WorldWideScience

Sample records for 5s ribosomal rna

  1. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  2. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  3. Comparative analyses among the Trichomonas vaginalis, Trichomonas tenax, and Tritrichomonas foetus 5S ribosomal RNA genes.

    Science.gov (United States)

    Torres-Machorro, Ana Lilia; Hernández, Roberto; Alderete, John F; López-Villaseñor, Imelda

    2009-04-01

    The 5S ribosomal RNA (5S rRNA) is an essential component of ribosomes. Throughout evolution, variation is found among 5S rRNA genes regarding their chromosomal localization, copy number, and intergenic regions. In this report, we describe and compare the gene sequences, motifs, genomic copy number, and chromosomal localization of the Trichomonas vaginalis, Trichomonas tenax, and Tritrichomonas foetus 5S rRNA genes. T. vaginalis and T. foetus have a single type of 5S rRNA-coding region, whereas two types were found in T. tenax. The sequence identities among the three organisms are between 94 and 97%. The intergenic regions are more divergent in sequence and size with characteristic species-specific motifs. The T. foetus 5S rRNA gene has larger and more complex intergenic regions, which contain either an ubiquitin gene or repeated sequences. The 5S rRNA genes were located in Trichomonads chromosomes by fluorescent in situ hybridization.

  4. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  5. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  6. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  7. Changes in the conformation of 5S rRNA cause alterations in principal functions of the ribosomal nanomachine.

    Science.gov (United States)

    Kouvela, Ekaterini C; Gerbanas, George V; Xaplanteri, Maria A; Petropoulos, Alexandros D; Dinos, George P; Kalpaxis, Dimitrios L

    2007-01-01

    5S rRNA is an integral component of the large ribosomal subunit in virtually all living organisms. Polyamine binding to 5S rRNA was investigated by cross-linking of N1-azidobenzamidino (ABA)-spermine to naked 5S rRNA or 50S ribosomal subunits and whole ribosomes from Escherichia coli cells. ABA-spermine cross-linking sites were kinetically measured and their positions in 5S rRNA were localized by primer extension analysis. Helices III and V, and loops A, C, D and E in naked 5S rRNA were found to be preferred polyamine binding sites. When 50S ribosomal subunits or poly(U)-programmed 70S ribosomes bearing tRNA(Phe) at the E-site and AcPhe-tRNA at the P-site were targeted, the susceptibility of 5S rRNA to ABA-spermine was greatly reduced. Regardless of 5S rRNA assembly status, binding of spermine induced significant changes in the 5S rRNA conformation; loop A adopted an apparent 'loosening' of its structure, while loops C, D, E and helices III and V achieved a more compact folding. Poly(U)-programmed 70S ribosomes possessing 5S rRNA cross-linked with spermine were more efficient than control ribosomes in tRNA binding, peptidyl transferase activity and translocation. Our results support the notion that 5S rRNA serves as a signal transducer between regions of 23S rRNA responsible for principal ribosomal functions.

  8. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  9. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    OpenAIRE

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  10. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    Energy Technology Data Exchange (ETDEWEB)

    Liu, X (Washington State University); Mann, David B.(ASSOC WESTERN UNIVERSITY); Suquet, C (Washington State University); Springer, David L.(BATTELLE (PACIFIC NW LAB)); Smerdon, Michael J.(VISITORS)

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  11. Assembly factors Rpf2 and Rrs1 recruit 5S rRNA and ribosomal proteins rpL5 and rpL11 into nascent ribosomes.

    Science.gov (United States)

    Zhang, Jingyu; Harnpicharnchai, Piyanun; Jakovljevic, Jelena; Tang, Lan; Guo, Yurong; Oeffinger, Marlene; Rout, Michael P; Hiley, Shawna L; Hughes, Timothy; Woolford, John L

    2007-10-15

    More than 170 proteins are necessary for assembly of ribosomes in eukaryotes. However, cofactors that function with each of these proteins, substrates on which they act, and the precise functions of assembly factors--e.g., recruiting other molecules into preribosomes or triggering structural rearrangements of pre-rRNPs--remain mostly unknown. Here we investigated the recruitment of two ribosomal proteins and 5S ribosomal RNA (rRNA) into nascent ribosomes. We identified a ribonucleoprotein neighborhood in preribosomes that contains two yeast ribosome assembly factors, Rpf2 and Rrs1, two ribosomal proteins, rpL5 and rpL11, and 5S rRNA. Interactions between each of these four proteins have been confirmed by binding assays in vitro. These molecules assemble into 90S preribosomal particles containing 35S rRNA precursor (pre-rRNA). Rpf2 and Rrs1 are required for recruiting rpL5, rpL11, and 5S rRNA into preribosomes. In the absence of association of these molecules with pre-rRNPs, processing of 27SB pre-rRNA is blocked. Consequently, the abortive 66S pre-rRNPs are prematurely released from the nucleolus to the nucleoplasm, and cannot be exported to the cytoplasm.

  12. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-09-06

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  13. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  14. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  15. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    Science.gov (United States)

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  16. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    Science.gov (United States)

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants.

  17. Chaperoning 5S RNA assembly

    National Research Council Canada - National Science Library

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    ...—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP...

  18. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  19. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    Science.gov (United States)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  20. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  1. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  3. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region...

  4. 5S ribosomal RNA genes in six species of Mediterranean grey mullets: genomic organization and phylogenetic inference.

    Science.gov (United States)

    Gornung, Ekaterina; Colangelo, Paolo; Annesi, Flavia

    2007-09-01

    This paper describes a study of the 5S ribosomal RNA genes (5S rDNA) in a group of 6 species belonging to 4 genera of Mugilidae. In these 6 species, the relatively short 5S rDNA repeat units, generated by PCR and ranging in size from 219 to 257 bp, show a high level of intragenomic homogeneity of both coding and spacer regions (NTS-I). Phylogenetic reconstructions based on this data set highlight the greater phylogenetic and genetic diversity of Mugil cephalus and Oedalechilus labeo compared with the genera Liza and Chelon. Comparative sequence analysis revealed significant conservation of the short 5S rDNA repeat units across Chelon and Liza. Moreover, a second size class of 5S rDNA repeat units, ranging from roughly 800 to 1100 bp, was produced in the Liza and Chelon samples. Only short 5S rDNA repeat units were found in M. cephalus and O. labeo. The sequences of the long 5S rDNA repeat units, obtained in Chelon labrosus and Liza ramada, differ owing to the presence of 2 large insertion/deletions (indels) in the spacers (NTS-II) and show considerable sequence identity with NTS-I spacers. Interspecific sequence variation of NTS-II spacers, excluding the indels, is low. Southern-blot hybridization patterns suggest an intermixed arrangement of short and long repeat units within a single chromosome locus.

  5. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  6. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Two trypanosome-specific proteins are essential factors for 5S rRNA abundance and ribosomal assembly in Trypanosoma brucei.

    Science.gov (United States)

    Hellman, Kristina M; Ciganda, Martin; Brown, Silvia V; Li, Jinlei; Ruyechan, William; Williams, Noreen

    2007-10-01

    We have previously identified and characterized two novel nuclear RNA binding proteins, p34 and p37, which have been shown to bind 5S rRNA in Trypanosoma brucei. These two proteins are nearly identical, with one major difference, an 18-amino-acid insert in the N-terminal region of p37, as well as three minor single-amino-acid differences. Homologues to p34 and p37 have been found only in other trypanosomatids, suggesting that these proteins are unique to this ancient family. We have employed RNA interference (RNAi) studies in order to gain further insight into the interaction between p34 and p37 with 5S rRNA in T. brucei. In our p34/p37 RNAi cells, decreased expression of the p34 and p37 proteins led to morphological alterations, including loss of cell shape and vacuolation, as well as to growth arrest and ultimately to cell death. Disruption of a higher-molecular-weight complex containing 5S rRNA occurs as well as a dramatic decrease in 5S rRNA levels, suggesting that p34 and p37 serve to stabilize 5S rRNA. In addition, an accumulation of 60S ribosomal subunits was observed, accompanied by a significant decrease in overall protein synthesis within p34/p37 RNAi cells. Thus, the loss of the trypanosomatid-specific proteins p34 and p37 correlates with a diminution in 5S rRNA levels as well as a decrease in ribosome activity and an alteration in ribosome biogenesis.

  8. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  9. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  10. Eukaryotic 5S rRNA biogenesis.

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2011-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. Copyright © 2011 John Wiley & Sons, Ltd.

  11. Localization of 18S + 28S and 5S ribosomal RNA genes in the dog by fluorescence in situ hybridization.

    Science.gov (United States)

    Mäkinen, A; Zijlstra, C; de Haan, N A; Mellink, C H; Bosma, A A

    1997-01-01

    The gene clusters encoding 18S + 28S and 5S rRNA in the dog (Canis familiaris) have been localized by using GTG-banding and fluorescence in situ hybridization. The 18S + 28S rDNA maps to chromosome regions 7q2.5-->q2.7, 17q1.7, qter of a medium-sized, not yet numbered autosome, and Yq1.2-->q1.3. Our data show that there is one cluster of 5S rDNA in the dog, which maps to chromosome region 4q1.4.

  12. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    Science.gov (United States)

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  13. Interaction of ribosomal proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA.

    Science.gov (United States)

    Stern, S; Powers, T; Changchien, L M; Noller, H F

    1988-06-20

    We have examined the effects of assembly of ribosomal proteins S5, S6, S11, S12, S18 and S21 on the reactivities of residues in 16 S rRNA towards chemical probes. The results show that S6, S18 and S11 interact with the 690-720 and 790 loop regions of 16 S rRNA in a highly co-operative manner, that is consistent with the previously defined assembly map relationships among these proteins. The results also indicate that these proteins, one of which (S18) has previously been implicated as a component of the ribosomal P-site, interact with residues near some of the recently defined P-site (class II tRNA protection) nucleotides in 16 S rRNA. In addition, assembly of protein S12 has been found to result in the protection of residues in both the 530 stem/loop and the 900 stem regions; the latter group is closely juxtaposed to a segment of 16 S rRNA recently shown to be protected from chemical probes by streptomycin. Interestingly, both S5 and S12 appear to protect, to differing degrees, a well-defined set of residues in the 900 stem/loop and 5'-terminal regions. These observations are discussed in terms of the effects of S5 and S12 on streptomycin binding, and in terms of the class III tRNA protection found in the 900 stem of 16 S rRNA. Altogether these results show that many of the small subunit proteins, which have previously been shown to be functionally important, appear to be associated with functionally implicated segments of 16 S rRNA.

  14. Nucleotide sequences of chloroplast 5S ribosomal RNA from cell suspension cultures of the liverworts Marchantia polymorpha and Jungermannia subulata.

    OpenAIRE

    Yamano, Y; Ohyama, K; Komano, T

    1984-01-01

    The nucleotide sequences of chloroplast 5S rRNAs from cell suspension cultures of the liverworts Marchantia polymorpha and Jungermannia subulata were determined. Their nucleotide sequences, 119 nucleotides long, were highly homologous to each other (96% identity) and had high homology with those from chloroplast 5S rRNAs of two higher plants, tobacco (92% identity) and spinach (92-91% identity), but less homology (87-85% identity) with that from a lower plant, the fern Dryopteris acuminata.

  15. Molecular characterization of the full-length 23S and 5S ribosomal RNA (rRNA) genes of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, Akihiro; Saito, Satoru; Sekizuka, Tsuyoshi; Murayama, Ohoshi; Takamiya, Shinzaburo; Moore, John E; Millar, B Cherie; Matsuda, Motoo

    2007-08-01

    An approximately 4.2 kbp region encoding 23S and 5S rRNA genes was identified when recombinant plasmid DNAs from two genomic DNA libraries and an inverse PCR product of Taylorella asinigenitalis UK-1 isolate were analyzed. Full-length genes of 23S rRNA (3,225 bp) and 5S rRNA (117 bp) of T. asinigenitalis are described. The present sequence analysis identified a non-coding hypothetically intrinsic transcription terminator region downstream of the 5S rRNA gene. The sequence, however, downstream of the 5S rRNA gene did not show any distal tRNA genes. Surprisingly, an intervening sequence (IVS) of 270 bp in length, including two specific tandem repeat units of 80 bp and one partial unit of 48 bp with unknown functions was identified in the first quarter of the 23S rRNA gene sequence. A second IVS of 70 bp in length was also identified in the central region of the 23S rRNA gene. In addition, by using PCR and sequencing procedures, two T. asinigenitalis isolates, UK-1 and UK-2, carried multiple IVSs in the first quarter and central regions. Moreover, the 23S rRNA fragmentation occurred in the UK-1 isolate. A phylogenetic analysis was first carried out based on the 23S rRNA sequence data from T. asinigenitalis UK-1 and 13 other beta-Proteobacteria. This is the first report of IVSs in the 23S rRNA gene from the beta-Proteobacteria.

  16. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    Science.gov (United States)

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  17. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA in the Asteraceae family

    Directory of Open Access Journals (Sweden)

    Garcia Sònia

    2010-08-01

    Full Text Available Abstract Background In flowering plants and animals the most common ribosomal RNA genes (rDNA organisation is that in which 35S (encoding 18S-5.8S-26S rRNA and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae, a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing, gene copy number (quantitative PCR and chromosomal position (FISH of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases, tribe Gnaphalieae (100% and in the "Heliantheae alliance" (23%. The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic

  18. Mapping of the 18S and 5S ribosomal RNA genes in Astyanax altiparanae Garutti & Britski, 2000 (Teleostei, Characidae from the upper Paraná river basin, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Alexandre Fernandes

    2006-01-01

    Full Text Available Fluorescence in situ hybridization (FISH was undertaken in order to determinate the chromosomal distribution pattern of 18S and 5S ribosomal DNAs (rDNA in four populations of the characid fish Astyanax altiparanae from the upper Paraná river basin, Brazil. The 18S rDNA probe FISH revealed numerical and positional variations among specimens from the Keçaba stream compared to specimens of the other populations studied. In contrast to the variable 18S rDNA distribution pattern, highly stable chromosomal positioning of the 5S rDNA sites was observed in the four A. altiparanae populations. Divergence in the distribution pattern of 18S and 5S rDNA sites is also discussed.

  19. Increased 5S rRNA oxidation in Alzheimer's disease.

    Science.gov (United States)

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  20. [Ribosomal RNA Evolution

    Science.gov (United States)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  1. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  2. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  3. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  4. The 5S RNP Couples p53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress

    Science.gov (United States)

    Sloan, Katherine E.; Bohnsack, Markus T.; Watkins, Nicholas J.

    2013-01-01

    Summary Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14ARF, a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. PMID:24120868

  5. The 5S RNP Couples p53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress

    Directory of Open Access Journals (Sweden)

    Katherine E. Sloan

    2013-10-01

    Full Text Available Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2 homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP. We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14ARF, a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production.

  6. The participation of 5S rRNA in the co-translational formation of a eukaryotic 5S ribonucleoprotein complex

    OpenAIRE

    Lin, Elong; Lin, Sue-Wen; Lin, Alan

    2001-01-01

    The eukaryotic ribosomal 5S RNA–protein complex (5S rRNP) is formed by a co-translational event that requires 5S rRNA binding to the nascent peptide chain of eukaryotic ribosomal protein L5. Binding between 5S rRNA and the nascent chain is specific: neither the 5S rRNA nor the nascent chain of L5 protein can be substituted by other RNAs or other ribosomal proteins. The region responsible for binding 5S rRNA is located at positions 35–50 with amino acid sequence RLV...

  7. Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs.

    Science.gov (United States)

    Trinh-Rohlik, Q; Maxwell, E S

    1988-07-11

    Previous work has reported the isolation and sequencing of a mouse low molecular weight RNA species designated 4.5S hybridizing RNA or hybRNA because of its ability to intermolecularly hybridize with mouse mRNA and 18S rRNA sequences. Using synthetic DNA oligonucleotide probes we have examined the conservation of this gene sequence and its expression as a lmwRNA transcript across evolution. Southern blot analysis has shown that homologous genes of single or low copy number are found in all eukaryotes examined as well as in E. coli. Northern blot analysis has demonstrated 4.5S hybRNA transcription in all mouse tissues as well as expression in yeast and Xenopus laevis as lmwRNAs of approximately 130 and 100 nucleotides, respectively, as compared with mouse/rat/hamster species of approximately 87 nucleotides. Yeast and X. laevis 4.5S hybRNA homologs, isolated by hybrid-selection, were shown by Northern blot analysis to intermolecularly hybridize with homologous as well as heterologous 18S rRNA sequences. The conservation of 4.5S hybRNA homologous genes and their expression as lmwRNA transcripts with common intermolecular RNA:RNA hybridization capabilities in fungi, amphibians, and mammals argues for a common, conserved and required biological function for this lmwRNA in all eukaryotes and potential utilization of its intermolecular RNA:RNA hybridization capabilities to carry out this function.

  8. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  9. Fluorescent in situ hybridization of the ribosomal RNA genes (5S and 35S in the genus Lolium: Lolium canariense, the missing link with Festuca?

    Directory of Open Access Journals (Sweden)

    Inda, Luis A.

    2013-06-01

    Full Text Available Two groups of taxa can be distinguished within the genus Lolium L. based on the pollination system, chromosome size, chromosomal location of nrDNA (5S and 35S (18S-5.8S-26S] and nrDNA phylogeny. The first group includes self-pollinated taxa (L. temulentum, L. persicum and L. remotum, whereas the second group comprises cross-pollinated species (L. perenne, L. multiflorum and L. rigidum. Here we describe that the autogamous species have two 5S sites and four 35S sites in their genome. Two of the 35S sites are present in the chromosomes containing the 5S regions. The allogamous taxa possess two 5S rDNA sites and 6-10 35S sites per genome, depending on the species. Two of these regions (35S may also be present in the chromosomes bearing 5S sites. Our study also demonstrates that Lolium canariense shows a distinctive pattern. It has two 5S and four 35S sites. In this case, the 35S loci are located in different chromosomes than the 5S. This cytogenetic pattern is consistent with that of Festuca pratensis. Thus, despite being allogamous, Lolium canariense does not entirely fit in either of the groups defined for the genus Lolium. The physical mapping of the nrDNA regions in L. canariense is different, and resembles that of F. pratensis, suggesting that this Macaronesian Lolium could be intermediate between Festuca and Lolium.En trabajos previos se ha descrito que el género Lolium L. está formado por dos grupos de taxones basados en el tipo de polinización, tamaño de los cromosomas, localización cromosómica de los loci del ADN ribosómico [5S y 35S (18S-5.8S-26S] y filogenia molecular basada en secuencias de ADN ribosómico. Los dos grupos son: especies autógamas (L. temulentum, L. persicum y L. remotum y especies alógamas (L. perenne, L. multiflorum y L. rigidum. Aquí describimos que según la localización cromosómica de los loci ribosómicos, las especies autógamas tienen dos sitios 5S y cuatro sitios 35S; dos de las cuales coinciden en

  10. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    Science.gov (United States)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  11. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Science.gov (United States)

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  12. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  13. Systematic analysis and evolution of 5S ribosomal DNA in metazoans

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-01-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12 766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades. PMID:23838690

  14. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  15. Bacterial 5S rRNA-binding proteins of the CTC family.

    Science.gov (United States)

    Gongadze, G M; Korepanov, A P; Korobeinikova, A V; Garber, M B

    2008-12-01

    The presence of CTC family proteins is a unique feature of bacterial cells. In the CTC family, there are true ribosomal proteins (found in ribosomes of exponentially growing cells), and at the same time there are also proteins temporarily associated with the ribosome (they are produced by the cells under stress only and incorporate into the ribosome). One feature is common for these proteins - they specifically bind to 5S rRNA. In this review, the history of investigations of the best known representatives of this family is described briefly. Structural organization of the CTC family proteins and their occurrence among known taxonomic bacterial groups are discussed. Structural features of 5S rRNA and CTC protein are described that predetermine their specific interaction. Taking into account the position of a CTC protein and its intermolecular contacts in the ribosome, a possible role of its complex with 5S rRNA in ribosome functioning is discussed.

  16. An unusual 5S rRNA, from Sulfolobus acidocaldarius, and its implications for a general 5S rRNA structure.

    OpenAIRE

    Stahl, D A; Luehrsen, K R; Woese, C R; Pace, N R

    1981-01-01

    The nucleotide sequence of the 5S ribosomal RNA of the thermoacidophilic archaebacterium Sulfolobus acidocaldarius was determined. The high degree of evident secondary structure in the molecule has implications for the common higher order structure of other 5S rRNAs, both bacterial and eukaryotic.

  17. An unusual 5S rRNA, from Sulfolobus acidocaldarius, and its implications for a general 5S rRNA structure.

    OpenAIRE

    Stahl, D A; Luehrsen, K R; Woese, C R; Pace, N R

    1981-01-01

    The nucleotide sequence of the 5S ribosomal RNA of the thermoacidophilic archaebacterium Sulfolobus acidocaldarius was determined. The high degree of evident secondary structure in the molecule has implications for the common higher order structure of other 5S rRNAs, both bacterial and eukaryotic.

  18. Low abundant spacer 5S rRNA transcripts are frequently polyadenylated in Nicotiana.

    Science.gov (United States)

    Fulnecek, Jaroslav; Kovarik, Ales

    2007-11-01

    In plants, 5S rRNA genes (5S rDNA) encoding 120-nt structural RNA molecules of ribosomes are organized in tandem arrays comprising thousands of units. Failure to correctly terminate transcription would generate longer inaccurately processed transcripts interfering with ribosome biogenesis. Hence multiple termination signals occur immediately after the 5S rRNA coding sequence. To obtain information about the efficiency of termination of 5S rDNA transcription in plants we analyzed 5S rRNA pools in three Nicotiana species, N. sylvestris, N. tomentosiformis and N. tabacum. In addition to highly abundant 120-nt 5S rRNA transcripts, we also detected RNA species composed of a genic region and variable lengths of intergenic sequences. These genic-intergenic RNA molecules occur at a frequency severalfold lower than the mature 120-nt transcripts, and are posttranscriptionally modified by polyadenylation at their 3' end in contrast to 120-nt transcripts. An absence of 5S small RNAs (smRNA) argue against a dominant role for the smRNA biosynthesis pathway in the degradation of aberrant 5S rRNA in Nicotiana. This work is the first description of polyadenylated 5S rRNA species in higher eukaryotes originating from a read-through transcription into the intergenic spacer. We propose that polyadenylation may function in a "quality control" pathway ensuring that only correctly processed molecules enter the ribosome biogenesis.

  19. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits......A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  20. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  1. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kiparisov, Sergey; Petrov, Alexey; Meskauskas, Arturas; Sergiev, Petr V; Dontsova, Olga A; Dinman, Jonathan D

    2005-10-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semi-dominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression.

  2. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    OpenAIRE

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

  3. Resurrection of an ancestral 5S rRNA

    Directory of Open Access Journals (Sweden)

    Fox George E

    2011-07-01

    Full Text Available Abstract Background In addition to providing phylogenetic relationships, tree making procedures such as parsimony and maximum likelihood can make specific predictions of actual historical sequences. Resurrection of such sequences can be used to understand early events in evolution. In the case of RNA, the nature of parsimony is such that when applied to multiple RNA sequences it typically predicts ancestral sequences that satisfy the base pairing constraints associated with secondary structure. The case for such sequences being actual ancestors is greatly improved, if they can be shown to be biologically functional. Results A unique common ancestral sequence of 28 Vibrio 5S ribosomal RNA sequences predicted by parsimony was resurrected and found to be functional in the context of the E. coli cellular environment. The functionality of various point variants and intermediates that were constructed as part of the resurrection were examined in detail. When separately introduced the changes at single stranded positions and individual double variants at base-paired positions were also viable. An additional double variant was examined at a different base-paired position and it was also valid. Conclusions The results show that at least in the case of the 5S rRNAs considered here, ancestors predicted by parsimony are likely to be realistic when the prediction is not overly influenced by single outliers. It is especially noteworthy that the phenotype of the predicted ancestors could be anticipated as a cumulative consequence of the phenotypes of the individual variants that comprised them. Thus, point mutation data is potentially useful in evaluating the reasonableness of ancestral sequences predicted by parsimony or other methods. The results also suggest that in the absence of significant tertiary structure constraints double variants that preserve pairing in stem regions will typically be accepted. Overall, the results suggest that it will be feasible

  4. Resurrection of an ancestral 5S rRNA.

    Science.gov (United States)

    Lu, Qing; Fox, George E

    2011-07-22

    In addition to providing phylogenetic relationships, tree making procedures such as parsimony and maximum likelihood can make specific predictions of actual historical sequences. Resurrection of such sequences can be used to understand early events in evolution. In the case of RNA, the nature of parsimony is such that when applied to multiple RNA sequences it typically predicts ancestral sequences that satisfy the base pairing constraints associated with secondary structure. The case for such sequences being actual ancestors is greatly improved, if they can be shown to be biologically functional. A unique common ancestral sequence of 28 Vibrio 5S ribosomal RNA sequences predicted by parsimony was resurrected and found to be functional in the context of the E. coli cellular environment. The functionality of various point variants and intermediates that were constructed as part of the resurrection were examined in detail. When separately introduced the changes at single stranded positions and individual double variants at base-paired positions were also viable. An additional double variant was examined at a different base-paired position and it was also valid. The results show that at least in the case of the 5S rRNAs considered here, ancestors predicted by parsimony are likely to be realistic when the prediction is not overly influenced by single outliers. It is especially noteworthy that the phenotype of the predicted ancestors could be anticipated as a cumulative consequence of the phenotypes of the individual variants that comprised them. Thus, point mutation data is potentially useful in evaluating the reasonableness of ancestral sequences predicted by parsimony or other methods. The results also suggest that in the absence of significant tertiary structure constraints double variants that preserve pairing in stem regions will typically be accepted. Overall, the results suggest that it will be feasible to resurrect additional meaningful 5S rRNA ancestors as well

  5. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  6. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  7. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

    Science.gov (United States)

    Kamina, Anyango D; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  8. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    Science.gov (United States)

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  9. 5S rRNA-recognition module of CTC family proteins and its evolution.

    Science.gov (United States)

    Korobeinikova, A V; Gongadze, G M; Korepanov, A P; Eliseev, B D; Bazhenova, M V; Garber, M B

    2008-02-01

    The effects of amino acid replacements in the RNA-binding sites of homologous ribosomal proteins TL5 and L25 (members of the CTC family) on ability of these proteins to form stable complexes with ribosomal 5S RNA were studied. It was shown that even three simultaneous replacements of non-conserved amino acid residues by alanine in the RNA-binding site of TL5 did not result in noticeable decrease in stability of the TL5-5S rRNA complex. However, any replacement among five conserved residues in the RNA-binding site of TL5, as well as of L25 resulted in serious destabilization or complete impossibility of complex formation. These five residues form an RNA-recognition module in TL5 and L25. These residues are strictly conserved in proteins of the CTC family. However, there are several cases of natural replacements of these residues in TL5 and L25 homologs in Bacilli and Cyanobacteria, which are accompanied by certain changes in the CTC-binding site of 5S rRNAs of the corresponding organisms. CTC proteins and specific fragments of 5S rRNA of Enterococcus faecalis and Nostoc sp. were isolated, and their ability to form specific complexes was tested. It was found that these proteins formed specific complexes only with 5S rRNA of the same organism. This is an example of coevolution of the structures of two interacting macromolecules.

  10. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  11. The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

    OpenAIRE

    Takaiwa, F.; Kusuda, M; SUGIURA, M.

    1982-01-01

    The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

  12. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  13. Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA.

    Science.gov (United States)

    Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W Brad

    2009-05-01

    Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element.

  14. Abundant 5S rRNA-like transcripts encoded by the mitochondrial genome in amoebozoa.

    Science.gov (United States)

    Bullerwell, Charles E; Burger, Gertraud; Gott, Jonatha M; Kourennaia, Olga; Schnare, Murray N; Gray, Michael W

    2010-05-01

    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified.

  15. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  16. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Science.gov (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Precursors of ribosomal RNA in yeast nucleus : Biosynthesis and relation to cytoplasmic ribosomal RNA

    NARCIS (Netherlands)

    Sillevis Smitt, W.W.; Vlak, J.M.; Schiphof, R.; Rozijn, Th.H.

    In vivo methylated precursors of ribosomal RNA in yeast have been characterized on acrylamide gels. The initial ribosomal precursor in the yeast nucleus is a 37S RNA component, which is processed to a nuclear 28S RNA. Both the 37S and the 28S RNA components are important constituents of the yeast

  18. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei.

  19. Protein CTC from Aquifex aeolicus possesses a full-sized 5S rRNA-binding domain.

    Science.gov (United States)

    Korobeinikova, A V; Shestakov, S A; Korepanov, A P; Garber, M B; Gongadze, G M

    2009-03-01

    Ribosomal 5S RNA is the only identified target for proteins of the CTC family. All known proteins of this family, except for CTC from Aquifex aeolicus, contain a full-sized 5S rRNA-binding domain. In the present study a mistake in the published A. aeolicus genome is corrected. It has been demonstrated that the ctc gene of this organism encodes the protein with a full-length 5S rRNA-binding domain. This protein binds specifically to the bacterial 5S rRNA. Thereby, our data show that CTC A. aeolicus is not an exception from the other known CTC proteins.

  20. Rapid in vivo exploration of a 5S rRNA neutral network.

    Science.gov (United States)

    Zhang, Zhengdong D; Nayar, Madhavi; Ammons, David; Rampersad, Joanne; Fox, George E

    2009-02-01

    A partial knockout compensation method to screen 5S ribosomal RNA sequence variants in vivo is described. The system utilizes an Escherichia coli strain in which five of eight genomic 5S rRNA genes were deleted in conjunction with a plasmid which is compensatory when carrying a functionally active 5S rRNA. The partial knockout strain is transformed with a population of potentially compensatory plasmids each carrying a randomly generated 5S rRNA gene variant. a The ability to compensate the slow growth rate of the knockout strain is used in conjunction with sequencing to rapidly identify variant 5S rRNAs that are functional as well as those that likely are not. The assay is validated by showing that the growth rate of 15 variants separately expressed in the partial knockout strain can be accurately correlated with in vivo assessments of the potential validity of the same variants. A region of 5S rRNA was mutagenized with this approach and nine novel variants were recovered and characterized. Unlike a complete knockout system, the method allows recovery of both deleterious and functional variants.. The method can be used to study variants of any 5S rRNA in the E. coli context including those of E. coli.

  1. Crystallization and X-ray diffraction data of Thermus flavus 5S rRNA helices

    Science.gov (United States)

    Vallazza, Marco; Senge, Andrea; Lippmann, Corinna; Perbandt, Markus; Betzel, Christian; Bald, Rolf; Erdmann, Volker A.

    2001-11-01

    5S rRNA is an essential component of the large ribosomal subunit in prokaryotes and eukaryotes. Its unknown function in the ribosome will eventually be revealed in part by structural studies. To promote crystallization and enhance resolution in X-ray diffraction the molecule was subdivided into five domains A-E. Several RNA oligonucleotides were chemically produced by solid-phase phosphoramidite synthesis in order to construct the domains of the 5S rRNA. An improved RNA-MPD-screen was applied in crystallization which covers a complete 2D matrix for the components used. Crystallization analysis resulted in preferred combinations of pH, polyamine, monovalent and divalent cations for short RNA molecules. Six types of crystals corresponding to the domains B, C and E of Thermus flavus 5S rRNA could be obtained which were suitable for X-ray diffraction. Four RNA helices consist of seven base pairs and two of eight base pairs. As special features, they contain two adenines in a bulge position or G : U wobble base pairs assumed to be involved in RNA-protein recognition. With an increase in crystal size an increase in resolution by X-ray analysis was observed. X-ray diffraction data were collected to 1.5 Å resolution using synchrotron radiation and cryogenic cooling techniques.

  2. Specific features of 5S rRNA structure - its interactions with macromolecules and possible functions.

    Science.gov (United States)

    Smirnov, A V; Entelis, N S; Krasheninnikov, I A; Martin, R; Tarassov, I A

    2008-12-01

    Small non-coding RNAs are today a topic of great interest for molecular biologists because they can be regarded as relicts of a hypothetical "RNA world" which, apparently, preceded the modern stage of organic evolution on Earth. The small molecule of 5S rRNA (approximately 120 nucleotides) is a component of large ribosomal subunits of all living beings (5S rRNAs are not found only in mitoribosomes of fungi and metazoans). This molecule interacts with various protein factors and 23S (28S) rRNA. This review contains the accumulated data to date concerning 5S rRNA structure, interactions with other biological macromolecules, intracellular traffic, and functions in the cell.

  3. Hypomethylation and hypermethylation of the tandem repetitive 5S rRNA genes in Arabidopsis.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Jasencakova, Zuzana; Douet, Julien; Schubert, Ingo; Tourmente, Sylvette

    2008-04-01

    5S ribosomal DNA (5S rDNA) is organized in tandem repeats on chromosomes 3, 4 and 5 in Arabidopsis thaliana. One part of the 5S rDNA is located within the heterochromatic chromocenters, and the other fraction forms loops with euchromatic features that emanate from the chromocenters. We investigated whether the A. thaliana heterochromatin, and particularly the 5S rDNA, is modified when changing the culture conditions (cultivation in growth chamber versus greenhouse). Nuclei from challenged tissues displayed larger total, as well as 5S rDNA, heterochromatic fractions, and the DNA methyltransferase mutants met1 and cmt3 had different impacts in Arabidopsis. The enlarged fraction of heterochromatic 5S rDNA was observed, together with the reversal of the silencing of some 5S rRNA genes known as minor genes. We observed hypermethylation at CATG sites, and a concomitant DNA hypomethylation at CG/CXG sites in 5S rDNA. Our results show that the asymmetrical hypermethylation is correlated with the ageing of the plants, whereas hypomethylation results from the growth chamber/culture conditions. In spite of severely reduced DNA methylation, the met1 mutant revealed no increase in minor 5S rRNA transcripts in these conditions. The increasing proportion of cytosines in asymmetrical contexts during transition from the euchromatic to the heterochromatic state in the 5S rDNA array suggests that 5S rDNA units are differently affected by the (hypo and hyper)methylation patterns along the 5S rDNA locus. This might explain the different behaviour of 5S rDNA subpopulations inside a 5S array in terms of chromatin compaction and expression, i.e. some 5S rRNA genes would become derepressed, whereas others would join the heterochromatic fraction.

  4. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    Science.gov (United States)

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  5. Reconstitution of functional eukaryotic ribosomes from Dictyostelium discoideum ribosomal proteins and RNA.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S

    1997-08-08

    40 and 60 S ribosomal subunits have been reconstituted in vitro from purified ribosomal RNA and ribosomal proteins of Dictyostelium discoideum. The functionality of the reconstituted ribosomes was demonstrated in in vitro mRNA-directed protein synthesis. The reassembly proceeded well with immature precursors of ribosomal RNA but poorly if at all with mature cytoplasmic RNA species. Reassembly also required a preparation of small nuclear RNA(s), acting as morphopoietic factor(s).

  6. 5S rRNA-assisted DnaK refolding.

    Science.gov (United States)

    Kim, Hyo Kyung; Choi, Seong Il; Seong, Baik L

    2010-01-08

    Although accumulating evidence has revealed that most proteins can fold without the assistance of molecular chaperones, little attention has been paid to other types of chaperoning macromolecules. A variety of proteins interact with diverse RNA molecules in vivo, suggesting a potential role of RNAs for folding of their interacting proteins. Here we show that the in vitro refolding of a representative molecular chaperone, DnaK, an Escherichia coli homolog of Hsp70, could be assisted by its interacting 5S rRNA. The folding enhancement occurred in RNA concentration and its size dependent manner whereas neither the RNA with the reverse sequence of 5S rRNA nor the RNase pretreated 5S rRNA stimulated the folding in vitro. Based on our results, we propose that 5S rRNA could exert the chaperoning activity on DnaK during the folding process. The results suggest an interesting possibility that the folding of RNA-interacting proteins could be assisted by their cognate RNA ligands. Copyright 2009 Elsevier Inc. All rights reserved.

  7. Transcription of the 5S rRNA heterochromatic genes is epigenetically controlled in Arabidopsis thaliana and Xenopus laevis.

    Science.gov (United States)

    Douet, J; Tourmente, S

    2007-07-01

    5S ribosomal DNA is a highly conserved tandemly repeated multigenic family. As suggested for a long time, we have shown that only a fraction of the 5S rRNA genes are expressed in Arabidopsis thaliana. In Xenopus laevis, there is a developmental control of the expression of the 5S rRNA genes with only one of the two 5S rDNA families expressed during oogenesis. For both Arabidopsis and Xenopus, the strongest transcription of 5S rRNA, respectively in the seed and during oogenesis is correlated with heterogeneity in the transcribed 5S rRNAs. Epigenetic mechanisms such as modification of the chromatin structure are involved in the transcriptional regulation of the 5S rRNA genes in both organisms. In Arabidopsis, two silencing pathways, methylation-dependent (RNAi) and methylation-independent (MOM pathway), are involved in the silencing of a 5S rDNA fraction.

  8. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  9. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    Directory of Open Access Journals (Sweden)

    Martin Ciganda

    Full Text Available P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  10. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  11. A Study of the 5S Ribosomal RNAs of the Vibrionaceae

    Science.gov (United States)

    1984-01-01

    M.T. and R.R. Colwell. 1984. Identical 5S rRNA nucleotide sequence of (ibrio cholrar strains representing temporal, geographical and ecological...diversity. Appl. Environ. Microbiol. 48:119-121. MacDonell, M.T. and R.R. Colwell. 1984. The nucleotide base sequence of Vibrionaceae 5S rRNA . FEBS Lett...and R.R. Colwell. 1984. Nucleotide sequences of 5S rRNA from two Vibrio species, V. fluvialis and V. parahaemolyticus. MIRCEN J. Appl. Microbial

  12. Novel variants of the 5S rRNA genes in Eruca sativa.

    Science.gov (United States)

    Singh, K; Bhatia, S; Lakshmikumaran, M

    1994-02-01

    The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. Ribosomal RNA pseudouridines and pseudouridine synthases.

    Science.gov (United States)

    Ofengand, James

    2002-03-01

    Pseudouridines are found in virtually all ribosomal RNAs but their function is unknown. There are four to eight times more pseudouridines in eukaryotes than in eubacteria. Mapping 19 Haloarcula marismortui pseudouridines on the three-dimensional 50S subunit does not show clustering. In bacteria, specific enzymes choose the site of pseudouridine formation. In eukaryotes, and probably also in archaea, selection and modification is done by a guide RNA-protein complex. No unique specific role for ribosomal pseudouridines has been identified. We propose that pseudouridine's function is as a molecular glue to stabilize required RNA conformations that would otherwise be too flexible.

  14. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    DEFF Research Database (Denmark)

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

  15. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.

    Science.gov (United States)

    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha

    2012-10-12

    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  16. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    Science.gov (United States)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  17. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).

    Science.gov (United States)

    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S

    2013-06-01

    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  18. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    Science.gov (United States)

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  19. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  20. Mutational robustness of 16S ribosomal RNA, shown by experimental horizontal gene transfer in Escherichia coli

    OpenAIRE

    Kitahara, Kei; Yasutake, Yoshiaki; Miyazaki, Kentaro

    2012-01-01

    The bacterial ribosome consists of three rRNA molecules and 57 proteins and plays a crucial role in translating mRNA-encoded information into proteins. Because of the ribosome’s structural and mechanistic complexity, it is believed that each ribosomal component coevolves to maintain its function. Unlike 5S rRNA, 16S and 23S rRNAs appear to lack mutational robustness, because they form the structural core of the ribosome. However, using Escherichia coli Δ7 (null mutant of operons) as a host, w...

  1. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  2. Abundant 5S rRNA-Like Transcripts Encoded by the Mitochondrial Genome in Amoebozoa ▿ †

    Science.gov (United States)

    Bullerwell, Charles E.; Burger, Gertraud; Gott, Jonatha M.; Kourennaia, Olga; Schnare, Murray N.; Gray, Michael W.

    2010-01-01

    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified. PMID:20304999

  3. Proteolytic footprinting of transcription factor TFIIIA reveals different tightly binding sites for 5S RNA and 5S DNA.

    OpenAIRE

    Bogenhagen, D F

    1993-01-01

    Transcription factor IIIA (TFIIIA) employs an array of nine N-terminal zinc fingers to bind specifically to both 5S RNA and 5S DNA. The binding of TFIIIA to 5S RNA and 5S DNA was studied by using a protease footprinting technique. Brief treatment of free or bound TFIIA with trypsin or chymotrypsin generated fragments which were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Fragments retaining the N terminus of TFIIA were identified by immunoblotting with an antibody ...

  4. 5S rRNA-derived and tRNA-derived SINEs in fruit bats.

    Science.gov (United States)

    Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

    2009-05-01

    Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.

  5. Reverse Translocation of tRNA in the Ribosome

    OpenAIRE

    2006-01-01

    A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes ...

  6. Dicistronic tRNA-5S rRNA genes in Yarrowia lipolytica: an alternative TFIIIA-independent way for expression of 5S rRNA genes.

    Science.gov (United States)

    Acker, Joël; Ozanne, Christophe; Kachouri-Lafond, Rym; Gaillardin, Claude; Neuvéglise, Cécile; Marck, Christian

    2008-10-01

    In eukaryotes, genes transcribed by RNA polymerase III (Pol III) carry their own internal promoters and as such, are transcribed as individual units. Indeed, a very few cases of dicistronic Pol III genes are yet known. In contrast to other hemiascomycetes, 5S rRNA genes of Yarrowia lipolytica are not embedded into the tandemly repeated rDNA units, but appear scattered throughout the genome. We report here an unprecedented genomic organization: 48 over the 108 copies of the 5S rRNA genes are located 3' of tRNA genes. We show that these peculiar tRNA-5S rRNA dicistronic genes are expressed in vitro and in vivo as Pol III transcriptional fusions without the need of the 5S rRNA gene-specific factor TFIIIA, the deletion of which displays a viable phenotype. We also report the existence of a novel putative non-coding Pol III RNA of unknown function about 70 nucleotide-long (RUF70), the 13 genes of which are devoid of internal Pol III promoters and located 3' of the 13 copies of the tDNA-Trp (CCA). All genes embedded in the various dicistronic genes, fused 5S rRNA genes, RUF70 genes and their leader tRNA genes appear to be efficiently transcribed and their products correctly processed in vivo.

  7. In Vivo Production of Small Recombinant RNAs Embedded in a 5S rRNA-Derived Protective Scaffold.

    Science.gov (United States)

    Stepanov, Victor G; Fox, George E

    2015-01-01

    Preparative synthesis of RNA is a challenging task that is usually accomplished using either chemical or enzymatic polymerization of ribonucleotides in vitro. Herein, we describe an alternative approach in which RNAs of interest are expressed as a fusion with a 5S rRNA-derived scaffold. The scaffold provides protection against cellular ribonucleases resulting in cellular accumulations comparable to those of regular ribosomal RNAs. After isolation of the chimeric RNA from the cells, the scaffold can be removed if necessary by deoxyribozyme-catalyzed cleavage followed by preparative electrophoretic separation of the cleavage reaction products. The protocol is designed for sustained production of high quality RNA on the milligram scale.

  8. Trends in evolution of 5S rRNA of deuterostomes: bases and homogeneous clusters

    Directory of Open Access Journals (Sweden)

    Sandra Maria Rodrigues Subacius

    2002-01-01

    Full Text Available Evolution of metazoan 5S rRNA sequences was analyzed through base composition and types, location and frequency of clustered bases. Characters from sequences of protostomes did not show regular trends as compared with paleontology dating or organism complexity. Trends of increasing G and C, stronger in G clusters, and decreasing A and U, were detected in deuterostomes, in parallel with evolution of complexity. The multifunctional domain 71-104 was highlighted among conserved stretches. Clusters of C were typical of helices. Those of G were longer, extending from helices into loops or related to bulges, which is suggestive of functional significance. Deuterostomian trends were installed early in the lineage and reached full development in aquatic organisms, not increasing further after reptiles. It can be suggested that ribosomal RNA structures participated in deuterostomian high regulatory complexity, either specifically or as part of the widespread processes of chromosomal regionalization.

  9. Linkage of 35S and 5S rRNA genes in Artemisia (family Asteraceae): first evidence from angiosperms.

    Science.gov (United States)

    Garcia, Sònia; Lim, K Yoong; Chester, Michael; Garnatje, Teresa; Pellicer, Jaume; Vallès, Joan; Leitch, Andrew R; Kovarík, Ales

    2009-02-01

    Typically in plants, the 5S and 35S ribosomal DNA (rDNA) encoding two major ribosomal RNA species occur at separate loci. However, in some algae, bryophytes and ferns, they are at the same locus (linked arranged). Southern blot hybridisation, polymerase chain reactions (PCR), fluorescent in situ hybridisation, cloning and sequencing were used to reveal 5S and 35S rDNA genomic organisation in Artemisia. We observed thousands of rDNA units at two-three loci containing 5S rDNA in an inverted orientation within the inter-genic spacer (IGS) of 35S rDNA. The sequenced clones of 26-18S IGS from Artemisia absinthium appeared to contain a conserved 5S gene insertion proximal to the 26S gene terminus (5S rDNA-1) and a second less conserved 5S insertion (5S rDNA-2) further downstream. Whilst the 5S rDNA-1 showed all the structural features of a functional gene, the 5S-rDNA-2 had a deletion in the internal promoter and probably represents a pseudogene. The linked arrangement probably evolved before the divergence of Artemisia from the rest of Asteraceae (>10 Myrs). This arrangement may have involved retrotransposons and once formed spread via mechanisms of concerted evolution. Heterogeneity in unit structure may reflect ongoing homogenisation of variant unit types without fixation for any particular variant.

  10. Patterns and regulation of ribosomal RNA transcription in Borrelia burgdorferi

    Directory of Open Access Journals (Sweden)

    Schwartz Ira

    2011-01-01

    Full Text Available Abstract Background Borrelia burgdorferi contains one 16S and two tandem sets of 23S-5S ribosomal (r RNA genes whose patterns of transcription and regulation are unknown but are likely to be critical for survival and persistence in its hosts. Results RT-PCR of B. burgdorferi N40 and B31 revealed three rRNA region transcripts: 16S rRNA-alanine transfer RNA (tRNAAla; tRNAIle; and both sets of 23S-5S rRNA. At 34°C, there were no differences in growth rate or in accumulation of total protein, DNA and RNA in B31 cultured in Barbour-Stoenner-Kelly (BSK-H whether rabbit serum was present or not. At 23°C, B31 grew more slowly in serum-containing BSK-H than at 34°C. DNA per cell was higher in cells in exponential as compared to stationary phase at either temperature; protein per cell was similar at both temperatures in both phases. Similar amounts of rRNA were produced in exponential phase at both temperatures, and rRNA was down-regulated in stationary phase at either temperature. Interestingly, a relBbu deletion mutant unable to generate (pppGpp did not down-regulate rRNA at transition to stationary phase in serum-containing BSK-H at 34°C, similar to the relaxed phenotype of E. coli relA mutants. Conclusions We conclude that rRNA transcription in B. burgdorferi is complex and regulated both by growth phase and by the stringent response but not by temperature-modulated growth rate.

  11. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose

    OpenAIRE

    Rozier, Claude; Mache, Régis

    1984-01-01

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20° C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloropl...

  12. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    Science.gov (United States)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  13. Higher order structure in ribosomal RNA.

    Science.gov (United States)

    Gutell, R R; Noller, H F; Woese, C R

    1986-05-01

    The only reliable general method currently available for determining precise higher order structure in the large ribosomal RNAs is comparative sequence analysis. The method is here applied to reveal 'tertiary' structure in the 16S-like rRNAs, i.e. structure more complex than simple double-helical, secondary structure. From a list of computer-generated potential higher order interactions within 16S rRNA one such interaction considered likely was selected for experimental test. The putative interaction involves a Watson-Crick one to one correspondence between positions 570 and 866 in the molecule (E. coli numbering). Using existing oligonucleotide catalog information several organisms were selected whose 16S rRNA sequences might test the proposed co-variation. In all of the (phylogenetically independent) cases selected, full sequence evidence confirms the predicted one to one (Watson-Crick) correspondence. An interaction between positions 570 and 866 is, therefore, considered proven phylogenetically.

  14. Structural features of the tmRNA-ribosome interaction.

    Science.gov (United States)

    Bugaeva, Elizaveta Y; Surkov, Serhiy; Golovin, Andrey V; Ofverstedt, Lars-Göran; Skoglund, Ulf; Isaksson, Leif A; Bogdanov, Alexey A; Shpanchenko, Olga V; Dontsova, Olga A

    2009-12-01

    Trans-translation is a process which switches the synthesis of a polypeptide chain encoded by a nonstop messenger RNA to the mRNA-like domain of a transfer-messenger RNA (tmRNA). It is used in bacterial cells for rescuing the ribosomes arrested during translation of damaged mRNA and directing this mRNA and the product polypeptide for degradation. The molecular basis of this process is not well understood. Earlier, we developed an approach that allowed isolation of tmRNA-ribosomal complexes arrested at a desired step of tmRNA passage through the ribosome. We have here exploited it to examine the tmRNA structure using chemical probing and cryo-electron microscopy tomography. Computer modeling has been used to develop a model for spatial organization of the tmRNA inside the ribosome at different stages of trans-translation.

  15. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    Science.gov (United States)

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  16. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  17. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  18. [Characterization of 5S rRNA gene sequence and secondary structure in gymnosperms].

    Science.gov (United States)

    Liu, Zhan-Lin; Zhang, Da-Ming; Wang, Xiao-Ru

    2003-01-01

    In higher plants the primary and the secondary structures of 5S ribosomal RNA gene are considered highly conservative. Little is known about the 5S rRNA gene structure, organization and variation in gyimnosperms. In this study we analyzed sequence and structure variation of 5S rRNA gene in Pinus through cloning and sequencing multiple copies of 5S rDNA repeats from individual trees of five pines, P. bungeana, P. tabulaeformis, P. yunnanensis, P. massoniana and P. densata. Pinus bungeana is from the subgenus Strobus while the other four are from the subgenus Pinus (diploxylon pines). Our results revealed variations in both primary and secondary structure among copies of 5S rDNA within individual genomes and between species. 5S rRNA gene in Pinus is 120 bp long in most of the 122 clones we sequenced except for one or two deletions in three clones. Among these clones 50 unique sequences were identified and they were shared by different pine species. Our sequences were compared to 13 sequences each representing a different gymnosperm species, and to six sequences representing both angiosperm monocots and dicots. Average sequence similarity was 97.1% among Pinus species and 94.3% between Pinus and other gymnosperms. Between gymnosperms and angiosperms the sequence similarity decreased to 88.1%. Similar to other molecular data, significant sequence divergence was found between the two Pinus subgenera. The 5S gene tree (neighbor-joining tree) grouped the four diploxylon pines together and separated them distinctly from P. bungeana. Comparison of sequence divergence within individuals and between species suggested that concerted evolution has been very weak especially after the divergence of the four diploxylon pines. The phylogenetic information contained in the 5S rRNA gene is limited due to its shorter length and the difficulties in identifying orthologous and paralogous copies of rDNA multigene family further complicate its phylogenetic application. Pinus densata is a

  19. Mapping the interaction of SmpB with ribosomes by footprinting of ribosomal RNA

    Science.gov (United States)

    Ivanova, Natalia; Pavlov, Michael Y.; Bouakaz, Elli; Ehrenberg, Måns; Schiavone, Lovisa Holmberg

    2005-01-01

    In trans-translation transfer messenger RNA (tmRNA) and small protein B (SmpB) rescue ribosomes stalled on truncated or in other ways problematic mRNAs. SmpB promotes the binding of tmRNA to the ribosome but there is uncertainty about the number of participating SmpB molecules as well as their ribosomal location. Here, the interaction of SmpB with ribosomal subunits and ribosomes was studied by isolation of SmpB containing complexes followed by chemical modification of ribosomal RNA with dimethyl sulfate, kethoxal and hydroxyl radicals. The results show that SmpB binds 30S and 50S subunits with 1:1 molar ratios and the 70S ribosome with 2:1 molar ratio. SmpB-footprints are similar on subunits and the ribosome. In the 30S subunit, SmpB footprints nucleotides that are in the vicinity of the P-site facing the E-site, and in the 50S subunit SmpB footprints nucleotides that are located below the L7/L12 stalk in the 3D structure of the ribosome. Based on these results, we suggest a mechanism where two molecules of SmpB interact with tmRNA and the ribosome during trans-translation. The first SmpB molecule binds near the factor-binding site on the 50S subunit helping tmRNA accommodation on the ribosome, whereas the second SmpB molecule may functionally substitute for a missing anticodon stem–loop in tmRNA during later steps of trans-translation. PMID:15972795

  20. A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

    Science.gov (United States)

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

  1. A novel association between two trypanosome-specific factors and the conserved L5-5S rRNA complex.

    Directory of Open Access Journals (Sweden)

    Martin Ciganda

    Full Text Available P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis.

  2. A novel association between two trypanosome-specific factors and the conserved L5-5S rRNA complex.

    Science.gov (United States)

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis.

  3. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

    Science.gov (United States)

    Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

    2017-01-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

  4. A conserved alternative splicing event in plants reveals an ancient exonization of 5S rRNA that regulates TFIIIA.

    Science.gov (United States)

    Barbazuk, W Brad

    2010-01-01

    Uncovering conserved alternative splicing (AS) events can identify AS events that perform important functions. This is especially useful for identifying premature stop codon containing (PTC) AS isoforms that may regulate protein expression by being targets for nonsense mediated decay. This report discusses the identification of a PTC containing splice isoform of the TFIIIA gene that is highly conserved in land plants. TFIIIA is essential for RNA Polymerase III-based transcription of 5S rRNA in eukaryotes. Two independent groups have determined that the PTC containing alternative exon is ultraconserved and is coupled with nonsense-mediated mRNA decay. The alternative exon appears to have been derived by the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA. This provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized non-coding element.

  5. Structural and Functional Studies of Ribosome-inactivating Proteins and Ribosomal RNA

    Institute of Scientific and Technical Information of China (English)

    LIU Wangyi; ZHANG Jinsong; LIU Renshui; HE Wenjun; LING Jun

    2007-01-01

    @@ A plant's ribosome-inactivating proteins (RIPs) are a group of toxic proteins. Theoretically, they can be employed as a tool enzyme in the exploration of the structure and function of the ribosomal RNA; in practical application, they can be used as an insecticide in agriculture, for preparation of immuno-toxic protein to kill cancer cells or against viral infection in medicine.

  6. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    Science.gov (United States)

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  7. Fragmentary 5S rRNA gene in the human mitochondrial genome

    Energy Technology Data Exchange (ETDEWEB)

    Nierlich, D.P.

    1982-02-01

    The human mitochondrial genoma contains a 23-nucleodtide sequence that is homologous to a part of the 5S rRNA's of bacteria. This homology, the structure of the likely transcript, and the location of the sequence relative to the mitochondrial rRNA genes suggest that the sequence represents a fragmentary 5S rRNA gene.

  8. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    Science.gov (United States)

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Translation with frameshifting of ribosome along mRNA transcript

    CERN Document Server

    Li, Jingwei

    2015-01-01

    Translation is an important process for prokaryotic and eukaryotic cells to produce necessary proteins for cell growth. Numerious experiments have been performed to explore the translational properties. Diverse models have also been developed to determine the biochemical mechanism of translation. However, to simplify the majority of the existing models, the frameshifting of ribosome along the mRNA transcript is neglected, which actually occurs in real cells and has been extensively experimentally studied. The frameshifting of ribosome evidently influences the efficiency and speed of translation, considering that the peptide chains synthesized by shifted ribosomes will not fold into functional proteins and will degrade rapidly. In this study, a theoretical model is presented to describe the translational process based on the model for totally asymmetric simple exclusion process. In this model, the frameshifting of the ribosome along the mRNA transcript and the attachment/detachment of the ribosome to/from the ...

  10. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C.; Dennis, P. P.

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  11. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  12. Mutations in the gene for EF-G reduce the requirement for 4.5S RNA in the growth of E. coli

    DEFF Research Database (Denmark)

    Brown, S

    1987-01-01

    A general strategy is described for the isolation of suppressors of essential genes whose functions are unknown. This strategy was used to analyze the role of 4.5S RNA, an essential RNA of E. coli. In this strategy, the structural gene for 4.5S RNA is fused to the Ptac promoter in such a way...... that the strain becomes dependent upon inducers of lac for growth. Mutants mapping to fus, the structural gene for protein synthesis elongation factor G, appear as spontaneous, inducer-independent revertants. These mutants alter the intracellular distribution of 4.5S RNA such that it sediments at 70S or greater....... Furthermore, the increased sedimentation velocity is sensitive to the antibiotic puromycin. These results show that 4.5S RNA physically associates with the ribosome in performing its essential function, and that this association is mediated by elongation factor G....

  13. Induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway delays the initiation but fails to eradicate established murine acute myeloid leukemia.

    Science.gov (United States)

    Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D

    2017-01-01

    Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.

  14. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly

    Directory of Open Access Journals (Sweden)

    Oliver Rackham

    2016-08-01

    Full Text Available The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE and RNA-seq enabled us to identify that in vivo 5′ tRNA cleavage precedes 3′ tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome.

  15. Identification and chromosomal distribution of 5S rRNA genes in Neurospora crassa.

    OpenAIRE

    Metzenberg, R L; Stevens, J N; Selker, E U; Morzycka-Wroblewska, E

    1985-01-01

    The 5S rRNA genes of Neurospora crassa, unlike those of most organisms, are not tandemly arranged, and they are found imbedded in a variety of unique sequences. The 5S rRNA regions of most of the genes are of one type, alpha; however, several other "isotypes" (beta, gamma, delta, zeta, and eta) are also found. We asked whether Neurospora 5S rRNA genes are dispersed on a chromosomal scale and whether genes of different isotypes are spatially segregated. We identified, by DNA sequencing, 5S rRN...

  16. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  17. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

    Directory of Open Access Journals (Sweden)

    Stern David B

    2010-09-01

    Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  18. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth.

    Science.gov (United States)

    Hotto, Amber M; Huston, Zoe E; Stern, David B

    2010-09-29

    The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs) in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. AS5-overexpressing (AS5ox) plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT) and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  19. Coevolution in RNA molecules driven by selective constraints: evidence from 5S rRNA.

    Directory of Open Access Journals (Sweden)

    Nan Cheng

    Full Text Available Understanding intra-molecular coevolution helps to elucidate various structural and functional constraints acting on molecules and might have practical applications in predicting molecular structure and interactions. In this study, we used 5S rRNA as a template to investigate how selective constraints have shaped the RNA evolution. We have observed the nonrandom occurrence of paired differences along the phylogenetic trees, the high rate of compensatory evolution, and the high TIR scores (the ratio of the numbers of terminal to intermediate states, all of which indicate that significant positive selection has driven the evolution of 5S rRNA. We found three mechanisms of compensatory evolution: Watson-Crick interaction (the primary one, complex interactions between multiple sites within a stem, and interplay of stems and loops. Coevolutionary interactions between sites were observed to be highly dependent on the structural and functional environment in which they occurred. Coevolution occurred mostly in those sites closest to loops or bulges within structurally or functionally important helices, which may be under weaker selective constraints than other stem positions. Breaking these pairs would directly increase the size of the adjoining loop or bulge, causing a partial or total structural rearrangement. In conclusion, our results indicate that sequence coevolution is a direct result of maintaining optimal structural and functional integrity.

  20. Coevolution in RNA molecules driven by selective constraints: evidence from 5S rRNA.

    Science.gov (United States)

    Cheng, Nan; Mao, Yuanhui; Shi, Youyi; Tao, Shiheng

    2012-01-01

    Understanding intra-molecular coevolution helps to elucidate various structural and functional constraints acting on molecules and might have practical applications in predicting molecular structure and interactions. In this study, we used 5S rRNA as a template to investigate how selective constraints have shaped the RNA evolution. We have observed the nonrandom occurrence of paired differences along the phylogenetic trees, the high rate of compensatory evolution, and the high TIR scores (the ratio of the numbers of terminal to intermediate states), all of which indicate that significant positive selection has driven the evolution of 5S rRNA. We found three mechanisms of compensatory evolution: Watson-Crick interaction (the primary one), complex interactions between multiple sites within a stem, and interplay of stems and loops. Coevolutionary interactions between sites were observed to be highly dependent on the structural and functional environment in which they occurred. Coevolution occurred mostly in those sites closest to loops or bulges within structurally or functionally important helices, which may be under weaker selective constraints than other stem positions. Breaking these pairs would directly increase the size of the adjoining loop or bulge, causing a partial or total structural rearrangement. In conclusion, our results indicate that sequence coevolution is a direct result of maintaining optimal structural and functional integrity.

  1. mRNA pseudoknot structures can act as ribosomal roadblocks

    DEFF Research Database (Denmark)

    Hansen, Jesper Tholstrup; Oddershede, Lene Broeng; Sørensen, Michael Askvad

    2012-01-01

    Several viruses utilize programmed ribosomal frameshifting mediated by mRNA pseudoknots in combination with a slippery sequence to produce a well defined stochiometric ratio of the upstream encoded to the downstream-encoded protein. A correlation between the mechanical strength of mRNA pseudoknot...

  2. A Molecular Titration System Coordinates Ribosomal Protein Gene Transcription with Ribosomal RNA Synthesis.

    Science.gov (United States)

    Albert, Benjamin; Knight, Britta; Merwin, Jason; Martin, Victoria; Ottoz, Diana; Gloor, Yvonne; Bruzzone, Maria Jessica; Rudner, Adam; Shore, David

    2016-11-17

    Cell growth potential is determined by the rate of ribosome biogenesis, a complex process that requires massive and coordinated transcriptional output. In the yeast Saccharomyces cerevisiae, ribosome biogenesis is highly regulated at the transcriptional level. Although evidence for a system that coordinates ribosomal RNA (rRNA) and ribosomal protein gene (RPG) transcription has been described, the molecular mechanisms remain poorly understood. Here we show that an interaction between the RPG transcriptional activator Ifh1 and the rRNA processing factor Utp22 serves to coordinate RPG transcription with that of rRNA. We demonstrate that Ifh1 is rapidly released from RPG promoters by a Utp22-independent mechanism following growth inhibition, but that its long-term dissociation requires Utp22. We present evidence that RNA polymerase I activity inhibits the ability of Utp22 to titrate Ifh1 from RPG promoters and propose that a dynamic Ifh1-Utp22 interaction fine-tunes RPG expression to coordinate RPG and rRNA transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Maturation of the 5S rRNA 5' end is catalyzed in vitro by the endonuclease tRNase Z in the archaeon H. volcanii.

    Science.gov (United States)

    Hölzle, Annette; Fischer, Susan; Heyer, Ruth; Schütz, Stefanie; Zacharias, Martin; Walther, Paul; Allers, Thorsten; Marchfelder, Anita

    2008-05-01

    Ribosomal RNA molecules are synthesized as precursors that have to undergo several processing steps to generate the functional rRNA. The 5S rRNA in the archaeon Haloferax volcanii is transcribed as part of a multicistronic transcript containing both large rRNAs and one or two tRNAs. Release of the 5S rRNA from the precursor requires two endonucleolytic cleavages by enzymes as yet not identified. Here we report the first identification of an archaeal 5S rRNA processing endonuclease. The enzyme tRNase Z, which was initially identified as tRNA processing enzyme, generates not only tRNA 3' ends but also mature 5S rRNA 5' ends in vitro. Interestingly, the sequence upstream of the 5S rRNA can be folded into a mini-tRNA, which might explain the processing of this RNA by tRNase Z. The endonuclease is active only at low salt concentrations in vitro, which is in contrast to the 2-4 M KCl concentration present inside the cell in vivo. Electron microscopy studies show that there are no compartments inside the Haloferax cell that could provide lower salt environments. Processing of the 5S rRNA 5' end is not restricted to the haloarchaeal tRNase Z since tRNase Z enzymes from a thermophilic archaeon, a lower and a higher eukaryote, are as well able to cleave the tRNA-like structure 5' of the 5S rRNA. Knock out of the tRNase Z gene in Haloferax volcanii is lethal, showing that the protein is essential for the cell.

  4. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  5. The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

    OpenAIRE

    1986-01-01

    We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

  6. The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

    OpenAIRE

    1986-01-01

    We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

  7. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  8. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H.

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  9. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis.

    Directory of Open Access Journals (Sweden)

    Khan Umaer

    Full Text Available RNA binding proteins (RBP play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD. Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components.

  10. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis.

    Science.gov (United States)

    Umaer, Khan; Williams, Noreen

    2015-01-01

    RNA binding proteins (RBP) play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD). Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components.

  11. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis

    Science.gov (United States)

    Umaer, Khan; Williams, Noreen

    2015-01-01

    RNA binding proteins (RBP) play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD). Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components. PMID:26121669

  12. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  13. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  14. Reverse translocation of tRNA in the ribosome.

    Science.gov (United States)

    Shoji, Shinichiro; Walker, Sarah E; Fredrick, Kurt

    2006-12-28

    A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes containing P-site tRNA. In the latter assay, the rate of tRNA movement is increased by streptomycin and neomycin, decreased by tetracycline, and not affected by the acylation state of the tRNA. In one case, we provide evidence that complex conversion occurs by reverse translocation (i.e., direct movement of the tRNAs from the E and P sites to the P and A sites, respectively). These findings have important implications for the energetics of translocation.

  15. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Directory of Open Access Journals (Sweden)

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  16. Polyadenylation of ribosomal RNA in human cells

    OpenAIRE

    Slomovic, Shimyn; Laufer, David; Geiger, Dan; Schuster, Gadi

    2006-01-01

    The addition of poly(A)-tails to RNA is a process common to almost all organisms. In eukaryotes, stable poly(A)-tails, important for mRNA stability and translation initiation, are added to the 3′ ends of most nuclear-encoded mRNAs, but not to rRNAs. Contrarily, in prokaryotes and organelles, polyadenylation stimulates RNA degradation. Recently, polyadenylation of nuclear-encoded transcripts in yeast was reported to promote RNA degradation, demonstrating that polyadenylation can play a double-...

  17. RNA structures regulating ribosomal protein biosynthesis in bacilli.

    Science.gov (United States)

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M

    2013-07-01

    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species.

  18. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  19. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  20. The European database on small subunit ribosomal RNA

    OpenAIRE

    Wuyts, Jan; Van de Peer, Yves; Winkelmans, Tina; De Wachter, Rupert

    2002-01-01

    The European database on SSU rRNA can be consulted via the World WideWeb at http://rrna.uia.ac.be/ssu/ and compiles all complete or nearly complete small subunit ribosomal RNA sequences. Sequences are provided in aligned format. The alignment takes into account the secondary structure information derived by comparative sequence analysis of thousands of sequences. Additional information such as literature references, taxonomy, secondary structure models and nucleotide variability maps, is also...

  1. Species-genomic relationships among the tribasic diploid and polyploid Carthamus taxa based on physical mapping of active and inactive 18S-5.8S-26S and 5S ribosomal RNA gene families, and the two tandemly repeated DNA sequences.

    Science.gov (United States)

    Agrawal, Renuka; Tsujimoto, Hisashi; Tandon, Rajesh; Rao, Satyawada Rama; Raina, Soom Nath

    2013-05-25

    In the genus Carthamus (2n=20, 22, 24, 44, 64; x=10, 11, 12), most of the homologues within and between the chromosome complements are difficult to be identified. In the present work, we used fluorescent in situ hybridisation (FISH) to determine the chromosome distribution of the two rRNA gene families, and the two isolated repeated DNA sequences in the 14 Carthamus taxa. The distinctive variability in the distribution, number and signal intensity of hybridisation sites for 18S-26S and 5S rDNA loci could generally distinguish the 14 Carthamus taxa. Active 18S-26S rDNA sites were generally associated with NOR loci on the nucleolar chromosomes. The two A genome taxa, C. glaucus ssp. anatolicus and C. boissieri with 2n=20, and the two botanical varieties of B genome C. tinctorius (2n=24) had diagnostic FISH patterns. The present results support the origin of C. tinctorius from C. palaestinus. FISH patterns of C. arborescens vis-à-vis the other taxa indicate a clear division of Carthamus taxa into two distinct lineages. Comparative distribution and intensity pattern of 18S-26S rDNA sites could distinguish each of the tetraploid and hexaploid taxa. The present results indicate that C. boissieri (2n=20) is one of the genome donors for C. lanatus and C. lanatus ssp. lanatus (2n=44), and C. lanatus is one of the progenitors for the hexaploid (2n=64) taxa. The association of pCtKpnI-2 repeated sequence with rRNA gene cluster (orphon) in 2-10 nucleolar and non-nucleolar chromosomes and the consistent occurrence of pCtKpnI-1 repeated sequence at the subtelomeric region in all the taxa analysed indicate some functional role of these sequences.

  2. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    DEFF Research Database (Denmark)

    Brown, S; Fournier, M J

    1984-01-01

    The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

  3. Molecular and cytological characterization of ribosomal RNA genes in Chenopodium quinoa and Chenopodium berlandieri.

    Science.gov (United States)

    Maughan, P J; Kolano, B A; Maluszynska, J; Coles, N D; Bonifacio, A; Rojas, J; Coleman, C E; Stevens, M R; Fairbanks, D J; Parkinson, S E; Jellen, E N

    2006-07-01

    The nucleolus organizer region (NOR) and 5S ribosomal RNA (rRNA) genes are valuable as chromosome landmarks and in evolutionary studies. The NOR intergenic spacers (IGS) and 5S rRNA nontranscribed spacers (NTS) were PCR-amplified and sequenced from 5 cultivars of the Andean grain crop quinoa (Chenopodium quinoa Willd., 2n = 4x = 36) and a related wild ancestor (C. berlandieri Moq. subsp. zschackei (Murr) A. Zobel, 2n = 4x = 36). Length heterogeneity observed in the IGS resulted from copy number difference in subrepeat elements, small re arrangements, and species-specific indels, though the general sequence composition of the 2 species was highly similar. Fifteen of the 41 sequence polymorphisms identified among the C. quinoa lines were synapomorphic and clearly differentiated the highland and lowland ecotypes. Analysis of the NTS sequences revealed 2 basic NTS sequence classes that likely originated from the 2 allopolyploid subgenomes of C. quinoa. Fluorescence in situ hybridization (FISH) analysis showed that C. quinoa possesses an interstitial and a terminal pair of 5S rRNA loci and only 1 pair of NOR, suggesting a reduction in the number of rRNA loci during the evolution of this species. C. berlandieri exhibited variation in both NOR and 5S rRNA loci without changes in ploidy.

  4. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  5. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  6. Structural arrangement of tRNA binding sites on Escherichia coli ribosomes, as revealed from data on affinity labelling with photoactivatable tRNA derivatives.

    Science.gov (United States)

    Graifer, D M; Babkina, G T; Matasova, N B; Vladimirov, S N; Karpova, G G; Vlassov, V V

    1989-07-01

    A systematic study of protein environment of tRNA in ribosomes in model complexes representing different translation steps was carried out using the affinity labelling of the ribosomes with tRNA derivatives bearing aryl azide groups scattered statistically over tRNA guanine residues. Analysis of the proteins crosslinked to tRNA derivatives showed that the location of the derivatives in the aminoacyl (A) site led to the labelling of the proteins S5 and S7 in all complexes studied, whereas the labelling of the proteins S2, S8, S9, S11, S14, S16, S17, S18, S19, S21 as well as L9, L11, L14, L15, L21, L23, L24, L29 depended on the state of tRNA in A site. Similarly, the location of tRNA derivatives in the peptidyl (P) site resulted in the labelling of the proteins L27, S11, S13 and S19 in all states, whereas the labelling of the proteins S5, S7, S9, S12, S14, S20, S21 as well as L2, L13, L14, L17, L24, L27, L31, L32, L33 depended on the type of complex. The derivatives of tRNA(fMet) were found to crosslink to S1, S3, S5, S7, S9, S14 and L1, L2, L7/L12, L27. Based on the data obtained, a general principle of the dynamic functioning of ribosomes has been proposed: (i) the formation of each type of ribosomal complex is accompanied by changes in mutual arrangement of proteins - 'conformational adjustment' of the ribosome - and (ii) a ribosome can dynamically change its internal structure at each step of initiation and elongation; on the 70 S ribosome there are no rigidly fixed structures forming tRNA-binding sites (primarily A and P sites).

  7. RNA polymerase and the ribosome: the close relationship.

    Science.gov (United States)

    McGary, Katelyn; Nudler, Evgeny

    2013-04-01

    In bacteria transcription and translation are linked in time and space. When coupled to RNA polymerase (RNAP), the translating ribosome ensures transcriptional processivity by preventing RNAP backtracking. Recent advances in the field have characterized important linker proteins that bridge the gap between transcription and translation: In particular, the NusE(S10):NusG complex and the NusG homolog, RfaH. The direct link between the moving ribosome and RNAP provides a basis for maintaining genomic integrity while enabling efficient transcription and timely translation of various genes within the bacterial cell. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    Science.gov (United States)

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  9. The Maize Imprinted Gene Floury3 Encodes a PLATZ Protein Required for tRNA and 5S rRNA Transcription Through Interaction with RNA Polymerase III.

    Science.gov (United States)

    Li, Qi; Wang, Jiechen; Ye, Jianwei; Zheng, Xixi; Xiang, Xiaoli; Li, Changsheng; Fu, Miaomiao; Wang, Qiong; Zhang, Zhi-Yong; Wu, Yongrui

    2017-09-05

    Maize (Zea mays) floury3 (fl3) is a classic semi-dominant negative mutant that exhibits severe defects in the endosperm but fl3 plants otherwise appear normal. We cloned the fl3 gene and determined that it encodes a PLATZ (plant AT-rich sequence- and zinc-binding) protein. The mutation in fl3 resulted in an Asn to His replacement in the conserved PLATZ domain, creating a dominant allele. Fl3 is specifically expressed in starchy endosperm cells and regulated by genomic imprinting, which leads to the suppressed expression of fl3 when transmitted through the male, perhaps as a consequence the semi-dominant behavior. Yeast two-hybrid screening and bimolecular luciferase complementation (BiLC) experiments revealed that FL3 interacts with the RNA polymerase III subunit 53 (RPC53) and transcription factor class C 1 (TFC1), two critical factors of the RNA polymerase III (RNAPIII) transcription complex. In the fl3 endosperm, the levels of many tRNAs and 5S rRNA that are transcribed by RNAPIII are significantly reduced, suggesting that the incorrectly folded fl3 protein may impair the function of RNAPIII. The transcriptome is dramatically altered in fl3 mutants, in which the down-regulated genes are primarily enriched in pathways related to translation, ribosome, misfolded protein responses and nutrient reservoir activity. Collectively, these changes may lead to defects in endosperm development and storage reserve filling in fl3 seeds. © 2017 American Society of Plant Biologists. All rights reserved.

  10. Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

    Science.gov (United States)

    Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

    2012-01-01

    5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

  11. 25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications

    Science.gov (United States)

    Baharaeen, S.; Vishniac, H. S.

    1984-01-01

    Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.

  12. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Diversity and evolution of 5S rRNA gene family organization in Pythium.

    Science.gov (United States)

    Bedard, James E J; Schurko, Andrew M; de Cock, Arthur W A M; Klassen, Glen R

    2006-01-01

    The 5S rRNA gene family organization among 87 species and varieties of Pythium was investigated to assess evolutionary stability of the two patterns detected and to determine which pattern is likely the ancestral state in the genus. Species with filamentous sporangia (Groups A-C according to the ITS phylogenetic tree for Pythium) had 5S genes linked to the rDNA repeat that were predominantly coded for on the DNA strand opposite to the one with the other rRNA genes ('inverted' orientation). A small group of species with contiguous sporangia (Group D) is related to Groups A-C but had unlinked 5S genes. The main group of species with spherical zoosporangia (Groups E-J) generally had unlinked 5S genes in tandem arrays. The six species in Group K, although they also have spherical sporangia, had linked genes on the same strand as the other rRNA genes 'non-inverted' and most of them had pairs of tandem 5S genes. The evolutionary stability of 5S sequence organization was compared with the stability of morphological characters as interpreted from a phylogeny based on ITS sequence analysis. Features of 5S sequence organization were found to be just as consistent within groups as were the morphological characters. To determine the ancestral type of 5S family organization, a survey of Phytophthora strains was conducted to supply an outgroup reference. The most parsimonious interpretation of the data in this survey yielded the tentative conclusion that the linked condition of the 5S sequences was ancestral.

  14. c-Myc co-ordinates mRNA cap methylation and ribosomal RNA production.

    Science.gov (United States)

    Dunn, Sianadh; Lombardi, Olivia; Cowling, Victoria H

    2017-02-01

    The mRNA cap is a structure added to RNA pol II transcripts in eukaryotes, which recruits factors involved in RNA processing, nuclear export and translation initiation. RNA guanine-7 methyltransferase (RNMT)-RNA-activating miniprotein (RAM), the mRNA cap methyltransferase complex, completes the basic functional mRNA cap structure, cap 0, by methylating the cap guanosine. Here, we report that RNMT-RAM co-ordinates mRNA processing with ribosome production. Suppression of RNMT-RAM reduces synthesis of the 45S ribosomal RNA (rRNA) precursor. RNMT-RAM is required for c-Myc expression, a major regulator of RNA pol I, which synthesises 45S rRNA. Constitutive expression of c-Myc restores rRNA synthesis when RNMT-RAM is suppressed, indicating that RNMT-RAM controls rRNA production predominantly by controlling c-Myc expression. We report that RNMT-RAM is recruited to the ribosomal DNA locus, which may contribute to rRNA synthesis in certain contexts. © 2017 The Author(s).

  15. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Depletion of Ribosomal RNA Sequences from Single-Cell RNA-Sequencing Library.

    Science.gov (United States)

    Fang, Nan; Akinci-Tolun, Rumeysa

    2016-07-01

    Recent advances in single-cell RNA sequencing technologies have revealed high heterogeneity of gene expression profiles in individual cells. However, most current single-cell RNA-seq methods use oligo-dT priming in the reverse transcription steps and detect only polyA-positive for more accuracy, since there are also polyA-positive non-coding RNAs transcripts, not other important RNA species, such as polyA-negative noncoding RNA. Reverse transcription using random oligos enables detection of not only the noncoding RNA species without polyA tails, but also ribosomal RNA (rRNA). rRNA comprises more than 90% of the total RNA and should be depleted from the RNA-seq library to ensure efficient usage of the sequencing capacity. Commonly used hybridization-based rRNA depletion methods can preserve noncoding RNA in the standard RNA-seq library. However, such rRNA depletion methods require high input amounts of total RNA and do not work at the single-cell level or with limited input DNA. This unit describes a novel procedure for RNA-seq library construction from single cells or a minimal amount of RNA. A thermostable duplex-specific nuclease is used in this method to effectively remove ribosomal RNA sequences following whole-transcriptome amplification and sequencing library construction. © 2016 by John Wiley & Sons, Inc.

  17. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    Energy Technology Data Exchange (ETDEWEB)

    He, Kaiyu [Department of Microbiology and Molecular Genetics (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Zhou, Hui-Ren [Food Science and Human Nutrition (United States); Pestka, James J., E-mail: pestka@msu.edu [Department of Microbiology and Molecular Genetics (United States); Food Science and Human Nutrition (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States)

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  18. The effect of aminoacyl- or peptidyl-tRNA at the A-site on the arrangement of deacylated tRNA at the ribosomal P-site.

    Science.gov (United States)

    Babkina, G T; Bausk, E V; Graifer, D M; Karpova, G G; Matasova, N B

    1984-05-21

    Photoreactive derivatives of E. coli tRNAPhe bearing arylazido groups on guanine residues (azido-tRNA) were used for affinity labelling of E. coli ribosomes in the region of the P-site when the A-site was either free or occupied by aminoacyl- or peptidyl-tRNA. Corresponding complexes of azido-tRNA with ribosomes and poly(U) were obtained both nonenzymatically and with the use of elongation factors. UV-irradiation of the complexes resulted in labelling of ribosomal proteins (preferentially of 30 S subunit). Proteins S9 and S21 were labelled only when the A-site was free; S14 - only when it was occupied; S11, S13, S19 - in both cases; S5, S7, S12, S20 - in some states.

  19. RNA tertiary interactions in the large ribosomal subunit: The A-minor motif

    Energy Technology Data Exchange (ETDEWEB)

    Nissen, Poul; Ippolito, Joseph A.; Ban, Nenad; Moore, Peter B.; Steitz, Thomas A. (Yale University); (Yale University); (Yale Unversity)

    2009-10-07

    Analysis of the 2.4-{angstrom} resolution crystal structure of the large ribosomal subunit from Haloarcula marismortui reveals the existence of an abundant and ubiquitous structural motif that stabilizes RNA tertiary and quaternary structures. This motif is termed the A-minor motif, because it involves the insertion of the smooth, minor groove edges of adenines into the minor groove of neighboring helices, preferentially at C-G base pairs, where they form hydrogen bonds with one or both of the 2' OHs of those pairs. A-minor motifs stabilize contacts between RNA helices, interactions between loops and helices, and the conformations of junctions and tight turns. The interactions between the 3' terminal adenine of tRNAs bound in either the A site or the P site with 23S rRNA are examples of functionally significant A-minor interactions. The A-minor motif is by far the most abundant tertiary structure interaction in the large ribosomal subunit; 186 adenines in 23S and 5S rRNA participate, 68 of which are conserved. It may prove to be the universally most important long-range interaction in large RNA structures.

  20. Purine and pyrimidine composition in 5S rRNA and its mutational significance

    Directory of Open Access Journals (Sweden)

    Subacius Sandra Maria Rodrigues

    1998-01-01

    Full Text Available Variations observed in 5S rRNA base compositions are almost entirely due to fixation of point mutations. As a consequence, 5S rRNA size has remained relatively constant during evolution and, therefore, dependencies among the four bases can be predicted. In order to characterize the nature and to determine the degree of such dependencies, correlation analysis followed by principal component factorial analysis was conducted on a large sample of 5S rRNA sequences. The results show that the purine and pyrimidine contents tend to remain constant, so that A + G = Kpur and C + U = Kpyr. The composition of the four bases expressed now by Kpur/Kpyr relationships is also constant (Ks. These relationships imply that the behavior of the mutations in the variable sites of the molecule follows rules imposed by the chemical nature of the bases involved. Consequently, transition mutations would be more favored than substitutions in transversion sites and also than insertion-deletion (rare in 5S rRNAs, since transitions would not significantly alter the values of the Ks-index.

  1. Traffic of interacting ribosomes on mRNA during protein synthesis: effects of chemo-mechanics of individual ribosomes

    CERN Document Server

    Basu, A; Basu, Aakash; Chowdhury, Debashish

    2006-01-01

    Many {\\it ribosomes} simultaneously move on the same messenger RNA (mRNA), each synthesizing a protein. In contrast to the earlier models, here {\\it we develope a ``unified'' theoretical model} that not only incorporates the {\\it mutual exclusions} of the interacting ribosomes, but also describes explicitly the mechano-chemistry of each of these individual cyclic machines during protein synthesis. Using a combination of analytical and numerical techniques of non-equilibrium statistical mechanics, we analyze the rates of protein synthesis and the spatio-temporal oraganization of the ribosomes in this model. We also predict how these properties would change with the changes in the rates of the various chemo-mechanical processes in each ribosome. Finally, we illustrate the power of this model by making experimentally testable predictions on the rates of protein synthesis and the density profiles of the ribosomes on some mRNAs in {\\it E-coli}.

  2. Direct regulation of tRNA and 5S rRNA gene transcription by Polo-like kinase 1.

    Science.gov (United States)

    Fairley, Jennifer A; Mitchell, Louise E; Berg, Tracy; Kenneth, Niall S; von Schubert, Conrad; Silljé, Herman H W; Medema, René H; Nigg, Erich A; White, Robert J

    2012-02-24

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase III (pol III) through direct binding and phosphorylation of transcription factor Brf1. During interphase, Plk1 promotes tRNA and 5S rRNA expression by phosphorylating Brf1 directly on serine 450. However, this stimulatory modification is overridden at mitosis, when elevated Plk1 activity causes Brf1 phosphorylation on threonine 270 (T270), which prevents pol III recruitment. Thus, although Plk1 enhances net tRNA and 5S rRNA production, consistent with its proliferation-stimulating function, it also suppresses untimely transcription when cells divide. Genomic instability is apparent in cells with Brf1 T270 mutated to alanine to resist Plk1-directed inactivation, suggesting that chromosome segregation is vulnerable to inappropriate pol III activity. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. [Study of the photoaffinity modification of Escherichia coli ribosomes near the donor tRNA-binding center].

    Science.gov (United States)

    Bausk, E V; Graĭfer, D M; Karpova, G G

    1985-01-01

    Affinity labelling of E. coli ribosomes near the donor tRNA-binding (P) site was studied with the use of photoreactive derivatives of tRNAPhe bearing arylazidogroups on N7 atoms of guanine residues (azido-tRNA). UV-irradiation of complexes 70S ribosome.poly(U).azido- tRNA(P-site) and 70S ribosome.poly(U).azido-tRNA(P-site).Phe- tRNAPhe(A-site) resulted in covalent attachment of azido-tRNA to ribosomes, both subunits being labelled. In both cases modification extent of 30S subunit was two-fold than that of the 50S one. It was shown that when the A-site was free the azido-tRNA located in P-site labelled proteins S9, S11, S12, S13, S21 and L14, L27, L31. Azido-tRNA located in P-site when the A-site was occupied with Phe-tRNAPhe labelled proteins S11, S12, S13, S14, S19, L32/L33 and possibly L23, L25. From the comparison of the sets of proteins labelled when A-site was free or occupied a conclusion was drawn that aminoacyl-tRNA located in ribosomal A-site affects the arrangement of deacylated tRNA in P-site. Data obtained allow to propose that proteins S5, S19, S20 and L24, L33 interact with guanine residues important for the tRNA tertiary structure formation.

  4. Removal of ribosomal subunits (and rRNA) from cytoplasmic extracts before solubilization with SDS and deproteinization.

    Science.gov (United States)

    Rio, Donald C; Ares, Manuel; Hannon, Gregory J; Nilsen, Timothy W

    2010-06-01

    More than 95% of total RNA is composed of ribosomal RNAs (rRNAs) (28S, 18S, 5.8S, and 5S). Here, we present a method that is effective in removing rRNA before extraction and purification of total RNA. If you choose to prepare cytoplasmic RNA and wish to analyze any RNA other than rRNA, it is desirable to eliminate the rRNAs by taking advantage of the fact that the ribosomal subunits are very large (40S and 60S). Few, if any, other cellular RNAs are present in such large macromolecular complexes. The vast majority of rRNAs can be removed by sedimentation. Of course, steps must be taken to avoid co-sedimentation of desired RNAs. Co-sedimentation can be greatly reduced by first dissociating ribosomes into their respective subunits by EDTA treatment. The subunits are then "cleaned" by treatment with high salt and nonionic detergent. Ribosomal subunits remain intact under these conditions and can be sedimented free of other RNAs. Subsequently, the remaining RNAs (messenger RNAs [mRNAs] and all other RNAs) can be purified and analyzed by a variety of methods.

  5. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    Energy Technology Data Exchange (ETDEWEB)

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna (Cornell); (UCB); (Duke)

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  6. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  8. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

    Science.gov (United States)

    Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

    2015-12-21

    5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  9. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    Science.gov (United States)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes--UtpA and UtpB--interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  10. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly.

    Science.gov (United States)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R; Kim, Kelly H; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-29

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes-UtpA and UtpB-interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  11. Cyclin-dependent kinase 9 links RNA polymerase II transcription to processing of ribosomal RNA.

    Science.gov (United States)

    Burger, Kaspar; Mühl, Bastian; Rohrmoser, Michaela; Coordes, Britta; Heidemann, Martin; Kellner, Markus; Gruber-Eber, Anita; Heissmeyer, Vigo; Strässer, Katja; Eick, Dirk

    2013-07-19

    Ribosome biogenesis is a process required for cellular growth and proliferation. Processing of ribosomal RNA (rRNA) is highly sensitive to flavopiridol, a specific inhibitor of cyclin-dependent kinase 9 (Cdk9). Cdk9 has been characterized as the catalytic subunit of the positive transcription elongation factor b (P-TEFb) of RNA polymerase II (RNAPII). Here we studied the connection between RNAPII transcription and rRNA processing. We show that inhibition of RNAPII activity by α-amanitin specifically blocks processing of rRNA. The block is characterized by accumulation of 3' extended unprocessed 47 S rRNAs and the entire inhibition of other 47 S rRNA-specific processing steps. The transcription rate of rRNA is moderately reduced after inhibition of Cdk9, suggesting that defective 3' processing of rRNA negatively feeds back on RNAPI transcription. Knockdown of Cdk9 caused a strong reduction of the levels of RNAPII-transcribed U8 small nucleolar RNA, which is essential for 3' rRNA processing in mammalian cells. Our data demonstrate a pivotal role of Cdk9 activity for coupling of RNAPII transcription with small nucleolar RNA production and rRNA processing.

  12. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    Science.gov (United States)

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  13. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  14. Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

    Directory of Open Access Journals (Sweden)

    Jin-Mei Feng

    Full Text Available BACKGROUND: 5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. METHODOLOGY/PRINCIPAL FINDINGS: By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi, and one free-living one (Naegleria gruberi. After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. CONCLUSION/SIGNIFICANCE: The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically

  15. Comparative Analysis of the 5S rRNA and Its Associated Proteins Reveals Unique Primitive Rather Than Parasitic Features in Giardia lamblia

    Science.gov (United States)

    Xin, De-Dong; Wen, Jian-Fan

    2012-01-01

    Background 5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. Methodology/Principal Findings By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. Conclusion/Significance The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features. PMID

  16. Defining 5S rRNA structure space: point mutation data can be used to predict the phenotype of multichange variants.

    Science.gov (United States)

    Nayar, Madhavi; Fox, George E

    2011-09-01

    A portion of the 5S ribosomal RNA (rRNA) structure space in the vicinity of the Vibrio proteolyticus 5S rRNA sequence is explored in detail with the intention of establishing principles that will allow a priori prediction of which sequences would be valid members of a particular RNA structure space. Four hundred and one sequence variants differing from the V. proteolyticus 5S rRNA wild-type sequence in 1-7 positions were characterized using an in vivo assay system. Most significantly, it was found that in general, the phenotypic effects of single changes were independent of the phenotypic effect of a second change. As a result, it was possible to use the new data in conjunction with results from prior studies of the same RNA to develop "truth tables" to predict which multiple change variants would be functional and which would be nonfunctional. The actual phenotype of 93.8% of the multichange variants studied was consistent with the predictions made using truth tables thereby providing for perhaps the first time an upper limit estimate of how frequent unexpected interactions are. It was also observed that single changes at positions involved in secondary structure were no more likely to be invalid than changes in other regions. In particular, internal changes in long standard stems were in fact almost always tolerated. Changes at positions that were hypervariable in the context of an alignment of related sequences were, as expected, usually found to be valid. However, the potential validity of changes that were idiosyncratic to a single lineage of related sequences when placed in the V. proteolyticus 5S rRNA context was unpredictable.

  17. Comparative chromosome mapping of U2 snRNA and 5S rRNA genes in Gymnotus species (Gymnotiformes, Gymnotidae): evolutionary dynamics and sex chromosome linkage in G . pantanal.

    Science.gov (United States)

    Utsunomia, Ricardo; Scacchetti, Priscilla C; Pansonato-Alves, José C; Oliveira, Claudio; Foresti, Fausto

    2014-01-01

    A comparative mapping of U2 small nuclear RNA (snRNA) and 5S ribosomal RNA (rRNA) genes was performed in 6 Gymnotus species. All species analyzed presented the U2 snDNA organized in conspicuous blocks and not co-located with rRNA genes. In addition, 5 species showed the U2 snDNA located in a single pair of chromosomes, which seems to be a conserved trait in this genus. Conversely, G. pantanal was the only species displaying several terminal signals in different chromosome pairs, including the X1 sex chromosome but not the Y chromosome. This is the first report of U2 snRNA genes in sex chromosomes of fishes. The absence of sites in the Y chromosome of G. pantanal indicates a possible loss of terminal segments of the chromosomes involved in the Y formation. © 2014 S. Karger AG, Basel.

  18. Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

    Science.gov (United States)

    Schnare, M N; Gray, M W

    1982-01-01

    In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

  19. tmRNA-SmpB: a journey to the centre of the bacterial ribosome.

    OpenAIRE

    Weis, Félix; Bron, Patrick; Giudice, Emmanuel; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-01-01

    International audience; Ribosomes mediate protein synthesis by decoding the information carried by messenger RNAs (mRNAs) and catalysing peptide bond formation between amino acids. When bacterial ribosomes stall on incomplete messages, the trans-translation quality control mechanism is activated by the transfer-messenger RNA bound to small protein B (tmRNA-SmpB ribonucleoprotein complex). Trans-translation liberates the stalled ribosomes and triggers degradation of the incomplete proteins. He...

  20. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  1. Evidence for several higher order structural elements in ribosomal RNA.

    Science.gov (United States)

    Woese, C R; Gutell, R R

    1989-05-01

    Comparative analysis of small subunit ribosomal RNA sequences suggests the existence of two new higher order interactions: (i) a double-helical structure involving positions 505-507 and 524-526 (Escherichia coli numbering) and (ii) an interaction between the region of position 130 and the helix located approximately between positions 180 and 195. In the first of these, one of the strands of the helix exists in the bulge loop, and the other strand exists in the terminal loop of a previously recognized compound helix involving positions 500-545. Therefore, the new structure formally represents a pseudoknot. In the second, the insertion/deletion of a nucleotide in the vicinity of position 130 correlates with the length of the helix in the 180-195 region, the latter having a 3-base-pair stalk when the base in question is deleted and a stalk of approximately 10 pairs when it is inserted.

  2. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae

    Directory of Open Access Journals (Sweden)

    Amina Kharrat-Souissi

    2012-08-01

    Full Text Available The Buffelgrass (Cenchrus ciliaris L., Poaceae is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA for pentaploid and hexaploid cytotypes of C. ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S, displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level. For three studied cytotypes (4x, 5x and 6x all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes.

  3. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    Science.gov (United States)

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

    2012-01-01

    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  4. A Pol V-mediated silencing, independent of RNA-directed DNA methylation, applies to 5S rDNA.

    Directory of Open Access Journals (Sweden)

    Julien Douet

    2009-10-01

    Full Text Available The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA-directed DNA methylation (RdDM, which also requires activities from RDR2 (RNA-Dependent RNA Polymerase 2, DCL3 (Dicer-Like 3, AGO4 (Argonaute, and DRM2 (Domains Rearranged Methyltransferase 2. RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA-encoding DNA (rDNA arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V-loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM-independent and comes specifically at chromosome 4, in addition to the RdDM pathway.

  5. Turnover of ribosomal RNA in mouse fibroblasts (3T3) in culture

    Energy Technology Data Exchange (ETDEWEB)

    Kolodny, G.M.

    1975-01-01

    Growing and confluent cultures of mouse fibroblasts were labeled with /sup 3/H-uridine and chased with an excess of nonradioactive uridine to investigate the turnover of ribosomal RNA. Growing cultures did not turn over their 18S and 28S ribosomal RNA; however, confluent cultures did show ribosomal RNA (rRNA) turnover. If the cells were labeled while growing and chased when confluent, 18S RNA displayed a two-component decay curve, while 28S RNA showed only single-component decay, similar in lifetime to the first component of the 18S RNA decay curve. If the cells were labeled while confluent, both the 18S and 28S RNA showed single-component decay curves with a lifetime possibly only slightly longer than the lifetime of the first component of the 18S RNA and the single component of the 28S RNA of the cultures labeled while growing.

  6. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    Science.gov (United States)

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  7. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. © 2013 Elsevier Inc. All rights reserved.

  8. tmRNA-SmpB: a journey to the centre of the bacterial ribosome.

    Science.gov (United States)

    Weis, Félix; Bron, Patrick; Giudice, Emmanuel; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-11-17

    Ribosomes mediate protein synthesis by decoding the information carried by messenger RNAs (mRNAs) and catalysing peptide bond formation between amino acids. When bacterial ribosomes stall on incomplete messages, the trans-translation quality control mechanism is activated by the transfer-messenger RNA bound to small protein B (tmRNA-SmpB ribonucleoprotein complex). Trans-translation liberates the stalled ribosomes and triggers degradation of the incomplete proteins. Here, we present the cryo-electron microscopy structures of tmRNA-SmpB accommodated or translocated into stalled ribosomes. Two atomic models for each state are proposed. This study reveals how tmRNA-SmpB crosses the ribosome and how, as the problematic mRNA is ejected, the tmRNA resume codon is placed onto the ribosomal decoding site by new contacts between SmpB and the nucleotides upstream of the tag-encoding sequence. This provides a structural basis for the transit of the large tmRNA-SmpB complex through the ribosome and for the means by which the tmRNA internal frame is set for translation to resume.

  9. The conserved endoribonuclease YbeY is required for chloroplast ribosomal RNA processing in Arabidopsis.

    Science.gov (United States)

    Liu, Jinwen; Zhou, Wenbin; Liu, Guifeng; Yang, Chuanping; Sun, Yi; Wu, Wenjuan; Cao, Shenquan; Wang, Chong; Hai, Guanghui; Wang, Zhifeng; Bock, Ralph; Huang, Jirong; Cheng, Yuxiang

    2015-05-01

    Maturation of chloroplast ribosomal RNAs (rRNAs) comprises several endoribonucleolytic and exoribonucleolytic processing steps. However, little is known about the specific enzymes involved and the cleavage steps they catalyze. Here, we report the functional characterization of the single Arabidopsis (Arabidopsis thaliana) gene encoding a putative YbeY endoribonuclease. AtYbeY null mutants are seedling lethal, indicating that AtYbeY function is essential for plant growth. Knockdown plants display slow growth and show pale-green leaves. Physiological and ultrastructural analyses of atybeY mutants revealed impaired photosynthesis and defective chloroplast development. Fluorescent microcopy analysis showed that, when fused with the green fluorescence protein, AtYbeY is localized in chloroplasts. Immunoblot and RNA gel-blot assays revealed that the levels of chloroplast-encoded subunits of photosynthetic complexes are reduced in atybeY mutants, but the corresponding transcripts accumulate normally. In addition, atybeY mutants display defective maturation of both the 5' and 3' ends of 16S, 23S, and 4.5S rRNAs as well as decreased accumulation of mature transcripts from the transfer RNA genes contained in the chloroplast rRNA operon. Consequently, mutant plants show a severe deficiency in ribosome biogenesis, which, in turn, results in impaired plastid translational activity. Furthermore, biochemical assays show that recombinant AtYbeY is able to cleave chloroplast rRNAs as well as messenger RNAs and transfer RNAs in vitro. Taken together, our findings indicate that AtYbeY is a chloroplast-localized endoribonuclease that is required for chloroplast rRNA processing and thus for normal growth and development.

  10. rRNA maturation as a "quality" control step in ribosomal subunit assembly in Dictyostelium discoideum.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S; Bulfone, S

    1997-10-31

    In Dictyostelium discoideum, newly assembled ribosomal subunits enter polyribosomes while they still contain immature rRNA. rRNA maturation requires the engagement of the subunits in protein synthesis and leads to stabilization of their structure. Maturation of pre-17 S rRNA occurs only after the newly formed 40 S ribosomal particle has entered an 80 S ribosome and participated at least in the formation of one peptide bond or in one translocation event; maturation of pre-26 S rRNA requires the presence on the 80 S particle of a peptidyl-tRNA containing at least 6 amino acids. Newly assembled particles that cannot fulfill these requirements for structural reasons are disassembled into free immature rRNA and ribosomal proteins.

  11. Regulation of the rplY gene encoding 5S rRNA binding protein L25 in Escherichia coli and related bacteria.

    Science.gov (United States)

    Aseev, Leonid V; Bylinkina, Natalia S; Boni, Irina V

    2015-05-01

    Ribosomal protein (r-protein) L25 is one of the three r-proteins (L25, L5, L18) that interact with 5S rRNA in eubacteria. Specific binding of L25 with a certain domain of 5S r-RNA, a so-called loop E, has been studied in detail, but information about regulation of L25 synthesis has remained totally lacking. In contrast to the rplE (L5) and rplR (L18) genes that belong to the polycistronic spc-operon and are regulated at the translation level by r-protein S8, the rplY (L25) gene forms an independent transcription unit. The main goal of this work was to study the regulation of the rplY expression in vivo. We show that the rplY promoter is down-regulated by ppGpp and its cofactor DksA in response to amino acid starvation. At the level of translation, the rplY expression is subjected to the negative feedback control. The 5'-untranslated region of the rplY mRNA comprises specific sequence/structure features, including an atypical SD-like sequence, which are highly conserved in a subset of gamma-proteobacterial families. Despite the lack of a canonical SD element, the rplY'-'lacZ single-copy reporter showed unusually high translation efficiency. Expression of the rplY gene in trans decreased the translation yield, indicating the mechanism of autogenous repression. Site-directed mutagenesis of the rplY 5' UTR revealed an important role of the conserved elements in the translation control. Thus, the rplY expression regulation represents one more example of regulatory pathways that control ribosome biogenesis in Escherichia coli and related bacteria. © 2015 Aseev et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  12. Dynamics of translation by single ribosomes through mRNA secondary structures

    OpenAIRE

    Chen, Chunlai; Zhang, Haibo; Broitman, Steven L.; Reiche, Michael; Farrell, Ian; Cooperman, Barry S.; Goldman, Yale E.

    2013-01-01

    During protein synthesis, the ribosome translates nucleotide triplets in single-stranded mRNA into polypeptide sequences. Strong downstream mRNA secondary (2°) structures, which must be unfolded for translation, can slow or even halt protein synthesis. Here we employ single molecule fluorescence resonance energy transfer to determine reaction rates for specific steps within the elongation cycle as the Escherichia coli ribosome encounters stem loop or pseudoknot mRNA 2° structures. Downstream ...

  13. Identification of Swertia mussotii and its adulterant Swertia species by 5S rRNA gene spacer.

    Science.gov (United States)

    Yu, Man-Tang; Wong, Ka-Lok; Zong, Yu-Ying; Shaw, Pang-Chui; Che, Chun-Tao

    2008-03-01

    This research focused on analyzing the differences of 5S rRNA gene spacer sequences on Swertia mussotii and its commonly used adulterants, including S. franchetiana, S. wolfangiana and S. chirayita. DNA was extracted from the collected Swertia samples. 5S rRNA intergenic spacers were amplified by PCR, sequenced and analyzed. 5S rRNA gene spacer sequences were different between S. mussotii and its other three adulterants. Sequence divergence among species ranged from 30.6% to 65.0%. 5S rRNA spacers may be used as molecular authentication markers to differentiate S. mussotii and other commonly used Swertia adulterants. This result provides reliable and simple reference for the authentication of Swertia genus species.

  14. Specialized yeast ribosomes: a customized tool for selective mRNA translation.

    Directory of Open Access Journals (Sweden)

    Johann W Bauer

    Full Text Available Evidence is now accumulating that sub-populations of ribosomes - so-called specialized ribosomes - can favour the translation of subsets of mRNAs. Here we use a large collection of diploid yeast strains, each deficient in one or other copy of the set of ribosomal protein (RP genes, to generate eukaryotic cells carrying distinct populations of altered 'specialized' ribosomes. We show by comparative protein synthesis assays that different heterologous mRNA reporters based on luciferase are preferentially translated by distinct populations of specialized ribosomes. These mRNAs include reporters carrying premature termination codons (PTC thus allowing us to identify specialized ribosomes that alter the efficiency of translation termination leading to enhanced synthesis of the wild-type protein. This finding suggests that these strains can be used to identify novel therapeutic targets in the ribosome. To explore this further we examined the translation of the mRNA encoding the extracellular matrix protein laminin β3 (LAMB3 since a LAMB3-PTC mutant is implicated in the blistering skin disease Epidermolysis bullosa (EB. This screen identified specialized ribosomes with reduced levels of RP L35B as showing enhanced synthesis of full-length LAMB3 in cells expressing the LAMB3-PTC mutant. Importantly, the RP L35B sub-population of specialized ribosomes leave both translation of a reporter luciferase carrying a different PTC and bulk mRNA translation largely unaltered.

  15. Choreography of molecular movements during ribosome progression along mRNA.

    Science.gov (United States)

    Belardinelli, Riccardo; Sharma, Heena; Caliskan, Neva; Cunha, Carlos E; Peske, Frank; Wintermeyer, Wolfgang; Rodnina, Marina V

    2016-04-01

    During translation elongation, ribosome translocation along an mRNA entails rotations of the ribosomal subunits, swiveling motions of the small subunit (SSU) head and stepwise movements of the tRNAs together with the mRNA. Here, we reconstructed the choreography of the collective motions of the Escherichia coli ribosome during translocation promoted by elongation factor EF-G, by recording the fluorescence signatures of nine different reporters placed on both ribosomal subunits, tRNA and mRNA. We captured an early forward swiveling of the SSU head taking place while the SSU body rotates in the opposite, clockwise direction. Backward swiveling of the SSU head starts upon tRNA translocation and continues until the post-translocation state is reached. This work places structures of translocation intermediates along a time axis and unravels principles of the motions of macromolecular machines.

  16. Translation by polysome: theory of ribosome profile on a single mRNA transcript

    CERN Document Server

    Sharma, Ajeet K

    2011-01-01

    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called {\\it translation}. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, {\\it polysome}). Experimentally measured {\\it polysome profile} gives the distribution of polysome {\\it sizes}. Recently a breakthrough in determining the instantaneous {\\it positions} of the ribosomes on a given mRNA track has been achieved and the technique is called {\\it ribosome profiling} \\cite{ingolia10,guo10}. Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere \\cite{sharma11}. This extended version of our model incorporates not only (i) mechano-chemical cycle of indivi...

  17. The human Shwachman-Diamond syndrome protein, SBDS, associates with ribosomal RNA.

    Science.gov (United States)

    Ganapathi, Karthik A; Austin, Karyn M; Lee, Chung-Sheng; Dias, Anusha; Malsch, Maggie M; Reed, Robin; Shimamura, Akiko

    2007-09-01

    Shwachman-Diamond syndrome (SDS) is an autosomal recessive disorder characterized by bone marrow failure, exocrine pancreatic dysfunction, and leukemia predisposition. Mutations in the SBDS gene are identified in most patients with SDS. SBDS encodes a highly conserved protein of unknown function. Data from SBDS orthologs suggest that SBDS may play a role in ribosome biogenesis or RNA processing. Human SBDS is enriched in the nucleolus, the major cellular site of ribosome biogenesis. Here we report that SBDS nucleolar localization is dependent on active rRNA transcription. Cells from patients with SDS or Diamond-Blackfan anemia are hypersensitive to low doses of actinomycin D, an inhibitor of rRNA transcription. The addition of wild-type SBDS complements the actinomycin D hypersensitivity of SDS patient cells. SBDS migrates together with the 60S large ribosomal subunit in sucrose gradients and coprecipitates with 28S ribosomal RNA (rRNA). Loss of SBDS is not associated with a discrete block in rRNA maturation or with decreased levels of the 60S ribosomal subunit. SBDS forms a protein complex with nucleophosmin, a multifunctional protein implicated in ribosome biogenesis and leukemogenesis. Our studies support the addition of SDS to the growing list of human bone marrow failure syndromes involving the ribosome.

  18. Modeling of ribosome dynamics on a ds-mRNA under an external load

    Science.gov (United States)

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid

    2016-07-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  19. Modeling of Ribosome Dynamics on a ds-mRNA under an External Load

    CERN Document Server

    Shakiba, Bahareh; Mohammad-Rafiee, Farshid

    2016-01-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force, and translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  20. Proteins associated with rRNA in the Escherichia coli ribosome.

    Science.gov (United States)

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  1. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    Science.gov (United States)

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  2. A ribonucleoprotein fragment of the 30 S ribosome of E. coli containing two contiguous domains of the 16 S RNA.

    Science.gov (United States)

    Spitnik-Elson, P; Elson, D; Avital, S; Abramowitz, R

    1982-08-11

    Ribonucleoprotein fragments of the 30 S ribosome of E. coli have been prepared by limited ribonuclease digestion and mild heating of the ribosome in a constant ionic environment. One such fragment has been described previously. A second electrophoretically homogeneous fragment has now been isolated and its RNA and protein moieties have been characterized. It contains the 5' half of the 16 S RNA, encompassing domains I and II except for the extreme 5' terminus and several small gaps. Seven proteins are present: S4, S5, S6, S8, S12, S15 and S20. The RNA binding sites of five of these proteins are known, and all are RNA sequences that are present in the fragment. Published neutron scattering and immuno-electron microscopic data indicate that six of the proteins are clustered together in a cross sectional slice through the center of the subunit. After deproteinization, the RNA moiety gives two bands in gel electrophoresis, one containing domains I and II and the other, essentially only domain II. The former, although larger, migrates faster in gel electrophoresis, indicating that RNA domains I and II interact with each other in such a way as to become more compact than domain II by itself.

  3. Characterisation of RNA fragments obtained by mild nuclease digestion of 30-S ribosomal subunits from Escherichia coli.

    Science.gov (United States)

    Rinke, J; Ross, A; Brimacombe, R

    1977-06-01

    When Escherichia coli 30-S ribosomal subunits are hydrolysed under mild conditions, two ribonucleoprotein fragments of unequal size are produced. Knowledge of the RNA sequences contained in these hydrolysis products was required for the experiments described in the preceding paper, and the RNA sub-fragments have therefore been examined by oligonucleotide analysis. Two well-defined small fragments of free RNA, produced concomitantly with the ribonucleoprotein fragments, were also analysed. The larger ribonucleoprotein fragment, containing predominantly proteins S4, S5, S8, S15, S16 (17) and S20, contains a complex mixture of RNA sub-fragments varying from about 100 to 800 nucleotides in length. All these fragments arose from the 5'-terminal 900 nucleotides of 16-S RNA, corresponding to the well-known 12-S fragment. No long-range interactions could be detected within this RNA region in these experiments. The RNA from the smaller ribonucleoprotein fragment (containing proteins S7, S9 S10, S14 and S19) has been described in detail previously, and consists of about 450 nucleotides near the 3' end of the 16-S RNA, but lacking the 3'-terminal 150 nucleotides. The two small free RNA fragments (above) partly account for these missing 150 nucleotides; both fragments arose from section A of the 16-S RNA, but section J (the 3'-terminal 50 nucleotides) was not found. This result suggests that the 3' region of 16-S RNA is not involved in stable interactions with protein.

  4. What do we know about ribosomal RNA methylation in Escherichia coli?

    Science.gov (United States)

    Sergeeva, O V; Bogdanov, A A; Sergiev, P V

    2015-10-01

    A ribosome is a ribonucleoprotein that performs the synthesis of proteins. Ribosomal RNA of all organisms includes a number of modified nucleotides, such as base or ribose methylated and pseudouridines. Methylated nucleotides are highly conserved in bacteria and some even universally. In this review we discuss available data on a set of modification sites in the most studied bacteria, Escherichia coli. While most rRNA modification enzymes are known for this organism, the function of the modified nucleotides is rarely identified.

  5. Ribosome collisions and Translation efficiency: Optimization by codon usage and mRNA destabilization

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-01-01

    Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation...... process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome...... collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of m...

  6. A critical role for the non-coding 5S rRNA in regulating Mdmx stability

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2013-01-01

    Summary Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most of cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2 whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal an critical role of noncoding 5S rRNA in modulating the p53-Mdmx axis. PMID:21925390

  7. A new model for the three-dimensional folding of Escherichia coli 16 S ribosomal RNA. II. The RNA-protein interaction data.

    Science.gov (United States)

    Mueller, F; Brimacombe, R

    1997-08-29

    The map of the mass centres of the 21 proteins from the Escherichia coli 30 S ribosomal subunit, as determined by neutron scattering, was fitted to a cryoelectron microscopic (cryo-EM) model at a resolution of 20 A of 70 S ribosomes in the pre-translocational state, carrying tRNA molecules at the A and P sites. The fit to the 30 S moiety of the 70 S particles was accomplished with the help of the well-known distribution of the ribosomal proteins in the head, body and side lobe regions of the 30 S subunit, as determined by immuno electron microscopy (IEM). Most of the protein mass centres were found to lie close to the surface (or even outside) of the cryo-EM contour of the 30 S subunit, supporting the idea that the ribosomal proteins are arranged peripherally around the rRNA. The ribosomal protein distribution was then compared with the corresponding model for the 16 S rRNA, fitted to the same EM contour (described in an accompanying paper), in order to analyse the mutual compatibility of the arrangement of proteins and rRNA in terms of the available RNA-protein interaction data. The information taken into account included the hydroxyl radical and base foot-printing data from Noller's laboratory, and our own in situ cross-linking results. Proteins S1 and S14 were not considered, due to the lack of RNA-protein data. Among the 19 proteins analysed, 12 (namely S2, S4, S5, S7, S8, S9, S10, S11, S12, S15, S17 and S21) showed a fit to the rRNA model that varied from being excellent to at least acceptable. Of the remaining 7, S3 and S13 showed a rather poor fit, as did S18 (which is considered in combination with S6 in the foot-printing experiments). S16 was difficult to evaluate, as the foot-print data for this protein cover a large area of the rRNA. S19 and S20 showed a bad fit in terms of the neutron map, but their foot-print and cross-link sites were clustered into compact groups in the rRNA model in those regions of the 30 S subunit where these proteins have

  8. Chromosome mapping of H1 histone and 5S rRNA gene clusters in three species of Astyanax (Teleostei, Characiformes).

    Science.gov (United States)

    Hashimoto, D T; Ferguson-Smith, M A; Rens, W; Foresti, F; Porto-Foresti, F

    2011-01-01

    We report here on the physical mapping of the H1 histone genes (hisDNA) and the 5S ribosomal DNA (rDNA) in 3 Neotropical fish species of the genus Astyanax(A. altiparanae, A. bockmanni and A. fasciatus) and the comparative analysis of the chromosomes bearing these genes. Nucleotide analyses by sequencing of both genes were also performed. The distribution of the H1 histone genes was more conserved than that of the rRNA genes, since these were always located in the pericentromeric regions of 2 chromosome pairs. 5S rDNA was found on one of the pairs that presented an H1 histone cluster; this seems to be a conserved chromosomal feature of the genus Astyanax. In addition, individuals of A. bockmanni and A. fasciatus showed clusters of 5S rDNA on 1 pair of acrocentric chromosomes, not found in A. altiparanae. The results obtained by chromosome mapping as well as by sequencing of both genes showed that A.bockmanni is more closely related to A. fasciatus than to A. altiparanae. The results allow the characterization of cytogenetic markers for improved elucidation of the processes involved in karyotype differentiation of fish genomes. Copyright © 2011 S. Karger AG, Basel.

  9. Nucleotide sequence of a crustacean 18S ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs.

    Science.gov (United States)

    Nelles, L; Fang, B L; Volckaert, G; Vandenberghe, A; De Wachter, R

    1984-12-11

    The primary structure of the gene for 18 S rRNA of the crustacean Artemia salina was determined. The sequence has been aligned with 13 other small ribosomal subunit RNA sequences of eukaryotic, archaebacterial, eubacterial, chloroplastic and plant mitochondrial origin. Secondary structure models for these RNAs were derived on the basis of previously proposed models and additional comparative evidence found in the alignment. Although there is a general similarity in the secondary structure models for eukaryotes and prokaryotes, the evidence seems to indicate a different topology in a central area of the structures.

  10. Dynamics of translation by single ribosomes through mRNA secondary structures.

    Science.gov (United States)

    Chen, Chunlai; Zhang, Haibo; Broitman, Steven L; Reiche, Michael; Farrell, Ian; Cooperman, Barry S; Goldman, Yale E

    2013-05-01

    During protein synthesis, the ribosome translates nucleotide triplets in single-stranded mRNA into polypeptide sequences. Strong downstream mRNA secondary structures, which must be unfolded for translation, can slow or even halt protein synthesis. Here we used single-molecule fluorescence resonance energy transfer to determine reaction rates for specific steps within the elongation cycle as the Escherichia coli ribosome encounters stem-loop or pseudoknot mRNA secondary structures. Downstream stem-loops containing 100% GC base pairs decrease the rates of both tRNA translocation within the ribosome and deacylated tRNA dissociation from the ribosomal exit site (E site). Downstream stem-loops or pseudoknots containing both GC and AU pairs also decrease the rate of tRNA dissociation, but they have little effect on tRNA translocation rate. Thus, somewhat unexpectedly, unfolding of mRNA secondary structures is more closely coupled to E-site tRNA dissociation than to tRNA translocation.

  11. Ribosomal protein S7 from Escherichia coli uses the same determinants to bind 16S ribosomal RNA and its messenger RNA.

    Science.gov (United States)

    Robert, F; Brakier-Gingras, L

    2001-02-01

    Ribosomal protein S7 from Escherichia coli binds to the lower half of the 3' major domain of 16S rRNA and initiates its folding. It also binds to its own mRNA, the str mRNA, and represses its translation. Using filter binding assays, we show in this study that the same mutations that interfere with S7 binding to 16S rRNA also weaken its affinity for its mRNA. This suggests that the same protein regions are responsible for mRNA and rRNA binding affinities, and that S7 recognizes identical sequence elements within the two RNA targets, although they have dissimilar secondary structures. Overexpression of S7 is known to inhibit bacterial growth. This phenotypic growth defect was relieved in cells overexpressing S7 mutants that bind poorly the str mRNA, confirming that growth impairment is controlled by the binding of S7 to its mRNA. Interestingly, a mutant with a short deletion at the C-terminus of S7 was more detrimental to cell growth than wild-type S7. This suggests that the C-terminal portion of S7 plays an important role in ribosome function, which is perturbed by the deletion.

  12. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    Science.gov (United States)

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  13. A ribonuclease-resistant region of 5S RNA and its relation to the RNA binding sites of proteins L18 and L25

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A; Wagner, R

    1979-01-01

    An RNA fragment, constituting three subfragments of nucleotide sequences 1-11, 69-87 and 89-120, is the most ribonuclease-resistant part of the native 5S RNA of Escherichia coli, at 0 degrees C. A smaller fragment of nucleotide sequence 69-87 and 90-110 is ribonuclease-resistant at 25 degrees....... Degradation of the L25-5S RNA complex with ribonuclease A or T2 yielded RNA fragments similar to those of the free 5S RNA at 0 degrees C and 25 degrees C; moreover L25 remained strongly bound to both RNA fragments and also produced some opening of the RNA structure in at least two positions. Protein L18...... initially protected most of the 5S RNA against ribonuclease digestion, at 0 degrees C, but was then gradually released prior to the formation of the larger RNA fragment. It cannot be concluded, therefore, as it was earlier (Gray et al., 1973), that this RNA fragment contains the primary binding site of L18....

  14. Cerastoderma glaucum 5S ribosomal DNA: characterization of the repeat unit, divergence with respect to Cerastoderma edule, and PCR-RFLPs for the identification of both cockles.

    Science.gov (United States)

    Freire, Ruth; Insua, Ana; Méndez, Josefina

    2005-06-01

    The 5S rDNA repeat unit of the cockle Cerastoderma glaucum from the Mediterranean and Baltic coasts was PCR amplified and sequenced. The length of the units was 539-568 bp, of which 120 bp were assigned to the 5S rRNA gene and 419-448 bp to the spacer region, and the G/C content was 46%-49%, 54%, and 44%-47%, respectively. Two types of units (A and B), differing in the spacer, were distinguished based on the percentage of differences and clustering in phylogenetic trees. A PCR assay with specific primers for each unit type indicated that the occurrence of both units is not restricted to the sequenced individuals. The 5S rDNA units of C. glaucum were compared with new and previously reported sequences of Cerastoderma edule. The degree of variation observed in C. edule was lower than that in C. glaucum and evidence for the existence of units A and B in C. edule was not found. The two cockles have the same coding region but displayed numerous fixed differences in the spacer region and group separately in the phylogenetic trees. Digestion of the 5S rDNA PCR product with the restriction enzymes HaeIII and EcoRV revealed two RFLPs useful for cockle identification.

  15. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...

  16. Classification of methanogenic bacteria by 16S ribosomal RNA characterization

    Energy Technology Data Exchange (ETDEWEB)

    Fox, G.E.; Magrum, L.J.; Balch, W.E.; Wolfe, R.S.; Woese, C.R.

    1977-10-01

    The 16S ribosomal RNAs from 10 species of methanogenic bacteria have been characterized in terms of the oligonucleotides produced by T/sub 1/ RNase digestion. Comparative analysis of these data reveals the methanogens to constitute a distinct phylogenetic group containing two major divisions. These organisms appear to be only distantly related to typical bacteria.

  17. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    DEFF Research Database (Denmark)

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

  18. Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

    Science.gov (United States)

    Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

    2014-05-04

    The tomato (Solanum lycopersicum) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

  19. Molecular Hybridization of Iodinated 4S, 5S, and 18S + 28S RNA to Salamander Chromosomes

    National Research Council Canada - National Science Library

    Pedro E. León

    1976-01-01

    4S, 5S, and 18S + 28S RNA from the newt Taricha granulosa granulosa were iodinated in vitro with carrier-free 125I and hybridized to the denatured chromosomes of Taricha granulosa and Batrachoseps wrighti. Iodinated 18S...

  20. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on peptide bond...

  1. The Expression of Antibiotic Resistance Methyltransferase Correlates with mRNA Stability Independently of Ribosome Stalling.

    Science.gov (United States)

    Dzyubak, Ekaterina; Yap, M N

    2016-12-01

    Members of the Erm methyltransferase family modify 23S rRNA of the bacterial ribosome and render cross-resistance to macrolides and multiple distantly related antibiotics. Previous studies have shown that the expression of erm is activated when a macrolide-bound ribosome stalls the translation of the leader peptide preceding the cotranscribed erm Ribosome stalling is thought to destabilize the inhibitory stem-loop mRNA structure and exposes the erm Shine-Dalgarno (SD) sequence for translational initiation. Paradoxically, mutations that abolish ribosome stalling are routinely found in hyper-resistant clinical isolates; however, the significance of the stalling-dead leader sequence is largely unknown. Here, we show that nonsense mutations in the Staphylococcus aureus ErmB leader peptide (ErmBL) lead to high basal and induced expression of downstream ErmB in the absence or presence of macrolide concomitantly with elevated ribosome methylation and resistance. The overexpression of ErmB is associated with the reduced turnover of the ermBL-ermB transcript, and the macrolide appears to mitigate mRNA cleavage at a site immediately downstream of the ermBL SD sequence. The stabilizing effect of antibiotics on mRNA is not limited to ermBL-ermB; cationic antibiotics representing a ribosome-stalling inducer and a noninducer increase the half-life of specific transcripts. These data unveil a new layer of ermB regulation and imply that ErmBL translation or ribosome stalling serves as a "tuner" to suppress aberrant production of ErmB because methylated ribosome may impose a fitness cost on the bacterium as a result of misregulated translation.

  2. Extraction of ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial community

    NARCIS (Netherlands)

    Duarte, G.F.; Rosado, A.S.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    1998-01-01

    A method for the indirect (cell extraction followed by nucleic acid extraction) isolation of bacterial ribosomal RNA (rRNA) and genomic DNA from soil was developed. The protocol allowed for the rapid parallel extraction of genomic DNA as well as small and large ribosomal subunit RNA from four soils

  3. Extraction of ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial community

    NARCIS (Netherlands)

    Duarte, G.F.; Rosado, A.S.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    1998-01-01

    A method for the indirect (cell extraction followed by nucleic acid extraction) isolation of bacterial ribosomal RNA (rRNA) and genomic DNA from soil was developed. The protocol allowed for the rapid parallel extraction of genomic DNA as well as small and large ribosomal subunit RNA from four soils

  4. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Science.gov (United States)

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  5. Flipping of the ribosomal A-site adenines provides a basis for tRNA selection

    Science.gov (United States)

    Zeng, Xiancheng; Chugh, Jeetender; Casiano-Negroni, Anette; Al-Hashimi, Hashim M.; Brooks, Charles L.

    2014-01-01

    Ribosomes control the missense error rate of ~10−4 during translation though quantitative contributions of individual mechanistic steps of the conformational changes yet to be fully determined. Biochemical and biophysical studies led to a qualitative tRNA selection model in which ribosomal A-site residues A1492 and A1493 (A1492/3) flip out in response to cognate tRNA binding, promoting the subsequent reactions, but not in the case of near cognate or non-cognate tRNA. However, this model was recently questioned by X-ray structures revealing conformations of extrahelical A1492/3 and domain closure of the decoding center in both cognate and near-cognate tRNA bound ribosome complexes, suggesting that the non-specific flipping of A1492/3 has no active role in tRNA selection. We explore this question by carrying out molecular dynamics (MD) simulations, aided with fluorescence and NMR experiments, to probe the free energy cost of extrahelical flipping of 1492/3 and the strain energy associated with domain conformational change. Our rigorous calculations demonstrate that the A1492/3 flipping is indeed a specific response to the binding of cognate tRNA, contributing 3 kcal/mol to the specificity of tRNA selection. Furthermore, the different A-minor interactions in cognate and near-cognate complexes propagate into the conformational strain and contribute another 4 kcal/mol in domain closure. The recent structure of ribosome with features of extrahelical A1492/3 and closed domain in near-cognate complex is reconciled by possible tautomerization of the wobble base pair in mRNA-tRNA. These results quantitatively rationalize other independent experimental observations and explain the ribosomal discrimination mechanism of selecting cognate versus near-cognate tRNA. PMID:24813122

  6. A detailed view of a ribosomal active site: the structure of the L11-RNA complex.

    Science.gov (United States)

    Wimberly, B T; Guymon, R; McCutcheon, J P; White, S W; Ramakrishnan, V

    1999-05-14

    We report the crystal structure of a 58 nucleotide fragment of 23S ribosomal RNA bound to ribosomal protein L11. This highly conserved ribonucleoprotein domain is the target for the thiostrepton family of antibiotics that disrupt elongation factor function. The highly compact RNA has both familiar and novel structural motifs. While the C-terminal domain of L11 binds RNA tightly, the N-terminal domain makes only limited contacts with RNA and is proposed to function as a switch that reversibly associates with an adjacent region of RNA. The sites of mutations conferring resistance to thiostrepton and micrococcin line a narrow cleft between the RNA and the N-terminal domain. These antibiotics are proposed to bind in this cleft, locking the putative switch and interfering with the function of elongation factors.

  7. Elucidation of pathways of ribosomal RNA degradation: an essential role for RNase E

    Science.gov (United States)

    Sulthana, Shaheen; Basturea, Georgeta N.; Deutscher, Murray P.

    2016-01-01

    Although normally stable in growing cells, ribosomal RNAs are degraded under conditions of stress, such as starvation, and in response to misassembled or otherwise defective ribosomes in a process termed RNA quality control. Previously, our laboratory found that large fragments of 16S and 23S rRNA accumulate in strains lacking the processive exoribonucleases RNase II, RNase R, and PNPase, implicating these enzymes in the later steps of rRNA breakdown. Here, we define the pathways of rRNA degradation in the quality control process and during starvation, and show that the essential endoribonuclease, RNase E, is required to make the initial cleavages in both degradative processes. We also present evidence that explains why the exoribonuclease, RNase PH, is required to initiate the degradation of rRNA during starvation. The data presented here provide the first detailed description of rRNA degradation in bacterial cells. PMID:27298395

  8. Counterselection of prokaryotic ribosomal RNA during reverse transcription using non-random hexameric oligonucleotides.

    Science.gov (United States)

    Gonzalez, J M; Robb, F T

    2007-12-01

    Ribosomal RNA (rRNA) is the major component in total RNA extracts, interfering with the synthesis of cDNA corresponding to messenger RNA (mRNA). In this study, we present a novel strategy for selectively discriminating against rRNA and favoring mRNA from prokaryotes during synthesis of cDNA by reverse transcriptase. Our technique is based on the fact that rRNA sequences, in many species, are G+C rich relative to the genome at large, and highly conserved among prokaryotes. The sequence TTTT is therefore rarely found in rRNA sequences. However, TTTT priming sites are found at a much higher frequency in protein-encoding gene sequences. We designed specific hexamers (HD/DHTTTT) to prime reverse transcription reactions resulting in a selective synthesis of cDNA corresponding to mRNA from prokaryotic total RNA extractions.

  9. Ribosomal RNA and protein transcripts persist in the cysts of Entamoeba invadens.

    Science.gov (United States)

    Ojha, Sandeep; Ahamad, Jamaluddin; Bhattacharya, Alok; Bhattacharya, Sudha

    2014-06-01

    In most organisms rDNA transcription ceases under conditions of growth stress. However, we have earlier shown that pre-rRNA accumulates during encystation in Entamoeba invadens. We labeled newly-synthesized rRNA during encystation, with [methyl-(3)H] methionine in the presence of chitinase to enable uptake of isotope. Incorporation rate reduced after 24h, and then increased to reach levels comparable with normal cells. The label was rapidly chased to the ribosomal pellet in dividing cells, while at late stages of encystation the ratio of counts going to the pellet dropped 3-fold. The transcript levels of selected ribosomal protein genes also went down initially but went up again at later stages of encystation. This suggested that rRNA and ribosomal protein transcription may be coordinately regulated. Our data shows that encysting E. invadens cells accumulate transcripts of both the RNA and protein components of the ribosome, which may ensure rapid synthesis of new ribosomes when growth resumes.

  10. Basic Mechanisms in RNA Polymerase I Transcription of the Ribosomal RNA Genes

    Science.gov (United States)

    Goodfellow, Sarah J.; Zomerdijk, Joost C. B. M.

    2013-01-01

    RNA Polymerase (Pol) I produces ribosomal (r)RNA, an essential component of the cellular protein synthetic machinery that drives cell growth, underlying many fundamental cellular processes. Extensive research into the mechanisms governing transcription by Pol I has revealed an intricate set of control mechanisms impinging upon rRNA production. Pol I-specific transcription factors guide Pol I to the rDNA promoter and contribute to multiple rounds of transcription initiation, promoter escape, elongation and termination. In addition, many accessory factors are now known to assist at each stage of this transcription cycle, some of which allow the integration of transcriptional activity with metabolic demands. The organisation and accessibility of rDNA chromatin also impinge upon Pol I output, and complex mechanisms ensure the appropriate maintenance of the epigenetic state of the nucleolar genome and its effective transcription by Pol I. The following review presents our current understanding of the components of the Pol I transcription machinery, their functions and regulation by associated factors, and the mechanisms operating to ensure the proper transcription of rDNA chromatin. The importance of such stringent control is demonstrated by the fact that deregulated Pol I transcription is a feature of cancer and other disorders characterised by abnormal translational capacity. PMID:23150253

  11. Comment on "Length-dependent translation of messenger RNA by ribosomes"

    CERN Document Server

    Zhang, Yunxin

    2011-01-01

    In recent paper [Phys. Rev. E {\\bf 83}, 042903 (2011)], a simple model for the translation of messenger RNA by ribosomes is provided, and the expression of translational ratio of protein is given. In this comments, varied methods to get this ratio are addressed. Depending on a different method, we find that, roughly speaking, this translational ratio decays exponentially with mRNA length in prokaryotic cell, and reciprocally with mRNA length in eukaryotic cells.

  12. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S rRNA, a...

  13. Chromosome mapping of 5S rRNA genes differentiates Brazilian populations of Leporellus vittatus (Anostomidae, Characiformes

    Directory of Open Access Journals (Sweden)

    Cecilia Teixeira de Aguilar

    2008-01-01

    Full Text Available Among the anostomid fishes, the genus Leporellus is represented by only three species: L. nattereri, endemic of the Amazon River, L. retropinnis, endemic of the Piracicaba River, and L. vittatus, widely distributed in rivers from Peru, Colombia, Guianas, and different major hydrographic basins of Brazil. A cytogenetic study carried out on specimens of Leporellus vittatus from three major Brazilian hydrographic basins evidenced a karyotype of 54 metacentric and submetacentric chromosomes. C-banding analysis revealed the presence of large pericentromeric heterochromatic segments in all chromosomes and a telomeric block coincident with the NOR sites. Ag, CMA3 or MM staining, and FISH with ribosomal probes located the 45S ribosomal genes on the terminal region of the long arm of the 12th chromosome pair of all populations. Nevertheless, in the specimens from the Paraná and São Francisco Basins the 5S rDNA clusters were interstitially located by FISH on the long arm of the 2nd chromosome pair, while in the specimens from the Tocantins-Araguaia Basin these sites were observed on the long arm of the 9th chromosome pair and on the short arm of the 17th chromosome pair. These data suggest that the species currently named Leporellus vittatus may comprise a complex of cryptic species.

  14. [Affinity modification of Escherichia coli ribosomes with photoactivated analogs of mRNA].

    Science.gov (United States)

    Gimautdinova, O I; Zenkova, M A; Karpova, G G; Podust, L M

    1984-01-01

    Oligoribonucleotide derivatives containing the photoactivated arylazidogroup at 5'-end of the oligonucleotide fragment [2-(N-2,4-dinitro-5-azidophenyl) aminoethyl] phosphamides of the oligoribonucleotides, azido-NH (CH2)2NHpN (pN) n-1, were prepared. It was demonstrated that azido-NH(CH2)2NHpA(pA)4 and azido-NH (CH2)2NHpU (pU)3 stimulate the binding of the codonspecific aminoacyl-tRNA with ribosome. After irradiation of the ternary complex ribosome-azido-NH (CH2)2NHpU (pU) n-1 X tRNA with UV-light (lambda greater than 350 nm) covalent binding of the reagent to ribosome occurs. Up to 10% of the reagent, bound in the ternary complex with ribosome, is cross-linked with the ribosomal proteins of 30S and 50S subunits. The ribosomal RNA are not modified by azido-NH (CH2)2NHpU (pU) n-1. The proteins of 30S and 50S subunits, modified with azido-NH (CH2)2NHpU (pU) n-1 with n = 4,7 and 8, were identified. It is shown that proteins of 30S subunits S3, S4, S9, S11, S12, S14, S17, S19, S20 undergo modification. The proteins of 50S subunits L2, L13, L16, L27, L32, L33 are modified. The set of the modified proteins essentially depends on the length of the oligonucleotide part of the reagent and on occupancy of ribosome A-site by a molecule of tRNA.

  15. Visual analysis of the yeast 5S rRNA gene transcriptome: regulation and role of La protein.

    Science.gov (United States)

    French, Sarah L; Osheim, Yvonne N; Schneider, David A; Sikes, Martha L; Fernandez, Cesar F; Copela, Laura A; Misra, Vikram A; Nomura, Masayasu; Wolin, Sandra L; Beyer, Ann L

    2008-07-01

    5S rRNA genes from Saccharomyces cerevisiae were examined by Miller chromatin spreading, representing the first quantitative analysis of RNA polymerase III genes in situ by electron microscopy. These very short genes, approximately 132 nucleotides (nt), were engaged by one to three RNA polymerases. Analysis in different growth conditions and in strains with a fourfold range in gene copy number revealed regulation at two levels: number of active genes and polymerase loading per gene. Repressive growth conditions (presence of rapamycin or postexponential growth) led first to fewer active genes, followed by lower polymerase loading per active gene. The polymerase III elongation rate was estimated to be in the range of 60 to 75 nt/s, with a reinitiation interval of approximately 1.2 s. The yeast La protein, Lhp1, was associated with 5S genes. Its absence had no discernible effect on the amount or size of 5S RNA produced yet resulted in more polymerases per gene on average, consistent with a non-rate-limiting role for Lhp1 in a process such as polymerase release/recycling upon transcription termination.

  16. Ribosomal protein L16 binds to the 3'-end of transfer RNA.

    Science.gov (United States)

    Maimets, T; Remme, J; Villems, R

    1984-01-23

    Escherichia coli 50 S ribosomal subunits were reconstituted with and without protein L16 present. The latter particles, although active in puromycin reaction, were unable to use CACCA-Phe as an acceptor substrate. We also found that L16 interacts directly with this oligonucleotide and, in the complex with tRNA, protects its 3'-end from pancreatic ribonuclease digestion. We suggest that the role of L16 is in the fixation of the aminoacyl stem of tRNA to the ribosome at its A-site.

  17. Ribosomal RNA in Alzheimer disease is oxidized by bound redox-active iron.

    Science.gov (United States)

    Honda, Kazuhiro; Smith, Mark A; Zhu, Xiongwei; Baus, Diane; Merrick, William C; Tartakoff, Alan M; Hattier, Thomas; Harris, Peggy L; Siedlak, Sandra L; Fujioka, Hisashi; Liu, Quan; Moreira, Paula I; Miller, Frank P; Nunomura, Akihiko; Shimohama, Shun; Perry, George

    2005-06-03

    Oxidative modification of cytoplasmic RNA in vulnerable neurons is an important, well documented feature of the pathophysiology of Alzheimer disease. Here we report that RNA-bound iron plays a pivotal role for RNA oxidation in vulnerable neurons in Alzheimer disease brain. The cytoplasm of hippocampal neurons showed significantly higher redox activity and iron(II) staining than age-matched controls. Notably, both were susceptible to RNase, suggesting a physical association of iron(II) with RNA. Ultrastructural analysis further suggested an endoplasmic reticulum association. Both rRNA and mRNA showed twice the iron binding as tRNA. rRNA, extremely abundant in neurons, was considered to provide the greatest number of iron binding sites among cytoplasmic RNA species. Interestingly, the difference of iron binding capacity disappeared after denaturation of RNA, suggesting that the higher order structure may contribute to the greater iron binding of rRNA. Reflecting the difference of iron binding capacity, oxidation of rRNA by the Fenton reaction formed 13 times more 8-hydroxyguanosine than tRNA. Consistent with in situ findings, ribosomes purified from Alzheimer hippocampus contained significantly higher levels of RNase-sensitive iron(II) and redox activity than control. Furthermore, only Alzheimer rRNA contains 8-hydroxyguanosine in reverse transcriptase-PCR. Addressing the biological significance of ribosome oxidation by redox-active iron, in vitro translation with oxidized ribosomes from rabbit reticulocyte showed a significant reduction of protein synthesis. In conclusion these results suggest that rRNA provides a binding site for redox-active iron and serves as a redox center within the cytoplasm of vulnerable neurons in Alzheimer disease in advance of the appearance of morphological change indicating neurodegeneration.

  18. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    Science.gov (United States)

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes.

  19. Impact of P-Site tRNA and antibiotics on ribosome mediated protein folding: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Surojit Mondal

    Full Text Available BACKGROUND: The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3' -CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA also displays chaperoning activity. RESULTS: The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin and macrolide antibiotics (erythromycin and josamycin on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3'-CCA end of P/P-site tRNA with the PTC is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA to be important for its chaperoning ability. CONCLUSION: Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions.

  20. Computational and Experimental Characterization of Ribosomal DNA and RNA G-Quadruplexes

    Science.gov (United States)

    Cho, Samuel

    DNA G-quadruplexes in human telomeres and gene promoters are being extensively studied for their role in controlling the growth of cancer cells. Recent studies strongly suggest that guanine (G)-rich genes encoding pre-ribosomal RNA (pre-rRNA) are a potential anticancer target through the inhibition of RNA polymerase I (Pol I) in ribosome biogenesis. However, the structures of ribosomal G-quadruplexes at atomic resolution are unknown, and very little biophysical characterization has been performed on them to date. Here, we have modeled two putative rDNA G-quadruplex structures, NUC 19P and NUC 23P, which we observe via circular dichroism (CD) spectroscopy to adopt a predominantly parallel topology, and their counterpart rRNA. To validate and refine the putative ribosomal G-quadruplex structures, we performed all-atom molecular dynamics (MD) simulations using the CHARMM36 force field in the presence and absence of stabilizing K + or Na + ions. We optimized the CHARMM36 force field K + parameters to be more consistent with quantum mechanical calculations (and the polarizable Drude model force field) so that the K + ion is predominantly in the G-quadruplex channel. Our MD simulations show that the rDNA G-quadruplex have more well-defined, predominantly parallel-topology structures than rRNA and NUC 19P is more structured than NUC 23P, which features extended loops. Our study demonstrates that they are both potential targets for the design of novel chemotherapeutics.

  1. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  2. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  3. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  4. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  5. Computational modeling analyses of RNA secondary structures and phylogenetic inference of evolutionary conserved 5S rRNA in the prokaryotes.

    Science.gov (United States)

    Singh, Vijai; Somvanshi, Pallavi

    2009-04-01

    Bacteria are unicellular, ubiquitous microorganisms which grow on soil, acidic hot springs, radioactive wastes, etc. The genome of bacteria constitutes species specific conserved region. The 5S rRNA is one of the most conserved region determined in each bacteria and the size ranges between 110 and 148 bp. On this basis phylogenetic study of 37 bacterial strains was done which results in formation of seven clades and furthermore RNA secondary structure from each clade was made. The lowest free energy (delta G) of the 5S rRNA may divulge the most primitive bacteria and slow changes occurs throughout the evolution whereas the higher free energy indicates less stability during the evolution. The RNA secondary structure may provide new insights to understand bacteria evolution and stability.

  6. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    Science.gov (United States)

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn.

  7. Can we estimate bacterial growth rates from ribosomal RNA content?

    Energy Technology Data Exchange (ETDEWEB)

    Kemp, P.F.

    1995-12-31

    Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.

  8. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  9. Characterization of recombinant bacteriophages containing mosquito ribosomal RNA genes

    Energy Technology Data Exchange (ETDEWEB)

    Park, Y.J.

    1988-01-01

    A family of nine recombinant bacteriophages containing rRNA genes from cultured cells of the mosquito, Aedes albopictus, has been isolated by screening two different genomic DNA libraries - Charon 30 and EMBL 3 using {sup 32}P-labeled 18S and 28S rRNA as probes. These nine recombinant bacteriophages were characterized by restriction mapping, Southern blotting, and S1 nuclease analysis. The 18S rRNA coding region contains an evolutionarily conserved EcoRI site near the 3{prime}-end, and measures 1800 bp. The 28S rRNA genes were divided into {alpha} and {beta} coding regions measuring 1750 bp and 2000 bp, respectively. The gap between these two regions measures about 340 bp. No insertion sequences were found in the rRNA coding regions. The entire rDNA repeat unit had a minimum length of 15.6 kb, including a nontranscribed spacer region. The non-transcribed spacer region of cloned A. albopictus rDNA contained a common series of seven PvuI sites within a 1250 bp region upstream of the 18S rRNA coding region, and a proportion of this region also showed heterogeneity both in the length and in the restriction sites.

  10. Preparation of Biologically Active Arabidopsis Ribosomes and Comparison with Yeast Ribosomes for Binding to a tRNA-Mimic that Enhances Translation of Plant Plus-Strand RNA Viruses

    Directory of Open Access Journals (Sweden)

    Vera Aleksey Stupina

    2013-07-01

    Full Text Available Isolation of biologically active cell components from multicellular eukaryotic organisms often poses difficult challenges such as low yields and inability to retain the integrity and functionality of the purified compound. We previously identified a cap-independent translation enhancer (3’CITE in the 3’UTR of Turnip crinkle virus (TCV that structurally mimics a tRNA and binds to yeast 80S ribosomes and 60S subunits in the P-site. Yeast ribosomes were used for these studies due to the lack of methods for isolation of plant ribosomes with high yields and integrity. To carry out studies with more natural components, a simple and efficient procedure has been developed for the isolation of large quantities of high quality ribosomes and ribosomal subunits from Arabidopsis thaliana protoplasts prepared from seed-derived callus tissue. Attempts to isolate high quality ribosomes from wheat germ, bean sprouts and evacuolated protoplasts were unsuccessful. Addition of purified Arabidopsis 80S plant ribosomes to ribosome-depleted wheat germ lysates resulted in a greater than 1200-fold enhancement in in vitro translation of a luciferase reporter construct. The TCV 3’CITE bound to ribosomes with a 3 to 7-fold higher efficiency when using plant 80S ribosomes compared with yeast ribosomes, indicating that this viral translational enhancer is adapted to interact more efficiently with host plant ribosomes.

  11. Robertsonian rearrangements in the reef fish Chromis (Perciformes, Pomacentridae involving chromosomes bearing 5s rRNA genes

    Directory of Open Access Journals (Sweden)

    Wagner F. Molina

    2002-01-01

    Full Text Available Cytogenetic studies were done on three Pomacentridae species of the genus Chromis. The karyotype of C. multilineata consisted of 48 acrocentric chromosomes (FN = 48, C. insolata had 2n = 46-47 (3-4M+6SM+36-38A; FN = 56 and C. flavicauda had 2n = 39 (9M+6SM+24A; FN = 54. Robertsonian polymorphisms were detected in C. insolata and C. flavicauda. All three species had small heterochromatic blocks restricted to centromeric regions. Nucleolar organizer regions (NORs were detected in the telomeric position of a medium acrocentric chromosome pair in C. multilineata and in non-homologous chromosomes in both C. flavicauda and C. insolata. FISH with a telomeric probe detected no internal telomeric sequences in C. flavicauda and C. insolata. 5S rRNA genes were observed in a pericentromeric region of two large metacentric chromosome pairs in C. flavicauda and two large acrocentric pairs in C. insolata. The karyotype structure and the number and location of the 5S rDNA loci in these two species indicated that the 5S rRNA-bearing acrocentric chromosomes were directly involved in the origin of the polymorphisms observed. These data reinforce the idea that Robertsonian rearrangements have been involved in molding the karyotype in the subfamily Chrominae.

  12. Complementarity between the mRNA 5' untranslated region and 18S ribosomal RNA can inhibit translation.

    Science.gov (United States)

    Verrier, S B; Jean-Jean, O

    2000-04-01

    In eubacteria, base pairing between the 3' end of 16S rRNA and the ribosome-binding site of mRNA is required for efficient initiation of translation. An interaction between the 18S rRNA and the mRNA was also proposed for translation initiation in eukaryotes. Here, we used an antisense RNA approach in vivo to identify the regions of 18S rRNA that might interact with the mRNA 5' untranslated region (5' UTR). Various fragments covering the entire mouse 18S rRNA gene were cloned 5' of a cat reporter gene in a eukaryotic vector, and translation products were analyzed after transient expression in human cells. For the largest part of 18S rRNA, we show that the insertion of complementary fragments in the mRNA 5' UTR do not impair translation of the downstream open reading frame (ORF). When translation inhibition is observed, reduction of the size of the complementary sequence to less than 200 nt alleviates the inhibitory effect. A single fragment complementary to the 18S rRNA 3' domain retains its inhibitory potential when reduced to 100 nt. Deletion analyses show that two distinct sequences of approximately 25 nt separated by a spacer sequence of 50 nt are required for the inhibitory effect. Sucrose gradient fractionation of polysomes reveals that mRNAs containing the inhibitory sequences accumulate in the fractions with 40S ribosomal subunits, suggesting that translation is blocked due to stalling of initiation complexes. Our results support an mRNA-rRNA base pairing to explain the translation inhibition observed and suggest that this region of 18S rRNA is properly located for interacting with mRNA.

  13. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    -rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...... translates the genetic message encoded in mRNAs to synthesize proteins. Initiation of translation requires localization and recognition of the start codon at the P-site of the 40S small ribosomal subunit. On most eukaryotic mRNAs, the start codon is identified by a scanning mechanism, whereby a small subunit...

  14. CED-4 is an mRNA-binding protein that delivers ced-3 mRNA to ribosomes.

    Science.gov (United States)

    Wang, Miao-xing; Itoh, Masanori; Li, Shimo; Hida, Yoko; Ohta, Kazunori; Hayakawa, Miki; Nishida, Emika; Ueda, Masashi; Islam, Saiful; Tana; Nakagawa, Toshiyuki

    2016-01-29

    Cell death abnormal (ced)-3 and ced-4 genes regulate apoptosis to maintain tissue homeostasis in Caenorhabditis elegans. Apoptosome formation and CED-4 translocation drive CED-3 activation. However, the precise role of CED-4 translocation is not yet fully understood. In this study, using a combination of immunoprecipitation and reverse transcription-polymerase chain reaction methods in cells and a glutathione-S-transferase pull down assay in a cell-free system, we show that CED-4 binds ced-3 mRNA. In the presence of ced-3 mRNA, CED-4 protein is enriched in the microsomal fraction and interacts with ribosomal protein L10a in mammalian cells, increasing the levels of CED-3. These results suggest that CED-4 forms a complex with ced-3 mRNA and delivers it to ribosomes for translation.

  15. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    Energy Technology Data Exchange (ETDEWEB)

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip

    2010-10-01

    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  16. Structural and functional analysis of Escherichia coli ribosomes containing small deletions around position 1760 in the 23S ribosomal RNA.

    Science.gov (United States)

    Zweib, C; Dahlberg, A E

    1984-09-25

    Three different small deletions were produced at a single Pvu 2 restriction site in E. coli 23S rDNA of plasmid pKK 3535 using exonuclease Bal 31. The deletions were located around position 1760 in 23S rRNA and were characterized by DNA sequencing as well as by direct fingerprinting and S1-mapping of the rRNA. Two of the mutant plasmids, Pvu 2-32 and Pvu 2-33, greatly reduced the growth rate of transformed cells while the third mutant, Pvu 2-14 grew as fast as cells containing the wild-type plasmid pKK 3535. All three mutant 23S rRNAs were incorporated into 50S-like particles and were even found in 70S ribosomes and polysomes in vivo. The conformation of mutant 23S rRNA in 50S subunits was probed with a double-strand specific RNase from cobra venom. These analyses revealed changes in the accessibility of cleavage sites near the deletions around position 1760 and in the area around position 800 in all three mutant rRNAs. We suggest, that an altered conformation of the rRNAs at the site of the deletion is responsible for the slow growth of cells containing mutant plasmids Pvu 2-32 and Pvu 2-33.

  17. Pyrosequencing Using SL and 5S rRNA as Molecular Markers for Identifying Zoonotic Filarial Nematodes in Blood Samples and Mosquitoes.

    Science.gov (United States)

    Sanpool, Oranuch; Tantrawatpan, Chairat; Thanchomnang, Tongjit; Janwan, Penchom; Intapan, Pewpan M; Rodpai, Rutchanee; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Maleewong, Wanchai

    2016-05-01

    Lymphatic filariasis is principally caused by Wuchereria bancrofti, and Brugia malayi. The other two filarial nematode species, Brugia pahangi and Dirofilaria immitis, possibly cause human zoonotic diseases. We propose the development of a PCR assay linked with DNA pyrosequencing as a rapid tool to identify W. bancrofti, B. malayi, B. pahangi, and D. immitis in blood samples and mosquitoes. Primers targeting the fragment of the 5S ribosomal RNA and spliced leader sequences were newly designed and developed to identify these four filarial nematodes. Analytical sensitivity and specificity were evaluated. Pyrosequencing determination of nucleotide variations within 36 nucleotides for B. malayi and B. pahangi, and 32 nucleotides for W. bancrofti and D. immitis is sufficient for differentiation of those filarial nematodes, and for detection of intraspecies genetic variation of B. malayi. This analysis could detect a single B. malayi, B. pahangi, W. bancrofti, and D. immitis microfilaria in blood samples. Overall, the PCR-linked pyrosequencing-based method was faster than direct sequencing and less expensive than real-time PCR or direct sequencing. This is the possibility of choice that can be applied in a high-throughput platform for identification and surveillance of reservoirs and vectors infected with lymphatic filaria in endemic areas.

  18. Chromosomal localization of the major ribosomal RNA genes in scallop Chlamys farreri

    Institute of Scientific and Technical Information of China (English)

    HUANG Xiaoting; BAO Zhenmin; BI Ke; HU Jingjie; ZHANG Can; ZHANG Quanqi; HU Xiaoli

    2006-01-01

    The chromosomes of Chlamys farreri were analyzed by means of silver staining and fluorescence in situ hybridization ( FISH ) with 18S-28S rDNA probe. Probe was made by PCR amplification of a DNA fragment containing internal transcribed spacers ITS1 between 18S and 5.8S ribosomal RNA gene, ITS2 between 5.8S and 28S ribosomal RNA gene and 5.8S rRNA gene, and labeled by PCR incorporation of bio-16-dUTP. FISH signals were located on the short arm of subtelocentric chromosome 10. After silverstaining, nucleolus organizer regions (NORs) could be observed on the telomere of the short arm of chromosome 10. However,one metaphase spread displayed an additional silver spot on the short arm of subtelocentric chromosome 12.

  19. Cocrystallizing natural RNA with its unnatural mirror image: biochemical and preliminary X-ray diffraction analysis of a 5S rRNA A-helix racemate

    Energy Technology Data Exchange (ETDEWEB)

    Förster, Charlotte; Brauer, Arnd B. E.; Lehmann, Daniel; Borowski, Tordis; Brode, Svenja; Fürste, Jens P. [Institute of Chemistry and Biochemistry, Free University Berlin, Thielallee 63, 14195 Berlin (Germany); Perbandt, Markus; Betzel, Christian [Institute of Biochemistry and Molecular Biology, University of Hamburg, c/o DESY, Notkestrasse 85, Building 22a, 22603 Hamburg (Germany); Erdmann, Volker A., E-mail: erdmann@chemie.fu-berlin.de [Institute of Chemistry and Biochemistry, Free University Berlin, Thielallee 63, 14195 Berlin (Germany)

    2007-10-01

    A 5S rRNA A-helix 7-mer oligonucleotide was chemically synthesized both as d-RNA and as l-RNA, biochemically investigated, crystallized as a stochiometric racemate and examined by X-ray diffraction. Chemically synthesized RNAs with the unnatural l-configuration possess enhanced in vivo stability and nuclease resistance, which is a highly desirable property for pharmacological applications. For a structural comparison, both l- and d-RNA oligonucleotides of a shortened Thermus flavus 5S rRNA A-helix were chemically synthesized. The enantiomeric RNA duplexes were stochiometrically cocrystallized as a racemate, which enabled analysis of the d- and l-RNA enantiomers in the same crystals. In addition to a biochemical investigation, diffraction data were collected to 3.0 Å resolution using synchrotron radiation. The crystals belonged to space group P3{sub 1}21, with unit-cell parameters a = b = 35.59, c = 135.30 Å, γ = 120° and two molecules per asymmetric unit.

  20. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  1. Targets and intracellular signaling mechanisms for deoxynivalenol-induced ribosomal RNA cleavage.

    Science.gov (United States)

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J

    2012-06-01

    The trichothecene mycotoxin deoxynivalenol (DON), a known translational inhibitor, induces ribosomal RNA (rRNA) cleavage. Here, we characterized this process relative to (1) specific 18S and 28S ribosomal RNA cleavage sites and (2) identity of specific upstream signaling elements in this pathway. Capillary electrophoresis indicated that DON at concentrations as low as 200 ng/ml evoked selective rRNA cleavage after 6 h and that 1000 ng/ml caused cleavage within 2 h. Northern blot analysis revealed that DON exposure induced six rRNA cleavage fragments from 28S rRNA and five fragments from 18S rRNA. When selective kinase inhibitors were used to identify potential upstream signals, RNA-activated protein kinase (PKR), hematopoietic cell kinase (Hck), and p38 were found to be required for rRNA cleavage, whereas c-Jun N-terminal kinase and extracellular signal-regulated kinase were not. Furthermore, rRNA fragmentation was suppressed by the p53 inhibitors pifithrin-α and pifithrin-μ as well as the pan caspase inhibitor Z-VAD-FMK. Concurrent apoptosis was confirmed by acridine orange/ethidium bromide staining and flow cytometry. DON activated caspases 3, 8, and 9, thus suggesting the possible coinvolvement of both extrinsic and intrinsic apoptotic pathways in rRNA cleavage. Satratoxin G (SG), anisomycin, and ricin also induced specific rRNA cleavage profiles identical to those of DON, suggesting that ribotoxins might share a conserved rRNA cleavage mechanism. Taken together, DON-induced rRNA cleavage is likely to be closely linked to apoptosis activation and appears to involve the sequential activation of PKR/Hck →p38→p53→caspase 8/9→caspase 3.

  2. The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes.

    OpenAIRE

    Krol, A; Gallinaro, H; Lazar, E; Jacob, M.; Branlant, C

    1981-01-01

    Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently a...

  3. Regulation of ribosomal rna synthesis in escherichia coli

    OpenAIRE

    Oostra, Bernard Anne

    1981-01-01

    Bacterien kunnen met verschillende snelheden groeien. De groeisnelheid hangt af van het milieu waarin de bakterien zich bevinden. De expressie van genen wordt aangepast aan de groeiomstandigheden. Omdat op een bepaald moment slechts een beperkt deel van de genen tot expressie komt, moet er sprake zijn van regulering. Daarbij is het ook van belang te weten dat prokaryoten één enzym hebben, het RNA polymerase, dat zorgt voor de transcriptie van alle genen. ... Samenvatting

  4. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  5. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading.

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Lohoff, Tim; Jia, Qidong; Satterlee, James; Ke, Kenneth; von Arnim, Albrecht G

    2015-09-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock.

  6. The origin of modern 5S rRNA: a case of relating models of structural history to phylogenetic data.

    Science.gov (United States)

    Sun, Feng-Jie; Caetano-Anollés, Gustavo

    2010-07-01

    Evolutionary models of molecular structures must incorporate molecular information at different levels of structural complexity and must be phrased within a phylogenetic perspective. In this regard, phylogenetic trees of substructures that are reconstructed from molecular features that contribute to order and thermodynamic stability show that a gradual model of evolution of 5S rRNA structure is more parsimonious than models that invoke large segmental duplications of the molecule. The search for trees of substructures that are most parsimonious, by their very nature, defines an objective strategy to select models of molecular change that best fit structural data. When combined with additional data, such as the age of protein domains that interact with RNA substructures, these trees can be used to falsify unlikely hypotheses.

  7. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  8. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex

    Directory of Open Access Journals (Sweden)

    Ping Xie

    2015-10-01

    Full Text Available Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA. It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by “hungry” codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  9. Recognition of Cognate Transfer RNA by the 30S Ribosomal Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Ogle, James M.; Brodersen, Ditlev E.; Clemons, William M.; Tarry, Michael J.; Carter, Andrew P.; Ramakrishnan, V. (MRC Laboratory of Molecular Biology)

    2009-10-07

    Crystal structures of the 30S ribosomal subunit in complex with messenger RNA and cognate transfer RNA in the A site, both in the presence and absence of the antibiotic paromomycin, have been solved at between 3.1 and 3.3 angstroms resolution. Cognate transfer RNA (tRNA) binding induces global domain movements of the 30S subunit and changes in the conformation of the universally conserved and essential bases A1492, A1493, and G530 of 16S RNA. These bases interact intimately with the minor groove of the first two base pairs between the codon and anticodon, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognate tRNA. The third, or 'wobble,' position of the codon is free to accommodate certain noncanonical base pairs. By partially inducing these structural changes, paromomycin facilitates binding of near-cognate tRNAs.

  10. Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

    Science.gov (United States)

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

    2013-10-01

    Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

  11. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  12. DksA Guards Elongating RNA Polymerase Against Ribosome-Stalling-Induced Arrest

    Science.gov (United States)

    Zhang, Yan; Mooney, Rachel A.; Grass, Jeffrey A.; Sivaramakrishnan, Priya; Herman, Christophe; Landick, Robert; Wang, Jue D.

    2014-01-01

    Summary In bacteria, translation-transcription coupling inhibits RNA polymerase (RNAP) stalling. We present evidence suggesting that, upon amino acid starvation, inactive ribosomes promote rather than inhibit RNAP stalling. We developed an algorithm to evaluate genome-wide polymerase progression independently of local noise, and used it to reveal that the transcription factor DksA inhibits promoter-proximal pausing and increases RNAP elongation when uncoupled from translation by depletion of charged tRNAs. DksA has minimal effect on RNAP elongation in vitro and on untranslated RNAs in vivo. In these cases, transcripts can form RNA structures that prevent backtracking. Thus, the effect of DksA on transcript elongation may occur primarily upon ribosome slowing/stalling or at promoter-proximal locations that limit the potential for RNA structure. We propose that inactive ribosomes prevent formation of backtrack-blocking mRNA structures and that, in this circumstance, DksA acts as a transcription elongation factor in vivo. PMID:24606919

  13. Structure and Function of the Ribosomal Frameshifting Pseudoknot RNA from Beet Western Yellow Virus

    Energy Technology Data Exchange (ETDEWEB)

    Egli, M.; Sarkhel, S.; Minasov, G.; Rich, A.

    2010-03-05

    Many viruses reprogram ribosomes to produce two different proteins from two different reading frames. So-called -1 frameshifting often involves pairwise alignment of two adjacent tRNAs at a 'slippery' sequence in the ribosomal A and P sites such that an overlapping codon is shifted upstream by one base relative to the zero frame. In the majority of cases, an RNA pseudoknot located downstream stimulates this type of frameshift. Crystal structures of the frameshifting RNA pseudoknot from Beet Western Yellow Virus (BWYV) have provided a detailed picture of the tertiary interactions stabilizing this folding motif, including a minor-groove triplex and quadruple-base interactions. The structure determined at atomic resolution revealed the locations of several magnesium ions and provided insights into the role of structured water stabilizing the RNA. Systematic in vitro and in vivo mutational analyses based on the structural results revealed specific tertiary interactions and regions in the pseudoknot that drastically change frameshifting efficiency. Here, we summarize recent advances in our understanding of pseudoknot-mediated ribosomal frameshifting on the basis of the insights gained from structural and functional studies of the RNA pseudoknot from BWYV.

  14. The structure of a ribosomal protein S8/spc operon mRNA complex.

    Science.gov (United States)

    Merianos, Helen J; Wang, Jimin; Moore, Peter B

    2004-06-01

    In bacteria, translation of all the ribosomal protein cistrons in the spc operon mRNA is repressed by the binding of the product of one of them, S8, to an internal sequence at the 5' end of the L5 cistron. The way in which the first two genes of the spc operon are regulated, retroregulation, is mechanistically distinct from translational repression by S8 of the genes from L5 onward. A 2.8 A resolution crystal structure has been obtained of Escherichia coli S8 bound to this site. Despite sequence differences, the structure of this complex is almost identical to that of the S8/helix 21 complex seen in the small ribosomal subunit, consistent with the hypothesis that autogenous regulation of ribosomal protein synthesis results from conformational similarities between mRNAs and rRNAs. S8 binding must repress the translation of its own mRNA by inhibiting the formation of a ribosomal initiation complex at the start of the L5 cistron.

  15. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    OpenAIRE

    Triman, K L; Peister, A; Goel, R A

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  16. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  17. Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

    Science.gov (United States)

    Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

    1999-01-01

    Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

  18. mTOR associates with TFIIIC, is found at tRNA and 5S rRNA genes, and targets their repressor Maf1.

    Science.gov (United States)

    Kantidakis, Theodoros; Ramsbottom, Ben A; Birch, Joanna L; Dowding, Sarah N; White, Robert J

    2010-06-29

    Synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is regulated by the mTOR pathway in mammalian cells. The mTOR kinase localizes to tRNA and 5S rRNA genes, providing an opportunity for direct control. Its presence at these sites can be explained by interaction with TFIIIC, a DNA-binding factor that recognizes the promoters of these genes. TFIIIC contains a TOR signaling motif that facilitates its association with mTOR. Maf1, a repressor that binds and inhibits pol III, is phosphorylated in a mTOR-dependent manner both in vitro and in vivo at serine 75, a site that contributes to its function as a transcriptional inhibitor. Proximity ligation assays confirm the interaction of mTOR with Maf1 and TFIIIC in nuclei. In contrast to Maf1 regulation in yeast, no evidence is found for nuclear export of Maf1 in response to mTOR signaling in HeLa cells. We conclude that mTOR associates with TFIIIC, is recruited to pol III-transcribed genes, and relieves their repression by Maf1.

  19. Sequence of the 16S Ribosomal RNA from Halobacterium volcanii, an Archaebacterium.

    Science.gov (United States)

    Gupta, R; Lanter, J M; Woese, C R

    1983-08-12

    The sequence of the 16S ribosomal RNA (rRNA) from the archaebacterium Halobacterium volcanii has been determined by DNA sequencing methods. The archaebacterial rRNA is similar to its eubacterial counterpart in secondary structure. Although it is closer in sequence to the eubacterial 16S rRNA than to the eukaryotic 16S-like rRNA, the H. volcanii sequence also shows certain points of specific similarity to its eukaryotic counterpart. Since the H. volcanii sequence is closer to both the eubacterial and the eukaryotic sequences than these two are to one another, it follows that the archaebacterial sequence resembles their common ancestral sequence more closely than does either of the other two versions.

  20. Probing the structure of 16 S ribosomal RNA from Bacillus brevis.

    Science.gov (United States)

    Kop, J; Kopylov, A M; Magrum, L; Siegel, R; Gupta, R; Woese, C R; Noller, H F

    1984-12-25

    A majority (approximately 89%) of the nucleotide sequence of Bacillus brevis 16 S rRNA has been determined by a combination of RNA sequencing methods. Several experimental approaches have been used to probe its structure, including (a) partial RNase digestion of 30 S ribosomal subunits, followed by two-dimensional native/denatured gel electrophoresis, in which base-paired fragments were directly identified; (b) identification of positions susceptible to cleavage by RNase A and RNase T1 in 30 S subunits; (c) sites of attack by cobra venom RNase on naked 16 S rRNA; and (d) nucleotides susceptible to attack by bisulfite in 16 S rRNA. These data are discussed with respect to a secondary structure model for B. brevis 16 S rRNA derived by comparative sequence analysis.

  1. Detection of bacterial 16S ribosomal RNA genes for forensic identification of vaginal fluid.

    Science.gov (United States)

    Akutsu, Tomoko; Motani, Hisako; Watanabe, Ken; Iwase, Hirotaro; Sakurada, Koichi

    2012-05-01

    To preliminarily evaluate the applicability of bacterial DNA as a marker for the forensic identification of vaginal fluid, we developed and performed PCR-based detection of 16S ribosomal RNA genes of Lactobacillus spp. dominating the vagina and of bacterial vaginosis-related bacteria from DNA extracted from body fluids and stains. As a result, 16S ribosomal RNA genes of Lactobacillus crispatus, Lactobacillus jensenii and Atopobium vaginae were specifically detected in vaginal fluid and female urine samples. Bacterial genes detected in female urine might have originated from contaminated vaginal fluid. In addition, those of Lactobacillus iners, Lactobacillus gasseri and Gardnerella vaginalis were also detected in non-vaginal body fluids such as semen. Because bacterial genes were successfully amplified in DNA samples extracted by using the general procedure for animal tissues without any optional treatments, DNA samples prepared for the identification of vaginal fluid can also be used for personal identification. In conclusion, 16S ribosomal RNA genes of L. crispatus, L. jensenii and A. vaginae could be effective markers for forensic identification of vaginal fluid.

  2. Detection of Enterobacter sakazakii in neonatal sepsis by PCR on 16S ribosomal RNA

    Directory of Open Access Journals (Sweden)

    Khadijeh Ahmadi

    2014-08-01

    Full Text Available Background: Enterobacter sakazakii is a gram negative, facultative anaerobic, straight rod-shaped bacterium that belongs to the family Enterobacteriaceae. It is also considered an emerging opportunistic pathogen, responsible of cases of neonatal infections including sepsis, meningitis, necrotizing enterocolitis ad bacteremia. The goal of this study was detection of Enterobacter salazakii in neonates with sepsis by PCR on 16S ribosomal RNA gene. Material and Methods: This cross-sectional study was conducted on 405 blood specimens that were taken from hospitalized neonates suspected to sepsis in Ahvaz Abuzar Hospital in 2011. From each neonate 0.5 ml blood sample was taken and placed in CBC tubes containing EDTA at -200C for polymerase chain reaction. For detection of Enterobacter sakazakii, PCR was performed on DNA for amplification of 16S ribosomal RNA gene. Results: In all 405 neonates blood samples’ PCR reactions for Enterobacter sakazakii 16S ribosomal RNA gene were negative. Blood cultures were positive for Streptococcus agalactiae in 8 (1.4 % patients. Conclusion: Because Enterobacter sakazakii is an opportunistic pathogen with high pathogenicity power, more investigation on high risk groups is required. For detection of infection caused by this organism using of different diagnostic methods with high specificity and sensitivity is necessary.

  3. Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Richards Eric J

    2008-09-01

    Full Text Available Abstract Background DNA methylation is an important biochemical mark that silences repetitive sequences, such as transposons, and reinforces epigenetic gene expression states. An important class of repetitive genes under epigenetic control in eukaryotic genomes encodes ribosomal RNA (rRNA transcripts. The ribosomal genes coding for the 45S rRNA precursor of the three largest eukaryotic ribosomal RNAs (18S, 5.8S, and 25–28S are found in nucleolus organizer regions (NORs, comprised of hundreds to thousands of repeats, only some of which are expressed in any given cell. An epigenetic switch, mediated by DNA methylation and histone modification, turns rRNA genes on and off. However, little is known about the mechanisms that specify and maintain the patterns of NOR DNA methylation. Results Here, we explored the extent of naturally-occurring variation in NOR DNA methylation among accessions of the flowering plant Arabidopsis thaliana. DNA methylation in coding regions of rRNA genes was positively correlated with copy number of 45S rRNA gene and DNA methylation in the intergenic spacer regions. We investigated the inheritance of NOR DNA methylation patterns in natural accessions with hypomethylated NORs in inter-strain crosses and defined three different categories of inheritance in F1 hybrids. In addition, subsequent analysis of F2 segregation for NOR DNA methylation patterns uncovered different patterns of inheritance. We also revealed that NOR DNA methylation in the Arabidopsis accession Bor-4 is influenced by the vim1-1 (variant in methylation 1-1 mutation, but the primary effect is specified by the NORs themselves. Conclusion Our results indicate that the NORs themselves are the most significant determinants of natural variation in NOR DNA methylation. However, the inheritance of NOR DNA methylation suggests the operation of a diverse set of mechanisms, including inheritance of parental methylation patterns, reconfiguration of parental NOR DNA

  4. Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3'-Terminal Fragment of 16S rRNA in E. coli.

    Science.gov (United States)

    Golovin, A V; Khayrullina, G A; Kraal, B; Kopylov, Capital A Cyrillic М

    2012-10-01

    For prokaryotes in vitro, 16S rRNA and 20 ribosomal proteins are capable of hierarchical self- assembly yielding a 30S ribosomal subunit. The self-assembly is initiated by interactions between 16S rRNA and three key ribosomal proteins: S4, S8, and S7. These proteins also have a regulatory function in the translation of their polycistronic operons recognizing a specific region of mRNA. Therefore, studying the RNA-protein interactions within binary complexes is obligatory for understanding ribosome biogenesis. The non-conventional RNA-protein contact within the binary complex of recombinant ribosomal protein S7 and its 16S rRNA binding site (236 nucleotides) was identified. UV-induced RNA-protein cross-links revealed that S7 cross-links to nucleotide U1321 of 16S rRNA. The careful consideration of the published RNA- protein cross-links for protein S7 within the 30S subunit and their correlation with the X-ray data for the 30S subunit have been performed. The RNA - protein cross-link within the binary complex identified in this study is not the same as the previously found cross-links for a subunit both in a solution, and in acrystal. The structure of the binary RNA-protein complex formed at the initial steps of self-assembly of the small subunit appears to be rearranged during the formation of the final structure of the subunit.

  5. An RNA Element That Facilitates Programmed Ribosomal Readthrough in Turnip Crinkle Virus Adopts Multiple Conformations.

    Science.gov (United States)

    Kuhlmann, Micki M; Chattopadhyay, Maitreyi; Stupina, Vera A; Gao, Feng; Simon, Anne E

    2016-10-01

    Ribosome recoding is used by RNA viruses for translational readthrough or frameshifting past termination codons for the synthesis of extension products. Recoding sites, along with downstream recoding stimulatory elements (RSEs), have long been studied in reporter constructs, because these fragments alone mediate customary levels of recoding and are thus assumed to contain complete instructions for establishment of the proper ratio of termination to recoding. RSEs from the Tombusviridae and Luteoviridae are thought to be exceptions, since they contain a long-distance RNA-RNA connection with the 3' end. This interaction has been suggested to substitute for pseudoknots, thought to be missing in tombusvirid RSEs. We provide evidence that the phylogenetically conserved RSE of the carmovirus Turnip crinkle virus (TCV) adopts an alternative, smaller structure that extends an upstream conserved hairpin and that this alternative structure is the predominant form of the RSE within nascent viral RNA in plant cells and when RNA is synthesized in vitro The TCV RSE also contains an internal pseudoknot along with the long-distance interaction, and the pseudoknot is not compatible with the phylogenetically conserved structure. Conserved residues just past the recoding site are important for recoding, and these residues are also conserved in the RSEs of gammaretroviruses. Our data demonstrate the dynamic nature of the TCV RSE and suggest that studies using reporter constructs may not be effectively recapitulating RSE-mediated recoding within viral genomes. Ribosome recoding is used by RNA viruses to enable ribosomes to extend translation past termination codons for the synthesis of longer products. Recoding sites and a downstream recoding stimulatory element (RSE) mediate expected levels of recoding when excised and placed in reporter constructs and thus are assumed to contain complete instructions for the establishment of the proper ratio of termination to recoding. We provide

  6. Helix 69 of Escherichia coli 23S ribosomal RNA as a peptide nucleic acid target.

    Science.gov (United States)

    Kulik, Marta; Markowska-Zagrajek, Agnieszka; Wojciechowska, Monika; Grzela, Renata; Wituła, Tomasz; Trylska, Joanna

    2017-07-01

    A fragment of 23S ribosomal RNA (nucleotides 1906-1924 in E. coli), termed Helix 69, forms a hairpin that is essential for ribosome function. Helix 69 forms a conformationally flexible inter-subunit connection with helix 44 of 16S ribosomal RNA, and the nucleotide A1913 of Helix 69 influences decoding accuracy. Nucleotides U1911 and U1917 are post-transcriptionally modified with pseudouridines (Ψ) and U1915 with 3-methyl-Ψ. We investigated Helix 69 as a target for a complementary synthetic oligonucleotide - peptide nucleic acid (PNA). We determined thermodynamic properties of Helix 69 and its complexes with PNA and tested the performance of PNA targeted at Helix 69 in inhibiting translation in cell-free extracts and growth of E. coli cells. First, we examined the interactions of a PNA oligomer complementary to the G1907-A1919 fragment of Helix 69 with the sequences corresponding to human and bacterial species (with or without pseudouridine modifications). PNA invades the Helix 69 hairpin creating stable complexes and PNA binding to the pseudouridylated bacterial sequence is stronger than to Helix 69 without any modifications. Second, we confirmed the binding of PNA to 23S rRNA and 70S ribosomes. Third, we verified the efficiency of translation inhibition of these PNA oligomers in the cell-free translation/transcription E. coli system, which were in a similar range as tetracycline. Next, we confirmed that PNA conjugated to the (KFF)3K transporter peptide inhibited E. coli growth in micromolar concentrations. Overall, targeting Helix 69 with PNA or other sequence-specific oligomers could be a promising way to inhibit bacterial translation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  7. Efficient hammerhead ribozyme and antisense RNA targeting in a slow ribosome Escherichia coli mutant.

    Science.gov (United States)

    Chen, H; Ferbeyre, G; Cedergren, R

    1997-05-01

    We have evaluated inhibition of the plasmid-born chloramphenicol acetyl transferase gene (CAT) by the hammerhead ribozyme and antisense RNA in Escherichia coli where the translation and transcription rates have been modified. Whereas neither antisense nor the hammerhead had an inhibitory effect on CAT activity in wild-type E. coli, both reduced the level of the messenger RNA and the activity of the CAT gene by almost 60% in a slow ribosome mutant. Streptomycin, which increases the speed of translation in this mutant strain, restored full CAT activity. The level of CAT activity expressed from a T7 RNA polymerase promoter was not affected by the presence of either antisense RNA or the hammerhead ribozyme. When the target gene was expressed from a chromosomal locus in wild-type E. coli, both antisense RNA and the hammerhead ribozyme showed some inhibitory activity, but the level of inhibition was significantly increased in the slow ribosome strain. This bacterial system offers a unique entry to the study of cellular factors which mediate the activity of ribozymes in vivo.

  8. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  9. Polynucleotide Phosphorylase, RNase E/G, and YbeY Are Involved in the Maturation of 4.5S RNA in Corynebacterium glutamicum.

    Science.gov (United States)

    Maeda, Tomoya; Tanaka, Yuya; Wachi, Masaaki; Inui, Masayuki

    2017-03-01

    Corynebacterium glutamicum has been applied for the industrial production of various metabolites, such as amino acids. To understand the biosynthesis of the membrane protein in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP is found in all three domains of life and plays an important role in the membrane insertion of proteins. SRP RNA is initially transcribed as precursor molecules; however, relatively little is known about its maturation. In C. glutamicum, SRP consists of the Ffh protein and 4.5S RNA lacking an Alu domain. In this study, we found that 3'-to-5' exoribonuclease, polynucleotide phosphorylase (PNPase), and two endo-type RNases, RNase E/G and YbeY, are involved in the 3' maturation of 4.5S RNA in C. glutamicum The mature form of 4.5S RNA was inefficiently formed in ΔrneG Δpnp mutant cells, suggesting the existence of an alternative pathway for the 3' maturation of 4.5S RNA. Primer extension analysis also revealed that the 5' mature end of 4.5S RNA corresponds to that of the transcriptional start site. Immunoprecipitated Ffh protein contained immature 4.5S RNA in Δpnp, ΔrneG, and ΔybeY mutants, suggesting that 4.5S RNA precursors can interact with Ffh. These results imply that the maturation of 4.5S RNA can be performed in the 4.5S RNA-Ffh complex.IMPORTANCE Overproduction of a membrane protein, such as a transporter, is useful for engineering of strains of Corynebacterium glutamicum, which is a workhorse of amino acid production. To understand membrane protein biogenesis in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP contains the Ffh protein and SRP RNA and plays an important role in the membrane insertion of proteins. Although SRP RNA is highly conserved among the three domains of life, relatively little is known about its maturation. We show that PNPase, RNase E/G, and YbeY are involved in the 3' maturation of the SRP RNA (4.5S RNA) in this

  10. Functional ribosome biogenesis is a prerequisite for p53 destabilization: impact of chemotherapy on nucleolar functions and RNA metabolism.

    Science.gov (United States)

    Burger, Kaspar; Eick, Dirk

    2013-09-01

    The production and processing of ribosomal RNA is a complex and well-coordinated nucleolar process for ribosome biogenesis. Progress in understanding nucleolar structure and function has lead to the unexpected discovery of the nucleolus as a highly sensitive sensor of cellular stress and an important regulator of the tumor suppressor p53. Inhibition of ribosomal RNA metabolism has been shown to activate a signaling pathway for p53 induction. This review elucidates the potential of classical and recently developed chemotherapeutic drugs to stabilize p53 by inhibiting nucleolar functions.

  11. A growth-dependent transcription initiation factor (TIF-IA) interacting with RNA polymerase I regulates mouse ribosomal RNA synthesis.

    Science.gov (United States)

    Schnapp, A; Pfleiderer, C; Rosenbauer, H; Grummt, I

    1990-09-01

    Control of mouse ribosomal RNA synthesis in response to extracellular signals is mediated by TIF-IA, a regulatory factor whose amount or activity correlates with cell proliferation. Factor TIF-IA interacts with RNA polymerase I (pol I), thus converting it into a transcriptionally active holoenzyme, which is able to initiate specifically at the rDNA promoter in the presence of the other auxiliary transcription initiation factors, designated TIF-IB, TIF-IC and UBF. With regard to several criteria, the growth-dependent factor TIF-IA behaves like a bacterial sigma factor: (i) it associates physically with pol I, (ii) it is required for initiation of transcription, (iii) it is present in limiting amounts and (iv) under certain salt conditions, it is chromatographically separable from the polymerase. In addition, evidence is presented that dephosphorylation of pol I abolishes in vitro transcription initiation from the ribosomal gene promoter without significantly affecting the polymerizing activity of the enzyme at nonspecific templates. The involvement of both a regulatory factor and post-translational modification of the transcribing enzyme provides an efficient and versatile mechanism of rDNA transcription regulation which enables the cell to adapt ribosome synthesis rapidly to a variety of extracellular signals.

  12. Decrease in Ribosomal RNA in Candida albicans Induced by Serum Exposure.

    Science.gov (United States)

    Fleischmann, Jacob; Rocha, Miguel A

    2015-01-01

    Candida albicans is an important polymorphic human pathogen. It can switch from a unicellular yeast form to germinating hypha, which may play a role in making it the successful pathogen it is. This hyphal transformation can be triggered by various extracellular stimuli, the most potent one being serum from any source. We have previously reported that Candida albicans transiently polyadenylates portions of both the large and small subunits of ribosomal RNA, shortly after serum exposure. Northern blots at the same time suggested that serum might induce a decrease in total ribosomal RNA. We have carried out a number of experiments to carefully assess this possibility and now report that serum significantly reduces ribosomal RNA in Candida albicans. Fluorometric measurements, Northern blotting and quantitative RT-PCR, have all confirmed this decrease. Timed experiments show that serum induces this decrease rapidly, as it was seen in as early as five minutes. Cell mass is not decreased as total cellular protein content remains the same and metabolic activity does not appear to slow, as assessed by XTT assay, and by the observation that cells form hyphal structures robustly. Another hyphal inducer, N-acetylglucosamine, also caused RNA decrease, but to a lesser extent. We also observed it in non-germinating yeast, such as Candida glabrata. The reason for this decrease is unknown and overall our data suggests that decrease in rRNA does not play a causal role in hyphal transformation. Rapid and significant decrease in a molecule so central to the yeast's biology is of some importance, and further studies, such as its effect on protein metabolism, will be required to better understand its purpose.

  13. DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA-derived chimera expressed in Escherichia coli.

    Science.gov (United States)

    Liu, Yamei; Stepanov, Victor G; Strych, Ulrich; Willson, Richard C; Jackson, George W; Fox, George E

    2010-12-06

    Manufacturing large quantities of recombinant RNAs by overexpression in a bacterial host is hampered by their instability in intracellular environment. To overcome this problem, an RNA of interest can be fused into a stable bacterial RNA for the resulting chimeric construct to accumulate in the cytoplasm to a sufficiently high level. Being supplemented with cost-effective procedures for isolation of the chimera from cells and recovery of the recombinant RNA from stabilizing scaffold, this strategy might become a viable alternative to the existing methods of chemical or enzymatic RNA synthesis. Sequence encoding a 71-nucleotide recombinant RNA was inserted into a plasmid-borne deletion mutant of the Vibrio proteolyticus 5S rRNA gene in place of helix III - loop C segment of the original 5S rRNA. After transformation into Escherichia coli, the chimeric RNA (3×pen aRNA) was expressed constitutively from E. coli rrnB P1 and P2 promoters. The RNA chimera accumulated to levels that exceeded those of the host's 5S rRNA. A novel method relying on liquid-solid partitioning of cellular constituents was developed for isolation of total RNA from bacterial cells. This protocol avoids toxic chemicals, and is therefore more suitable for large scale RNA purification than traditional methods. A pair of biotinylated 8-17 DNAzymes was used to bring about the quantitative excision of the 71-nt recombinant RNA from the chimera. The recombinant RNA was isolated by sequence-specific capture on beads with immobilized complementary deoxyoligonucleotide, while DNAzymes were recovered by biotin affinity chromatography for reuse. The feasibility of a fermentation-based approach for manufacturing large quantities of small RNAs in vivo using a "5S rRNA scaffold" strategy is demonstrated. The approach provides a route towards an economical method for the large-scale production of small RNAs including shRNAs, siRNAs and aptamers for use in clinical and biomedical research.

  14. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    Science.gov (United States)

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  15. RISSC: a novel database for ribosomal 16S-23S RNA genes spacer regions.

    Science.gov (United States)

    García-Martínez, J; Bescós, I; Rodríguez-Sala, J J; Rodríguez-Valera, F

    2001-01-01

    A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S-23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documentation tool for studies on evolution, identification, typing and strain characterization, among others.

  16. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection.

    Science.gov (United States)

    Au, Hilda H; Cornilescu, Gabriel; Mouzakis, Kathryn D; Ren, Qian; Burke, Jordan E; Lee, Seonghoon; Butcher, Samuel E; Jan, Eric

    2015-11-24

    The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts a triple-pseudoknotted RNA structure and occupies the core ribosomal E, P, and A sites to directly recruit the ribosome and initiate translation at a non-AUG codon. A subset of dicistrovirus IRESs directs translation in the 0 and +1 frames to produce the viral structural proteins and a +1 overlapping open reading frame called ORFx, respectively. Here we show that specific mutations of two unpaired adenosines located at the core of the three-helical junction of the honey bee dicistrovirus Israeli acute paralysis virus (IAPV) IRES PKI domain can uncouple 0 and +1 frame translation, suggesting that the structure adopts distinct conformations that contribute to 0 or +1 frame translation. Using a reconstituted translation system, we show that ribosomes assembled on mutant IRESs that direct exclusive 0 or +1 frame translation lack reading frame fidelity. Finally, a nuclear magnetic resonance/small-angle X-ray scattering hybrid approach reveals that the PKI domain of the IAPV IRES adopts an RNA structure that resembles a complete tRNA. The tRNA shape-mimicry enables the viral IRES to gain access to the ribosome tRNA-binding sites and form intermolecular contacts with the ribosome that are necessary for initiating IRES translation in a specific reading frame.

  17. Dataset of the transcribed 45S ribosomal RNA sequence of the tree crop “yerba mate”

    Directory of Open Access Journals (Sweden)

    Patricia M. Aguilera

    2017-06-01

    Full Text Available This contribution contains data related to the research article entitled “The 18S-25S ribosomal RNA unit of yerba mate (Ilex paraguariensis A. St.-Hil.” (Aguilera et al., 2016 [1]. Through a bioinformatic approach involving NGS data, we provide information of the transcribed 45S ribosomal RNA (rRNA sequence of yerba mate, the first reference for the Ilex L. genus. This dataset (Supplementary file 1 comprises information regarding the assembly and annotation of this rRNA unit. The generated data is applicable for comparative analysis and evolutionary studies among Ilex and related taxa. The raw sequencing data used here is available at DDBJ/EMBL/GenBank (NCBI Resource Coordinators, 2016 [2] Sequence Read Archive (SRA under the accession SRP043293 and the consensus 45S ribosomal RNA sequence has been deposited there under the accession GFHV00000000.

  18. Lateral transfer of eukaryotic ribosomal RNA genes: an emerging concern for molecular ecology of microbial eukaryotes.

    Science.gov (United States)

    Yabuki, Akinori; Toyofuku, Takashi; Takishita, Kiyotaka

    2014-07-01

    Ribosomal RNA (rRNA) genes are widely utilized in depicting organismal diversity and distribution in a wide range of environments. Although a few cases of lateral transfer of rRNA genes between closely related prokaryotes have been reported, it remains to be reported from eukaryotes. Here, we report the first case of lateral transfer of eukaryotic rRNA genes. Two distinct sequences of the 18S rRNA gene were detected from a clonal culture of the stramenopile, Ciliophrys infusionum. One was clearly derived from Ciliophrys, but the other gene originated from a perkinsid alveolate. Genome-walking analyses revealed that this alveolate-type rRNA gene is immediately adjacent to two protein-coding genes (ubc12 and usp39), and the origin of both genes was shown to be a stramenopile (that is, Ciliophrys) in our phylogenetic analyses. These findings indicate that the alveolate-type rRNA gene is encoded on the Ciliophrys genome and that eukaryotic rRNA genes can be transferred laterally.

  19. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

    2006-01-01

    of the embryonic genome. In the present study, ribosomal RNA (rRNA) transcription was investigated by visualization of the rRNA by fluorescent in situ hybridization, and subsequent visualization of the argyrophilic nucleolar proteins by silver staining. A total of 145 in vivo developed and 200 in vitro produced...... bovine embryos were investigated to allow comparison of transcription initiation. Signs of active transcription of rRNA were observed in the third cell cycle in 29% of the in vitro produced embryos (n=35) and in 58% of the in vivo developed embryos (n=11). Signs of active transcription of rRNA were...... not apparent in the early phase of the fourth cell cycle but restarted later on. All embryos in the fifth or later cell cycles were all transcribing rRNA. The signs of rRNA synthesis during the third and fourth embryonic cell cycles could be blocked by actinomycin D, which is a strong inhibitor of RNA...

  20. Structures of human SRP72 complexes provide insights into SRP RNA remodeling and ribosome interaction

    Science.gov (United States)

    Becker, Matthias M. M.; Lapouge, Karine; Segnitz, Bernd; Wild, Klemens; Sinning, Irmgard

    2017-01-01

    Co-translational protein targeting and membrane protein insertion is a fundamental process and depends on the signal recognition particle (SRP). In mammals, SRP is composed of the SRP RNA crucial for SRP assembly and function and six proteins. The two largest proteins SRP68 and SRP72 form a heterodimer and bind to a regulatory site of the SRP RNA. Despite their essential roles in the SRP pathway, structural information has been available only for the SRP68 RNA-binding domain (RBD). Here we present the crystal structures of the SRP68 protein-binding domain (PBD) in complex with SRP72-PBD and of the SRP72-RBD bound to the SRP S domain (SRP RNA, SRP19 and SRP68) detailing all interactions of SRP72 within SRP. The SRP72-PBD is a tetratricopeptide repeat, which binds an extended linear motif of SRP68 with high affinity. The SRP72-RBD is a flexible peptide crawling along the 5e- and 5f-loops of SRP RNA. A conserved tryptophan inserts into the 5e-loop forming a novel type of RNA kink-turn stabilized by a potassium ion, which we define as K+-turn. In addition, SRP72-RBD remodels the 5f-loop involved in ribosome binding and visualizes SRP RNA plasticity. Docking of the S domain structure into cryo-electron microscopy density maps reveals multiple contact sites between SRP68/72 and the ribosome, and explains the role of SRP72 in the SRP pathway. PMID:27899666

  1. Polynucleotide phosphorylase hinders mRNA degradation upon ribosomal protein S1 overexpression in Escherichia coli.

    Science.gov (United States)

    Briani, Federica; Curti, Serena; Rossi, Francesca; Carzaniga, Thomas; Mauri, Pierluigi; Dehò, Gianni

    2008-11-01

    The exoribonuclease polynucleotide phosphorylase (PNPase, encoded by pnp) is a major player in bacterial RNA decay. In Escherichia coli, PNPase expression is post-transcriptionally regulated at the level of mRNA stability. The primary transcript is very efficiently processed by the endonuclease RNase III at a specific site and the processed pnp mRNA is rapidly degraded in a PNPase-dependent manner. While investigating the PNPase autoregulation mechanism we found, by UV-cross-linking experiments, that the ribosomal protein S1 in crude extracts binds to the pnp-mRNA leader region. We assayed the potential role of S1 protein in pnp gene regulation by modulating S1 expression from depletion to overexpression. We found that S1 depletion led to a sharp decrease of the amount of pnp and other tested mRNAs, as detected by Northern blotting, whereas S1 overexpression caused a strong stabilization of pnp and the other transcripts. Surprisingly, mRNA stabilization depended on PNPase, as it was not observed in a pnp deletion strain. PNPase-dependent stabilization, however, was not detected by chemical decay assay of bulk mRNA. Overall, our data suggest that PNPase exonucleolytic activity may be modulated by the translation potential of the target mRNAs and that, upon ribosomal protein S1 overexpression, PNPase protects from degradation a set of full-length mRNAs. It thus appears that a single mRNA species may be differentially targeted to either decay or PNPase-dependent stabilization, thus preventing its depletion in conditions of fast turnover.

  2. Highly purified spermatozoal RNA obtained by a novel method indicates an unusual 28S/18S rRNA ratio and suggests impaired ribosome assembly.

    Science.gov (United States)

    Cappallo-Obermann, Heike; Schulze, Wolfgang; Jastrow, Holger; Baukloh, Vera; Spiess, Andrej-Nikolai

    2011-11-01

    Human spermatozoal RNA features special characteristics such as a significantly reduced quantity within spermatozoa compared with somatic cells is described as being devoid of ribosomal RNAs and is difficult to isolate due to a massive excess of genomic DNA in the lysates. Using a novel two-round column-based protocol for human ejaculates delivering highly purified spermatozoal RNA, we uncovered a heterogeneous, but specific banding pattern in microelectrophoresis with 28S ribosomal RNA being indicative for the amount of round cell contamination. Ejaculates with different round cell quantities and density-purified spermatozoa revealed that 18S rRNA but not 28S rRNA is inherent to a pure spermatozoal fraction. Transmission electron microscopy showed monoribosomes and polyribosomes in spermatozoal cytoplasm, while immunohistochemical results suggest the presence of proteins from small and large ribosomal subunits in retained spermatozoal cytoplasm irrespective of 28S rRNA absence.

  3. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  4. Streptomycin binds to the decoding center of 16 S ribosomal RNA.

    Science.gov (United States)

    Spickler, C; Brunelle, M N; Brakier-Gingras, L

    1997-10-31

    Streptomycin, an error-inducing aminoglycoside antibiotic, binds to a single site on the small ribosomal subunit of bacteria, but this site has not yet been defined precisely. Here, we demonstrate that streptomycin binds to E. coli 16 S rRNA in the absence of ribosomal proteins, and protects a set of bases in the decoding region against dimethyl sulfate attack. The binding studies were performed in a high ionic strength buffer containing 20 mM Mg2+. The pattern of protection in the decoding region was similar to that observed when streptomycin binds to the 30 S subunit. However, streptomycin also protects the 915 region of 16 S rRNA within the 30 S subunit, whereas it did not protect the 915 region of the naked 16 S rRNA. The interaction of streptomycin with 16 S rRNA was further defined by using two fragments that correspond to the 3' minor domain of 16 S rRNA and to the decoding analog, a portion of this domain encompassing the decoding center. In the presence of streptomycin, the pattern of protection against dimethyl sulfate attack for the two fragments was similar to that seen with the full-length 16 S rRNA. This indicates that the 3' minor domain as well as the decoding analog contain the recognition signals for the binding of streptomycin. However, streptomycin could not bind to the decoding analog in the absence of Mg2+. This contrasts with neomycin, another error-inducing aminoglycoside antibiotic, that binds to the decoding analog in the absence of Mg2+, but not at 20 mM Mg2+. Our results suggest that both neomycin and streptomycin interact with the decoding center, but recognize alternative conformations of this region.

  5. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale

    2008-08-01

    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  6. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion.

  7. Antibiotic resistance evolved via inactivation of a ribosomal RNA methylating enzyme

    Science.gov (United States)

    Stojković, Vanja; Noda-Garcia, Lianet; Tawfik, Dan S.; Fujimori, Danica Galonić

    2016-01-01

    Modifications of the bacterial ribosome regulate the function of the ribosome and modulate its susceptibility to antibiotics. By modifying a highly conserved adenosine A2503 in 23S rRNA, methylating enzyme Cfr confers resistance to a range of ribosome-targeting antibiotics. The same adenosine is also methylated by RlmN, an enzyme widely distributed among bacteria. While RlmN modifies C2, Cfr modifies the C8 position of A2503. Shared nucleotide substrate and phylogenetic relationship between RlmN and Cfr prompted us to investigate evolutionary origin of antibiotic resistance in this enzyme family. Using directed evolution of RlmN under antibiotic selection, we obtained RlmN variants that mediate low-level resistance. Surprisingly, these variants confer resistance not through the Cfr-like C8 methylation, but via inhibition of the endogenous RlmN C2 methylation of A2503. Detection of RlmN inactivating mutations in clinical resistance isolates suggests that the mechanism used by the in vitro evolved variants is also relevant in a clinical setting. Additionally, as indicated by a phylogenetic analysis, it appears that Cfr did not diverge from the RlmN family but from another distinct family of predicted radical SAM methylating enzymes whose function remains unknown. PMID:27496281

  8. Mutation of the mitochondrial large ribosomal RNA can provide pentamidine resistance to Saccharomyces cerevisiae.

    Science.gov (United States)

    Örs, Ş Tomris; Akdoğan, Emel; Dunn, Cory D

    2014-09-01

    Pentamidine is used to treat several trypanosomal diseases, as well as opportunistic infection by pathogenic fungi. However, the relevant targets of this drug are unknown. We isolated dominant mutations providing pentamidine resistance to Saccharomyces cerevisiae, one of which was localized to mitochondrial DNA. Next-generation sequencing revealed alteration of a widely conserved base at the peptidyl transferase center of the mitochondrial 21S ribosomal RNA. Our results provide a potential rationale for the toxicity of this drug to patients, and we discuss whether blockade of mitochondrial translation is the mechanism by which pathogenic fungi or protists are killed by pentamidine.

  9. Nonstop mRNA Decay: a Special Attribute of Trans-Translation Mediated Ribosome Rescue

    Directory of Open Access Journals (Sweden)

    Krithika eVenkataraman

    2014-03-01

    Full Text Available Decoding of aberrant mRNAs leads to unproductive ribosome stalling and sequestration of components of the translation machinery. Bacteria have evolved three seemingly independent pathways to resolve stalled translation complexes. The trans-translation process, orchestrated by the hybrid transfer-messenger RNA (tmRNA and its essential protein co-factor, SmpB, is the principal translation quality control system for rescuing unproductively stalled ribosomes. Two specialized alternative rescue pathways, coordinated by ArfA and ArfB, have been recently discovered. The SmpB-tmRNA mediated trans-translation pathway, in addition to re-mobilizing stalled translation complexes, co-translationally appends a degradation tag to the associated nascent polypeptides, marking them for proteolysis by various cellular proteases. Another unique feature of trans-translation, not shared by the alternative rescue pathways, is the facility to recruit RNase R for targeted degradation of nonstop mRNAs, thus preventing further futile cycles of translation. The distinct C-terminal lysine-rich (K-rich domain of RNase R is essential for its recruitment to stalled ribosomes. To gain new insights into the structure and function of RNase R, we investigated its global architecture, the spatial arrangement of its distinct domains, and the identities of key functional residues in its unique K-rich domain. Small-angle X-ray scattering (SAXS models of RNase R reveal a tri-lobed structure with flexible N- and C-terminal domains, and suggest intimate contacts between the K-rich domain and the catalytic core of the enzyme. Alanine-scanning mutagenesis of the K-rich domain, in the region spanning residues 735 and 750, has uncovered the precise amino acid determinants required for the productive engagement of RNase R on tmRNA-rescued ribosomes. Theses analyses demonstrate that alanine substitution of conserved residues E740 and K741 result in profound defects, not only in the recruitment

  10. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex.......The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...

  11. Mapping of the RNA recognition site of Escherichia coli ribosomal protein S7.

    Science.gov (United States)

    Robert, F; Gagnon, M; Sans, D; Michnick, S; Brakier-Gingras, L

    2000-11-01

    Bacterial ribosomal protein S7 initiates the folding of the 3' major domain of 16S ribosomal RNA by binding to its lower half. The X-ray structure of protein S7 from thermophilic bacteria was recently solved and found to be a modular structure, consisting of an alpha-helical domain with a beta-ribbon extension. To gain further insights into its interaction with rRNA, we cloned the S7 gene from Escherichia coli K12 into a pET expression vector and introduced 4 deletions and 12 amino acid substitutions in the protein sequence. The binding of each mutant to the lower half of the 3' major domain of 16S rRNA was assessed by filtration on nitrocellulose membranes. Deletion of the N-terminal 17 residues or deletion of the B hairpins (residues 72-89) severely decreased S7 affinity for the rRNA. Truncation of the C-terminal portion (residues 138-178), which includes part of the terminal alpha-helix, significantly affected S7 binding, whereas a shorter truncation (residues 148-178) only marginally influenced its binding. Severe effects were also observed with several strategic point mutations located throughout the protein, including Q8A and F17G in the N-terminal region, and K35Q, G54S, K113Q, and M115G in loops connecting the alpha-helices. Our results are consistent with the occurrence of several sites of contact between S7 and the 16S rRNA, in line with its role in the folding of the 3' major domain.

  12. Studies on the control of ribosomal RNA synthesis in HeLa cells.

    Science.gov (United States)

    Chesterton, C J; Coupar, B E; Butterworth, P H; Green, M H

    1975-09-01

    In many eucaryotic systems protein synthesis is coupled to ribosomal RNA synthesis such that shut-down of the former causes inhibition of the latter. We have investigated this stringency phenomenon in HeLa cells. The protein synthesis inhibitors cycloheximide and puromycin cause inactivation of both processes but valine starvation totally inhibits only the processing of 45-S RNA. DNA-dependent RNA polymerases from A, B and C (or I, II and III respectively) were extracted, separated partially by DEAE-cellulose chromatography and their activity levels determined. These do not decrease significantly during inhibition of protein synthesis. To find out whether or not form A is bound to its template under these conditions, proteins were removed from chromatin with the detergent sarkosyl. This does not affect bound RNA polymerase. Inhibition of protein synthesis caused up to 50% reduction in endogenous alpha-amanitin-insensitive chromatin-RNA-synthesising activity. This reduced level of activity was not affected by sarkosyl treatment. Levels in normal cells were stimulated. This result indicates that the form A RNA polymerase is not bound to its template when protein synthesis is inhibited.

  13. Effects of ethidium bromide on the production of ribosomal RNA in cultured mouse cells.

    Science.gov (United States)

    Lange, M; May, P

    1979-06-25

    A treatment of primary mouse kidney cell cultures with 5 microM Ethidium Bromide (Eth Br) reduces the transcription of nuclear-coded genes and especially of ribosomal RNA genes. This effect was consistently observed when comparing drug-treated and control cells for (i), the incorporation of 3H uridine into total nuclear and B RNA polymerases as determined in isolated nuclei. It became more pronounced with exposure time; however, after removal of the drug, there was a progressive recovery of RNA synthesis culminating in the complete reversal of the drug effect. That this effect is probably not due only to the suppression of mitochondrial protein synthesis by the drug, is shown by a comparative study of the effects of chloramphenicol treatment. In addition, in the cytoplasm Eth Br depresses the labeling of 28 S rRNA more than that of 18 S whereas no abnormal accumulation of 28 S rRNA is observed in the nucleus. It is suggested that Eth Br may affect either the stability of the 28 S rRNA or its rate of formation from the 32 S precursor.

  14. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    supported the model. We thus suggest that translation-rate-mediated differences in the spacing between ribosomes in this early coding region is a parameter that determines the mRNAs functional half-life. We present a model that is in accordance with many earlier observations and that allows a prediction...... codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts......Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  15. Cell-Type-Specific mRNA Purification by Translating Ribosome Affinity Purification (TRAP)

    Science.gov (United States)

    Heiman, Myriam; Kulicke, Ruth; Fenster, Robert J.; Greengard, Paul; Heintz, Nathaniel

    2014-01-01

    Cellular diversity and architectural complexity create barriers to understanding the function of the mammalian central nervous system (CNS) at a molecular level. To address this problem, we recently developed a methodology that provides the ability to profile the entire translated mRNA complement of any genetically defined cell population. This methodology, which we termed translating ribosome affinity purification, or TRAP, combines cell-type-specific transgene expression with affinity purification of translating ribosomes. TRAP can be used to study the cell-type-specific mRNA profiles of any genetically defined cell type, and has been successfully used to date in organisms ranging from D. melanogaster to mice and human cultured cells. Unlike other methodologies that rely upon micro-dissection, cell panning, or cell sorting, the TRAP methodology bypasses the need for tissue fixation or single-cell suspensions (and potential artifacts these treatments introduce), and reports on mRNAs in the entire cell body. This protocol provides a step-by-step guide to implementing the TRAP methodology, which takes two days to complete once all materials are in hand. PMID:24810037

  16. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S

    1991-01-01

    4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....

  17. [Study of the mRNA-binding region of ribosomes at different steps of translation. II. Affinity modification of Escherichia coli ribosomes by benzylidene derivative of AUGU6 in the 70S initiation complex].

    Science.gov (United States)

    Babkina, G T; Karpova, G G; Matasova, N B; Berzin', V M; Gren, E Ia

    1985-01-01

    2',3'-O-(4-[N-(2-chloroethyl)-N-methylamino]) benzylidene derivative of AUGU6 was used for identification of the proteins in the region of the mRNA-binding centre of E. coli ribosomes. This derivative alkylated ribosomes (preferentially 30S ribosomal) with high efficiency within the 70S initiation complex. In both 30S and 50S ribosomal subunits proteins and rRNA were modified. Specificity of the alkylation of ribosomal proteins and rRNA with the reagent was proved by the inhibitory action of AUGU6. Using the method of two-dimensional electrophoresis in polyacrylamide gel the proteins S4, S12, S13, S14, S15, S18, S19 and S20/L26 which are labelled by the analog of mRNA were identified.

  18. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    Science.gov (United States)

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives.

  19. Ribosomal RNA gene diversity, effective population size, and evolutionary longevity in asexual glomeromycota.

    Science.gov (United States)

    Vankuren, Nicholas W; den Bakker, Henk C; Morton, Joseph B; Pawlowska, Teresa E

    2013-01-01

    Arbuscular mycorrhizal fungi (phylum Glomeromycota) are among the oldest and most successful symbionts of land plants. With no evidence of sexual reproduction, their evolutionary success is inconsistent with the prediction that asexual taxa are vulnerable to extinction due to accumulation of deleterious mutations. To explore why Glomeromycota defy this prediction, we studied ribosomal RNA (rRNA) gene evolution in the Claroideoglomus lineage and estimated effective population size, N(e) , in C. etunicatum. We found that rRNA genes of these fungi exhibit unusual and complex patterns of molecular evolution. In C. etunicatum, these patterns can be collectively explained by an unexpectedly large N(e) combined with imperfect genome-wide and population-level rRNA gene repeat homogenization. The mutations accumulated in rRNA gene sequences indicate that natural selection is effective at purging deleterious mutations in the Claroideoglomus lineage, which is also consistent with the large N(e) of C. etunicatum. We propose that in the near absence of recombination, asexual reproduction involving massively multinucleate spores typical for Glomeromycota is responsible for the improved efficacy of selection relative to drift. We postulate that large effective population sizes contribute to the evolutionary longevity of Glomeromycota.

  20. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA....... Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... to form translationally active ribosomes. The function of 23S rRNA is largely reestablished by introduction of an alternative G1262.C2017 or U1262.A2017 pair, although neither of these supports polysome formation quite as effectively as the wild-type pair. A 23S rRNA with a C1262.G2017 pair...

  1. The putative RNA helicase HELZ promotes cell proliferation, translation initiation and ribosomal protein S6 phosphorylation.

    Directory of Open Access Journals (Sweden)

    Philippe A Hasgall

    Full Text Available The hypoxia-inducible transcription factor (HIF is a key component of the cellular adaptation mechanisms to hypoxic conditions. HIFα subunits are degraded by prolyl-4-hydroxylase domain (PHD enzyme-dependent prolyl-4-hydroxylation of LxxLAP motifs that confer oxygen-dependent proteolytic degradation. Interestingly, only three non-HIFα proteins contain two conserved LxxLAP motifs, including the putative RNA helicase with a zinc finger domain HELZ. However, HELZ proteolytic regulation was found to be oxygen-independent, supporting the notion that a LxxLAP sequence motif alone is not sufficient for oxygen-dependent protein destruction. Since biochemical pathways involving RNA often require RNA helicases to modulate RNA structure and activity, we used luciferase reporter gene constructs and metabolic labeling to demonstrate that HELZ overexpression activates global protein translation whereas RNA-interference mediated HELZ suppression had the opposite effect. Although HELZ interacted with the poly(A-binding protein (PABP via its PAM2 motif, PABP was dispensable for HELZ function in protein translation. Importantly, downregulation of HELZ reduced translational initiation, resulting in the disassembly of polysomes, in a reduction of cell proliferation and hypophosphorylation of ribosomal protein S6.

  2. Label- and amplification-free electrochemical detection of bacterial ribosomal RNA.

    Science.gov (United States)

    Henihan, Grace; Schulze, Holger; Corrigan, Damion K; Giraud, Gerard; Terry, Jonathan G; Hardie, Alison; Campbell, Colin J; Walton, Anthony J; Crain, Jason; Pethig, Ronald; Templeton, Kate E; Mount, Andrew R; Bachmann, Till T

    2016-07-15

    Current approaches to molecular diagnostics rely heavily on PCR amplification and optical detection methods which have restrictions when applied to point of care (POC) applications. Herein we describe the development of a label-free and amplification-free method of pathogen detection applied to Escherichia coli which overcomes the bottleneck of complex sample preparation and has the potential to be implemented as a rapid, cost effective test suitable for point of care use. Ribosomal RNA is naturally amplified in bacterial cells, which makes it a promising target for sensitive detection without the necessity for prior in vitro amplification. Using fluorescent microarray methods with rRNA targets from a range of pathogens, an optimal probe was selected from a pool of probe candidates identified in silico. The specificity of probes was investigated on DNA microarray using fluorescently labeled 16S rRNA target. The probe yielding highest specificity performance was evaluated in terms of sensitivity and a LOD of 20 pM was achieved on fluorescent glass microarray. This probe was transferred to an EIS end point format and specificity which correlated to microarray data was demonstrated. Excellent sensitivity was facilitated by the use of uncharged PNA probes and large 16S rRNA target and investigations resulted in an LOD of 50 pM. An alternative kinetic EIS assay format was demonstrated with which rRNA could be detected in a species specific manner within 10-40min at room temperature without wash steps.

  3. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  4. Recognizing RNA structural motifs in HT-SELEX data for ribosomal protein S15.

    Science.gov (United States)

    Pei, Shermin; Slinger, Betty L; Meyer, Michelle M

    2017-06-06

    Proteins recognize many different aspects of RNA ranging from single stranded regions to discrete secondary or tertiary structures. High-throughput sequencing (HTS) of in vitro selected populations offers a large scale method to study RNA-proteins interactions. However, most existing analysis methods require that the binding motifs are enriched in the population relative to earlier rounds, and that motifs are found in a loop or single stranded region of the potential RNA secondary structure. Such methods do not generalize to all RNA-protein interaction as some RNA binding proteins specifically recognize more complex structures such as double stranded RNA. In this study, we use HT-SELEX derived populations to study the landscape of RNAs that interact with Geobacillus kaustophilus ribosomal protein S15. Our data show high sequence and structure diversity and proved intractable to existing methods. Conventional programs identified some sequence motifs, but these are found in less than 5-10% of the total sequence pool. Therefore, we developed a novel framework to analyze HT-SELEX data. Our process accounts for both sequence and structure components by abstracting the overall secondary structure into smaller substructures composed of a single base-pair stack, which allows us to leverage existing approaches already used in k-mer analysis to identify enriched motifs. By focusing on secondary structure motifs composed of specific two base-pair stacks, we identified significantly enriched or depleted structure motifs relative to earlier rounds. Discrete substructures are likely to be important to RNA-protein interactions, but they are difficult to elucidate. Substructures can help make highly diverse sequence data more tractable. The structure motifs provide limited accuracy in predicting enrichment suggesting that G. kaustophilus S15 can either recognize many different secondary structure motifs or some aspects of the interaction are not captured by the analysis. This

  5. Molecular Identification of Ptychodera flava (Hemichordata: Enteropneusta): Reconsideration in Light of Nucleotide Polymorphism in the 18S Ribosomal RNA Gene.

    Science.gov (United States)

    Urata, Makoto

    2015-06-01

    Seven nuclear and mitochondrial DNA markers were examined in 12 specimens of Ptychodera flava, a model acorn worm used in molecular biology, collected in Japan from three local populations with different modes of living. A comparison of intraspecific results did not show genetically isolated populations despite the species' enclave habitats and asexual reproduction. Moreover, both the nuclear 18S ribosomal RNA gene and mitochondrial 16S ribosomal RNA gene sequences were identical to those from Moorea in French Polynesia, nearly 10,000 kilometers away from Japan. I also provide the first definitive information regarding polymorphisms in 18S ribosomal RNA gene, the external transcribed spacer (ETS), internal transcribed spacers (ITS), and mitochondrial cytochrome c oxidase subunit 1 (mtCO1) sequence in hemichordates using newly designed primer sets, and I show both high larval vagility and certain criteria for the molecular identification of this species.

  6. The bacterial toxin RelE induces specific mRNA cleavage in the A site of the eukaryote ribosome

    Science.gov (United States)

    Andreev, Dmitri; Hauryliuk, Vasili; Terenin, Ilya; Dmitriev, Sergey; Ehrenberg, Måns; Shatsky, Ivan

    2008-01-01

    RelE/RelB is a well-characterized toxin–anti-toxin pair involved in nutritional stress responses in Bacteria and Archae. RelE lacks any eukaryote homolog, but we demonstrate here that it efficiently and specifically cleaves mRNA in the A site of the eukaryote ribosome. The cleavage mechanism is similar to that in bacteria, showing the feasibility of A-site cleavage of mRNA for regulatory purposes also in eukaryotes. RelE cleavage in the A-site codon of a stalled eukaryote ribosome is precise and easily monitored, making “RelE printing” a useful complement to toeprinting to determine the exact mRNA location on the eukaryote ribosome and to probe the occupancy of its A site. PMID:18083838

  7. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  8. DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA-derived chimera expressed in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Willson Richard C

    2010-12-01

    Full Text Available Abstract Background Manufacturing large quantities of recombinant RNAs by overexpression in a bacterial host is hampered by their instability in intracellular environment. To overcome this problem, an RNA of interest can be fused into a stable bacterial RNA for the resulting chimeric construct to accumulate in the cytoplasm to a sufficiently high level. Being supplemented with cost-effective procedures for isolation of the chimera from cells and recovery of the recombinant RNA from stabilizing scaffold, this strategy might become a viable alternative to the existing methods of chemical or enzymatic RNA synthesis. Results Sequence encoding a 71-nucleotide recombinant RNA was inserted into a plasmid-borne deletion mutant of the Vibrio proteolyticus 5S rRNA gene in place of helix III - loop C segment of the original 5S rRNA. After transformation into Escherichia coli, the chimeric RNA (3×pen aRNA was expressed constitutively from E. coli rrnB P1 and P2 promoters. The RNA chimera accumulated to levels that exceeded those of the host's 5S rRNA. A novel method relying on liquid-solid partitioning of cellular constituents was developed for isolation of total RNA from bacterial cells. This protocol avoids toxic chemicals, and is therefore more suitable for large scale RNA purification than traditional methods. A pair of biotinylated 8-17 DNAzymes was used to bring about the quantitative excision of the 71-nt recombinant RNA from the chimera. The recombinant RNA was isolated by sequence-specific capture on beads with immobilized complementary deoxyoligonucleotide, while DNAzymes were recovered by biotin affinity chromatography for reuse. Conclusions The feasibility of a fermentation-based approach for manufacturing large quantities of small RNAs in vivo using a "5S rRNA scaffold" strategy is demonstrated. The approach provides a route towards an economical method for the large-scale production of small RNAs including shRNAs, siRNAs and aptamers for use

  9. The ribosomal genes of Mycoplasma capricolum.

    Science.gov (United States)

    Muto, A; Hori, H; Sawada, M; Kawauchi, Y; Iwami, M; Yamao, F; Osawa, S

    1983-01-01

    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is more similar to that of the gram-positive bacteria than that of the gram-negative bacteria. The presence of two copies of rRNA genes in M. capricolum genome has been demonstrated. The two different rRNA gene clusters have been cloned in E. coli plasmid vectors and analyzed for the rRNA gene organizations, demonstrating that the gene arrangement is in the order of 16S, 23S, and 5S rDNA. The ribosomes of M. capricolum contain about 30 species of proteins in 50S and 20 in 30S subunits. The number and size of the ribosomal proteins are not significantly different from those of other eubacterial ribosomes.

  10. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Directory of Open Access Journals (Sweden)

    Markus Buchhaupt

    Full Text Available Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  11. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Science.gov (United States)

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  12. Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli.

    Science.gov (United States)

    Knutsson Jenvert, Rose-Marie; Holmberg Schiavone, Lovisa

    2005-02-01

    Stringent factor is a ribosome-dependent ATP:GTP pyrophosphoryl transferase that synthesizes (p)ppGpp upon nutrient deprivation. It is activated by unacylated tRNA in the ribosomal amino-acyl site (A-site) but it is unclear how activation occurs. A His-tagged stringent factor was isolated by affinity-chromatography and precipitation. This procedure yielded a protein of high purity that displayed (a) a low endogenous pyrophosphoryl transferase activity that was inhibited by the antibiotic tetracycline; (b) a low ribosome-dependent activity that was inhibited by the A-site specific antibiotics thiostrepton, micrococcin, tetracycline and viomycin; (c) a tRNA- and ribosome-dependent activity amounting to 4500 pmol pppGpp per pmol stringent factor per minute. Footprinting analysis showed that stringent factor interacted with ribosomes that contained tRNAs bound in classical states. Maximal activity was seen when the ribosomal A-site was presaturated with unacylated tRNA. Less tRNA was required to reach maximal activity when stringent factor and unacylated tRNA were added simultaneously to ribosomes, suggesting that stringent factor formed a complex with tRNA in solution that had higher affinity for the ribosomal A-site. However, tRNA-saturation curves, performed at two different ribosome/stringent factor ratios and filter-binding assays, did not support this hypothesis.

  13. Model of EF4-induced ribosomal state transitions and mRNA translocation

    Science.gov (United States)

    Xie, Ping

    2014-08-01

    EF4, a highly conserved protein present in bacteria, mitochondria and chloroplasts, can bind to both the posttranslocation and pretranslocation ribosomal complexes. When binding to the posttranslocation state, it catalyzes backward translocation to a pretranslocation state. When binding to the pretranslocation state, it catalyzes transition to another pretranslocation state that is similar and possibly identical to that resulting from the posttranslocation state bound by EF4, and competes with EF-G to regulate the elongation cycle. However, the molecular mechanism on how EF4 induces state transitions and mRNA translocation remains unclear. Here, we present both the model for state transitions induced by EF4 binding to the posttranslocation state and that by EF4 binding to the pretranslocation state, based on which we study the kinetics of EF4-induced state transitions and mRNA translocation, giving quantitative explanations of the available experimental data. Moreover, we present some predicted results on state transitions and mRNA translocation induced by EF4 binding to the pretranslocation state complexed with the mRNA containing a duplex region.

  14. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Science.gov (United States)

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  15. Profiling of 2'-O-Me in human rRNA reveals a subset of fractionally modified positions and provides evidence for ribosome heterogeneity

    DEFF Research Database (Denmark)

    Krogh, Nicolai; Jansson, Martin D; Häfner, Sophia J

    2016-01-01

    Ribose methylation is one of the two most abundant modifications in human ribosomal RNA and is believed to be important for ribosome biogenesis, mRNA selectivity and translational fidelity. We have applied RiboMeth-seq to rRNA from HeLa cells for ribosome-wide, quantitative mapping of 2'-O-Me sites...... and obtained a comprehensive set of 106 sites, including two novel sites, and with plausible box C/D guide RNAs assigned to all but three sites. We find approximately two-thirds of the sites to be fully methylated and the remainder to be fractionally modified in support of ribosome heterogeneity at the level...

  16. RACK1 is a ribosome scaffold protein for β-actin mRNA/ZBP1 complex.

    Directory of Open Access Journals (Sweden)

    Marcello Ceci

    Full Text Available In neurons, specific mRNAs are transported in a translationally repressed manner along dendrites or axons by transport ribonucleic-protein complexes called RNA granules. ZBP1 is one RNA binding protein present in transport RNPs, where it transports and represses the translation of cotransported mRNAs, including β-actin mRNA. The release of β-actin mRNA from ZBP1 and its subsequent translation depends on the phosphorylation of ZBP1 by Src kinase, but little is known about how this process is regulated. Here we demonstrate that the ribosomal-associated protein RACK1, another substrate of Src, binds the β-actin mRNA/ZBP1 complex on ribosomes and contributes to the release of β-actin mRNA from ZBP1 and to its translation. We identify the Src binding and phosphorylation site Y246 on RACK1 as the critical site for the binding to the β-actin mRNA/ZBP1 complex. Based on these results we propose RACK1 as a ribosomal scaffold protein for specific mRNA-RBP complexes to tightly regulate the translation of specific mRNAs.

  17. Connecting the kinetics and energy landscape of tRNA translocation on the ribosome.

    Science.gov (United States)

    Whitford, Paul C; Blanchard, Scott C; Cate, Jamie H D; Sanbonmatsu, Karissa Y

    2013-01-01

    Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds) to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states.

  18. A minor class of 5S rRNA genes in Saccharomyces cerevisiae X2180-1B, one member of which lies adjacent to a Ty transposable element.

    OpenAIRE

    Piper, P W; Lockheart, A; Patel, N.

    1984-01-01

    In Saccharomyces cerevisiae the majority of the genes for 5S rRNA lie within a 9kb rDNA sequence that is present as 100-200 tandemly-repeated copies on Chromosome XII. Following our observations that about 10% of yeast 5S rRNA exists as minor variant sequences, we screened a collection of yeast DNA fragments cloned in lambda gt for 5S rRNA genes whose flanking sequences differed from those adjacent to 5S rRNA genes of the rDNA repeat. Three variant 5S rRNA genes were isolated on the basis of ...

  19. Basonuclin regulates a subset of ribosomal RNA genes in HaCaT cells.

    Directory of Open Access Journals (Sweden)

    Shengliang Zhang

    Full Text Available Basonuclin (Bnc1, a cell-type-specific ribosomal RNA (rRNA gene regulator, is expressed mainly in keratinocytes of stratified epithelium and gametogenic cells of testis and ovary. Previously, basonuclin was shown in vitro to interact with rRNA gene (rDNA promoter at three highly conserved sites. Basonuclin's high affinity binding site overlaps with the binding site of a dedicated and ubiquitous Pol I transcription regulator, UBF, suggesting that their binding might interfere with each other if they bind to the same promoter. Knocking-down basonuclin in mouse oocytes eliminated approximately one quarter of RNA polymerase I (Pol I transcription foci, without affecting the BrU incorporation of the remaining ones, suggesting that basonuclin might regulate a subset of rDNA. Here we show, via chromatin immunoprecipitation (ChIP, that basonuclin is associated with rDNA promoters in HaCaT cells, a spontaneously established human keratinocyte line. Immunoprecipitation data suggest that basonuclin is in a complex that also contains the subunits of Pol I (RPA194, RPA116, but not UBF. Knocking-down basonuclin in HaCaT cells partially impairs the association of RPA194 to rDNA promoter, but not that of UBF. Basonuclin-deficiency also reduces the amount of 47S pre-rRNA, but this effect can be seen only after cell-proliferation related rRNA synthesis has subsided at a higher cell density. DNA sequence of basonuclin-bound rDNA promoters shows single nucleotide polymorphisms (SNPs that differ from those associated with UBF-bound promoters, suggesting that basonuclin and UBF interact with different subsets of promoters. In conclusion, our results demonstrate basonuclin's functional association with rDNA promoters and its interaction with Pol I in vivo. Our data also suggest that basonuclin-Pol I complex transcribes a subset of rDNA.

  20. Genetic characterization of clinical acanthamoeba isolates from Japan using nuclear and mitochondrial small subunit ribosomal RNA.

    Science.gov (United States)

    Rahman, Md Moshiur; Yagita, Kenji; Kobayashi, Akira; Oikawa, Yosaburo; Hussein, Amjad I A; Matsumura, Takahiro; Tokoro, Masaharu

    2013-08-01

    Because of an increased number of Acanthamoeba keratitis (AK) along with associated disease burdens, medical professionals have become more aware of this pathogen in recent years. In this study, by analyzing both the nuclear 18S small subunit ribosomal RNA (18S rRNA) and mitochondrial 16S rRNA gene loci, 27 clinical Acanthamoeba strains that caused AK in Japan were classified into 3 genotypes, T3 (3 strains), T4 (23 strains), and T5 (one strain). Most haplotypes were identical to the reference haplotypes reported from all over the world, and thus no specificity of the haplotype distribution in Japan was found. The T4 sub-genotype analysis using the 16S rRNA gene locus also revealed a clear sub-conformation within the T4 cluster, and lead to the recognition of a new sub-genotype T4i, in addition to the previously reported sub-genotypes T4a-T4h. Furthermore, 9 out of 23 strains in the T4 genotype were identified to a specific haplotype (AF479533), which seems to be a causal haplotype of AK. While heterozygous nuclear haplotypes were observed from 2 strains, the mitochondrial haplotypes were homozygous as T4 genotype in the both strains, and suggested a possibility of nuclear hybridization (mating reproduction) between different strains in Acanthamoeba. The nuclear 18S rRNA gene and mitochondrial 16S rRNA gene loci of Acanthamoeba spp. possess different unique characteristics usable for the genotyping analyses, and those specific features could contribute to the establishment of molecular taxonomy for the species complex of Acanthamoeba.

  1. Corynebacterium glutamicum RNase E/G-type endoribonuclease encoded by NCgl2281 is involved in the 5' maturation of 5S rRNA.

    Science.gov (United States)

    Maeda, Tomoya; Wachi, Masaaki

    2012-02-01

    Corynebacterium glutamicum has one RNase E/G ortholog and one RNase J ortholog but no RNase Y. We previously reported that the C. glutamicum NCgl2281 gene encoding the RNase E/G ortholog complemented the rng::cat mutation in Escherichia coli but not the rne-1 mutation. In this study, we constructed an NCgl2281 knockout mutant and found that the mutant cells accumulated 5S rRNA precursor molecules. The processing of 16S and 23S rRNA, tRNA, and tmRNA was normal. Primer extension analysis revealed that the RNase E/G ortholog cleaved at the -1 site of the 5' end of 5S rRNA. However, 3' maturation was essentially unaffected. These findings showed that C. glutamicum NCgl2281 endoribonuclease is involved in the 5' maturation of 5S rRNA. This is the first report showing the physiological function of the RNase E/G ortholog in bacteria having one RNase E/G and one RNase J but no RNase Y.

  2. Sequence and secondary structure of the mitochondrial 16S ribosomal RNA gene of Ixodes scapularis.

    Science.gov (United States)

    Krakowetz, Chantel N; Chilton, Neil B

    2015-02-01

    The complete DNA sequences and secondary structure of the mitochondrial (mt) 16S ribosomal (r) RNA gene were determined for six Ixodes scapularis adults. There were 44 variable nucleotide positions in the 1252 bp sequence alignment. Most (95%) nucleotide alterations did not affect the integrity of the secondary structure of the gene because they either occurred at unpaired positions or represented compensatory changes that maintained the base pairing in helices. A large proportion (75%) of the intraspecific variation in DNA sequence occurred within Domains I, II and VI of the 16S gene. Therefore, several regions within this gene may be highly informative for studies of the population genetics and phylogeography of I. scapularis, a major vector of pathogens of humans and domestic animals in North America.

  3. Small-subunit ribosomal RNA gene sequences of Phaeodarea challenge the monophyly of Haeckel's Radiolaria.

    Science.gov (United States)

    Polet, Stephane; Berney, Cédric; Fahrni, José; Pawlowski, Jan

    2004-03-01

    In his grand monograph of Radiolaria, Ernst Haeckel originally included Phaeodarea together with Acantharea and Polycystinea, all three taxa characterized by the presence of a central capsule and the possession of axopodia. Cytological and ultrastructural studies, however, questioned the monophyly of Radiolaria, suggesting an independent evolutionary origin of the three taxa, and the first molecular data on Acantharea and Polycystinea brought controversial results. To test further the monophyly of Radiolaria, we sequenced the complete small subunit ribosomal RNA gene of three phaeodarians and three polycystines. Our analyses reveal that phaeodarians clearly branch among the recently described phylum Cercozoa, separately from Acantharea and Polycystinea. This result enhances the morphological variability within the phylum Cercozoa, which already contains very heterogeneous groups of protists. Our study also confirms the common origin of Acantharea and Polycystinea, which form a sister-group to the Cercozoa, and allows a phylogenetic reinterpretation of the morphological features of the three radiolarian groups.

  4. Ribosome-associated GTPases: the role of RNA for GTPase activation.

    Science.gov (United States)

    Clementi, Nina; Polacek, Norbert

    2010-01-01

    The GTPase super-family comprises a variety of G proteins found in all three domains of life. Although they are participating in completely different processes like signal transduction, protein biosynthesis and regulation of cell proliferation, they all share a highly conserved G domain and use a common mechanism for GTP hydrolysis. Exact timing in hydrolyzing the bound GTP serves as a molecular switch to initiate diverse cellular reactions. Classical GTPases depend on external proteins to fire GTP hydrolysis (GAPs), and following the GTPase reaction to exchange GDP for GTP (GEFs), converting the GTPase into the active state again. In recent years it became clear that there are many GTPases that do not follow this classical switch mode scheme. Certain ribosome-associated GTPases are not reliant on other GEF proteins to exchange GDP for GTP. Furthermore many of these G proteins are not activated by external GAPs, but by evolutionarily ancient molecules, namely by RNA.

  5. Routine forensic use of the mitochondrial 12S ribosomal RNA gene for species identification.

    Science.gov (United States)

    Melton, Terry; Holland, Charity

    2007-11-01

    Since July 2004, Mitotyping Technologies has been amplifying and sequencing a approximately 150 base pair fragment of mitochondrial DNA (mtDNA) that codes for 12S ribosomal RNA, to identify the species origin of nonhuman casework samples. The approximately 100 base pair sequence product is searched at http://www.ncbi.nlm.nih.gov/BLAST and the species match is reported. The use of this assay has halved the number of samples for which no mtDNA results are obtained and is especially useful on hairs and degraded samples. The availability of species determination may aid forensic investigators in opening or closing off lines of inquiry where a highly probative but challenging sample has been collected.

  6. 微孢子虫核糖体小亚单位RNA(ssUrRNA)基因%Small Subunit Ribosomal RNA Genes of Microsporidia

    Institute of Scientific and Technical Information of China (English)

    王见杨; 黄可威; 毛西成; 赵 昀; 陆长德

    2001-01-01

    微孢子虫是广泛分布于自然界的细胞内原虫类寄生物。它们可寄生于整个生物界。微孢子虫是真核生物,但其核糖体及核糖体RNA(rRNA)为原核生物型。为探讨9种家蚕病原性微孢子虫的种属地位及亲缘关系,对已广泛用于生物进化分类的核糖体小亚单位RNA(asurRNA)基因进行了研究。由微孢子虫ssurRNA基因序列同源性分析所构建的系统进化发育树及Southam杂交分析表明,这9种微孢子虫同为Nosema属,为同属不同种。%Microsporidia are ubiquitous intracellular parasitic protozoa infecting all types of animals. Their ribosomes and rRNAs are of prokaryotic size. In order to better understand their phylogenetic relationship and identify the uncertain species, the sequences of the small subunit ribosomal RNA (ssurRNA, 16 S rRNA) genesof nine microsporidia infectious to the silkworm, Bombyx mori, were determined. The results of phylogenetic trees and Southern blotting suggest all the nine strains of icrosporidia are various species of the genus Nosema.

  7. Terminal-sequence studies of high-molecular-weight ribonucleic acid. The 3'-termini of rabbit reticulocyte ribosomal RNA.

    Science.gov (United States)

    Hunt, J A

    1970-11-01

    Sequences of the polynucleotide chains of RNA found in the large and small ribosomal subunits of rabbit reticulocytes have been determined from the 3'-end by use of periodate oxidation and condensation with [(3)H]isoniazid and by stepwise degradation. By these methods the hexanucleotide sequences have been found as -pGpUpUpUpGpU for the 28S RNA and -pGpUpCpGpCpU for the 6S RNA of the large ribosomal subunit and the octanucleotide sequence -pGpApUpCpApUpUpA for the 18S rRNA of the small ribosomal subunit. These sequences are present in at least 70% of all the RNA molecules and are discussed in relation to the specific cleavage of rRNA from its precursors and the role of multiple cistrons for rRNA in the DNA of higher organisms. The feasibility of using the method for longer sequence determinations is discussed.

  8. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua; (NCI)

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  9. Combined heat shock protein 90 and ribosomal RNA sequence phylogeny supports multiple replacements of dinoflagellate plastids.

    Science.gov (United States)

    Shalchian-Tabrizi, Kamran; Minge, Marianne A; Cavalier-Smith, Tom; Nedreklepp, Joachim M; Klaveness, Dag; Jakobsen, Kjetill S

    2006-01-01

    Dinoflagellates harbour diverse plastids obtained from several algal groups, including haptophytes, diatoms, cryptophytes, and prasinophytes. Their major plastid type with the accessory pigment peridinin is found in the vast majority of photosynthetic species. Some species of dinoflagellates have other aberrantly pigmented plastids. We sequenced the nuclear small subunit (SSU) ribosomal RNA (rRNA) gene of the "green" dinoflagellate Gymnodinium chlorophorum and show that it is sister to Lepidodinium viride, indicating that their common ancestor obtained the prasinophyte (or other green alga) plastid in one event. As the placement of dinoflagellate species that acquired green algal or haptophyte plastids is unclear from small and large subunit (LSU) rRNA trees, we tested the usefulness of the heat shock protein (Hsp) 90 gene for dinoflagellate phylogeny by sequencing it from four species with aberrant plastids (G. chlorophorum, Karlodinium micrum, Karenia brevis, and Karenia mikimotoi) plus Alexandrium tamarense, and constructing phylogenetic trees for Hsp90 and rRNAs, separately and together. Analyses of the Hsp90 and concatenated data suggest an ancestral origin of the peridinin-containing plastid, and two independent replacements of the peridinin plastid soon after the early radiation of the dinoflagellates. Thus, the Hsp90 gene seems to be a promising phylogenetic marker for dinoflagellate phylogeny.

  10. Analysis of the interaction between bovine mitochondrial 28 S ribosomal subunits and mRNA.

    Science.gov (United States)

    Farwell, M A; Schirawski, J; Hager, P W; Spremulli, L L

    1996-11-11

    The small subunit of the bovine mitochondrial ribosome forms a tight complex with mRNAs. This [28 S:mRNA] complex forms as readily on circular mRNAs as on linear mRNAs indicating that a free 5' end on the mRNA is not required for the interaction observed. The effects of monovalent cations on the equilibrium association constant and on the forward and reverse rate constants governing this interaction have been determined. Monovalent cations have a strong effect on the forward rate constant. Increasing the KCl concentration from 1 mM to 100 mM reduces kon by nearly 100-fold. Monovalent cations have only a small effect on the reverse rate constant, koff'. Analysis of these data indicates that the rate laws governing the formation and dissociation of the [28 S:mRNA] complex cannot be deduced from the chemical equation. This observation suggests that there are "hidden intermediates' in the formation and dissociation of this complex. The implications of these observations are discussed in terms of a model for the interaction between the mitochondrial 28 S subunit and mRNAs.

  11. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... and chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...... "eukaryal" (1005G.1138C or 1006U.1137A) pair and one "bacterial" C.G pair largely restores the structure and function of the rRNA. Bacterial ribosomes containing both these eukaryal pairs also participate in protein synthesis, although at much reduced efficiency, and the structure of their pseudoknot region...

  12. The Comparative RNA Web (CRW Site: an online database of comparative sequence and structure information for ribosomal, intron, and other RNAs

    Directory of Open Access Journals (Sweden)

    Müller Kirsten M

    2002-01-01

    Full Text Available Abstract Background Comparative analysis of RNA sequences is the basis for the detailed and accurate predictions of RNA structure and the determination of phylogenetic relationships for organisms that span the entire phylogenetic tree. Underlying these accomplishments are very large, well-organized, and processed collections of RNA sequences. This data, starting with the sequences organized into a database management system and aligned to reveal their higher-order structure, and patterns of conservation and variation for organisms that span the phylogenetic tree, has been collected and analyzed. This type of information can be fundamental for and have an influence on the study of phylogenetic relationships, RNA structure, and the melding of these two fields. Results We have prepared a large web site that disseminates our comparative sequence and structure models and data. The four major types of comparative information and systems available for the three ribosomal RNAs (5S, 16S, and 23S rRNA, transfer RNA (tRNA, and two of the catalytic intron RNAs (group I and group II are: (1 Current Comparative Structure Models; (2 Nucleotide Frequency and Conservation Information; (3 Sequence and Structure Data; and (4 Data Access Systems. Conclusions This online RNA sequence and structure information, the result of extensive analysis, interpretation, data collection, and computer program and web development, is accessible at our Comparative RNA Web (CRW Site http://www.rna.icmb.utexas.edu. In the future, more data and information will be added to these existing categories, new categories will be developed, and additional RNAs will be studied and presented at the CRW Site.

  13. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  14. Comparative characterization of Santolina insularis chemotypes by essential oil composition, 5S-rRNA-NTS sequencing and EcoRV RFLP-PCR.

    Science.gov (United States)

    Gnavi, Giorgio; Bertea, Cinzia M; Usai, Marianna; Maffei, Massimo E

    2010-06-01

    Santolina insularis (Genn ex Fiori) Arrig. is a medicinal plant whose essential oil shows antiviral and antibacterial activities and potent and selective cytotoxic activity against the human colon carcinoma cell line. The occurrence of several chemotypes makes the taxonomic identification of S. insularis hard to achieve. GC-MS essential oil analyses of four chemotypes (SI1, SI2, SI3 and SI4) revealed the presence of different percentages of santolina triene, beta-pinene, myrcene, beta-phellandrene, artemisia ketone and cis-chrysanthemol, allowing a chemical discrimination. Single fragments of the 5S-rRNA-NTS region of approximately 150, 170, 260 and 280bp were produced by SI1, SI2, SI3 and SI4, respectively, and the sequence alignment of the 5S-rRNA spacer region flanked by the 3'-and 5'-ends of the coding region confirmed a consistent difference between chemotypes. Furthermore, a PCR-RFLP method was applied. From the identified sequences, an EcoRV site could be found in chemotypes SI1, SI2 and SI3 in the 5S-rRNA spacer regions at 81 bp position; however, this site was absent in the chemotype SI4. This study, by showing remarkable chemical variation in the terpenoid profile and consistent genomic difference in the 5S-rRNA spacer regions, identified four chemotypes of S. insularis which could be grouped into two ecotypes, based on chemical and genomic analyses. The identification of specific gene sequences of the 5S-rRNA-NTS region and of a EcoRV site identified in this work can be used for a rapid and precise identification of the plant chemo-/ecotypes, complementing the essential oil chemical analysis. Copyright 2010 Elsevier Ltd. All rights reserved.

  15. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  16. Bypassing rRNA methylation by RsmA/Dim1during ribosome maturation in the hyperthermophilic archaeon Nanoarchaeum equitans

    DEFF Research Database (Denmark)

    Seistrup, Kenneth H; Rose, Simon; Birkedal, Ulf

    2017-01-01

    In all free-living organisms a late-stage checkpoint in the biogenesis of the small ribosomal subunit involves rRNA modification by an RsmA/Dim1 methyltransferase. The hyperthermophilic archaeon Nanoarchaeum equitans, whose existence is confined to the surface of a second archaeon, Ignicoccus hos...

  17. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko;

    2011-01-01

    . Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual...... of slowly translated codons before codon 20 or after codon 45 should shorten or prolong, respectively, the functional mRNA half-life by altering the ribosome density in the important region. These predictions were tested on eight new lacZ variants, and their experimentally determined mRNA half-lives all...

  18. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection

    OpenAIRE

    2015-01-01

    Viruses use alternate mechanisms to increase the coding capacity of their viral genomes. The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts an RNA structure that can direct translation in 0 and +1 reading frames to produce the viral structural proteins and an overlapping ORFx product. Here we provide structural and biochemical evidence that the PKI domain of the IRES mimics a complete tRNA-like structure to facilitate reading frame selection and allows the viral IR...

  19. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements.

    Science.gov (United States)

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-10-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  20. The ribosomal RNA transcription unit of Entamoeba invadens: accumulation of unprocessed pre-rRNA and a long non coding RNA during encystation.

    Science.gov (United States)

    Ojha, Sandeep; Singh, Nishant; Bhattacharya, Alok; Bhattacharya, Sudha

    2013-01-01

    The ribosomal RNA genes in Entamoeba spp. are located on extrachromosomal circular molecules. Unlike model organisms where rRNA transcription stops during growth stress, Entamoeba histolytica continues transcription; but unprocessed pre-rRNA accumulates during stress, along with a novel class of circular transcripts from the 5'-external transcribed spacer (ETS). To determine the fate of rRNA transcription during stage conversion between trophozoite to cyst we analyzed Entamoeba invadens, a model system for differentiation studies in Entamoeba. We characterized the complete rDNA transcription unit by mapping the ends of pre-rRNA and mature rRNAs. The 3' end of mature 28S rRNA was located 321 nt downstream of the end predicted by sequence homology with E. histolytica. The major processing sites were mapped in external and internal transcribed spacers. The promoter located within 146 nt upstream of 5' ETS was used to transcribe the pre-rRNA. On the other hand, a second promoter located at the 3' end of 28S rDNA was used to transcribe almost the entire intergenic spacer into a long non coding (nc) RNA (>10 kb). Interestingly we found that the levels of pre-rRNA and long ncRNA, measured by northern hybridization, decreased initially in cells shifted to encystation medium, after which they began to increase and reached high levels by 72 h when mature cysts were formed. Unlike E. histolytica, no circular transcripts were found in E. invadens. E. histolytica and E. invadens express fundamentally different ncRNAs from the rDNA locus, which may reflect their adaptation to different hosts (human and reptiles, respectively). This is the first description of rDNA organization and transcription in E. invadens, and provides the framework for further studies on regulation of rRNA synthesis during cyst formation.

  1. Photoinduced cross-linkage, in situ, of Escherichia coli 30S ribosomal proteins to 16S rRNA: identification of cross-linked proteins and relationships between reactivity and ribosome structure.

    Science.gov (United States)

    Gorelic, L

    1976-08-10

    The kinetics of photoinduced cross-linkage of Escherichia coli 30S ribosomal proteins to the 16S-rRNA molecule in the intact Escherichia coli 30S ribosomal subunit was studied in this report. All of the 30S ribosomal proteins become cross-linked to the 16S rRNA before changes in the sedimentation characteristics of the 30S ribosomal subunit can be detected. The proteins exhibit different reactivities in the cross-linkage reaction. One group of proteins-S3, S7-S9, S11, S12, and S15-S19-is cross-linked to the 16S rRNA by single-hit kinetics, or by photoprocesses of nonunity but low multiplicities. A second group of proteins--S1, S2, S4-S6, S10, S13, S14, and S21--is cross-linked to the 16S rRNA by photoprocesses of a complex nature. A comparison of these data with other properties of the individual 30S ribosomal proteins related to ribosome structure indicated that most of the 30S ribosomal proteins cross-linked to the 16S rRNA by photoprocesses of low multiplicities had been classified rRNA-binding proteins by nonphotochemical methods, and most of the proteins cross-linked to the 16S rRNA by photoprocesses of large multiplicities had been classified as nonbinding proteins. There were certain exceptions to these correlations. Proteins S4 and S20, both RNA-binding proteins, become cross-linked to the 16S rRNA by photoprocessses of large multiplicities, and proteins S3, S11, S12, and S18, none of which have been classified RNA-binding proteins, exhibited low multiplicities in the cross-linkage reaction. All of these exceptions could be explained in terms of limitations inherent in the photochemical methods used in this study and in other types of methods that have been used to study RNA-protein interactions in the 30S ribosomal subunit. The data presented here also suggest that labile RNA-protein cross-links are present in the uv-irradiated 30S ribosomal subunits, and that neither peptide-bond cleavage nor photoinduced modification of the charged side-chain groups in

  2. Determination of the number of copies of genes coding for 5s-rRNA and tRNA in the genomes of 43 species of wheat and Aegilops

    Energy Technology Data Exchange (ETDEWEB)

    Vakhitov, V.A.; Gimalov, F.R.; Nikonorov, Yu.M.

    1986-10-01

    The number of 5s-rRNA and tRNA genes has been studied in 43 species of wheat and Aegilops differing in ploidy level, genomic composition and origin. It has been demonstrated that the repeatability of the 5s-rRNA and tRNA genes increases in wheat with increasing ploidy level, but not in proportion to the genome size. In Aegilops, in distinction from wheat, the relative as well as absolute number of 5s-RNA genes increases with increasing ploidy level. The proportion of the sequences coding for tRNA in the dipoloid and polyploid Aegilops species is practically similar, while the number of tRNA genes increases almost 2-3 times with increasing ploidy level. Large variability has been recorded between the species with similar genomic composition and ploidy level in respect of the number of the 5s-rRNA and tRNA genes. It has been demonstrated that integration of the initial genomes of the amphidiploids is accompanied by elimination of a particular part of these genomes. It has been concluded that the mechanisms of establishment and evolution of genomes in the intra- and intergeneric allopolyploids are not identical.

  3. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.

    OpenAIRE

    1988-01-01

    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting relate...

  4. Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper.

    Science.gov (United States)

    Kwon, Jin-Kyung; Kim, Byung-Dong

    2009-02-28

    The loci of the 5S and 45S rRNA genes were localized on chromosomes in five species of Capsicum, namely, annuum, chacoense, frutescens, baccatum, and chinense by FISH. The 5S rDNA was localized to the distal region of one chromosome in all species observed. The number of 45S rDNA loci varied among species; one in annuum, two in chacoense, frutescens, and chinense, and four in baccatum, with the exceptions that 'CM334' of annuum had three loci and 'tabasco' of frutescens had one locus. 'CM334'-derived BAC clones, 384B09 and 365P05, were screened with 5S rDNA as a probe, and BACs 278M03 and 262A23 were screened with 25S rDNA as a probe. Both ends of these BAC clones were sequenced. FISH with these BAC probes on pachytenes from 'CM334' plant showed one 5S rDNA locus and three 45S rDNA loci, consistent with the patterns on the somatic chromosomes. The 5S rDNA probe was also applied on extended DNA fibers to reveal that its coverage measured as long as 0.439 Mb in the pepper genome. FISH techniques applied on somatic and meiotic chromosomes and fibers have been established for chili to provide valuable information about the copy number variation of 45S rDNA and the actual physical size of the 5S rDNA in chili.

  5. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Directory of Open Access Journals (Sweden)

    Larisa Gunderina

    2015-05-01

    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  6. 18S ribosomal RNA gene sequences of Cochliopodium (Himatismenida) and the phylogeny of Amoebozoa.

    Science.gov (United States)

    Kudryavtsev, Alexander; Bernhard, Detlef; Schlegel, Martin; Chao, Ema E Y; Cavalier-Smith, Thomas

    2005-08-01

    Cochliopodium is a very distinctive genus of discoid amoebae covered by a dorsal tectum of carbohydrate microscales. Its phylogenetic position is unclear, since although sharing many features with naked "gymnamoebae", the tectum sets it apart. We sequenced 18S ribosomal RNA genes from three Cochliopodium species (minus, spiniferum and Cochliopodium sp., a new species resembling C. minutum). Phylogenetic analysis shows Cochliopodium as robustly holophyletic and within Amoebozoa, in full accord with morphological data. Cochliopodium is always one of the basal branches within Amoebozoa but its precise position is unstable. In Bayesian analysis it is sister to holophyletic Glycostylida, but distance trees mostly place it between Dermamoeba and a possibly artifactual long-branch cluster including Thecamoeba. These positions are poorly supported and basal amoebozoan branching ill-resolved, making it unclear whether Discosea (Glycostylida, Himatismenida, Dermamoebida) is holophyletic; however, Thecamoeba seems not specifically related to Dermamoeba. We also sequenced the small-subunit rRNA gene of Vannella persistens, which constantly grouped with other Vannella species, and two Hartmannella strains. Our trees suggest that Vexilliferidae, Variosea and Hartmannella are polyphyletic, confirming the existence of two very distinct Hartmannella clades: that comprising H. cantabrigiensis and another divergent species is sister to Glaeseria, whilst Hartmannella vermiformis branches more deeply.

  7. Structural diversity in bacterial ribosomes: mycobacterial 70S ribosome structure reveals novel features.

    Directory of Open Access Journals (Sweden)

    Manidip Shasmal

    Full Text Available Here we present analysis of a 3D cryo-EM map of the 70S ribosome from Mycobacterium smegmatis, a saprophytic cousin of the etiological agent of tuberculosis in humans, Mycobacterium tuberculosis. In comparison with the 3D structures of other prokaryotic ribosomes, the density map of the M. smegmatis 70S ribosome reveals unique structural features and their relative orientations in the ribosome. Dramatic changes in the periphery due to additional rRNA segments and extra domains of some of the peripheral ribosomal proteins like S3, S5, S16, L17, L25, are evident. One of the most notable features appears in the large subunit near L1 stalk as a long helical structure next to helix 54 of the 23S rRNA. The sharp upper end of this structure is located in the vicinity of the mRNA exit channel. Although the M. smegmatis 70S ribosome possesses conserved core structure of bacterial ribosome, the new structural features, unveiled in this study, demonstrates diversity in the 3D architecture of bacterial ribosomes. We postulate that the prominent helical structure related to the 23S rRNA actively participates in the mechanisms of translation in mycobacteria.

  8. A study of ribonucleoproteins: The sequence of rabbit 18S ribosomal RNA and the identification of proteins associated with messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Connaughton, J.F. Jr.

    1989-01-01

    This study considers the functional role of ribosomal RNA and messenger ribonucleoproteins in the translational regulation of gene expression. The primary structure of rabbit 18S ribosomal RNA was determined by nucleotide sequence analysis of the RNA directly. Rabbit 18S RNA was cleaved with either T{sub 1} ribonuclease or RNase H, using a Pst 1 DNA linker to generate a unique set of overlapping fragments spanning the entire molecule. Both intact and fragmented 18S RNA were end-labeled with {sup 32}P and base-specifically cleaved enzymatically and chemically. Nucleotide sequences were determined from long polyacrylamide sequencing gels run in formamide. To assess functional roles of RNA in gene expression, specific mRNA-protein interactions were also examined. Eukaryotic mRNA is associated with specific proteins that may be important in translational regulation and mRNA stability; mRNP complexes were reconstituted in a message-dependent, cell-free rabbit reticulocyte translation system, using unique mRNA species transcribed in vitro with SP6 polymerase. Transcripts of both rabbit and human {beta}-globin cDNA were labeled with {sup 32}P either throughout the molecule ore selectively at the 5{prime} and 3{prime} terminus.

  9. Restriction fragment length polymorphism of the 5S-rRNA-NTS region: a rapid and precise method for plant identification.

    Science.gov (United States)

    Bertea, Cinzia Margherita; Gnavi, Giorgio

    2012-01-01

    Molecular genetic methods have several advantages over classical morphological and chemical analyses. The genetic method requires genotype instead than phenotype, therefore PCR-based techniques have been widely used for a rapid identification of plant species, varieties and chemotypes. Recently, the molecular discrimination of some higher plant species has been evaluated using sequences of a 5S-rRNA gene spacer region. The variation in the nontranscribed sequence (NTS) region has been used in a number of plant species for studying intraspecific variation, genome evolution, and phylogenetic reconstruction. Here, we describe a rapid method based on the use of the 5S-rRNA-NTS region as a tool for plant DNA fingerprinting, which combines PCR, sequencing and restriction fragment length polymorphism analyses.

  10. Evidence for compensatory evolution of ribosomal proteins in response to rapid divergence of mitochondrial rRNA.

    Science.gov (United States)

    Barreto, Felipe S; Burton, Ronald S

    2013-02-01

    Rapid evolution of mitochondrial DNA (mtDNA) places intrinsic selective pressures on many nuclear genes involved in mitochondrial functions. Mitochondrial ribosomes, for example, are composed of mtDNA-encoded ribosomal RNAs (rRNAs) and a set of more than 60 nuclear-encoded ribosomal proteins (mRP) distinct from the cytosolic RPs (cRP). We hypothesized that the rapid divergence of mt-rRNA would result in rapid evolution of mRPs relative to cRPs, which respond to slowly evolving nuclear-encoded rRNA. In comparisons of rates of nonsynonymous and synonymous substitutions between a pair of divergent populations of the copepod Tigriopus californicus, we found that mRPs showed elevated levels of amino acid changes relative to cRPs. This pattern was equally strong at the interspecific level, between three pairs of sister species (Nasonia vitripennis vs. N. longicornis, Drosophila melanogaster vs. D. simulans, and Saccharomyces cerevisae vs. S. paradoxus). This high rate of mRP evolution may result in intergenomic incompatibilities between taxonomic lineages, and such incompatibilities could lead to dysfunction of mitochondrial ribosomes and the loss of fitness observed among interpopulation hybrids in T. californicus and interspecific hybrids in other species.

  11. Covalent crosslinking of tRNA1Val to 16S RNA at the ribosomal P site: identification of crosslinked residues.

    Science.gov (United States)

    Prince, J B; Taylor, B H; Thurlow, D L; Ofengand, J; Zimmermann, R A

    1982-09-01

    N-Acetylvalyl-tRNA1Val (AcVal-tRNA1Val) was bound to the P site of uniformly 32P-labeled 70S ribosomes from Escherichia coli and crosslinked to 16S RNA in the 30S ribosomal subunit by irradiation with light of 300-400 nm. To identify the crosslinked nucleotide in 16S RNA. AcVal-tRNA1Val-16S [32P]RNA was digested completely with RNase T1 and the band containing the covalently attached oligonucleotides from tRNA and rRNA was isolated by polyacrylamide gel electrophoresis. The crosslinked oligonucleotide, and the 32P-labeled rRNA moiety released from it by photoreversal of the crosslink at 254 nm, were then analyzed by secondary hydrolysis with pancreatic RNase A and RNase U2. The oligonucleotide derived from 16S RNA was found to be the evolutionarily conserved sequence, U-A-C-A-C-A-C-C-G1401, and the nucleotide crosslinked to tRNA1Val, C1400. The identity of the covalently attached residue in the tRNA was established by using AcVal-tRNA1Val-16S RNA prepared from unlabeled ribosomes. This complex was digested to completion with RNase T1 and the resulting RNA fragments were labeled at the 3' end with [5'-32P]pCp. The crosslinked T1 oligonucleotide isolated from the mixture yielded one major end-labeled component upon photoreversal. Chemical sequence analysis demonstrated that this product was derived from the anticodon-containing pentadecanucleotide of tRNA1Val, C-A-C-C-U-C-C-C-U-cmo5U-A-C-m6A-A-G39(cmo5U, 5-carboxymethoxyuridine). A similar study of the crosslinked oligonucleotide revealed that the residue covalently bound to 16S was cmo5U34, the 5' or wobble base of the anticodon. The adduct is believed to result from formation of a cyclobutane dimer between cmo5U34 of tRNA1Val and C1400 of the 16S RNA.

  12. Trypanosoma cruzi 5S rRNA arrays define five groups and indicate the geographic origins of an ancestor of the heterozygous hybrids.

    Science.gov (United States)

    Westenberger, Scott J; Sturm, Nancy R; Campbell, David A

    2006-03-01

    Isolates of the etiological agent of Chagas disease, Trypanosoma cruzi, have been subdivided into six subgroups referred to as discrete typing units. The subgroups are related through two distinct hybridisation events: representatives of homozygous discrete typing units I and IIb fused to form discrete typing units IIa and IIc, whose homozygous genotypes have features of both ancestral types; a second fusion between strains of homozygous discrete typing units IIb and IIc created the heterozygous hybrid strains discrete typing units IId and IIe. The intergenic region of the tandemly repeated 5S rRNA array displays four variant sequence classes, allowing the discrimination of five discrete typing units. The genome project reference strain, CL Brener, is a hybrid discrete typing unit IIe strain that contains both discrete typing unit IIb and IIc classes of 5S rRNA repeats in distinct arrays present on different chromosomes. The CL Brener discrete typing unit IIb-type array contains approximately 193 repeated units, of which about one-third contain a 129 bp sequence that replaces a majority of the 5S rRNA sequence. The 129 bp 'invader' sequence was detected within the arrays of all hybrid discrete typing unit IId and IIe strains and in a subset of discrete typing unit IIb strains. This array invader replaces the internal promoter elements conserved in 5S rRNA. The discrete typing unit IIb Esmeraldo strain contains approximately 135 repeats and shows a region of homology to the array invader in the 5' flank of the array, but no evidence of the invading sequence element within the array. A survey of additional discrete typing unit IIb strains revealed a split within the subgroup, in which some strains contained invaded arrays and others were homogeneous for the 5S rRNA. The putative discrete typing unit IIb ancestor of the hybrid discrete typing units IId and IIe more closely resembles the extant Bolivian/Chilean IIb isolates than the Brazilian IIb isolates based on the

  13. Interindividual size heteromorphism of NOR and chromosomal location of 5S rRNA genes in Iheringichthys labrosus

    Directory of Open Access Journals (Sweden)

    Rafael Augusto de Carvalho

    2007-01-01

    Full Text Available Twenty-five specimens of Iheringichthys labrosus from the Capivara Reservoir were analysed cytogenetically. AgNORs were detected in a pair of ST chromosomes, in the telomeric region of the long arm. Some individuals showed size heteromorphism of this region between homologous chromosomes. Treatment with CMA3 displayed GC-rich regions corresponding to the AgNOR pair, plus other fluorescent staining. In situ hybridization by fluorescence (FISH with the 18S rDNA probe showed only one pair of stained chromosomes, confirming the heteromorphism observed with AgNO3 and CMA3 in some individuals. The 5S rDNA probe revealed telomeric staining on the long arm of a pair of chromosomes of the ST-A group, probably different from the NOR pair.Foram analisados citogeneticamente vinte e cinco indivíduos de Iheringichthys labrosus da Represa Capivara. As AgNORs foram detectadas em um par de cromossomos ST na região telomérica do braço longo. Em alguns exemplares machos e fêmeas foi observado um heteromorfismo de tamanho desta região entre cromossomos homólogos. O tratamento com CMA3 exibiu regiões ricas em GC correspondentes ao par da NOR e outras marcações fluorescentes. A hibridação in situ por fluorescência (FISH com a sonda de DNAr 18S mostrou somente um par de cromossomos marcados, confirmando o heteromorfismo observado com AgNO3 and CMA3 em alguns indivíduos. A sonda de DNAr 5S revelou marcação telomérica no braço longo de um par de cromossomos do grupo ST-A, provavelmente diferente do par da NOR.

  14. Combined large and small subunit ribosomal RNA phylogenies support a basal position of the acoelomorph flatworms.

    Science.gov (United States)

    Telford, Maximilian J; Lockyer, Anne E; Cartwright-Finch, Chloë; Littlewood, D Timothy J

    2003-05-22

    The phylogenetic position of the phylum Platyhelminthes has been re-evaluated in the past decade by analysis of diverse molecular datasets. The consensus is that the Rhabditophora + Catenulida, which includes most of the flatworm taxa, are not primitively simple basal bilaterians but are related to coelomate phyla such as molluscs. The status of two other groups of acoelomate worms, Acoela and Nemertodermatida, is less clear. Although many characteristics unite these two groups, initial molecular phylogenetic studies placed the Nemertodermatida within the Rhabditophora, but placed the Acoela at the base of the Bilateria, distant from other flatworms. This contradiction resulted in scepticism about the basal position of acoels and led to calls for further data. We have sequenced large subunit ribosomal RNA genes from 13 rhabditophorans + catenulids, three acoels and one nemertodermatid, tripling the available data. Our analyses strongly support a basal position of both acoels and nemertodermatids. Alternative hypotheses are significantly less well supported by the data. We conclude that the Nemertodermatida and Acoela are basal bilaterians and, owing to their unique body plan and embryogenesis, should be recognized as a separate phylum, the Acoelomorpha.

  15. A phylogeny of the Passerida (Aves:Passeriformes) based on mitochondrial 12S ribosomal RNA gene

    Institute of Scientific and Technical Information of China (English)

    Lina Wu; Yanfeng Sun; Juyong Li; Yaqing Li; Yuefeng Wu; and Dongming Li

    2015-01-01

    Background:Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations;however, the phylogenetic relationships within this assemblage have been the subject of many debates. Methods:We analyzed the 12S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group. Results:Our results identified the monophyly of the three superfamilies in Passerida:Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida. Conclusion:Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  16. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  17. Transcriptional repressor NIR functions in the ribosome RNA processing of both 40S and 60S subunits.

    Science.gov (United States)

    Wu, Jianguo; Zhang, Ying; Wang, Yingshuang; Kong, Ruirui; Hu, Lelin; Schuele, Roland; Du, Xiaojuan; Ke, Yang

    2012-01-01

    NIR was identified as an inhibitor of histone acetyltransferase and it represses transcriptional activation of p53. NIR is predominantly localized in the nucleolus and known as Noc2p, which is involved in the maturation of the 60S ribosomal subunit. However, how NIR functions in the nucleolus remains undetermined. In the nucleolus, a 47S ribosomal RNA precursor (pre-rRNA) is transcribed and processed to produce 18S, 5.8S and 28S rRNAs. The 18S rRNA is incorporated into the 40S ribosomal subunit, whereas the 28S and 5.8S rRNAs are incorporated into the 60S subunit. U3 small nucleolar RNA (snoRNA) directs 18S rRNA processing and U8 snoRNA mediates processing of 28S and 5.8 S rRNAs. Functional disruption of nucleolus often causes p53 activation to inhibit cell proliferation. Western blotting showed that NIR is ubiquitously expressed in different human cell lines. Knock-down of NIR by siRNA led to inhibition of the 18S, 28S and 5.8S rRNAs evaluated by pulse-chase experiment. Pre-rRNA particles (pre-rRNPs) were fractionated from the nucleus by sucrose gradient centrifugation and analysis of the pre-RNPs components showed that NIR existed in the pre-RNPs of both the 60S and 40S subunits and co-fractionated with 32S and 12S pre-rRNAs in the 60S pre-rRNP. Protein-RNA binding experiments demonstrated that NIR is associated with the 32S pre-rRNA and U8 snoRNA. In addition, NIR bound U3 snoRNA. It is a novel finding that depletion of NIR did not affect p53 protein level but de-repressed acetylation of p53 and activated p21. We provide the first evidence for a transcriptional repressor to function in the rRNA biogenesis of both the 40S and 60S subunits. Our findings also suggested that a nucleolar protein may alternatively signal to p53 by affecting the p53 modification rather than affecting p53 protein level.

  18. Transcriptional repressor NIR functions in the ribosome RNA processing of both 40S and 60S subunits.

    Directory of Open Access Journals (Sweden)

    Jianguo Wu

    Full Text Available BACKGROUND: NIR was identified as an inhibitor of histone acetyltransferase and it represses transcriptional activation of p53. NIR is predominantly localized in the nucleolus and known as Noc2p, which is involved in the maturation of the 60S ribosomal subunit. However, how NIR functions in the nucleolus remains undetermined. In the nucleolus, a 47S ribosomal RNA precursor (pre-rRNA is transcribed and processed to produce 18S, 5.8S and 28S rRNAs. The 18S rRNA is incorporated into the 40S ribosomal subunit, whereas the 28S and 5.8S rRNAs are incorporated into the 60S subunit. U3 small nucleolar RNA (snoRNA directs 18S rRNA processing and U8 snoRNA mediates processing of 28S and 5.8 S rRNAs. Functional disruption of nucleolus often causes p53 activation to inhibit cell proliferation. METHODOLOGY/PRINCIPAL FINDINGS: Western blotting showed that NIR is ubiquitously expressed in different human cell lines. Knock-down of NIR by siRNA led to inhibition of the 18S, 28S and 5.8S rRNAs evaluated by pulse-chase experiment. Pre-rRNA particles (pre-rRNPs were fractionated from the nucleus by sucrose gradient centrifugation and analysis of the pre-RNPs components showed that NIR existed in the pre-RNPs of both the 60S and 40S subunits and co-fractionated with 32S and 12S pre-rRNAs in the 60S pre-rRNP. Protein-RNA binding experiments demonstrated that NIR is associated with the 32S pre-rRNA and U8 snoRNA. In addition, NIR bound U3 snoRNA. It is a novel finding that depletion of NIR did not affect p53 protein level but de-repressed acetylation of p53 and activated p21. CONCLUSIONS: We provide the first evidence for a transcriptional repressor to function in the rRNA biogenesis of both the 40S and 60S subunits. Our findings also suggested that a nucleolar protein may alternatively signal to p53 by affecting the p53 modification rather than affecting p53 protein level.

  19. Cyanobacterial ribosomal RNA genes with multiple, endonuclease-encoding group I introns

    Directory of Open Access Journals (Sweden)

    Turner Seán

    2007-09-01

    Full Text Available Abstract Background Group I introns are one of the four major classes of introns as defined by their distinct splicing mechanisms. Because they catalyze their own removal from precursor transcripts, group I introns are referred to as autocatalytic introns. Group I introns are common in fungal and protist nuclear ribosomal RNA genes and in organellar genomes. In contrast, they are rare in all other organisms and genomes, including bacteria. Results Here we report five group I introns, each containing a LAGLIDADG homing endonuclease gene (HEG, in large subunit (LSU rRNA genes of cyanobacteria. Three of the introns are located in the LSU gene of Synechococcus sp. C9, and the other two are in the LSU gene of Synechococcus lividus strain C1. Phylogenetic analyses show that these introns and their HEGs are closely related to introns and HEGs located at homologous insertion sites in organellar and bacterial rDNA genes. We also present a compilation of group I introns with homing endonuclease genes in bacteria. Conclusion We have discovered multiple HEG-containing group I introns in a single bacterial gene. To our knowledge, these are the first cases of multiple group I introns in the same bacterial gene (multiple group I introns have been reported in at least one phage gene and one prophage gene. The HEGs each contain one copy of the LAGLIDADG motif and presumably function as homodimers. Phylogenetic analysis, in conjunction with their patchy taxonomic distribution, suggests that these intron-HEG elements have been transferred horizontally among organelles and bacteria. However, the mode of transfer and the nature of the biological connections among the intron-containing organisms are unknown.

  20. Different organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene sequences.

    Science.gov (United States)

    Allsopp, M; Visser, E S; du Plessis, J L; Vogel, S W; Allsopp, B A

    1997-08-01

    Cowdria ruminantium is a rickettsial parasite which causes heartwater, a economically important disease of domestic and wild ruminants in tropical and subtropical Africa and parts of the Caribbean. Because existing diagnostic methods are unreliable, we investigated the small-subunit ribosomal RNA (srRNA) gene from heartwater-infected material to characterise the organisms present and to develop specific oligonucleotide probes for polymerase chain reaction (PCR) based diagnosis. DNA was obtained from ticks and ruminants from heartwater-free and heartwater-endemic areas from Cowdria in tissue culture. PCR was carried out using primers designed to amplify only rickettsial srRNA genes, the target region being the highly variable V1 loop. Amplicons were cloned and sequenced; 51% were C. ruminantium sequences corresponding to four genotypes, two of which were identical to previously reported C. ruminantium sequences while the other two were new. The four different Cowdria genotypes can be correlated with different phenotypes. Tissue-culture samples yielded only Cowdria genotype sequences, but an extraordinary heterogeneity of 16S sequences was obtained from field samples. In addition to Cowdria genotypes we found sequences from previously unknown Ehrlichia spp., sequences showing homology to other Rickettsiales and a variety of Pseudomonadaceae. One Ehrlichia sequence was phylogenetically closely related to Ehrlichia platys (Group II Ehrlichia) and one to Ehrlichia canis (Group III Ehrlichia). This latter sequence was from an isolate (Germishuys) made from a naturally infected sheep which, from brain smear examination and pathology, appeared to be suffering from heartwater; nevertheless no Cowdria genotype sequences were found in this isolate. In addition no Cowdria sequences were obtained from uninfected ticks. Complete 16S rRNA gene sequences were determined for two C. ruminantium genotypes and for two previously uncharacterised heartwater-associated Ehrlichia spp

  1. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    NARCIS (Netherlands)

    Essers, Paul B.; Nonnekens, Julie; Goos, Yvonne J.; Betist, Marco C.|info:eu-repo/dai/nl/304073202; Viester, Marjon D.; Mossink, Britt; Lansu, Nico; Korswagen, Hendrik C.; Jelier, Rob; Brenkman, Arjan B.; MacInnes, Alyson W.|info:eu-repo/dai/nl/338681388

    2015-01-01

    The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs

  2. Asaia bogorensis peritonitis identified by 16S ribosomal RNA sequence analysis in a patient receiving peritoneal dialysis.

    Science.gov (United States)

    Snyder, Richard W; Ruhe, Jorg; Kobrin, Sidney; Wasserstein, Alan; Doline, Christa; Nachamkin, Irving; Lipschutz, Joshua H

    2004-08-01

    Here the authors report a case of refractory peritonitis leading to multiple hospitalizations and the loss of peritoneal dialysis access in a patient on automated peritoneal dialysis, caused by Asaia bogorensis, a bacterium not previously described as a human pathogen. This organism was identified by sequence analysis of the 16S ribosomal RNA gene. Unusual microbial agents may cause peritonitis, and molecular microbiological techniques are important tools for identifying these agents.

  3. Molecular phylogeny of silk-producing insects based on 16S ribosomal RNA and cytochrome oxidase subunit I genes

    Indian Academy of Sciences (India)

    B. Mahendran; S. K. Ghosh; S. C. Kundu

    2006-04-01

    We have examined the molecular-phylogenetic relationships between nonmulberry and mulberry silkwormspecies that belong to the families Saturniidae, Bombycidae and Lasiocampidae using 16S ribosomal RNA (16S rRNA) and cytochrome oxidase subunit I (coxI) gene sequences. Aligned nucleotide sequences of 16S rRNA and coxI from 14 silk-producing species were used for construction of phylogenetic trees by maximum likelihood and maximum parsimony methods. The tree topology on the basis of 16S rRNA supports monophyly for members of Saturniidae and Bombycidae. Weighted parsimony analysis weighted towards transversions relative to transitions (ts, tv4) for coxI resulted in more robust bootstrap support over unweighted parsimony and favours the 16S rRNA tree topology. Combined analysis reflected clear biogeographic pattern, and agrees with morphological and cytological data.

  4. Cockayne syndrome protein A is a transcription factor of RNA polymerase I and stimulates ribosomal biogenesis and growth

    Science.gov (United States)

    Koch, Sylvia; Garcia Gonzalez, Omar; Assfalg, Robin; Schelling, Adrian; Schäfer, Patrick; Scharffetter-Kochanek, Karin; Iben, Sebastian

    2014-01-01

    Mutations in the Cockayne syndrome A (CSA) protein account for 20% of Cockayne syndrome (CS) cases, a childhood disorder of premature aging and early death. Hitherto, CSA has exclusively been described as DNA repair factor of the transcription-coupled branch of nucleotide excision repair. Here we show a novel function of CSA as transcription factor of RNA polymerase I in the nucleolus. Knockdown of CSA reduces pre-rRNA synthesis by RNA polymerase I. CSA associates with RNA polymerase I and the active fraction of the rDNA and stimulates re-initiation of rDNA transcription by recruiting the Cockayne syndrome proteins TFIIH and CSB. Moreover, compared with CSA deficient parental CS cells, CSA transfected CS cells reveal significantly more rRNA with induced growth and enhanced global translation. A previously unknown global dysregulation of ribosomal biogenesis most likely contributes to the reduced growth and premature aging of CS patients. PMID:24781187

  5. Selection of random RNA fragments as method for searching for a site of regulation of translation of E. coli streptomycin mRNA by ribosomal protein S7.

    Science.gov (United States)

    Surdina, A V; Rassokhin, T I; Golovin, A V; Spiridonova, V A; Kraal, B; Kopylov, A M

    2008-06-01

    In E. coli cells ribosomal small subunit biogenesis is regulated by RNA-protein interactions involving protein S7. S7 initiates the subunit assembly interacting with 16S rRNA. During shift-down of rRNA synthesis level, free S7 inhibits self-translation by interacting with 96 nucleotides long specific region of streptomycin (str) mRNA between cistrons S12 and S7 (intercistron). Many bacteria do not have the extended intercistron challenging development of specific approaches for searching putative mRNA regulatory regions, which are able to interact with proteins. The paper describes application of SERF approach (Selection of Random RNA Fragments) to reveal regulatory regions of str mRNA. Set of random DNA fragments has been generated from str operon by random hydrolysis and then transcribed into RNA; the fragments being able to bind protein S7 (serfamers) have been selected by iterative rounds. S7 binds to single serfamer, 109 nucleotide long (RNA109), derived from the intercistron. After multiple copying and selection, the intercistronic mutant (RNA109) has been isolated; it has enhanced affinity to S7. RNA109 binds to the protein better than authentic intercistronic str mRNA; apparent dissociation constants are 26 +/- 5 and 60 +/- 8 nM, respectively. Location of S7 binding site on the mRNA, as well as putative mode of regulation of coupled translation of S12 and S7 cistrons have been hypothesized.

  6. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  7. Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

    Directory of Open Access Journals (Sweden)

    Vincent J Denef

    2016-04-01

    Full Text Available Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP. Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.

  8. PCR and PCR-RFLP of the 5S-rRNA-NTS region and salvinorin A analyses for the rapid and unequivocal determination of Salvia divinorum.

    Science.gov (United States)

    Bertea, Cinzia M; Luciano, Pino; Bossi, Simone; Leoni, Francesca; Baiocchi, Claudio; Medana, Claudio; Azzolin, Chiara M M; Temporale, Giovanni; Lombardozzi, Maria Antonietta; Maffei, Massimo E

    2006-02-01

    Salvia divinorum Epling & Játiva-M. is a perennial herb belonging to the Lamiaceae family; its active ingredient, the neoclerodane diterpene salvinorin A, is a psychotropic molecule that produces hallucinations. A comparative evaluation of S. divinorum fresh and dried leaves, S. officinalis fresh leaves, and dried powdered leaves claimed to be S. divinorum was done. HPLC-MS data confirmed the presence of salvinorin A in both S. divinorun leaf extracts and the powdered leaves, whereas no salvinorin A was found in S. officinalis. The non-transcribed spacer (NTS) in the 5S-rRNA gene of all leaf samples and the dried powdered leaves was amplified by PCR using a pair of primers located at the 3' and 5' ends of the coding sequence of 5S-rRNA gene. The resulting PCR products (about 500bp for S. divinorum and 300bp for S. officinalis) were gel purified, subcloned into pGEM-T Easy vector and sequenced. By aligning the isolated nucleotide sequences, great diversities were found in the spacer region of the two species. Specific S. divinorum primers were designed on the sequence of the 5S-rRNA gene spacer region. In addition, a PCR-restriction fragment length polymorphism (PCR-RFLP) method was applied using NdeI and TaqI restriction enzymes. An NdeI site, absent in S. officinalis, was found in S. divinorum NTS region at 428-433bp. For TaqI, multiple sites (161-164, 170-173, and 217-220bp) were found in S. officinalis, whereas a unique site was found in S. divinorum (235-238bp). The results of this work show that the combined use of analytical chemical (HPLC-MS) and molecular (DNA fingerprinting) methods lead to the precise and unequivocal identification of S. divinorum.

  9. WDR55 is a nucleolar modulator of ribosomal RNA synthesis, cell cycle progression, and teleost organ development.

    Directory of Open Access Journals (Sweden)

    Norimasa Iwanami

    2008-08-01

    Full Text Available The thymus is a vertebrate-specific organ where T lymphocytes are generated. Genetic programs that lead to thymus development are incompletely understood. We previously screened ethylnitrosourea-induced medaka mutants for recessive defects in thymus development. Here we report that one of those mutants is caused by a missense mutation in a gene encoding the previously uncharacterized protein WDR55 carrying the tryptophan-aspartate-repeat motif. We find that WDR55 is a novel nucleolar protein involved in the production of ribosomal RNA (rRNA. Defects in WDR55 cause aberrant accumulation of rRNA intermediates and cell cycle arrest. A mutation in WDR55 in zebrafish also leads to analogous defects in thymus development, whereas WDR55-null mice are lethal before implantation. These results indicate that WDR55 is a nuclear modulator of rRNA synthesis, cell cycle progression, and embryonic organogenesis including teleost thymus development.

  10. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    DEFF Research Database (Denmark)

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig

    2007-01-01

    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...... nuclear transfer (SCNT) using fluorescence in situ hybridization (FISH) with an rDNA probe and subsequent visualization of the nucleolar proteins by silver staining. In the 205 IVP embryos investigated, all two-cell embryos (n = 34) were categorized as transcriptionally inactive. At the late four......-cell stage (n = 45), 38% of the embryos contained 1-3 nuclei with signs of rRNA transcription, indicating an asynchronous transcription initiation. This pattern continued in the following stages, as 78% (n = 47), 47% (n = 42) and 83% (n = 37) of the embryos revealed a mixture of transcriptionally inactive...

  11. Recovery from ultraviolet light-induced depression of ribosomal RNA synthesis in normal human, xeroderma pigmentosum and cockayne syndrome cells

    Energy Technology Data Exchange (ETDEWEB)

    Ayaki, Hitoshi; Hara, Ryujiro; Ikenaga, Mituo [Kyoto Univ. (Japan). Radiation Biology Center

    1996-06-01

    The rate of ribosomal RNA (rRNA) synthesis was analyzed at different times after ultraviolet light (UV) irradiation in normal human, xeroderma pigmentosum (XP) and Cockayne syndrome (CS) cells. In normal cells, the rate of rRNA synthesis, as measured by the incorporation of {sup 3}H-uridine into 18S and 28S rRNAs, decreased immediately after UV irradiation to about half of that of unirradiated cells, and then recovered significantly at 24h after UV. However, the rate of synthesis continued to decrease during post-UV incubation in XP cells belonging to groups A, D, E, F and G, as well as in CS cells of groups A and B. In contrast, group C XP cells showed a slight recovery at 24h after UV, suggesting that they have the capacity to repair UV lesions in rRNA genes. (author)

  12. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    Science.gov (United States)

    Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production. PMID:28091612

  13. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    Science.gov (United States)

    Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production.

  14. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    DEFF Research Database (Denmark)

    Beuchert Kallehauge, Thomas; Li, Shangzhong; Pedersen, Lasse Ebdrup

    2017-01-01

    as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we......Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated...... as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated...

  15. A novel mutation 3090 G>A of the mitochondrial 16S ribosomal RNA associated with myopathy.

    Science.gov (United States)

    Coulbault, L; Deslandes, B; Herlicoviez, D; Read, M H; Leporrier, N; Schaeffer, S; Mouadil, A; Lombès, A; Chapon, F; Jauzac, P; Allouche, S

    2007-10-26

    We describe a young woman who presented with a progressive myopathy since the age of 9. Spectrophotometric analysis of the respiratory chain in muscle tissue revealed combined and profound complex I, III, II+III, and IV deficiency ranging from 60% to 95% associated with morphological and histochemical abnormalities of the muscle. An exhaustive screening of mitochondrial transfer and ribosomal RNAs showed a novel G>A substitution at nucleotide position 3090 which was detected only in urine sediment and muscle of the patient and was not found in her mother's blood cells and urine sample. We suggest that this novel de novo mutation in the 16S ribosomal RNA, a nucleotide which is highly conserved in different species, would impair mitochondrial protein synthesis and would cause a severe myopathy.

  16. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.

    Science.gov (United States)

    Melançon, P; Lemieux, C; Brakier-Gingras, L

    1988-10-25

    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting related aminoglycoside antibiotics such as neomycin, kanamycin or gentamicin, which do not compete for the streptomycin binding site. The 530 loop where the mutation in the 16S rRNA is located has been mapped at the external surface of the 30S subunit, and is therefore distal from the streptomycin binding site at the subunit interface. Our results support the conclusion that the mutation at position 523 in the 16S rRNA does not interfere with the binding of streptomycin, but prevents the drug from inducing conformational changes in the 530 loop which account for its miscoding effect. Since this effect primarily results from a perturbation of the translational proofreading control, our results also provide evidence that the 530 loop of the 16S rRNA is involved in this accuracy control.

  17. Crosstalk in gene expression: coupling and co-regulation of rDNA transcription, pre-ribosome assembly and pre-rRNA processing.

    Science.gov (United States)

    Granneman, Sander; Baserga, Susan J

    2005-06-01

    Ribosomes, the large RNPs that translate mRNA into protein in the cytoplasm of eukaryotic cells, are synthesized in a subcompartment of the nucleus, the nucleolus. There, transcription by Pol I yields a pre-rRNA which is modified, cleaved and assembled with ribosomal proteins to make functional ribosomes. Previously, rRNA transcription and pre-rRNA cleavage in eukaryotes were considered to be separable steps in gene expression. However, recent findings suggest that these two steps in gene expression can be concurrent and are co-regulated. Unexpectedly, optimal rDNA transcription requires the presence of a defined subset of components of the pre-rRNA processing machinery.

  18. Studies on the ability of partially iodinated 16S RNA to participate in 30S ribosome assembly.

    Science.gov (United States)

    Schendel, P L; Craven, G R

    1976-11-01

    Deproteinated 16S RNA was iodinated at pH 5.0 in an aqueous solution containing TlCl3 plus KI for 1-5 hours at 42 degrees C. Under these conditions 33 moles of iodine are incorporated per mole of RNA. As judged by sucrose gradient sedimentation, the iodinated RNA does not exhibit any large alteration in conformation as compared to unmodified 16S. The iodinated RNA was examined for its ability to reconstitute with total 30S proteins. Sedimentation velocity analysis reveals that the reconstituted subunit has a sedimentation constant of approximately 20S. In addition, protein analysis of particles reconstituted with 16S RNA iodinated for 5 hours indicates that proteins S2, S10, S13, S14, S15, S17, S18, S19, and S21 are no longer able to participate in the 30S assembly process and that proteins S6, S16 and S20 are present in reduced amounts. The ramifications of these results concerning protein-RNA and RNA-RNA interactions occurring in ribosome assembly are discussed.

  19. First structural evidence of sequestration of mRNA cap structures by type 1 ribosome inactivating protein from Momordica balsamina.

    Science.gov (United States)

    Kushwaha, Gajraj Singh; Yamini, Shavait; Kumar, Mukesh; Sinha, Mau; Kaur, Punit; Sharma, Sujata; Singh, Tej P

    2013-05-01

    This is the first structural evidence of recognition of mRNA cap structures by a ribosome inactivating protein. It is well known that a unique cap structure is formed at the 5' end of mRNA for carrying out various processes including mRNA maturation, translation initiation, and RNA turnover. The binding studies and crystal structure determinations of type 1 ribosome inactivating protein (RIP-1) from Momordica balsamina (MbRIP-1) were carried out with mRNA cap structures including (i) N7-methyl guanine (m7G), (ii) N7-methyl guanosine diphosphate (m7GDP), and (iii) N7-methyl guanosine triphosphate (m7GTP). These compounds showed affinities to MbRIP-1 at nanomolar concentrations. The structure determinations of the complexes of MbRIP-1 with m7G, m7GDP, and m7GTP at 2.65, 1.77, and 1.75 Å resolutions revealed that all the three compounds bound to MbRIP-1 in the substrate binding site at the positions which are slightly shifted towards Glu85 as compared to those of rRNA substrates. In this position, Glu85 forms several hydrogen bonds with guanine moiety while N-7 methyl group forms van der Waals contacts. However, the guanine rings are poorly stacked in these complexes. Thus, the mode of binding by MbRIP-1 to mRNA cap structures is different which results in the inhibition of depurination. Since some viruses are known to exploit the capping property of the host, this action of MbRIP-1 may have implications for the antiviral activity of this protein in vivo. The understanding of the mode of binding of MbRIP-1 to cap structures may also assist in the design of anti-viral agents. Copyright © 2013 Wiley Periodicals, Inc.

  20. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    Science.gov (United States)

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. © 2015 S. Karger AG, Basel.

  1. Dual detection of Legionella pneumophila and Legionella species by real-time PCR targeting the 23S-5S rRNA gene spacer region.

    Science.gov (United States)

    Yang, G; Benson, R; Pelish, T; Brown, E; Winchell, J M; Fields, B

    2010-03-01

    Although the majority of cases of Legionnaires' disease (LD) are caused by Legionella pneumophila, an increasing number of other Legionella species have been reported to cause human disease. There are no clinical presentations unique to LD and hence accurate laboratory tests are required for early diagnosis. Therefore, we designed a real-time PCR assay that targets the 23S-5S rRNA intergenic spacer region (23S-5S PCR) and allows for detection of all Legionella species and discrimination of L. pneumophila from other Legionella species. In total, 271 isolates representing 50 Legionella species were tested and the assay was validated using 39 culture-positive and 110 culture-negative patient specimens collected between 1989 and 2006. PCR-positive results were obtained with all 39 culture-positive samples (100% sensitivity). Specimens that tested positive according to 23S-5S PCR, but were culture-negative, were further analysed by DNA sequencing of the amplicon or the macrophage infectivity potentiator (mip) gene. In addition to L. pneumophila, Legionella longbeachae, Legionella cincinnatiensis and Legionella micdadei were identified in the specimens. The assay showed a 7-log dynamic range displaying a sensitivity of 7.5 CFU/mL or three genome equivalents per reaction. Sixty-one specimens containing viruses or bacteria other than Legionellae were negative according to 23S-5S PCR, demonstrating its specificity. Use of this assay should contribute to the earlier detection of respiratory disease caused by Legionella species, as well as to increased rates of detection.

  2. Isolation of eukaryotic ribosomal proteins. Purification and characterization of the 40 S ribosomal subunit proteins Sa, Sc, S3a, S3b, S5', S9, S10, S11, S12, S14, S15, S15', S16, S17, S18, S19, S20, S21, S26, S27', and S29.

    Science.gov (United States)

    Collatz, E; Ulbrich, N; Tsurugi, K; Lightfoot, H N; MacKinlay, W; Lin, A; Wool, I G

    1977-12-25

    The proteins of the small subunit of rat liver ribosomes were separated into five main groups by stepwise elution from carboxymethylcellulose with LiCl at pH 6.5. Twenty-one proteins (Sa, Sc, S3a, S3b, S5', S9, S10, S11, S12, S14, S15, S15', S16, S17, S18, S19, S20, S21, S26, S27', and S29) were isolated from three groups (A40, C40, and D40) by ion exchange chromatography on DEAE-cellulose, carboxymethylcellulose, and phosphocellulose and by filtration through Sephadex. The amount of protein obtained varied from 0.1 to 11 mg. Six of the proteins (S5', S10, S11, S18, S19, and S27') had no detectable contamination; the impurities in the others were no greater than 9%. The molecular weight of the proteins was estimated by polyacrylamide gel electrophoresis in sodium dodecyl sulfate; the amino acid composition was determined.

  3. An RNA-binding complex involved in ribosome biogenesis contains a protein with homology to tRNA CCA-adding enzyme.

    Directory of Open Access Journals (Sweden)

    Jinzhong Lin

    2013-10-01

    Full Text Available A multitude of proteins and small nucleolar RNAs transiently associate with eukaryotic ribosomal RNAs to direct their modification and processing and the assembly of ribosomal proteins. Utp22 and Rrp7, two interacting proteins with no recognizable domain, are components of the 90S preribosome or the small subunit processome that conducts early processing of 18S rRNA. Here, we determine the cocrystal structure of Utp22 and Rrp7 complex at 1.97 Å resolution and the NMR structure of a C-terminal fragment of Rrp7, which is not visible in the crystal structure. The structure reveals that Utp22 surprisingly resembles a dimeric class I tRNA CCA-adding enzyme yet with degenerate active sites, raising an interesting evolutionary connection between tRNA and rRNA processing machineries. Rrp7 binds extensively to Utp22 using a deviant RNA recognition motif and an extended linker. Functional sites on the two proteins were identified by structure-based mutagenesis in yeast. We show that Rrp7 contains a flexible RNA-binding C-terminal tail that is essential for association with preribosomes. RNA-protein crosslinking shows that Rrp7 binds at the central domain of 18S rRNA and shares a neighborhood with two processing H/ACA snoRNAs snR30 and snR10. Depletion of snR30 prevents the stable assembly of Rrp7 into preribosomes. Our results provide insight into the evolutionary origin and functional context of Utp22 and Rrp7.

  4. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    Science.gov (United States)

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  5. LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions.

    Science.gov (United States)

    Liu, Fakeng; Jin, Rui; Liu, Xiuju; Huang, Henry; Wilkinson, Scott C; Zhong, Diansheng; Khuri, Fadlo R; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

    2016-01-19

    We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells.

  6. [Mutual effect of human ribosomal proteins S5 and S16 on their binding with 18S rRNA fragment 1203-1236/1521-1698].

    Science.gov (United States)

    Ian'shina, D D; Malygin, A A; Karpova, G G

    2009-01-01

    Human ribosomal proteins S5 and S16 are homologues of prokaryotic ribosomal proteins S7p and S9p, respectively, that according to X-ray crystallography data on the Thermus thermophilus 30S ribosomal subunit contact the 3'-terminal 16S rRNA region formed by helices H28-H30 and H38-H43. In the present work we report studying mutual effect of human ribosomal proteins S5 and S16 on their binding with RNA transcript corresponding to the region 1203-1236/1521-1698 of the 18S rRNA (helices H28-30 and H41-43), which is homologous to thel6S rRNA region known to contain binding site of S7p and part of binding site of S9p. It was shown that simultaneous binding of ribosomal proteins S5 and S16 with this RNA transcript causes conformational changes in it stabilizing the complex by involvement of new parts of the RNA that interact with neither S5 nor S16 in the respective binary complexes.

  7. Quinacrine impairs enterovirus 71 RNA replication by preventing binding of polypyrimidine-tract binding protein with internal ribosome entry sites.

    Directory of Open Access Journals (Sweden)

    Jianmin Wang

    Full Text Available Since the 1980s, epidemics of enterovirus 71 (EV71 and other enteroviruses have occurred in Asian countries and regions, causing a wide range of human diseases. No effective therapy is available for the treatment of these infections. Internal ribosome entry sites (IRESs are indispensable for the initiation of translation in enteroviruses. Several cellular factors, as well as the ribosome, are recruited to the conserved IRES during this process. Quinacrine intercalates into the RNA architecture and inhibits RNA transcription and protein synthesis, and a recent study showed that quinacrine inhibited encephalomyocarditis virus and poliovirus IRES-mediated translation in vitro without disrupting internal cellular IRES. Here, we report that quinacrine was highly active against EV71, protecting cells from EV71 infection. Replication of viral RNA, expression of viral capsid protein, and production of virus were all strongly inhibited by quinacrine. Interaction of the polypyrimidine tract-binding protein (PTB with the conserved IRES was prevented by quinacrine. Coxsackieviruses and echovirus were also inhibited by quinacrine in cultured cells. These results indicate that quinacrine may serve as a potential protective agent for use in the treatment of patients with chronic enterovirus infection.

  8. Molecular inventory control in ribosome biosynthesis.

    Science.gov (United States)

    Warner, J R; Johnson, S P

    1986-11-01

    The eukaryotic cell coordinates the accumulation of each ribosomal protein with every other ribosomal protein, with ribosomal RNA and with the needs of the cell. To do so it regulates the transcription, processing, translation and lifetime of the mRNA for ribosomal proteins. When all else fails, it rapidly degrades any excess ribosomal protein which is synthesized.

  9. Phylogeny-function analysis of (meta)genomic libraries: screening for expression of ribosomal RNA genes by large-insert library fluorescent in situ hybridization (LIL-FISH)

    NARCIS (Netherlands)

    Leveau, J.H.J.; Gerards, S.; De Boer, W.; Van Veen, J.A.

    2004-01-01

    We assessed the utility of fluorescent in situ hybridization (FISH) in the screening of clone libraries of (meta)genomic or environmental DNA for the presence and expression of bacterial ribosomal RNA (rRNA) genes. To establish proof-of-principle, we constructed a fosmid-based library in Escherichia

  10. Direct Activation of Ribosome-Associated Double-Stranded RNA-Dependent Protein Kinase (PKR by Deoxynivalenol, Anisomycin and Ricin: A New Model for Ribotoxic Stress Response Induction

    Directory of Open Access Journals (Sweden)

    Hui-Ren Zhou

    2014-12-01

    Full Text Available Double-stranded RNA (dsRNA-activated protein kinase (PKR is a critical upstream mediator of the ribotoxic stress response (RSR to the trichothecene deoxynivalenol (DON and other translational inhibitors. Here, we employed HeLa cell lysates to: (1 characterize PKR’s interactions with the ribosome and ribosomal RNA (rRNA; (2 demonstrate cell-free activation of ribosomal-associated PKR and (3 integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR.

  11. Direct activation of ribosome-associated double-stranded RNA-dependent protein kinase (PKR) by deoxynivalenol, anisomycin and ricin: a new model for ribotoxic stress response induction.

    Science.gov (United States)

    Zhou, Hui-Ren; He, Kaiyu; Landgraf, Jeff; Pan, Xiao; Pestka, James J

    2014-12-16

    Double-stranded RNA (dsRNA)-activated protein kinase (PKR) is a critical upstream mediator of the ribotoxic stress response (RSR) to the trichothecene deoxynivalenol (DON) and other translational inhibitors. Here, we employed HeLa cell lysates to: (1) characterize PKR's interactions with the ribosome and ribosomal RNA (rRNA); (2) demonstrate cell-free activation of ribosomal-associated PKR and (3) integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP) of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR.

  12. Translation complex profile sequencing to study the in vivo dynamics of mRNA-ribosome interactions during translation initiation, elongation and termination.

    Science.gov (United States)

    Shirokikh, Nikolay E; Archer, Stuart K; Beilharz, Traude H; Powell, David; Preiss, Thomas

    2017-04-01

    Messenger RNA (mRNA) translation is a tightly controlled process that is integral to gene expression. It features intricate and dynamic interactions of the small and large subunits of the ribosome with mRNAs, aided by multiple auxiliary factors during distinct initiation, elongation and termination phases. The recently developed ribosome profiling method can generate transcriptome-wide surveys of translation and its regulation. Ribosome profiling records the footprints of fully assembled ribosomes along mRNAs and thus primarily interrogates the elongation phase of translation. Importantly, it does not monitor multiple substeps of initiation and termination that involve complexes between the small ribosomal subunit (SSU) and mRNA. Here we describe a related method, termed 'translation complex profile sequencing' (TCP-seq), that is uniquely capable of recording positions of any type of ribosome-mRNA complex transcriptome-wide. It uses fast covalent fixation of translation complexes in live cells, followed by RNase footprinting of translation intermediates and their separation into complexes involving either the full ribosome or the SSU. The footprints derived from each type of complex are then deep-sequenced separately, generating native distribution profiles during the elongation, as well as the initiation and termination stages of translation. We provide the full TCP-seq protocol for Saccharomyces cerevisiae liquid suspension culture, including a data analysis pipeline. The protocol takes ∼3 weeks to complete by a researcher who is well acquainted with standard molecular biology techniques and who has some experience in ultracentrifugation and the preparation of RNA sequencing (RNA-seq) libraries. Basic Bash and UNIX/Linux command skills are required to use the bioinformatics tools provided.

  13. The structure of the archaebacterial ribosomal protein S7 and its possible interaction with 16S rRNA.

    Science.gov (United States)

    Hosaka, H; Yao, M; Kimura, M; Tanaka, I

    2001-11-01

    Ribosomal protein S7 is one of the ubiquitous components of the small subunit of the ribosome. It is a 16S rRNA-binding protein positioned close to the exit of the tRNA, and it plays a role in initiating assembly of the head of the 30S subunit. Previous structural analyses of eubacterial S7 have shown that it has a stable alpha-helix core and a flexible beta-arm. Unlike these eubacterial proteins, archaebacterial or eukaryotic S7 has an N-terminal extension of approximately 60 residues. The crystal structure of S7 from archaebacterium Pyrococcus horikoshii (PhoS7) has been determined at 2.1 A resolution. The final model of PhoS7 consists of six major alpha-helices, a short 3(10)-helix and two beta-stands. The major part (residues 18-45) of the N-terminal extension of PhoS7 reinforces the alpha-helical core by well-extended hydrophobic interactions, while the other part (residues 46-63) is not visible in the crystal and is possibly fixed only by interacting with 16S rRNA. These differences in the N-terminal extension as well as in the insertion (between alpha1 and alpha2) of the archaebacterial S7 structure from eubacterial S7 are such that they do not necessitate a major change in the structure of the currently available eubacterial 16S rRNA. Some of the inserted chains might pass through gaps formed by helices of the 16S rRNA.

  14. Inhibition of the protein kinase PKR by the internal ribosome entry site of hepatitis C virus genomic RNA.

    Science.gov (United States)

    Vyas, Jashmin; Elia, Androulla; Clemens, Michael J

    2003-07-01

    Translation of the hepatitis C genome is mediated by internal ribosome entry on the structurally complex 5' untranslated region of the large viral RNA. Initiation of protein synthesis by this mechanism is independent of the cap-binding factor eIF4E, but activity of the initiator Met-tRNA(f)-binding factor eIF2 is still required. HCV protein synthesis is thus potentially sensitive to the inhibition of eIF2 activity that can result from the phosphorylation of the latter by the interferon-inducible, double-stranded RNA-activated protein kinase PKR. Two virally encoded proteins, NS5A and E2, have been shown to reduce this inhibitory effect of PKR by impairing the activation of the kinase. Here we present evidence for a third viral strategy for PKR inhibition. A region of the viral RNA comprising part of the internal ribosome entry site (IRES) is able to bind to PKR in competition with double-stranded RNA and can prevent autophosphorylation and activation of the kinase in vitro. The HCV IRES itself has no PKR-activating ability. Consistent with these findings, cotransfection experiments employing a bicistronic reporter construct and wild-type PKR indicate that expression of the protein kinase is less inhibitory towards HCV IRES-driven protein synthesis than towards cap-dependent protein synthesis. These data suggest a dual function for the viral IRES, with both a structural role in promoting initiation complex formation and a regulatory role in preventing inhibition of initiation by PKR.

  15. Cytogenetic characterization by in situ hybridization techniques and molecular analysis of 5S rRNA genes of the European hazelnut (Corylus avellana).

    Science.gov (United States)

    Falistocco, E; Marconi, G

    2013-03-01

    The European hazelnut (Corylus avellana L.) is widespread in Europe, where it has been cultivated for centuries. Despite progress in genetics, most of the cytogenetic aspects of this species have been overlooked. The aim of this study was to fill in this gap and obtain basic information on the chromosome structure of this species. Karyomorphological analysis confirmed the chromosome number 2n = 22 and showed that, despite their apparent uniformity, the chromosomes could be separated into three groups of different size: large (L), medium (M), and small (S). As a first step towards the physical mapping of the hazelnut chromosomes, we applied FISH to localize the position of rRNA genes (rDNA). The sites of 45S and 5S rDNA enabled us to identify two chromosome pairs belonging, respectively, to the L and S groups. The self-GISH procedure revealed that repetitive DNA is concentrated in the pericentromeric regions of the chromosomes, as with other species with rather small genomes. The analysis of 5S rDNA repeats offered additional information on the hazelnut genome by obtaining the whole sequence of the transcribed region so far unpublished. The overall results constitute a substantial advance in hazelnut cytogenetics. Further investigation of other species of Corylus could be an effective approach to understanding the phylogenesis of the genus and resolving taxonomic problems.

  16. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    Science.gov (United States)

    Mishra, Bhavya; Schütz, Gunter M.; Chowdhury, Debashish

    2016-06-01

    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special “slippery” sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obtained from a mean-field analysis of the stochastic dynamics.

  17. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    CERN Document Server

    Mishra, Bhavya; Chowdhury, Debashish

    2016-01-01

    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special "slippery" sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obt...

  18. A tRNA body with high affinity for EF-Tu hastens ribosomal incorporation of unnatural amino acids.

    Science.gov (United States)

    Ieong, Ka-Weng; Pavlov, Michael Y; Kwiatkowski, Marek; Ehrenberg, Måns; Forster, Anthony C

    2014-05-01

    There is evidence that tRNA bodies have evolved to reduce differences between aminoacyl-tRNAs in their affinity to EF-Tu. Here, we study the kinetics of incorporation of L-amino acids (AAs) Phe, Ala allyl-glycine (aG), methyl-serine (mS), and biotinyl-lysine (bK) using a tRNA(Ala)-based body (tRNA(AlaB)) with a high affinity for EF-Tu. Results are compared with previous data on the kinetics of incorporation of the same AAs using a tRNA(PheB) body with a comparatively low affinity for EF-Tu. All incorporations exhibited fast and slow phases, reflecting the equilibrium fraction of AA-tRNA in active ternary complex with EF-Tu:GTP before the incorporation reaction. Increasing the concentration of EF-Tu increased the amplitude of the fast phase and left its rate unaltered. This allowed estimation of the affinity of each AA-tRNA to EF-Tu:GTP during translation, showing about a 10-fold higher EF-Tu affinity for AA-tRNAs formed from the tRNA(AlaB) body than from the tRNA(PheB) body. At ∼1 µM EF-Tu, tRNA(AlaB) conferred considerably faster incorporation kinetics than tRNA(PheB), especially in the case of the bulky bK. In contrast, the swap to the tRNA(AlaB) body did not increase the fast phase fraction of N-methyl-Phe incorporation, suggesting that the slow incorporation of N-methyl-Phe had a different cause than low EF-Tu:GTP affinity. The total time for AA-tRNA release from EF-Tu:GDP, accommodation, and peptidyl transfer on the ribosome was similar for the tRNA(AlaB) and tRNA(PheB) bodies. We conclude that a tRNA body with high EF-Tu affinity can greatly improve incorporation of unnatural AAs in a potentially generalizable manner.

  19. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    Science.gov (United States)

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. A Genome-Wide Analysis of RNA Pseudoknots That Stimulate Efficient −1 Ribosomal Frameshifting or Readthrough in Animal Viruses

    Directory of Open Access Journals (Sweden)

    Xiaolan Huang

    2013-01-01

    Full Text Available Programmed −1 ribosomal frameshifting (PRF and stop codon readthrough are two translational recoding mechanisms utilized by some RNA viruses to express their structural and enzymatic proteins at a defined ratio. Efficient recoding usually requires an RNA pseudoknot located several nucleotides downstream from the recoding site. To assess the strategic importance of the recoding pseudoknots, we have carried out a large scale genome-wide analysis in which we used an in-house developed program to detect all possible H-type pseudoknots within the genomic mRNAs of 81 animal viruses. Pseudoknots are detected downstream from ~85% of the recoding sites, including many previously unknown pseudoknots. ~78% of the recoding pseudoknots are the most stable pseudoknot within the viral genomes. However, they are not as strong as some designed pseudoknots that exhibit roadblocking effect on the translating ribosome. Strong roadblocking pseudoknots are not detected within the viral genomes. These results indicate that the decoding pseudoknots have evolved to possess optimal stability for efficient recoding. We also found that the sequence at the gag-pol frameshift junction of HIV1 harbors potential elaborated pseudoknots encompassing the frameshift site. A novel mechanism is proposed for possible involvement of the elaborated pseudoknots in the HIV1 PRF event.

  1. Delimitation of the Thoracosphaeraceae (Dinophyceae), including the calcareous dinoflagellates, based on large amounts of ribosomal RNA sequence data.

    Science.gov (United States)

    Gottschling, Marc; Soehner, Sylvia; Zinssmeister, Carmen; John, Uwe; Plötner, Jörg; Schweikert, Michael; Aligizaki, Katerina; Elbrächter, Malte

    2012-01-01

    The phylogenetic relationships of the Dinophyceae (Alveolata) are not sufficiently resolved at present. The Thoracosphaeraceae (Peridiniales) are the only group of the Alveolata that include members with calcareous coccoid stages; this trait is considered apomorphic. Although the coccoid stage apparently is not calcareous, Bysmatrum has been assigned to the Thoracosphaeraceae based on thecal morphology. We tested the monophyly of the Thoracosphaeraceae using large sets of ribosomal RNA sequence data of the Alveolata including the Dinophyceae. Phylogenetic analyses were performed using Maximum Likelihood and Bayesian approaches. The Thoracosphaeraceae were monophyletic, but included also a number of non-calcareous dinophytes (such as Pentapharsodinium and Pfiesteria) and even parasites (such as Duboscquodinium and Tintinnophagus). Bysmatrum had an isolated and uncertain phylogenetic position outside the Thoracosphaeraceae. The phylogenetic relationships among calcareous dinophytes appear complex, and the assumption of the single origin of the potential to produce calcareous structures is challenged. The application of concatenated ribosomal RNA sequence data may prove promising for phylogenetic reconstructions of the Dinophyceae in future.

  2. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

    Science.gov (United States)

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

    2013-03-01

    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  3. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    Science.gov (United States)

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  4. Hyper-regulation of pyr-gene expression in Escherichia coli cells with slow ribosomes. Evidence for RNA polymerase pausing in vivo

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank

    1988-01-01

    transcription should terminate or continue into the structural genes. This paper described a study of pyrBI and pyrE gene regulation in cells where the ribosomes move slowly as a result of mutation in rpsL. It appears that expression of the two genes is hyper-regulated by the UTP pool in this type of cells......UTP-modulated attenuation of transcription is involved in regulating the synthesis of pyrimidine nucleotides in Escherichia coli. Thus, expression of two genes, pyrBI and pyrE, was shown to be under this type of control. The genes encode the two subunits of aspartate transcarbamylase and orotate....... Mechanistically this will couple the ribosomes translating a leader peptide gene more tightly to the elongating RNA polymerase. The ribosomes will then be more prone to prevent the folding of the mRNA chains into terminating hairpin structures when RNA polymerase is at the attenuator and has to decide whether...

  5. Ribosome maturation in E. coli.

    Science.gov (United States)

    Silengo, L; Altruda, F; Dotto, G P; Lacquaniti, F; Perlo, C; Turco, E; Mangiarotti, G

    1977-01-01

    In vivo and in vitro experiments have shown that processing of ribosomal RNA is a late event in ribosome biogenesis. The precursor form of RNA is probably necessary to speed up the assembly of ribomal proteins. Newly formed ribosomal particles which have already entered polyribosomes differ from mature ribosomes not only in their RNA content but also in their susceptibility to unfolding in low Mg concentration and to RNase attack. Final maturation of new ribosomes is probably dependent on their functioning in protein synthesis. Thus only those ribosomes which have proven to be functional may be converted into stable cellular structures.

  6. The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA

    Directory of Open Access Journals (Sweden)

    Milos Patrice

    2010-12-01

    Full Text Available Abstract Background Discovery that the transcriptional output of the human genome is far more complex than predicted by the current set of protein-coding annotations and that most RNAs produced do not appear to encode proteins has transformed our understanding of genome complexity and suggests new paradigms of genome regulation. However, the fraction of all cellular RNA whose function we do not understand and the fraction of the genome that is utilized to produce that RNA remain controversial. This is not simply a bookkeeping issue because the degree to which this un-annotated transcription is present has important implications with respect to its biologic function and to the general architecture of genome regulation. For example, efforts to elucidate how non-coding RNAs (ncRNAs regulate genome function will be compromised if that class of RNAs is dismissed as simply 'transcriptional noise'. Results We show that the relative mass of RNA whose function and/or structure we do not understand (the so called 'dark matter' RNAs, as a proportion of all non-ribosomal, non-mitochondrial human RNA (mt-RNA, can be greater than that of protein-encoding transcripts. This observation is obscured in studies that focus only on polyA-selected RNA, a method that enriches for protein coding RNAs and at the same time discards the vast majority of RNA prior to analysis. We further show the presence of a large number of very long, abundantly-transcribed regions (100's of kb in intergenic space and further show that expression of these regions is associated with neoplastic transformation. These overlap some regions found previously in normal human embryonic tissues and raises an interesting hypothesis as to the function of these ncRNAs in both early development and neoplastic transformation. Conclusions We conclude that 'dark matter' RNA can constitute the majority of non-ribosomal, non-mitochondrial-RNA and a significant fraction arises from numerous very long

  7. Insects' RNA Profiling Reveals Absence of "Hidden Break" in 28S Ribosomal RNA Molecule of Onion Thrips, Thrips tabaci.

    Science.gov (United States)

    Macharia, Rosaline Wanjiru; Ombura, Fidelis Levi; Aroko, Erick Onyango

    2015-01-01

    With an exception of aphids, insects' 28S rRNA is thought to harbor a "hidden break" which cleaves under denaturing conditions to comigrate with 18S rRNA band to exhibit a degraded appearance on native agarose gels. The degraded appearance confounds determination of RNA integrity in laboratories that rely on gel electrophoresis. To provide guidelines for RNA profiles, RNA from five major insect orders, namely, Diptera, Hemiptera, Thysanoptera, Hymenoptera, and Lepidoptera, was compared under denaturing and nondenaturing conditions. This study confirmed that although present in most of insect's RNA, the "hidden break" is absent in the 28S rRNA of onion thrips, Thrips tabaci. On the other hand, presence of "hidden break" was depicted in whiteflies' 28S rRNA despite their evolutionary grouping under same order with aphids. Divergence of 28S rRNA sequences confirms variation of both size and composition of gap region among insect species. However, phylogeny reconstruction does not support speciation as a possible source of the hidden break in insect's 28S rRNA. In conclusion, we show that RNA from a given insect order does not conform to a particular banding profile and therefore this approach cannot be reliably used to characterize newly discovered species.

  8. Ribosome Biogenesis in African Trypanosomes Requires Conserved and Trypanosome-Specific Factors

    Science.gov (United States)

    Umaer, Khan; Ciganda, Martin

    2014-01-01

    Large ribosomal subunit protein L5 is responsible for the stability and trafficking of 5S rRNA to the site of eukaryotic ribosomal assembly. In Trypanosoma brucei, in addition to L5, trypanosome-specific proteins P34 and P37 also participate in this process. These two essential proteins form a novel preribosomal particle through interactions with both the ribosomal protein L5 and 5S rRNA. We have generated a procyclic L5 RNA interference cell line and found that L5 itself is a protein essential for trypanosome growth, despite the presence of other 5S rRNA binding proteins. Loss of L5 decreases the levels of all large-subunit rRNAs, 25/28S, 5.8S, and 5S rRNAs, but does not alter small-subunit 18S rRNA. Depletion of L5 specifically reduced the levels of the other large ribosomal proteins, L3 and L11, whereas the steady-state levels of the mRNA for these proteins were increased. L5-knockdown cells showed an increase in the 40S ribosomal subunit and a loss of the 60S ribosomal subunits, 80S monosomes, and polysomes. In addition, L5 was involved in the processing and maturation of precursor rRNAs. Analysis of polysomal fractions revealed that unprocessed rRNA intermediates accumulate in the ribosome when L5 is depleted. Although we previously found that the loss of P34 and P37 does not result in a change in the levels of L5, the loss of L5 resulted in an increase of P34 and P37 proteins, suggesting the presence of a compensatory feedback loop. This study demonstrates that ribosomal protein L5 has conserved functions, in addition to nonconserved trypanosome-specific features, which could be targeted for drug intervention. PMID:24706018

  9. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    Science.gov (United States)

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  10. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number.

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F; Gaal, Tamas; Posfai, Gyorgy

    2015-02-18

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5-10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7-8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, 'feast and famine' life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology.

  11. Chromosomal mapping of repetitive DNAs in the beetle Dichotomius geminatus provides the first evidence for an association of 5S rRNA and histone H3 genes in insects, and repetitive DNA similarity between the B chromosome and A complement.

    Science.gov (United States)

    Cabral-de-Mello, D C; Moura, R C; Martins, C

    2010-04-01

    Chromosomal banding techniques and repetitive DNA mapping are useful tools in comparative analysis and in the elucidation of genome organization of several groups of eukaryotes. In this study, we contributed to the knowledge of Coleoptera genomes by reporting the chromosomal organization of repetitive DNA sequences, as well as the presence and characteristics of a B chromosome in two natural populations of Dichotomius geminatus (Coleoptera; Scarabaeidae) using classical, chromosomal banding and molecular cytogenetic techniques. As in other coleopteran species, the heterochromatin was mainly concentrated in pericentromeric regions and the B chromosome was composed almost entirely of heterochromatin. Physical mapping using double fluorescent in situ hybridization was performed for the first time in Coleoptera; using DNA probes for 5S and 18S ribosomal RNA (rRNA) and histone H3 genes, we showed that ribosomal 18S rDNAs are located in chromosomes 3 and 4, whereas 5S rRNA and histone H3 genes are colocalized in chromosomal pair 2 and show an apparently interspersed organization. Moreover, these genes are not present in the B chromosome, suggesting that the B chromosome did not originate from chromosomal pairs 2, 3 or 4. On the other hand, mapping of the C(0)t-1 DNA fraction showed that the B chromosome is enriched in repetitive DNA elements, also present in the standard complement, indicating an intraspecific origin of this element in D. geminatus. These results will contribute to our understanding of genome organization and evolution of repetitive elements in Coleoptera and other insects regarding both A and B chromosomes.

  12. Accuracy of initial codon selection by aminoacyl-tRNAs on the mRNA-programmed bacterial ribosome.

    Science.gov (United States)

    Zhang, Jingji; Ieong, Ka-Weng; Johansson, Magnus; Ehrenberg, Måns

    2015-08-04

    We used a cell-free system with pure Escherichia coli components to study initial codon selection of aminoacyl-tRNAs in ternary complex with elongation factor Tu and GTP on messenger RNA-programmed ribosomes. We took advantage of the universal rate-accuracy trade-off for all enzymatic selections to determine how the efficiency of initial codon readings decreased linearly toward zero as the accuracy of discrimination against near-cognate and wobble codon readings increased toward the maximal asymptote, the d value. We report data on the rate-accuracy variation for 7 cognate, 7 wobble, and 56 near-cognate codon readings comprising about 15% of the genetic code. Their d values varied about 400-fold in the 200-80,000 range depending on type of mismatch, mismatch position in the codon, and tRNA isoacceptor type. We identified error hot spots (d = 200) for U:G misreading in second and U:U or G:A misreading in third codon position by His-tRNA(His) and, as also seen in vivo, Glu-tRNA(Glu). We suggest that the proofreading mechanism has evolved to attenuate error hot spots in initial selection such as those found here.

  13. Posttranscriptional down-regulation of small ribosomal subunit proteins correlates with reduction of 18S rRNA in RPS19 deficiency.

    Science.gov (United States)

    Badhai, Jitendra; Fröjmark, Anne-Sophie; Razzaghian, Hamid Reza; Davey, Edward; Schuster, Jens; Dahl, Niklas

    2009-06-18

    Ribosomal protein S19 (RPS19) is mutated in patients with Diamond-Blackfan anemia (DBA). We hypothesized that decreased levels of RPS19 lead to a coordinated down-regulation of other ribosomal (r-)proteins at the subunit level. We show that small interfering RNA (siRNA) knock-down of RPS19 results in a relative decrease of small subunit (SSU) r-proteins (S20, S21 and S24) when compared to large subunit (LSU) r-proteins (L3, L9, L30 and L38). This correlates with a relative decrease in 18S rRNA with respect to 28S rRNA. The r-protein mRNA levels remain relatively unchanged indicating a post transcriptional regulation of r-proteins at the level of subunit formation.

  14. Predicted class-I aminoacyl tRNA synthetase-like proteins in non-ribosomal peptide synthesis

    Directory of Open Access Journals (Sweden)

    Iyer Lakshminarayan M

    2010-08-01

    Full Text Available Abstract Background Recent studies point to a great diversity of non-ribosomal peptide synthesis systems with major roles in amino acid and co-factor biosynthesis, secondary metabolism, and post-translational modifications of proteins by peptide tags. The least studied of these systems are those utilizing tRNAs or aminoacyl-tRNA synthetases (AAtRS in non-ribosomal peptide ligation. Results Here we describe novel examples of AAtRS related proteins that are likely to be involved in the synthesis of widely distributed peptide-derived metabolites. Using sensitive sequence profile methods we show that the cyclodipeptide synthases (CDPSs are members of the HUP class of Rossmannoid domains and are likely to be highly derived versions of the class-I AAtRS catalytic domains. We also identify the first eukaryotic CDPSs in fungi and in animals; they might be involved in immune response in the latter organisms. We also identify a paralogous version of the methionyl-tRNA synthetase, which is widespread in bacteria, and present evidence using contextual information that it might function independently of protein synthesis as a peptide ligase in the formation of a peptide- derived secondary metabolite. This metabolite is likely to be heavily modified through multiple reactions catalyzed by a metal-binding cupin domain and a lysine N6 monooxygenase that are strictly associated with this paralogous methionyl-tRNA synthetase (MtRS. We further identify an analogous system wherein the MtRS has been replaced by more typical peptide ligases with the ATP-grasp or modular condensation-domains. Conclusions The prevalence of these predicted biosynthetic pathways in phylogenetically distant, pathogenic or symbiotic bacteria suggests that metabolites synthesized by them might participate in interactions with the host. More generally, these findings point to a complete spectrum of recruitment of AAtRS to various non-ribosomal biosynthetic pathways, ranging from the

  15. Neonatal Meningitis by Multidrug Resistant Elizabethkingia meningosepticum Identified by 16S Ribosomal RNA Gene Sequencing

    Directory of Open Access Journals (Sweden)

    V. V. Shailaja

    2014-01-01

    Full Text Available Clinical and microbiological profile of 9 neonates with meningitis by Elizabethkingia meningosepticum identified by 16S ribosomal gene sequencing was studied. All the clinical isolates were resistant to cephalosporins, aminoglycosides, trimethoprim-sulfamethoxazole, β-lactam combinations, carbapenems and only one isolate was susceptible to ciprofloxacin. All the isolates were susceptible to vancomycin. Six of nine neonates died even after using vancomycin, based on susceptibility results. E. meningosepticum meningitis in neonates results in high mortality rate. Though the organism is susceptible to vancomycin in vitro, its efficacy in vivo is questionable and it is difficult to determine the most appropriate antibiotic for treating E. meningosepticum meningitis in neonates.

  16. Open complex scrunching before nucleotide addition accounts for the unusual transcription start site of E. coli ribosomal RNA promoters.

    Science.gov (United States)

    Winkelman, Jared T; Chandrangsu, Pete; Ross, Wilma; Gourse, Richard L

    2016-03-29

    Most Escherichia coli promoters initiate transcription with a purine 7 or 8 nt downstream from the -10 hexamer, but some promoters, including the ribosomal RNA promoter rrnB P1, start 9 nt from the -10 element. We identified promoter and RNA polymerase determinants of this noncanonical rrnB P1 start site using biochemical and genetic approaches including mutational analysis of the promoter, Fe(2+) cleavage assays to monitor template strand positions near the active-site, and Bpa cross-linking to map the path of open complex DNA at amino acid and nucleotide resolution. We find that mutations in several promoter regions affect transcription start site (TSS) selection. In particular, we show that the absence of strong interactions between the discriminator region and σ region 1.2 and between the extended -10 element and σ region 3.0, identified previously as a determinant of proper regulation of rRNA promoters, is also required for the unusual TSS. We find that the DNA in the single-stranded transcription bubble of the rrnB P1 promoter complex expands and is "scrunched" into the active site channel of RNA polymerase, similar to the situation in initial transcribing complexes. However, in the rrnB P1 open complex, scrunching occurs before RNA synthesis begins. We find that the scrunched open complex exhibits reduced abortive product synthesis, suggesting that scrunching and unusual TSS selection contribute to the extraordinary transcriptional activity of rRNA promoters by increasing promoter escape, helping to offset the reduction in promoter activity that would result from the weak interactions with σ.

  17. Two 5S genes are expressed in chicken somatic cells.

    OpenAIRE

    Lazar, E; Haendler, B.; Jacob, M

    1983-01-01

    Two 5S RNA species were detected in chicken cells. 5S I RNA has the nucleotide sequence of chicken 5S RNA previously published by Brownlee et al. (1) and 5S II RNA differs from it by 10 mutations. The secondary structure of both species is compatible with that proposed for other eukaryotic 5S RNAs. 5S II RNA represents 50-60% of 5S I RNA. Both species were found in total chicken liver and brain and were present in polysomes in the same relative proportions. Only one 5S RNA species could be de...

  18. Intra-genomic ribosomal RNA polymorphism and morphological variation in Elphidium macellum suggests inter-specific hybridization in foraminifera.

    Directory of Open Access Journals (Sweden)

    Loïc Pillet

    Full Text Available Elphidium macellum is a benthic foraminifer commonly found in the Patagonian fjords. To test whether its highly variable morphotypes are ecophenotypes or different genotypes, we analysed 70 sequences of the SSU rRNA gene from 25 specimens. Unexpectedly, we identified 11 distinct ribotypes, with up to 5 ribotypes co-occurring within the same specimen. The ribotypes differ by varying blocks of sequence located at the end of stem-loop motifs in the three expansion segments specific to foraminifera. These changes, distinct from typical SNPs and indels, directly affect the structure of the expansion segments. Their mosaic distribution suggests that ribotypes originated by recombination of two or more clusters of ribosomal genes. We propose that this expansion segment polymorphism (ESP could originate from hybridization of morphologically different populations of Patagonian Elphidium. We speculate that the complex geological history of Patagonia enhanced divergence of coastal foraminiferal species and contributed to increasing genetic and morphological variation.

  19. RNA:protein ratio of the unicellular organism as a characteristic of phosphorous and nitrogen stoichiometry and of the cellular requirement of ribosomes for protein synthesis

    Directory of Open Access Journals (Sweden)

    Sams Carl E

    2006-09-01

    Full Text Available Abstract Background Mean phosphorous:nitrogen (P:N ratios and relationships of P:N ratios with the growth rate of organisms indicate a surprising similarity among and within microbial species, plants, and insect herbivores. To reveal the cellular mechanisms underling this similarity, the macromolecular composition of seven microorganisms and the effect of specific growth rate (SGR on RNA:protein ratio, the number of ribosomes, and peptide elongation rate (PER were analyzed under different conditions of exponential growth. Results It was found that P:N ratios calculated from RNA and protein contents in these particular organisms were in the same range as the mean ratios reported for diverse organisms and had similar positive relationships with growth rate, consistent with the growth-rate hypothesis. The efficiency of protein synthesis in microorganisms is estimated as the number of active ribosomes required for the incorporation of one amino acid into the synthesized protein. This parameter is calculated as the SGR:PER ratio. Experimental and theoretical evidence indicated that the requirement of ribosomes for protein synthesis is proportional to the RNA:protein ratio. The constant of proportionality had the same values for all organisms, and was derived mechanistically from the characteristics of the protein-synthesis machinery of the cell (the number of nucleotides per ribosome, the average masses of nucleotides and amino acids, the fraction of ribosomal RNA in the total RNA, and the fraction of active ribosomes. Impairment of the growth conditions decreased the RNA:protein ratio and increased the overall efficiency of protein synthesis in the microorganisms. Conclusion Our results suggest that the decrease in RNA:protein and estimated P:N ratios with decrease in the growth rate of the microorganism is a consequence of an increased overall efficiency of protein synthesis in the cell resulting from activation of the general stress response and

  20. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    Science.gov (United States)

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Structural and functional evaluation of interaction between mammalian ribosomal RNA with platinum-containing antineoplastic drugs.

    Science.gov (United States)

    Theile, Dirk; Kos, Martin

    2016-02-03

    Cisplatin, oxaliplatin, and carboplatin primarily target DNA, but also alter RNA functionality, albeit to different extent. This study determined the in vitro cytotoxicity (IC50 values) of platinum drugs in LS180 cells and compared the rRNA platination patterns following IC50 exposure. Relevance of particular secondary RNA structures for platination susceptibility was evaluated by primer extension methodology using 18S rRNA as a model RNA. Consequences of rRNA platination for translation efficiency were evaluated by monitoring fluorescence of a destabilised green fluorescent protein variant through flow cytometry. Oxaliplatin and cisplatin were most cytotoxic with IC50 values of 1.7 μM±0.8 and 4.1 μM±0.1, respectively. Carboplatin was significantly less efficient (IC50 147.1 μM±19.4). When exposed to equitoxic concentrations (respective IC50), all three compounds caused similar stop signal incidence or intensity. Moreover, the same rRNA sites were targeted without selectivity for particular secondary structures but with a slight preference for guanine-rich regions. Compared to cycloheximide, none of the drugs diminished translation efficiency at typical in vivo concentrations. In conclusion, equitoxic concentrations of platinum drugs target the same sites in cellular rRNA and cause similar platination intensities. At pharmacokinetically relevant concentrations, cisplatin, oxaliplatin or carboplatin do not inhibit translation efficiency. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  2. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter

    2002-01-01

    electron microscopy. In general, the 2-cell and 4-cell embryos fixed at 10 and 20 h postcleavage (hpc) showed no signs of rRNA transcription. Four small clusters of fluorescein isothiocyanate (FITC) labeling were visible in interphase nuclei, consistent with hybridization to the rRNA gene clusters only...

  3. The major transcripts of the kinetoplast Trypanosoma brucei are very small ribosomal RNA's.

    NARCIS (Netherlands)

    I.C. Eperon; J.W.G. Janssen; J.H.J. Hoeijmakers (Jan); P. Borst (Piet)

    1983-01-01

    textabstractThe nucleotide sequence has been determined of a 2.2 kb segment of kinetoplast DNA, which encodes the major mitochondrial transcripts (12S and 9S) of Trypanosoma brucei. The sequence shows that the 12S RNA is a large subunit rRNA, although sufficiently unusual for resistance to chloramph

  4. Synergistic Internal Ribosome Entry Site/MicroRNA-Based Approach for Flavivirus Attenuation and Live Vaccine Development

    Directory of Open Access Journals (Sweden)

    Konstantin A. Tsetsarkin

    2017-04-01

    Full Text Available The recent emergence of Zika virus underscores the need for new strategies for a rapid development of safe flavivirus vaccines. Using another flavivirus (Langat virus [LGTV] that belongs to the group of tick-borne flaviviruses as a model, we describe a dual strategy for virus attenuation which synergistically accesses the specificity of microRNA (miRNA genome targeting and the effectiveness of internal ribosome entry site (IRES insertion. To increase the stability and immunogenicity of bicistronic LGTVs, we developed a novel approach in which the capsid (C protein gene was relocated into the 3′ noncoding region (NCR and expressed under translational control from an IRES. Engineered bicistronic LGTVs carrying multiple target sequences for brain-specific miRNAs were stable in Vero cells and induced adaptive immunity in mice. Importantly, miRNA-targeted bicistronic LGTVs were not pathogenic for either newborn mice after intracranial inoculation or adult immunocompromised mice (SCID or type I interferon receptor knockout after intraperitoneal injection. Moreover, bicistronic LGTVs were restricted for replication in tick-derived cells, suggesting an interruption of viral transmission in nature by arthropod vectors. This approach is suitable for reliable att