined by plotting Activity% vs [I].

  18. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    Science.gov (United States)

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites.

  19. Nuclear factor YY1 activates the mammalian F0F1 ATP synthase alpha-subunit gene.

    Science.gov (United States)

    Breen, G A; Vander Zee, C A; Jordan, E M

    1996-01-01

    Analysis of the promoters of the bovine and human nuclear-encoded mitochondrial F0F1 ATP synthase alpha-subunit genes (ATPA) has identified several positive cis-acting regulatory regions that are important for basal promoter activity in human HeLa cells. We have previously determined that the binding of a protein factor, termed ATPF1, to an E-box sequence (CANNTG) located within one of these cis-acting regions is critical for transcriptional activation of the ATPA gene. In this article, we describe a second positive cis-acting regulatory element of the ATPA gene that is important for expression of the ATPA gene. We show that this cis-acting element also contains a binding site for a protein present in HeLa cells. On the basis of electrophoretic mobility shift patterns, oligonucleotide competition assays, and immunological cross-reactivity, we conclude that this protein factor is Yin-Yang 1 (YY1). Experiments carried out to examine the functional role of YY1 within the context of the ATPA promoter demonstrated that YY1 acts as a positive regulator of the ATPA gene. For example, when the YY1 binding site of the ATPA promoter was placed upstream of a reporter gene it was found to activate transcription in transient transfection assays. In addition, disruption of the YY1 binding site in the ATPA gene resulted in a loss of transcriptional activity. Furthermore, in cotransfection experiments overexpression of YY1 in trans was found to activate transcription of ATPA promoter-CAT constructs. Thus, at least two positive trans-acting regulatory factors, ATPF1 and YY1, are important for expression of the bovine and human F0F1 ATP synthase alpha-subunit genes.

  20. Gene-gene interactions of fatty acid synthase (FASN) using multifactor-dimensionality reduction method in Korean cattle.

    Science.gov (United States)

    Lee, Jeayoung; Jin, Mehyun; Lee, Yoonseok; Ha, Jaejung; Yeo, Jungsou; Oh, Dongyep

    2014-01-01

    We examined the gene-gene interactions of five exonic single nucleotide polymorphisms (SNPs) in the gene encoding fatty acid synthase using 513 Korean cattle and using the model free and the non-parametrical multifactor dimensionality reduction method for the analysis. The five SNPs of g.12870 T>C, g.13126 T>C, g.15532 C>A, g.16907 T>C and g.17924 G>A associated with a variety of fatty acid compositions and marbling score were used in this study. The two-factor interaction between g.13126 T>C and g.15532 C>A had the highest training-balanced among the five-factor models and a testing-balanced accuracy at 70.18 % on C18:1 with a cross-validation consistency of 10 out of 10. Also, the two-factor interaction between g.13126 T>C and g.15532 C>A had the highest testing-balanced accuracy at 68.59 % with a 10 out of 10 cross-validation consistency, than any other models on MUFA. In MS, a single SNP g.15532 C>A had the best accuracy at 58.85 % and the two-factor interaction model g.12870 T>C and g.15532 C>A had the highest testing-balanced accuracy at 64.00 %. The three-factor interaction model g.12870 T>C, g.13126 T>C and g.15532 C>A was recorded as having a high testing-balanced accuracy of 63.24 %, but it was lower than the two-factor interaction model. We used likelihood ratio tests for interaction, and Chi square tests to validate our results, with all tests showing statistical significance. We also compared this with mean scores between the high-risk trait group and low-risk trait group. The genotypes of TTCA, TTAA and TCAA at g.15532 and g.13126 on C18:1, genotypes TTCC, TTCA, TTAA, TCAA CCAA at g.15532 and g.13126 on MUFA and genotypes CCCC, TCCA, CCCA, TTAA, TCAA and CCAA at g.15532 and g.12870 on MS were recommended for the genetic improvement of beef quality.

  1. Feedback Inhibition of Starch Degradation in Arabidopsis Leaves Mediated by Trehalose 6-Phosphate1[W][OPEN

    Science.gov (United States)

    Martins, Marina Camara Mattos; Hejazi, Mahdi; Fettke, Joerg; Steup, Martin; Feil, Regina; Krause, Ursula; Arrivault, Stéphanie; Vosloh, Daniel; Figueroa, Carlos María; Ivakov, Alexander; Yadav, Umesh Prasad; Piques, Maria; Metzner, Daniela; Stitt, Mark; Lunn, John Edward

    2013-01-01

    Many plants accumulate substantial starch reserves in their leaves during the day and remobilize them at night to provide carbon and energy for maintenance and growth. In this paper, we explore the role of a sugar-signaling metabolite, trehalose-6-phosphate (Tre6P), in regulating the accumulation and turnover of transitory starch in Arabidopsis (Arabidopsis thaliana) leaves. Ethanol-induced overexpression of trehalose-phosphate synthase during the day increased Tre6P levels up to 11-fold. There was a transient increase in the rate of starch accumulation in the middle of the day, but this was not linked to reductive activation of ADP-glucose pyrophosphorylase. A 2- to 3-fold increase in Tre6P during the night led to significant inhibition of starch degradation. Maltose and maltotriose did not accumulate, suggesting that Tre6P affects an early step in the pathway of starch degradation in the chloroplasts. Starch granules isolated from induced plants had a higher orthophosphate content than granules from noninduced control plants, consistent either with disruption of the phosphorylation-dephosphorylation cycle that is essential for efficient starch breakdown or with inhibition of starch hydrolysis by β-amylase. Nonaqueous fractionation of leaves showed that Tre6P is predominantly located in the cytosol, with estimated in vivo Tre6P concentrations of 4 to 7 µm in the cytosol, 0.2 to 0.5 µm in the chloroplasts, and 0.05 µm in the vacuole. It is proposed that Tre6P is a component in a signaling pathway that mediates the feedback regulation of starch breakdown by sucrose, potentially linking starch turnover to demand for sucrose by growing sink organs at night. PMID:24043444

  2. Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

    OpenAIRE

    Jeknić, Zoran; Jeffrey T. Morré; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H. H.

    2012-01-01

    The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

  3. Changes of macrovascular endothelial ultrastructure and gene expression of endothelial nitric oxide synthase in diabetic rats

    Institute of Scientific and Technical Information of China (English)

    陆颖理; 胡申江; 沈周俊; 邵一川

    2004-01-01

    Background The most intimidatory pathological changes in patients with DM are cardiovascular illnesses, which are the major causes of death in diabetic patients and are far more prevalent than in nondiabetics because of accelerated atherosclerosis. In this study, we tried to clarify the changes in macrovascular endothelial ultrastructure and in the gene expression of endothelial nitric oxide synthase (eNOS)mRNA in diabetic rats. Methods The study was conducted on 52 of 10-week old Sprague Dawley (SD) rats with body weight of (320±42) g. SD rats were divided into: experimental group treated with a single intraperitoneal injection of streptozotocin (STZ, 60 mg/kg), (male, n=20, diabetes mellitus (DMM)); female, n=12, diabetes mellitus female (DMF)) and control group (male, n=10, diabetes mellitus male control (DMMC); female, n=10, diabetes mellitus female control (DMFC)). Four weeks after treatment, half of the rats were sacrificed; the remainders were sacrificed ten weeks after treatment. One part of the abdominal aortic sample was stored under glutaraldehyde (volume fraction ψB = 2.5 %). After the process of chemical fixation, chemical dehydration, drying and conductivity enhancement, all samples were observed and photographed using scanning electron microscopy (Leica-Stereoscan 260, England). The other part of the abdominal aortic sample was treated with liquid nitrogen and the expression of eNOSmRNA was assessed by semi-quantitative RT-PCR. Results The aortic lumen of both experimental groups adsorbed much more debris than that of either control group. The endothelial surfaces of diabetic rats were coarse, wrinkled and protuberant like fingers or villi. The vascular endothelial lesions of diabetic male rats were very distinct after 4 weeks, and as obvious as those at 10 weeks. The vascular endothelial lesions of diabetic female rats were not severe at 4 weeks and only became marked after 10 weeks. In both males and females, the abdominal aortic eNOSmRNA content

  4. The Relationship Between Endothelial Nitric Oxide Synthase Gene (NOS3) Polymorphisms, NOS3 Expression, and Varicocele.

    Science.gov (United States)

    Kahraman, Cigdem Yuce; Tasdemir, Sener; Sahin, Ibrahim; Marzioglu Ozdemir, Ebru; Yaralı, Oguzhan; Ziypak, Tevfik; Adanur, Senol; Kahraman, Mustafa; Tatar, Abdulgani

    2016-04-01

    Varicocele is an abnormal enlargement of the pampiniform venous plexus in the scrotum. Varicocele is the most common cause of secondary male infertility. Nitric oxide (NO), which has a role on varicocele pathophysiology, is synthesized by endothelial nitric oxide synthase gene (NOS3). In our study, we aimed to explain the relationship between varicocele, three common NOS3 polymorphisms (T-786C, G894T, 4b/a), and NOS3 mRNA expression levels. We investigated NOS3 T-786C, G894T, and 4b/a polymorphisms in 102 patients with varicocele and 100 healthy controls. Twenty-four patients and 17 controls were chosen for expression studies based on polymorphism subgroupings. Subgroup 1 includes patients who have no minor allele polymorphisms, and subgroups 2, 3, and 4 have T-786C, G894T, and 4b/a polymorphisms, respectively. The 4b/a polymorphism demonstrated significantly elevated levels in both allele and genotype analysis in the control group compared to the patient group. The G894T polymorphism was statistically elevated for genotypic frequencies in the patient group compared to the control group, but this finding did not extend to allelic frequencies. There were no statistically significant differences in either the allelic or genotypic frequencies between patients and control groups for the T-786C polymorphism. When patient and control expression levels were compared without considering the subgroups, the NOS3 expression level was found to be statistically higher in the patient group. There were no statistically significant differences in the patient and control group expression levels when stratified by subgroup, nor was there any effect of the polymorphisms under study on expression levels. The 4b/a polymorphism may have a protective effect for varicocelem and G894T polymorphism may contribute to varicocele occurrence by lowering the level of NO. The higher NOS3 expression levels in the patient group may be a kind of dilator compensatory mechanism to protect vascular

  5. Relationships between endothelial nitric oxide synthase gene polymorphisms and osteoporosis in postmenopausal women

    Institute of Scientific and Technical Information of China (English)

    Shun-zhi LIU; Hong YAN; Wei-kun HOU; Peng XU; Juan TUN; Li-fang TIAN; Bo-feng ZHU; Jie MA; She-min LU

    2009-01-01

    Objective: To investigate the relationships between endothelial nitric oxide synthases (eNOS) G894T and 27 bp-variable number tandem repeat (VNTR) gene polymorphisms and osteoporosis in the postmenopausal women of Chinese Han nationality. Methods: In the present study, 281 postmenopausal women from Xi'an urban area in West China were recruited, and divided into osteoporosis, osteopenia, and normal groups according to the diagnostic criteria of osteoporosis proposed by World Health Organization (WHO). The bone mineral density (BMD) values of lumbar vertebrae and left hips were determined by QDR-2000 dual energy X-ray absorptiometry. Blood samples were tested for plasma biochemical indicators including testosterone, estradiol, calcitonin, osteocalcin, and procollagen type I amino-terminal propeptide by enzyme-linked immunosorbent assay (ELISA), tartrate-resistant acid phosphatase by spectrophotometric method, and the content of nitric oxide by Griess method. Genome DNA was extracted from whole blood, and G894T polymorphism of eNOS gene was analyzed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and 27 bp-VNTR polymorphism of eNOS gene was genotyped by PCR method. Then the relationships between genotypes and biochemical indicators, genotypes and osteoporosis, and haplotypes and osteoporosis were analyzed. Results: The average BMD values of the femoral neck, ward's triangle and lumbar vertebrae 1~4 (L1~L4) in the subjects with T/T genotype in eNOS G894T locus were significantly higher than those in the subjects with G/T and G/G genotypes (P<0.05). The average BMD of the femoral neck in the subjects with a/a genotype of eNOS 27 bp-VNTR locus was evidently higher than that in the subjects with b/b genotype (P<0.05). The plasma testosterone and osteocalcin concentrations in the subjects of eNOS G894T G/T genotype were evidently higher than those in the subjects of other genotypes (P<0.05); the plasma estradiol

  6. Factors influencing gene silencing of granule-bound starch synthase in potato

    NARCIS (Netherlands)

    Heilersig, H.J.B.

    2005-01-01

    In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI

  7. Metabolite profiling of Arabidopsis thaliana (L.) plants transformed with an antisense chalcone synthase gene

    DEFF Research Database (Denmark)

    Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.;

    2005-01-01

    A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...

  8. Cloning and manipulation of the Escherichia coli cyclopropane fatty acid synthase gene: physiological aspects of enzyme overproduction.

    OpenAIRE

    Grogan, D W; Cronan, J E

    1984-01-01

    Like many other eubacteria, cultures of Escherichia coli accumulate cyclopropane fatty acids (CFAs) at a well-defined stage of growth, due to the action of the cytoplasmic enzyme CFA synthase. We report the isolation of the putative structural gene, cfa, for this enzyme on an E. coli-ColE1 chimeric plasmid by the use of an autoradiographic colony screening technique. When introduced into a variety of E. coli strains, this plasmid, pLC18-11, induced corresponding increases in CFA content and C...

  9. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    Science.gov (United States)

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously.

  10. Structural organization of the human neuronal nitric oxide synthase gene (NOS1).

    Science.gov (United States)

    Hall, A V; Antoniou, H; Wang, Y; Cheung, A H; Arbus, A M; Olson, S L; Lu, W C; Kau, C L; Marsden, P A

    1994-12-30

    Neuronal nitric oxide (NO) synthase, localized to human chromosome 12, uniquely participates in diverse biologic processes; neurotransmission, the regulation of body fluid homeostasis, neuroendocrine physiology, control of smooth muscle motility, sexual function, and myocyte/myoblast biology, among others. Restriction enzyme mapping, subcloning, and DNA sequence analysis of bacteriophage- and yeast artificial chromosome-derived human genomic DNA indicated that the mRNA for neuronal NO synthase is dispersed over a minimum of 160 kilobases of human genomic DNA. Analysis of intron-exon splice junctions predicted that the open reading frame is encoded by 28 exons, with translation initiation and termination in exon 2 and exon 29, respectively. Determination of transcription initiation sites in brain poly(A) RNA with primer extension analysis and RNase protection revealed a major start site 28 nucleotides downstream from a TATA box. Sequence inspection of 5'-flanking regions revealed potential cis-acting DNA elements: AP-2, TEF-1/MCBF, CREB/ATF/c-Fos, NRF-1, Ets, NF-1, and NF-kappa B-like sequences. Diversity appears to represent a major theme apparent upon analysis of human neuronal NO synthase mRNA transcripts. A microsatellite of the dinucleotide variety was detected within the 3'-untranslated region of exon 29. Multiple alleles were evident in normal individuals indicating the existence of allelic mRNA sequence variation. Characterization of variant human neuronal NO synthase cDNAs indicated the existence of casette exon 9/10 and exon 10 deletions as examples of structural mRNA diversity due to alternative splicing. The latter deletion of a 175-nucleotide exon introduces a frame-shift and premature stop codon indicating the potential existence of a novel NH2 terminus protein. In summary, analysis of the human neuronal NO synthase locus reveals a complex genomic organization and mRNA diversity that is both allelic and structural.

  11. Transcriptional profiling of canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) constitutively overexpressing a spermidine synthase gene.

    Science.gov (United States)

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease.

  12. Transcriptional Profiling of Canker-Resistant Transgenic Sweet Orange (Citrus sinensis Osbeck Constitutively Overexpressing a Spermidine Synthase Gene

    Directory of Open Access Journals (Sweden)

    Xing-Zheng Fu

    2013-01-01

    Full Text Available Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT and the transgenic line (TG9 by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease.

  13. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  14. Glucose-6-Phosphate Dehydrogenase Deficiency and Adrenal Hemorrhage in a Filipino Neonate with Hyperbilirubinemia

    Directory of Open Access Journals (Sweden)

    Akira Ohishi

    2013-05-01

    Full Text Available We report on a Filipino neonate with early onset and prolonged hyperbilirubinemia who was delivered by a vacuum extraction due to a prolonged labor. Subsequent studies revealed adrenal hemorrhage and glucose-6-phosphate dehydrogenase (G6PD deficiency. It is likely that asphyxia and resultant hypoxia underlie the occurrence of adrenal hemorrhage and the clinical manifestation of G6PD deficiency and that the presence of the two events explains the early onset and prolonged hyperbilirubinemia of this neonate. Our results represent the importance of examining possible underlying factors for the development of severe, early onset, or prolonged hyperbilirubinemia.

  15. Glucose-6-phosphate dehydrogenase (G6PD) deficiency among tribal populations of India - Country scenario

    OpenAIRE

    Mukherjee, Malay B.; Colah, Roshan B; Martin, Snehal; Ghosh, Kanjaksha

    2015-01-01

    It is believed that the tribal people, who constitute 8.6 per cent of the total population (2011 census of India), are the original inhabitants of India. Glucose-6-phosphate-dehydrogenase (G6PD) deficiency is an X-linked genetic defect, affecting around 400 million people worldwide and is characterized by considerable biochemical and molecular heterogeneity. Deficiency of this enzyme is highly polymorphic in those areas where malaria is/has been endemic. G6PD deficiency was reported from Indi...

  16. Host-induced gene silencing of an essential chitin synthase gene confers durable resistance to Fusarium head blight and seedling blight in wheat.

    Science.gov (United States)

    Cheng, Wei; Song, Xiu-Shi; Li, He-Ping; Cao, Le-Hui; Sun, Ke; Qiu, Xiao-Li; Xu, Yu-Bin; Yang, Peng; Huang, Tao; Zhang, Jing-Bo; Qu, Bo; Liao, Yu-Cai

    2015-12-01

    Fusarium head blight (FHB) and Fusarium seedling blight (FSB) of wheat, caused by Fusarium pathogens, are devastating diseases worldwide. We report the expression of RNA interference (RNAi) sequences derived from an essential Fusarium graminearum (Fg) virulence gene, chitin synthase (Chs) 3b, as a method to enhance resistance of wheat plants to fungal pathogens. Deletion of Chs3b was lethal to Fg; disruption of the other Chs gene family members generated knockout mutants with diverse impacts on Fg. Comparative expression analyses revealed that among the Chs gene family members, Chs3b had the highest expression levels during Fg colonization of wheat. Three hairpin RNAi constructs corresponding to the different regions of Chs3b were found to silence Chs3b in transgenic Fg strains. Co-expression of these three RNAi constructs in two independent elite wheat cultivar transgenic lines conferred high levels of stable, consistent resistance (combined type I and II resistance) to both FHB and FSB throughout the T3 to T5 generations. Confocal microscopy revealed profoundly restricted mycelia in Fg-infected transgenic wheat plants. Presence of the three specific short interfering RNAs in transgenic wheat plants was confirmed by Northern blotting, and these RNAs efficiently down-regulated Chs3b in the colonizing Fusarium pathogens on wheat seedlings and spikes. Our results demonstrate that host-induced gene silencing of an essential fungal chitin synthase gene is an effective strategy for enhancing resistance in crop plants under field test conditions.

  17. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    Science.gov (United States)

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies.

  18. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  19. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  20. A genomic approach to characterization of the Citrus terpene synthase gene family

    Directory of Open Access Journals (Sweden)

    Marcelo Carnier Dornelas

    2007-01-01

    Full Text Available Terpenes are a very large and structurally diverse group of secondary metabolites which are abundant in many essential oils, resins and floral scents. Additionally, some terpenes have roles as phytoalexins in plant-pathogen relationships, allelopathic inhibitors in plant-plant interactions, or as airborne molecules of plant-herbivore multitrophic signaling. Thus the elucidation of the biochemistry and molecular genetics of terpenoid biosynthesis has paramount importance in any crop species. With this aim, we searched the CitEST database for clusters of expressed sequence tags (ESTs coding for terpene synthases. Herein is a report on the identification and in silico characterization of 49 putative members of the terpene synthase family in diverse Citrus species. The expression patterns and the possible physiological roles of the identified sequences are also discussed.

  1. [Identification and characterization of intraspecific variability of the sucrose synthase gene Sus4 of potato (Solanum tuberosum)].

    Science.gov (United States)

    Boris, K V; Ryzhova, N N; Kochieva, E Z

    2011-02-01

    Nucleotide and amino acid variability of fragments of the Sus4 gene encoding the sucrose synthase enzyme was studied in 24 potato cultivars selected in Russia and other countries and differing in starch content in tubers. Both SNPs and indels were detected in a chosen Sus4 gene fragment including the sequence from exon 3 to exon 6 and corresponding to the main part of the sucrose synthase domain. Four types of Sus4 sequences were revealed depending on the presence of an insertion in introns 4 and 5 and of the mononucleotide octamer (T)8 in intron 5. Differentiation of these sequences was confirmed by statistical methods. Sixteen amino acid substitutions were identified in the translated sequence, of which eleven were nonsynonymous. Specific varietal nucleotide and amino acid substitutions were also revealed, which can be used in future for marking potato cultivars/genotypes. No direct associations between the mutational changes and the starch content were found in the potato cultivars studied by us.

  2. Expression in Arabidopsis of a Strawberry Linalool Synthase Gene Under the Control of the Inducible Potato P12 Promoter

    Institute of Scientific and Technical Information of China (English)

    YANG Li-mei; Per Mercke; Joop J A van Loon; FANG Zhi-yuan; Marcel Dicke; Maarten A Jongsma

    2008-01-01

    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FANESl linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The construct pBin-PP12-LIS' was transformed to Arabidopsis thaliana ecotype Columbia O. Kanamycin resistant T0 seedlings were confirmed for the presence and transcription of the LIS' gene by PCR analysis on genomic DNA and by RT-PCR analysis on RNA. Genomic and RT-PCR products were sequenced to confirm correct splicing of the synthetic intron. The expression of active linalool synthase by the PP12-LIS' gene construct in the transgenic lines was assessed by measuring linalool emission using solid phase micro-extraction (SPME) GC-MS measurements after induction with methyl jasmonate. Among 30 tested independent T2 transgenic lines, 10 exhibited linalool production.Linalool expression could be induced by methyl jasmonate treatment, but not by diamondback moth larvae.

  3. Molecular cloning and functional expression analysis of a new gene encoding geranylgeranyl diphosphate synthase from hazel (Corylus avellana L. Gasaway).

    Science.gov (United States)

    Wang, Yechun; Miao, Zhiqi; Tang, Kexuan

    2010-10-01

    Geranylgeranyl diphosphate synthase (GGPPS) [EC 2.5.1.29] catalyzes the biosynthesis of geranylgeranyl diphosphate (GGPP), which is a key precursor for diterpenes such as taxol. Herein, a full-length cDNA encoding GGPPS (designated as CgGGPPS) was cloned and characterized from hazel (Corylus avellana L. Gasaway), a taxol-producing angiosperms. The full-length cDNA of CgGGPPS was 1515 bp with a 1122 bp open reading frame (ORF) encoding a 373 amino acid polypeptide. The CgGGPPS genomic DNA sequence was also obtained, revealing CgGGPPS gene was not interrupted by an intron. Southern blot analysis indicated that CgGGPPS belonged to a small gene family. Tissue expression pattern analysis indicated that CgGGPPS expressed the highest in leaves. RT-PCR analysis indicated that CgGGPPS expression could be induced by exogenous methyl jasmonate acid. Furthermore, carotenoid accumulation was observed in Escherichia coli carrying pACCAR25ΔcrtE plasmid carrying CgGGPPS. The result revealed that cDNA encoded a functional GGPP synthase.

  4. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    Directory of Open Access Journals (Sweden)

    Gea Guerriero

    2016-06-01

    Full Text Available WD40 repeat (WDR proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD. FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed.

  5. T-786c Polymorphism in nitric oxide synthase 3 gene and Nitrit Oxide Level of Diabetic Retinopathy in Javanese Population

    Directory of Open Access Journals (Sweden)

    Putri Widelia Welkriana

    2015-11-01

    Full Text Available AbstractComplication of retinopathy in type 2 DM is caused of lower level of NO. Nitric oxide level is synthesizedfrom L-arginin in reaction that catalyze Nitric oxide synthase (NOS 3. The T-786C mutation in NOS 3 genedecreases the expression of nitric oxide synthase (NOS 3 so decreases NO synthesis. To investigate theassociation between T-786C polymorphism in NOS 3 gene with NO level of diabetic retinopathy patients. Thisstudy was a case control study, consist of 40 patient of type 2 diabetic with DR (case group and 40 patient oftype 2 diabetic without DR (control group of Javanese ethnic. The genotyping of T-786C polymorphism wasperformed by PCR-RLFP. Level of NO was measured by spectrophotometry. Chi square test and odd ratiowere used to analyze the association of the T-786C polymorphism in NOS 3 gene with DR. Differences ofNO level between TT and TC genotypes were analyzed using independent t test. The distribution of T-786Cpolymorphism in NOS 3 gene of DR subjects showed that frequency of TT genotype was 22.5% and TC genotypewas 77.5%. Non DR subjects showed the frequency of TT genotype was 50% and TC genotype was 50%, (p=0.011. Frequency of T allele in DR group was 61.25% and C allele was 38.75%, and frequency of T allele in nonDR group was 75% and C allele was 25%, (p= 0.62. Odd ratio of TC genotype was 3.444(CI; 95% : 0.964-3.735and C allele was 1.898 (CI; 95% : 1.310-9.058. The NO level of TC genotype was 1.43+0.126 and TT genotypewas 11.27+5.87 (p=0.000. Level of NO between RD and non RD showed not different significantly (p=0.160for retinopathy. The T-786C polymorphism of NOS 3 gene is risk factor for retinopathy in type 2 DiabetesMellitus. Individual with TC genotype of NOS 3 gene has lower level of NO than TT genotype.Keywords : Diabetic Retinopathy, Polymorphism, Nitric Oxide, Nitric Oxide Synthase.

  6. Glucose-6-phosphate dehydrogenase deficiency and Alzheimer's disease: Partners in crime? The hypothesis.

    Science.gov (United States)

    Ulusu, N Nuray

    2015-08-01

    Alzheimer's disease is a multifaceted brain disorder which involves various coupled irreversible, progressive biochemical reactions that significantly reduce quality of life as well as the actual life expectancy. Aging, genetic predispositions, head trauma, diabetes, cardiovascular disease, deficiencies in insulin signaling, dysfunction of mitochondria-associated membranes, cerebrovascular changes, high cholesterol level, increased oxidative stress and free radical formation, DNA damage, disturbed energy metabolism, and synaptic dysfunction, high blood pressure, obesity, dietary habits, exercise, social engagement, and mental stress are noted among the risk factors of this disease. In this hypothesis review I would like to draw the attention on glucose-6-phosphate dehydrogenase deficiency and its relationship with Alzheimer's disease. This enzymopathy is the most common human congenital defect of metabolism and defined by decrease in NADPH+H(+) and reduced form of glutathione concentration and that might in turn, amplify oxidative stress due to essentiality of the enzyme. This most common enzymopathy may manifest itself in severe forms, however most of the individuals with this deficiency are not essentially symptomatic. To understand the sporadic Alzheimer's disease, the writer of this paper thinks that, looking into a crystal ball might not yield much of a benefit but glucose-6-phosphate dehydrogenase deficiency could effortlessly give some clues. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Separation of polyhydroxyalkanoates-producing bacterial strains using PHA synthase gene and their evaluation for PHA deposition

    Directory of Open Access Journals (Sweden)

    Abdul Basit Khan

    2013-08-01

    Full Text Available In this study, a variety of samples were screened for the presence of PHA synthase gene. Results showed that 16 out of 102 isolated were positive for PHA respective genes. The highest prevalence was observed in Pseudomonas aeruginosa. The capability of PHA production was also shown by growing these strains on the defined medium and subsequent analysis using intracellular granules staining and Fourier transform infrared spectroscopy (FT-IR. The microscopic analysis showed that the positive strains accumulated PHA in the cell. The FT-IR analysis showed the presence of PHA peaks in the dried cells as well as in extraction product. P aeruginosa strain P7 showed higher concentration of PHA compared to the others as demonstrated by the highest respective peaks in FT-IR.

  8. Congenital erythropoietic porphyria with two mutations of the uroporphyrinogen III synthase gene (Cys73Arg, Thr228Met).

    Science.gov (United States)

    Gucev, Zoran; Slavevska, Nevenka; Tasic, Velibor; Laban, Nevenka; Pop-Jordanova, Nada; Danilovski, Dragan; Woolf, Jacqueline; Cole, Duncan

    2011-05-01

    Congenital erythropoietic porphyria (CEP) is an autosomal recessive inborn error of metabolism that results from the markedly deficient activity of uroporphyrinogen III synthase (UROS). We describe a 14-year-old girl with red urine since infancy, progressive blistering and scarring of the skin, and moderate hemolytic anemia. After years of skin damage, her face is mutilated; she has a bald patch on the scalp, hypertrichosis of the neck, areas of skin darkening, and limited joint movements of the hands. Total urine excretion and fecal total porphyrin were both markedly raised above normal levels. Sequencing of the UROS gene identified two mutations causing CEP (Cys73Arg, Thr228Met). The patient lesions are progressing. Bone marrow transplantation and/or gene therapy are proposed as the next steps in her treatment. In brief, we describe a CEP with confirmed two pathogenic mutations, severe phenotype and discuss the various treatment options available.

  9. Congenital erythropoietic porphyria with two mutations of the uroporphyrinogen III synthase gene (Cys73Arg, Thr228Met

    Directory of Open Access Journals (Sweden)

    Zoran Gucev

    2011-01-01

    Full Text Available Congenital erythropoietic porphyria (CEP is an autosomal recessive inborn error of metabolism that results from the markedly deficient activity of uroporphyrinogen III synthase (UROS. We describe a 14-year-old girl with red urine since infancy, progressive blistering and scarring of the skin, and moderate hemolytic anemia. After years of skin damage, her face is mutilated; she has a bald patch on the scalp, hypertrichosis of the neck, areas of skin darkening, and limited joint movements of the hands. Total urine excretion and fecal total porphyrin were both markedly raised above normal levels. Sequencing of the UROS gene identified two mutations causing CEP (Cys73Arg, Thr228Met. The patient lesions are progressing. Bone marrow transplantation and/or gene therapy are proposed as the next steps in her treatment. In brief, we describe a CEP with confirmed two pathogenic mutations, severe phenotype and discuss the various treatment options available.

  10. The endothelial nitric oxide synthase gene and risk of diabetic nephropathy and development of cardiovascular disease in type 1 diabetes

    DEFF Research Database (Denmark)

    Möllsten, Anna; Lajer, Maria Stenkil; Jorsal, Anders

    2009-01-01

    Nitric oxide (NO) is important in the maintenance of vascular tone and regulation of blood pressure. NO may also play a role in the development of both nephropathy and cardiovascular disease (CVD) in patients with diabetes. The susceptibility to nephropathy and CVD depends to some extent on genetic...... factors, therefore polymorphisms in the gene coding for endothelial NO-synthase, NOS3, can affect the risk of developing these diseases. Type 1 diabetes patients attending the Steno Diabetes Center, Denmark, between 1993 and 2001 were enrolled in this study. A total of 458 cases with diabetic nephropathy...... (albumin excretion >300 mg/24h) and 319 controls with persistent normoalbuminuria ( or =20 years of diabetes duration at follow-up were identified. Patients were followed until death or end of the study. Associations between seven NOS3-gene polymorphisms and nephropathy, progression...

  11. One type of chalcone synthase gene expressed during embryogenesis regulates the flavonoid accumulation in citrus cell cultures.

    Science.gov (United States)

    Moriguchi, T; Kita, M; Tomono, Y; EndoInagaki, T; Omura, M

    1999-06-01

    To elucidate the relationship between the expression of chalcone synthase (CHS) genes and the production of flavonoid in citrus cell cultures, two cDNA clones encoding CHS were isolated (CitCHS1 and CitCHS2) from the citrus. The accumulation of CitCHS2 mRNA was notably induced by embryogenesis but CitCHS1 mRNA was not. There was no detectable accumulation of flavonoid in the undifferentiated calli, but flavonoid accumulated after the morphological changes to embryoids. These results indicate that two CHS genes differentially expressed during citrus somatic embryogenesis and CitCHS2 may regulate the accumulation of flavonoid in citrus cell cultures.

  12. Identification of a Polyketide Synthase Gene in the Synthesis of Phleichrome of the Phytopathogenic Fungus Cladosporium phlei.

    Science.gov (United States)

    So, Kum-Kang; Chung, Yun-Jo; Kim, Jung-Mi; Kim, Beom-Tae; Park, Seung-Moon; Kim, Dae-Hyuk

    2015-12-01

    Phleichrome, a pigment produced by the phytopathogenic fungus Cladosporium phlei, is a fungal perylenequinone whose photodynamic activity has been studied intensively. To determine the biological function of phleichrome and to engineer a strain with enhanced production of phleichrome, we identified the gene responsible for the synthesis of phleichrome. Structural comparison of phleichrome with other fungal perylenequinones suggested that phleichrome is synthesized via polyketide pathway. We recently identified four different polyketide synthase (PKS) genes encompassing three major clades of fungal PKSs that differ with respect to reducing conditions for the polyketide product. Based on in silico analysis of cloned genes, we hypothesized that the non-reducing PKS gene, Cppks1, is involved in phleichrome biosynthesis. Increased accumulation of Cppks1 transcript was observed in response to supplementation with the application of synthetic inducer cyclo-(l-Pro-l-Phe). In addition, heterologous expression of the Cppks1 gene in Cryphonectria parasitica resulted in the production of phleichrome. These results provide convincing evidence that the Cppks1 gene is responsible for the biosynthesis of phleichrome.

  13. Diversification of the monoterpene synthase gene family (TPSb) in Protium, a highly diverse genus of tropical trees.

    Science.gov (United States)

    Zapata, Felipe; Fine, Paul V A

    2013-09-01

    Plant monoterpenes are a diverse class of secondary metabolites mediating biotic and abiotic interactions with direct effects on plant fitness. To evaluate the hypothesis that monoterpene diversity is related to functional diversification after gene duplication, we reconstructed the evolutionary history of monoterpene synthases (TPSb)--the genes underlying monoterpene synthesis--in Protium, a taxonomically and chemically diverse genus of tropical trees. We isolated multiple copies of TPSb genes from chemically divergent Protium species, reconstructed the phylogeny of this gene family, used maximum-likelihood estimation of selection coefficients, and inferred residues evolving under positive selection. We found evidence for one ancient and multiple more recent duplication events giving rise to three, and potentially five, copies of TPSb genes currently present in Protium. There was evidence for adaptive evolution in one copy with a positively selected residue likely involved in protein folding and product specificity. All other copies were inferred to be evolving under a combination of stabilizing and/or relaxed selection. Although gene copy number is consistent with the extensive phenotypic diversity in monoterpenes shown in Protium, selection analyses suggest that not all copies are undergoing divergent selection consistent with a coevolutionary arms race with enemies, but instead may be under stabilizing and relaxed selection consistent with signaling or physiological stress functionality.

  14. Endogenous, tissue-specific short interfering RNAs silence the chalcone synthase gene family in glycine max seed coats.

    Science.gov (United States)

    Tuteja, Jigyasa H; Zabala, Gracia; Varala, Kranthi; Hudson, Matthew; Vodkin, Lila O

    2009-10-01

    Two dominant alleles of the I locus in Glycine max silence nine chalcone synthase (CHS) genes to inhibit function of the flavonoid pathway in the seed coat. We describe here the intricacies of this naturally occurring silencing mechanism based on results from small RNA gel blots and high-throughput sequencing of small RNA populations. The two dominant alleles of the I locus encompass a 27-kb region containing two perfectly repeated and inverted clusters of three chalcone synthase genes (CHS1, CHS3, and CHS4). This structure silences the expression of all CHS genes, including CHS7 and CHS8, located on other chromosomes. The CHS short interfering RNAs (siRNAs) sequenced support a mechanism by which RNAs transcribed from the CHS inverted repeat form aberrant double-stranded RNAs that become substrates for dicer-like ribonuclease. The resulting primary siRNAs become guides that target the mRNAs of the nonlinked, highly expressed CHS7 and CHS8 genes, followed by subsequent amplification of CHS7 and CHS8 secondary siRNAs by RNA-dependent RNA polymerase. Most remarkably, this silencing mechanism occurs only in one tissue, the seed coat, as shown by the lack of CHS siRNAs in cotyledons and vegetative tissues. Thus, production of the trigger double-stranded RNA that initiates the process occurs in a specific tissue and represents an example of naturally occurring inhibition of a metabolic pathway by siRNAs in one tissue while allowing expression of the pathway and synthesis of valuable secondary metabolites in all other organs/tissues of the plant.

  15. Incidence and molecular characterization of Glucose-6-Phosphate Dehydrogenase deficiency among neonates for newborn screening in Chaozhou, China.

    Science.gov (United States)

    Yang, H; Wang, Q; Zheng, L; Zhan, X-F; Lin, M; Lin, F; Tong, X; Luo, Z-Y; Huang, Y; Yang, L-Y

    2015-06-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is highly prevalent in southern China. The aim of this study is to assess the extent of this disease in Chinese neonates and determine its molecular characteristics using a novel molecular screening method. A total of 2500 neonates were routinely screened for G6PD deficiency using a modified fluorescent spot test (FST). PCR-high-resolution melting (HRM) analysis was then used for the molecular assay. The overall incidence of G6PD deficiency was 2.68% in our study cohort. Frequency in male population was 3.22% (44 neonates of 1365 male neonates), and in female population was 2.03% (23 neonates of 1135 female neonates). Of the 67 newborns suspected to be G6PD deficient based on FST (44 males, 23 females), 58 of 67 (87%) were detected with gene alterations. Seven kinds of mutations [c.95A>G, c.392G>T, c.493A>G, c.871G>A, c.1360C>T, c.1376G>T, and c.1388G>A] were identified by HRM analysis. Routine newborn screening in Chaozhou, China with a relatively high prevalence of G6PD deficiency is justified and meets the World Health Organization recommendation. The usage of molecular diagnosis can favor the detection of heterozygotes which can be a supplement to regular newborn screening and useful for premarital and prenatal diagnosis for G6PD deficiency. © 2014 John Wiley & Sons Ltd.

  16. Functional and Biochemical Characterization of Three Recombinant Human Glucose-6-Phosphate Dehydrogenase Mutants: Zacatecas, Vanua-Lava and Viangchan

    Directory of Open Access Journals (Sweden)

    Saúl Gómez-Manzo

    2016-05-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD deficiency in humans causes severe disease, varying from mostly asymptomatic individuals to patients showing neonatal jaundice, acute hemolysis episodes or chronic nonspherocytic hemolytic anemia. In order to understand the effect of the mutations in G6PD gene function and its relation with G6PD deficiency severity, we report the construction, cloning and expression as well as the detailed kinetic and stability characterization of three purified clinical variants of G6PD that present in the Mexican population: G6PD Zacatecas (Class I, Vanua-Lava (Class II and Viangchan (Class II. For all the G6PD mutants, we obtained low purification yield and altered kinetic parameters compared with Wild Type (WT. Our results show that the mutations, regardless of the distance from the active site where they are located, affect the catalytic properties and structural parameters and that these changes could be associated with the clinical presentation of the deficiency. Specifically, the structural characterization of the G6PD Zacatecas mutant suggests that the R257L mutation have a strong effect on the global stability of G6PD favoring an unstable active site. Using computational analysis, we offer a molecular explanation of the effects of these mutations on the active site.

  17. Functional and Biochemical Characterization of Three Recombinant Human Glucose-6-Phosphate Dehydrogenase Mutants: Zacatecas, Vanua-Lava and Viangchan

    Science.gov (United States)

    Gómez-Manzo, Saúl; Marcial-Quino, Jaime; Vanoye-Carlo, America; Serrano-Posada, Hugo; González-Valdez, Abigail; Martínez-Rosas, Víctor; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Castillo-Rodríguez, Rosa Angélica; Cuevas-Cruz, Miguel; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency in humans causes severe disease, varying from mostly asymptomatic individuals to patients showing neonatal jaundice, acute hemolysis episodes or chronic nonspherocytic hemolytic anemia. In order to understand the effect of the mutations in G6PD gene function and its relation with G6PD deficiency severity, we report the construction, cloning and expression as well as the detailed kinetic and stability characterization of three purified clinical variants of G6PD that present in the Mexican population: G6PD Zacatecas (Class I), Vanua-Lava (Class II) and Viangchan (Class II). For all the G6PD mutants, we obtained low purification yield and altered kinetic parameters compared with Wild Type (WT). Our results show that the mutations, regardless of the distance from the active site where they are located, affect the catalytic properties and structural parameters and that these changes could be associated with the clinical presentation of the deficiency. Specifically, the structural characterization of the G6PD Zacatecas mutant suggests that the R257L mutation have a strong effect on the global stability of G6PD favoring an unstable active site. Using computational analysis, we offer a molecular explanation of the effects of these mutations on the active site. PMID:27213370

  18. Effect of thymidylate synthase (TYMS) gene polymorphisms with methotrexate treatment outcome in south Indian Tamil patients with rheumatoid arthritis.

    Science.gov (United States)

    Muralidharan, Niveditha; Misra, Durga P; Jain, Vikramraj K; Negi, Vir Singh

    2017-03-27

    Rheumatoid arthritis (RA) is a chronic systemic autoimmune disease causing joint damage and significant functional impairment. Methotrexate (MTX) remains the mainstay for the treatment of RA. MTX inhibits several enzymes of the folate and nucleotide pathways. Thymidylate synthase (TYMS) is an important enzyme in the de novo pyrimidine pathway responsible for DNA replication. The two common gene polymorphisms analyzed in TYMS are 28-bp tandem repeat polymorphism and a 6-bp insertion/deletion polymorphism. The present study was carried out to find the role of these TYMS gene polymorphisms with clinical phenotype, treatment response, and MTX adverse events in 254 patients with RA of south Indian Tamil ethnicity. TYMS gene polymorphisms were analyzed by PCR. The allele frequencies of TYMS gene polymorphisms did not differ between good and non-responders. However, the TYMS 28-bp tandem repeat 3R allele was higher in non-responders than in patients undergoing remission [64 vs 51.11%, p = 0.06, OR 0.58, 95% CI (0.34-1.00)]. The TYMS 6-bp deletion allele was higher in non-responders than good responders [78.20 vs 64.92%, p = 0.06, OR 0.51 95% CI (0.27-0.98)]. TYMS 3R allele and TYMS 6-bp deletion allele may favor non-response to MTX in south Indian Tamils. TYMS gene polymorphisms did not influence MTX adverse events.

  19. Suppression of the barley uroporphyrinogen III synthase gene by a Ds activation tagging element generates developmental photosensitivity.

    Science.gov (United States)

    Ayliffe, Michael A; Agostino, Anthony; Clarke, Bryan C; Furbank, Robert; von Caemmerer, Susanne; Pryor, Anthony J

    2009-03-01

    Chlorophyll production involves the synthesis of photoreactive intermediates that, when in excess, are toxic due to the production of reactive oxygen species (ROS). A novel, activation-tagged barley (Hordeum vulgare) mutant is described that results from antisense suppression of a uroporphyrinogen III synthase (Uros) gene, the product of which catalyzes the sixth step in the synthesis of chlorophyll and heme. In homozygous mutant plants, uroporphyrin(ogen) I accumulates by spontaneous cyclization of hydroxyl methylbilane, the substrate of Uros. Accumulation of this tetrapyrrole intermediate results in photosensitive cell death due to the production of ROS. The efficiency of Uros gene suppression is developmentally regulated, being most effective in mature seedling leaves compared with newly emergent leaves. Reduced transcript accumulation of a number of nuclear-encoded photosynthesis genes occurs in the mutant, even under 3% light conditions, consistent with a retrograde plastid-nuclear signaling mechanism arising from Uros gene suppression. A similar set of nuclear genes was repressed in wild-type barley following treatment with a singlet oxygen-generating herbicide, but not by a superoxide generating herbicide, suggesting that the retrograde signaling apparent in the mutant is specific to singlet oxygen.

  20. Regulation of Expression of GLT1, the Gene Encoding Glutamate Synthase in Saccharomyces cerevisiae

    OpenAIRE

    Valenzuela, Lourdes; Ballario, Paola; Aranda, Cristina; Filetici, Patrizia; González, Alicia

    1998-01-01

    Saccharomyces cerevisiae glutamate synthase (GOGAT) is an oligomeric enzyme composed of three 199-kDa identical subunits encoded by GLT1. In this work, we analyzed GLT1 transcriptional regulation. GLT1-lacZ fusions were prepared and GLT1 expression was determined in a GDH1 wild-type strain and in a gdh1 mutant derivative grown in the presence of various nitrogen sources. Null mutants impaired in GCN4, GLN3, GAT1/NIL1, or UGA43/DAL80 were transformed with a GLT1-lacZ fusion to determine whethe...

  1. Hydrocellular foam dressing promotes wound healing along with increases in hyaluronan synthase 3 and PPARα gene expression in epidermis.

    Directory of Open Access Journals (Sweden)

    Takumi Yamane

    Full Text Available BACKGROUND: Hydrocellular foam dressing, modern wound dressing, induces moist wound environment and promotes wound healing: however, the regulatory mechanisms responsible for these effects are poorly understood. This study was aimed to reveal the effect of hydrocellular foam dressing on hyaluronan, which has been shown to have positive effects on wound healing, and examined its regulatory mechanisms in rat skin. METHODOLOGY/PRINCIPAL FINDINGS: We created two full-thickness wounds on the dorsolateral skin of rats. Each wound was covered with either a hydrocellular foam dressing or a film dressing and hyaluronan levels in the periwound skin was measured. We also investigated the mechanism by which the hydrocellular foam dressing regulates hyaluronan production by measuring the gene expression of hyaluronan synthase 3 (Has3, peroxisome proliferator-activated receptor α (PPARα, and CD44. Hydrocellular foam dressing promoted wound healing and upregulated hyaluronan synthesis, along with an increase in the mRNA levels of Has3, which plays a primary role in hyaluronan synthesis in epidermis. In addition, hydrocellular foam dressing enhanced the mRNA levels of PPARα, which upregulates Has3 gene expression, and the major hyaluronan receptor CD44. CONCLUSIONS/SIGNIFICANCE: These findings suggests that hydrocellular foam dressing may be beneficial for wound healing along with increases in hyaluronan synthase 3 and PPARα gene expression in epidermis. We believe that the present study would contribute to the elucidation of the mechanisms underlying the effects of hydrocellular foam dressing-induced moist environment on wound healing and practice evidence-based wound care.

  2. Association of Variable Number of Tandem Repeats in Endothelial Nitric Oxide Synthase Gene with Coronary Artery Disease

    Directory of Open Access Journals (Sweden)

    S Salimi

    2006-08-01

    Full Text Available Endo-derived nitric oxide (NO is synthesized from L-arginine by endothelium nitric oxide synthase (eNOS. Since reduced NO synthesis has been implicated in the development of coronary atherosclerosis; we hypothesized that polymorphisms of NOS gene might be associated with increased susceptibility to this disorder and coronary artery disease (CAD. We studied the 27 base pair tandem repeat polymorphism in intron4 of the endothelial nitric oxide synthase (eNOS gene in 141 unrelated CAD patients with positive coronary angiograms in Shahid Rajaee Heart Hospital and 159 age matched control subjects without a history of symptomatic CAD. The study protocol was approved by the Iran University of Medical Sciences Ethics Committee. The eNOS gene intron4a/b VNTR polymorphism was analyzed by polymerase chain reaction. The plasma lipids levels and other risk factors were also determined. The genotype frequencies for eNOS4b/b, eNOS4a/b and eNOS4a/a were 68.8, 29.1 and 2.1% in CAD subjects, and 81, 18.4 and 0.6 % in control subjects, respectively. The genotype frequencies differed significantly between the two groups (χ²= 6.38 P= 0.041. The frequency of the allele was 16.7% in CAD subjects and 9.8% in control subjects and was significantly higher in the patients (χ²= 6.18 P= 0.013, odds ratio=1.84. Plasma lipids, except HDL-C were also remarkablely increased in CAD group.

  3. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance.

    Science.gov (United States)

    Faulkes, Christopher G; Davies, Kalina T J; Rossiter, Stephen J; Bennett, Nigel C

    2015-05-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan--a key constituent of the extracellular matrix--that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  4. Molecular cloning and expression of an encoding galactinol synthase gene (AnGolS1) in seedling of Ammopiptanthus nanus

    Science.gov (United States)

    Liu, YuDong; Zhang, Li; Chen, LiJing; Ma, Hui; Ruan, YanYe; Xu, Tao; Xu, ChuanQiang; He, Yi; Qi, MingFang

    2016-01-01

    Based on the galactinol synthase (AnGolS1) fragment sequence from a cold-induced Suppression Subtractive Hybridization (SSH) library derived from Ammopiptanthus nanus (A. nanus) seedlings, AnGolS1 mRNA (including the 5′ UTR and 3′ UTR) (GenBank accession number: GU942748) was isolated and characterized by rapid amplification of cDNA ends polymerase chain reaction (RACE–PCR). A substrate reaction test revealed that AnGolS1 possessed galactinol synthase activity in vitro and could potentially be an early-responsive gene. Furthermore, quantitative real-time PCR (qRT-PCR) indicated that AnGolS1 was responded to cold, salts and drought stresses, however, significantly up-regulated in all origans by low temperatures, especially in plant stems. In addition, the hybridization signals in the fascicular cambium were strongest in all cells under low temperature. Thus, we propose that AnGolS1 plays critical roles in A. nanus low-temperature stress resistance and that fascicular cambium cells could be involved in AnGolS1 mRNA transcription, galactinol transportation and coordination under low-temperature stress. PMID:27786294

  5. Endothelial Nitric Oxide Synthase Gene Polymorphism (G894T and Diabetes Mellitus (Type II among South Indians

    Directory of Open Access Journals (Sweden)

    T. Angeline

    2011-01-01

    Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.

  6. A case of primary selective hypoaldosteronism carrying three mutations in the aldosterone synthase (Cyp11b2) gene.

    Science.gov (United States)

    Taranta, Anna; Bizzarri, Carla; Masotti, Andrea; Sciré, Giuseppe; Pampanini, Valentina; Cappa, Marco

    2012-05-25

    An infant with a clinical phenotype of early onset hypoaldosteronism has been screened for mutation analysis of the Cyp11b2 gene encoding aldosterone synthase enzyme. We have described a novel nonsense mutation in exon 3 (c.508C>T) that gave rise to a shorter protein (Q170X) and two known concurrent missense mutations (c.594A>C in exon 3 and c.1157T>C in exon 7) that led to substitution of glutamic acid for aspartic acid at amino acid position 198 (E198D) and of valine for alanine at amino acid position 386 (V386A). The father, who carried E198D plus V386A mutations, showed a fractional sodium excretion of 1.25% that was unmodified by dietary salt restriction, suggesting a mild haploinsufficiency. We examined by in silico analysis the effect of the mutations on the secondary and tertiary structures of aldosterone synthase to explain the inefficient enzymatic activity. The Q170X mutation produced a truncated protein, which was consequently associated with a loss of catalytic activity. As predicted by JPred web system and Dock 6.3 software, the concurrent expression of E198D and V386A mutations induced a significant secondary structure rearrangement and a shift of the heme group and the 18-hydroxycorticosterone substrate from their optimal placement.

  7. Expression of a GALACTINOL SYNTHASE gene is positively associated with desiccation tolerance of Brassica napus seeds during development.

    Science.gov (United States)

    Li, Xu; Zhuo, Jiajin; Jing, Yin; Liu, Xiao; Wang, Xiaofeng

    2011-10-15

    Desiccation tolerance of seeds is positively correlated with raffinose family oligosaccharides (RFOs). However, RFOs' role in desiccation tolerance is still a matter of controversy. The aim of this work was to monitor the accumulation of RFO during acquisition of desiccation tolerance in rapeseed (Brassica napus L.). Rapeseeds become desiccation tolerant at 21-24d after flowering (DAF), and the time was coincident with an accumulation of raffinose and stachyose. A gene encoding galactinol synthase (GolS; EC2.4.1.123), involved in RFO biosynthesis, was cloned and functionally characterized. Enzymatic properties of recombinant galactinol synthase were also determined. Accumulation of BnGOLS-1 mRNA in developing rapeseeds was concomitant with dry weight deposition and the acquisition of desiccation tolerance, and was concurrent with the formation of raffinose and stachyose. The physiological implications of BnGOLS-1 expression patterns in developing seeds are discussed in light of the hypothesized role of RFOs in seed desiccation tolerance. Copyright © 2011 Elsevier GmbH. All rights reserved.

  8. Comparative microarray analysis of Arabidopsis thaliana and Arabidopsis halleri roots identifies nicotianamine synthase, a ZIP transporter and other genes as potential metal hyperaccumulation factors.

    Science.gov (United States)

    Weber, Michael; Harada, Emiko; Vess, Christoph; Roepenack-Lahaye, Edda v; Clemens, Stephan

    2004-01-01

    The hyperaccumulation of zinc (Zn) and cadmium (Cd) is a constitutive property of the metallophyte Arabidopsis halleri. We therefore used Arabidopsis GeneChips to identify genes more active in roots of A. halleri as compared to A. thaliana under control conditions. The two genes showing highest expression in A. halleri roots relative to A. thaliana roots out of more than 8000 genes present on the chip encode a nicotianamine (NA) synthase and a putative Zn2+ uptake system. The significantly higher activity of these and other genes involved in metal homeostasis under various growth conditions was confirmed by Northern and RT-PCR analyses. A. halleri roots also show higher NA synthase protein levels. Furthermore, we developed a capillary liquid chromatography electrospray ionization quadrupole time-of-flight mass spectrometry (CapLC-ESI-QTOF-MS)-based NA analysis procedure and consistently found higher NA levels in roots of A. halleri. Expression of a NA synthase in Zn2+-hypersensitive Schizosaccharomyces pombe cells demonstrated that formation of NA can confer Zn2+ tolerance. Taken together, these observations implicate NA in plant Zn homeostasis and NA synthase in the hyperaccumulation of Zn by A. halleri. Furthermore, the results show that comparative microarray analysis of closely related species can be a valuable tool for the elucidation of phenotypic differences between such species.

  9. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    Science.gov (United States)

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  10. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  11. Alfalfa Cellulose synthase gene expression under abiotic stress: a Hitchhiker's guide to RT-qPCR normalization.

    Directory of Open Access Journals (Sweden)

    Gea Guerriero

    Full Text Available Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L., no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress at various time points (e.g. 0, 24, 72 and 96 h. We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots, under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses.

  12. Cloning and expression of sesquiterpene synthase genes from lettuce (Lactuca sativa L.).

    Science.gov (United States)

    Bennett, Mark H; Mansfield, John W; Lewis, Mervyn J; Beale, Michael H

    2002-06-01

    Sesquiterpenoid lactones (SLs) from lettuce (Lactuca sativa L.) include constitutive components of latex such as lactucin and the induced phytoalexin, lettucenin A. A redundant primer strategy was used to recover two full length cDNA clones (LTC1 and LTC2) encoding sesquiterpene synthases from a cDNA library derived from seedlings with the red spot disorder, which accumulate phytoalexins. Recombinant enzymes produced from LTC1 and LTC2 in Escherichia coli catalysed the cyclisation of farnesyl diphosphate to germacrene A, potentially an early step in the biosynthesis of SLs. RT-PCR analysis showed LTC1 and LTC2 were expressed constitutively in roots, hypocotyls and true leaves but not in cotyledons. Expression in cotyledons was induced by challenge with the downy mildew pathogen Bremia lactucae in the disease resistant cultivar Diana. Southern hybridisation experiments showed that LTC1 and LTC2 were not part of a multigene family. The germacrene A synthases provide targets for modified expression to generate beneficial modifications to the SL profile in lettuce.

  13. Expression of the inducible nitric oxide synthase gene in diaphragm and skeletal muscle.

    Science.gov (United States)

    Thompson, M; Becker, L; Bryant, D; Williams, G; Levin, D; Margraf, L; Giroir, B P

    1996-12-01

    Nitric oxide (NO) is a pluripotent molecule that can be secreted by skeletal muscle through the activity of the neuronal constitutive isoform of NO synthase. To determine whether skeletal muscle and diaphragm might also express the macrophage-inducible form of NO synthase (iNOS) during provocative states, we examined tissue from mice at serial times after intravenous administration of Escherichia coli endotoxin. In these studies, iNOS mRNA was strongly expressed in the diaphragm and skeletal muscle of mice 4 h after intravenous endotoxin and was significantly diminished by 8 h after challenge. Induction of iNOS mRNA was followed by expression of iNOS immunoreactive protein on Western immunoblots. Increased iNOS activity was demonstrated by conversion of arginine to citrulline. Immunochemical analysis of diaphragmatic explants exposed to endotoxin in vitro revealed specific iNOS staining in myocytes, in addition to macrophages and endothelium. These results may be important in understanding the pathogenesis of respiratory pump failure during septic shock, as well as skeletal muscle injury during inflammation or metabolic stress.

  14. Abscisic acid effects on activity and expression of barley (Hordeum vulgare) plastidial glucose-6-phosphate dehydrogenase.

    Science.gov (United States)

    Cardi, Manuela; Chibani, Kamel; Cafasso, Donata; Rouhier, Nicolas; Jacquot, Jean-Pierre; Esposito, Sergio

    2011-07-01

    Total glucose-6-phosphate dehydrogenase (G6PDH) activity, protein abundance, and transcript levels of G6PDH isoforms were measured in response to exogenous abscisic acid (ABA) supply to barley (Hordeum vulgare cv Nure) hydroponic culture. Total G6PDH activity increased by 50% in roots treated for 12 h with exogenous 0.1 mM ABA. In roots, a considerable increase (35%) in plastidial P2-G6PDH transcript levels was observed during the first 3 h of ABA treatment. Similar protein variations were observed in immunoblotting analyses. In leaves, a 2-fold increase in total G6PDH activity was observed after ABA treatment, probably related to an increase in the mRNA level (increased by 50%) and amount of protein (increased by 85%) of P2-G6PDH. Together these results suggest that the plastidial P2-isoform plays an important role in ABA-treated barley plants.

  15. Signal amplification of glucosamine-6-phosphate based on ribozyme glmS.

    Science.gov (United States)

    Zhao, Yongyun; Chen, Haodong; Du, Feng; Yasmeen, Afshan; Dong, Juan; Cui, Xin; Tang, Zhuo

    2014-12-15

    Ribozyme glmS based isothermal amplification assay is developed for the colorimetric detection of glucosamine-6-phosphate (GlcN6P). Upon binding to the metabolite target GlcN6P, self-cleavage of glmS ribozyme is initiated to release RNA fragment that can trigger the cascade signal amplification to release large amount of G-quadruplex DNAzymes as reporter for colorimetric detection. Given the importance of GlcN6P for cell wall biosynthesis, the glmS riboswitch has become a new drug target for the development of antibiotics. This assay not only offers a convenient detection of GlcN6P with high specificity and sensitivity, but also provides a platform for high-throughput screening of antibiotics based on glmS riboswitches.

  16. [The role glucose-6-phosphate dehydrogenase in pathogenesis of anemia in leptospirosis].

    Science.gov (United States)

    Avdeeva, M G; Moĭsova, D L; Gorodin, V N; Kostomarov, A M; Zotov, S V; Cherniavskaia, O V

    2002-01-01

    The activity of glucose-6-phosphate dehydrogenase (G-6-PDG) of plasma and erythrocytes, levels of erythrocytes, hemoglobin, free hemoglobin and reticulocytes in different periods of illness were assessed in 30 men with severe icteric leptospirosis and anemia. Elevation of plasma G-6-PDG activity, levels of free hemoglobin (FH) and reticulocytes were found. Hemolysis was more pronounced at the height of the disease. One of the causes of hemolysis in severe leptospiral jaundice may be deficiency of erythrocytic G-6-PDG which is inheritable male disease. Low G-6-PDG activity of erythrocytes on the second week of the illness preceded anemia in 83.3% cases which could be a prognostic criterion of developing anemic syndrome. Combined treatment of leptospirosis with administration of tocopherol acetate resulted in a significant fall of plasma FH and G-6-PDG, of severity and duration of anemia versus the control group.

  17. Reference genes to study herbicide stress response in Lolium sp.: up-regulation of P450 genes in plants resistant to acetolactate-synthase inhibitors.

    Directory of Open Access Journals (Sweden)

    Arnaud Duhoux

    Full Text Available Variation in the expression of numerous genes is at the basis of plant response to environmental stresses. Non-target-site-based resistance to herbicides (NTSR, the major threat to grass weed chemical control, is governed by a subset of the genes involved in herbicide stress response. Quantitative PCR assays allowing reliable comparison of gene expression are thus key to identify genes governing NTSR. This work aimed at identifying a set of reference genes with a stable expression to be used as an internal standard for the normalisation of quantitative PCR data in studies investigating NTSR to herbicides inhibiting acetolactate synthase (ALS in the major grass weed Lolium sp. Gene expression stability was assessed in plants resistant or sensitive to two ALS inhibitors, subjected or not to herbicide stress. Using three complementary approaches implemented in the programs BestKeeper, NormFinder and geNorm, cap-binding protein, glyceraldehyde-3-phosphate-dehydrogenase and ubiquitin were identified as the most suitable reference genes. This reference gene set can probably be used to study herbicide response in other weed species. It was used to compare the expression of the genes encoding two herbicide target enzymes (ALS and acetyl-coenzyme A carboxylase and five cytochromes P450 (CYP with potential herbicide-degrading activity between plants resistant or sensitive to ALS inhibitors. Overall, herbicide application enhanced CYP gene expression. Constitutive up-regulation of all CYP genes observed in resistant plants compared to sensitive plants suggested enhanced secondary metabolism in the resistant plants. Comprehensive transcriptome studies associated to gene expression analyses using the reference gene set validated here are required to unravel NTSR genetic determinants.

  18. Glucose-6-phosphate reduces calcium accumulation in rat brain endoplasmic reticulum

    Directory of Open Access Journals (Sweden)

    Jeffrey Thomas Cole

    2012-04-01

    Full Text Available Brain cells expend large amounts of energy sequestering calcium (Ca2+, while loss of Ca2+ compartmentalization leads to cell damage or death. Upon cell entry, glucose is converted to glucose-6-phosphate (G6P, a parent substrate to several metabolic major pathways, including glycolysis. In several tissues, G6P alters the ability of the endoplasmic reticulum to sequester Ca2+. This led to the hypothesis that G6P regulates Ca2+ accumulation by acting as an endogenous ligand for sarco-endoplasmic reticulum calcium ATPase (SERCA. Whole brain ER microsomes were pooled from adult male Sprague-Dawley rats. Using radio-isotopic assays, 45Ca2+ accumulation was quantified following incubation with increasing amounts of G6P, in the presence or absence of thapsigargin, a potent SERCA inhibitor. To qualitatively assess SERCA activity, the simultaneous release of inorganic phosphate (Pi coupled with Ca2+ accumulation was quantified. Addition of G6P significantly and decreased Ca2+ accumulation in a dose-dependent fashion (1-10 mM. The reduction in Ca2+ accumulation was not significantly different that seen with addition of thapsigargin. Addition of glucose-1-phosphate or fructose-6-phosphate, or other glucose metabolic pathway intermediates, had no effect on Ca2+ accumulation. Further, the release of Pi was markedly decreased, indicating G6P-mediated SERCA inhibition as the responsible mechanism for reduced Ca2+ uptake. Simultaneous addition of thapsigargin and G6P did decrease inorganic phosphate in comparison to either treatment alone, which suggests that the two treatments have different mechanisms of action. Therefore, G6P may be a novel, endogenous regulator of SERCA activity. Additionally, pathological conditions observed during disease states that disrupt glucose homeostasis, may be attributable to Ca2+ dystasis caused by altered G6P regulation of SERCA activity

  19. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping.

    Directory of Open Access Journals (Sweden)

    Ran Chai

    Full Text Available Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR, and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi.

  20. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum

    Directory of Open Access Journals (Sweden)

    Takashi Kadono

    2015-08-01

    Full Text Available Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase.

  1. The glycogen synthase 2 gene (Gys2) displays parallel evolution between Old World and New World fruit bats.

    Science.gov (United States)

    Qian, Yamin; Fang, Tao; Shen, Bin; Zhang, Shuyi

    2014-01-01

    Frugivorous and nectarivorous bats rely largely on hepatic glycogenesis and glycogenolysis for postprandial blood glucose disposal and maintenance of glucose homeostasis during short time starvation, respectively. The glycogen synthase 2 encoded by the Gys2 gene plays a critical role in liver glycogen synthesis. To test whether the Gys2 gene has undergone adaptive evolution in bats with carbohydrate-rich diets in relation to their insect-eating sister taxa, we sequenced the coding region of the Gys2 gene in a number of bat species, including three Old World fruit bats (OWFBs) (Pteropodidae) and two New World fruit bats (NWFBs) (Phyllostomidae). Our results showed that the Gys2 coding sequences are highly conserved across all bat species we examined, and no evidence of positive selection was detected in the ancestral branches leading to OWFBs and NWFBs. Our explicit convergence test showed that posterior probabilities of convergence between several branches of OWFBs, and the NWFBs were markedly higher than that of divergence. Three parallel amino acid substitutions (Q72H, K371Q, and E666D) were detected among branches of OWFBs and NWFBs. Tests for parallel evolution showed that two parallel substitutions (Q72H and E666D) were driven by natural selection, while the K371Q was more likely to be fixed randomly. Thus, our results suggested that the Gys2 gene has undergone parallel evolution on amino acid level between OWFBs and NWFBs in relation to their carbohydrate metabolism.

  2. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  3. Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.).

    Science.gov (United States)

    Prasad, B C Narasimha; Kumar, Vinod; Gururaj, H B; Parimalan, R; Giridhar, P; Ravishankar, G A

    2006-09-05

    Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS ( approximately 35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes.

  4. β-Glucan Synthase Gene Overexpression and β-Glucans Overproduction in Pleurotus ostreatus Using Promoter Swapping

    Science.gov (United States)

    Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

    2013-01-01

    Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884

  5. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping.

    Science.gov (United States)

    Chai, Ran; Qiu, Cuiwei; Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

    2013-01-01

    Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi.

  6. The Endothelial Nitric Oxide Synthase Gene T-786C Polymorphism Increases Myocardial Infarction Risk: A Meta-Analysis

    Science.gov (United States)

    Kong, Xiang-Zhen; Zhang, Zheng-Yi; Wei, Lian-Hua; Li, Rui; Yu, Jing

    2017-01-01

    Background Polymorphisms of the endothelial nitric oxide synthase (eNOS) gene are reportedly associated with myocardial infarction (MI) risk. However, definitive evidence of this association is lacking. In this study, we investigated the potential association of eNOS gene polymorphisms with MI risk by conducting a meta-analysis of studies evaluating this association. Material/Methods PubMed, Web of Knowledge, ScienceDirect, China National Knowledge Infrastructure (CNKI), WanFang, and Database of Chinese Scientific and Technical Periodicals (VIP) were searched for relevant studies. Pooled odds ratios (OR) with 95% confidence interval (CI) were calculated to evaluate the association of eNOS gene T-786C and 4b4a polymorphisms with MI risk. Results Fifteen studies with 8,067 controls and 4,923 MI cases were included in the final meta-analysis. In the overall analysis, T-786C (rs2070744) polymorphism was associated with MI risk (pmeta-analysis, T-786C polymorphism of the eNOS gene was associated with the risk of MI, especially in the Asian populations. PMID:28188309

  7. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    Science.gov (United States)

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.

  8. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, Jesper

    1999-01-01

    BACKGROUND: Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential...... for folate biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP. METHODS: We studied bronchoalveolar samples collected in 1989-99 from a prospective cohort of HIV-1-infected patients who had PCP. In 144...... patients with 152 episodes of PCP, we analysed portions of DHPS using PCR and direct sequencing. The relation between survival, P. carinii DHPS mutations, and other predictors of treatment failure was assessed by Kaplan-Meier and multivariate Cox regression analysis. FINDINGS: P. carinii DHPS mutations...

  9. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  10. Novel point mutation in the uroporphyrinogen III synthase gene causes congenital erythropoietic porphyria of a Japanese family.

    Science.gov (United States)

    Takamura, N; Hombrados, I; Tanigawa, K; Namba, H; Nagayama, Y; de Verneuil, H; Yamashita, S

    1997-06-13

    The molecular basis of the uroporphyrinogen III synthase (UROIIIS) deficiency was investigated in a member of a Japanese family. This defect in heme biosynthesis is responsible for a rare autosomal recessive disease: congenital erythropoietic porphyria (CEP) or Günther's disease. The patient was homozygous for a novel missense mutation: a G to T transition of nucleotide 7 that predicted a valine to phenylalanine substitution at residue 3 (V3F). The parents were heterozygous for the same mutation. The loss of UROIIIS activity was verified by an in vitro assay system. The corresponding mutated protein was expressed in Escherichia coli and no residual activity was observed. Further studies are needed to determine whether the mutations of the UROIIIS gene (UROS) have a specific profile in Japan compared to European or American countries.

  11. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils

    Directory of Open Access Journals (Sweden)

    Irmisch Sandra

    2012-06-01

    Full Text Available Abstract Background The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS, the key enzymes in constructing terpene carbon skeletons. Results Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita. Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (−-(E-β-caryophyllene (MrTPS1, (+-germacrene A (MrTPS3, (E-β-ocimene (MrTPS4 and (−-germacrene D (MrTPS5. A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (−-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. Conclusions The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils.

  12. Four novel cellulose synthase (CESA) genes from Birch (Betula platyphylla Suk.) involved in primary and secondary cell Wall biosynthesis.

    Science.gov (United States)

    Liu, Xuemei; Wang, Qiuyu; Chen, Pengfei; Song, Funan; Guan, Minxiao; Jin, Lihua; Wang, Yucheng; Yang, Chuanping

    2012-09-25

    Cellulose synthase (CESA), which is an essential catalyst for the generation of plant cell wall biomass, is mainly encoded by the CesA gene family that contains ten or more members. In this study; four full-length cDNAs encoding CESA were isolated from Betula platyphylla Suk., which is an important timber species, using RT-PCR combined with the RACE method and were named as BplCesA3, -4, -7 and -8. These deduced CESAs contained the same typical domains and regions as their Arabidopsis homologs. The cDNA lengths differed among these four genes, as did the locations of the various protein domains inferred from the deduced amino acid sequences, which shared amino acid sequence identities ranging from only 63.8% to 70.5%. Real-time RT-PCR showed that all four BplCesAs were expressed at different levels in diverse tissues. Results indicated that BplCESA8 might be involved in secondary cell wall biosynthesis and floral development. BplCESA3 appeared in a unique expression pattern and was possibly involved in primary cell wall biosynthesis and seed development; it might also be related to the homogalacturonan synthesis. BplCESA7 and BplCESA4 may be related to the formation of a cellulose synthase complex and participate mainly in secondary cell wall biosynthesis. The extremely low expression abundance of the four BplCESAs in mature pollen suggested very little involvement of them in mature pollen formation in Betula. The distinct expression pattern of the four BplCesAs suggested they might participate in developments of various tissues and that they are possibly controlled by distinct mechanisms in Betula.

  13. Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

    NARCIS (Netherlands)

    Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

    2004-01-01

    The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

  14. Overexpression of erg20 gene encoding farnesyl pyrophosphate synthase has contrasting effects on activity of enzymes of the dolichyl and sterol branches of mevalonate pathway in Trichoderma reesei.

    Science.gov (United States)

    Piłsyk, Sebastian; Perlińska-Lenart, Urszula; Górka-Nieć, Wioletta; Graczyk, Sebastian; Antosiewicz, Beata; Zembek, Patrycja; Palamarczyk, Grażyna; Kruszewska, Joanna S

    2014-07-10

    The mevalonate pathway is the most diverse metabolic route resulting in the biosynthesis of at least 30,000 isoprenoid compounds, many of which, such as sterols or dolichols, are indispensable for living cells. In the filamentous fungus Trichoderma of major biotechnological interest isoprenoid metabolites are also involved in the biocontrol processes giving the mevalonate pathway an additional significance. On the other hand, little is known about genes coding for enzymes of the mevalonate pathway in Trichoderma. Here, we present cloning and functional analysis of the erg20 gene from Trichoderma reesei coding for farnesyl pyrophosphate (FPP) synthase (EC 2.5.1.10), an enzyme located at the branching point of the mevalonate pathway. Expression of the gene in a thermosensitive erg20-2 mutant of Saccharomyces cerevisiae impaired in the FPP synthase activity suppressed the thermosensitive phenotype. The same gene overexpressed in T. reesei significantly enhanced the FPP synthase activity and also stimulated the activity of cis-prenyltransferase, an enzyme of the dolichyl branch of the mevalonate pathway. Unexpectedly, the activity of squalene synthase from the other, sterol branch, was significantly decreased without, however, affecting ergosterol level.

  15. Diversity of cystathionine ß-synthase haplotypes bearing the most common homocystinuria mutation c.833T>C: a possible role for gene conversion

    DEFF Research Database (Denmark)

    Vyletal, P; Sokolová, J; Cooper, DN;

    2007-01-01

    Homozygosity or compound heterozygosity for the c.833T>C transition (p.I278 T) in the cystathionine beta-synthase (CBS) gene represents the most common cause of pyridoxine-responsive homocystinuria in Western Eurasians. However, the frequency of the pathogenic c.833C allele, as observed in healthy...

  16. SEQUENCE OF THE STRUCTURAL GENE FOR GRANULE-BOUND STARCH SYNTHASE OF POTATO (SOLANUM-TUBEROSUM L) AND EVIDENCE FOR A SINGLE POINT DELETION IN THE AMF ALLELE

    NARCIS (Netherlands)

    van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem

    1991-01-01

    The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type seq

  17. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

    2007-01-01

    , the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...

  18. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  19. [Attempt at characterization of 2 erythrocyte variants of glucose-6-phosphate dehydrogenase in a patient with a partial enzymatic deficit].

    Science.gov (United States)

    Bansard-Desmidt, N

    1975-09-01

    The electrophoresis shows, in red blood cells of a North African man affected by a glucose-6-phosphate dehydrogenase deficiency, the presence of two enzymes differing by their electrophoretic mobilities: one of them presents in the same mobility as variant Gd (+) B, the other being faster. After partial purification of the enzymes by ionic exchange chromatography on cellex D BIO-RAD, the preparation obtained shows some kinetic abnormalities: an increased value of 2-deoxy-glucose-6-phosphate utilisation and a non linear plot of 1/v versus 1/s, inadequate for Km determination. Assuming that our preparation contains two enzymes differing by their affinities for glucose-6-phosphate, were carried out a study of their Michaelis constants for glucose-6-phosphate by a method based on the densitometric determination of colored spots corresponding to these two variants after electrophoretic separation on cellogel strips. One of these variants is similar to Gd (+) B, the other being characterised by increased values of: electrophoretic mobility (+ 110%), Km for glucose-6-hosphate (194 +/- 38 muM, normal range being 55 to 70 muM), utilisation coefficient of 2-deoxy-glucose-6-phosphate.

  20. Chrysanthemyl diphosphate synthase: Isolation of the gene and characterization of the recombinant non-head-to-tail monoterpene synthase from Chrysanthemum cinerariaefolium

    OpenAIRE

    Rivera, Susan B.; Swedlund, Bradley D.; King, Gretchen J.; Bell, Russell N.; Hussey, Charles E.; Shattuck-Eidens, Donna M.; Wrobel, Wislawa M.; Peiser, Galen D.; Poulter, C. Dale

    2001-01-01

    Chrysanthemyl diphosphate synthase (CPPase) catalyzes the condensation of two molecules of dimethylallyl diphosphate to produce chrysanthemyl diphosphate (CPP), a monoterpene with a non-head-to-tail or irregular c1′-2-3 linkage between isoprenoid units. Irregular monoterpenes are common in Chrysanthemum cinerariaefolium and related members of the Asteraceae family. In C. cinerariaefolium, CPP is an intermediate in the biosynthesis of the pyrethrin ester insecticides. CPPa...

  1. Development of genome-specific primers for homoeologous genes in allopolyploid species: the waxy and starch synthase II genes in allohexaploid wheat (Triticum aestivum L. as examples

    Directory of Open Access Journals (Sweden)

    Brûlé-Babel Anita

    2010-05-01

    Full Text Available Abstract Background In allopolypoid crops, homoeologous genes in different genomes exhibit a very high sequence similarity, especially in the coding regions of genes. This makes it difficult to design genome-specific primers to amplify individual genes from different genomes. Development of genome-specific primers for agronomically important genes in allopolypoid crops is very important and useful not only for the study of sequence diversity and association mapping of genes in natural populations, but also for the development of gene-based functional markers for marker-assisted breeding. Here we report on a useful approach for the development of genome-specific primers in allohexaploid wheat. Findings In the present study, three genome-specific primer sets for the waxy (Wx genes and four genome-specific primer sets for the starch synthase II (SSII genes were developed mainly from single nucleotide polymorphisms (SNPs and/or insertions or deletions (Indels in introns and intron-exon junctions. The size of a single PCR product ranged from 750 bp to 1657 bp. The total length of amplified PCR products by these genome-specific primer sets accounted for 72.6%-87.0% of the Wx genes and 59.5%-61.6% of the SSII genes. Five genome-specific primer sets for the Wx genes (one for Wx-7A, three for Wx-4A and one for Wx-7D could distinguish the wild type wheat and partial waxy wheat lines. These genome-specific primer sets for the Wx and SSII genes produced amplifications in hexaploid wheat, cultivated durum wheat, and Aegilops tauschii accessions, but failed to generate amplification in the majority of wild diploid and tetraploid accessions. Conclusions For the first time, we report on the development of genome-specific primers from three homoeologous Wx and SSII genes covering the majority of the genes in allohexaploid wheat. These genome-specific primers are being used for the study of sequence diversity and association mapping of the three homoeologous Wx

  2. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  3. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Burke, Charles Cullen (Moscow, ID); Gershenzon, Jonathan (Jena, DE)

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  4. Expression, subcellular localization, and cis-regulatory structure of duplicated phytoene synthase genes in melon (Cucumis melo L.).

    Science.gov (United States)

    Qin, Xiaoqiong; Coku, Ardian; Inoue, Kentaro; Tian, Li

    2011-10-01

    Carotenoids perform many critical functions in plants, animals, and humans. It is therefore important to understand carotenoid biosynthesis and its regulation in plants. Phytoene synthase (PSY) catalyzes the first committed and rate-limiting step in carotenoid biosynthesis. While PSY is present as a single copy gene in Arabidopsis, duplicated PSY genes have been identified in many economically important monocot and dicot crops. CmPSY1 was previously identified from melon (Cucumis melo L.), but was not functionally characterized. We isolated a second PSY gene, CmPSY2, from melon in this work. CmPSY2 possesses a unique intron/exon structure that has not been observed in other plant PSYs. Both CmPSY1 and CmPSY2 are functional in vitro, but exhibit distinct expression patterns in different melon tissues and during fruit development, suggesting differential regulation of the duplicated melon PSY genes. In vitro chloroplast import assays verified the plastidic localization of CmPSY1 and CmPSY2 despite the lack of an obvious plastid target peptide in CmPSY2. Promoter motif analysis of the duplicated melon and tomato PSY genes and the Arabidopsis PSY revealed distinctive cis-regulatory structures of melon PSYs and identified gibberellin-responsive motifs in all PSYs except for SlPSY1, which has not been reported previously. Overall, these data provide new insights into the evolutionary history of plant PSY genes and the regulation of PSY expression by developmental and environmental signals that may involve different regulatory networks.

  5. Genetic characterization of the acetohydroxyacid synthase (AHAS) gene responsible for resistance to imidazolinone in chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Thompson, Courtney; Tar'an, Bunyamin

    2014-07-01

    A point mutation in the AHAS1 gene leading to resistance to imidazolinone in chickpea was identified. The resistance is inherited as a single gene. A KASP marker targeting the mutation was developed. Weed control in chickpea (Cicer arietinum L.) is challenging due to poor crop competition ability and limited herbicide options. A chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified, but the genetic inheritance and the mechanism were unknown. In many plant species, resistance to IMI is caused by point mutation(s) in the acetohydroxyacid synthase (AHAS) gene resulting in an amino acid substitution preventing herbicide attachment to the molecule. The main objective of this research was to characterize the resistance to IMI herbicides in chickpea. Two homologous AHAS genes namely AHAS1 and AHAS2 sharing 80 % amino acid sequence similarity were identified in the chickpea genome. Cluster analysis indicated independent grouping of AHAS1 and AHAS2 across legume species. A point mutation in the AHAS1 gene at C675 to T675 resulting in an amino acid substitution from Ala205 to Val205 confers the resistance to IMI in chickpea. A KASP marker targeting the point mutation was developed and effectively predicted the response to IMI herbicides in a recombinant inbred (RI) population of chickpea. The RI population was used in molecular mapping where the major locus for the reaction to IMI herbicide was mapped to chromosome 5. Segregation analysis across an F2 population and RI population demonstrated that the resistance is inherited as a single gene in a semi-dominant fashion. The simple genetic inheritance and the availability of KASP marker generated in this study would speed up development of chickpea varieties with resistance to IMI herbicides.

  6. Cloning and characterization of the gene encoding β-amyrin synthase in the glycyrrhizic acid biosynthetic pathway in Glycyrrhiza uralensis

    Directory of Open Access Journals (Sweden)

    Honghao Chen

    2013-12-01

    Full Text Available Glycyrrhiza uralensis is considered to be one of the most important herbs in traditional Chinese medicine due to its numerous pharmacological effects particularly its ability to relieve cough and act as a mucolytic. Based on previous research, these effects are mediated by a number of active ingredients, especially glycyrrhizic acid (GA. In the present study, a gene encoding β-amyrin synthase (β-AS involved in GA biosynthesis in G. uralensis has been cloned and expressed in Saccharomyces cerevisiae. The cloned enzyme showed similar activity to native enzymes isolated from other Glycyrrhiza species to catalyze the conversion of 2,3-oxidosqualene into β-amyrin. In fact the β-AS gene is particularly important in the GA biosynthetic pathway in G. uralensis. The complete sequence of the enzyme was determined and a phylogenetic tree based on the β-AS gene of G. uralensis and 20 other species was created. This showed that Glycyrrhiza glabra had the closest kinship with G. uralensis. The results of this work will be useful in determining how to improve the efficacy of G. uralensis by improving its GA content and in exploring the biosynthesis of GA in vitro.

  7. Citrate-release-mediated aluminum resistance is coupled to the inducible expression of mitochondrial citrate synthase gene in Paraserianthes falcataria.

    Science.gov (United States)

    Osawa, Hiroki; Kojima, Katsumi

    2006-05-01

    Aluminum (Al) resistance in some leguminous plants is achieved by enhanced citrate release from roots. Enhancement requires several hours for complete activation and is postulated to involve Al-responsive genes or components. We examined the mechanism of Al-induced citrate release by studying the relationship between citrate release and expression of the mitochondrial citrate synthase (mCS) gene in three leguminous trees. Root elongation in Leucaena leucocephala (Lam.) de Wit was arrested within 24 h by 30 microM Al, whereas root elongation in Paraserianthes falcataria (L.) Neilson and Acacia mangium Willd. was inhibited mangium maintained enhanced release and accumulation of citrate for at least 28 days in response to Al treatment. Aluminum increased the accumulation of mCS transcripts in P. falcataria roots, but not in L. leucocephala roots, and thus up-regulation decreased following removal of Al. Lanthanum did not alter the expression level of mCS. Aluminum increased mCS activity concomitantly with enhanced mCS gene expression in P. falcataria, whereas it did not affect mCS activity in L. leucocephala. Aluminum content in root apices of P. falcataria was increased by cycloheximide, supporting the idea that de novo synthesis of proteins is a prerequisite for Al resistance. Our findings suggest that Al-inducible expression of mCS coupled with enhanced citrate release mediates Al resistance in P. falcataria.

  8. Molecular cloning and functional characterization of Catharanthus roseus hydroxymethylbutenyl 4-diphosphate synthase gene promoter from the methyl erythritol phosphate pathway.

    Science.gov (United States)

    Ginis, Olivia; Courdavault, Vincent; Melin, Céline; Lanoue, Arnaud; Giglioli-Guivarc'h, Nathalie; St-Pierre, Benoit; Courtois, Martine; Oudin, Audrey

    2012-05-01

    The Madagascar periwinkle produces monoterpenoid indole alkaloids (MIA) of high interest due to their therapeutical values. The terpenoid moiety of MIA is derived from the methyl erythritol phosphate (MEP) and seco-iridoid pathways. These pathways are regarded as the limiting branch for MIA biosynthesis in C. roseus cell and tissue cultures. In previous studies, we demonstrated a coordinated regulation at the transcriptional and spatial levels of genes from both pathways. We report here on the isolation of the 5'-flanking region (1,049 bp) of the hydroxymethylbutenyl 4-diphosphate synthase (HDS) gene from the MEP pathway. To investigate promoter transcriptional activities, the HDS promoter was fused to GUS reporter gene. Agrobacterium-mediated transformation of young tobacco leaves revealed that the cloned HDS promoter displays a tissue-specific GUS staining restricted to the vascular region of the leaves and limited to a part of the vein that encompasses the phloem in agreement with the previous localization of HDS transcripts in C. roseus aerial organs. Further functional characterizations in stably or transiently transformed C. roseus cells allowed us to identify the region that can be consider as the minimal promoter and to demonstrate the induction of HDS promoter by several hormonal signals (auxin, cytokinin, methyljasmonate and ethylene) leading to MIA production. These results, and the bioinformatic analysis of the HDS 5'-region, suggest that the HDS promoter harbours a number of cis-elements binding specific transcription factors that would regulate the flux of terpenoid precursors involved in MIA biosynthesis.

  9. Investigation of Cosenza Mutation in Patients with Deficiency of Glucose-6-Phosphate Dehydrogenase (G6PD in North West of Iran

    Directory of Open Access Journals (Sweden)

    Omolbanin Javadi

    2015-03-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD is a greatly polymorphic enzyme encoded by human X-linked gene. G6PD deficit is the most public enzymopathy in human with about 400 million people affected globally. It is the main controlling enzyme in the hexose monophosphate shunt catalase the oxidation of glucose-6-phosphate  to 6-phosphogluconolacton and the creation of reducing equals in the form of NADPH to meet the cellular redox formal and its absence origin hemolytic anemia - favism and newborn jaundice. Mutation in this enzyme cause three major types of unusual phenotype, including Mediterranean, Chatham and Cosenza. In this study, by Rapid Genomic DNA Extraction (RGDE method, from 90 blood samples of unrelated male and female patients with genetic deficiency of G6PD, DNA was removed and next digestion by Eco81I enzymes, in order to research for Cosenza mutation, they were analyzed by means of PCR-RFLP. Sequencing methods were used. Of 90 patients, one patient had a Cosenza mutation frequency of 1.01%. Eighty-nine patients (98.99% were not affected by the Cosenza-type mutation. Accordingly, Cosenza mutation is not regarded as the most common mutation in Iranian North-west population.   

  10. Investigation of Cosenza Mutation in Patients with Deficiency of Glucose-6-Phosphate Dehydrogenase (G6PD in North West of Iran

    Directory of Open Access Journals (Sweden)

    Omolbanin Javadi Javadi

    2015-02-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD is a greatly polymorphic enzyme encoded by human X-linked gene. G6PD deficit is the most public enzymopathy in human with about 400 million people affected globally. It is the main controlling enzyme in the hexose monophosphate shunt catalase the oxidation of glucose-6-phosphate  to 6-phosphogluconolacton and the creation of reducing equals in the form of NADPH to meet the cellular redox formal and its absence origin hemolytic anemia - favism and newborn jaundice. Mutation in this enzyme cause three major types of unusual phenotype, including Mediterranean, Chatham and Cosenza. In this study, by Rapid Genomic DNA Extraction (RGDE method, from 90 blood samples of unrelated male and female patients with genetic deficiency of G6PD, DNA was removed and next digestion by Eco81I enzymes, in order to research for Cosenza mutation, they were analyzed by means of PCR-RFLP. Sequencing methods were used. Of 90 patients, one patient had a Cosenza mutation frequency of 1.01%. Eighty-nine patients (98.99% were not affected by the Cosenza-type mutation. Accordingly, Cosenza mutation is not regarded as the most common mutation in Iranian North-west population.   

  11. Endothelial Nitric Oxide Synthase Gene Intron 4, 27 bp Repeat Polymorphism and Essential Hypertension in the Kazakh Chinese Population

    Institute of Scientific and Technical Information of China (English)

    Fengmei DENG; Huimin ZHANG; Juan ZHAO; Hua ZHONG; Ling HE; Jun LI; Le ZHANG; Shuren WANG; Qinghua HU; Bin TANG; Fang HE; Shuxia GUO; Jiang CHEN; Feng LI; Xuehua WU; Jun ZHANG

    2007-01-01

    To investigate the relationship between 27 bp repeat polymorphism in intron 4 in the endothelial nitric oxide synthase (eNOS4) gene and essential hypertension in the Kazakh Chinese population, 151 patients with essential hypertension and 138 healthy people were selected from the Boertonggu countryside of Shawan region in the Xinjiang Uygur Autonomous Region of China in 2006. The polymorphism of eNOS in the two groups was detected with polymerase chain reaction assays and the genotype frequencies in each group were calculated following the Hardy-Weinberg law. Four and five tandem 27 bp repeats were designated as "a" and "b", respectively. It was found that the frequencies of b/b, b/a and a/a genotypes of the eNOS4 gene were 84.06%, 15.22% and 0.72% in the control group, and 81.46%, 15.89% and 2.65% in the hypertension group, respectively. The frequencies of gene "b" and "a" were 91.67% and 8.33% in the control group and 89.40% and 10.60% in the hypertension group, respectively. It was found that plasma eNOS activity was not associated with genotypes and alleles of eNOS gene. Plasma eNOS activity in the hypertension group was significantly decreased compared with the control group (P<0.01). The results suggest that eNOS4 gene polymorphisms are unlikely to be the major genetic susceptibility factors for essential hypertension in the Xinjiang Kazakh population. However, a positive association between plasma eNOS activity and essential hypertension has been revealed.

  12. Effects of endothelial nitric oxide synthase, alpha-adducin, and other candidate gene polymorphisms on blood pressure response to hydrochlorothiazide.

    Science.gov (United States)

    Turner, Stephen T; Chapman, Arlene B; Schwartz, Gary L; Boerwinkle, Eric

    2003-10-01

    Pharmacogenetic discoveries may enable greater individualization of antihypertensive drug therapy. We investigated polymorphisms in the genes encoding endothelial nitric oxide synthase (Glu298-->Asp), alpha-adducin (Gly460-->Trp), the beta(1)-adrenoceptor (Arg389-->Gly), beta2-adrenoceptor (Arg16-->Gly), and lipoprotein lipase (Ser447-->Stop) for their potential influences on blood pressure (BP) response to a thiazide diuretic. The sample consisted of 291 unrelated non-Hispanic African American adults (150 women and 141 men) and 294 unrelated non-Hispanic white adults (126 women and 168 men) who were between 30 and 59.9 years of age and who had essential hypertension. Previous antihypertensive drug therapy was withdrawn for at least 4 weeks, and subjects were then treated with hydrochlorothiazide (25 mg daily) for 4 weeks to determine BP response. The covariates of ethnicity, gender, age, and waist-to-hip ratio accounted for 26% of interindividual variation in systolic BP response and 11% of interindividual variation in diastolic BP response. After adjustment for covariates, the endothelial nitric oxide synthase Glu298-->Asp polymorphism made an additional statistically significant contribution to predicting diastolic BP response to hydrochlorothiazide, accounting for another 1% of interindividual variation in response (P =.034). In contrast, the other polymorphisms, including the alpha-adducin Gly460-->Trp polymorphism, made no statistically significant contributions to prediction of BP response. Although we reject the null hypothesis of no genetic effects on BP response to hydrochlorothiazide, the influence of variation at single sites is likely to be small. More extensive characterization of genetic variation is required for pharmacogenetic approaches to become clinically useful in tailoring antihypertensive drug therapy for individual patients.

  13. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  14. Molecular cloning and expression profile of β-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.

    Directory of Open Access Journals (Sweden)

    Long Hongxu

    2015-01-01

    Full Text Available Tung tree (Vernicia fordii is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole α-eleostearic acid (9 cis, 11 trans, 13 trans octadecatrienoic acid. Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a multienzyme complex including β-ketoacyl-acyl-carrier-protein synthase (KAS. Little is known about KAS in tung tree. The objective of this study was to clone KAS genes and analyze their expression profiles in tung tree. A full-length cDNA encoding KAS III and a partial cDNA encoding KAS II were isolated from tung tree by PCR cloning using degenerate primers and rapid amplification of cDNA ends system. The full-length cDNA of VfKAS III was 1881 bp in length with an open reading frame of 1212 bp. VfKAS III genomic DNA was also isolated and sequenced, which contained 8 exons in 5403 bp length. The deduced VfKAS III protein shared approximately 80% identity with homologous KAS IIIs from other plants. Quantitative PCR analysis revealed that KAS II and KAS III were expressed in all of the tissues and organs tested but exhibited different expression patterns in tung tree. The expression levels of KAS II in young tissues were much lower than those in mature tissues, whereas the highest expression levels of KAS III were observed in young stem and young leaf. These results should facilitate further studies on the regulation of tung oil biosynthesis by KAS in tung tree.

  15. Gene identification and functional analysis of methylcitrate synthase in citric acid-producing Aspergillus niger WU-2223L.

    Science.gov (United States)

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2013-01-01

    Methylcitrate synthase (EC 2.3.3.5; MCS) is a key enzyme of the methylcitric acid cycle localized in the mitochondria of eukaryotic cells and related to propionic acid metabolism. In this study, cloning of the gene mcsA encoding MCS and heterologous expression of it in Escherichia coli were performed for functional analysis of the MCS of citric acid-producing Aspergillus niger WU-2223L. Only one copy of mcsA (1,495 bp) exists in the A. niger WU-2223L chromosome. It encodes a 51-kDa polypeptide consisting of 465 amino acids containing mitochondrial targeting signal peptides. Purified recombinant MCS showed not only MCS activity (27.6 U/mg) but also citrate synthase (EC 2.3.3.1; CS) activity (26.8 U/mg). For functional analysis of MCS, mcsA disruptant strain DMCS-1, derived from A. niger WU-2223L, was constructed. Although A. niger WU-2223L showed growth on propionate as sole carbon source, DMCS-1 showed no growth. These results suggest that MCS is an essential enzyme in propionic acid metabolism, and that the methylcitric acid cycle operates functionally in A. niger WU-2223L. To determine whether MCS makes a contribution to citric acid production, citric acid production tests on DMCS-1 were performed. The amount of citric acid produced from glucose consumed by DMCS-1 in citric acid production medium over 12 d of cultivation was on the same level to that by WU-2223L. Thus it was found that MCS made no contribution to citric acid production from glucose in A. niger WU-2223L, although MCS showed CS activity.

  16. Identification and characterization of granule bound starch synthase I (GBSSI) gene of tartary buckwheat (Fagopyrum tataricum Gaertn.).

    Science.gov (United States)

    Wang, Xun; Feng, Bo; Xu, Zhibin; Sestili, Francesco; Zhao, Guojun; Xiang, Chao; Lafiandra, Domenico; Wang, Tao

    2014-01-25

    Tartary buckwheat (Fagopyrum tataricum Gaertn.) is increasingly considered as an important functional food material because of its rich nutraceutical compounds. Reserve starch is the major component of tartary buckwheat seed. However, the gene sequences and the molecular mechanism of tartary buckwheat starch synthesis are unknown so far. In this study, the complete genomic sequence and full-size cDNA coding tartary buckwheat granule-bound starch synthase I (FtGBSSI), which is responsible for amylose synthesis, were isolated and analyzed. The genomic sequence of the FtGBSSI contained 3947 nucleotides and was composed of 14 exons and 13 introns. The cDNA coding sequence of FtGBSSI shared 63.3%-75.1% identities with those of dicots and 56.6%-57.5% identities with monocots (Poaceae). In deduced amino acid sequence of FtGBSSI, eight motifs conserved among plant starch synthases were identified. A cleavage at the site IVC↓G of FtGBSSI protein produces the chloroplast transit sequence of 78 amino acids and the mature protein of 527 amino acids. The FtGBSSI mature protein showed an identity of 73.4%-77.8% with dicot plants, and 67.6%-70.4% with monocot plants (Poaceae). The mature protein was composed of 20 α-helixes and 16 β-strands, and folds into two main domains, N- and C-terminal domains. The critical residues which are involved in ADP and sugar binding were predicted. These results will be useful to modulate starch composition of buckwheat kernels with the aim to produce novel improved varieties in future breeding programs.

  17. Effect of growth hormone on fatty acid synthase gene expression in porcine adipose tissue cultures

    Directory of Open Access Journals (Sweden)

    Andrea A.F.B.V. José

    2006-01-01

    Full Text Available We describe an efficient in vitro assay to test growth hormone effects on mRNA levels and fatty acid synthase (FAS, EC. 2.3.1.85 activity. Swine adipose tissue explants were long-term cultured in medium containing growth hormone and FAS mRNA levels and enzyme activity were measured. We quantified FAS transcripts by competitive reverse transcriptase PCR (RT-PCR using total RNA from cultured adipose tissue explants and RT-PCR standard-curves were constructed using a cloned 307 bp segment of native FAS cDNA and a shorter fragment from which a 64 bp (competitor, 243 bp internal sequence had been deleted. A known amount of competitor was added to each PCR as an internal control and µ-actin transcripts were also measured to correct for differences in total RNA extraction and reverse transcription efficiency. In cultures with added growth hormone FAS mRNA levels decreased 70% (p < 0.01 and FAS enzyme activity decreased 22% (p < 0.05. These in vitro growth hormone effects were consistent with those observed in vivo, showing that in vitro adipose tissue culture combined with RT-PCR is a useful and accurate tool for studying growth hormone modulation of adipose tissue metabolism. This technique allowed the diagnosis of lower levels of FAS mRNA in the presence of growth hormone and these low levels were associated with decreased FAS activity in the adipose tissue explants.

  18. Isolation of 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey.

    Science.gov (United States)

    Yang, G H; Liu, J P

    2014-10-20

    A full-length cDNA of a 1-aminocyclopropane-1-carboxylate synthase (ACS) family member from Oncidium, named OnACS1 (GenBank accession No. JQ822087) was cloned and characterized by reverse transcription polymerase chain reaction and rapid amplification of cDNA ends technology. The full-length cDNA was 1586 bp, including a 1308-bp open reading frame, a 105-bp 5' untranslated region (UTR), and 173-bp 3' UTR, encoding 436 amino acids. The deduced amino acid sequence of OnACS1 shares 85, 84, and 83% homology with ACS proteins of Cattleya bicolor, Dendrobium crumenatum, and Phalaenopsis hybrid, respectively. Prokaryotic expression and sodium dodecyl sulfate polyacrylamide gel electrophoresis showed that a specific band was produced and was consistent with the predicted protein size. A tissue-specific manner of OnACS1 expression was observed, and it was predominantly expressed in the gynostemium. The OnACS1 expression in the sepals and gynandria was upregulated by 1% ethephon treatment.

  19. Dynamic modulation of thymidylate synthase gene expression and fluorouracil sensitivity in human colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Kentaro Wakasa

    Full Text Available Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy.

  20. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    Science.gov (United States)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  1. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  2. In silico identification and analysis of phytoene synthase genes in plants.

    Science.gov (United States)

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

    2015-08-14

    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  3. Glucosamine: fructose-6-phosphate amidotransferase in the white shrimp Litopenaeus vannamei: characterization and regulation under alkaline and cadmium stress.

    Science.gov (United States)

    Liu, Y; Cai, D X; Wang, L; Li, J Z; Wang, W N

    2015-10-01

    Heavy metal residues and chemical contaminators considered as relevant sources of aquatic environmental pollutants have a generally immunosuppressive effect on aquatic organisms, depressing metabolic activities and immune response. Glutamine: fructose-6-phosphate aminotransferase (GFAT, EC2.6.1.16) is the first, and rate-limiting, enzyme in the hexosamine biosynthetic pathway, and is involved in the regulation of chitin biosynthesis and glycosylation of proteins. We have isolated and characterized GFAT from the white shrimp Litopenaeus vannamei. Amino acid sequence similarity of the Lv-GFAT (L.vannamei-GFAT) was highest to GFATs isolated from insects and mammals (83 % similarity to that of Haemaphysalis longicornis). The open-reading frame of the Lv-GFAT codes for a protein of 41.6 kDa with a calculated isoelectric point of 5.03. RT-PCR assays showed that endogenous Lv-GFAT mRNA is most strongly expressed in the intestine. Further analysis of Lv-GFAT gene expression in hepatopancreas by quantitative real-time PCR demonstrated that Lv-GFAT transcript levels increased when the shrimp were exposed to alkaline pH (9.3) and cadmium stress, but the time when its mRNA expression level peaked differed under these stresses. We also first expressed the recombinant protein of GFAT from shrimps in Escherichia coli. Western blot analyses confirmed that the Lv-GFAT protein was strongly expressed in the hepatopancreas after exposure to the LC-Cd stress. These results suggest that Lv-GFAT expression is stimulated by alkaline pH and cadmium stress and that it may play important roles in resistance of shrimp to environmental stresses.

  4. Expression of glutamine:fructose-6-phosphate amidotransferase in human tissues: evidence for high variability and distinct regulation in diabetes.

    Science.gov (United States)

    Nerlich, A G; Sauer, U; Kolm-Litty, V; Wagner, E; Koch, M; Schleicher, E D

    1998-02-01

    Recent in vitro and in vivo studies suggested that the increased flux of glucose through the hexosamine biosynthetic pathway may contribute to glucose-induced insulin resistance and to the induction of the synthesis of growth factors. Because glutamine:fructose-6-phosphate amidotransferase (GFAT) catalyzes the first and rate-limiting step in the formation of hexosamine products, this enzyme is the key regulator in this pathway and is therefore possibly also involved in the alterations occurring in preclinical or manifest diabetic patients. To study the expression of GFAT in human tissues, we produced and characterized a peptic antiserum specifically recognizing GFAT protein and a riboprobe for the detection of GFAT mRNA. Immunohistochemical and nonradioactive in situ hybridization analysis revealed high levels of expression of GFAT protein and mRNA in adipocytes and skeletal muscle. Furthermore, a marked GFAT expression was found in vascular smooth muscle cells with unexpectedly high variability and lower levels in other cells, e.g., peripheral nerve sheath cells or endocrine-active cells, including the pancreatic islet cell. GFAT protein expression was below detection level in endothelium, osteocytes, lymphocytes, granulocytes, and in most quiescent fibroblasts. In renal tissue, GFAT was expressed in tubular epithelial cells, while glomerular cells remained essentially unstained. Renal sections obtained from patients with diabetic nephropathy showed significant GFAT expression in some glomerular epithelial and mesangial cells, indicating that GFAT expression may be induced by manifest diabetes. Our data indicate that GFAT is expressed in most tissues involved in the development of diabetic late complications. Furthermore, the results suggest that GFAT gene expression is highly regulated.

  5. Genetics Home Reference: GM3 synthase deficiency

    Science.gov (United States)

    ... Facebook Share on Twitter Your Guide to Understanding Genetic Conditions Search MENU Toggle navigation Home Page Search ... Conditions Genes Chromosomes & mtDNA Resources Help Me Understand Genetics Home Health Conditions GM3 synthase deficiency GM3 synthase ...

  6. Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase.

    Science.gov (United States)

    Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N

    2014-09-01

    Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily.

  7. Structural analysis of the promoter of tomato 1-aminocyclopropane-1-carboxylate synthase 6 gene(Le-ACS6)

    Institute of Scientific and Technical Information of China (English)

    LIN JingYu; FAN Rong; WAN XiaoRong; CHARNG Yeeyung; WANG NingNing

    2007-01-01

    Ethylene plays an important role in the regulation of many growth and developmental processes of higher plants. In tomato, Le-ACS6, a member of the ACC synthase multigene family involved in system 1 ethylene biosynthesis during fruit ripening, is subject to negative feedback regulation by ethylene. To identify the cis-elements that are responsible for the negative feedback control, we established an in vitro transient assay system employing particle bombardment on mature-green tomato fruit pericarp to examine the expression of a luciferase (LUC) reporter gene driven by a 5'-serially deleted Le-ACS6 promoter. The results localized putative cis-elements required for negative ethylene-response between -347 and -266 upstream from the translational start site ATG. Several lines of stable transformation of the Le-ACS6 promoter and GUS reporter fusion gene containing internal deletion from -347 to -266 were generated. The expression pattern of the GUS reporter showed that removal of the nucleotides from -347 to -266 completely eliminated the response of the Le-ACS6 promoter to exogenous ethylene.

  8. 2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

    Science.gov (United States)

    Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

    2012-12-01

    Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

  9. Phenotype commitment in vascular smooth muscle cells derived from coronary atherosclerotic plaques: differential gene expression of endothelial Nitric Oxide Synthase

    Directory of Open Access Journals (Sweden)

    ML Rossi

    2009-06-01

    Full Text Available Unstable angina and myocardial infarction are the clinical manifestations of the abrupt thrombotic occlusion of an epicardial coronary artery as a result of spontaneous atherosclerotic plaque rupture or fissuring, and the exposure of highly thrombogenic material to blood. It has been demonstrated that the proliferation of vascular smooth muscle cells (VSMCs and impaired bioavailabilty of nitric oxide (NO are among the most important mechanisms involved in the progression of atherosclerosis. It has also been suggested that a NO imbalance in coronary arteries may be involved in myocardial ischemia as a result of vasomotor dysfunction triggering plaque rupture and the thrombotic response. We used 5’ nuclease assays (TaqMan™ PCRs to study gene expression in coronary plaques collected by means of therapeutic directional coronary atherectomy from 15 patients with stable angina (SA and 15 with acute coronary syndromes (ACS without ST elevation. Total RNA was extracted from the 30 plaques and the cDNA was amplified in order to determine endothelial nitric oxide synthase (eNOS gene expression. Analysis of the results showed that the expression of eNOS was significantly higher (p<0.001 in the plaques from the ACS patients. Furthermore, isolated VSMCs from ACS and SA plaques confirmed the above pattern even after 25 plating passages. In situ RT-PCR was also carried out to co-localize the eNOS messengers and the VSMC phenotype.

  10. Relationship of endothelial nitric oxide synthase gene polymorphism with blood pressure,lipid profile and blood glucose level

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    To study the relationship of the polymorphism of endothelial nitric oxide synthase(eNOS)gene and blood pressure,lipid profiles and blood glucose level.By using PCR-RFLP,the eNOS Glu298Asp gene polymorphism was detected in 184 patients with essential hypertension and 196 matched healthy individuals with normal blood pressure.Taking into account eNOS Glu298Asp polymorphisms,the relationship of blood pressure with triglycerides(TG),total cholesterol(TC),high density lipoprotein(HDL),low density lipoprotein(LDL)and blood glucose level was analyzed.The distribution of eNOS Glu298Asp polymorphism had no significant difference between different blood pressure groups and gender groups,but there was a significant difference between different age groups,diastolic blood pressure groups or BMI groups(P<0.05).Asp/Asp genotype significantly increased the risk of hypertension in individuals with serum TC above 5.4 mmol/L(P=0.03,OR=2.65).eNOSGlu298Asp polymorphism and serum lipid could synergistically modulate the blood pressure,eNOS Asp/Asp genotype could significantly increase the risk of hypertension in individuals with serum TC over 5.4 mmol/L,eNOS Glu298Asp in combination with serum TC could be used to predict the risk of hypertension.

  11. Gene therapy via inducible nitric oxide synthase: a tool for the treatment of a diverse range of pathological conditions.

    Science.gov (United States)

    McCarthy, Helen O; Coulter, Jonathan A; Robson, Tracy; Hirst, David G

    2008-08-01

    Nitric oxide (NO(.)) is a reactive nitrogen radical produced by the NO synthase (NOS) enzymes; it affects a plethora of downstream physiological and pathological processes. The past two decades have seen an explosion in the understanding of the role of NO(.) biology, highlighting various protective and damaging modes of action. Much of the controversy surrounding the role of NO(.) relates to the differing concentrations generated by the three isoforms of NOS. Both calcium-dependent isoforms of the enzyme (endothelial and neuronal NOS) generate low-nanomolar/picomolar concentrations of NO(.). By contrast, the calcium-independent isoform (inducible NOS (iNOS)) generates high concentrations of NO(.), 2-3 orders of magnitude greater. This review summarizes the current literature in relation to iNOS gene therapy for the therapeutic benefit of various pathological conditions, including various states of vascular disease, wound healing, erectile dysfunction, renal dysfunction and oncology. The available data provide convincing evidence that manipulation of endogenous NO(.) using iNOS gene therapy can provide the basis for future clinical trials.

  12. Bioengineering of the Plant Culture of Capsicum frutescens with Vanillin Synthase Gene for the Production of Vanillin.

    Science.gov (United States)

    Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan

    2017-01-01

    Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a plant system. The VpVAN enzyme had been shown to directly convert ferulic acid and its glucoside into vanillin and its glucoside, respectively. As the ferulic acid precursor and vanillin were found to be the intermediates in the phenylpropanoid biosynthetic pathway of Capsicum species, this work serves as a proof-of-concept for vanillin production using Capsicum frutescens (C. frutescens or hot chili pepper). The cells of C. frutescens were genetically transformed with a codon optimized VpVAN gene via biolistics. Transformed explants were selected and regenerated into callus. Successful integration of the gene cassette into the plant genome was confirmed by polymerase chain reaction. High-performance liquid chromatography was used to quantify the phenolic compounds detected in the callus tissues. The vanillin content of transformed calli was 0.057% compared to 0.0003% in untransformed calli.

  13. Bioinformatic and molecular analysis of hydroxymethylbutenyl diphosphate synthase (GCPE) gene expression during carotenoid accumulation in ripening tomato fruit.

    Science.gov (United States)

    Rodríguez-Concepción, Manuel; Querol, Jordi; Lois, Luisa María; Imperial, Santiago; Boronat, Albert

    2003-07-01

    Carotenoids are plastidic isoprenoid pigments of great biological and biotechnological interest. The precursors for carotenoid production are synthesized through the recently elucidated methylerythritol phosphate (MEP) pathway. Here we have identified a tomato ( Lycopersicon esculentum Mill.) cDNA sequence encoding a full-length protein with homology to the MEP pathway enzyme hydroxymethylbutenyl 4-diphosphate synthase (HDS, also called GCPE). Comparison with other plant and bacterial HDS sequences showed that the plant enzymes contain a plastid-targeting N-terminal sequence and two highly conserved plant-specific domains in the mature protein with no homology to any other sequence in the databases. The ubiquitous distribution of HDS-encoding expressed sequence tags (ESTs) in the tomato collections suggests that the corresponding gene is likely expressed throughout the plant. The role of HDS in controlling the supply of precursors for carotenoid biosynthesis was estimated from the bioinformatic and molecular analysis of transcript abundance in different stages of fruit development. No significant changes in HDS gene expression were deduced from the statistical analysis of EST distribution during fruit ripening, when an active MEP pathway is required to support a massive accumulation of carotenoids. RNA blot experiments confirmed that similar transcript levels were present in both the wild-type and carotenoid-depleted yellow ripe ( r) mutant fruit independent of the stage of development and the carotenoid composition of the fruit. Together, our results are consistent with a non-limiting role for HDS in carotenoid biosynthesis during tomato fruit ripening.

  14. Association of a functional variant of the nitric oxide synthase 1 gene with personality, anxiety, and depressiveness.

    Science.gov (United States)

    Kurrikoff, Triin; Lesch, Klaus-Peter; Kiive, Evelyn; Konstabel, Kenn; Herterich, Sabine; Veidebaum, Toomas; Reif, Andreas; Harro, Jaanus

    2012-11-01

    A functional promoter polymorphism of the nitric oxide synthase 1 gene first exon 1f variable number tandem repeat (NOS1 ex1f-VNTR) is associated with impulsivity and related psychopathology. Facets of impulsivity are strongly associated with personality traits; maladaptive impulsivity with neuroticism; and adaptive impulsivity with extraversion. Both high neuroticism and low extraversion predict anxiety and depressive symptoms. The aim of the present study was to evaluate the effect of the NOS1 ex1f-VNTR genotype and possible interaction with environmental factors on personality, anxiety, and depressiveness in a population-representative sample. Short allele carriers had higher neuroticism and anxiety than individuals with the long/long (l/l) genotype. Male short/short homozygotes also had higher extraversion. In the face of environmental adversity, females with a short allele had higher scores of neuroticism, anxiety, and depressiveness compared to the l/l genotype. Males were more sensitive to environmental conditions when they had the l/l genotype and low extraversion. In conclusion, the NOS1 ex1f-VNTR influences personality and emotional regulation dependent on gender and environment. Together with previous findings on the effect of the NOS1 genotype on impulse control, these data suggest that NOS1 should be considered another plasticity gene, because its variants are associated with different coping strategies.

  15. Glucose-6-phosphate dehydrogenase deficiency in northern Mexico and description of a novel mutation

    Indian Academy of Sciences (India)

    N. García-Magallanes; F. Luque-Ortega; E. M. Aguilar-Medina; R. Ramos-Payán; C. Galaviz-Hernández; J. G. Romero-Quintana; L. Del Pozo-Yauner; H. Rangel-Villalobos; E. Arámbula-Meraz

    2014-08-01

    Glucose-6-phosphate dehydrogenase deficiency (G6PD) is the most common enzyme pathology in humans; it is X-linked inherited and causes neonatal hyperbilirubinaemia, chronic nonspherocytic haemolytic anaemia and drug-induced acute haemolytic anaemia. G6PD deficiency has scarcely been studied in the northern region of Mexico, which is important because of the genetic heterogeneity described in Mexican population. Therefore, samples from the northern Mexico were biochemically screened for G6PD deficiency, and PCR-RFLPs, and DNA sequencing used to identify mutations in positive samples. The frequency of G6PD deficiency in the population was 0.95% ($n = 1993$); the mutations in 86% of these samples were G6PD A-202A/376G, G6PD A-376G/968C and G6PD Santamaria376G/542T. Contrary to previous reports, we demonstrated that G6PD deficiency distribution is relatively homogenous throughout the country $(P = 0.48336)$, and the unique exception with high frequency of G6PD deficiency does not involve a coastal population (Chihuahua: 2.4%). Analysis of eight polymorphic sites showed only 10 haplotypes. In one individual we identified a new G6PD mutation named Mexico DF193A>G (rs199474830), which probably results in a damaging functional effect, according to PolyPhen analysis. Proteomic impact of the mutation is also described.

  16. Telomerase prevents accelerated senescence in glucose-6-phosphate dehydrogenase (G6PD-deficient human fibroblasts

    Directory of Open Access Journals (Sweden)

    Wu Yi-Hsuan

    2009-02-01

    Full Text Available Abstract Fibroblasts derived from glucose-6-phosphate dehydrogenase (G6PD-deficient patients display retarded growth and accelerated cellular senescence that is attributable to increased accumulation of oxidative DNA damage and increased sensitivity to oxidant-induced senescence, but not to accelerated telomere attrition. Here, we show that ectopic expression of hTERT stimulates telomerase activity and prevents accelerated senescence in G6PD-deficient cells. Stable clones derived from hTERT-expressing normal and G6PD-deficient fibroblasts have normal karyotypes, and display no sign of senescence beyond 145 and 105 passages, respectively. Activation of telomerase, however, does not prevent telomere attrition in earlier-passage cells, but does stabilize telomere lengths at later passages. In addition, we provide evidence that ectopic expression of hTERT attenuates the increased sensitivity of G6PD-deficient fibroblasts to oxidant-induced senescence. These results suggest that ectopic expression of hTERT, in addition to acting in telomere length maintenance by activating telomerase, also functions in regulating senescence induction.

  17. Comparison of quantitative and qualitative tests for glucose-6-phosphate dehydrogenase deficiency in the neonatal period.

    Science.gov (United States)

    Keihanian, F; Basirjafari, S; Darbandi, B; Saeidinia, A; Jafroodi, M; Sharafi, R; Shakiba, M

    2017-06-01

    Considering the high prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency among newborns, different screening methods have been established in various countries. In this study, we aimed to assess the prevalence of G6PD deficiency among newborns in Rasht, Iran, and compare G6PD activity in cord blood samples, using quantitative and qualitative tests. This cross-sectional, prospective study was performed at five largest hospitals in Rasht, Guilan Province, Iran. The screening tests were performed for all the newborns, referred to these hospitals. Specimens were characterized in terms of G6PD activity under ultraviolet light, using the kinetic method and the qualitative fluorescent spot test (FST). We also determined the sensitivity, specificity, negative predictive value, and positive predictive value of the qualitative assay. Blood samples were collected from 1474 newborns. Overall, 757 (51.4%) subjects were male. As the findings revealed, 1376 (93.4%) newborns showed normal G6PD activity, while 98 (6.6%) had G6PD deficiency. There was a significant difference in the mean G6PD level between males and females (P = 0.0001). Also, a significant relationship was detected between FST results and the mean values obtained in the quantitative test (P < 0.0001). According to the present study, FST showed acceptable sensitivity and specificity for G6PD activity, although it appeared inefficient for diagnostic purposes in some cases. © 2017 John Wiley & Sons Ltd.

  18. Splenic artery pseudoaneurysm due to seatbelt injury in a glucose-6-phosphate dehydrogenase-deficient adult.

    Science.gov (United States)

    Lau, Yu Zhen; Lau, Yuk Fai; Lai, Kang Yiu; Lau, Chu Pak

    2013-11-01

    A 23-year-old man presented with abdominal pain after suffering blunt trauma caused by a seatbelt injury. His low platelet count of 137 × 10(9)/L was initially attributed to trauma and his underlying hypersplenism due to glucose-6-phosphate dehydrogenase (G6PD) deficiency. Despite conservative management, his platelet count remained persistently reduced even after his haemoglobin and clotting abnormalities were stabilised. After a week, follow-up imaging revealed an incidental finding of a pseudoaneurysm (measuring 9 mm × 8 mm × 10 mm) adjacent to a splenic laceration. The pseudoaneurysm was successfully closed via transcatheter glue embolisation; 20% of the spleen was also embolised. A week later, the platelet count normalised, and the patient was subsequently discharged. This case highlights the pitfalls in the detection of a delayed occurrence of splenic artery pseudoaneurysm after blunt injury via routine delayed phase computed tomography. While splenomegaly in G6PD may be a predisposing factor for injury, a low platelet count should arouse suspicion of internal haemorrhage rather than hypersplenism.

  19. Glucose-6-phosphate dehydrogenase in rat lung alveolar epithelial cells. An ultrastructural enzyme-cytochemical study

    Directory of Open Access Journals (Sweden)

    S Matsubara

    2010-01-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD is the key enzyme of the pentose phosphate pathway in carbohydrate metabolism, and it plays an important role in cell proliferation and antioxidant regulation within cells in various organs. Although marked cell proliferation and oxidant/antioxidant metabolism occur in lung alveolar epithelial cells, definite data has been lacking as to whether cytochemically detectable G6PD is present in alveolar epithelial cells. The distribution pattern of G6PD within these cells, if it is present, is also unknown. The purpose of the present study was to investigate the subcellular localization of G6PD in alveolar cells in the rat lung using a newly- developed enzyme-cytochemistry (copper-ferrocyanide method. Type I cells and stromal endothelia and fibroblasts showed no activities. Electron-dense precipitates indicating G6PD activity were clearly visible in the cytoplasm and on the cytosolic side of the endoplasmic reticulum of type II alveolar epithelial cells. The cytochemical controls ensured specific detection of enzyme activity. This enzyme may play a role in airway defense by delivering substances for cell proliferation and antioxidant forces, thus maintaining the airway architecture.

  20. Inactivation of Bakers' yeast glucose-6-phosphate dehydrogenase by aluminum

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Sungwoo; Joshi, J.G. (Univ. of Tennessee, Knoxville (USA))

    1989-04-18

    Preincubation of yeast glucose-6-phosphate dehydrogenase (G6PD) with Al(III) produced an inactive enzyme containing 1 mol of Al(III)/mol of enzyme subunit. None of the enzyme-bound Al(III) was dissociated by dialysis against 10 mM Tris-HCl, pH 7.0, containing 0.2 mM EDTA at 4{degree}C for 24 h. Citrate, NADP{sup +}, EDTA, or NaF protected the enzyme against the Al(III) inactivation. The Al(III)-inactivated enzyme, however, was completely reactivated only by citrate and NaF. The dissociation constant for the enzyme-aluminum complex was calculated to be 4 {times} 10{sup {minus}6} M with NaF, a known reversible chelator for aluminum. Modification of histidine and lysine residues of the enzyme with diethyl pyrocarbonate and acetylsalicylic acid, respectively, inactivated the enzyme. However, the modified enzyme still bound 1 mol of Al(III)/mol of enzyme subunit. Circular dichroism studies showed that the binding of Al(III) to the enzyme induced a decrease in {alpha}-helix and {beta}-sheet and an increase in random coil. Therefore, it is suggested that inactivation of G6PD by Al(III) is due to the conformational change induced by Al(III) binding.

  1. Design of an interface peptide as new inhibitor of human glucose-6-phosphate dehydrogenase.

    Science.gov (United States)

    Obiol-Pardo, Cristian; Alcarraz-Vizán, Gema; Díaz-Moralli, Santiago; Cascante, Marta; Rubio-Martinez, Jaime

    2014-04-01

    Glucose-6-phosphate dehydrogenase (G6PDH) is an essential enzyme involved in the first reaction of the oxidative branch of the pentose phosphate pathway (PPP). Recently, G6PDH was suggested as a novel target protein for cancer therapy as one of the final products of the PPP, ribose-5-phosphate, is necessary for nucleic acid synthesis and tumor progression. After analyzing the protein-protein interface of the crystal structure of human G6PDH by means of molecular dynamics simulations, we designed six interface peptides based on the natural sequence of the protein. The three most promising peptides, as predicted by binding free energy calculations, were synthesized and one of them was confirmed as a novel inhibitor of human G6PDH in experimental assays. Together, the active peptide found and its suggested binding mode proposes a new strategy for inhibiting this enzyme and should aid the further design of novel, potent and non-peptidic G6PDH inhibitors. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Trehalose 6-phosphate signal is closely related to sorbitol in apple (Malus domestica Borkh. cv. Gala)

    Science.gov (United States)

    Zhang, Wen; Lunn, John E.; Feil, Regina; Wang, Yufei; Zhao, Jingjing; Tao, Hongxia; Zhao, Zhengyang

    2017-01-01

    ABSTRACT Trehalose-6-phosphate (Tre6P) is a precursor of trehalose, which is widespread in nature and greatly influences plant growth and development. Tre6P acts as a signal of carbon availability in many plants, but little is known about the function of Tre6P in rosaceous plants, which have specific sorbitol biosynthesis and transportation pathways. In the present study, Tre6P levels and Sorbitol:Tre6P ratios were analyzed in apple (Malus domestica, Borkh. cv. Gala). Tre6P levels were positively correlated with sorbitol content but negatively correlated with sucrose, glucose, and fructose content in developing fruit. However, under sorbitol-limited conditions, Tre6P levels were positively correlated with both sorbitol and sucrose. In the presence of different exogenous sugar supply, Tre6P levels increased corresponding with sorbitol, but this was not the case with sucrose. In addition, Tre6P content and sorbitol:Tre6P ratios were more highly correlated with ADP-glucose levels under sorbitol-limited conditions and fruit development stages, respectively. These results suggest that Tre6P is more closely related to sorbitol than other soluble sugars and has an important role in influencing carbon metabolism in apple. PMID:28069587

  3. Glucose-6-Phosphate Dehydrogenase Deficiency among Male Blood Donors in Sana’a City, Yemen

    Science.gov (United States)

    Al-Nood, Hafiz A.; Bazara, Fakiha A.; Al-Absi, Rashad; Habori, Molham AL

    2012-01-01

    Objectives To determine the prevalence of Glucose-6-phosphate dehydrogenase (G-6-PD) deficiency among Yemeni people from different regions of the country living in the capital city, Sana’a, giving an indication of its overall prevalence in Yemen. Methods A cross-sectional study was conducted among Yemeni male blood donors attending the Department of Blood Bank at the National Centre of the Public Health Laboratories in the capital city, Sana’a, Yemen. Fluorescent spot method was used for screening, spectrophotometeric estimation of G-6-PD activity and separation by electrophoresis was done to determine the G-6-PD phenotype. Results Of the total 508 male blood donors recruited into the study, 36 were G-6-PD deficient, giving a likely G-6-PD deficiency prevalence of 7.1%. None of these deficient donors had history of anemia or jaundice. Thirty-five of these deficient cases (97.2%) showed severe G-6-PD deficiency class II (<10% of normal activity), and their phenotyping presumptively revealed a G-6-PD-Mediterranean variant. Conclusion The results showed a significant presence of G-6-PD deficiency with predominance of a severe G-6-PD deficiency type in these blood donors in Sana’a City, which could represent an important health problem through occurrence of hemolytic anemia under oxidative stress. A larger sample size is needed to determine the overall prevalence of G-6-PD deficiency, and should be extended to include DNA analysis to identify its variants in Yemen. PMID:22359725

  4. Comparison of quantitative and qualitative tests for glucose-6-phosphate dehydrogenase deficiency.

    Science.gov (United States)

    LaRue, Nicole; Kahn, Maria; Murray, Marjorie; Leader, Brandon T; Bansil, Pooja; McGray, Sarah; Kalnoky, Michael; Zhang, Hao; Huang, Huiqiang; Jiang, Hui; Domingo, Gonzalo J

    2014-10-01

    A barrier to eliminating Plasmodium vivax malaria is inadequate treatment of infected patients. 8-Aminoquinoline-based drugs clear the parasite; however, people with glucose-6-phosphate dehydrogenase (G6PD) deficiency are at risk for hemolysis from these drugs. Understanding the performance of G6PD deficiency tests is critical for patient safety. Two quantitative assays and two qualitative tests were evaluated. The comparison of quantitative assays gave a Pearson correlation coefficient of 0.7585 with significant difference in mean G6PD activity, highlighting the need to adhere to a single reference assay. Both qualitative tests had high sensitivity and negative predictive value at a cutoff G6PD value of 40% of normal activity if interpreted conservatively and performed under laboratory conditions. The performance of both tests dropped at a cutoff level of 45%. Cytochemical staining of specimens confirmed that heterozygous females with > 50% G6PD-deficient cells can seem normal by phenotypic tests. © The American Society of Tropical Medicine and Hygiene.

  5. Nitrogen Assimilation, Abiotic Stress and Glucose 6-Phosphate Dehydrogenase: The Full Circle of Reductants.

    Science.gov (United States)

    Esposito, Sergio

    2016-05-11

    Glucose 6 phosphate dehydrogenase (G6PDH; EC 1.1.1.49) is well-known as the main regulatory enzyme of the oxidative pentose phosphate pathway (OPPP) in living organisms. Namely, in Planta, different G6PDH isoforms may occur, generally localized in cytosol and plastids/chloroplasts. These enzymes are differently regulated by distinct mechanisms, still far from being defined in detail. In the last decades, a pivotal function for plant G6PDHs during the assimilation of nitrogen, providing reductants for enzymes involved in nitrate reduction and ammonium assimilation, has been described. More recently, several studies have suggested a main role of G6PDH to counteract different stress conditions, among these salinity and drought, with the involvement of an ABA depending signal. In the last few years, this recognized vision has been greatly widened, due to studies clearly showing the non-conventional subcellular localization of the different G6PDHs, and the peculiar regulation of the different isoforms. The whole body of these considerations suggests a central question: how do the plant cells distribute the reductants coming from G6PDH and balance their equilibrium? This review explores the present knowledge about these mechanisms, in order to propose a scheme of distribution of reductants produced by G6PDH during nitrogen assimilation and stress.

  6. A new paper-based analytical device for detection of Glucose-6-phosphate dehydrogenase deficiency.

    Science.gov (United States)

    Kaewarsa, Phuritat; Laiwattanapaisal, Wanida; Palasuwan, Attakorn; Palasuwan, Duangdao

    2017-03-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a genetic haemolytic disorder. Most persons with G6PD deficiency are asymptomatic, but exposure to oxidant drugs, such as the anti-malarial drug primaquine, may induce haemolysis, which is commonly found in Asian countries. A reliable test is necessary for diagnosing the deficiency to prevent an acute haemolytic crisis. This study proposes a novel quantitative method to detect G6PD deficiency using paper-based analytical devices (G6PDD-PAD). Wax printing was utilized for fabricating circular reaction zone patterns in paper. The colorimetric assay is based on the formation of formazan via a reduction of tetra-nitro blue tetrazolium (TNBT) by the G6PD enzyme on G6PDD-PAD. Detection was achieved by capturing the colour using a desktop scanner and the colour intensity was analysed with Adobe Photoshop C56. The results showed that the G6PD activity analysed by G6PDD-PAD was highly correlated with the standard biochemical assay (SBA) (r(2)=0.87, pPAD and the SBA (mean bias 1.4 IU/gHb). The detection limit was 0 IU/gHb of G6PD activity. This study demonstrates the feasibility of using G6PDD-PAD. This simple, low-cost test ($0.1/test) should be useful for diagnosing G6PD deficiency in resource-limited settings.

  7. Incidence and mutation analysis of glucose-6-phosphate dehydrogenase deficiency in eastern indonesian populations

    Directory of Open Access Journals (Sweden)

    Tantular,Indah S.

    2010-12-01

    Full Text Available We conducted a field survey of glucose-6-phosphate dehydrogenese (G6PD deficiency in the eastern Indonesian islands, and analyzed G6PD variants molecularly. The incidence of G6PD deficiency in 5 ethnic groups (Manggarai, Bajawa, Nage-Keo, Larantuka, and Palue on the Flores and Palue Islands was lower than that of another native group, Sikka, or a nonnative group, Riung. Molecular analysis of G6PD variants indicated that 19 cases in Sikka had a frequency distribution of G6PD variants similar to those in our previous studies, while 8 cases in Riung had a different frequency distribution of G6PD variants. On the other hand, from field surveys in another 8 ethnic groups (Timorese, Sumbanese, Savunese, Kendari, Buton, Muna, Minahasa, and Sangirese on the islands of West Timor, Sumba, Sulawesi, Muna and Bangka, a total of 49 deficient cases were detected. Thirty-nine of these 49 cases had G6PD Vanua Lava (383T>C of Melanesian origin. In our previous studies, many cases of G6PD Vanua Lava were found on other eastern Indonesian islands. Taken together, these findings may indicate that G6PD Vanua Lava is the most common variant in eastern Indonesian populations, except for Sikka.

  8. Incidence and mutation analysis of glucose-6-phosphate dehydrogenase deficiency in eastern Indonesian populations.

    Science.gov (United States)

    Tantular, Indah S; Matsuoka, Hiroyuki; Kasahara, Yuichi; Pusarawati, Suhintam; Kanbe, Toshio; Tuda, Josef S B; Kido, Yasutoshi; Dachlan, Yoes P; Kawamoto, Fumihiko

    2010-12-01

    We conducted a field survey of glucose-6-phosphate dehydrogenese (G6PD) deficiency in the eastern Indonesian islands, and analyzed G6PD variants molecularly. The incidence of G6PD deficiency in 5 ethnic groups (Manggarai, Bajawa, Nage-Keo, Larantuka, and Palue) on the Flores and Palue Islands was lower than that of another native group, Sikka, or a nonnative group, Riung. Molecular analysis of G6PD variants indicated that 19 cases in Sikka had a frequency distribution of G6PD variants similar to those in our previous studies, while 8 cases in Riung had a different frequency distribution of G6PD variants. On the other hand, from field surveys in another 8 ethnic groups (Timorese, Sumbanese, Savunese, Kendari, Buton, Muna, Minahasa, and Sangirese) on the islands of West Timor, Sumba, Sulawesi, Muna and Bangka, a total of 49 deficient cases were detected. Thirty-nine of these 49 cases had G6PD Vanua Lava (383T>C) of Melanesian origin. In our previous studies, many cases of G6PD Vanua Lava were found on other eastern Indonesian islands. Taken together, these findings may indicate that G6PD Vanua Lava is the most common variant in eastern Indonesian populations, except for Sikka.

  9. Glucose-6-phosphate dehydrogenase deficiency A- variant in febrile patients in Haiti.

    Science.gov (United States)

    Carter, Tamar E; Maloy, Halley; von Fricken, Michael; St Victor, Yves; Romain, Jean R; Okech, Bernard A; Mulligan, Connie J

    2014-08-01

    Haiti is one of two remaining malaria-endemic countries in the Caribbean. To decrease malaria transmission in Haiti, primaquine was recently added to the malaria treatment public health policy. One limitation of primaquine is that, at certain doses, primaquine can cause hemolytic anemia in individuals with glucose-6-phosphate dehydrogenase (G6PD) deficiency (G6PDd). In this study, we genotyped two mutations (A376G and G202A), which confer the most common G6PDd variant in West African populations, G6PDd A-. We estimated the frequency of G6PDd A- in a sample of febrile patients enrolled in an on-going malaria study who represent a potential target population for a primaquine mass drug administration. We found that 33 of 168 individuals carried the G6PDd A- allele (includes A- hemizygous males, A- homozygous or heterozygous females) and could experience toxicity if treated with primaquine. These data inform discussions on safe and effective primaquine dosing and future malaria elimination strategies for Haiti.

  10. Contribution of haemolysis to jaundice in Sephardic Jewish glucose-6-phosphate dehydrogenase deficient neonates.

    Science.gov (United States)

    Kaplan, M; Vreman, H J; Hammerman, C; Leiter, C; Abramov, A; Stevenson, D K

    1996-06-01

    We determined the contribution of haemolysis to the development of hyperbilirubinaemia in glucose-6-phosphate dehydrogenase (G-6-PD) deficient neonates and G-6-PD normal controls. Blood carboxyhaemoglobin (COHb), sampled on the third day of life, was measured by gas chromatography, corrected for inhaled carbon monoxide (COHbC), and expressed as a percentage of total haemoglobin concentration (Hb). Serum bilirubin was tested as clinically necessary. 37 non-jaundiced (peak serum total bilirubin (PSTB) or = 257 mumol/l) G-6-PD-deficient neonates were compared to 31 non-jaundiced and 24 jaundiced controls with comparable PSTB values, respectively. COHbC values for the entire G-6-PD deficient group were higher than in the controls (0.75 +/- 0.17% v 0.62 +/- 0.19%, P 0.05) but did in the controls (r = 0.58, P < 0.001). COHbC values were increased to a similar extent in the G-6-PD-deficient, non-jaundiced (0.72 +/- 0.16%), the G-6-PD-deficient, jaundiced (0.80 +/- 0.19%) and the control, jaundiced (0.75 +/- 0.18%) subgroups, compared to the control, non-jaundiced subgroup (0.53 +/- 0.13%) (P < 0.05). Although present in G-6-PD deficient neonates, increased haemolysis was not directly related to the PSTB.

  11. Trehalose 6-phosphate signal is closely related to sorbitol in apple (Malus domestica Borkh. cv. Gala

    Directory of Open Access Journals (Sweden)

    Wen Zhang

    2017-02-01

    Full Text Available Trehalose-6-phosphate (Tre6P is a precursor of trehalose, which is widespread in nature and greatly influences plant growth and development. Tre6P acts as a signal of carbon availability in many plants, but little is known about the function of Tre6P in rosaceous plants, which have specific sorbitol biosynthesis and transportation pathways. In the present study, Tre6P levels and Sorbitol:Tre6P ratios were analyzed in apple (Malus domestica, Borkh. cv. Gala. Tre6P levels were positively correlated with sorbitol content but negatively correlated with sucrose, glucose, and fructose content in developing fruit. However, under sorbitol-limited conditions, Tre6P levels were positively correlated with both sorbitol and sucrose. In the presence of different exogenous sugar supply, Tre6P levels increased corresponding with sorbitol, but this was not the case with sucrose. In addition, Tre6P content and sorbitol:Tre6P ratios were more highly correlated with ADP-glucose levels under sorbitol-limited conditions and fruit development stages, respectively. These results suggest that Tre6P is more closely related to sorbitol than other soluble sugars and has an important role in influencing carbon metabolism in apple.

  12. Glucose 6-phosphate dehydrogenase on indian piaroas in malaria-endemic area.

    Directory of Open Access Journals (Sweden)

    Gilberto Antonio Bastidas-Pacheco

    2017-01-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD remains intact sulfhydryl groups and assist in the detoxification of free radicals and peroxides, therefore deficit irreversible oxidative damage and destruction of the erythrocyte when these are subjected to oxidative substances and stress. Plasmodium spp. infection causes anemia as a result of the rupture of the erythrocyte by this parasite, it can be aggravated in people infected with G6PD deficiency when exposed to drugs. Descriptive field study in which the enzymatic activity of G6PD in an indigenous community of Piaroa municipality of Atures Amazonas state was determined by biochemical tests. The sample consisted of 186 individuals, 100 women and 86 men. The average concentration of hemoglobin was 10.6 g/dL, 88, 6% of the subjects were moderately anemic and none had G6PD deficiency. It is concluded that anemia is common in indigenous Piaroas, moderate and deficiency type; no biochemical test that G6PD deficiency is detected; and that this study provides useful information to state agencies responsible for administering health care in Venezuela information.

  13. The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content.

    Science.gov (United States)

    Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C

    2015-07-28

    Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.

  14. The Endothelial Nitric Oxide Synthase Gene T-786C Polymorphism Increases Myocardial Infarction Risk: A Meta-Analysis.

    Science.gov (United States)

    Kong, Xiang-Zhen; Zhang, Zheng-Yi; Wei, Lian-Hua; Li, Rui; Yu, Jing

    2017-02-11

    BACKGROUND Polymorphisms of the endothelial nitric oxide synthase (eNOS) gene are reportedly associated with myocardial infarction (MI) risk. However, definitive evidence of this association is lacking. In this study, we investigated the potential association of eNOS gene polymorphisms with MI risk by conducting a meta-analysis of studies evaluating this association. MATERIAL AND METHODS PubMed, Web of Knowledge, ScienceDirect, China National Knowledge Infrastructure (CNKI), WanFang, and Database of Chinese Scientific and Technical Periodicals (VIP) were searched for relevant studies. Pooled odds ratios (OR) with 95% confidence interval (CI) were calculated to evaluate the association of eNOS gene T-786C and 4b4a polymorphisms with MI risk. RESULTS Fifteen studies with 8,067 controls and 4,923 MI cases were included in the final meta-analysis. In the overall analysis, T-786C (rs2070744) polymorphism was associated with MI risk (p<0.05, OR=1.69, 95% CI: 1.53-1.86 for T vs. C; p<0.05, OR=2.76, 95% CI: 2.03-3.75 for TT vs. CC; p<0.05, OR=1.74, 95% CI 1.56-1.95 for TT vs. (CT + CC); p<0.05, OR=2.43, 95% CI: 1.79-3.30 for (CT + TT) vs. CC). In addition, a significant association between 4b4a VNTR polymorphism and MI risk was observed. On sub-group analyses by ethnicity, a significant increase in MI risk was observed separately for Asian and Caucasian populations for T-786C polymorphism, but not for the 4b4a polymorphism. CONCLUSIONS In this meta-analysis, T-786C polymorphism of the eNOS gene was associated with the risk of MI, especially in the Asian populations.

  15. The comparative analysis of the potential relationship between resveratrol and stilbene synthase gene family in the development stages of grapes (Vitis quinquangularis and Vitis vinifera).

    Science.gov (United States)

    Shi, Jiangli; He, Mingyang; Cao, Jiangling; Wang, Huan; Ding, Jiahua; Jiao, Yuntong; Li, Ruimin; He, Jing; Wang, Dan; Wang, Yuejin

    2014-01-01

    Resveratrol is positively correlated with grapevine disease resistance and its consumption is also highly beneficial to human health. HPLC analyses showed that resveratrol content was significantly higher in most wild Chinese grapevines than in most European Vitis vinifera grapevine cvs. Fruit of the wild Chinese genotype Vitis quinquangularis Danfeng-2 contains much higher levels of resveratrol than some others. Because stilbene synthase is responsible for resveratrol biosynthesis, 41 full-length stilbene synthase genes were isolated from Danfeng-2 using the RACE method. A neighbor-joining tree of the STS family displayed high similarity between Danfeng-2 and V. vinifera cv. Pinot Noir. The content of the endogenous stilbene synthase family in tissues and the expression levels induced by powdery mildew were both higher in Danfeng-2 than in Pinot Noir. Moreover, expression in the berry was significantly higher than in the leaves. Our results demonstrated that resveratrol accumulation was consistent with endogenous STS gene expressions, and that both were higher in Danfeng-2 than in Pinot Noir. Therefore, STS genes and producing resveratrol from V. quinquangularis played more important role in Vitis resistance. Otherwise, the gene VqSTS6 was markedly higher than the other VqSTS genes in the six tissues/organs assayed by Real-time PCR, which will offer a useful basis for commercial application of resveratrol from Chinese wild grapes. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  16. Analysis of carbon source-regulated gene expression by the upstream region of the Candida tropicalis malate synthase gene in Saccharomyces cerevisiae.

    Science.gov (United States)

    Umemura, K; Atomi, H; Izuta, M; Kanai, T; Takeshita, S; Ueda, M; Tanaka, A

    1997-01-03

    We investigated the regulation of expression of a gene encoding malate synthase (MS) of an n-alkane-utilizable yeast Candida tropicalis in the yeast Saccharomyces cerevisiae, where its expression is highly induced by acetate. By comparing levels of gene expression in cells grown on glucose, acetate, lactate, and oleic acid, we found that the increase in gene expression was due to a glucose repression-derepression mechanism. In order to obtain information concerning the regulation of the gene expression, a fusion gene which consists of the 5'-upstream region of MS-2 (UPR-MS-2) and the lacZ gene (encoding Escherichia coli beta-galactosidase), was introduced into S. cerevisiae, and beta-galactosidase activities were measured with cells grown on glucose or acetate. Deletion analysis of UPR-MS-2 revealed that the region between -777 and -448 (against the translation initiation codon) enhanced the level of gene expression in both glucose- and acetate-grown cells. In this region, sequences which resemble binding sites of Rap1p/Grf1p/Tufp, a global transcription activator, were found at seven locations and one was found for another pleiotropic activator Abf1p. The result also suggested the presence of multiple upstream repression sequences (URSs), which function specifically in glucose-grown cells, in the region between -368 and -126. In the repressing region, there were three tandem C(A/T)CTCCC sequences and also a putative binding site of Mig1p, a transcriptional repressor which mediates glucose repression of several other genes. When MIG1 gene of S. cerevisiae was disrupted, the expression of the UPR-MS-2-lacZ gene in glucose-grown cells increased approx. 10-fold. Furthermore, the effect of deletion of a putative Mig1p binding site was abolished in the MIG1-disrupted strain, suggesting Mig1p binds to this site and brings about glucose repression. When the SNF1 gene was disrupted, the high level gene expression observed in acetate-grown cells bearing UPR-MS-2 was

  17. Regulation of expression of GLT1, the gene encoding glutamate synthase in Saccharomyces cerevisiae.

    Science.gov (United States)

    Valenzuela, L; Ballario, P; Aranda, C; Filetici, P; González, A

    1998-07-01

    Saccharomyces cerevisiae glutamate synthase (GOGAT) is an oligomeric enzyme composed of three 199-kDa identical subunits encoded by GLT1. In this work, we analyzed GLT1 transcriptional regulation. GLT1-lacZ fusions were prepared and GLT1 expression was determined in a GDH1 wild-type strain and in a gdh1 mutant derivative grown in the presence of various nitrogen sources. Null mutants impaired in GCN4, GLN3, GAT1/NIL1, or UGA43/DAL80 were transformed with a GLT1-lacZ fusion to determine whether the above-mentioned transcriptional factors had a role in GLT1 expression. A collection of increasingly larger 5' deletion derivatives of the GLT1 promoter was constructed to identify DNA sequences that could be involved in GLT1 transcriptional regulation. The effect of the lack of GCN4, GLN3, or GAT1/NIL1 was also tested in the pertinent 5' deletion derivatives. Our results indicate that (i) GLT1 expression is negatively modulated by glutamate-mediated repression and positively regulated by Gln3p- and Gcn4p-dependent transcriptional activation; (ii) two cis-acting elements, a CGGN15CCG palindrome and an imperfect poly(dA-dT), are present and could play a role in GLT1 transcriptional activation; and (iii) GLT1 expression is moderately regulated by GCN4 under amino acid deprivation. Our results suggest that in a wild-type strain grown on ammonium, GOGAT constitutes an ancillary pathway for glutamate biosynthesis.

  18. Cloning and expression of quorum sensing N-acyl-homoserine synthase (LuxI gene detected in Acinetobacter baumannii

    Directory of Open Access Journals (Sweden)

    Farzan Modarresi

    2016-05-01

    Full Text Available Objectives: In present study we aimed to clone the luxI gene encoding N-acyl-homoserine synthase detected in biofilm forming clinical isolates of Acinetobacter baumannii and study its expression in Escherichia coli transformants.Materials and Methods: Four A. baumannii hospital strains which demonstrated strong biofilm activity were selected in this investigation. The presence of luxI gene was detected using PCR technique. Purified PCR product DNA was initially cloned to pTG19 plasmid embedded with overhang 3'dT residue and transformed to Escherichia coli K12 DH5α (luxI- mutant. The gene was then recovered from agarose gel after digestion after digestion with DraI restriction enzyme and ligated by T4 DNA ligase into pET28a expression vector using NdeI and XhoI enzymes. Recombinant (pET28a + luxI was transformed into E. coli BL21 (DE3 containing knockout luxI- gene. The luxI putative gene was further detected in transformants by colony PCR. Expression of the luxI gene in the recombinant E. coli BL21 cells was studied by quantitative real time PCR (qRT-PCR and the presence of N-acyl-homoserine lactone (AHL in wild types and the transformants were checked by colorimetric assay and Fourier Transform Infra- Red (FT-IR.Results: In our study, we found successful cloning of AHL from A. baumannii strain 23 which showed high biofilm. The presence of luxI gene in recombinant E. coli BL21 was confirmed by PCR. There was four fold increases in expression of luxI in the transformants (P ≤ 0.05. To verify the AHL synthesis, it was found that, strain 23 and the transformants showed highest amount of AHL activity (OD = 1.524. The FT-IR analysis indicated stretching C=O bond of the lactone ring and primary amides (N=H at 1764.69 cm-1 and 1659.23 cm-1 respectively.Conclusion: From above results we concluded that, luxI and AHL are the only quorum sensing elements existed in A. baumannii and pET28a vector allows efficient AHL expression in E. coli BL21

  19. Influence of hCG on inducible nitric oxide synthase gene expression in ram testicular arteries

    Directory of Open Access Journals (Sweden)

    Maria Matteo

    2014-09-01

    Full Text Available Background. Experimental evidence suggests a relationship between the vasodilatory effect of hCG and the NOS system in the testis. The influence of hCG administration on testicular vascular NOS gene expression has not been fully investigated. Objective: This study aimed to evaluate the presence of the nitric oxide syntheses gene in ram testicular arteries and the influence of hCG administration on its expression. Materials and methods: Both testicular arteries of sixteen rams were extracted before and after i.v. administration of 5000 IU of hCG or placebo. The expression of the iNOS gene was investigated by real time PCR. Data were analyzed by means of Wilcoxon and Mann-Whitney tests. A p value of < 0.05 was considered statistically significant. Results: PCR revealed the presence of iNOS mRNA in all basal samples but the expression of the iNOS gene was significantly reduced in all arteries obtained 24 h after the administration of either hCG or placebo. A significant reduction in the expression of iNOS gene was observed in the testicular arteries extracted after 24 h in both treated and placebo groups. On the other hand hCG stimulation did not significantly influence iNOS expression following its administration compared to a placebo. Conclusion: Ram testicular arteries express the iNOS gene but hCG stimulation did not significantly influence iNOS expression. A significant reduction in the expression of this gene was observed in the testicular arteries extracted after 24 h in both treated and placebo groups, suggesting that iNOS expression on the testicular artery could be influenced by the spermatic vessel ligation of the controlateral testis.

  20. Prevalence of glucose-6-phosphate dehydrogenase deficiency and diagnostic challenges in 1500 immigrants in Denmark examined for haemoglobinopathies

    DEFF Research Database (Denmark)

    Warny, Marie; Klausen, Tobias Wirenfeldt; Petersen, Jesper

    2015-01-01

    Similar to the thalassaemia syndromes, glucose-6-phosphate dehydrogenase (G6PD) deficiency is highly prevalent in areas historically exposed to malaria. In the present study, we used quantitative and molecular methods to determine the prevalence of G6PD deficiency in a population of 1508 immigran...

  1. Tumor-targeted intracellular delivery of anticancer drugs through the mannose-6-phosphate/insulin-like growth factor II receptor

    NARCIS (Netherlands)

    Prakash, Jai; Beljaars, Leonie; Harapanahalli, Akshay K.; Zeinstra-Smith, Mieke; de Jager-Krikken, Alie; Hessing, Martin; Steen, Herman; Poelstra, Klaas

    2010-01-01

    Tumor-targeting of anticancer drugs is an interesting approach for the treatment of cancer since chemotherapies possess several adverse effects. In the present study, we propose a novel strategy to deliver anticancer drugs to the tumor cells through the mannose-6-phosphate/insulin-like growth factor

  2. Sequence analysis of a 9873 bp fragment of the left arm of yeast chromosome XV that contains the ARG8 and CDC33 genes, a putative riboflavin synthase beta chain gene, and four new open reading frames.

    Science.gov (United States)

    Casas, C; Aldea, M; Casamayor, A; Lafuente, M J; Gamo, F J; Gancedo, C; Ariño, J; Herrero, E

    1995-09-15

    The DNA sequence of a 9873 bp fragment located near the left telomere of chromosome XV has been determined. Sequence analysis reveals seven open reading frames. One is the ARG8 gene coding for N-acetylornithine aminotransferase. Another corresponds to CDC33, which codes for the initiation factor 4E or cap binding protein. The open reading frame AOE169 can be considered as the putative gene for the Saccharomyces cerevisiae riboflavin synthase beta chain, since its translation product shows strong homology with four prokaryotic riboflavin synthase beta chains.

  3. Polymorphisms in thymidylate synthase gene and susceptibility to breast cancer in a Chinese population: a case-control analysis

    Directory of Open Access Journals (Sweden)

    Liu Jiyong

    2006-05-01

    Full Text Available Abstract Background Accumulative evidence suggests that low folate intake is associated with increased risk of breast cancer. Polymorphisms in genes involved in folate metabolism may influence DNA methylation, nucleotide synthesis, and thus individual susceptibility to cancer. Thymidylate synthase (TYMS is a key enzyme that participates in folate metabolism and catalyzes the conversion of dUMP to dTMP in the process of DNA synthesis. Two potentially functional polymorphisms [a 28-bp tandem repeat in the TYMS 5'-untranslated enhanced region (TSER and a 6-bp deletion/insertion in the TYMS 3'-untranslated region (TS 3'-UTR] were suggested to be correlated with alteration of thymidylate synthase expression and associated with cancer risk. Methods To test the hypothesis that polymorphisms of the TYMS gene are associated with risk of breast cancer, we genotyped these two polymorphisms in a case-control study of 432 incident cases with invasive breast cancer and 473 cancer-free controls in a Chinese population. Results We found that the distribution of TS3'-UTR (1494del6 genotype frequencies were significantly different between the cases and controls (P = 0.026. Compared with the TS3'-UTR del6/del6 wild-type genotype, a significantly reduced risk was associated with the ins6/ins6 homozygous variant genotype (adjusted OR = 0.58, 95% CI = 0.35–0.97 but not the del6/ins6 genotype (OR = 1.09, 95% CI = 0.82–1.46. Furthermore, breast cancer risks associated with the TS3'-UTR del6/del6 genotype were more evident in older women, postmenopausal subjects, individuals with a younger age at first-live birth and individuals with an older age at menarche. However, there was no evidence for an association between the TSER polymorphism and breast cancer risks. Conclusion These findings suggest that the TS3'-UTR del6 polymorphism may play a role in the etiology of breast cancer. Further larger population-based studies as well as functional evaluation of the

  4. Quick guide to polyketide synthase and nonribosomal synthetase genes in Fusarium

    DEFF Research Database (Denmark)

    Hansen, Jørgen T.; Sørensen, Jens L.; Giese, Henriette;

    2012-01-01

    Fusarium species produce a plethora of bioactive polyketides and nonribosomal peptides that give rise to health problems in animals and may have drug development potential. Using the genome sequences for Fusarium graminearum, F. oxysporum, F. solani and F. verticillioides we developed a framework...... and NRPS genes in sequenced Fusarium species and their known products. With the rapid increase in the number of sequenced fungal genomes a systematic classification will greatly aid the scientific community in obtaining an overview of the number of different NRPS and PKS genes and their potential...

  5. Molecular cloning and characterization of a phytochelatin synthase gene, PvPCS1, from Pteris vittata L.

    Science.gov (United States)

    Dong, Ruibin; Formentin, Elide; Losseso, Carmen; Carimi, Francesco; Benedetti, Piero; Terzi, Mario; Schiavo, Fiorella Lo

    2005-12-01

    Pteris vittata L. is a staggeringly efficient arsenic hyperaccumulator that has been shown to be capable of accumulating up to 23,000 microg arsenic g(-1), and thus represents a species that may fully exploit the adaptive potential of plants to toxic metals. However, the molecular mechanisms of adaptation to toxic metal tolerance and hyperaccumulation remain unknown, and P. vittata genes related to metal detoxification have not yet been identified. Here, we report the isolation of a full-length cDNA sequence encoding a phytochelatin synthase (PCS) from P. vittata. The cDNA, designated PvPCS1, predicts a protein of 512 amino acids with a molecular weight of 56.9 kDa. Homology analysis of the PvPCS1 nucleotide sequence revealed that it has low identity with most known plant PCS genes except AyPCS1, and the homology is largely confined to two highly conserved regions near the 5'-end, where the similarity is as high as 85-95%. The amino acid sequence of PvPCS1 contains two Cys-Cys motifs and 12 single Cys, only 4 of which (Cys-56, Cys-90/91, and Cys-109) in the N-terminal half of the protein are conserved in other known PCS polypeptides. When expressed in Saccharomyces cerevisae, PvPCS1 mediated increased Cd tolerance. Cloning of the PCS gene from an arsenic hyperaccumulator may provide information that will help further our understanding of the genetic basis underlying toxic metal tolerance and hyperaccumulation.

  6. Characterization of 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS) gene from Ginkgo biloba.

    Science.gov (United States)

    Kim, Sang-Min; Kim, Soo-Un

    2010-02-01

    Diterpene trilactone ginkgolides, one of the major constituents of Ginkgo biloba extract, have shown interesting bioactivities including platelet-activating factor antagonistic activity. 1-Hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS), converting 2-C-methyl-d-erythritol-2,4-cyclodiphosphate into 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate, is the penultimate enzyme of the seven-step 2-C-methyl-d-erythritol 4-phosphate pathway that supplies building blocks for plant isoprenoids of plastid origin such as ginkgolides and carotenoids. Here, we report on the isolation and characterization of the full-length cDNA encoding HDS (GbHDS, GenBank accession number: DQ251630) from G. biloba. Full-length cDNA of GbHDS, 2,763 bp long, contained an ORF of 2,226 bp encoding a protein composed of 741 amino acids. The theoretical molecular weight and pI of the deduced mature GbHDS of 679 amino acid residues are 75.6 kDa and 5.5, respectively. From 2 weeks after initiation of the culture onward, transcription level of this gene in the ginkgo embryo roots increased to about two times higher than that in the leaves. GbHDS was predicted to possess chloroplast transit peptide of 62 amino acid residues, suggesting its putative localization in the plastids. The transient gene expression in Arabidopsis protoplasts confirmed that the transit peptide was capable of delivering the GbHDS protein from the cytosol into the chloroplasts. The isolation and characterization of GbHDS gene enabled us to further understand the role of GbHDS in the terpenoid biosynthesis in G. biloba.

  7. Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA Genes in Flax (Linum usitatissimum L.

    Directory of Open Access Journals (Sweden)

    Olga Y. Yurkevich

    2017-08-01

    Full Text Available Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH-based chromosomal localization of the CesA conserved fragment (KF011584.1, 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

  8. Over-expression of the apple spermidine synthase gene in pear confers multiple abiotic stress tolerance by altering polyamine titers.

    Science.gov (United States)

    Wen, Xiao-Peng; Pang, Xiao-Ming; Matsuda, Narumi; Kita, Masayuki; Inoue, Hiromichi; Hao, Yu-Jin; Honda, Chikako; Moriguchi, Takaya

    2008-04-01

    An apple spermidine synthase (SPDS) gene (MdSPDS1) was verified to encode a functional protein by the complementation of the spe3 yeast mutant, which lacks the SPDS gene. To justify our hypothesis that apple SPDS is involved in abiotic stress responses and to obtain transgenic fruit trees tolerant to abiotic stresses as well, MdSPDS1-over-expressing transgenic European pear (Pyrus communis L. 'Ballad') plants were created by Agrobacterium-mediated transformation. A total of 21 transgenic lines showing various spermidine (Spd) titers and MdSPDS1 expression levels were obtained. Selected lines were exposed to salt (150 mM NaCl), osmosis (300 mM mannitol), and heavy metal (500 microM CuSO4) stresses for evaluating their stress tolerances. Transgenic line no. 32, which was revealed to have the highest Spd accumulation and expression level of MdSPDS1, showed the strongest tolerance to these stresses. When growth increments, electrolyte leakage (EL), and values of thiobarbituric acid reactive substances (TBARS) were monitored, line no. 32 showed the lowest growth inhibition and the least increase in EL or TBARS under stress conditions. Spd titers in wild-type and transgenic lines showed diverse changes upon stresses, and these changes were not consistent with the changes in MdSPDS1 expressions. Moreover, there were no differences in the sodium concentration in the shoots between the wild type and line no. 32, whereas the copper concentration was higher in the wild type than in line no. 32. Although the mechanism(s) underlying the involvement of polyamines in stress responses is not known, these results suggest that the over-expression of the SPDS gene substantially increased the tolerance to multiple stresses by altering the polyamine titers in pear. Thus, MdSPDS1-over-expressing transgenic pear plants could be used to improve desert land and/or to repair polluted environments.

  9. Differential stress-response expression of two flavonol synthase genes and accumulation of flavonols in tartary buckwheat.

    Science.gov (United States)

    Li, Xiaohua; Kim, Yeon Bok; Kim, Yeji; Zhao, Shicheng; Kim, Haeng Hoon; Chung, Eunsook; Lee, Jai-Heon; Park, Sang Un

    2013-12-15

    Flavonoids are ubiquitously present in plants and play important roles in these organisms as well as in the human diet. Flavonol synthase (FLS) is a key enzyme of the flavonoid biosynthetic pathway, acting at the diverging point into the flavonol subclass branch. We isolated and characterized a FLS isoform gene, FtFLS2, from tartary buckwheat (Fagopyrum tataricum). FtFLS2 shares 48% identity and 67% similarity with the previously reported FtFLS1, whereas both genes share 47-65% identity and 65-69% similarit