WorldWideScience

Sample records for 5s rdna transcripts

  1. Nucleolar association and transcriptional inhibition through 5S rDNA in mammals.

    Science.gov (United States)

    Fedoriw, Andrew M; Starmer, Joshua; Yee, Della; Magnuson, Terry

    2012-01-01

    Changes in the spatial positioning of genes within the mammalian nucleus have been associated with transcriptional differences and thus have been hypothesized as a mode of regulation. In particular, the localization of genes to the nuclear and nucleolar peripheries is associated with transcriptional repression. However, the mechanistic basis, including the pertinent cis- elements, for such associations remains largely unknown. Here, we provide evidence that demonstrates a 119 bp 5S rDNA can influence nucleolar association in mammals. We found that integration of transgenes with 5S rDNA significantly increases the association of the host region with the nucleolus, and their degree of association correlates strongly with repression of a linked reporter gene. We further show that this mechanism may be functional in endogenous contexts: pseudogenes derived from 5S rDNA show biased conservation of their internal transcription factor binding sites and, in some cases, are frequently associated with the nucleolus. These results demonstrate that 5S rDNA sequence can significantly contribute to the positioning of a locus and suggest a novel, endogenous mechanism for nuclear organization in mammals.

  2. The 5S rDNA gene family in mollusks: characterization of transcriptional regulatory regions, prediction of secondary structures, and long-term evolution, with special attention to Mytilidae mussels.

    Science.gov (United States)

    Vizoso, Miguel; Vierna, Joaquín; González-Tizón, Ana M; Martínez-Lage, Andrés

    2011-01-01

    Several reports on the characterization of 5S ribosomal DNA (5S rDNA) in various animal groups have been published to date, but there is a lack of studies analyzing this gene family in a much broader context. Here, we have studied 5S rDNA variation in several molluskan species, including bivalves, gastropods, and cephalopods. The degree of conservation of transcriptional regulatory regions was analyzed in these lineages, revealing a conserved TATA-like box in the upstream region. The evolution of the 120 bp coding region (5S) was also studied, suggesting the occurrence of paralogue groups in razor clams, clams, and cockles. In addition, 5S rDNA sequences from 11 species and 7 genus of Mytilidae Rafinesque, 1815 mussels were sampled and studied in detail. Four different 5S rDNA types, based on the nontranscribed spacer region were identified. The phylogenetic analyses performed within each type showed a between-species gene clustering pattern, suggesting ancestral polymorphism. Moreover, some putative pseudogenized 5S copies were also identified. Our report, together with previous studies that found high degree of intragenomic divergence in bivalve species, suggests that birth-and-death evolution may be the main force driving the evolution of 5S rDNA in these animals, even at the genus level.

  3. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Science.gov (United States)

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. A Pol V-mediated silencing, independent of RNA-directed DNA methylation, applies to 5S rDNA.

    Directory of Open Access Journals (Sweden)

    Julien Douet

    2009-10-01

    Full Text Available The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA-directed DNA methylation (RdDM, which also requires activities from RDR2 (RNA-Dependent RNA Polymerase 2, DCL3 (Dicer-Like 3, AGO4 (Argonaute, and DRM2 (Domains Rearranged Methyltransferase 2. RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA-encoding DNA (rDNA arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V-loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM-independent and comes specifically at chromosome 4, in addition to the RdDM pathway.

  5. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    Science.gov (United States)

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S rDNA

  6. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Science.gov (United States)

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  7. Molecular organization of 5S rDNA in bitterlings (Cyprinidae).

    Science.gov (United States)

    Fujiwara, Mika; Inafuku, Junya; Takeda, Akiko; Watanabe, Akiko; Fujiwara, Atushi; Kohno, Sei-Ichi; Kubota, Souichirou

    2009-04-01

    Molecular organization and nucleotide sequences of the 5S rRNA gene and NTS were investigated in freshwater fish, bitterlings (Acheilognathinae), including 10 species/subspecies of four genera, Acheilognathus, Pseudoperilampus, Rhodeus, and Tanakia, to understand the evolutionary trait of 5S rDNA arrays. Southern hybridization analysis revealed a general trend with tandem repeats of 5S rDNA in all the examined bitterlings. Sequence analysis demonstrated a conserved 120 bp sequence of the 5S rRNA gene and a short NTS of 56-67 bp with two distinct portions, a conserved (5'-flanking portion; at positions -1 to -38) and a variable part (3'-flanking portion), in 6 of 10 species/subspecies examined. The conserved NTS region was most likely an external promoter so far observed in various vertebrates, whereas the variable NTS region could be divided into two types due to its nucleotide polymorphisms. Molecular phylogeny using the 5S rRNA gene and NTS sequences suggested the occurrence of 5S rDNA duplication before speciation and a concerted evolution for the gene and conserved NTS regions, but a birth-and-death process to maintain the variable NTS region. Thus, the 5S rDNA in the examined bitterlings might have evolved under a mixed process of evolution.

  8. The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

    Science.gov (United States)

    Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

    2015-12-03

    The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

  9. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Science.gov (United States)

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  10. Physical mapping of 18S-25S rDNA and 5S rDNA in Lupinus via fluorescent in situ hybridization.

    Science.gov (United States)

    Naganowska, Barbara; Zielińska, Anna

    2002-01-01

    Double-target fluorescent in situ hybridization (FISH) was used to determine the genomic distribution of ribosomal RNA genes in five Lupinus species: L. cosentinii (2n=32), L. pilosus (2n=42), L. angustifolius (2n=40), L. luteus (2n=52) and L. mutabilis (2n=48). 18S-25S rDNA and 5S rDNA were used as probes. Some interspecific variation was observed in the number and size of the 18S-25S rDNA loci. All the studied species had one chromosome pair carrying 5S rDNA.

  11. Low abundant spacer 5S rRNA transcripts are frequently polyadenylated in Nicotiana.

    Science.gov (United States)

    Fulnecek, Jaroslav; Kovarik, Ales

    2007-11-01

    In plants, 5S rRNA genes (5S rDNA) encoding 120-nt structural RNA molecules of ribosomes are organized in tandem arrays comprising thousands of units. Failure to correctly terminate transcription would generate longer inaccurately processed transcripts interfering with ribosome biogenesis. Hence multiple termination signals occur immediately after the 5S rRNA coding sequence. To obtain information about the efficiency of termination of 5S rDNA transcription in plants we analyzed 5S rRNA pools in three Nicotiana species, N. sylvestris, N. tomentosiformis and N. tabacum. In addition to highly abundant 120-nt 5S rRNA transcripts, we also detected RNA species composed of a genic region and variable lengths of intergenic sequences. These genic-intergenic RNA molecules occur at a frequency severalfold lower than the mature 120-nt transcripts, and are posttranscriptionally modified by polyadenylation at their 3' end in contrast to 120-nt transcripts. An absence of 5S small RNAs (smRNA) argue against a dominant role for the smRNA biosynthesis pathway in the degradation of aberrant 5S rRNA in Nicotiana. This work is the first description of polyadenylated 5S rRNA species in higher eukaryotes originating from a read-through transcription into the intergenic spacer. We propose that polyadenylation may function in a "quality control" pathway ensuring that only correctly processed molecules enter the ribosome biogenesis.

  12. Discrimination of Shark species by simple PCR of 5S rDNA repeats

    Directory of Open Access Journals (Sweden)

    Danillo Pinhal

    2008-01-01

    Full Text Available Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat units amplification, in order to contribute conservation management of these animals. The generated agarose electrophoresis band patterns allowed to unequivocally distinguish eight shark species. The data showed for the first time that a simple PCR is able to discriminate elasmobranch species. The described 5S rDNA PCR approach generated species-specific genetic markers that should find broad application in fishery management and trade of sharks and their subproducts.

  13. Chromosomal localization of rDNA genes and genomic organization of 5S rDNA in Oreochromis mossambicus, O. urolepis hornorum and their hybrid

    Indian Academy of Sciences (India)

    Hua Ping Zhu; Mai Xin Lu; Feng Ying Gao; Zhang Han Huang; Li Ping Yang; Jain Fang Gui

    2010-08-01

    In this study, classical and molecular cytogenetic analyses were performed in tilapia fishes, Oreochromis mossambicus (XX/XY sex determination system), O. urolepis hornorum (WZ/ZZ sex determination system) and their hybrid by crossing O. mossambicus female × O. u. hornorum male. An identical karyotype (($2n = 44$, NF (total number of chromosomal arms) = 50) was obtained from three examined tilapia samples. Genomic organization analysis of 5S rDNA revealed two different types of 5S rDNA sequences, 5S type I and 5S type II. Moreover, fluorescence in situ hybridization (FISH) with 5S rDNA probes showed six positive fluorescence signals on six chromosomes of all the analysed metaphases from the three tilapia samples. Subsequently, 45S rDNA probes were also prepared, and six positive fluorescence signals were observed on three chromosome pairs in all analysed metaphases of the three tilapia samples. The correlation between 45 rDNA localization and nucleolar organizer regions (NORs) was confirmed by silver nitrate staining in tilapia fishes. Further, different chromosomal localizations of 5S rDNA and 45S rDNA were verified by two different colour FISH probes. Briefly, the current data provide an insights for hybridization projects and breeding improvement of tilapias.

  14. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    Science.gov (United States)

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  15. 5S rDNA characterization in twelve Sciaenidae fish species (Teleostei, Perciformes: depicting gene diversity and molecular markers

    Directory of Open Access Journals (Sweden)

    Fernanda A. Alves-Costa

    2008-01-01

    Full Text Available In order to extend the genetic data on the Sciaenidae fish family, the present study had the purpose to characterize PCR-generated 5S rDNA repeats of twelve species of this group through PAGE (Polyacrylamide Gel Electrophoresis analysis. The results showed the occurrence of at least two different 5S rDNA size classes in all the species. Moreover, 5S rDNA repeats of one of the studied species - Isopisthus parvipinnis - were cloned and subjected to nucleotide sequencing and Southern blot membrane hybridization analyses, which permitted to confirm the existence of two major 5S rDNA classes. Phylogenetic analysis based on the nucleotide sequences of different 5S rDNA repeats of I. parvipinnis lead to their separation into two major clusters. These results may reflect the high dynamism that rules the evolution rate of 5S rDNA repeats. The obtained data suggest that 5S rDNA can be useful in genetic analyses to identify species-specific markers and determine relationships among species of the Sciaenidae group.

  16. A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).

    Science.gov (United States)

    Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao

    2017-01-01

    In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.

  17. Obtencao de marcadores moleculares 5S rDNA para populaces nativas e introduzidas de Cichla , do Brasil

    National Research Council Canada - National Science Library

    De Oliveira, Viviane Fatima; De Oliveira, Alessandra Valeria; Prioli, Alberto Jose; Alves Pinto Prioli, Sonia Maria

    2008-01-01

    .... O objetivo desse trabalho foi padronizar a metodologia de amplificacao de regioes nao-transcritas da familia multigenica rDNA 5S de Cichla e obter marcadores especificos para as especies parentais...

  18. Evolutionary dynamics of 5S rDNA location in acridid grasshoppers and its relationship with H3 histone gene and 45S rDNA location.

    Science.gov (United States)

    Cabral-de-Mello, Diogo C; Cabrero, Josefa; López-León, María Dolores; Camacho, Juan Pedro M

    2011-07-01

    We analyze the chromosomal location of 5S rDNA clusters in 29 species of grasshoppers belonging to the family Acrididae. There was extensive variation among species for the number and location of 5S rDNA sites. Out of 148 sites detected, 75% were proximally located, 21.6% were interstitial, and only 3.4% were distal. The number of 5S rDNA sites per species varied from a single chromosome pair (in six species) to all chromosome pairs (in five species), with a range of intermediate situations. Thirteen chromosomes from eight species carried two 5S rDNA clusters. At intraspecific level, differences among populations were detected in Eyprepocnemis plorans, and some heteromorphisms have also been observed in some species. Double FISH for 5S rDNA and H3 histone gene DNA, performed on 17 of these 29 species, revealed that both markers are sometimes placed in a same chromosome but at different location, whereas they appeared to co-localize in five species (Calliptamus barbarus, Heteracris adpersa, Aiolopus strepens, Oedipoda charpentieri and O. coerulescens). Double fiber-FISH in A. strepens and O. coerulescens showed that the two DNAs are closely interspersed with variable relative amounts of both classes of DNA. Finally, no correlation was observed between the number of 5S and 45S rDNA clusters in 23 species where this information was available. These results are discussed in the light of possible mechanisms of spread that led to the extensive variation in the number of clusters observed for both rDNA types in acridid grasshoppers.

  19. Karyotypic features including organizations of the 5S, 45S rDNA loci and telomeres of Scadoxus multiflorus (Amaryllidaceae).

    Science.gov (United States)

    Monkheang, Pansa; Chaveerach, Arunrat; Sudmoon, Runglawan; Tanee, Tawatchai

    2016-01-01

    Scadoxus multiflorus Martyn, 1795 is an ornamental plant with brilliantly colored flowers. Even though its chromosomes are rather large, there is no karyotype description reported so far. Therefore, conventional and molecular cytogenetic studies including fluorescence in situ hybridization (FISH) with 45S and 5S rDNA, and human telomere sequence (TTAGGG)n probes (Arabidopsis-type telomere probes yielded negative results) were carried out. The chromosome number is as reported previously, 2n = 18. The nine chromosome pairs include two large submetacentric, five large acrocentric, one medium acrocentric, two small metacentric and eight small submetacentric chromosomes. Hybridization sites of the 45S rDNA signals were on the short arm ends of chromosomes #1, #3 and #8, while 5S rDNA signals appeared on the long arm of chromosome 3, in one homologue as a double signal. The telomere signals were restricted to all chromosome ends. Three chromosome pairs could be newly identified, chromosome pair 3 by 5S rDNA and chromosomes #1, #3 and #8 by 45S rDNA loci. In addition to new information about rDNA locations we show that the ends of Scadoxus multiflorus chromosomes harbor human instead of Arabidopsis-type telomere sequences. Overall, the Scadoxus multiflorus karyotype presents chromosomal heteromorphy concerning size, shape and 45S and 5S rDNA positioning. As Scadoxus Rafinesque, 1838 and related species are poorly studied on chromosomal level the here presented data is important for better understanding of evolution in Amaryllidaceae.

  20. Contrasting patterns of the 5S and 45S rDNA evolutions in the Byblis liniflora complex (Byblidaceae).

    Science.gov (United States)

    Fukushima, Kenji; Imamura, Kaori; Nagano, Katsuya; Hoshi, Yoshikazu

    2011-03-01

    To clarify the evolutionary dynamics of ribosomal RNA genes (rDNAs) in the Byblis liniflora complex (Byblidaceae), we investigated the 5S and 45S rDNA genes through (1) chromosomal physical mapping by fluorescence in situ hybridization (FISH) and (2) phylogenetic analyses using the nontranscribed spacer of 5S rDNA (5S-NTS) and the internal transcribed spacer of 45S rDNA (ITS). In addition, we performed phylogenetic analyses based on rbcL and trnK intron. The complex was divided into 2 clades: B. aquatica-B. filifolia and B. guehoi-B. liniflora-B. rorida. Although members of the complex had conservative symmetric karyotypes, they were clearly differentiated on chromosomal rDNA distribution patterns. The sequence data indicated that ITS was almost homogeneous in all taxa in which two or four 45S rDNA arrays were frequently found at distal regions of chromosomes in the somatic karyotype. ITS homogenization could have been prompted by relatively distal 45S rDNA positions. In contrast, 2-12 5S rDNA arrays were mapped onto proximal/interstitial regions of chromosomes, and some paralogous 5S-NTS were found in the genomes harboring 4 or more arrays. 5S-NTS sequence type-specific FISH analysis showed sequence heterogeneity within and between some 5S rDNA arrays. Interlocus homogenization may have been hampered by their proximal location on chromosomes. Chromosomal location may have affected the contrasting evolutionary dynamics of rDNAs in the B. liniflora complex.

  1. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    Science.gov (United States)

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  2. Phylogenetic relationships among diploid Aegilops species inferred from 5S rDNA units.

    Science.gov (United States)

    Baum, B R; Edwards, T; Johnson, D A

    2009-10-01

    Relationships among the currently recognized 11 diploid species within the genus Aegilops have been investigated. Sequence similarity analysis, based upon 363 sequenced 5S rDNA clones from 44 accessions plus 15 sequences retrieved from GenBank, depicted two unit classes labeled the long AE1 and short AE1. Several different analytical methods were applied to infer relationships within haplomes, between haplomes and among the species, including maximum parsimony and maximum likelihood analyses of consensus sequences, "total evidence" phylogeny analysis and "matrix representation with parsimony" analysis. None were able to depict suites of markers or unit classes that could discern among the seven haplomes as is observed among established haplomes in other genera within the tribe Triticeae; however, most species could be separated when displayed on gene trees. These results suggest that the haplomes currently recognized are so refined that they may be relegated as sub-haplomes or haplome variants. Amblyopyrum shares the same 5S rDNA unit classes with the diploid Aegilops species suggesting that it belongs within the latter. Comparisons of the Aegilops sequences with those of Triticum showed that the long AE1 unit class of Ae. tauschii shared the clade with the equivalent long D1 unit class, i.e., the putative D haplome donor, but the short AE1 unit class did not. The long AE1 unit class but not the short, of Ae. speltoides and Ae. searsii both share the clade with the previously identified long {S1 and long G1 unit classes meaning that both Aegilops species can be equally considered putative B haplome donors to tetraploid Triticum species. The semiconserved nature of the nontranscribed spacer in Aegilops and in Triticeae in general is discussed in view that it may have originated by processes of incomplete gene conversion or biased gene conversion or birth-and-death evolution.

  3. Transcription of the 5S rRNA heterochromatic genes is epigenetically controlled in Arabidopsis thaliana and Xenopus laevis.

    Science.gov (United States)

    Douet, J; Tourmente, S

    2007-07-01

    5S ribosomal DNA is a highly conserved tandemly repeated multigenic family. As suggested for a long time, we have shown that only a fraction of the 5S rRNA genes are expressed in Arabidopsis thaliana. In Xenopus laevis, there is a developmental control of the expression of the 5S rRNA genes with only one of the two 5S rDNA families expressed during oogenesis. For both Arabidopsis and Xenopus, the strongest transcription of 5S rRNA, respectively in the seed and during oogenesis is correlated with heterogeneity in the transcribed 5S rRNAs. Epigenetic mechanisms such as modification of the chromatin structure are involved in the transcriptional regulation of the 5S rRNA genes in both organisms. In Arabidopsis, two silencing pathways, methylation-dependent (RNAi) and methylation-independent (MOM pathway), are involved in the silencing of a 5S rDNA fraction.

  4. Linked 5S and 45S rDNA sites are highly conserved through the subfamily Aurantioideae (Rutaceae).

    Science.gov (United States)

    Barros E Silva, A E; Dos Santos Soares Filho, W; Guerra, M

    2013-01-01

    Sites of 5S and 45S rDNA are more commonly located on different chromosomes of most angiosperms. Previous investigations have shown that in the subfamily Aurantioideae these sites may appear closely linked (adjacent sites), as in Poncirustrifoliata, or completely isolated, as in some species of Citrus. In the present work, the distribution of rDNA sites was investigated in representatives of 9 genera of Aurantioideae by FISH and CMA banding, aiming to understand the evolution of adjacent sites in the subfamily. A total of 57 rDNA sites were observed, 40 of them being adjacent to each other. All adjacent sites displayed the 45S rDNA array more terminally located. Assuming that the linked 5S-45S rDNA arrangement was the ancestral condition in Aurantioideae, the isolated rDNA sites observed in Clausena excavata,Bergera koenigii, and Fortunella obovata, as well as the complete linkage loss in Citrus maxima and C. medica indicates that unlinked sites arose independently several times in the evolution of the group. The linkage loss may be due to independent dispersion of one or both rDNA sequence families followed by deletion of the corresponding array in the adjacent site. The possible mechanisms behind these events and their occurrence in other groups are discussed.

  5. Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.

    Science.gov (United States)

    Roa, Fernando; Guerra, Marcelo

    2015-01-01

    5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.

  6. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Science.gov (United States)

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  7. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    Science.gov (United States)

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  8. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Science.gov (United States)

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  9. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    Science.gov (United States)

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  10. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae

    Directory of Open Access Journals (Sweden)

    PATRICIA M. AGUILERA

    2016-03-01

    Full Text Available ABSTRACT We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  11. The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

    OpenAIRE

    1986-01-01

    We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

  12. The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

    OpenAIRE

    1986-01-01

    We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

  13. Comparative Studies of 5S rDNA Profiles and Cyt b Sequences in two Onychostoma Species (Cyprinidae

    Directory of Open Access Journals (Sweden)

    Chiao-Chuan Han

    2015-12-01

    Full Text Available Onychostoma barbatulum and O. alticorpus, two primarily freshwater cyprinid fish, have similar morphological characters and partially overlapping ecological habitats. In order to explore the genetic differences between these two species, chromosomal characteristics and genetic variations were examined by fluorescence in situ hybridization (FISH of 5S rDNA and cytochrome (Cyt b gene analysis. Ten specimens of O. barbatulum and O. alticorpus were collected from the Nanzihsian Stream in southern Taiwan. FISH revealed that the 5S rDNA loci of O. barbatulum and O. alticorpus were found at a pericentromeric and subtelomeric position, respectively, in a pair of submetacentric chromosomes. Cyt b genes were amplified and sequenced from five individuals of each species. Intraspecific genetic distances ranged from 0.001–0.004 in O. barbatulum and from 0.001–0.006 in O. alticorpus. Genetic distances between these two species ranged from 0.132–0.142. The phylogenetic tree showed these two species are not sister species. In conclusion, FISH cytogenetic information and Cyt b gene analyses indicated that these two species have significantly different genetic characteristics; nevertheless, their morphological similarities may be due to environmental adaptation.

  14. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    Science.gov (United States)

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-12-18

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes.

  15. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    Science.gov (United States)

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. © 2014 S. Karger AG, Basel.

  16. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    Science.gov (United States)

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  17. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    Science.gov (United States)

    He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  18. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    Directory of Open Access Journals (Sweden)

    Weiguo He

    Full Text Available Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100 × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48 were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC and only class IV from their male parent (TC. Triploid hybrids inherited class II and class III from their female parent (RCC and class IV from their male parent (TC. Tetraploid hybrids gained class II and class III from their female parent (RCC, and generated a new 5S rDNA sequence (designated class I-N. The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  19. Distribution of 5S and 45S rDNA sites in plants with holokinetic chromosomes and the "chromosome field" hypothesis.

    Science.gov (United States)

    Sousa, A; Barros e Silva, A E; Cuadrado, A; Loarce, Y; Alves, M V; Guerra, M

    2011-08-01

    Secondary constrictions or 45S rDNA sites are commonly reported to be located mainly in the terminal regions of the chromosomes. This distribution has been assumed to be related to the existence of a "chromosome field" lying between the centromere and the telomere, an area in which certain cytogenetic events may predominantly occur. If this hypothesis is true this distribution should not be observed in holokinetic chromosomes, as they do not have a localized centromere. In order to evaluate this hypothesis, a comparative study was made of the distributions of 5S and 45S rDNA sites using fluorescence in situ hybridization in representatives of the genera Eleocharis, Diplacrum, Fimbristylis, Kyllinga and Rhynchospora, all of which belong to the family Cyperaceae. The numbers of sites per diploid chromosome complement varied from 2 to ∼10 for 5S rDNA, and from 2 to ∼45 for 45S rDNA. All of the 11 species analyzed had terminally located 45S rDNA sites on the chromosomes whereas the 5S rDNA sites also generally had terminal distributions, except for the Rhynchospora species, where their position was almost always interstitial. These results, together with other previously published data, suggest that the variation in the number and position of the rDNA sites in species with holokinetic chromosomes is non-random and similar to that reported for species with monocentric chromosomes. Therefore, the predominant terminal position of the 45S rDNA sites does not appear to be influenced by the centromere-telomere polarization as suggested by the "chromosome field" hypothesis. Additionally, the hybridization of 5S and 45S rDNA sites provides interesting markers to distinguish several chromosomes on the rather symmetrical karyotypes of Cyperaceae.

  20. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    Science.gov (United States)

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  1. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Proteolytic footprinting of transcription factor TFIIIA reveals different tightly binding sites for 5S RNA and 5S DNA.

    OpenAIRE

    Bogenhagen, D F

    1993-01-01

    Transcription factor IIIA (TFIIIA) employs an array of nine N-terminal zinc fingers to bind specifically to both 5S RNA and 5S DNA. The binding of TFIIIA to 5S RNA and 5S DNA was studied by using a protease footprinting technique. Brief treatment of free or bound TFIIA with trypsin or chymotrypsin generated fragments which were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Fragments retaining the N terminus of TFIIA were identified by immunoblotting with an antibody ...

  3. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays.

    Science.gov (United States)

    Pinhal, Danillo; Yoshimura, Tatiana S; Araki, Carlos S; Martins, Cesar

    2011-05-31

    Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution.

  4. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    Directory of Open Access Journals (Sweden)

    Araki Carlos S

    2011-05-01

    Full Text Available Abstract Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution.

  5. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    Science.gov (United States)

    2011-01-01

    Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815

  6. Identification of goose (Anser anser) and mule duck (Anasplatyrhynchos x Cairina moschata) foie gras by multiplex polymerase chain reaction amplification of the 5S RDNA gene.

    Science.gov (United States)

    Rodríguez, M A; García, T; González, I; Asensio, L; Fernández, A; Lobo, E; Hernández, P E; Martín, R

    2001-06-01

    Polymerase chain reaction (PCR) amplification of the nuclear 5S rDNA gene has been used for the identification of goose and mule duck foie gras. Two species-specific reverse primers were designed and used in a multiplex reaction, together with a forward universal primer, to amplify specific fragments of the 5S rDNA in each species. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose and mule duck foie gras samples. This genetic marker can be useful for detecting fraudulent substitution of the duck liver for the more expensive goose liver.

  7. Evolutionary Dynamics of 5S rDNA and Recurrent Association of Transposable Elements in Electric Fish of the Family Gymnotidae (Gymnotiformes): The Case of Gymnotus mamiraua.

    Science.gov (United States)

    da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana

    2016-01-01

    Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.

  8. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    Science.gov (United States)

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C0t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C0t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  9. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.).

    Science.gov (United States)

    Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš

    2017-05-18

    Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation

  10. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    Science.gov (United States)

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-11-25

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition.

  11. Co-located 18S/5S rDNA arrays: an ancient and unusual chromosomal trait in Julidini species (Labridae, Perciformes)

    Science.gov (United States)

    Amorim, Karlla Danielle Jorge; Cioffi, Marcelo de Bello; Bertollo, Luiz Antonio Carlos; Soares, Rodrigo Xavier; de Souza, Allyson Santos; da Costa, Gideão Wagner Werneck Felix; Molina, Wagner Franco

    2016-01-01

    Abstract Wrasses (Labridae) are extremely diversified marine fishes, whose species exhibit complex interactions with the reef environment. They are widely distributed in the Indian, Pacific and Atlantic oceans. Their species have displayed a number of karyotypic divergent processes, including chromosomal regions with complex structural organization. Current cytogenetic information for this family is phylogenetically and geographically limited and mainly based on conventional cytogenetic techniques. Here, the distribution patterns of heterochromatin, GC-specific chromosome regions and Ag-NORs, and the organization of 18S and 5S rDNA sites of the Atlantic species Thalassoma noronhanum (Boulenger, 1890), Halichoeres poeyi (Steindachner, 1867), Halichoeres radiatus (Linnaeus, 1758), Halichoeres brasiliensis (Bloch, 1791) and Halichoeres penrosei Starks, 1913, belonging to the tribe Julidini were analyzed. All the species exhibited 2n=48 chromosomes with variation in the number of chromosome arms among genera. Thalassoma noronhanum has 2m+46a, while species of the genus Halichoeres Rüppell, 1835 share karyotypes with 48 acrocentric chromosomes. The Halichoeres species exhibit differences in the heterochromatin distribution patterns and in the number and distribution of 18S and 5S rDNA sites. The occurrence of 18S/5S rDNA syntenic arrangements in all the species indicates a functionally stable and adaptive genomic organization. The phylogenetic sharing of this rDNA organization highlights a marked and unusual chromosomal singularity inside the family Labridae. PMID:28123678

  12. Organization and variation analysis of 5S rDNA in gynogenetic offspring of Carassius auratus red var. (♀) × Megalobrama amblycephala (♂).

    Science.gov (United States)

    Qin, QinBo; Wang, Juan; Wang, YuDe; Liu, Yun; Liu, ShaoJun

    2015-03-13

    The offspring with 100 chromosomes (abbreviated as GRCC) have been obtained in the first generation of Carassius auratus red var. (abbreviated as RCC, 2n = 100) (♀) × Megalobrama amblycephala (abbreviated as BSB, 2n = 48) (♂), in which the females and unexpected males both are found. Chromosomal and karyotypic analysis has been reported in GRCC which gynogenesis origin has been suggested, but lack genetic evidence. Fluorescence in situ hybridization with species-specific centromere probes directly proves that GRCC possess two sets of RCC-derived chromosomes. Sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (abbreviated as NTS) reveals that three types of 5S rDNA class (class I; class II and class III) in GRCC are completely inherited from their female parent (RCC), and show obvious base variations and insertions-deletions. Fluorescence in situ hybridization with the entire 5S rDNA probe reveals obvious chromosomal loci (class I and class II) variation in GRCC. This paper provides directly genetic evidence that GRCC is gynogenesis origin. In addition, our result is also reveals that distant hybridization inducing gynogenesis can lead to sequence and partial chromosomal loci of 5S rDNA gene obvious variation.

  13. Population distribution of 45S and 5S rDNA in golden mahseer, Tor putitora: population-specific FISH marker

    Indian Academy of Sciences (India)

    Mamta Singh; Ravindra Kumar; N. S. Nagpure; Basdeo Kushwaha; Indra Mani; U. K. Chauhan; W. S. Lakra

    2009-12-01

    Chromosomal locations of major 45S and minor 5S ribosomal DNAs (rDNAs) and organization of 5S rRNA genes were analysed in five different populations of golden mahseers (Tor putitora) using fluorescence in situ hybridization (FISH) and Southern blot hybridization. All five populations of T. putitora ($2n = 100$) showed a similar type of macro-karyotype composed of 12 metacentric, 22 submetacentric, 14 subtelocentric and 52 telocentric chromosomes. Analysis of active nucleolar organizer regions (NORs) by silver staining did not show any differences in number and chromosomal position in different populations. But FISH data showed significant difference between the populations, four of the five populations showed six 18S (three pairs) and two 5S (one pair) signals with positional polymorphism, while one population showed eight 18S and four 5S signals, respectively. Southern blot data confirms that 5S rDNA clusters present on two different chromosome pairs in Kosi river population contain non-transcribed spacers (NTS) of same length. In the present study, simultaneous localization of 45S and 5S rDNA by in situ hybridization helped us to develop the discrete population-specific markers in different geographically isolated populations of T. putitora.

  14. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

    Science.gov (United States)

    Cruz, V P; Oliveira, C; Foresti, F

    2015-01-01

    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.

  15. Evidence for 5S rDNA horizontal transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families.

    Science.gov (United States)

    Merlo, Manuel A; Cross, Ismael; Palazón, José L; Ubeda-Manzanaro, María; Sarasquete, Carmen; Rebordinos, Laureana

    2012-10-07

    The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes and Clupeiformes orders. Two

  16. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801 based on the analysis of three multigene families

    Directory of Open Access Journals (Sweden)

    Merlo Manuel A

    2012-10-01

    Full Text Available Abstract Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH. Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not

  17. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    Science.gov (United States)

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  18. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA in the Asteraceae family

    Directory of Open Access Journals (Sweden)

    Garcia Sònia

    2010-08-01

    Full Text Available Abstract Background In flowering plants and animals the most common ribosomal RNA genes (rDNA organisation is that in which 35S (encoding 18S-5.8S-26S rRNA and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae, a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing, gene copy number (quantitative PCR and chromosomal position (FISH of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases, tribe Gnaphalieae (100% and in the "Heliantheae alliance" (23%. The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic

  19. Chromosomal localization of 5S rDNA in Chinese shrimp (Fenneropenaeus chinensis):a chromosome-specific marker for chromosome identification

    Institute of Scientific and Technical Information of China (English)

    郇聘; 张晓军; 李富花; 赵翠; 张成松; 相建海

    2010-01-01

    Chinese shrimp(Fenneropenaeus chinensis)is an economically important aquaculture species in China.However,cytogenetic and genomic data is limited in the organism partly because the chromosomes are difficult to isolate and analyze.In this study,fluorescence in-situ hybridization(FISH) was used to identify the chromosomes of F.chinensis.The 5S ribosomal RNA gene(rDNA)of F. chinensis was isolated,cloned and then used as a hybridization probe.The results show that the 5S rDNA was located on one pair of homologo...

  20. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

    Science.gov (United States)

    Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  1. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae: Evolutionary Tendencies in the Genus

    Directory of Open Access Journals (Sweden)

    Vanessa Bueno

    2014-01-01

    Full Text Available Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  2. The 5S rDNA high dynamism in Diplodus sargus is a transposon-mediated mechanism. Comparison with other multigene families and Sparidae species.

    Science.gov (United States)

    Merlo, Manuel A; Cross, Ismael; Manchado, Manuel; Cárdenas, Salvador; Rebordinos, Laureana

    2013-03-01

    There has been considerable discussion in recent years on the evolution of the tandemly repeated multigene families, since some organisms show a concerted model whereas others show a birth-and-death model. This controversial subject extends to several species of fish. In this study, three species of the Sparidae family (Pagrus pagrus, P. auriga and Diplodus sargus) and an interspecific hybrid (P. pagrus (♀) × P. auriga (♂)) have been studied at both molecular and cytogenetic level, taking three different multigene families (5S rDNA, 45S rDNA and U2 snDNA). Results obtained with the 5S rDNA in P. pagrus and P. auriga are characterized by a considerable degree of conservation at the two levels; however, an extraordinary variation was observed in D. sargus at the two levels, which has never been found in other fishes studied to date. As a consequence of this, the evolutionary model of the multigene families is discussed considering the results obtained and others from the bibliography. The result obtained in the hybrid allowed the recombination frequency in each multigene family to be estimated.

  3. 砂梨45 S rDNA和5 S rDNA的染色体定位研究%Physical Mapping of the 45 S rDNA and 5 S rDNA to Pear Metaphase Chromosome

    Institute of Scientific and Technical Information of China (English)

    杨光绪; 刁英

    2007-01-01

    45 S rDNA和5 S rDNA是砂梨中与核糖体RNA合成有关的2个功能片段.通过双色FISH(fluorescence in situ hybridization)确定了45 S rDNA序列和5 S rDNA在砂梨中期染色体上的分布,其中45 S rDNA位于砂梨的第4号,第11号和第15号染色体的短臂末端.5 S rDNA序列位于第12号染色体上着丝粒附近,而在第6和第13号染色体上则分布在长臂上.

  4. The formation of diploid and triploid hybrids of female grass carp × male blunt snout bream and their 5S rDNA analysis.

    Science.gov (United States)

    He, Weiguo; Xie, Lihua; Li, Tangluo; Liu, Shaojun; Xiao, Jun; Hu, Jie; Wang, Jing; Qin, Qinbo; Liu, Yun

    2013-11-23

    Hybridization is a useful strategy to alter the genotypes and phenotypes of the offspring. It could transfer the genome of one species to another through combing the different genome of parents in the hybrid offspring. And the offspring may exhibit advantages in growth rate, disease resistance, survival rate and appearance, which resulting from the combination of the beneficial traits from both parents. Diploid and triploid hybrids of female grass carp (Ctenopharyngodon idellus, GC, Cyprininae, 2n = 48) × male blunt snout bream (Megalobrama amblycephala, BSB, Cultrinae, 2n = 48) were successfully obtained by distant hybridization. Diploid hybrids had 48 chromosomes, with one set from GC and one set from BSB. Triploid hybrids possessed 72 chromosomes, with two sets from GC and one set from BSB.The morphological traits, growth rates, and feeding ecology of the parents and hybrid offspring were compared and analyzed. The two kinds of hybrid offspring exhibited significantly phenotypic divergence from GC and BSB. 2nGB hybrids showed similar growth rate compared to that of GC, and 3nGB hybrids significantly higher results. Furthermore, the feeding ecology of hybrid progeny was omnivorous.The 5S rDNA of GC, BSB and their hybrid offspring were also cloned and sequenced. There was only one type of 5S rDNA (designated type I: 180 bp) in GC and one type of 5S rDNA (designated type II: 188 bp) in BSB. However, in the hybrid progeny, diploid and triploid hybrids both inherited type I and type II from their parents, respectively. In addition, a chimera of type I and type II was observed in the genome of diploid and triploid hybrids, excepting a 10 bp of polyA insertion in type II sequence of the chimera of the diploid hybrids. This is the first report of diploid and triploid hybrids being produced by crossing GC and BSB, which have the same chromosome number. The obtainment of two new hybrid offspring has significance in fish genetic breeding. The results illustrate the effect

  5. Molecular Cytogenetic Analysis of Cucumis Wild Species Distributed in Southern Africa: Physical Mapping of 5S and 45S rDNA with DAPI.

    Science.gov (United States)

    Yagi, Kouhei; Pawełkowicz, Magdalena; Osipowski, Paweł; Siedlecka, Ewa; Przybecki, Zbigniew; Tagashira, Norikazu; Hoshi, Yoshikazu; Malepszy, Stefan; Pląder, Wojciech

    2015-01-01

    Wild Cucumis species have been divided into Australian/Asian and African groups using morphological and phylogenetic characteristics, and new species have been described recently. No molecular cytogenetic information is available for most of these species. The crossability between 5 southern African Cucumis species (C. africanus, C. anguria, C. myriocarpus, C. zeyheri, and C. heptadactylus) has been reported; however, the evolutionary relationship among them is still unclear. Here, a molecular cytogenetic analysis using FISH with 5S and 45 S ribosomal DNA (rDNA) was used to investigate these Cucumis species based on sets of rDNA-bearing chromosomes (rch) types I, II and III. The molecular cytogenetic and phylogenetic results suggested that at least 2 steps of chromosomal rearrangements may have occurred during the evolution of tetraploid C. heptadactylus. In step 1, an additional 45 S rDNA site was observed in the chromosome (type III). In particular, C. myriocarpus had a variety of rch sets. Our results suggest that chromosomal rearrangements may have occurred in the 45 S rDNA sites. We propose that polyploid evolution occurred in step 2. This study provides insights into the chromosomal characteristics of African Cucumis species and contributes to the understanding of chromosomal evolution in this genus.

  6. An uncommon co-localization of rDNA 5S with major rDNA clusters in Callichthyidae (Siluriformes): a report case in Corydoras carlae Nijssen & Isbrücker, 1983

    Science.gov (United States)

    da Rocha, Rafael Henrique; Baumgärtner, Lucas; Paiz, Leonardo Marcel; Margarido, Vladimir Pavan; Fernandes, Carlos Alexandre; Gubiani, Éder André

    2016-01-01

    Abstract Corydoras Lacepède, 1803 is the most specious genus of Corydoradinae subfamily and many of its species are still unknown in relation to molecular cytogenetic markers. However, the diploid number and karyotypic formula were recorded for many species of this group. In current study, we provided the first cytogenetic information of Corydoras carlae Nijssen & Isbrücker, 1983, an endemic fish species from Iguassu River basin, Paraná State, Brazil. The individuals were collected in Florido River, a tributary of Iguassu River and analysed with respect to diploid number, heterochromatin distribution pattern, Ag-NORs and mapping of 5S and 18S ribosomal genes. The karyotype of this species comprises 46 chromosomes arranged in 22m+22sm+2st. The heterochromatin is distributed in centromeric and pericentromeric positions in most of the chromosomes, and also associated with NORs. The Ag-NORs were detected in the terminal position on the long arm of the metacentric pair 6. The double-FISH technique showed that 5S rDNA and 18S rDNA were co-localized in the terminal portion on the long arm of the metacentric pair 6. This condition of co-localization of ribosomal genes in Corydoras carlae seems to represent a marker for this species. PMID:28123681

  7. Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA.

    Science.gov (United States)

    Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W Brad

    2009-05-01

    Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element.

  8. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  9. S6 Kinase is essential for MYC-dependent rDNA transcription in Drosophila.

    Science.gov (United States)

    Mitchell, Naomi C; Tchoubrieva, Elissaveta B; Chahal, Arjun; Woods, Simone; Lee, Amanda; Lin, Jane I; Parsons, Linda; Jastrzebski, Katarzyna; Poortinga, Gretchen; Hannan, Katherine M; Pearson, Richard B; Hannan, Ross D; Quinn, Leonie M

    2015-10-01

    Increased rates of ribosome biogenesis and biomass accumulation are fundamental properties of rapidly growing and dividing malignant cells. The MYC oncoprotein drives growth predominantly via its ability to upregulate the ribosome biogenesis program, in particular stimulating the activity of the RNA Polymerase I (Pol I) machinery to increase ribosomal RNA (rRNA) transcription. Although MYC function is known to be highly dependent on the cellular signalling context, the pathways interacting with MYC to regulate transcription of ribosomal genes (rDNA) in vivo in response to growth factor status, nutrient availability and cellular stress are only beginning to be understood. To determine factors critical to MYC-dependent stimulation of rDNA transcription in vivo, we performed a transient expression screen for known oncogenic signalling pathways in Drosophila. Strikingly, from the broad range of pathways tested, we found that ribosomal protein S6 Kinase (S6K) activity, downstream of the TOR pathway, was the only factor rate-limiting for the rapid induction of rDNA transcription due to transiently increased MYC. Further, we demonstrated that one of the mechanism(s) by which MYC and S6K cooperate is through coordinate activation of the essential Pol I transcription initiation factor TIF-1A (RRN 3). As Pol I targeted therapy is now in phase 1 clinical trials in patients with haematological malignancies, including those driven by MYC, these data suggest that therapies dually targeting Pol I transcription and S6K activity may be effective in treating MYC-driven tumours.

  10. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Directory of Open Access Journals (Sweden)

    Garcia Sònia

    2012-06-01

    Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.

  11. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).

    Science.gov (United States)

    Mahelka, Václav; Kopecky, David; Baum, Bernard R

    2013-09-01

    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass.

  12. Obtaining 5S rDNA molecular markers for native and invasive Cichla populations (Perciformes – Cichlidae, in Brazil - DOI: 10.4025/actascibiolsci.v30i1.1467 Obtaining 5S rDNA molecular markers for native and invasive Cichla populations (Perciformes – Cichlidae, in Brazil - DOI: 10.4025/actascibiolsci.v30i1.1467

    Directory of Open Access Journals (Sweden)

    Sônia Maria Alves Pinto Prioli

    2008-03-01

    Full Text Available O gene DNAr 5S é informativo e possui altas taxas de conservação ao longo do genoma dos eucariotos, possuindo características únicas que são hereditárias. Estudos moleculares do gene DNAr 5S vem sendo realizados com diversos grupos, inclusive em algumas espécies de peixes, com o intuito de solucionar problemas de relações filogenéticas, padrão de ancestralidade e diversidade genética, entre grupos de populações naturais. Espécies do gênero Cichla, introduzidas na bacia do alto rio Paraná, apresentam polimorfismos genéticos, detectados por análise de RAPD e SPAR. Essas espécies estão intercruzando-se e formando híbridos viáveis, com maior variabilidade genética. O objetivo desse trabalho foi padronizar a metodologia de amplificação de regiões não-transcritas da família multigênica rDNA 5S de Cichla e obter marcadores específicos para as espécies parentais que pudessem, também, ser identificados nos híbridos. Foram analisados 65 espécimes de Cichla, das bacias do alto rio Paraná e Amazônica. Apesar de não se obter marcadores moleculares que pudessem ser úteis à identificação de híbridos, foram obtidos marcadores moleculares genéticos DNAr 5S espécie-específicos para Cichla temensis, que podem ser utilizados para identificação de exemplares dessa espécie e, também, marcadores populacionais, que podem ser úteis para estudos de variabilidade genética populacionalThe 5S rDNA gene is informative and has high conservation rates along the eukaryotic genome, having unique hereditary characteristics. Molecular studies with the 5S rDNA gene have been carried out with several groups, including some species of fish, aiming at solving phylogenetic relationship problems, ancestral patterns and genetic diversity among groups in natural populations. Species of the Cichla genus, introduced in the Upper Paraná River basin, present some genetic polymorphisms detected by RAPD and SPAR analyses. These species have

  13. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase.

    Science.gov (United States)

    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M; Ha, Taekjip; Prasanth, Kannanganattu V; Prasanth, Supriya G

    2015-07-01

    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1-interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing.

  15. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. © 2013 Elsevier Inc. All rights reserved.

  16. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Grierson, Patrick M. [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Acharya, Samir, E-mail: samir.acharya@osumc.edu [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Groden, Joanna [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States)

    2013-03-15

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription.

  17. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Science.gov (United States)

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  18. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    Science.gov (United States)

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. © 2015 S. Karger AG, Basel.

  19. Characterization of S1 nuclease sensitive site at transcription initiation region of Attacus ricini rDNA

    Institute of Scientific and Technical Information of China (English)

    何明亮; 赵慕钧; 靳嘉瑞; 李载平

    1997-01-01

    A single-stranded S1 nuclease hypersensitive site which contains a d(AT)18 sequence structure locat-ed in the 5 -non transcription spacer of silkworm A . ricini ribosomal RNA gene has been reported[1] Using starved-refed silkworms, another S1 nuclease sensitive site was found existing in the rDNA chromatin, while under merely starving, this S1 sensitive site disappeared[2] . Recently this inducible S1 sensitive site has been further determined. It consists of a d(GT)10-d(AT)10 special DNA sequence at the transcription initiation region, and shows a behavior of ease in DNA-unwinding, indicating that S1 nuclease sensitive sites may have an important function in the regulation of rDNA transcription and replication.

  20. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  1. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  2. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei.

  3. Hypomethylation and hypermethylation of the tandem repetitive 5S rRNA genes in Arabidopsis.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Jasencakova, Zuzana; Douet, Julien; Schubert, Ingo; Tourmente, Sylvette

    2008-04-01

    5S ribosomal DNA (5S rDNA) is organized in tandem repeats on chromosomes 3, 4 and 5 in Arabidopsis thaliana. One part of the 5S rDNA is located within the heterochromatic chromocenters, and the other fraction forms loops with euchromatic features that emanate from the chromocenters. We investigated whether the A. thaliana heterochromatin, and particularly the 5S rDNA, is modified when changing the culture conditions (cultivation in growth chamber versus greenhouse). Nuclei from challenged tissues displayed larger total, as well as 5S rDNA, heterochromatic fractions, and the DNA methyltransferase mutants met1 and cmt3 had different impacts in Arabidopsis. The enlarged fraction of heterochromatic 5S rDNA was observed, together with the reversal of the silencing of some 5S rRNA genes known as minor genes. We observed hypermethylation at CATG sites, and a concomitant DNA hypomethylation at CG/CXG sites in 5S rDNA. Our results show that the asymmetrical hypermethylation is correlated with the ageing of the plants, whereas hypomethylation results from the growth chamber/culture conditions. In spite of severely reduced DNA methylation, the met1 mutant revealed no increase in minor 5S rRNA transcripts in these conditions. The increasing proportion of cytosines in asymmetrical contexts during transition from the euchromatic to the heterochromatic state in the 5S rDNA array suggests that 5S rDNA units are differently affected by the (hypo and hyper)methylation patterns along the 5S rDNA locus. This might explain the different behaviour of 5S rDNA subpopulations inside a 5S array in terms of chromatin compaction and expression, i.e. some 5S rRNA genes would become derepressed, whereas others would join the heterochromatic fraction.

  4. Molecular cytogenetics studies in Reichardia tingetana: Physical mapping of heterochromatin, telomere repeats, and 5S and 45S rDNA by 4',6-diamidino-2-phenylindole and fluorescence in situ hybridization

    Institute of Scientific and Technical Information of China (English)

    Magdy Hussein ABD EL-TWAB

    2012-01-01

    Molecular cytogenetics studies of A-T-rich regions,telomeres,and 5S and 45S rDNA sites on the chromosomes of Reichardia tingetana Roth (2n =16; diploid) were done using 4',6-diamidino-2-phenylindole (DAPI) and fluorescence in situ hybridization (FISH).The species were collected from three geographically isolated populations at Borg El Arab (salt marsh habitat),and Rashed and Shosha (sandy clay habitats) in Egypt.The three populations showed the chromosome number of all plants are diploid except for two tetraploid samples from Shosha.Plants from both Rashed and Shosha showed similarity in the distribution of six DAPI bands on six chromosomes,whereas those of Borg El Arab showed a distribution of 16 bands on 14 chromosomes.The FISH signals of the telomeres,and 5S and 45S rDNA,were at the telomeres of all chromosomes,two interstitial,and four terminal,respectively.The combination of DAPI and FISH showed colocalization of the DAPI bands with two 5S and two 45S rDNA loci.The increased number of DAPI bands in the cytotypes from the salt marsh habitat could indicate natural genetic adaptation through increasing the heterochromatin of A-T-rich regions.

  5. Abundant 5S rRNA-like transcripts encoded by the mitochondrial genome in amoebozoa.

    Science.gov (United States)

    Bullerwell, Charles E; Burger, Gertraud; Gott, Jonatha M; Kourennaia, Olga; Schnare, Murray N; Gray, Michael W

    2010-05-01

    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified.

  6. mTOR signaling regulates myotube hypertrophy by modulating protein synthesis, rDNA transcription, and chromatin remodeling.

    Science.gov (United States)

    von Walden, Ferdinand; Liu, Chang; Aurigemma, Nicole; Nader, Gustavo A

    2016-10-01

    Ribosome production is an early event during skeletal muscle hypertrophy and precedes muscle protein accretion. Signaling via mTOR is crucial for ribosome production and hypertrophy; however, the mechanisms by which it regulates these processes remain to be identified. Herein, we investigated the activation of mTOR signaling in hypertrophying myotubes and determined that mTOR coordinates various aspects of gene expression important for ribosome production. First, inhibition of translation with cycloheximide had a more potent effect on protein synthesis than rapamycin indicating that mTOR function during hypertrophy is not on general, but rather on specific protein synthesis. Second, blocking Pol II transcription had a similar effect as Rapamycin and, unexpectedly, revealed the necessity of Pol II transcription for Pol I transcription, suggesting that mTOR may regulate ribosome production also by controlling Class II genes at the transcriptional level. Third, Pol I activity is essential for rDNA transcription and, surprisingly, for protein synthesis as selective Pol I inhibition blunted rDNA transcription, protein synthesis, and the hypertrophic response of myotubes. Finally, mTOR has nuclear localization in muscle, which is not sensitive to rapamycin. Inhibition of mTOR signaling by rapamycin disrupted mTOR-rDNA promoter interaction and resulted in altered histone marks indicative of repressed transcription and formation of higher-order chromatin structure. Thus mTOR signaling appears to regulate muscle hypertrophy by affecting protein synthesis, Class I and II gene expression, and chromatin remodeling. Copyright © 2016 the American Physiological Society.

  7. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA

    Science.gov (United States)

    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio Jr., Horácio Ferreira; Dias, Ana Lúcia

    2011-01-01

    Abstract Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group. PMID:24260632

  8. Direct regulation of tRNA and 5S rRNA gene transcription by Polo-like kinase 1.

    Science.gov (United States)

    Fairley, Jennifer A; Mitchell, Louise E; Berg, Tracy; Kenneth, Niall S; von Schubert, Conrad; Silljé, Herman H W; Medema, René H; Nigg, Erich A; White, Robert J

    2012-02-24

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase III (pol III) through direct binding and phosphorylation of transcription factor Brf1. During interphase, Plk1 promotes tRNA and 5S rRNA expression by phosphorylating Brf1 directly on serine 450. However, this stimulatory modification is overridden at mitosis, when elevated Plk1 activity causes Brf1 phosphorylation on threonine 270 (T270), which prevents pol III recruitment. Thus, although Plk1 enhances net tRNA and 5S rRNA production, consistent with its proliferation-stimulating function, it also suppresses untimely transcription when cells divide. Genomic instability is apparent in cells with Brf1 T270 mutated to alanine to resist Plk1-directed inactivation, suggesting that chromosome segregation is vulnerable to inappropriate pol III activity. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Chromosomal mapping of repetitive DNAs in Gobionellus oceanicus and G. stomatus (Gobiidae; Perciformes): A shared XX/XY system and an unusual distribution of 5S rDNA sites on the Y chromosome.

    Science.gov (United States)

    Lima-Filho, Paulo A; Amorim, Karlla D J; Cioffi, Marcelo B; Bertollo, Luiz A C; Molina, Wagner F

    2014-01-01

    With nearly 2,000 species, Gobiidae is the most specious family of the vertebrates. This high level of speciation is accompanied by conspicuous karyotypic modifications, where the role of repetitive sequences remains largely unknown. This study analyzed the karyotype of 2 species of the genus Gobionellus and mapped 18S and 5S ribosomal RNA genes and (CA)15 microsatellite sequences onto their chromosomes. G. oceanicus (2n = 56; ♂ 12 metacentrics (m) + 4 submetacentrics (sm) + 1 subtelocentric (st) + 39 acrocentrics (a); ♀ 12m + 4sm + 2st + 38a) and G. stomatus (2n = 56; ♂ 20m + 14sm + 1st + 21a; ♀ 20m + 14sm + 2st + 20a) possess the highest diploid chromosome number among the Gobiidae and have different karyotypes. Both species share an XX/XY sex chromosome system with a large subtelocentric X and a small acrocentric Y chromosome which is rich in (CA)15 sequences and bears 5S rRNA sites. Although coding and noncoding repetitive DNA sequences may be involved in the genesis or differentiation of the sex chromosomes, the exclusive presence of 5S rDNA sites on the Y, but not on the X chromosome of both species, represents a novelty in fishes. In summary, the karyotypic differences, as well as new data on the sex chromosome systems in these 2 Gobiidae species, confirm the high chromosomal dynamism observed in this family.

  10. Regulation of rDNA transcription in response to growth factors, nutrients and energy.

    Science.gov (United States)

    Kusnadi, Eric P; Hannan, Katherine M; Hicks, Rodney J; Hannan, Ross D; Pearson, Richard B; Kang, Jian

    2015-02-01

    Exquisite control of ribosome biogenesis is fundamental for the maintenance of cellular growth and proliferation. Importantly, synthesis of ribosomal RNA by RNA polymerase I is a key regulatory step in ribosome biogenesis and a major biosynthetic and energy consuming process. Consequently, ribosomal RNA gene transcription is tightly coupled to the availability of growth factors, nutrients and energy. Thus cells have developed an intricate sensing network to monitor the cellular environment and modulate ribosomal DNA transcription accordingly. Critical controllers in these sensing networks, which mediate growth factor activation of ribosomal DNA transcription, include the PI3K/AKT/mTORC1, RAS/RAF/ERK pathways and MYC transcription factor. mTORC1 also responds to amino acids and energy status, making it a key hub linking all three stimuli to the regulation of ribosomal DNA transcription, although this is achieved via overlapping and distinct mechanisms. This review outlines the current knowledge of how cells respond to environmental cues to control ribosomal RNA synthesis. We also highlight the critical points within this network that are providing new therapeutic opportunities for treating cancers through modulation of RNA polymerase I activity and potential novel imaging strategies.

  11. Abundant 5S rRNA-Like Transcripts Encoded by the Mitochondrial Genome in Amoebozoa ▿ †

    Science.gov (United States)

    Bullerwell, Charles E.; Burger, Gertraud; Gott, Jonatha M.; Kourennaia, Olga; Schnare, Murray N.; Gray, Michael W.

    2010-01-01

    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified. PMID:20304999

  12. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    Science.gov (United States)

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  13. Crosstalk in gene expression: coupling and co-regulation of rDNA transcription, pre-ribosome assembly and pre-rRNA processing.

    Science.gov (United States)

    Granneman, Sander; Baserga, Susan J

    2005-06-01

    Ribosomes, the large RNPs that translate mRNA into protein in the cytoplasm of eukaryotic cells, are synthesized in a subcompartment of the nucleus, the nucleolus. There, transcription by Pol I yields a pre-rRNA which is modified, cleaved and assembled with ribosomal proteins to make functional ribosomes. Previously, rRNA transcription and pre-rRNA cleavage in eukaryotes were considered to be separable steps in gene expression. However, recent findings suggest that these two steps in gene expression can be concurrent and are co-regulated. Unexpectedly, optimal rDNA transcription requires the presence of a defined subset of components of the pre-rRNA processing machinery.

  14. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  15. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  16. The sub-nucleolar localization of PHF6 defines its role in rDNA transcription and early processing events

    Science.gov (United States)

    Todd, Matthew A M; Huh, Michael S; Picketts, David J

    2016-01-01

    Ribosomal RNA synthesis occurs in the nucleolus and is a tightly regulated process that is targeted in some developmental diseases and hyperactivated in multiple cancers. Subcellular localization and immunoprecipitation coupled mass spectrometry demonstrated that a proportion of plant homeodomain (PHD) finger protein 6 (PHF6) protein is localized within the nucleolus and interacts with proteins involved in ribosomal processing. PHF6 sequence variants cause Börjeson–Forssman–Lehmann syndrome (BFLS, MIM#301900) and are also associated with a female-specific phenotype overlapping with Coffin–Siris syndrome (MIM#135900), T-cell acute lymphoblastic leukemia (MIM#613065), and acute myeloid leukemia (MIM#601626); however, very little is known about its cellular function, including its nucleolar role. HEK 293T cells were treated with RNase A, DNase I, actinomycin D, or 5,6-dichloro-β-D-ribofuranosylbenzimadole, followed by immunocytochemistry to determine PHF6 sub-nucleolar localization. We observed RNA-dependent localization of PHF6 to the sub-nucleolar fibrillar center (FC) and dense fibrillar component (DFC), at whose interface rRNA transcription occurs. Subsequent ChIP-qPCR analysis revealed strong enrichment of PHF6 across the entire rDNA-coding sequence but not along the intergenic spacer (IGS) region. When rRNA levels were quantified in a PHF6 gain-of-function model, we observed an overall decrease in rRNA transcription, accompanied by a modest increase in repressive promoter-associated RNA (pRNA) and a significant increase in the expression levels of the non-coding IGS36RNA and IGS39RNA transcripts. Collectively, our results demonstrate a role for PHF6 in carefully mediating the overall levels of ribosome biogenesis within a cell. PMID:27165002

  17. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin

    2015-03-01

    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  18. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  19. The Maize Imprinted Gene Floury3 Encodes a PLATZ Protein Required for tRNA and 5S rRNA Transcription Through Interaction with RNA Polymerase III.

    Science.gov (United States)

    Li, Qi; Wang, Jiechen; Ye, Jianwei; Zheng, Xixi; Xiang, Xiaoli; Li, Changsheng; Fu, Miaomiao; Wang, Qiong; Zhang, Zhi-Yong; Wu, Yongrui

    2017-09-05

    Maize (Zea mays) floury3 (fl3) is a classic semi-dominant negative mutant that exhibits severe defects in the endosperm but fl3 plants otherwise appear normal. We cloned the fl3 gene and determined that it encodes a PLATZ (plant AT-rich sequence- and zinc-binding) protein. The mutation in fl3 resulted in an Asn to His replacement in the conserved PLATZ domain, creating a dominant allele. Fl3 is specifically expressed in starchy endosperm cells and regulated by genomic imprinting, which leads to the suppressed expression of fl3 when transmitted through the male, perhaps as a consequence the semi-dominant behavior. Yeast two-hybrid screening and bimolecular luciferase complementation (BiLC) experiments revealed that FL3 interacts with the RNA polymerase III subunit 53 (RPC53) and transcription factor class C 1 (TFC1), two critical factors of the RNA polymerase III (RNAPIII) transcription complex. In the fl3 endosperm, the levels of many tRNAs and 5S rRNA that are transcribed by RNAPIII are significantly reduced, suggesting that the incorrectly folded fl3 protein may impair the function of RNAPIII. The transcriptome is dramatically altered in fl3 mutants, in which the down-regulated genes are primarily enriched in pathways related to translation, ribosome, misfolded protein responses and nutrient reservoir activity. Collectively, these changes may lead to defects in endosperm development and storage reserve filling in fl3 seeds. © 2017 American Society of Plant Biologists. All rights reserved.

  20. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex.......The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...

  1. Chaperoning 5S RNA assembly

    National Research Council Canada - National Science Library

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    ...—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP...

  2. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  3. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H.

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  4. Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs.

    Science.gov (United States)

    Trinh-Rohlik, Q; Maxwell, E S

    1988-07-11

    Previous work has reported the isolation and sequencing of a mouse low molecular weight RNA species designated 4.5S hybridizing RNA or hybRNA because of its ability to intermolecularly hybridize with mouse mRNA and 18S rRNA sequences. Using synthetic DNA oligonucleotide probes we have examined the conservation of this gene sequence and its expression as a lmwRNA transcript across evolution. Southern blot analysis has shown that homologous genes of single or low copy number are found in all eukaryotes examined as well as in E. coli. Northern blot analysis has demonstrated 4.5S hybRNA transcription in all mouse tissues as well as expression in yeast and Xenopus laevis as lmwRNAs of approximately 130 and 100 nucleotides, respectively, as compared with mouse/rat/hamster species of approximately 87 nucleotides. Yeast and X. laevis 4.5S hybRNA homologs, isolated by hybrid-selection, were shown by Northern blot analysis to intermolecularly hybridize with homologous as well as heterologous 18S rRNA sequences. The conservation of 4.5S hybRNA homologous genes and their expression as lmwRNA transcripts with common intermolecular RNA:RNA hybridization capabilities in fungi, amphibians, and mammals argues for a common, conserved and required biological function for this lmwRNA in all eukaryotes and potential utilization of its intermolecular RNA:RNA hybridization capabilities to carry out this function.

  5. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    Science.gov (United States)

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Dicistronic tRNA-5S rRNA genes in Yarrowia lipolytica: an alternative TFIIIA-independent way for expression of 5S rRNA genes.

    Science.gov (United States)

    Acker, Joël; Ozanne, Christophe; Kachouri-Lafond, Rym; Gaillardin, Claude; Neuvéglise, Cécile; Marck, Christian

    2008-10-01

    In eukaryotes, genes transcribed by RNA polymerase III (Pol III) carry their own internal promoters and as such, are transcribed as individual units. Indeed, a very few cases of dicistronic Pol III genes are yet known. In contrast to other hemiascomycetes, 5S rRNA genes of Yarrowia lipolytica are not embedded into the tandemly repeated rDNA units, but appear scattered throughout the genome. We report here an unprecedented genomic organization: 48 over the 108 copies of the 5S rRNA genes are located 3' of tRNA genes. We show that these peculiar tRNA-5S rRNA dicistronic genes are expressed in vitro and in vivo as Pol III transcriptional fusions without the need of the 5S rRNA gene-specific factor TFIIIA, the deletion of which displays a viable phenotype. We also report the existence of a novel putative non-coding Pol III RNA of unknown function about 70 nucleotide-long (RUF70), the 13 genes of which are devoid of internal Pol III promoters and located 3' of the 13 copies of the tDNA-Trp (CCA). All genes embedded in the various dicistronic genes, fused 5S rRNA genes, RUF70 genes and their leader tRNA genes appear to be efficiently transcribed and their products correctly processed in vivo.

  8. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  9. Systematic analysis and evolution of 5S ribosomal DNA in metazoans

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-01-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12 766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades. PMID:23838690

  10. Linkage of 35S and 5S rRNA genes in Artemisia (family Asteraceae): first evidence from angiosperms.

    Science.gov (United States)

    Garcia, Sònia; Lim, K Yoong; Chester, Michael; Garnatje, Teresa; Pellicer, Jaume; Vallès, Joan; Leitch, Andrew R; Kovarík, Ales

    2009-02-01

    Typically in plants, the 5S and 35S ribosomal DNA (rDNA) encoding two major ribosomal RNA species occur at separate loci. However, in some algae, bryophytes and ferns, they are at the same locus (linked arranged). Southern blot hybridisation, polymerase chain reactions (PCR), fluorescent in situ hybridisation, cloning and sequencing were used to reveal 5S and 35S rDNA genomic organisation in Artemisia. We observed thousands of rDNA units at two-three loci containing 5S rDNA in an inverted orientation within the inter-genic spacer (IGS) of 35S rDNA. The sequenced clones of 26-18S IGS from Artemisia absinthium appeared to contain a conserved 5S gene insertion proximal to the 26S gene terminus (5S rDNA-1) and a second less conserved 5S insertion (5S rDNA-2) further downstream. Whilst the 5S rDNA-1 showed all the structural features of a functional gene, the 5S-rDNA-2 had a deletion in the internal promoter and probably represents a pseudogene. The linked arrangement probably evolved before the divergence of Artemisia from the rest of Asteraceae (>10 Myrs). This arrangement may have involved retrotransposons and once formed spread via mechanisms of concerted evolution. Heterogeneity in unit structure may reflect ongoing homogenisation of variant unit types without fixation for any particular variant.

  11. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    Science.gov (United States)

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  12. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    Science.gov (United States)

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes.

  13. rDNA Loci Evolution in the Genus Glechoma (Lamiaceae)

    Science.gov (United States)

    Jang, Tae-Soo; McCann, Jamie; Parker, John S.; Takayama, Koji; Hong, Suk-Pyo; Schneeweiss, Gerald M.

    2016-01-01

    Glechoma L. (Lamiaceae) is distributed in eastern Asia and Europe. Understanding chromosome evolution in Glechoma has been strongly hampered by its small chromosomes, constant karyotype and polyploidy. Here phylogenetic patterns and chromosomal variation in Glechoma species are considered, using genome sizes, chromosome mapping of 5S and 35S rDNAs by fluorescence in situ hybridisation (FISH), and phylogenetic analyses of internal transcribed spacers (nrITS) of 35S rDNA and 5S rDNA NTS sequences. Species and populations of Glechoma are tetraploid (2n = 36) with base chromosome number of x = 9. Four chromosomes carry pericentric 5S rDNA sites in their short arms in all the species. Two to four of these chromosomes also carry 35S rDNA in subterminal regions of the same arms. Two to four other chromosomes have 35S rDNA sites, all located subterminally within short arms; one individual possessed additional weak pericentric 35S rDNA signals on three other chromosomes. Five types of rDNA locus distribution have been defined on the basis of 35S rDNA variation, but none is species-specific, and most species have more than one type. Glechoma hederacea has four types. Genome size in Glechoma ranges from 0.80 to 0.94 pg (1C), with low levels of intrapopulational variation in all species. Phylogenetic analyses of ITS and NTS sequences distinguish three main clades coinciding with geographical distribution: European (G. hederacea–G. hirsuta), Chinese and Korean (G. longituba), and Japanese (G. grandis). The paper presents the first comparative cytogenetic analyses of Glechoma species including karyotype structure, rDNA location and number, and genome size interpreted in a phylogenetic context. The observed variation suggests that the genus is still in genomic flux. Genome size, but not rDNA loci number and distribution, provides a character for species delimitation which allows better inferences of interspecific relationships to be made, in the absence of well

  14. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Science.gov (United States)

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  15. Novel variants of the 5S rRNA genes in Eruca sativa.

    Science.gov (United States)

    Singh, K; Bhatia, S; Lakshmikumaran, M

    1994-02-01

    The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    Science.gov (United States)

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  17. Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper.

    Science.gov (United States)

    Kwon, Jin-Kyung; Kim, Byung-Dong

    2009-02-28

    The loci of the 5S and 45S rRNA genes were localized on chromosomes in five species of Capsicum, namely, annuum, chacoense, frutescens, baccatum, and chinense by FISH. The 5S rDNA was localized to the distal region of one chromosome in all species observed. The number of 45S rDNA loci varied among species; one in annuum, two in chacoense, frutescens, and chinense, and four in baccatum, with the exceptions that 'CM334' of annuum had three loci and 'tabasco' of frutescens had one locus. 'CM334'-derived BAC clones, 384B09 and 365P05, were screened with 5S rDNA as a probe, and BACs 278M03 and 262A23 were screened with 25S rDNA as a probe. Both ends of these BAC clones were sequenced. FISH with these BAC probes on pachytenes from 'CM334' plant showed one 5S rDNA locus and three 45S rDNA loci, consistent with the patterns on the somatic chromosomes. The 5S rDNA probe was also applied on extended DNA fibers to reveal that its coverage measured as long as 0.439 Mb in the pepper genome. FISH techniques applied on somatic and meiotic chromosomes and fibers have been established for chili to provide valuable information about the copy number variation of 45S rDNA and the actual physical size of the 5S rDNA in chili.

  18. 5S ribosomal RNA genes in six species of Mediterranean grey mullets: genomic organization and phylogenetic inference.

    Science.gov (United States)

    Gornung, Ekaterina; Colangelo, Paolo; Annesi, Flavia

    2007-09-01

    This paper describes a study of the 5S ribosomal RNA genes (5S rDNA) in a group of 6 species belonging to 4 genera of Mugilidae. In these 6 species, the relatively short 5S rDNA repeat units, generated by PCR and ranging in size from 219 to 257 bp, show a high level of intragenomic homogeneity of both coding and spacer regions (NTS-I). Phylogenetic reconstructions based on this data set highlight the greater phylogenetic and genetic diversity of Mugil cephalus and Oedalechilus labeo compared with the genera Liza and Chelon. Comparative sequence analysis revealed significant conservation of the short 5S rDNA repeat units across Chelon and Liza. Moreover, a second size class of 5S rDNA repeat units, ranging from roughly 800 to 1100 bp, was produced in the Liza and Chelon samples. Only short 5S rDNA repeat units were found in M. cephalus and O. labeo. The sequences of the long 5S rDNA repeat units, obtained in Chelon labrosus and Liza ramada, differ owing to the presence of 2 large insertion/deletions (indels) in the spacers (NTS-II) and show considerable sequence identity with NTS-I spacers. Interspecific sequence variation of NTS-II spacers, excluding the indels, is low. Southern-blot hybridization patterns suggest an intermixed arrangement of short and long repeat units within a single chromosome locus.

  19. Randomly detected genetically modified (GM maize (Zea mays L. near a transport route revealed a fragile 45S rDNA phenotype.

    Directory of Open Access Journals (Sweden)

    Nomar Espinosa Waminal

    Full Text Available Monitoring of genetically modified (GM crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a "beads-on-a-string" fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed.

  20. 5S IN QUALITY MANAGEMENT

    Directory of Open Access Journals (Sweden)

    BOCA GRATIELA DANA

    2015-07-01

    Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.

  1. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells.

    Science.gov (United States)

    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena

    2012-06-01

    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment.

  2. Mapping of the 18S and 5S ribosomal RNA genes in Astyanax altiparanae Garutti & Britski, 2000 (Teleostei, Characidae from the upper Paraná river basin, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Alexandre Fernandes

    2006-01-01

    Full Text Available Fluorescence in situ hybridization (FISH was undertaken in order to determinate the chromosomal distribution pattern of 18S and 5S ribosomal DNAs (rDNA in four populations of the characid fish Astyanax altiparanae from the upper Paraná river basin, Brazil. The 18S rDNA probe FISH revealed numerical and positional variations among specimens from the Keçaba stream compared to specimens of the other populations studied. In contrast to the variable 18S rDNA distribution pattern, highly stable chromosomal positioning of the 5S rDNA sites was observed in the four A. altiparanae populations. Divergence in the distribution pattern of 18S and 5S rDNA sites is also discussed.

  3. Plant 45S rDNA clusters are fragile sites and their instability is associated with epigenetic alterations.

    Directory of Open Access Journals (Sweden)

    Min Huang

    Full Text Available Our previous study demonstrated that 45S ribosomal DNA (45S rDNA clusters were chromosome fragile sites expressed spontaneously in Lolium. In this study, fragile phenotypes of 45S rDNA were observed under aphidicolin (APH incubation in several plant species. Further actinomycin D (ActD treatment showed that transcriptional stress might interfere with chromatin packaging, resulting in 45S rDNA fragile expression. These data identified 45S rDNA sites as replication-dependent as well as transcription-dependent fragile sites in plants. In the presence of ActD, a dramatic switch to an open chromatin conformation and accumulated incomplete 5' end of the external transcribed spacer (5'ETS transcripts were observed, accompanied by decreased DNA methylation, decreased levels of histone H3, and increased histone acetylation and levels of H3K4me2, suggesting that these epigenetic alterations are associated with failure of 45S rDNA condensation. Furthermore, the finding that γ-H2AX was accumulated at 45S rDNA sites following ActD treatment suggested that the DNA damage signaling pathway was associated with the appearance of 45S rDNA fragile phenotypes. Our data provide a link between 45S rDNA transcription and chromatin-packaging defects and open the door for further identifying the molecular mechanism involved.

  4. Plant 45S rDNA clusters are fragile sites and their instability is associated with epigenetic alterations.

    Science.gov (United States)

    Huang, Min; Li, Hui; Zhang, Lu; Gao, Fei; Wang, Pu; Hu, Yong; Yan, Shihan; Zhao, Lin; Zhang, Qi; Tan, Junjun; Liu, Xincheng; He, Shibin; Li, Lijia

    2012-01-01

    Our previous study demonstrated that 45S ribosomal DNA (45S rDNA) clusters were chromosome fragile sites expressed spontaneously in Lolium. In this study, fragile phenotypes of 45S rDNA were observed under aphidicolin (APH) incubation in several plant species. Further actinomycin D (ActD) treatment showed that transcriptional stress might interfere with chromatin packaging, resulting in 45S rDNA fragile expression. These data identified 45S rDNA sites as replication-dependent as well as transcription-dependent fragile sites in plants. In the presence of ActD, a dramatic switch to an open chromatin conformation and accumulated incomplete 5' end of the external transcribed spacer (5'ETS) transcripts were observed, accompanied by decreased DNA methylation, decreased levels of histone H3, and increased histone acetylation and levels of H3K4me2, suggesting that these epigenetic alterations are associated with failure of 45S rDNA condensation. Furthermore, the finding that γ-H2AX was accumulated at 45S rDNA sites following ActD treatment suggested that the DNA damage signaling pathway was associated with the appearance of 45S rDNA fragile phenotypes. Our data provide a link between 45S rDNA transcription and chromatin-packaging defects and open the door for further identifying the molecular mechanism involved.

  5. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    Science.gov (United States)

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  6. Multicolor FISH analysis of rDNA and telomere on spinach

    Institute of Scientific and Technical Information of China (English)

    Tianying LAN; Bo LIU; Fengping DONG; Ruiyang CHEN; Xiulan LI; Chengbin CHEN

    2008-01-01

    In this study,multicolor fluorescence in situ hybridization (FISH) analysis on metaphase chromosomes of spinach with biotin-labeled 25S rDNA,DIG-labeled telomere sequences and biotin-labeled and DIG-labeled 5S rDNA was performed.There were six 25S rDNA loci located on the satellites of the third,the fifth and the sixth chromosomes,and four 5S rDNA loci located on the long arms of the third and the fifth chromosomes.The telomere loci were located on the end of the sixth chromosome and also on both the end and centromeric regions of other chromosomes.This study is an important complement to both traditional karyotype analysis and FISH karyotype analysis in spinach.

  7. Localization of 18S + 28S and 5S ribosomal RNA genes in the dog by fluorescence in situ hybridization.

    Science.gov (United States)

    Mäkinen, A; Zijlstra, C; de Haan, N A; Mellink, C H; Bosma, A A

    1997-01-01

    The gene clusters encoding 18S + 28S and 5S rRNA in the dog (Canis familiaris) have been localized by using GTG-banding and fluorescence in situ hybridization. The 18S + 28S rDNA maps to chromosome regions 7q2.5-->q2.7, 17q1.7, qter of a medium-sized, not yet numbered autosome, and Yq1.2-->q1.3. Our data show that there is one cluster of 5S rDNA in the dog, which maps to chromosome region 4q1.4.

  8. Karyotyping of Brassica oleracea L.based on rDNA and Cot-1 DNA fluorescence in situ hybridization

    Institute of Scientific and Technical Information of China (English)

    WANG Taixia; WU Chunhong; HUANG Jinyong; WEI Wenhui

    2007-01-01

    To explore an effective and reliable karyotyping method in Brassica crop plants,Cot-1 DNA was isolated from Brassica oleracea genome,labeled as probe with Biotin-Nick Translation Mix kit,in situ hybridized to mitotic spreads,and where specific fluorescent bands showed on each chromosome pair.25S and 5S rDNA were labeled as probes with DIG-Nick Translation Mix kit and Biotin-Nick Translation Mix kit,respectively,in situ hybridized to mitotic preparations,where 25S rDNA could be detected on two chromosome pairs and 5S rDNA on only one.Cot-1 DNA contains rDNA and chromosome sites identity between Cot-1 DNA and 25S rDNA was determined by dual-colour fluorescence in situ hybridization.All these showed that the karyotyping technique based on a combination of rDNA and Cot-1 DNA chromosome landmarks is superior to all but one.A more exact karyotype ofB.oleracea has been analyzed based on a combination of rDNA sites,Cot-1 DNA fluorescent bands,chromosome lengths and arm ratios.

  9. Cytogenetic relationships among Citrullus species in comparison with some genera of the tribe Benincaseae (Cucurbitaceae) as inferred from rDNA distribution patterns.

    Science.gov (United States)

    Li, Kun-Peng; Wu, Yun-Xiang; Zhao, Hong; Wang, Yan; Lü, Xing-Ming; Wang, Ji-Ming; Xu, Yong; Li, Zong-Yun; Han, Yong-Hua

    2016-04-18

    Comparative mapping of 5S and 45S rDNA by fluorescent in situ hybridization (FISH) technique is an excellent tool to determine cytogenetic relationships among closely related species. In this study, the number and position of 5S and 45S rDNA loci in all Citrullus species and subspecies were determined. The cultivated watermelon (C. lanatus subsp. vulgaris), C. lanatus subsp. mucosospermus, C. colocynthis and C. naudinianus (or Acanthosicyos naudinianus) had two 45S rDNA loci and one 5S rDNA locus which was located syntenic to one of the 45S rDNA loci. C. ecirrhosus and C. lanatus subsp. lanatus had one 45S rDNA locus and two 5S rDNA loci, each located on a different chromosome. C. rehmii had one 5S and one 45S rDNA locus positioned on different chromosomes. The distribution of 5S and 45S rDNA in several species belonging to other genera in Benincaseae tribe was also investigated. The distribution pattern of rDNAs showed a great difference among these species. The present study confirmed evolutionary closeness among cultivated watermelon (C. lanatus subsp. vulgaris), C. lanatus subsp. mucosospermus and C. colocynthis. Our result also supported that C. lanatus subsp. lanatus was not a wild form of the cultivated watermelon instead was a separate crop species. In addition, present cytogenetic analysis suggested that A. naudinianus was more closely related to Cucumis than to Citrullus or Acanthosicyos, but with a unique position and may be a link bridge between the Citrullus and the Cucumis.

  10. Clinorotation influences rDNA and NopA100 localization in nucleoli

    Science.gov (United States)

    Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

    The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

  11. A minor class of 5S rRNA genes in Saccharomyces cerevisiae X2180-1B, one member of which lies adjacent to a Ty transposable element.

    OpenAIRE

    Piper, P W; Lockheart, A; Patel, N.

    1984-01-01

    In Saccharomyces cerevisiae the majority of the genes for 5S rRNA lie within a 9kb rDNA sequence that is present as 100-200 tandemly-repeated copies on Chromosome XII. Following our observations that about 10% of yeast 5S rRNA exists as minor variant sequences, we screened a collection of yeast DNA fragments cloned in lambda gt for 5S rRNA genes whose flanking sequences differed from those adjacent to 5S rRNA genes of the rDNA repeat. Three variant 5S rRNA genes were isolated on the basis of ...

  12. Variations in 5S rDNAs in diploid and tetraploid offspring of red crucian carp × common carp.

    Science.gov (United States)

    Ye, Lihai; Zhang, Chun; Tang, Xiaojun; Chen, Yiyi; Liu, Shaojun

    2017-08-08

    The allotetraploid hybrid fish (4nAT) that was created in a previous study through an intergeneric cross between red crucian carp (Carassius auratus red var., ♀) and common carp (Cyprinus carpio L., ♂) provided an excellent platform to investigate the effect of hybridization and polyploidization on the evolution of 5S rDNA. The 5S rDNAs of paternal common carp were made up of a coding sequence (CDS) and a non-transcribed spacer (NTS) unit, and while the 5S rDNAs of maternal red crucian carp contained a CDS and a NTS unit, they also contained a variable number of interposed regions (IPRs). The CDSs of the 5S rDNAs in both parental fishes were conserved, while their NTS units seemed to have been subjected to rapid evolution. The diploid hybrid 2nF1 inherited all the types of 5S rDNAs in both progenitors and there were no signs of homeologous recombination in the 5S rDNAs of 2nF1 by sequencing of PCR products. We obtained two segments of 5S rDNA with a total length of 16,457 bp from allotetraploid offspring 4nAT through bacterial artificial chromosome (BAC) sequencing. Using this sequence together with the 5S rDNA sequences amplified from the genomic DNA of 4nAT, we deduced that the 5S rDNAs of 4nAT might be inherited from the maternal progenitor red crucian carp. Additionally, the IPRs in the 5S rDNAs of 4nAT contained A-repeats and TA-repeats, which was not the case for the IPRs in the 5S rDNAs of 2nF1. We also detected two signals of a 200-bp fragment of 5S rDNA in the chromosomes of parental progenitors and hybrid progenies by fluorescence in situ hybridization (FISH). We deduced that during the evolution of 5S rDNAs in different ploidy hybrid fishes, interlocus gene conversion events and tandem repeat insertion events might occurred in the process of polyploidization. This study provided new insights into the relationship among the evolution of 5S rDNAs, hybridization and polyploidization, which were significant in clarifying the genome evolution of

  13. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    Energy Technology Data Exchange (ETDEWEB)

    Liu, X (Washington State University); Mann, David B.(ASSOC WESTERN UNIVERSITY); Suquet, C (Washington State University); Springer, David L.(BATTELLE (PACIFIC NW LAB)); Smerdon, Michael J.(VISITORS)

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  14. Functional intron+ and intron- rDNA in the same macronucleus of the ciliate Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Engberg, J

    1985-01-01

    alleles was followed in the total culture and in single cells during their vegetative segregation and it was observed that replication was non-preferential with respect to the two alleles. The diallelic clones were also used to demonstrate that intron-containing rDNA was transcribed and the transcript......Diallelic clones of Tetrahymena pigmentosa containing equal amounts of intron+ and intron- rDNA in the macronucleus were constructed. The macronucleus of the resulting strains divides amitotically during vegetative growth and the diallelic genotype is therefore unstable. The coexistence of the two...

  15. Molecular cytogenetic analysis of the Appenine endemic cyprinid fish Squalius lucumonis and three other Italian leuciscines using chromosome banding and FISH with rDNA probes.

    Science.gov (United States)

    Rossi, Anna Rita; Milana, Valentina; Hett, Anne Kathrin; Tancioni, Lorenzo

    2012-12-01

    Karyotype and other chromosomal characteristics of the Appenine endemic cyprinid fish, Toscana stream chub Squalius lucumonis, were analysed using conventional banding and FISH with 45S and 5S rDNA probes. The diploid chromosome number (2n = 50) and karyotype characteristics including pericentromeric heterochromatic blocks and GC-rich CMA(3)-positive sites corresponding to both positive Ag-NORs and 45S rDNA loci on the short arms of a single medium-sized submetacentric chromosome pair were consistent with those found in most European leuciscine cyprinids. On other hand, 5S rDNA FISH in the Toscana stream chub and three other Italian leuciscines, S. squalus, Rutilus rubilio and Telestes muticellus, revealed a species-specific hybridization pattern, i.e. signals on four (S. lucumonis), three (S. squalus and R. rubilio) and two (T. muticellus) chromosome pairs. Whereas all the species shared the 5S rDNA loci on the largest subtelocentric chromosome pair, a "leuciscine" cytotaxonomic marker, S. lucumonis showed both classes of rDNA loci tandem aligned on the short arms of chromosome pair No. 12. The present findings suggest that the observed high variability of 5S rDNA loci provides a powerful tool for investigation of karyotype differentiation in karyologically conservative leuciscine fishes.

  16. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  17. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).

    Science.gov (United States)

    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S

    2013-06-01

    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  18. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    Science.gov (United States)

    Long, Hong; Chen, Chunli; Wang, Bing; Feng, Yanni

    2015-01-01

    The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs) in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins.

  19. Sequence Analysis of the 5S rRNA Gene Repeat Units in 5 Durum Wheat Species from Xinjiang of China%新疆硬粒小麦5个品种5S rRNA基因重复单元间序列分析

    Institute of Scientific and Technical Information of China (English)

    米日古丽·马木提; 布热比艳木·吾布力卡斯木; 吾买尔江·库尔班; 帕夏伊木·艾麦提; 赵奇

    2015-01-01

    本研究参照GenBank禾本科以及前期新疆7个小麦种5S rDNA NTS序列,通过PCR技术扩增获得新疆5个硬粒小麦品种5S rDNA NTS序列,并通过与5S rRNA序列比对,得到5S rDNA NTS序列结构和边界范围。结果显示:5个硬粒小麦品种均存在两种类型5S rDNA NTS序列且相似程度不同,长NTS序列保守性较高,短NTS片段相对较低;短NTS序列存在两处序列缺失现象,两种类型NTS序列存在不同位置和程度的变异位点和变异频率。利用MEG4.0软件,采用邻接法构建了分子进化树并计算获得了品种间遗传距离。对来自不同品种克隆单元基的序列进行比对,得知对于几个组直向是存在的。直系群体的5S rDNA序列有益于硬粒小麦进一步的系统发育分析。%According to GenBank in barley grasses 5S rDNA sequences and previously published 5S rDNA NTS sequences of seven Xinjiang wheat species, 5S rDNA sequences of five durum wheat varieties from Xinjiang were obtained by Polymerase Chain Reaction, the 5S rDNA structure and NTS boundaries were obtained by further alignments with barley grasses 5S rRNA sequence. Sequence analysis revealed that two types of 5S rDNA NTS sequences were presented in five wheat varieties and the nontranscribed spacer of long repeat classes was less variable than that of short repeat classes. Deletion was presented in two parts of 5S rDNA nontranscribed spacer (NTS) length of short repeat class. The different degrees of variable sites and mutation frequency exists in two types of 5S rDNA NTS sequences. Molecular phylogenetic tree was constructed and genetic distance between varieties was calculated by using the MEGA4.0 software and the neighbor-joining method. Sequence comparisons of individual clones (units) isolated from different species have allowed us to confirm that orthology exists for several groups. This demonstration of orthologous groups suggests that the 5S rDNA sequence may be useful for

  20. 5S-menetelmän implementointi

    OpenAIRE

    Kaikula, Kari-Marko

    2017-01-01

    Tässä opinnäytetyössä tavoiteltiin siisteyden ja järjestyksen tuomista 5S-menetelmän avulla Helen Oy:n kunnossapidon varaosavarastoon Salmisaaren voimalaitoksella. Helen Oy on Helsingin kaupungin omistama energia-alan yritys. Kehittämistehtävänä työssä oli 5S-menetelmän implementointi. Tutkimuksen tarkoituksena oli tutkia niitä seikkoja, jotka vaikuttavat 5S-menetelmän käyttöönottoon. 5S on menetelmä, jolla tuodaan siisteyttä ja järjestystä työympäristöön. Tutkimusmenetelmänä oli toiminta...

  1. Linker histone variant H1T targets rDNA repeats.

    Science.gov (United States)

    Tani, Ruiko; Hayakawa, Koji; Tanaka, Satoshi; Shiota, Kunio

    2016-04-02

    H1T is a linker histone H1 variant that is highly expressed at the primary spermatocyte stage through to the early spermatid stage of spermatogenesis. While the functions of the somatic types of H1 have been extensively investigated, the intracellular role of H1T is unclear. H1 variants specifically expressed in germ cells show low amino acid sequence homology to somatic H1s, which suggests that the functions or target loci of germ cell-specific H1T differ from those of somatic H1s. Here, we describe the target loci and function of H1T. H1T was expressed not only in the testis but also in tumor cell lines, mouse embryonic stem cells (mESCs), and some normal somatic cells. To elucidate the intracellular localization and target loci of H1T, fluorescent immunostaining and ChIP-seq were performed in tumor cells and mESCs. We found that H1T accumulated in nucleoli and predominantly targeted rDNA repeats, which differ from somatic H1 targets. Furthermore, by nuclease sensitivity assay and RT-qPCR, we showed that H1T repressed rDNA transcription by condensing chromatin structure. Imaging analysis indicated that H1T expression affected nucleolar formation. We concluded that H1T plays a role in rDNA transcription, by distinctively targeting rDNA repeats.

  2. Fragmentary 5S rRNA gene in the human mitochondrial genome

    Energy Technology Data Exchange (ETDEWEB)

    Nierlich, D.P.

    1982-02-01

    The human mitochondrial genoma contains a 23-nucleodtide sequence that is homologous to a part of the 5S rRNA's of bacteria. This homology, the structure of the likely transcript, and the location of the sequence relative to the mitochondrial rRNA genes suggest that the sequence represents a fragmentary 5S rRNA gene.

  3. 5S tuotannonkehityksen työkaluna

    OpenAIRE

    Hautala, Teemu

    2015-01-01

    Tässä opinnäytetyössä on tutkittu lean-filosofiaan kuuluvan 5S-ohjelman käyttöönottoa mäntätoimisia painevaraajia valmistavassa yrityksessä. Konkreettisia työkaluja kehittämisen tukena käyttävä lean-filosofia on kerännyt menestystä yrityksissä ympäri maailmaa. 5S-ohjelman tarkoitus kehittää työpaikkaa viiden vaiheen avulla visuaalisemmaksi, tehokkaammaksi, turvallisemmaksi ja viihtyisämmäksi. Nimi 5S tulee japanin kielen sanoista seiri (erottele), seiton (järjestele), seiso (puhdista), seiket...

  4. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Directory of Open Access Journals (Sweden)

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  5. [Characterization of 5S rRNA gene sequence and secondary structure in gymnosperms].

    Science.gov (United States)

    Liu, Zhan-Lin; Zhang, Da-Ming; Wang, Xiao-Ru

    2003-01-01

    In higher plants the primary and the secondary structures of 5S ribosomal RNA gene are considered highly conservative. Little is known about the 5S rRNA gene structure, organization and variation in gyimnosperms. In this study we analyzed sequence and structure variation of 5S rRNA gene in Pinus through cloning and sequencing multiple copies of 5S rDNA repeats from individual trees of five pines, P. bungeana, P. tabulaeformis, P. yunnanensis, P. massoniana and P. densata. Pinus bungeana is from the subgenus Strobus while the other four are from the subgenus Pinus (diploxylon pines). Our results revealed variations in both primary and secondary structure among copies of 5S rDNA within individual genomes and between species. 5S rRNA gene in Pinus is 120 bp long in most of the 122 clones we sequenced except for one or two deletions in three clones. Among these clones 50 unique sequences were identified and they were shared by different pine species. Our sequences were compared to 13 sequences each representing a different gymnosperm species, and to six sequences representing both angiosperm monocots and dicots. Average sequence similarity was 97.1% among Pinus species and 94.3% between Pinus and other gymnosperms. Between gymnosperms and angiosperms the sequence similarity decreased to 88.1%. Similar to other molecular data, significant sequence divergence was found between the two Pinus subgenera. The 5S gene tree (neighbor-joining tree) grouped the four diploxylon pines together and separated them distinctly from P. bungeana. Comparison of sequence divergence within individuals and between species suggested that concerted evolution has been very weak especially after the divergence of the four diploxylon pines. The phylogenetic information contained in the 5S rRNA gene is limited due to its shorter length and the difficulties in identifying orthologous and paralogous copies of rDNA multigene family further complicate its phylogenetic application. Pinus densata is a

  6. Diversity and evolution of 5S rRNA gene family organization in Pythium.

    Science.gov (United States)

    Bedard, James E J; Schurko, Andrew M; de Cock, Arthur W A M; Klassen, Glen R

    2006-01-01

    The 5S rRNA gene family organization among 87 species and varieties of Pythium was investigated to assess evolutionary stability of the two patterns detected and to determine which pattern is likely the ancestral state in the genus. Species with filamentous sporangia (Groups A-C according to the ITS phylogenetic tree for Pythium) had 5S genes linked to the rDNA repeat that were predominantly coded for on the DNA strand opposite to the one with the other rRNA genes ('inverted' orientation). A small group of species with contiguous sporangia (Group D) is related to Groups A-C but had unlinked 5S genes. The main group of species with spherical zoosporangia (Groups E-J) generally had unlinked 5S genes in tandem arrays. The six species in Group K, although they also have spherical sporangia, had linked genes on the same strand as the other rRNA genes 'non-inverted' and most of them had pairs of tandem 5S genes. The evolutionary stability of 5S sequence organization was compared with the stability of morphological characters as interpreted from a phylogeny based on ITS sequence analysis. Features of 5S sequence organization were found to be just as consistent within groups as were the morphological characters. To determine the ancestral type of 5S family organization, a survey of Phytophthora strains was conducted to supply an outgroup reference. The most parsimonious interpretation of the data in this survey yielded the tentative conclusion that the linked condition of the 5S sequences was ancestral.

  7. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C.; Dennis, P. P.

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  8. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  9. Relationships between rDNA, Nop1 and Sir complex in biotechnologically relevant distillery yeasts.

    Science.gov (United States)

    Adamczyk, Jagoda; Deregowska, Anna; Potocki, Leszek; Kuna, Ewelina; Kaplan, Jakub; Pabian, Sylwia; Kwiatkowska, Aleksandra; Lewinska, Anna; Wnuk, Maciej

    2016-09-01

    Distillery yeasts are poorly characterized physiological group among the Saccharomyces sensu stricto complex. As industrial yeasts are under constant environmental stress during fermentation processes and the nucleolus is a stress sensor, in the present study, nucleolus-related parameters were evaluated in 22 commercially available distillery yeast strains. Distillery yeasts were found to be a heterogeneous group with a variable content and length of rDNA and degree of nucleolus fragmentation. The levels of rDNA were negatively correlated with Nop1 (r = -0.59, p = 0.0038). Moreover, the protein levels of Sir transcriptional silencing complex and longevity regulators, namely Sir1, Sir2, Sir3 and Fob1, were studied and negative correlations between Sir2 and Nop1 (r = -0.45, p = 0.0332), and between Sir2 and Fob1 (r = -0.49, p = 0.0211) were revealed. In general, S. paradoxus group of distillery yeasts with higher rDNA pools and Sir2 level than S. bayanus group was found to be more tolerant to fermentation-associated stress stimuli, namely mild cold/heat stresses and KCl treatment. We postulate that rDNA state may be considered as a novel factor that may modulate a biotechnological process.

  10. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  11. Eukaryotic 5S rRNA biogenesis.

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2011-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. Copyright © 2011 John Wiley & Sons, Ltd.

  12. Implementacija metode 5S v proces proizvodnje

    Directory of Open Access Journals (Sweden)

    Alojz Gorše

    2016-03-01

    Full Text Available Abstract: Research Question (RQ: The following research tries to show how the introduction of 5S methodology of work affects the production process itself, where the greatest changes are shown and how they are reflected in performance indicators. Purpose: The purpose of this project is to examine the existing methods and their application in practice as well as show the logic of actions we introduce in a particular process by using the 5S method. We will try to compare all the information using a practical example of company X. The results obtained are the basis for further improvements in an analyzed company. Method: We expect positive results in terms of certain improvements in the working environment within the company, as well as the opportunity for improvement in terms of increased efficiency and, consequently, more profit. Results: The results can represent the basis for achieving eve n better work in other processes in the studied company. It is very important to identify all the key activities that are important in generating profits while all the rest are eliminated from the process. Organization: The 5S model is applicable to all levels of the organization so it can be experienced by the highest levels of management in running a business. Society: The impact of the model will surely be seen by employees as they are offered a model after which they will work well, quickly, safely and without loss of time, which in today's world means competitive advantage. Originality: The research work represents an important contribution to the implementation of the 5S model in the company and to the positive things it brings. Limitations/Future Research: The survey as a case study was done in only one organization, in which they were implemented all phases of the method. In the direction of further research it is reasonable to make a quantitative analysis of the increase in profit, increase employee satisfaction analysis, to determine the reduction

  13. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kiparisov, Sergey; Petrov, Alexey; Meskauskas, Arturas; Sergiev, Petr V; Dontsova, Olga A; Dinman, Jonathan D

    2005-10-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semi-dominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression.

  14. Divergence between C. melo and African Cucumis Species Identified by Chromosome Painting and rDNA Distribution Pattern.

    Science.gov (United States)

    Li, Kunpeng; Wang, Huaisong; Wang, Jiming; Sun, Jianying; Li, Zongyun; Han, Yonghua

    2016-01-01

    The 5S and 45S rDNA sites are useful chromosome landmarks and can provide valuable information about karyotype evolution and species interrelationships. In this study, we employed fluorescence in situ hybridization (FISH) to determine the number and chromosomal location of 5S and 45S rDNA loci in 8 diploid Cucumis species. Two oligonucleotide painting probes specific for the rDNA-bearing chromosomes in C. melo were hybridized to other Cucumis species in order to investigate the homeologies among the rDNA-carrying chromosomes in Cucumis species. The analyzed diploid species showed 3 types of rDNA distribution patterns, which provided clear cytogenetic evidence on the divergence between C. melo and wild diploid African Cucumis species. The present results not only show species interrelationships in the genus Cucumis, but the rDNA FISH patterns can also be used as cytological markers for the discrimination of closely related species. The data will be helpful for breeders to choose the most suitable species from various wild species for improvement of cultivated melon.

  15. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    Science.gov (United States)

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn.

  16. Molecular Cytogenetics in Digenean Parasites: Linked and Unlinked Major and 5S rDNAs, B Chromosomes and Karyotype Diversification.

    Science.gov (United States)

    García-Souto, Daniel; Pasantes, Juan J

    2015-01-01

    Digenetic trematodes are the largest group of internal metazoan parasites, but their chromosomes are poorly studied. Although chromosome numbers and/or karyotypes are known for about 300 of the 18,000 described species, molecular cytogenetic knowledge is mostly limited to the mapping of telomeric sequences and/or of major rDNA clusters in 9 species. In this work we mapped major and 5S rDNA clusters and telomeric sequences in chromosomes of Bucephalus minimus, B. australis, Prosorhynchoides carvajali (Bucephaloidea), Monascus filiformis (Gymnophalloidea), Parorchis acanthus (Echinostomatoidea), Cryptocotyle lingua (Opisthorchioidea), Cercaria longicaudata, Monorchis parvus (Monorchioidea), Diphterostomum brusinae, and Bacciger bacciger (Microphalloidea). Whilst single major and minor rDNA clusters were mapped to different chromosome pairs in B. minimus and P. acanthus, overlapping signals were detected on a single chromosome pair in the remaining taxa. FISH experiments using major rDNA and telomeric probes clearly demonstrated the presence of highly stretched NORs in most of the digenean taxa analyzed. B chromosomes were detected in the B. bacciger samples hosted by Ruditapes decussatus. Although the cercariae specimens obtained from Donax trunculus, Tellina tenuis, and R. decussatus were in agreement with B. bacciger, their karyotypes showed striking morphological differences in agreement with the proposed assignation of these cercariae to different species of the genus Bacciger. Results are discussed in comparison with previous data on digenean chromosomes. © 2015 S. Karger AG, Basel.

  17. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    Science.gov (United States)

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  18. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  19. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

    Science.gov (United States)

    Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

    2017-01-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

  20. Two 5S genes are expressed in chicken somatic cells.

    OpenAIRE

    Lazar, E; Haendler, B.; Jacob, M

    1983-01-01

    Two 5S RNA species were detected in chicken cells. 5S I RNA has the nucleotide sequence of chicken 5S RNA previously published by Brownlee et al. (1) and 5S II RNA differs from it by 10 mutations. The secondary structure of both species is compatible with that proposed for other eukaryotic 5S RNAs. 5S II RNA represents 50-60% of 5S I RNA. Both species were found in total chicken liver and brain and were present in polysomes in the same relative proportions. Only one 5S RNA species could be de...

  1. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    Science.gov (United States)

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants.

  2. The B-WICH chromatin-remodelling complex regulates RNA polymerase III transcription by promoting Max-dependent c-Myc binding

    Science.gov (United States)

    Sadeghifar, Fatemeh; Böhm, Stefanie; Vintermist, Anna; Östlund Farrants, Ann-Kristin

    2015-01-01

    The chromatin-remodelling complex B-WICH, comprised of William syndrome transcription factor, the ATPase SNF2h and nuclear myosin, specifically activates RNA polymerase III transcription of the 5S rRNA and 7SL genes. However, the underlying mechanism is unknown. Using high-resolution MN walking we demonstrate here that B-WICH changes the chromatin structure in the vicinity of the 5S rRNA and 7SL RNA genes during RNA polymerase III transcription. The action of B-WICH is required for the binding of the RNA polymerase machinery and the regulatory factors c-Myc at the 5S rRNA and 7SL RNA genes. In addition to the c-Myc binding site at the 5S genes, we have revealed a novel c-Myc and Max binding site in the intergenic spacer of the 5S rDNA. This region also contains a region remodelled by B-WICH. We demonstrate that c-Myc binds to both sites in a Max-dependent way, and thereby activate transcription by acetylating histone H3. The novel binding patterns of c-Myc and Max link transcription of 5S rRNA to the Myc/Max/Mxd network. Since B-WICH acts prior to c-Myc and other factors, we propose a model in which the B-WICH complex is required to maintain an open chromatin structure at these RNA polymerase III genes. This is a prerequisite for the binding of additional regulatory factors. PMID:25883140

  3. Cerastoderma glaucum 5S ribosomal DNA: characterization of the repeat unit, divergence with respect to Cerastoderma edule, and PCR-RFLPs for the identification of both cockles.

    Science.gov (United States)

    Freire, Ruth; Insua, Ana; Méndez, Josefina

    2005-06-01

    The 5S rDNA repeat unit of the cockle Cerastoderma glaucum from the Mediterranean and Baltic coasts was PCR amplified and sequenced. The length of the units was 539-568 bp, of which 120 bp were assigned to the 5S rRNA gene and 419-448 bp to the spacer region, and the G/C content was 46%-49%, 54%, and 44%-47%, respectively. Two types of units (A and B), differing in the spacer, were distinguished based on the percentage of differences and clustering in phylogenetic trees. A PCR assay with specific primers for each unit type indicated that the occurrence of both units is not restricted to the sequenced individuals. The 5S rDNA units of C. glaucum were compared with new and previously reported sequences of Cerastoderma edule. The degree of variation observed in C. edule was lower than that in C. glaucum and evidence for the existence of units A and B in C. edule was not found. The two cockles have the same coding region but displayed numerous fixed differences in the spacer region and group separately in the phylogenetic trees. Digestion of the 5S rDNA PCR product with the restriction enzymes HaeIII and EcoRV revealed two RFLPs useful for cockle identification.

  4. Cytogenetic analysis in three Bryconamericus species (Characiformes, Characidae): first description of the 5S rDNA-bearing chromosome pairs in the genus

    Science.gov (United States)

    2013-01-01

    Background Nowadays, the genus Bryconamericus is placed in subfamily Stevardiinae within of Characidae, but not shows consistent evidence of monophyletism. The purpose of this work was to study the chromosomes of three species of Bryconamericus, aiming to add cytogenetic knowledge and contribute to the understanding of the chromosomal evolution of this genus. Results The chromosomes of three species of Bryconamericus were analyzed using cytogenetic techniques. The karyotype of Bryconamericus stramineus contained 6 metacentric (m) + 10 submetacentric (sm) + 16 subtelocentric (st) + 20 acrocentric (a), the fundamental number (FN) of 84, one silver impregnated (Ag-NOR) pair, one pair bearing the 18S ribosomal DNA sites, another pair bearing the 5S rDNA sites, and a few positive C-bands. Bryconamericus turiuba had a karyotype containing 8 m + 10sm + 14st + 20a (FN = 84), one chromosome pair Ag-NOR, two pairs bearing the 18S rDNA sites, two pairs bearing the 5S rDNA sites, and a few C-band regions. Bryconamericus cf. iheringii had a karyotype containing 10 m + 14sm + 18st + 10a (FN = 94), including one pair with a secondary constriction Ag-NOR positive. In this karyotype the fluorescent in situ hybridization (FISH) showed the 18S and 5S rDNA probe in adjacent position. Conclusions The results obtained in this work showed different characteristics in the organization of two multigene families, indicating that distinct evolutionary forces acting on the diversity of rDNA sequences in the genome of three Bryconamericus species. PMID:23547656

  5. Variability of stomata and 45S and 5S rDNAs loci characteristics in two species of Anthoxanthum genus: A. aristatum and A. odoratum (Poaceae).

    Science.gov (United States)

    Drapikowska, Maria; Susek, Karolina; Hasterok, R; Szkudlarz, P; Celka, Z; Jackowiak, B

    2013-09-01

    Diploid Anthoxanthum odoratum and tetraploid A. aristatum were compared with respect to stomatal guard cell lengths, and stomatal density at adaxial and abaxial surfaces of the lamina. Further, the genome size of both species was determined by flow cytometry, and the number as well as the chromosomal distribution of 5S and 45S rDNAs were examined using FISH with ribosomal DNA (rDNA) probes. The average length of stomatal guard cells in A. odoratum was shown to be greater than that for A. aristatum, but the ranges overlapped. Moreover, reduction in stomatal frequency was found at higher ploidy levels.The genome size was 6.863 pg/2C DNA for A. aristatum and 13.252 pg/2C DNA for A. odoratum. A. aristatum has four sites of 5S rDNA in its root-tip meristematic cells, whereas A. odoratum has six. Both species have six sites of 45S rDNA. Chromosomal localization of the rDNA varied, which suggests that chromosome rearrangements took place during Anthoxanthum genome evolution.

  6. Evolutionary dynamics of rDNA genes on chromosomes of the Eucinostomus fishes: cytotaxonomic and karyoevolutive implications.

    Science.gov (United States)

    Calado, L L; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Jacobina, U P; Molina, W F

    2014-11-27

    Several chromosomal features of Gerreidae fish have been found to be conserved. In this group, it is unclear whether the high degree of chromosomal stasis is maintained when analyzing more dynamic regions of chromosomes, such as rDNA sites that generally show a higher level of variability. Thus, cytogenetic analyses were performed on 3 Atlantic species of the genus Eucinostomus using conventional banding (C-banding, Ag-NOR), AT- and GC-specific fluorochromes, and fluorescence in situ hybridization mapping of telomeric sequences and 5S and 18S rDNA sites. The results showed that although the karyotypical macrostructure of these species is similar (2n = 48 chromosomes, simple Ag-NORs seemingly located on homeologous chromosomes and centromeric heterochromatin pattern), there are differences in the positions of rDNA subunits 5S and 18S. Thus, the ribosomal sites have demonstrated to be effective cytotaxonomic markers in Eucinostomus, presenting a different evolutionary dynamics in relation to other chromosomal regions and allowing access to important evolutionary changes in this group.

  7. Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).

    Science.gov (United States)

    Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata

    2015-08-01

    Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

  8. Structural analysis of two length variants of the rDNA intergenic spacer from Eruca sativa.

    Science.gov (United States)

    Lakshmikumaran, M; Negi, M S

    1994-03-01

    Restriction enzyme analysis of the rRNA genes of Eruca sativa indicated the presence of many length variants within a single plant and also between different cultivars which is unusual for most crucifers studied so far. Two length variants of the rDNA intergenic spacer (IGS) from a single individual E. sativa (cv. Itsa) plant were cloned and characterized. The complete nucleotide sequences of both the variants (3 kb and 4 kb) were determined. The intergenic spacer contains three families of tandemly repeated DNA sequences denoted as A, B and C. However, the long (4 kb) variant shows the presence of an additional repeat, denoted as D, which is a duplication of a 224 bp sequence just upstream of the putative transcription initiation site. Repeat units belonging to the three different families (A, B and C) were in the size range of 22 to 30 bp. Such short repeat elements are present in the IGS of most of the crucifers analysed so far. Sequence analysis of the variants (3 kb and 4 kb) revealed that the length heterogeneity of the spacer is located at three different regions and is due to the varying copy numbers of repeat units belonging to families A and B. Length variation of the spacer is also due to the presence of a large duplication (D repeats) in the 4 kb variant which is absent in the 3 kb variant. The putative transcription initiation site was identified by comparisons with the rDNA sequences from other plant species.

  9. Characterization of ribosomal DNA (rDNA in Drosophila arizonae

    Directory of Open Access Journals (Sweden)

    Francisco Javier Tovar

    2000-06-01

    Full Text Available Ribosomal DNA (rDNA is a multigenic family composed of one or more clusters of repeating units (RU. Each unit consists of highly conserved sequences codifying 18S, 5.8S and 28S rRNA genes intercalated with poorly conserved regulatory sequences between species. In this work, we analyzed the rDNA of Drosophila arizonae, a member of the mulleri complex (Repleta group. Using genomic restriction patterns, cloning and mapping of some representative rDNA fragments, we were able to construct a representative restriction map. RU in this species are 13.5-14 kb long, restriction sites are completely conserved compared with other drosophilids and the rDNA has an R1 retrotransposable element in some RU. We were unable to detect R2 elements in this species.O DNA ribossômico (rDNA é uma família multigênica composta de um ou mais aglomerados de unidades de repetição (RU. Cada unidade consiste de seqüências altamente conservadas que codificam os rRNAs 18S, 5.8S e 28S, intercaladas com seqüências regulatórias pouco conservadas entre as espécies. Neste trabalho analisamos o rDNA de Drosophila arizonae, um membro do complexo mulleri (grupo Repleta. Usando padrões de restrição genômicos, clonagem e mapeamento de alguns fragmentos de rDNA representativos, estabelecemos um mapa de restrição do rDNA representativo desta espécie. Neste drosofilídeo, a RU tem um tamanho médio de 13.5-14 kb e os sítios de restrição estão completamente conservados com relação a outras drosófilas. Além disto, este rDNA possui um elemento transponível tipo R1 presente em algumas unidades. Neste trabalho não tivemos evidências da presença de elementos R2 no rDNA desta espécie.

  10. Making safety an integral part of 5S in healthcare.

    Science.gov (United States)

    Ikuma, Laura H; Nahmens, Isabelina

    2014-01-01

    Healthcare faces major challenges with provider safety and rising costs, and many organizations are using Lean to instigate change. One Lean tool, 5S, is becoming popular for improving efficiency of physical work environments, and it can also improve safety. This paper demonstrates that safety is an integral part of 5S by examining five specific 5S events in acute care facilities. We provide two arguments for how safety is linked to 5S:1. Safety is affected by 5S events, regardless of whether safety is a specific goal and 2. Safety can and should permeate all five S's as part of a comprehensive plan for system improvement. Reports of 5S events from five departments in one health system were used to evaluate how changes made at each step of the 5S impacted safety. Safety was affected positively in each step of the 5S through initial safety goals and side effects of other changes. The case studies show that 5S can be a mechanism for improving safety. Practitioners may reap additional safety benefits by incorporating safety into 5S events through a safety analysis before the 5S, safety goals and considerations during the 5S, and follow-up safety analysis.

  11. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae

    Directory of Open Access Journals (Sweden)

    Amina Kharrat-Souissi

    2012-08-01

    Full Text Available The Buffelgrass (Cenchrus ciliaris L., Poaceae is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA for pentaploid and hexaploid cytotypes of C. ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S, displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level. For three studied cytotypes (4x, 5x and 6x all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes.

  12. Chromosome mapping of H1 histone and 5S rRNA gene clusters in three species of Astyanax (Teleostei, Characiformes).

    Science.gov (United States)

    Hashimoto, D T; Ferguson-Smith, M A; Rens, W; Foresti, F; Porto-Foresti, F

    2011-01-01

    We report here on the physical mapping of the H1 histone genes (hisDNA) and the 5S ribosomal DNA (rDNA) in 3 Neotropical fish species of the genus Astyanax(A. altiparanae, A. bockmanni and A. fasciatus) and the comparative analysis of the chromosomes bearing these genes. Nucleotide analyses by sequencing of both genes were also performed. The distribution of the H1 histone genes was more conserved than that of the rRNA genes, since these were always located in the pericentromeric regions of 2 chromosome pairs. 5S rDNA was found on one of the pairs that presented an H1 histone cluster; this seems to be a conserved chromosomal feature of the genus Astyanax. In addition, individuals of A. bockmanni and A. fasciatus showed clusters of 5S rDNA on 1 pair of acrocentric chromosomes, not found in A. altiparanae. The results obtained by chromosome mapping as well as by sequencing of both genes showed that A.bockmanni is more closely related to A. fasciatus than to A. altiparanae. The results allow the characterization of cytogenetic markers for improved elucidation of the processes involved in karyotype differentiation of fish genomes. Copyright © 2011 S. Karger AG, Basel.

  13. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    Science.gov (United States)

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

    2012-01-01

    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  14. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    Science.gov (United States)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  15. PROBLEMS OF IMPLEMENTATION 5S PRACTICES IN AN INDUSTRIAL COMPANY

    Directory of Open Access Journals (Sweden)

    Beata GALA

    2013-10-01

    Full Text Available 5S is a one of the tools of Lean Management enabling to organize workplace in an effective way. It could be implemented in all the spheres of the company. The article provides the theoretic description of Lean Management and 5S and also shows a case study based on gained experience. The author also describe the problems occured during the implementation of the 5S.

  16. Review on Implementation of 5S in Various Organization

    OpenAIRE

    Vipulkumar C. Patel; Dr. Hemant Thakkar

    2014-01-01

    This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ effic...

  17. BEND3 mediates transcriptional repression and heterochromatin organization.

    Science.gov (United States)

    Khan, Abid; Prasanth, Supriya G

    2015-01-01

    Transcription repression plays a central role in gene regulation. Transcription repressors utilize diverse strategies to mediate transcriptional repression. We have recently demonstrated that BEND3 (BANP, E5R and Nac1 domain) protein represses rDNA transcription by stabilizing a NoRC component. We discuss the role of BEND3 as a global regulator of gene expression and propose a model whereby BEND3 associates with chromatin remodeling complexes to modulate gene expression and heterochromatin organization.

  18. Altered gravity influences rDNA and NopA100 localization in nucleoli

    Science.gov (United States)

    Sobol, M. A.; Kordyum, E. L.

    Fundamental discovery of gravisensitivity of cells no specified to gravity perception focused increasing attention on an elucidation of the mechanisms involved in altered gravity effects at the cellular and subcellular levels. The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts with ribosomal and nonribosomal proteins. The mechanisms inducing the changes in the subcomponents of the nucleolus that is morphologically defined yet highly dynamic structure are still unknown in detail. To understand the functional organization of the nucleolus as in the control as under altered gravity conditions it is essential to determine both the precise location of rDNA and the proteins playing the key role in rRNA processing. Lepidium sativum seeds were germinated in 1% agar medium on the slow horizontal clinostat (2 rpm) and in the stationary conditions. We investigated the root meristematic cells dissected from the seedlings grown in darkness for two days. The investigations were carried out with anti-DNA and anti-NopA100 antibodies labeling as well as with TdT procedure, and immunogold electron microscopy. In the stationary growth conditions, the anti-DNA antibody as well TdT procedure were capable of detecting fibrillar centers (FCs) and the dense fibrillar component (DFC) in the nucleolus. In FCs, gold particles were revealed on the condensed chromatin inclusions, internal fibrils of decondensed rDNA and the transition zone FC-DFC. Quantitatively, FCs appeared 1,5 times more densely labeled than DFC. NopA100 was localized in FCs and in DFC. In FCs, the most of protein was revealed in the transition zone FC-DFC. After a quantitative study, FCs and the transition zone FC-DFC appeared to contain NopA100 1,7 times more than DFC. Under the conditions of altered gravity, quantitative data clearly showed a redistribution of nucleolar DNA and NopA100 between FCs and DFC in comparison with the control. In

  19. Increased 5S rRNA oxidation in Alzheimer's disease.

    Science.gov (United States)

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  20. Elimination of 5S DNA unit classes in newly formed allopolyploids of the genera Aegilops and Triticum.

    Science.gov (United States)

    Baum, B R; Feldman, M

    2010-06-01

    Two classes of 5S DNA units, namely the short (containing units of 410 bp) and the long (containing units of 500 bp), are recognized in species of the wheat (the genera Aegilops and Triticum) group. While every diploid species of this group contains 2 unit classes, the short and the long, every allopolyploid species contains a smaller number of unit classes than the sum of the unit classes of its parental species. The aim of this study was to determine whether the reduction in these unit classes is due to the process of allopolyploidization, that is, interspecific or intergeneric hybridization followed by chromosome doubling, and whether it occurs during or soon after the formation of the allopolyploids. To study this, the number and types of unit classes were determined in several newly formed allotetraploids, allohexaploids, and an allooctoploid of Aegilops and Triticum. It was found that elimination of unit classes of 5S DNA occurred soon (in the first 3 generations) after the formation of the allopolyploids. This elimination was reproducible, that is, the same unit classes were eliminated in natural and synthetic allopolyploids having the same genomic combinations. No further elimination occurred in the unit classes of the 5S DNA during the life of the allopolyploid. The genetic and evolutionary significance of this elimination as well as the difference in response to allopolyploidization of 5S DNA and rDNA are discussed.

  1. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    Directory of Open Access Journals (Sweden)

    Martins Cesar

    2011-10-01

    Full Text Available Abstract Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae. Results The number of 18S rRNA gene (a member of the 45S rDNA unit sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that

  2. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides AT+CG in the mitogenome of Kamimuria wangi.

    Science.gov (United States)

    Seligmann, Hervé

    2016-07-01

    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.

  3. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    Science.gov (United States)

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

  4. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Cytogenetic characterization by in situ hybridization techniques and molecular analysis of 5S rRNA genes of the European hazelnut (Corylus avellana).

    Science.gov (United States)

    Falistocco, E; Marconi, G

    2013-03-01

    The European hazelnut (Corylus avellana L.) is widespread in Europe, where it has been cultivated for centuries. Despite progress in genetics, most of the cytogenetic aspects of this species have been overlooked. The aim of this study was to fill in this gap and obtain basic information on the chromosome structure of this species. Karyomorphological analysis confirmed the chromosome number 2n = 22 and showed that, despite their apparent uniformity, the chromosomes could be separated into three groups of different size: large (L), medium (M), and small (S). As a first step towards the physical mapping of the hazelnut chromosomes, we applied FISH to localize the position of rRNA genes (rDNA). The sites of 45S and 5S rDNA enabled us to identify two chromosome pairs belonging, respectively, to the L and S groups. The self-GISH procedure revealed that repetitive DNA is concentrated in the pericentromeric regions of the chromosomes, as with other species with rather small genomes. The analysis of 5S rDNA repeats offered additional information on the hazelnut genome by obtaining the whole sequence of the transcribed region so far unpublished. The overall results constitute a substantial advance in hazelnut cytogenetics. Further investigation of other species of Corylus could be an effective approach to understanding the phylogenesis of the genus and resolving taxonomic problems.

  6. Regulation of rDNA stability by sumoylation

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2009-01-01

    , the eukaryotic cell has evolved mechanisms to favor equal sister chromatid exchange (SCE) and suppress unequal SCE, single-strand annealing and break-induced replication. In the budding yeast Saccharomyces cerevisiae, the tight regulation of homologous recombination at the rDNA locus is dependent on the Smc5-Smc...

  7. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    Science.gov (United States)

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  8. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  9. Organization and Variation Analysis of 5S rDNA in Different Ploidy-level Hybrids of Red Crucian Carp × Topmouth Culter

    OpenAIRE

    Weiguo He; Qinbo Qin; Shaojun Liu; Tangluo Li; Jing Wang; Jun Xiao; Lihua Xie; Chun Zhang; Yun Liu

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets...

  10. Stalled RNAP-II molecules bound to non-coding rDNA spacers are required for normal nucleolus architecture.

    Science.gov (United States)

    Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D

    2013-07-01

    The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes.

  11. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.

    Science.gov (United States)

    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha

    2012-10-12

    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  12. High-Resolution Infrared Spectroscopy of Carbon-Sulfur Chains: II. C_5S and SC_5S

    Science.gov (United States)

    Thorwirth, Sven; Salomon, Thomas; Dudek, John B.

    2016-06-01

    Unbiased high-resolution infrared survey scans of the ablation products from carbon-sulfur targets in the 2100 to 2150 cm-1 regime reveal two bands previously not observed in the gas phase. On the basis of comparison against laboratory matrix-isolation work and new high-level quantum-chemical calculations these bands are attributed to the linear C_5S and SC_5S clusters. While polar C_5S was studied earlier using Fourier-transform microwave techniques, the present work marks the first gas-phase spectroscopic detection of SC_5S. H. Wang, J. Szczepanski, P. Brucat, and M. Vala 2005, Int. J. Quant. Chem. 102, 795 Y. Kasai, K. Obi, Y. Ohshima, Y. Hirahara, Y. Endo, K. Kawaguchi, and A. Murakami 1993, ApJ 410, L45 V. D. Gordon, M. C. McCarthy, A. J. Apponi, and P. Thaddeus 2001, ApJS 134, 311

  13. Robertsonian rearrangements in the reef fish Chromis (Perciformes, Pomacentridae involving chromosomes bearing 5s rRNA genes

    Directory of Open Access Journals (Sweden)

    Wagner F. Molina

    2002-01-01

    Full Text Available Cytogenetic studies were done on three Pomacentridae species of the genus Chromis. The karyotype of C. multilineata consisted of 48 acrocentric chromosomes (FN = 48, C. insolata had 2n = 46-47 (3-4M+6SM+36-38A; FN = 56 and C. flavicauda had 2n = 39 (9M+6SM+24A; FN = 54. Robertsonian polymorphisms were detected in C. insolata and C. flavicauda. All three species had small heterochromatic blocks restricted to centromeric regions. Nucleolar organizer regions (NORs were detected in the telomeric position of a medium acrocentric chromosome pair in C. multilineata and in non-homologous chromosomes in both C. flavicauda and C. insolata. FISH with a telomeric probe detected no internal telomeric sequences in C. flavicauda and C. insolata. 5S rRNA genes were observed in a pericentromeric region of two large metacentric chromosome pairs in C. flavicauda and two large acrocentric pairs in C. insolata. The karyotype structure and the number and location of the 5S rDNA loci in these two species indicated that the 5S rRNA-bearing acrocentric chromosomes were directly involved in the origin of the polymorphisms observed. These data reinforce the idea that Robertsonian rearrangements have been involved in molding the karyotype in the subfamily Chrominae.

  14. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    Science.gov (United States)

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  15. Implementation of 5S Method for Ergonomic Laboratory

    Science.gov (United States)

    Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus

    2017-06-01

    This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment

  16. Review on Implementation of 5S in Various Organization

    Directory of Open Access Journals (Sweden)

    Vipulkumar C. Patel

    2014-04-01

    Full Text Available This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ efficiency, safety, security, quality and reduction of the industry pollution, proceedings according to decisions. The 5S methodology permits to analyze the processes running on the workplace and establishment of 5Ssustaining well organized, clean, high effective and high quality workplace. Research clearly show, that very essential is training of workers about the 5S rules. Essential thing is to divide activities on some main steps and to maintain the continuous improvement. This method can be used in all companies. Its result is the effective organization of the workplace.

  17. Karyotype analysis of Panax ginseng C.A.Meyer, 1843 (Araliaceae) based on rDNA loci and DAPI band distribution.

    Science.gov (United States)

    Waminal, Nomar Espinosa; Park, Hye Mi; Ryu, Kwang Bok; Kim, Joo Hyung; Yang, Tae-Jin; Kim, Hyun Hee

    2012-01-01

    Ginseng has long been considered a valuable plant owing to its medicinal properties; however, genomic information based on chromosome characterization and physical mapping of cytogenetic markers has been very limited. Dual-color FISH karyotype and DAPI banding analyses of Panax ginseng C. A. Meyer, 1843 were conducted using 5S and 45S rDNA probes. The somatic chromosome complement was 2n=48 with lengths from 3.3 μm to 6.3 μm. The karyotype was composed of 12 metacentric, 9 submetacentric, and 3 subtelocentric pairs. The 5S rDNA probe localized to the intercalary region of the short arm of pair 11, while the 45S rDNA was located at the secondary constriction of the subtelocentric satellited chromosome 14. DAPI bands were clearly observed for most chromosomes, with various signal intensities and chromosomal distributions that consequently improved chromosome identification. As a result, all 24 chromosomes could be distinguished and numbers were assigned to each chromosome for the first time. The results presented here will be useful for the on-going ginseng genome sequencing and further molecular-cytogenetic studies and breeding programs of ginseng.

  18. Karyotype analysis of Panax ginseng C.A.Meyer, 1843 (Araliaceae based on rDNA loci and DAPI band distribution

    Directory of Open Access Journals (Sweden)

    Nomar Waminal

    2012-12-01

    Full Text Available Ginseng has long been considered a valuable plant owing to its medicinal properties; however, genomic information based on chromosome characterization and physical mapping of cytogenetic markers has been very limited. Dual-color FISH karyotype and DAPI banding analyses of Panax ginseng C. A. Meyer, 1843 were conducted using 5S and 45S rDNA probes. The somatic chromosome complement was 2n=48 with lengths from 3.3 µm to 6.3 µm. The karyotype was composed of 12 metacentric, 9 submetacentric, and 3 subtelocentric pairs. The 5S rDNA probe localized to the intercalary region of the short arm of pair 11, while the 45S rDNA was located at the secondary constriction of the subtelocentric satellited chromosome 14. DAPI bands were clearly observed for most chromosomes, with various signal intensities and chromosomal distributions that consequently improved chromosome identification. As a result, all 24 chromosomes could be distinguished and numbers were assigned to each chromosome for the first time. The results presented here will be useful for the on-going ginseng genome sequencing and further molecular-cytogenetic studies and breeding programs of ginseng.

  19. Interindividual size heteromorphism of NOR and chromosomal location of 5S rRNA genes in Iheringichthys labrosus

    Directory of Open Access Journals (Sweden)

    Rafael Augusto de Carvalho

    2007-01-01

    Full Text Available Twenty-five specimens of Iheringichthys labrosus from the Capivara Reservoir were analysed cytogenetically. AgNORs were detected in a pair of ST chromosomes, in the telomeric region of the long arm. Some individuals showed size heteromorphism of this region between homologous chromosomes. Treatment with CMA3 displayed GC-rich regions corresponding to the AgNOR pair, plus other fluorescent staining. In situ hybridization by fluorescence (FISH with the 18S rDNA probe showed only one pair of stained chromosomes, confirming the heteromorphism observed with AgNO3 and CMA3 in some individuals. The 5S rDNA probe revealed telomeric staining on the long arm of a pair of chromosomes of the ST-A group, probably different from the NOR pair.Foram analisados citogeneticamente vinte e cinco indivíduos de Iheringichthys labrosus da Represa Capivara. As AgNORs foram detectadas em um par de cromossomos ST na região telomérica do braço longo. Em alguns exemplares machos e fêmeas foi observado um heteromorfismo de tamanho desta região entre cromossomos homólogos. O tratamento com CMA3 exibiu regiões ricas em GC correspondentes ao par da NOR e outras marcações fluorescentes. A hibridação in situ por fluorescência (FISH com a sonda de DNAr 18S mostrou somente um par de cromossomos marcados, confirmando o heteromorfismo observado com AgNO3 and CMA3 em alguns indivíduos. A sonda de DNAr 5S revelou marcação telomérica no braço longo de um par de cromossomos do grupo ST-A, provavelmente diferente do par da NOR.

  20. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants.

    Science.gov (United States)

    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A

    2016-01-01

    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes.

  1. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants

    Science.gov (United States)

    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A.

    2016-01-01

    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes. PMID:27622766

  2. 5s correlation confinement resonances in Xe-endo-fullerenes

    CERN Document Server

    Dolmatov, V K

    2011-01-01

    Spectacular trends in the modification of the Xe 5s photoionization via interchannel coupling with confinement resonances emerging in the Xe 4d giant resonance upon photoionization of the Xe@C60, Xe@C240 and Xe@C60@C240 endo-fullerenes are theoretically unraveled and interpreted.

  3. Analyzing Digital Library Initiatives: 5S Theory Perspective

    Science.gov (United States)

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  4. 5S rRNA-assisted DnaK refolding.

    Science.gov (United States)

    Kim, Hyo Kyung; Choi, Seong Il; Seong, Baik L

    2010-01-08

    Although accumulating evidence has revealed that most proteins can fold without the assistance of molecular chaperones, little attention has been paid to other types of chaperoning macromolecules. A variety of proteins interact with diverse RNA molecules in vivo, suggesting a potential role of RNAs for folding of their interacting proteins. Here we show that the in vitro refolding of a representative molecular chaperone, DnaK, an Escherichia coli homolog of Hsp70, could be assisted by its interacting 5S rRNA. The folding enhancement occurred in RNA concentration and its size dependent manner whereas neither the RNA with the reverse sequence of 5S rRNA nor the RNase pretreated 5S rRNA stimulated the folding in vitro. Based on our results, we propose that 5S rRNA could exert the chaperoning activity on DnaK during the folding process. The results suggest an interesting possibility that the folding of RNA-interacting proteins could be assisted by their cognate RNA ligands. Copyright 2009 Elsevier Inc. All rights reserved.

  5. TEXTILE INDUSTRY APPLICATION OF THE 5S METHOD

    Directory of Open Access Journals (Sweden)

    Raluca BRAD

    2015-05-01

    Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.

  6. Analyzing Digital Library Initiatives: 5S Theory Perspective

    Science.gov (United States)

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  7. Telomerase stimulates ribosomal DNA transcription under hyperproliferative conditions.

    Science.gov (United States)

    Gonzalez, Omar Garcia; Assfalg, Robin; Koch, Sylvia; Schelling, Adrian; Meena, Jitendra K; Kraus, Johann; Lechel, Andre; Katz, Sarah-Fee; Benes, Vladimir; Scharffetter-Kochanek, Karin; Kestler, Hans A; Günes, Cagatay; Iben, Sebastian

    2014-08-13

    In addition to performing its canonical function, Telomerase Reverse Transcriptase (TERT) has been shown to participate in cellular processes independent of telomerase activity. Furthermore, although TERT mainly localizes to Cajal bodies, it is also present within the nucleolus. Because the nucleolus is the site of rDNA transcription, we investigated the possible role of telomerase in regulating RNA polymerase I (Pol I). Here we show that TERT binds to rDNA and stimulates transcription by Pol I during liver regeneration and Ras-induced hyperproliferation. Moreover, the inhibition of telomerase activity by TERT- or TERC-specific RNA interference, the overexpression of dominant-negative-TERT, and the application of the telomerase inhibitor imetelstat reduce Pol I transcription and the growth of tumour cells. In vitro, telomerase can stimulate the formation of the transcription initiation complex. Our results demonstrate how non-canonical features of telomerase may direct Pol I transcription in oncogenic and regenerative hyperproliferation.

  8. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    Science.gov (United States)

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  9. rDNA mapping, heterochromatin characterization and AT/GC content of Agapanthus africanus (L. Hoffmanns (Agapanthaceae

    Directory of Open Access Journals (Sweden)

    ARYANE C. REIS

    2016-01-01

    Full Text Available ABSTRACT Agapanthus (Agapanthaceae has 10 species described. However, most taxonomists differ respect to this number because the great phenotypic plasticity of the species. The cytogenetic has been an important tool to aid the plant taxon identification, and to date, all taxa of Agapanthus L'Héritier studied cytologically, presented 2n = 30. Although the species possess large chromosomes, the group is karyologically little explored. This work aimed to increase the cytogenetic knowledge of Agapanthus africanus (L. Hoffmanns by utilization of chromosome banding techniques with DAPI / CMA3 and Fluorescent in situ Hybridization (FISH. In addition, flow cytometry was used for determination of DNA content and the percentage of AT / GC nitrogenous bases. Plants studied showed 2n = 30 chromosomes, ranging from 4.34 - 8.55 µm, with the karyotype formulae (KF = 10m + 5sm. Through FISH, one 45S rDNA signal was observed proximally to centromere of the chromosome 7, while for 5S rDNA sites we observed one signal proximally to centromere of chromosome 9. The 2C DNA content estimated for the species was 2C = 24.4 with 59% of AT and 41% of GC. Our data allowed important upgrade for biology and cytotaxonomy of Agapanthus africanus (L. Hoffmanns.

  10. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    Science.gov (United States)

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-11-14

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera.

  11. Patterns of rDNA and telomeric sequences diversification: contribution to repetitive DNA organization in Phyllostomidae bats.

    Science.gov (United States)

    Calixto, Merilane da Silva; de Andrade, Izaquiel Santos; Cabral-de-Mello, Diogo Cavalcanti; Santos, Neide; Martins, Cesar; Loreto, Vilma; de Souza, Maria José

    2014-02-01

    Chromosomal organization and the evolution of genome architecture can be investigated by physical mapping of the genes for 45S and 5S ribosomal DNAs (rDNAs) and by the analysis of telomeric sequences. We studied 12 species of bats belonging to four subfamilies of the family Phyllostomidae in order to correlate patterns of distribution of heterochromatin and the multigene families for rDNA. The number of clusters for 45S gene ranged from one to three pairs, with exclusively location in autosomes, except for Carollia perspicillata that had in X chromosome. The 5S gene all the species studied had only one site located on an autosomal pair. In no species the 45S and 5S genes collocated. The fluorescence in situ hybridization (FISH) probe for telomeric sequences revealed fluorescence on all telomeres in all species, except in Carollia perspicillata. Non-telomeric sites in the pericentromeric region of the chromosomes were observed in most species, ranged from one to 12 pairs. Most interstitial telomeric sequences were coincident with heterochromatic regions. The results obtained in the present work indicate that different evolutionary mechanisms are acting in Phyllostomidae genome architecture, as well as the occurrence of Robertsonian fusion during the chromosomal evolution of bats without a loss of telomeric sequences. These data contribute to understanding the organization of multigene families and telomeric sequences on bat genome as well as the chromosomal evolutionary history of Phyllostomidae bats.

  12. Sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2, and 28S rDNA) of Demodex and phylogenetic analysis of Acari based on 18S and 28S rDNA.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping; Hu, Li; Xu, Yang; Wang, Zheng-Hang; Liu, Wen-Yan

    2012-11-01

    Due to the difficulty of DNA extraction for Demodex, few studies dealt with the identification and the phyletic evolution of Demodex at molecular level. In this study, we amplified, sequenced, and analyzed a complete (Demodex folliculorum) and an almost complete (D12 missing) (Demodex brevis) ribosomal DNA (rDNA) sequence and also analyzed the primary sequences of divergent domains in small-subunit ribosomal RNA (rRNA) of 51 species and in large-subunit rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea, and Ixodoidea). The results revealed that 18S rDNA sequence was relatively conserved in rDNA-coding regions and was not evolving as rapidly as 28S rDNA sequence. The evolutionary rates of transcribed spacer regions were much higher than those of the coding regions. The maximum parsimony trees of 18S and 28S rDNA appeared to be almost identical, consistent with their morphological classification. Based on the fact that the resolution capability of sequence length and the divergence of the 13 segments (D1-D6, D7a, D7b, and D8-D12) of 28S rDNA were stronger than that of the nine variable regions (V1-V9) of 18S rDNA, we were able to identify Demodex (Cheyletoidea) by the indels occurring in D2, D6, and D8.

  13. Resurrection of an ancestral 5S rRNA

    Directory of Open Access Journals (Sweden)

    Fox George E

    2011-07-01

    Full Text Available Abstract Background In addition to providing phylogenetic relationships, tree making procedures such as parsimony and maximum likelihood can make specific predictions of actual historical sequences. Resurrection of such sequences can be used to understand early events in evolution. In the case of RNA, the nature of parsimony is such that when applied to multiple RNA sequences it typically predicts ancestral sequences that satisfy the base pairing constraints associated with secondary structure. The case for such sequences being actual ancestors is greatly improved, if they can be shown to be biologically functional. Results A unique common ancestral sequence of 28 Vibrio 5S ribosomal RNA sequences predicted by parsimony was resurrected and found to be functional in the context of the E. coli cellular environment. The functionality of various point variants and intermediates that were constructed as part of the resurrection were examined in detail. When separately introduced the changes at single stranded positions and individual double variants at base-paired positions were also viable. An additional double variant was examined at a different base-paired position and it was also valid. Conclusions The results show that at least in the case of the 5S rRNAs considered here, ancestors predicted by parsimony are likely to be realistic when the prediction is not overly influenced by single outliers. It is especially noteworthy that the phenotype of the predicted ancestors could be anticipated as a cumulative consequence of the phenotypes of the individual variants that comprised them. Thus, point mutation data is potentially useful in evaluating the reasonableness of ancestral sequences predicted by parsimony or other methods. The results also suggest that in the absence of significant tertiary structure constraints double variants that preserve pairing in stem regions will typically be accepted. Overall, the results suggest that it will be feasible

  14. Resurrection of an ancestral 5S rRNA.

    Science.gov (United States)

    Lu, Qing; Fox, George E

    2011-07-22

    In addition to providing phylogenetic relationships, tree making procedures such as parsimony and maximum likelihood can make specific predictions of actual historical sequences. Resurrection of such sequences can be used to understand early events in evolution. In the case of RNA, the nature of parsimony is such that when applied to multiple RNA sequences it typically predicts ancestral sequences that satisfy the base pairing constraints associated with secondary structure. The case for such sequences being actual ancestors is greatly improved, if they can be shown to be biologically functional. A unique common ancestral sequence of 28 Vibrio 5S ribosomal RNA sequences predicted by parsimony was resurrected and found to be functional in the context of the E. coli cellular environment. The functionality of various point variants and intermediates that were constructed as part of the resurrection were examined in detail. When separately introduced the changes at single stranded positions and individual double variants at base-paired positions were also viable. An additional double variant was examined at a different base-paired position and it was also valid. The results show that at least in the case of the 5S rRNAs considered here, ancestors predicted by parsimony are likely to be realistic when the prediction is not overly influenced by single outliers. It is especially noteworthy that the phenotype of the predicted ancestors could be anticipated as a cumulative consequence of the phenotypes of the individual variants that comprised them. Thus, point mutation data is potentially useful in evaluating the reasonableness of ancestral sequences predicted by parsimony or other methods. The results also suggest that in the absence of significant tertiary structure constraints double variants that preserve pairing in stem regions will typically be accepted. Overall, the results suggest that it will be feasible to resurrect additional meaningful 5S rRNA ancestors as well

  15. Thermodynamic properties of CaTiF{sub 5}(s)

    Energy Technology Data Exchange (ETDEWEB)

    Parida, S.C. [Department of Metallurgical and Materials Engineering, University of Alabama, P.O. Box 870202, A-129 Bevill Building, 126 Seventh Avenue, Tuscaloosa, AL 35487-0202 (United States); Reddy, R.G. [Department of Metallurgical and Materials Engineering, University of Alabama, P.O. Box 870202, A-129 Bevill Building, 126 Seventh Avenue, Tuscaloosa, AL 35487-0202 (United States)]. E-mail: rreddy@eng.ua.edu

    2007-06-15

    Calcium titanofluoride CaTiF{sub 5}(s) was prepared by solid-state reaction of CaF{sub 2}(s) with TiF{sub 3}(s) and characterized by X-ray diffraction method. The standard molar isobaric heat capacity (C{sub p,m}{sup o}) of CaTiF{sub 5}(s) was determined by a power compensated differential scanning calorimeter in the temperature from 230K to 710K. A solid-state galvanic cell with CaF{sub 2} as electrolyte was used to determine the standard molar Gibbs energy of formation ({delta}{sub f}G{sub m}{sup o}) of CaTiF{sub 5} in the temperature range from 803K to 1005K. The galvanic cell can be depicted as:(-)Pt,O{sub 2}(g,101.325kPa)/{l_brace}CaO(s)+CaF{sub 2}(s){r_brace}//CaF{sub 2}//{l_brace}CaTiF{sub 5}(s)+CaTiO{sub 3}(s){r_brace}/O{sub 2} (g,101.325kPa),Pt(+)The second law analysis of present data were carried out to derive the standard entropy S{sub m}{sup o}(298.15K) and the enthalpy of formation {delta}{sub f}H{sub m}{sup o} (298.15K) and the values derived are 68.7J.K{sup -1}.mol{sup -1} and -2848.4kJ.mol{sup -1}, respectively.

  16. 5S applied to the corporative network of data

    OpenAIRE

    Izekson Jose da Silva

    2002-01-01

    Resumo: Na busca de maior velocidade e agilidade nas organizações, para enfrentar com êxito o mercado cada vez mais competitivo, é acentuada a demanda por tecnologia de informação em rede corporativa de dados, como também de metodologias de tratamento de informações que proporcionem melhor desempenho dos recursos de informática utilizados, através de uma utilização disciplinada dos mesmos. Neste sentido, com base na experiência bem sucedida de aplicação do 5S em uma empresa de grande porte e ...

  17. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...

  18. Photocurrent analysis of AgIn$_5$S$_8$ crystal

    Indian Academy of Sciences (India)

    MAHMUT BUCURGAT; SELAHATTIN OZDEMIR; TEZER FIRAT

    2016-10-01

    The photocurrent (PC) spectrum of AgIn$_5$S$_8$ crystal consists of a single peak, which provides to determine the bandgap energy by applying the Moss rule. The temperature dependence of the bandgap energy was alsocalculated. The PC dramatically increased by pre-illumination with light having wavelength corresponding to the bandgap of AgIn$_5$S$_8$. The temperature-dependent PC of the sample was measured at different temperatures from80 to 300 K and the PC spectrum consisted a single broad peak. Thermal quenching of the PC was observed to start at $\\sim$105 K and the PC completely quenched at $\\sim$180 K. The quenching mechanism was discussed in terms of the two-centre model. The height of the PC peak rised linearly with applied voltage up to 5.0 V under constant intensity of light. Similarly, the dark current–voltage characteristics consisted of a single region dominating an ohmicbehaviour, and no space charge limited region was apparent at various temperatures up to 20 V.

  19. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  20. A conserved alternative splicing event in plants reveals an ancient exonization of 5S rRNA that regulates TFIIIA.

    Science.gov (United States)

    Barbazuk, W Brad

    2010-01-01

    Uncovering conserved alternative splicing (AS) events can identify AS events that perform important functions. This is especially useful for identifying premature stop codon containing (PTC) AS isoforms that may regulate protein expression by being targets for nonsense mediated decay. This report discusses the identification of a PTC containing splice isoform of the TFIIIA gene that is highly conserved in land plants. TFIIIA is essential for RNA Polymerase III-based transcription of 5S rRNA in eukaryotes. Two independent groups have determined that the PTC containing alternative exon is ultraconserved and is coupled with nonsense-mediated mRNA decay. The alternative exon appears to have been derived by the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA. This provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized non-coding element.

  1. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Science.gov (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Transcription Factor Substitution during the Evolution of Fungal Ribosome Regulation

    OpenAIRE

    Hogues, Hervé; Lavoie, Hugo; Sellam, Adnane; Mangos, Maria; Roemer, Terry; Purisima, Enrico; Nantel, André; Whiteway, Malcolm

    2008-01-01

    Coordinated ribosomal protein (RP) gene expression is crucial for cellular viability, but the transcriptional network controlling this regulon has only been well characterized in the yeast Saccharomyces cerevisiae. We have used whole-genome transcriptional and location profiling to establish that, in Candida albicans, the RP regulon is controlled by the Myb domain protein Tbf1 working in conjunction with Cbf1. These two factors bind both the promoters of RP genes and the rDNA locus; Tbf1 acti...

  3. Karyotype characterization of Crotalaria juncea (L. by chromosome banding and physical mapping of 18S-5.8S-26S and 5S rRNA gene sites

    Directory of Open Access Journals (Sweden)

    Mateus Mondin

    2007-01-01

    Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.

  4. Chromosomal locations of four minor rDNA loci and a marker microsatellite sequence in barley

    DEFF Research Database (Denmark)

    Pedersen, C.; Linde-Laursen, I.

    1994-01-01

    is located about 54% out on the short arm of chromosome 4 and it has not previously been reported in barley. We have designated the new locus Nor-I6. rDNA loci on homoeologous group 4 chromosomes have not yet been reported in other Triticeae species. The origin of these 4 minor rDNA loci is discussed...

  5. Recent Belle results from Y(5S) sample

    CERN Document Server

    Louvot, Remi

    2011-01-01

    The large data sample recorded with the Belle detector at the Y(5S) energy provides a unique opportunity to study the poorly-known $\\bs$ meson. Two analyses, performed with a data sample representing an integrated luminosity of 121 /fb, are presented: the measurement of the Bs0->J/psi f0(980) and Bs0->J/psi f0(1370) branching fractions, and the 5sigma observation of the decay Bs0-bar->Lambda(c)+ pi- Lambda-bar which is the first observation of a baryonic Bs0 decay. In addition, we present new results of a measurement of the CKM angle phi_1(beta) with B pi tagged events.

  6. The participation of 5S rRNA in the co-translational formation of a eukaryotic 5S ribonucleoprotein complex

    OpenAIRE

    Lin, Elong; Lin, Sue-Wen; Lin, Alan

    2001-01-01

    The eukaryotic ribosomal 5S RNA–protein complex (5S rRNP) is formed by a co-translational event that requires 5S rRNA binding to the nascent peptide chain of eukaryotic ribosomal protein L5. Binding between 5S rRNA and the nascent chain is specific: neither the 5S rRNA nor the nascent chain of L5 protein can be substituted by other RNAs or other ribosomal proteins. The region responsible for binding 5S rRNA is located at positions 35–50 with amino acid sequence RLV...

  7. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    Science.gov (United States)

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  8. Karyotyping and in situ chromosomal localization of rDNA sites in black cumin Bunium persicum (Boiss B. Fedtsch,1915 (Apiaceae

    Directory of Open Access Journals (Sweden)

    R. K. Chahota

    2011-11-01

    Full Text Available The fluorescent in situ hybridization (FISH technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes. The bicolour FISH technique involving 18S-5.8S-26S and 5S ribosomal RNA genes as probes was used to assign physical localization and measurement of rDNA sites on homologous pairs of chromosomes. The two 18S-5.8S-26S rRNA gene sites were at the terminal regions of the short arms of the chromosomes 1 and 2 involving NOR region of chromosome 1. The 5S rDNA sites were found on subtelomeric region of the long arm of the chromosome number 5 and at interstitial regions of the short arm of chromosome 7. Based on direct visual analysis of chromosome length, morphology and position of FISH signals, a pioneer attempt has been made to construct metaphase karyotype in B. persicum, an endangered medicinal plant of North Western Himalayas.

  9. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA in the fish Prochilodus lineatus (Characiformes, Prochilodontidae

    Directory of Open Access Journals (Sweden)

    Marcelo Ricardo Vicari

    2006-01-01

    Full Text Available We used differential staining techniques (BSG, GTG, AgNO3, DAPI and CMA3 banding and fluorescent in situ hybridization (FISH with 5S and 18S probes to investigated the karyotypic and cytogenetic chracteristics of Prochilodus lineatus specimens from a population in Vila Velha state park (Parque Estadual de Vila Velha, Ponta Grossa, Paraná state, southern Brazil. The specimens studied showed the same karyotype as that found in other P. lineatus populations, i.e. 2n = 54 biarmed chromosomes (40m + 14 sm and c-positive heterochromatin preferentially located pericentromerically in all chromosomes. The presence of partial or totally heterochromatic supernumerary chromosomes with numeric intra-individual variation was confirmed in the analyzed population. The nucleolar organizing regions (NORs were interstitially situated on the long arm of chromosome pair 4 directly beneath the centromere. The differential banding techniques and FISH revealed NOR size polymorphism due to structural events such as breaks and duplication of the larger rDNA site cluster. We also observed syntenic localization of the 5S ribosomal genes in the distal segment of the 45S cluster.

  10. Targeting of the human F8 at the multicopy rDNA locus in Hemophilia A patient-derived iPSCs using TALENickases.

    Science.gov (United States)

    Pang, Jialun; Wu, Yong; Li, Zhuo; Hu, Zhiqing; Wang, Xiaolin; Hu, Xuyun; Wang, Xiaoyan; Liu, Xionghao; Zhou, Miaojin; Liu, Bo; Wang, Yanchi; Feng, Mai; Liang, Desheng

    2016-03-25

    Hemophilia A (HA) is a monogenic disease due to lack of the clotting factor VIII (FVIII). This deficiency may lead to spontaneous joint hemorrhages or life-threatening bleeding but there is no cure for HA until very recently. In this study, we derived induced pluripotent stem cells (iPSCs) from patients with severe HA and used transcription activator-like effector nickases (TALENickases) to target the factor VIII gene (F8) at the multicopy ribosomal DNA (rDNA) locus in HA-iPSCs, aiming to rescue the shortage of FVIII protein. The results revealed that more than one copy of the exogenous F8 could be integrated into the rDNA locus. Importantly, we detected exogenous F8 mRNA and FVIII protein in targeted HA-iPSCs. After they were differentiated into endothelial cells (ECs), the exogenous FVIII protein was still detectable. Thus, it is showed that the multicopy rDNA locus could be utilized as an effective target site in patient-derived iPSCs for gene therapy. This strategy provides a novel iPSCs-based therapeutic option for HA and other monogenic diseases. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. The RNA polymerase I transcription machinery.

    Science.gov (United States)

    Russell, Jackie; Zomerdijk, Joost C B M

    2006-01-01

    The rRNAs constitute the catalytic and structural components of the ribosome, the protein synthesis machinery of cells. The level of rRNA synthesis, mediated by Pol I (RNA polymerase I), therefore has a major impact on the life and destiny of a cell. In order to elucidate how cells achieve the stringent control of Pol I transcription, matching the supply of rRNA to demand under different cellular growth conditions, it is essential to understand the components and mechanics of the Pol I transcription machinery. In this review, we discuss: (i) the molecular composition and functions of the Pol I enzyme complex and the two main Pol I transcription factors, SL1 (selectivity factor 1) and UBF (upstream binding factor); (ii) the interplay between these factors during pre-initiation complex formation at the rDNA promoter in mammalian cells; and (iii) the cellular control of the Pol I transcription machinery.

  12. Chromosome mapping of 5S rRNA genes differentiates Brazilian populations of Leporellus vittatus (Anostomidae, Characiformes

    Directory of Open Access Journals (Sweden)

    Cecilia Teixeira de Aguilar

    2008-01-01

    Full Text Available Among the anostomid fishes, the genus Leporellus is represented by only three species: L. nattereri, endemic of the Amazon River, L. retropinnis, endemic of the Piracicaba River, and L. vittatus, widely distributed in rivers from Peru, Colombia, Guianas, and different major hydrographic basins of Brazil. A cytogenetic study carried out on specimens of Leporellus vittatus from three major Brazilian hydrographic basins evidenced a karyotype of 54 metacentric and submetacentric chromosomes. C-banding analysis revealed the presence of large pericentromeric heterochromatic segments in all chromosomes and a telomeric block coincident with the NOR sites. Ag, CMA3 or MM staining, and FISH with ribosomal probes located the 45S ribosomal genes on the terminal region of the long arm of the 12th chromosome pair of all populations. Nevertheless, in the specimens from the Paraná and São Francisco Basins the 5S rDNA clusters were interstitially located by FISH on the long arm of the 2nd chromosome pair, while in the specimens from the Tocantins-Araguaia Basin these sites were observed on the long arm of the 9th chromosome pair and on the short arm of the 17th chromosome pair. These data suggest that the species currently named Leporellus vittatus may comprise a complex of cryptic species.

  13. Inheritance of the group I rDNA intron in Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1992-01-01

    . In an analysis of vegetatively growing cells containing intron+ and intron- rDNA, initially in the same macronucleus, we similarly find no evidence of intron homing. During the course of this work, we observed to our surprise that progeny clones from some crosses contained three types of rDNA. One possible...... explanation is that T. pigmentosa has two rdn loci in contrast to the single locus found in T. thermophila. Some of the progeny clones from the genetic analysis were expanded for several hundred generations, and allelic assortment of the rDNA was demonstrated by subcloning analysis....

  14. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    Science.gov (United States)

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  15. Basic Mechanisms in RNA Polymerase I Transcription of the Ribosomal RNA Genes

    Science.gov (United States)

    Goodfellow, Sarah J.; Zomerdijk, Joost C. B. M.

    2013-01-01

    RNA Polymerase (Pol) I produces ribosomal (r)RNA, an essential component of the cellular protein synthetic machinery that drives cell growth, underlying many fundamental cellular processes. Extensive research into the mechanisms governing transcription by Pol I has revealed an intricate set of control mechanisms impinging upon rRNA production. Pol I-specific transcription factors guide Pol I to the rDNA promoter and contribute to multiple rounds of transcription initiation, promoter escape, elongation and termination. In addition, many accessory factors are now known to assist at each stage of this transcription cycle, some of which allow the integration of transcriptional activity with metabolic demands. The organisation and accessibility of rDNA chromatin also impinge upon Pol I output, and complex mechanisms ensure the appropriate maintenance of the epigenetic state of the nucleolar genome and its effective transcription by Pol I. The following review presents our current understanding of the components of the Pol I transcription machinery, their functions and regulation by associated factors, and the mechanisms operating to ensure the proper transcription of rDNA chromatin. The importance of such stringent control is demonstrated by the fact that deregulated Pol I transcription is a feature of cancer and other disorders characterised by abnormal translational capacity. PMID:23150253

  16. Applications of inter simple sequence repeat (ISSR) rDNA in ...

    African Journals Online (AJOL)

    Applications of inter simple sequence repeat (ISSR) rDNA in detecting ... and phylogenetic relationships between Lymnaea natalensis collected from Giza, ... in water samples of all tested governorates with different significant differences.

  17. Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.

    Science.gov (United States)

    Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua

    2004-01-01

    In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae.

  18. Effects of altered gravity on a distribution of rDNA and nucleolar proteins and the expression of nucleolar proteins in plants

    Science.gov (United States)

    Sobol, Margaryta; Kordyum, Elizabeth; Medina, Francisco Javier

    The nucleolus is an inner nuclear organelle originated from the activity of hundreds of rRNA genes, typically spanning several megabases. It morphologically reflects the functional events leading to ribosome biogenesis, from the transcription of rDNA through the processing of nascent pre-rRNA to the assembly of pre-ribosomes. A typical nucleolus consists of three major elements, namely fibrillar centers (FCs), the dense fibrillar component (DFC), and granular component (GC). The rate of ribosome biosynthesis and the subnucleolar structure are reliable monitors of the general level of cell metabolism and, consequently, of the rate of cellular growth, being influenced with many external factors, among which altered gravity could be included. Thus, we can hypothesize that the structural organization of the nucleolar subcomponents and the level, distribution and quantitative/qualitative characteristics of the nucleolar proteins would be changed under conditions of altered gravity. To confirm our hypothesis, we applied parallel procedures, such as cytochemistry, immunofluorescence, confocal laser microscopy, immunogold electron microscopy, monoand bi-dimensional electrophoresis and immunoblotting in root meristematic cells from two-day cress seedlings grown under slow horizontal clinorotation (2 rpm) and in stationary control. The complex model of the ultrastructural organization and functions of the nucleolus was created based on the location of rDNA and the nucleolar proteins fibrillarin, NhL90 and NhL68, these latter being cress nucleolin homologues. The principal stages of ribosome biogenesis, namely ribosomal gene activation, rDNA transcription and pre-rRNA processing were reflected in this model. Compared to the pattern shown in control ground gravity conditions, we found firstly a redistribution of both rDNA and nucleolar proteins in nucleolar subcomponents, induced by clinorotation. Under the conditions of altered gravity, nucleolar DNA concentrated

  19. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p)3P2 - (5s4d)3D2 transition

    CERN Document Server

    Mickelson, P G; Anzel, P; DeSalvo, B J; Nagel, S B; Traverso, A J; Yan, M; Killian, T C

    2009-01-01

    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p)3P2 - (5s4d)3D2 transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p)3P2 dark state are repumped back into the (5s2)1S0 ground state. Spectroscopy of 84Sr, 86Sr, 87Sr, and 88Sr improves the value of the (5s5p)3P2 - (5s4d)3D2 transition frequency for 88Sr and determines the isotope shifts for the transition.

  20. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p)3P2-(5s4d)3D2 transition

    Science.gov (United States)

    Mickelson, P. G.; Martinez de Escobar, Y. N.; Anzel, P.; De Salvo, B. J.; Nagel, S. B.; Traverso, A. J.; Yan, M.; Killian, T. C.

    2009-12-01

    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p)3P2-(5s4d)3D2 transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p)3P2 dark state are repumped back into the (5s2)1S0 ground state. Spectroscopy of 84Sr, 86Sr, 87Sr and 88Sr improves the value of the (5s5p)3P2-(5s4d)3D2 transition frequency and determines the isotope shifts for the transition accurately enough to guide laser-cooling experiments with less abundant isotopes.

  1. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

    Directory of Open Access Journals (Sweden)

    Stern David B

    2010-09-01

    Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  2. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth.

    Science.gov (United States)

    Hotto, Amber M; Huston, Zoe E; Stern, David B

    2010-09-29

    The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs) in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. AS5-overexpressing (AS5ox) plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT) and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  3. Fluorescent in situ hybridization of the ribosomal RNA genes (5S and 35S in the genus Lolium: Lolium canariense, the missing link with Festuca?

    Directory of Open Access Journals (Sweden)

    Inda, Luis A.

    2013-06-01

    Full Text Available Two groups of taxa can be distinguished within the genus Lolium L. based on the pollination system, chromosome size, chromosomal location of nrDNA (5S and 35S (18S-5.8S-26S] and nrDNA phylogeny. The first group includes self-pollinated taxa (L. temulentum, L. persicum and L. remotum, whereas the second group comprises cross-pollinated species (L. perenne, L. multiflorum and L. rigidum. Here we describe that the autogamous species have two 5S sites and four 35S sites in their genome. Two of the 35S sites are present in the chromosomes containing the 5S regions. The allogamous taxa possess two 5S rDNA sites and 6-10 35S sites per genome, depending on the species. Two of these regions (35S may also be present in the chromosomes bearing 5S sites. Our study also demonstrates that Lolium canariense shows a distinctive pattern. It has two 5S and four 35S sites. In this case, the 35S loci are located in different chromosomes than the 5S. This cytogenetic pattern is consistent with that of Festuca pratensis. Thus, despite being allogamous, Lolium canariense does not entirely fit in either of the groups defined for the genus Lolium. The physical mapping of the nrDNA regions in L. canariense is different, and resembles that of F. pratensis, suggesting that this Macaronesian Lolium could be intermediate between Festuca and Lolium.En trabajos previos se ha descrito que el género Lolium L. está formado por dos grupos de taxones basados en el tipo de polinización, tamaño de los cromosomas, localización cromosómica de los loci del ADN ribosómico [5S y 35S (18S-5.8S-26S] y filogenia molecular basada en secuencias de ADN ribosómico. Los dos grupos son: especies autógamas (L. temulentum, L. persicum y L. remotum y especies alógamas (L. perenne, L. multiflorum y L. rigidum. Aquí describimos que según la localización cromosómica de los loci ribosómicos, las especies autógamas tienen dos sitios 5S y cuatro sitios 35S; dos de las cuales coinciden en

  4. Characterization of copy numbers of 16S rDNA and 16S rRNA of Candidatus Liberibacter asiaticus and the implication in detection in planta using quantitative PCR

    Directory of Open Access Journals (Sweden)

    Wang Nian

    2009-03-01

    Full Text Available Abstract Background Citrus Huanglongbing (HLB is one of the most devastating diseases on citrus and is associated with Candidatus Liberibacter spp.. The pathogens are phloem limited and have not been cultured in vitro. The current management strategy of HLB is to remove infected citrus trees and reduce psyllid populations with insecticides to prevent the spreading. This strategy requires sensitive and reliable diagnostic methods for early detection. Results We investigated the copy numbers of the 16S rDNA and 16S rRNA of the HLB pathogen and the implication of improving the diagnosis of HLB for early detection using Quantitative PCR. We compared the detection of HLB with different Quantitative PCR based methods with primers/probe targeting either 16S rDNA, beta-operon DNA, 16S rRNA, or beta-operon RNA. The 16S rDNA copy number of Ca. Liberibacter asiaticus was estimated to be three times of that of the beta-operon region, thus allowing detection of lower titer of Ca. L. asiaticus. Quantitative reverse transcriptional PCR (QRT-PCR indicated that the 16S rRNA averaged 7.83 times more than that of 16S rDNA for the same samples. Dilution analysis also indicates that QRT-PCR targeting 16S rRNA is 10 time more sensitive than QPCR targeting 16S rDNA. Thus QRT-PCR was able to increase the sensitivity of detection by targeting 16S rRNA. Conclusion Our result indicates that Candidatus Liberibacter asiaticus contains three copies of 16S rDNA. The copy number of 16S rRNA of Ca. L. asiaticus in planta averaged about 7.8 times of 16S rDNA for the same set of samples tested in this study. Detection sensitivity of HLB could be improved through the following approaches: using 16S rDNA based primers/probe in the QPCR assays; and using QRT-PCR assays targeting 16S rRNA.

  5. Copy number of the transposon, Pokey, in rDNA is positively correlated with rDNA copy number in Daphnia obtuse [corrected].

    Directory of Open Access Journals (Sweden)

    Kaitlynn LeRiche

    Full Text Available Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼ 87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species.

  6. Molecular phylogeny and barcoding of Caulerpa (Bryopsidales based on the tufA, rbcL, 18S rDNA and ITS rDNA genes.

    Directory of Open Access Journals (Sweden)

    Mudassar Anisoddin Kazi

    Full Text Available The biodiversity assessment of different taxa of the genus Caulerpa is of interest from the context of morphological plasticity, invasive potential of some species and biotechnological and pharmacological applications. The present study investigated the identification and molecular phylogeny of different species of Caulerpa occurring along the Indian coast inferred from tufA, rbcL, 18S rDNA and ITS rDNA nucleotide sequences. Molecular data confirmed the identification of 10 distinct Caulerpa species: C. veravalensis, C. verticillata, C. racemosa, C. microphysa, C. taxifolia, C. sertularioides, C. scalpelliformis, C. serrulata, C. peltata and C. mexicana. All datasets significantly supported the sister relationship between C. veravalensis and C. racemosa var. cylindracea. It was also concluded from the results that the specimen identified previously as C. microphysa and C. lentillifera could not be considered as separate species. The molecular data revealed the presence of multiple lineages for C. racemosa which can be resolved into separate species. All four markers were used to ascertain their utility for DNA barcoding. The tufA gene proved a better marker with monophyletic association as the main criteria for identification at the species level. The results also support the use of 18S rDNA insertion sequences to delineate the Caulerpa species through character-based barcoding. The ITS rDNA (5.8S-ITS2 phylogenetic analysis also served as another supporting tool. Further, more sequences from additional Caulerpa specimens will need to be analysed in order to support the role of these two markers (ITS rDNA and 18S insertion sequence in identification of Caulerpa species. The present study revealed the phylogeny of Caulerpa as complete as possible using the currently available data, which is the first comprehensive report illustrating the molecular phylogeny and barcoding of the genus Caulerpa from Indian waters.

  7. Molecular phylogeny and barcoding of Caulerpa (Bryopsidales) based on the tufA, rbcL, 18S rDNA and ITS rDNA genes.

    Science.gov (United States)

    Kazi, Mudassar Anisoddin; Reddy, C R K; Jha, Bhavanath

    2013-01-01

    The biodiversity assessment of different taxa of the genus Caulerpa is of interest from the context of morphological plasticity, invasive potential of some species and biotechnological and pharmacological applications. The present study investigated the identification and molecular phylogeny of different species of Caulerpa occurring along the Indian coast inferred from tufA, rbcL, 18S rDNA and ITS rDNA nucleotide sequences. Molecular data confirmed the identification of 10 distinct Caulerpa species: C. veravalensis, C. verticillata, C. racemosa, C. microphysa, C. taxifolia, C. sertularioides, C. scalpelliformis, C. serrulata, C. peltata and C. mexicana. All datasets significantly supported the sister relationship between C. veravalensis and C. racemosa var. cylindracea. It was also concluded from the results that the specimen identified previously as C. microphysa and C. lentillifera could not be considered as separate species. The molecular data revealed the presence of multiple lineages for C. racemosa which can be resolved into separate species. All four markers were used to ascertain their utility for DNA barcoding. The tufA gene proved a better marker with monophyletic association as the main criteria for identification at the species level. The results also support the use of 18S rDNA insertion sequences to delineate the Caulerpa species through character-based barcoding. The ITS rDNA (5.8S-ITS2) phylogenetic analysis also served as another supporting tool. Further, more sequences from additional Caulerpa specimens will need to be analysed in order to support the role of these two markers (ITS rDNA and 18S insertion sequence) in identification of Caulerpa species. The present study revealed the phylogeny of Caulerpa as complete as possible using the currently available data, which is the first comprehensive report illustrating the molecular phylogeny and barcoding of the genus Caulerpa from Indian waters.

  8. An unusual 5S rRNA, from Sulfolobus acidocaldarius, and its implications for a general 5S rRNA structure.

    OpenAIRE

    Stahl, D A; Luehrsen, K R; Woese, C R; Pace, N R

    1981-01-01

    The nucleotide sequence of the 5S ribosomal RNA of the thermoacidophilic archaebacterium Sulfolobus acidocaldarius was determined. The high degree of evident secondary structure in the molecule has implications for the common higher order structure of other 5S rRNAs, both bacterial and eukaryotic.

  9. An unusual 5S rRNA, from Sulfolobus acidocaldarius, and its implications for a general 5S rRNA structure.

    OpenAIRE

    Stahl, D A; Luehrsen, K R; Woese, C R; Pace, N R

    1981-01-01

    The nucleotide sequence of the 5S ribosomal RNA of the thermoacidophilic archaebacterium Sulfolobus acidocaldarius was determined. The high degree of evident secondary structure in the molecule has implications for the common higher order structure of other 5S rRNAs, both bacterial and eukaryotic.

  10. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  11. Implementation Of 5S Methodology In The Small Scale Industry A Case Study

    National Research Council Canada - National Science Library

    R. S. Agrahari; P.A. Dangle; K.V.Chandratre

    2015-01-01

    .... This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping...

  12. Implementation Of 5S Methodology In The Small Scale Industry A Case Study

    OpenAIRE

    R. S. Agrahari; P.A. Dangle; K.V.Chandratre

    2015-01-01

    Abstract 5S is a basic foundation of Lean Manufacturing systems. It is a tool for cleaning sorting organizing and providing the necessary groundwork for workpiece improvement. This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping. The improvements before and after 5S implementation is shown by pictures in the paper. It also intends to build a s...

  13. Results and prospects for Y(5S) running at B-factories

    OpenAIRE

    Drutskoy, A.

    2008-01-01

    Recent results and future prospects for Y(5S) running at B-factories are discussed. The first Belle measurements with 23.6 fb-1 of data taken at the Y(5S) energy are reported. Eligibility of potential measurements expected with 100 fb-1 and 1000 fb-1 of data at the Y(5S) is estimated.

  14. Budding Yeast Rif1 Controls Genome Integrity by Inhibiting rDNA Replication.

    Science.gov (United States)

    Shyian, Maksym; Mattarocci, Stefano; Albert, Benjamin; Hafner, Lukas; Lezaja, Aleksandra; Costanzo, Michael; Boone, Charlie; Shore, David

    2016-11-01

    The Rif1 protein is a negative regulator of DNA replication initiation in eukaryotes. Here we show that budding yeast Rif1 inhibits DNA replication initiation at the rDNA locus. Absence of Rif1, or disruption of its interaction with PP1/Glc7 phosphatase, leads to more intensive rDNA replication. The effect of Rif1-Glc7 on rDNA replication is similar to that of the Sir2 deacetylase, and the two would appear to act in the same pathway, since the rif1Δ sir2Δ double mutant shows no further increase in rDNA replication. Loss of Rif1-Glc7 activity is also accompanied by an increase in rDNA repeat instability that again is not additive with the effect of sir2Δ. We find, in addition, that the viability of rif1Δ cells is severely compromised in combination with disruption of the MRX or Ctf4-Mms22 complexes, both of which are implicated in stabilization of stalled replication forks. Significantly, we show that removal of the rDNA replication fork barrier (RFB) protein Fob1, alleviation of replisome pausing by deletion of the Tof1/Csm3 complex, or a large deletion of the rDNA repeat array all rescue this synthetic growth defect of rif1Δ cells lacking in addition either MRX or Ctf4-Mms22 activity. These data suggest that the repression of origin activation by Rif1-Glc7 is important to avoid the deleterious accumulation of stalled replication forks at the rDNA RFB, which become lethal when fork stability is compromised. Finally, we show that Rif1-Glc7, unlike Sir2, has an important effect on origin firing outside of the rDNA locus that serves to prevent activation of the DNA replication checkpoint. Our results thus provide insights into a mechanism of replication control within a large repetitive chromosomal domain and its importance for the maintenance of genome stability. These findings may have important implications for metazoans, where large blocks of repetitive sequences are much more common.

  15. Budding Yeast Rif1 Controls Genome Integrity by Inhibiting rDNA Replication.

    Directory of Open Access Journals (Sweden)

    Maksym Shyian

    2016-11-01

    Full Text Available The Rif1 protein is a negative regulator of DNA replication initiation in eukaryotes. Here we show that budding yeast Rif1 inhibits DNA replication initiation at the rDNA locus. Absence of Rif1, or disruption of its interaction with PP1/Glc7 phosphatase, leads to more intensive rDNA replication. The effect of Rif1-Glc7 on rDNA replication is similar to that of the Sir2 deacetylase, and the two would appear to act in the same pathway, since the rif1Δ sir2Δ double mutant shows no further increase in rDNA replication. Loss of Rif1-Glc7 activity is also accompanied by an increase in rDNA repeat instability that again is not additive with the effect of sir2Δ. We find, in addition, that the viability of rif1Δ cells is severely compromised in combination with disruption of the MRX or Ctf4-Mms22 complexes, both of which are implicated in stabilization of stalled replication forks. Significantly, we show that removal of the rDNA replication fork barrier (RFB protein Fob1, alleviation of replisome pausing by deletion of the Tof1/Csm3 complex, or a large deletion of the rDNA repeat array all rescue this synthetic growth defect of rif1Δ cells lacking in addition either MRX or Ctf4-Mms22 activity. These data suggest that the repression of origin activation by Rif1-Glc7 is important to avoid the deleterious accumulation of stalled replication forks at the rDNA RFB, which become lethal when fork stability is compromised. Finally, we show that Rif1-Glc7, unlike Sir2, has an important effect on origin firing outside of the rDNA locus that serves to prevent activation of the DNA replication checkpoint. Our results thus provide insights into a mechanism of replication control within a large repetitive chromosomal domain and its importance for the maintenance of genome stability. These findings may have important implications for metazoans, where large blocks of repetitive sequences are much more common.

  16. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  17. Visual analysis of the yeast 5S rRNA gene transcriptome: regulation and role of La protein.

    Science.gov (United States)

    French, Sarah L; Osheim, Yvonne N; Schneider, David A; Sikes, Martha L; Fernandez, Cesar F; Copela, Laura A; Misra, Vikram A; Nomura, Masayasu; Wolin, Sandra L; Beyer, Ann L

    2008-07-01

    5S rRNA genes from Saccharomyces cerevisiae were examined by Miller chromatin spreading, representing the first quantitative analysis of RNA polymerase III genes in situ by electron microscopy. These very short genes, approximately 132 nucleotides (nt), were engaged by one to three RNA polymerases. Analysis in different growth conditions and in strains with a fourfold range in gene copy number revealed regulation at two levels: number of active genes and polymerase loading per gene. Repressive growth conditions (presence of rapamycin or postexponential growth) led first to fewer active genes, followed by lower polymerase loading per active gene. The polymerase III elongation rate was estimated to be in the range of 60 to 75 nt/s, with a reinitiation interval of approximately 1.2 s. The yeast La protein, Lhp1, was associated with 5S genes. Its absence had no discernible effect on the amount or size of 5S RNA produced yet resulted in more polymerases per gene on average, consistent with a non-rate-limiting role for Lhp1 in a process such as polymerase release/recycling upon transcription termination.

  18. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

    Science.gov (United States)

    Kamina, Anyango D; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  19. Toxicity analysis of pesticides on cyanobacterial species by 16S rDNA molecular characterization

    Directory of Open Access Journals (Sweden)

    J. I. Nirmal Kumar

    2013-06-01

    Full Text Available Damaging effects of endosulfan on native structure of DNA, evident as a result of PCR based assay such as 16S rDNA amplification and sequencing, led to formation of gaps, mismatching of base pairs and dissimilarities in entire 16S rDNA sequences of treated cultures. Endosulfan was the most fatal to Westiellopsis prolifica of 16S rDNA region at 40ppm insecticide induced series of mispairing, and other lesions amounting up to 20% dissimilarity and 7% gaps. Whereas, 16S rDNA region of Anabaena fertilissima was comparatively less influenced with 18% dissimilarity and 7% gaps in response to 12ppm endosulfan, while 16S rDNA gene of Aulosira fertilissima was the least prone to changes with 17% dissimilarity, and 5% gaps under 60ppm endosulfan stress by the end of 16 days. On the other side, impact of fungicide tebuconazole after 16 days reflected identities up to 78% and 8% gaps for 30ppm treated A. fertilissima, while 60ppm treatment instilled 79% similarities with 10% gaps in W. prolifica and 83% identities with 5% gaps of Aulosira fertilissima after 16 days.

  20. Unexpected accumulation of ncm(5U and ncm(5S(2 (U in a trm9 mutant suggests an additional step in the synthesis of mcm(5U and mcm(5S(2U.

    Directory of Open Access Journals (Sweden)

    Changchun Chen

    Full Text Available BACKGROUND: Transfer RNAs are synthesized as a primary transcript that is processed to produce a mature tRNA. As part of the maturation process, a subset of the nucleosides are modified. Modifications in the anticodon region often modulate the decoding ability of the tRNA. At position 34, the majority of yeast cytosolic tRNA species that have a uridine are modified to 5-carbamoylmethyluridine (ncm(5U, 5-carbamoylmethyl-2'-O-methyluridine (ncm(5Um, 5-methoxycarbonylmethyl-uridine (mcm(5U or 5-methoxycarbonylmethyl-2-thiouridine (mcm(5s(2U. The formation of mcm(5 and ncm(5 side chains involves a complex pathway, where the last step in formation of mcm(5 is a methyl esterification of cm(5 dependent on the Trm9 and Trm112 proteins. METHODOLOGY AND PRINCIPAL FINDINGS: Both Trm9 and Trm112 are required for the last step in formation of mcm(5 side chains at wobble uridines. By co-expressing a histidine-tagged Trm9p together with a native Trm112p in E. coli, these two proteins purified as a complex. The presence of Trm112p dramatically improves the methyltransferase activity of Trm9p in vitro. Single tRNA species that normally contain mcm(5U or mcm(5s(2U nucleosides were isolated from trm9Δ or trm112Δ mutants and the presence of modified nucleosides was analyzed by HPLC. In both mutants, mcm(5U and mcm(5s(2U nucleosides are absent in tRNAs and the major intermediates accumulating were ncm(5U and ncm(5s(2U, not the expected cm(5U and cm(5s(2U. CONCLUSIONS: Trm9p and Trm112p function together at the final step in formation of mcm(5U in tRNA by using the intermediate cm(5U as a substrate. In tRNA isolated from trm9Δ and trm112Δ strains, ncm(5U and ncm(5s(2U nucleosides accumulate, questioning the order of nucleoside intermediate formation of the mcm(5 side chain. We propose two alternative explanations for this observation. One is that the intermediate cm(5U is generated from ncm(5U by a yet unknown mechanism and the other is that cm(5U is formed

  1. Reduced rDNA Copy Number Does Not Affect “Competitive” Chromosome Pairing in XYY Males of Drosophila melanogaster

    OpenAIRE

    Keith A. Maggert

    2014-01-01

    The ribosomal DNA (rDNA) arrays are causal agents in X-Y chromosome pairing in meiosis I of Drosophila males. Despite broad variation in X-linked and Y-linked rDNA copy number, polymorphisms in regulatory/spacer sequences between rRNA genes, and variance in copy number of interrupting R1 and R2 retrotransposable elements, there is little evidence that different rDNA arrays affect pairing efficacy. I investigated whether induced rDNA copy number polymorphisms affect chromosome pairing in a “co...

  2. Molecular Detection of Toxoplasmosis Using Specific Primers P30, B1, and rDNA

    Directory of Open Access Journals (Sweden)

    Wisnu Nurcahyo

    2014-04-01

    Full Text Available Study in order to develop molecular techniques using specific primers for the early diagnosis oftoxoplasmosis have been conducted. Detection of Toxoplasma gondii genome was performed usingpolymerase chain reaction (PCR technique. The primers used in this study were rDNA, P30, and B1. ThePCR products were further run using gel electrophoresis (gel 1.5% – 2.0% and the band was documented.Toxoplasma was detected at 500 bp and 600 bp using primer P30 and B1, respectively. Whereas usingprimer rDNA no band was observed. It was assumed that primer rDNA was not sensitive since the targetamplification was 88 bp.

  3. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    Science.gov (United States)

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  4. Transcription factories

    Science.gov (United States)

    Rieder, Dietmar; Trajanoski, Zlatko; McNally, James G.

    2012-01-01

    There is considerable evidence that transcription does not occur homogeneously or diffusely throughout the nucleus, but rather at a number of specialized, discrete sites termed transcription factories. The factories are composed of ~4–30 RNA polymerase molecules, and are associated with many other molecules involved in transcriptional activation and mRNA processing. Some data suggest that the polymerase molecules within a factory remain stationary relative to the transcribed DNA, which is thought to be reeled through the factory site. There is also some evidence that transcription factories could help organize chromatin and nuclear structure, contributing to both the formation of chromatin loops and the clustering of active and co-regulated genes. PMID:23109938

  5. Dead element replicating: degenerate R2 element replication and rDNA genomic turnover in the Bacillus rossius stick insect (Insecta: Phasmida.

    Directory of Open Access Journals (Sweden)

    Francesco Martoni

    Full Text Available R2 is an extensively investigated non-LTR retrotransposon that specifically inserts into the 28S rRNA gene sequences of a wide range of metazoans, disrupting its functionality. During R2 integration, first strand synthesis can be incomplete so that 5' end deleted copies are occasionally inserted. While active R2 copies repopulate the locus by retrotransposing, the non-functional truncated elements should frequently be eliminated by molecular drive processes leading to the concerted evolution of the rDNA array(s. Although, multiple R2 lineages have been discovered in the genome of many animals, the rDNA of the stick insect Bacillus rossius exhibits a peculiar situation: it harbors both a canonical, functional R2 element (R2Brfun as well as a full-length but degenerate element (R2Brdeg. An intensive sequencing survey in the present study reveals that all truncated variants in stick insects are present in multiple copies suggesting they were duplicated by unequal recombination. Sequencing results also demonstrate that all R2Brdeg copies are full-length, i. e. they have no associated 5' end deletions, and functional assays indicate they have lost the active ribozyme necessary for R2 RNA maturation. Although it cannot be completely ruled out, it seems unlikely that the degenerate elements replicate via reverse transcription, exploiting the R2Brfun element enzymatic machinery, but rather via genomic amplification of inserted 28S by unequal recombination. That inactive copies (both R2Brdeg or 5'-truncated elements are not eliminated in a short term in stick insects contrasts with findings for the Drosophila R2, suggesting a widely different management of rDNA loci and a lower efficiency of the molecular drive while achieving the concerted evolution.

  6. Chromosomal mapping of rDNAs and H3 histone sequences in the grasshopper rhammatocerus brasiliensis (acrididae, gomphocerinae: extensive chromosomal dispersion and co-localization of 5S rDNA/H3 histone clusters in the A complement and B chromosome

    Directory of Open Access Journals (Sweden)

    Oliveira Nathalia L

    2011-11-01

    Full Text Available Abstract Background Supernumerary B chromosomes occur in addition to standard karyotype and have been described in about 15% of eukaryotes, being the repetitive DNAs the major component of these chromosomes, including in some cases the presence of multigene families. To advance in the understanding of chromosomal organization of multigene families and B chromosome structure and evolution, the distribution of rRNA and H3 histone genes were analyzed in the standard karyotype and B chromosome of three populations of the grasshopper Rhammatocerus brasiliensis. Results The location of major rDNA was coincident with the previous analysis for this species. On the other hand, the 5S rDNA mapped in almost all chromosomes of the standard complement (except in the pair 11 and in the B chromosome, showing a distinct result from other populations previously analyzed. Besides the spreading of 5S rDNA in the genome of R. brasiliensis it was also observed multiple sites for H3 histone genes, being located in the same chromosomal regions of 5S rDNAs, including the presence of the H3 gene in the B chromosome. Conclusions Due to the intense spreading of 5S rRNA and H3 histone genes in the genome of R. brasiliensis, their chromosomal distribution was not informative in the clarification of the origin of B elements. Our results indicate a linked organization for the 5S rRNA and H3 histone multigene families investigated in R. brasiliensis, reinforcing previous data concerning the association of both genes in some insect groups. The present findings contribute to understanding the organization/evolution of multigene families in the insect genomes.

  7. Achieve Sustainable Hospital Excellence Through 5-S in an Emergency Department in Hong Kong

    Directory of Open Access Journals (Sweden)

    Tsoi Vincent F. K.

    2014-11-01

    Full Text Available 5-S is the first step towards TQM. Over the last century, the Japanese have formalised the technique and named it as 5-S Practice. Since 1993, Sam Ho has improved and defined its terms in English/Chinese and developed the world's first 5-S Audit Checklist. In the article, an emergency department of a Hong Kong hospital was examined against 5-S 50-point Checklist for the improvement of their quality assurance systems towards its accreditation process with Australian standards. The findings evidently reveal that the impact of 5-S on hospital quality assurance in the unit are positive. Riding on the above scenario, the research aim is to identify whether the 5-S practice is a suitable and effective tool for healthcare quality assurance in an emergency setting which is led towards its accreditation process set by other mechanisms.

  8. Formation of diploid and triploid hybrid groupers (hybridization of Epinephelus coioides ♀ × Epinephelus lanceolatus ♂) and their 5S gene analysis.

    Science.gov (United States)

    Huang, Wen; Qin, Qinbo; Yang, Huirong; Li, Shuisheng; Hu, Chaoqun; Wang, Yude; Zhang, Yong; Liu, Shaojun; Lin, Haoran

    2016-10-07

    Interspecies hybridization is widely used to achieve heterosis or hybrid vigor, which has been observed and harnessed by breeders for centuries. Natural allopolyploid hybrids generally exhibit more superior heterosis than both the diploid progenies and their parental species. However, polyploid formation processes have been long ignored, the genetic basis of heterosis in polyploids remains elusive. In the present study, triploid hybrids had been demonstrated to contain two sets of chromosomes from mother species and one set from father species. Cellular polyploidization process in the embryos had been traced. The triploid hybrids might be formed by failure formation of the second polarized genome during the second meiosis stage. Four spindle centers were observed in anaphase stage of the first cell division. Three spindle centers were observed in side of cell plate after the first cell division. The 5S rDNA genes of four types of groupers were cloned and analyzed. The diploid and triploid hybrids had been proved to contain the tandem chimera structures which were recombined by maternal and paternal monomer units. The results indicated that genome re-fusion had occurred in the hybrid progenies. To further elucidate the genetic patterns of diploid and triploid hybrids, fluorescence chromosome location had been carried out, maternal 5S gene (M-386) were used as the probe. The triploid hybrids contained fewer fluorescence loci numbers than the maternal species. The results indicated that participation of paternal 5S gene in the triploid hybrid genome had degraded the match rates of M-386 probe. Our study is the first to investigate the cellular formation processes of natural allopolyploids in hybrid fish, the cellular polyploidization process may be caused by failure formation of the second polarized genome during the meiosis, and our results will provide the molecular basis of hybrid vigor in interspecies hybridization.

  9. Implementation Of 5S Quality Tool In Manufacturing Company A Case Study

    Directory of Open Access Journals (Sweden)

    Vibhor Kakkar

    2015-02-01

    Full Text Available Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivity of the company is enhanced to 91 .

  10. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  11. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    OpenAIRE

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

  12. Identification and chromosomal distribution of 5S rRNA genes in Neurospora crassa.

    OpenAIRE

    Metzenberg, R L; Stevens, J N; Selker, E U; Morzycka-Wroblewska, E

    1985-01-01

    The 5S rRNA genes of Neurospora crassa, unlike those of most organisms, are not tandemly arranged, and they are found imbedded in a variety of unique sequences. The 5S rRNA regions of most of the genes are of one type, alpha; however, several other "isotypes" (beta, gamma, delta, zeta, and eta) are also found. We asked whether Neurospora 5S rRNA genes are dispersed on a chromosomal scale and whether genes of different isotypes are spatially segregated. We identified, by DNA sequencing, 5S rRN...

  13. Implementation Of 5S Methodology In The Small Scale Industry A Case Study

    Directory of Open Access Journals (Sweden)

    R. S. Agrahari

    2015-04-01

    Full Text Available Abstract 5S is a basic foundation of Lean Manufacturing systems. It is a tool for cleaning sorting organizing and providing the necessary groundwork for workpiece improvement. This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping. The improvements before and after 5S implementation is shown by pictures in the paper. It also intends to build a stronger work ethic within the management and workers who would be expected to continue the good practices.

  14. Uniqueness of the Gossypium mustelinum Genome Revealed by GISH and 45S rDNA FISH

    Institute of Scientific and Technical Information of China (English)

    STELLY; David

    2008-01-01

    Gossypium mustelinum [(AD)4] is one of five tetraploid species in Gossypium.Three pairs of nucleolar organizer regions(NOR) in(AD)4 were detected by FISH with 45S rDNA as a probe,they also were observed with genomic DNA(gDNA) from Gossypium D genome species as probes.Of the

  15. Evolutionary pattern of rDNA following polyploidy in Leymus (Triticeae: Poaceae).

    Science.gov (United States)

    Fan, Xing; Liu, Jing; Sha, Li-Na; Sun, Gen-Lou; Hu, Zhi-Qin; Zeng, Jian; Kang, Hou-Yang; Zhang, Hai-Qin; Wang, Yi; Wang, Xiao-Li; Zhang, Li; Ding, Chun-Bang; Yang, Rui-Wu; Zheng, You-Liang; Zhou, Yong-Hong

    2014-08-01

    Ribosomal ITS polymorphism and its ancestral genome origin of polyploid Leymus were examined to infer the evolutionary outcome of rDNA gene following allopolyploid speciation and to elucidate the geographic pattern of ITS variation. The results demonstrated that different polyploids have experienced varying fates, including maintenance or homogenization of divergent arrays, occurrence of chimeric repeats and potential pseudogenes. Our data suggested that (1) the Ns, P/F, and St genomic types in Leymus were originated from Psathyrostachys, Agropyron/Eremopyrum, and Pseudoroegneria, respectively; (2) the occurrence of a higher proportion of Leymus species with predominant uniparental rDNA type might associate with the segmental allopolyploid origin, nucleolar dominance of alloploids, and rapid radiation of Leymus; (3) maintenance of multiple parental ITS types in allopolyploid might result from long generation times associated to vegetative multiplication, number and chromosomal location of ribosomal loci and/or recurrent hybridization; (4) the rDNA genealogical structure of Leymus species might associate with the geographic origins; and (5) ITS sequence clade shared by Leymus species from Central Asia, North America, and Nordic might be an outcome of ancestral ITS homogenization. Our results shed new light on understanding evolutionary outcomes of rDNA following allopolyploid speciation and geographic isolation. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Top2 and Sgs1-Top3 Act Redundantly to Ensure rDNA Replication Termination.

    Directory of Open Access Journals (Sweden)

    Kamilla Mundbjerg

    2015-12-01

    Full Text Available Faithful DNA replication with correct termination is essential for genome stability and transmission of genetic information. Here we have investigated the potential roles of Topoisomerase II (Top2 and the RecQ helicase Sgs1 during late stages of replication. We find that cells lacking Top2 and Sgs1 (or Top3 display two different characteristics during late S/G2 phase, checkpoint activation and accumulation of asymmetric X-structures, which are both independent of homologous recombination. Our data demonstrate that checkpoint activation is caused by a DNA structure formed at the strongest rDNA replication fork barrier (RFB during replication termination, and consistently, checkpoint activation is dependent on the RFB binding protein, Fob1. In contrast, asymmetric X-structures are formed independent of Fob1 at less strong rDNA replication fork barriers. However, both checkpoint activation and formation of asymmetric X-structures are sensitive to conditions, which facilitate fork merging and progression of replication forks through replication fork barriers. Our data are consistent with a redundant role of Top2 and Sgs1 together with Top3 (Sgs1-Top3 in replication fork merging at rDNA barriers. At RFB either Top2 or Sgs1-Top3 is essential to prevent formation of a checkpoint activating DNA structure during termination, but at less strong rDNA barriers absence of the enzymes merely delays replication fork merging, causing an accumulation of asymmetric termination structures, which are solved over time.

  17. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    The extrachromosomal rDNA molecules from a number of Tetrahymena strains were characterized by restriction enzyme mapping using three different restriction enzymes combined with gel blotting and hybridization analysis. Strains from four out of six recently described species were found to contain...

  18. Community structure of arbuscular mycorrhizal fungi in undisturbed vegetation revealed by analyses of LSU rdna sequences

    DEFF Research Database (Denmark)

    Rosendahl, Søren; Holtgrewe-Stukenbrock, Eva

    2004-01-01

    Arbuscular mycorrhizal fungi (AMF) form a mutualistic symbiosis with plant roots and are found in most ecosystems. In this study the community structure of AMF in a clade of the genus Glomus was examined in undisturbed costal grassland using LSU rDNA sequences amplified from roots of Hieracium pi...

  19. Systematics of Penicillium simplicissimum based on rDNA sequences, morphology and secondary metabolites

    DEFF Research Database (Denmark)

    Tuthill, D.E.; Frisvad, Jens Christian; Christensen, M.

    2001-01-01

    supported by differences in micromorphological characters, particularly of the conidia and phialides, and the production of distinct profiles of secondary metabolites by each species. Group-I introns, located in the SSU rDNA, were identified in six of the 21 isolates; their presence was used to test...

  20. The Application of "5S" Activity in Electronic Packaging Industry%"5S"管理在电子封装企业中的应用

    Institute of Scientific and Technical Information of China (English)

    潘慧子; 张志胜; 谭光瑞; 史金飞

    2009-01-01

    从电子封装企业的生产现状出发,针对企业内部管理存在的问题,提出在测试车间推行"5S"管理活动的具体实施步骤.分析实施过程中的关键问题并寻找解决方法,制订"5S"管理5级考核标准.实践结果表明,"5S"管理很好地改善了企业工作环境,提升了员工素质,增强了企业竞争力.

  1. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  2. The 5S lean method as a tool of industrial management performances

    Science.gov (United States)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  3. Maturation of the 5S rRNA 5' end is catalyzed in vitro by the endonuclease tRNase Z in the archaeon H. volcanii.

    Science.gov (United States)

    Hölzle, Annette; Fischer, Susan; Heyer, Ruth; Schütz, Stefanie; Zacharias, Martin; Walther, Paul; Allers, Thorsten; Marchfelder, Anita

    2008-05-01

    Ribosomal RNA molecules are synthesized as precursors that have to undergo several processing steps to generate the functional rRNA. The 5S rRNA in the archaeon Haloferax volcanii is transcribed as part of a multicistronic transcript containing both large rRNAs and one or two tRNAs. Release of the 5S rRNA from the precursor requires two endonucleolytic cleavages by enzymes as yet not identified. Here we report the first identification of an archaeal 5S rRNA processing endonuclease. The enzyme tRNase Z, which was initially identified as tRNA processing enzyme, generates not only tRNA 3' ends but also mature 5S rRNA 5' ends in vitro. Interestingly, the sequence upstream of the 5S rRNA can be folded into a mini-tRNA, which might explain the processing of this RNA by tRNase Z. The endonuclease is active only at low salt concentrations in vitro, which is in contrast to the 2-4 M KCl concentration present inside the cell in vivo. Electron microscopy studies show that there are no compartments inside the Haloferax cell that could provide lower salt environments. Processing of the 5S rRNA 5' end is not restricted to the haloarchaeal tRNase Z since tRNase Z enzymes from a thermophilic archaeon, a lower and a higher eukaryote, are as well able to cleave the tRNA-like structure 5' of the 5S rRNA. Knock out of the tRNase Z gene in Haloferax volcanii is lethal, showing that the protein is essential for the cell.

  4. Polynucleotide Phosphorylase, RNase E/G, and YbeY Are Involved in the Maturation of 4.5S RNA in Corynebacterium glutamicum.

    Science.gov (United States)

    Maeda, Tomoya; Tanaka, Yuya; Wachi, Masaaki; Inui, Masayuki

    2017-03-01

    Corynebacterium glutamicum has been applied for the industrial production of various metabolites, such as amino acids. To understand the biosynthesis of the membrane protein in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP is found in all three domains of life and plays an important role in the membrane insertion of proteins. SRP RNA is initially transcribed as precursor molecules; however, relatively little is known about its maturation. In C. glutamicum, SRP consists of the Ffh protein and 4.5S RNA lacking an Alu domain. In this study, we found that 3'-to-5' exoribonuclease, polynucleotide phosphorylase (PNPase), and two endo-type RNases, RNase E/G and YbeY, are involved in the 3' maturation of 4.5S RNA in C. glutamicum The mature form of 4.5S RNA was inefficiently formed in ΔrneG Δpnp mutant cells, suggesting the existence of an alternative pathway for the 3' maturation of 4.5S RNA. Primer extension analysis also revealed that the 5' mature end of 4.5S RNA corresponds to that of the transcriptional start site. Immunoprecipitated Ffh protein contained immature 4.5S RNA in Δpnp, ΔrneG, and ΔybeY mutants, suggesting that 4.5S RNA precursors can interact with Ffh. These results imply that the maturation of 4.5S RNA can be performed in the 4.5S RNA-Ffh complex.IMPORTANCE Overproduction of a membrane protein, such as a transporter, is useful for engineering of strains of Corynebacterium glutamicum, which is a workhorse of amino acid production. To understand membrane protein biogenesis in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP contains the Ffh protein and SRP RNA and plays an important role in the membrane insertion of proteins. Although SRP RNA is highly conserved among the three domains of life, relatively little is known about its maturation. We show that PNPase, RNase E/G, and YbeY are involved in the 3' maturation of the SRP RNA (4.5S RNA) in this

  5. Cytogenetic mapping of 5S and 18S rRNAs and H3 histone genes in 4 ancient Proscopiidae grasshopper species: contribution to understanding the evolutionary dynamics of multigene families.

    Science.gov (United States)

    Cabral-de-Mello, D C; Martins, C; Souza, M J; Moura, R C

    2011-01-01

    This paper reports on the chromosomal location of 18S rRNA, 5S rRNA and H3 histone multigene families in 4 species of a relatively ancient and diversified group of grasshoppers belonging to the family Proscopiidae. The 5S rRNA and H3 histone genes were highly conserved in the number of sites and chromosomal position in the 4th chromosome pair in all species analyzed, whereas the 18S rRNA genes showed slightly more variation because they were present on one or 2 chromosome pairs, depending on the species. The 5S and 18S rRNA gene families occurred in different chromosomes; in contrast, H3 histone and 5S rRNA genes co-localized in the same chromosomal position, with an apparently interspersed organization. Considering that the Proscopiidae family is a relatively ancient group compared with the Acrididae family, the association of the H3 histone and 5S rRNA multigene families can represent a basal condition for grasshoppers, although more research is needed on other representatives of this insect group to confirm this statement. The presence of such an association of 5S rDNA and H3 histone in mussels and arthropods (beetles, grasshoppers and crustaceans) suggests that this linked configuration could represent an ancestral pattern for invertebrates. These results provide new insights into the understanding of the genome organization and the evolution of multigene families in grasshoppers and in insects as a whole. Copyright © 2010 S. Karger AG, Basel.

  6. Transcription elongation

    Science.gov (United States)

    Imashimizu, Masahiko; Shimamoto, Nobuo; Oshima, Taku; Kashlev, Mikhail

    2014-01-01

    Regulation of transcription elongation via pausing of RNA polymerase has multiple physiological roles. The pausing mechanism depends on the sequence heterogeneity of the DNA being transcribed, as well as on certain interactions of polymerase with specific DNA sequences. In order to describe the mechanism of regulation, we introduce the concept of heterogeneity into the previously proposed alternative models of elongation, power stroke and Brownian ratchet. We also discuss molecular origins and physiological significances of the heterogeneity. PMID:25764114

  7. Measurement of B9Upsilon(5S) to Bs(*) Bs(*)bar Using phi Mesons

    CERN Document Server

    Huang, G; Pavlunin, V; Sanghi, B; Shipsey, I P J; Xin, B; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Insler, J; Muramatsu, H; Park, C S; Thorndike, E H; Yang, F; Coan, T E; Gao, Y S; Liu, F; Artuso, M; Blusk, S; Butt, J; Li, J; Menaa, N; Mountain, R; Nisar, S; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Asner, D M; Edwards, K W; Briere, R A; Brock, I; Chen, J; Ferguson, T; Tatishvili, G T; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Gibbons, L; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Onyisi, P U E; Patterson, J R; Peterson, D; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Stroiney, S; Sun, W M; Wilksen, T; Weinberger, M; Athar, S B; Patel, R; Potlia, V; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Wiss, J; Shepherd, M R; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Poling, R; Scott, A W; Smith, A; Zweber, P; Dobbs, S; Metreveli, Z V; Seth, K K; Tomaradze, A G; Ernst, J; Severini, H; Dytman, S A; Love, W; Savinov, V; Aquines, O; Li, Z; López, A; Mehrabyan, S S; Méndez, H; Ramírez, J; al, et

    2006-01-01

    Knowledge of the Bs decay fraction of the Y(5S) resonance, fs, is important for Bs meson studies at the Y(5S) energy. Using data collected by the CLEO III detector at CESR consisting of 0.423 1/fb on the Y(5S) resonance, 6.34 1/fb on the Y(4S) and 2.32 1/fb in the continuum below the Y(4S), we measure B(Y(5S)-> phi X)=(13.2+/- 0.7 ^{+2.2}_{-1.4})% and B(Y (4S)-> phi X)=(7.1 +/- 0.1 +/- 0.6)%, the ratio of the two rates is (1.9 +/- 0.1 ^{+0.3}_{-0.2}). This is the first measurement of the phi meson yield from the Y(5S). Using these rates, and a model dependent estimate of B(Bs -> phi X), we measure fs=(27.3 +/- 3.2 ^{+14.6}_{-~6.1})%. We update our previous, independent measurement of this branching fraction using the inclusive Ds yields to be (21.8 +/- 3.4 ^{+8.5}_{-4.2})%, due to changes in the $D_s^+ -> phi \\pi^+$ branching fraction and a better estimate of the number of hadronic events. We also report the total Y(5S) hadronic cross section above continuum to be sigma(e^+e^- -> Y(5S))=(0.301 +/- 0.002 +/- 0...

  8. Measurement of B[Y(5S)->Bs(*) anti-Bs(*)] Using phi Mesons

    CERN Document Server

    Huang, G S; Adams, G S; Alexander, J P; Anderson, M; Aquines, O; Artuso, M; Asner, D M; Athar, S B; Berkelman, K; Besson, D; Blusk, S; Bonvicini, G; Briere, R A; Brock, I; Butt, J; Cassel, D G; Cawlfield, C; Chen, J; Cinabro, D; Coan, T E; Cronin-Hennessy, D; Csorna, S E; Cummings, J P; Danko, I; Dobbs, S; Duboscq, J E; Dubrovin, M; Dytman, S A; Ecklund, K M; Edwards, K W; Ehrlich, R; Eisenstein, B I; Ernst, J; Ferguson, T; Fields, L; Gao, K Y; Gao, Y S; Gibbons, L; Gong, D T; Gray, R; Gray, S W; Hartill, D L; He, Q; Heltsley, B K; Hertz, D; Hietala, J; Huang, G S; Insler, J; Jones, C D; Kandaswamy, J; Karliner, I; Kim, D; Klein, T; Kreinick, D L; Kubota, Y; Kuznetsov, V E; Lang, B W; Li, J; Li, Z; Lincoln, A; Liu, F; Love, W; Lowrey, N; López, A; Mahlke-Krüger, H; Mehrabyan, S S; Menaa, N; Metreveli, Z V; Miller, D H; Mountain, R; Muramatsu, H; Méndez, H; Naik, P; Napolitano, J; Nisar, S; Onyisi, P U E; Park, C S; Patel, R; Patterson, J R; Pavlunin, V; Pedlar, T K; Peterson, D; Pivarski, J; Poling, R; Potlia, V; Ramírez, J; Randrianarivony, K; Redjimi, R; Riley, D; Rosner, J L; Rubin, P; Ryd, A; Sadoff, A J; Sanghi, B; Savinov, V; Schwarthoff, H; Scott, A W; Sedlack, C; Selen, M; Seth, K K; Severini, H; Shepherd, M R; Shi, X; Shipsey, I P J; Sia, R; Skwarnicki, T; Smith, A; Stone, S; Stroiney, S; Sun, W M; Tatishvili, G T; Thorndike, E H; Tomaradze, A G; Vogel, H; Wang, J C; Watkins, M E; Weinberger, M; White, E J; Wilksen, T; Wiss, J; Xin, B; Yang, F; Yelton, J; Zhang, K; Zweber, P; al., et

    2007-01-01

    Knowledge of the Bs decay fraction of the Y(5S) resonance, fs, is important for Bs meson studies at the Y(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423/fb on the Y(5S) resonance, 6.34/fb on the Y(4S) and 2.32/fb in the continuum below the Y(4S), we measure B(Y(5S) -> phi X)=(13.8 +/- 0.7 {+2.3}{-1.5})% and B(Y(4S) -> phi X) = (7.1 +/- 0.1 +/-0.6)%; the ratio of the two rates is (1.9 +/- 0.1 {+0.3}{-0.2}). This is the first measurement of the phi meson yield from the Y(5S). Using these rates, and a model dependent estimate of B(Bs -> phi X), we determine fs = (24.6 +/- 2.9 {+11.0}{-5.3})%. We also update our previous independent measurement of fs made using the inclusive Ds yields to now be (16.8 +/- 2.6 {+6.7}{-3.4)%, due to a better estimate of the number of hadronic events. We also report the total Y(5S) hadronic cross section above continuum to be sigma(e^+e^- -> Y(5S))=(0.301 +/- 0.002 +/- 0.039) nb. This allows us to extract the fraction of B mesons as (58...

  9. Comparative analyses among the Trichomonas vaginalis, Trichomonas tenax, and Tritrichomonas foetus 5S ribosomal RNA genes.

    Science.gov (United States)

    Torres-Machorro, Ana Lilia; Hernández, Roberto; Alderete, John F; López-Villaseñor, Imelda

    2009-04-01

    The 5S ribosomal RNA (5S rRNA) is an essential component of ribosomes. Throughout evolution, variation is found among 5S rRNA genes regarding their chromosomal localization, copy number, and intergenic regions. In this report, we describe and compare the gene sequences, motifs, genomic copy number, and chromosomal localization of the Trichomonas vaginalis, Trichomonas tenax, and Tritrichomonas foetus 5S rRNA genes. T. vaginalis and T. foetus have a single type of 5S rRNA-coding region, whereas two types were found in T. tenax. The sequence identities among the three organisms are between 94 and 97%. The intergenic regions are more divergent in sequence and size with characteristic species-specific motifs. The T. foetus 5S rRNA gene has larger and more complex intergenic regions, which contain either an ubiquitin gene or repeated sequences. The 5S rRNA genes were located in Trichomonads chromosomes by fluorescent in situ hybridization.

  10. Rapid in vivo exploration of a 5S rRNA neutral network.

    Science.gov (United States)

    Zhang, Zhengdong D; Nayar, Madhavi; Ammons, David; Rampersad, Joanne; Fox, George E

    2009-02-01

    A partial knockout compensation method to screen 5S ribosomal RNA sequence variants in vivo is described. The system utilizes an Escherichia coli strain in which five of eight genomic 5S rRNA genes were deleted in conjunction with a plasmid which is compensatory when carrying a functionally active 5S rRNA. The partial knockout strain is transformed with a population of potentially compensatory plasmids each carrying a randomly generated 5S rRNA gene variant. a The ability to compensate the slow growth rate of the knockout strain is used in conjunction with sequencing to rapidly identify variant 5S rRNAs that are functional as well as those that likely are not. The assay is validated by showing that the growth rate of 15 variants separately expressed in the partial knockout strain can be accurately correlated with in vivo assessments of the potential validity of the same variants. A region of 5S rRNA was mutagenized with this approach and nine novel variants were recovered and characterized. Unlike a complete knockout system, the method allows recovery of both deleterious and functional variants.. The method can be used to study variants of any 5S rRNA in the E. coli context including those of E. coli.

  11. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits......A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  12. Molecular subtyping of Blastocystis spp. using a new rDNA marker from the mitochondria-like organelle genome.

    Science.gov (United States)

    Poirier, P; Meloni, D; Nourrisson, C; Wawrzyniak, I; Viscogliosi, E; Livrelli, V; Delbac, F

    2014-04-01

    Blastocystis spp. are common anaerobic intestinal protozoa found in both human and animals. They are characterized by a high genetic diversity with at least 17 subtypes (STs) that have been described on the basis of a 600 bp 'barcoding region' from the 18S rDNA gene. However, analysis of the recently sequenced genome of a Blastocystis ST7 isolate (strain B) revealed the presence of multiple variable copies of the 18S rDNA gene, with 17 completely assembled copies. Comparison of the barcoding region from these 17 copies allowed us to classify the 18S rDNA sequences into 6 clusters, each cluster containing identical sequences. Surprisingly, 4 of these clusters had the highest homology with 18S rDNA sequences from 2 other Blastocystis ST7 isolates referred as QQ98-4 and H. These results suggest that the 18S rDNA gene is not the marker of choice to discriminate between strains within STs. In the present study, we identified a single-copy subtyping rDNA marker in the genome of the mitochondria-like organelles (MLOs). Using a partial sequence of the MLO rDNA, we successfully subtyped 66 isolates from both human and animals belonging to Blastocystis ST1 to ST10. Our results also indicate that this mitochondrial marker could be useful to detect co-infections by different isolates of a same ST.

  13. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    Science.gov (United States)

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected.

  14. Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

    Science.gov (United States)

    El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

    2013-07-01

    Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks.

  15. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  16. A Study of the 5S Ribosomal RNAs of the Vibrionaceae

    Science.gov (United States)

    1984-01-01

    M.T. and R.R. Colwell. 1984. Identical 5S rRNA nucleotide sequence of (ibrio cholrar strains representing temporal, geographical and ecological...diversity. Appl. Environ. Microbiol. 48:119-121. MacDonell, M.T. and R.R. Colwell. 1984. The nucleotide base sequence of Vibrionaceae 5S rRNA . FEBS Lett...and R.R. Colwell. 1984. Nucleotide sequences of 5S rRNA from two Vibrio species, V. fluvialis and V. parahaemolyticus. MIRCEN J. Appl. Microbial

  17. 浅议5S-TPM促进安全管理

    Institute of Scientific and Technical Information of China (English)

    葛仔东

    2013-01-01

    安全生产重在现场,设备的稳定性直接影响安全生产,安全强调务实和强执行力,5S-TPM正是不讲空话,强调行动的管理工具.文章结合一年多的5S-TPM实践活动,介绍了在推行过程中5S-TPM对安全管理的促进作用.

  18. Assessment of helminth biodiversity in wild rats using 18S rDNA based metagenomics.

    Science.gov (United States)

    Tanaka, Ryusei; Hino, Akina; Tsai, Isheng J; Palomares-Rius, Juan Emilio; Yoshida, Ayako; Ogura, Yoshitoshi; Hayashi, Tetsuya; Maruyama, Haruhiko; Kikuchi, Taisei

    2014-01-01

    Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity.

  19. Molecular characterization of 18S rDNA partial sequence in Microcosmus (Stolidobranchiata, Pyuridae

    Directory of Open Access Journals (Sweden)

    D. FULGIONE

    2012-12-01

    Full Text Available We present a 18S rDNA based molecular phylogeny of two species of the genus Microcosmus (M. sulcatus and M. claudicans sampled in the Mediterranean, to investigate their phylogenetic position relative to species of the order Stolidobranchiata. The analysis is based on partial sequences (739 bp of the 18S rDNA. Among the 18 variable sites found between the two species, 4 correspond to transitions (ts, 14 to transversions (tv and 4 to deletions/insertions. In the considered Stolidobranchiata, we found 4.3% overall mean number of nucleotide differences and 0.06 (S.E. ±0.01 Kimura 2-parameter distance. The mean number of nucleotide differences between Microcosmus spp. and other Stolidobranchiata species was of 6% and 0.08 (S.E. ±0.01 Kimura 2-parameter distance. A molecular phylogeny obtained by Maximum Parsimony corroborates results of the traditional taxonomy.

  20. Assessment of helminth biodiversity in wild rats using 18S rDNA based metagenomics.

    Directory of Open Access Journals (Sweden)

    Ryusei Tanaka

    Full Text Available Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity.

  1. Molecular characterization of 18S rDNA partial sequence in Microcosmus (Stolidobranchiata, Pyuridae

    Directory of Open Access Journals (Sweden)

    D. FULGIONE

    2006-12-01

    Full Text Available We present a 18S rDNA based molecular phylogeny of two species of the genus Microcosmus (M. sulcatus and M. claudicans sampled in the Mediterranean, to investigate their phylogenetic position relative to species of the order Stolidobranchiata. The analysis is based on partial sequences (739 bp of the 18S rDNA. Among the 18 variable sites found between the two species, 4 correspond to transitions (ts, 14 to transversions (tv and 4 to deletions/insertions. In the considered Stolidobranchiata, we found 4.3% overall mean number of nucleotide differences and 0.06 (S.E. ±0.01 Kimura 2-parameter distance. The mean number of nucleotide differences between Microcosmus spp. and other Stolidobranchiata species was of 6% and 0.08 (S.E. ±0.01 Kimura 2-parameter distance. A molecular phylogeny obtained by Maximum Parsimony corroborates results of the traditional taxonomy.

  2. Uniqueness of the Gossypium mustelinum Genome Revealed by GISH and 45S rDNA FISH

    Institute of Scientific and Technical Information of China (English)

    WU Qiong; STELLY David; SONG Guo-li; WANG Kun-bo; WANG Chun-ying; LIU Fang; LI Shao-hui; ZHANG Xiang-di; WANG Yu-hong; LIU San-hong

    2008-01-01

    @@ Gossypium mustelinum [-(AD)4"] is one of five tetraploid species in Gossypium.Three pairs of nucleolar organizer regions (NOR) in (AD)4 were detected by FISH with 45S rDNA as a probe,they also were observed with genomic DNA (gDNA) from Gossypium D genome species as probes.Of the three NORs or GISH-NORs,one was super-major and other two were minor,which was distinctly different from other tetraploid cottons.

  3. Uniqueness of the Gossypium mustelinum Genome Revealed by GISH and 45S rDNA FISH

    Institute of Scientific and Technical Information of China (English)

    Qiong Wu; Fang Liu; Shaohui Li; Guoli Song; Chunying Wang; Xiangdi Zhang; Yuhong Wang

    2013-01-01

    Gossypium mustelinum ((AD)4) is one of five disomic species in Gossypium.Three 45S ribosomal DNA (rDNA) loci were detected in (AD)4 with 45S rDNA as probe,and three pairs of brighter signals were detected with genomic DNA (gDNA) of Gossypium D genome species as probes.The size and the location of these brighter signals were the same as those detected with 45S rDNA as probe,and were named GISH-NOR.One of them was super-major,which accounted for the fact that about one-half of its chromosome at metaphase was located at chromosome 3,and other two were minor and located at chromosomes 5 and 9,respectively.All GISH-NORs were located in A sub-genome chromosomes,separate from the other four allopolypioid cotton species.GISH-NOR were detected with D genome species as probe,but not A.The greatly abnormal sizes and sites of (AD)4 NORs or GISH-NORs indicate a possible mechanism for 45S rDNA diversification following (AD)4 speciation.Comparisons of GISH intensities and GISH-NOR production with gDNA probes between A and D genomes show that the better relationship of (AD)4 is with A genome.The shortest two chromosomes of A sub-genome of G.mustelinum were shorter than the longest chromosome of D sub-genome chromosomes.Therefore,the longest 13 chromosomes of tetraploid cotton being classified as A sub-genome,while the shorter 13 chromosomes being classified as D sub-genome in traditional cytogenetic and karyotype analyses may not be entirely correct.

  4. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    DEFF Research Database (Denmark)

    Brown, S; Fournier, M J

    1984-01-01

    The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

  5. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  6. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  7. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  8. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  9. Absolute Frequency Measurement of Rubidium 5S-7S Two-Photon Transitions

    CERN Document Server

    Morzynski, Piotr; Ablewski, Piotr; Gartman, Rafal; Gawlik, Wojciech; Maslowski, Piotr; Nagorny, Bartlomiej; Ozimek, Filip; Radzewicz, Czeslaw; Witkowski, Marcin; Ciurylo, Roman; Zawada, Michal

    2013-01-01

    We report the absolute frequency measurements of rubidium 5S-7S two-photon transitions with a cw laser digitally locked to an atomic transition and referenced to an optical frequency comb. The narrow, two-photon transition, 5S-7S (760 nm) insensitive to first order in a magnetic field, is a promising candidate for frequency reference. The performed tests yield the transition frequency with accuracy better than reported previously.

  10. Primary power sources Li/Cu4Bi5S10

    Directory of Open Access Journals (Sweden)

    Mintyansky I. V.

    2009-04-01

    Full Text Available The results of investigation of the operating characteristics of the electrochemical system Li/Cu4Bi5S10 are presented. The mechanism of the current forming reaction is established. The impedance spectra of Li/Cu4Bi5S10 cells are investigated and analyzed at different depths of discharge. A model of the equivalent electrical circuit is proposed, and the coefficients describing the electrode reactions are estimated.

  11. Inheritance of the group I rDNA intron in Tetrahymena pigmentosa.

    Science.gov (United States)

    Nielsen, H; Simon, E M; Engberg, J

    1992-01-01

    We have previously argued from phylogenetic sequence data that the group I intron in the rRNA genes of Tetrahymena was acquired by different Tetrahymena species at different times during evolution. We have now approached the question of intron mobility experimentally by crossing intron+ and intron- strains looking for a strong polarity in the inheritance of the intron (intron homing). Based on the genetic analysis we find that the intron in T. pigmentosa is inherited as a neutral character and that intron+ and intron- alleles segregate in a Mendelian fashion with no sign of intron homing. In an analysis of vegetatively growing cells containing intron+ and intron- rDNA, initially in the same macronucleus, we similarly find no evidence of intron homing. During the course of this work, we observed to our surprise that progeny clones from some crosses contained three types of rDNA. One possible explanation is that T. pigmentosa has two rdn loci in contrast to the single locus found in T. thermophila. Some of the progeny clones from the genetic analysis were expanded for several hundred generations, and allelic assortment of the rDNA was demonstrated by subcloning analysis.

  12. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

    Science.gov (United States)

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

    2014-05-01

    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  13. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  14. The 5S RNP Couples p53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress

    Science.gov (United States)

    Sloan, Katherine E.; Bohnsack, Markus T.; Watkins, Nicholas J.

    2013-01-01

    Summary Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14ARF, a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. PMID:24120868

  15. The 5S RNP Couples p53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress

    Directory of Open Access Journals (Sweden)

    Katherine E. Sloan

    2013-10-01

    Full Text Available Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2 homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP. We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14ARF, a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production.

  16. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    Science.gov (United States)

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (pjob and setting up a safe environment created a statistically significant effect on employees, and some sufficient satisfaction was

  17. History of myxozoan character evolution on the basis of rDNA and EF-2 data

    Directory of Open Access Journals (Sweden)

    Bartošová Pavla

    2010-07-01

    Full Text Available Abstract Background Phylogenetic relationships among myxosporeans based on ribosomal DNA data disagree with traditional taxonomic classification: a number of myxosporeans with very similar spore morphology are assigned to the same genera even though they are phylogenetically distantly related. The credibility of rDNA as a suitable marker for Myxozoa is uncertain and needs to be proved. Furthermore, we need to know the history of myxospore evolution to understand the great diversity of modern species. Results Phylogenetic analysis of elongation factor 2 supports the ribosomal DNA-based reconstruction of myxozoan evolution. We propose that SSU rDNA is a reliable marker for inferring myxozoan relationships, even though SSU rDNA analysis markedly disagrees with the current taxonomy. The analyses of character evolution of 15 morphological and 5 bionomical characters show the evolution of individual characters and uncover the main evolutionary changes in the myxosporean spore morphology and bionomy. Most bionomical and several morphological characters were found to be congruent with the phylogeny. The summary of character analyses leads to the simulation of myxozoan ancestral morphotypes and their evolution to the current species. As such, the ancestor of all myxozoans appears to have infected the renal tubules of freshwater fish, was sphaerosporid in shape, and had a spore with polar capsules that discharged slightly sideways. After the separation of Malacosporea, the spore of the common myxosporean ancestor then changed to the typical sphaerosporid morphotype. This species inhabited the marine environment as a parasite of the gall bladder of marine fish and ultimately separated into the three main myxosporean lineages evident today. Two of these lineages re-entered the freshwater environment, one as a myxosporean with Chloromyxum and another with a primitive sphaerosporid morphotype. The common ancestor of all marine myxosporeans had a ceratomyxid

  18. History of myxozoan character evolution on the basis of rDNA and EF-2 data.

    Science.gov (United States)

    Fiala, Ivan; Bartosová, Pavla

    2010-07-28

    Phylogenetic relationships among myxosporeans based on ribosomal DNA data disagree with traditional taxonomic classification: a number of myxosporeans with very similar spore morphology are assigned to the same genera even though they are phylogenetically distantly related. The credibility of rDNA as a suitable marker for Myxozoa is uncertain and needs to be proved. Furthermore, we need to know the history of myxospore evolution to understand the great diversity of modern species. Phylogenetic analysis of elongation factor 2 supports the ribosomal DNA-based reconstruction of myxozoan evolution. We propose that SSU rDNA is a reliable marker for inferring myxozoan relationships, even though SSU rDNA analysis markedly disagrees with the current taxonomy. The analyses of character evolution of 15 morphological and 5 bionomical characters show the evolution of individual characters and uncover the main evolutionary changes in the myxosporean spore morphology and bionomy. Most bionomical and several morphological characters were found to be congruent with the phylogeny. The summary of character analyses leads to the simulation of myxozoan ancestral morphotypes and their evolution to the current species. As such, the ancestor of all myxozoans appears to have infected the renal tubules of freshwater fish, was sphaerosporid in shape, and had a spore with polar capsules that discharged slightly sideways. After the separation of Malacosporea, the spore of the common myxosporean ancestor then changed to the typical sphaerosporid morphotype. This species inhabited the marine environment as a parasite of the gall bladder of marine fish and ultimately separated into the three main myxosporean lineages evident today. Two of these lineages re-entered the freshwater environment, one as a myxosporean with Chloromyxum and another with a primitive sphaerosporid morphotype. The common ancestor of all marine myxosporeans had a ceratomyxid shape of spore. We support rDNA based myxozoan

  19. Similar patterns of rDNA evolution in synthetic and recently formed natural populations of Tragopogon (Asteraceae allotetraploids

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2010-09-01

    Full Text Available Abstract Background Tragopogon mirus and T. miscellus are allotetraploids (2n = 24 that formed repeatedly during the past 80 years in eastern Washington and adjacent Idaho (USA following the introduction of the diploids T. dubius, T. porrifolius, and T. pratensis (2n = 12 from Europe. In most natural populations of T. mirus and T. miscellus, there are far fewer 35S rRNA genes (rDNA of T. dubius than there are of the other diploid parent (T. porrifolius or T. pratensis. We studied the inheritance of parental rDNA loci in allotetraploids resynthesized from diploid accessions. We investigate the dynamics and directionality of these rDNA losses, as well as the contribution of gene copy number variation in the parental diploids to rDNA variation in the derived tetraploids. Results Using Southern blot hybridization and fluorescent in situ hybridization (FISH, we analyzed copy numbers and distribution of these highly reiterated genes in seven lines of synthetic T. mirus (110 individuals and four lines of synthetic T. miscellus (71 individuals. Variation among diploid parents accounted for most of the observed gene imbalances detected in F1 hybrids but cannot explain frequent deviations from repeat additivity seen in the allotetraploid lines. Polyploid lineages involving the same diploid parents differed in rDNA genotype, indicating that conditions immediately following genome doubling are crucial for rDNA changes. About 19% of the resynthesized allotetraploid individuals had equal rDNA contributions from the diploid parents, 74% were skewed towards either T. porrifolius or T. pratensis-type units, and only 7% had more rDNA copies of T. dubius-origin compared to the other two parents. Similar genotype frequencies were observed among natural populations. Despite directional reduction of units, the additivity of 35S rDNA locus number is maintained in 82% of the synthetic lines and in all natural allotetraploids. Conclusions Uniparental reductions of

  20. A populational survey of 45S rDNA polymorphism in the Jefferson salamander Ambystoma jeffersonianum revealed by fluorescence in situ hybridization (FISH)

    Institute of Scientific and Technical Information of China (English)

    Ke BI; James P.BOGART; Jinzhong FU

    2009-01-01

    The chromosomal localization of 45S ribosomal RNA genes in Ambystoma jeffersonianum was determined by fluorescence in situ hybridization with 18S rDNA fragment as a probe (FISH-rDNA). Our results revealed the presence of rDNA polymorphism among A.jeffersonianum populations in terms of number, location and FISH signal intensity on the chromosomes. Nine rDNA cytotypes were found in ten geographically isolated populations and most of them contained derivative rDNA sites. Our preliminary study provides strong indication of karyotypic diversification of A.jeffersonianum that is demonstrated by intraspecific variation of 45S rDNA cytotypes. rDNA cytotype polymorphism has been described in many other caudate amphibians. We predict that habitat isolation, low dispersal ability and decline of effective population size could facilitate the fixation and accumulation of variable rDNA cytotypes during their chromosome evolution [Current Zoology 55(2):145-149,2009].

  1. A populational survey of 45S rDNA polymorphism in the Jefferson salamander Ambystoma jeffersonianum revealed by fluorescence in situ hybridization (FISH

    Directory of Open Access Journals (Sweden)

    Jinzhong FU

    2009-04-01

    Full Text Available The chromosomal localization of 45S ribosomal RNA genes in Ambystoma jeffersonianum was determined by fluorescence in situ hybridization with 18S rDNA fragment as a probe (FISH-rDNA. Our results revealed the presence of rDNA polymorphism among A.jeffersonianum populations in terms of number, location and FISH signal intensity on the chromosomes. Nine rDNA cytotypes were found in ten geographically isolated populations and most of them contained derivative rDNA sites. Our preliminary study provides strong indication of karyotypic diversification of A.jeffersonianum that is demonstrated by intraspecific variation of 45S rDNA cytotypes. rDNA cytotype polymorphism has been described in many other caudate amphibians. We predict that habitat isolation, low dispersal ability and decline of effective population size could facilitate the fixation and accumulation of variable rDNA cytotypes during their chromosome evolution.

  2. Nuclear 28S rDNA phylogeny supports the basal placement of Noctiluca scintillans (Dinophyceae; Noctilucales) in dinoflagellates.

    Science.gov (United States)

    Ki, Jang-Seu

    2010-05-01

    Noctiluca scintillans (Macartney) Kofoid et Swezy, 1921 is an unarmoured heterotrophic dinoflagellate with a global distribution, and has been considered as one of the ancestral taxa among dinoflagellates. Recently, 18S rDNA, actin, alpha-, beta-tubulin, and Hsp90-based phylogenies have shown the basal position of the noctilucids. However, the relationships of dinoflagellates in the basal lineages are still controversial. Although the nuclear rDNA (e.g. 18S, ITS-5.8S, and 28S) contains much genetic information, DNA sequences of N. scintillans rDNA molecules were insufficiently characterized as yet. Here the author sequenced a long-range nuclear rDNA, spanning from the 18S to the D5 region of the 28S rDNA, of N. scintillans. The present N. scintillans had a nearly identical genotype (>99.0% similarity) compared to other Noctiluca sequences from different geographic origins. Nucleotide divergence in the partial 28S rDNA was significantly high (pdinoflagellates, two perkinsids, and two apicomplexans as outgroups showed that N. scintillans and Oxyrrhis marina formed a clade that diverged separately from core dinoflagellates.

  3. Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA

    Indian Academy of Sciences (India)

    Ankita Srivastava; Alok Bhattacharya; Sudha Bhattacharya; Gagan Deep Jhingan

    2016-03-01

    Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.

  4. Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA.

    Science.gov (United States)

    Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep

    2016-03-01

    Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.

  5. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  6. 5S rRNA-recognition module of CTC family proteins and its evolution.

    Science.gov (United States)

    Korobeinikova, A V; Gongadze, G M; Korepanov, A P; Eliseev, B D; Bazhenova, M V; Garber, M B

    2008-02-01

    The effects of amino acid replacements in the RNA-binding sites of homologous ribosomal proteins TL5 and L25 (members of the CTC family) on ability of these proteins to form stable complexes with ribosomal 5S RNA were studied. It was shown that even three simultaneous replacements of non-conserved amino acid residues by alanine in the RNA-binding site of TL5 did not result in noticeable decrease in stability of the TL5-5S rRNA complex. However, any replacement among five conserved residues in the RNA-binding site of TL5, as well as of L25 resulted in serious destabilization or complete impossibility of complex formation. These five residues form an RNA-recognition module in TL5 and L25. These residues are strictly conserved in proteins of the CTC family. However, there are several cases of natural replacements of these residues in TL5 and L25 homologs in Bacilli and Cyanobacteria, which are accompanied by certain changes in the CTC-binding site of 5S rRNAs of the corresponding organisms. CTC proteins and specific fragments of 5S rRNA of Enterococcus faecalis and Nostoc sp. were isolated, and their ability to form specific complexes was tested. It was found that these proteins formed specific complexes only with 5S rRNA of the same organism. This is an example of coevolution of the structures of two interacting macromolecules.

  7. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  9. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements.

    Science.gov (United States)

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-10-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  10. Molecular organization of the 25S-18S rDNA IGS of Fagus sylvatica and Quercus suber: a comparative analysis.

    Science.gov (United States)

    Inácio, Vera; Rocheta, Margarida; Morais-Cecílio, Leonor

    2014-01-01

    The 35S ribosomal DNA (rDNA) units, repeated in tandem at one or more chromosomal loci, are separated by an intergenic spacer (IGS) containing functional elements involved in the regulation of transcription of downstream rRNA genes. In the present work, we have compared the IGS molecular organizations in two divergent species of Fagaceae, Fagus sylvatica and Quercus suber, aiming to comprehend the evolution of the IGS sequences within the family. Self- and cross-hybridization FISH was done on representative species of the Fagaceae. The IGS length variability and the methylation level of 18 and 25S rRNA genes were assessed in representatives of three genera of this family: Fagus, Quercus and Castanea. The intergenic spacers in Beech and Cork Oak showed similar overall organizations comprising putative functional elements needed for rRNA gene activity and containing a non-transcribed spacer (NTS), a promoter region, and a 5'-external transcribed spacer. In the NTS: the sub-repeats structure in Beech is more organized than in Cork Oak, sharing some short motifs which results in the lowest sequence similarity of the entire IGS; the AT-rich region differed in both spacers by a GC-rich block inserted in Cork Oak. The 5'-ETS is the region with the higher similarity, having nonetheless different lengths. FISH with the NTS-5'-ETS revealed fainter signals in cross-hybridization in agreement with the divergence between genera. The diversity of IGS lengths revealed variants from ∼ 2 kb in Fagus, and Quercus up to 5.3 kb in Castanea, and a lack of correlation between the number of variants and the number of rDNA loci in several species. Methylation of 25S Bam HI site was confirmed in all species and detected for the first time in the 18S of Q. suber and Q. faginea. These results provide important clues for the evolutionary trends of the rDNA 25S-18S IGS in the Fagaceae family.

  11. Molecular organization of the 25S-18S rDNA IGS of Fagus sylvatica and Quercus suber: a comparative analysis.

    Directory of Open Access Journals (Sweden)

    Vera Inácio

    Full Text Available The 35S ribosomal DNA (rDNA units, repeated in tandem at one or more chromosomal loci, are separated by an intergenic spacer (IGS containing functional elements involved in the regulation of transcription of downstream rRNA genes. In the present work, we have compared the IGS molecular organizations in two divergent species of Fagaceae, Fagus sylvatica and Quercus suber, aiming to comprehend the evolution of the IGS sequences within the family. Self- and cross-hybridization FISH was done on representative species of the Fagaceae. The IGS length variability and the methylation level of 18 and 25S rRNA genes were assessed in representatives of three genera of this family: Fagus, Quercus and Castanea. The intergenic spacers in Beech and Cork Oak showed similar overall organizations comprising putative functional elements needed for rRNA gene activity and containing a non-transcribed spacer (NTS, a promoter region, and a 5'-external transcribed spacer. In the NTS: the sub-repeats structure in Beech is more organized than in Cork Oak, sharing some short motifs which results in the lowest sequence similarity of the entire IGS; the AT-rich region differed in both spacers by a GC-rich block inserted in Cork Oak. The 5'-ETS is the region with the higher similarity, having nonetheless different lengths. FISH with the NTS-5'-ETS revealed fainter signals in cross-hybridization in agreement with the divergence between genera. The diversity of IGS lengths revealed variants from ∼ 2 kb in Fagus, and Quercus up to 5.3 kb in Castanea, and a lack of correlation between the number of variants and the number of rDNA loci in several species. Methylation of 25S Bam HI site was confirmed in all species and detected for the first time in the 18S of Q. suber and Q. faginea. These results provide important clues for the evolutionary trends of the rDNA 25S-18S IGS in the Fagaceae family.

  12. Ribosomal DNA transcription in the dorsal raphe nucleus is increased in residual but not in paranoid schizophrenia.

    Science.gov (United States)

    Krzyżanowska, Marta; Steiner, Johann; Brisch, Ralf; Mawrin, Christian; Busse, Stefan; Braun, Katharina; Jankowski, Zbigniew; Bernstein, Hans-Gert; Bogerts, Bernhard; Gos, Tomasz

    2015-03-01

    The central serotonergic system is implicated in the pathogenesis of schizophrenia, where the imbalance between dopamine, serotonin and glutamate plays a key pathophysiological role. The dorsal raphe nucleus (DRN) is the main source of serotonergic innervation of forebrain limbic structures disturbed in schizophrenia patients. The study was carried out on paraffin-embedded brains from 17 (8 paranoid and 9 residual) schizophrenia patients and 28 matched controls without mental disorders. The transcriptional activity of ribosomal DNA (rDNA) in DRN neurons was evaluated by the AgNOR silver-staining method. An increased rDNA transcriptional activity was found in schizophrenia patients in the cumulative analysis of all DRN subnuclei (t test, P = 0.02). Further subgroup analysis revealed that it was an effect specific for residual schizophrenia versus paranoid schizophrenia or control groups (ANOVA, P = 0.002). This effect was confounded neither by suicide nor by antipsychotic medication. Our findings suggest that increased activity of rDNA in DRN neurons is a distinct phenomenon in schizophrenia, particularly in residual patients. An activation of the rDNA transcription in DRN neurons may represent a compensatory mechanism to overcome the previously described prefrontal serotonergic hypofunction in this diagnostic subgroup.

  13. 5S rRNA-derived and tRNA-derived SINEs in fruit bats.

    Science.gov (United States)

    Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

    2009-05-01

    Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.

  14. Global Sustainable Development Through the Integrated Lean Management (Green 5-S Model for TQM

    Directory of Open Access Journals (Sweden)

    Ho Samuel K. M.

    2014-11-01

    Full Text Available Based on the 'Best Paper-2010' by the TQM Journal, the author has a chance to test out the model in a number of firms in Malaysia through SIRIM. Furthermore, riding on the success, SIRIM has named it as the SIRIM Green 5-S Model. As a result, the aim of this paper is to share the experience of the “SIRIM Green 5-S Model for Sustainable Development”. Since 1993, the author used the proprietary 5-S Checklist for training and consultancy in no less than 10 countries with over 50,000 persons from around 2,000 organisatioins world-wide. On the other hand, HKSAR takes the lead in the global oil energy consumption/GPD. The experience will be shared in this article.

  15. Bacterial 5S rRNA-binding proteins of the CTC family.

    Science.gov (United States)

    Gongadze, G M; Korepanov, A P; Korobeinikova, A V; Garber, M B

    2008-12-01

    The presence of CTC family proteins is a unique feature of bacterial cells. In the CTC family, there are true ribosomal proteins (found in ribosomes of exponentially growing cells), and at the same time there are also proteins temporarily associated with the ribosome (they are produced by the cells under stress only and incorporate into the ribosome). One feature is common for these proteins - they specifically bind to 5S rRNA. In this review, the history of investigations of the best known representatives of this family is described briefly. Structural organization of the CTC family proteins and their occurrence among known taxonomic bacterial groups are discussed. Structural features of 5S rRNA and CTC protein are described that predetermine their specific interaction. Taking into account the position of a CTC protein and its intermolecular contacts in the ribosome, a possible role of its complex with 5S rRNA in ribosome functioning is discussed.

  16. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    Science.gov (United States)

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. Specific features of 5S rRNA structure - its interactions with macromolecules and possible functions.

    Science.gov (United States)

    Smirnov, A V; Entelis, N S; Krasheninnikov, I A; Martin, R; Tarassov, I A

    2008-12-01

    Small non-coding RNAs are today a topic of great interest for molecular biologists because they can be regarded as relicts of a hypothetical "RNA world" which, apparently, preceded the modern stage of organic evolution on Earth. The small molecule of 5S rRNA (approximately 120 nucleotides) is a component of large ribosomal subunits of all living beings (5S rRNAs are not found only in mitoribosomes of fungi and metazoans). This molecule interacts with various protein factors and 23S (28S) rRNA. This review contains the accumulated data to date concerning 5S rRNA structure, interactions with other biological macromolecules, intracellular traffic, and functions in the cell.

  18. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    Science.gov (United States)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  19. 5S:n käyttöönotto Nomet Oy:ssä

    OpenAIRE

    Nummi, Janne

    2012-01-01

    Tämän opinnäytetyön aiheena on 5S-toimintamallin käyttöönotto Nomet Oy:n tuotannossa, Tampereen Vehmaisissa. Nomet on alihankintakonepaja, joka on erikoistunut lastuavaan työstöön. Yrityksessä on päätetty ottaa käyttöön Lean- valmistusfilosofiaan pohjautuvaa tuotannon uudistamista. 5S on yksi Leanin monista työkaluista, josta on hyvä lähteä alkuun. 5S:n päätavoitteena on parantaa tuotantoprosesseja siisteyden, järjestyksen ja standardisoinnin avulla. Työssä on esitelty kahdesta tuotannon ...

  20. Implementace metody 5S ve výrobním podniku

    OpenAIRE

    Čechová, Petra

    2014-01-01

    Bakalářská práce se zabývá implementací metody 5S v podniku zaměřeném na výrobu a zpracování skelného vlákna. Teoretická část vysvětluje základní principy filozofie Kaizen. V praktické části je navržena a dále implementována metodika 5S ve společnosti. V závěru práce jsou zhodnoceny přínosy aplikace užité metody. This thesis deals with implementation of 5S methods in company focussed on production and processing of fiberglass. The theoretical part explains the basic principles of the philo...

  1. 5S-järjestelmän integrointi tekniikan työluokkaan

    OpenAIRE

    Nurro, Jari

    2013-01-01

    Opinnäytetyön tavoitteena on 5S-menetelmän pilotointi ja implementointi Oulun seudun ammattiopiston Myllytullin yksikköön, kohteena poweritiimi ja A-siiven kolmannen kerroksen työtilat. Työn tavoitteena on ns. teollisuusstandardi 5S:n mukauttaminen oppilaitosympäristöön silmällä pitäen sitä aspektia, että järjestelmä voidaan ottaa myös opetukseen mukaan yleisellä tasolla, että oppilaat saisivat yleiskäsityksen 5S-järjestelmästä ja ylipäänsä yhdestä laatujärjestelmästä käytössä aidossa ympäris...

  2. Ethical and psychological factors in 5S and total productive maintenance

    Directory of Open Access Journals (Sweden)

    Jamal Ahmed Hama Kareem

    2017-08-01

    Full Text Available Purpose: The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results.  Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b Panneerselvam (2012 Singh et al. (2013 and Poduval & Pramod (2015 in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM that are used to bring out the best productivity.

  3. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    Science.gov (United States)

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-03

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics.

  4. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  5. CPD Banding Patterns and Identification of 45S Rdna Sites in Tomato%番茄的CPD带型和45S rDNA位点的鉴别

    Institute of Scientific and Technical Information of China (English)

    佘朝文; 刘静宇; 宋运淳

    2005-01-01

    采用CPD(PI和DAPI组合)染色对番茄减数分裂粗线期和有丝分裂中期染色体进行了显带分析,随后用两种不同的45S rDNA克隆在相同的分裂相进行了荧光原位杂交定位分析.CPD染色在8条粗线期染色体上显示出了10条红色的CPD带纹,在6对有丝分裂中期染色体上显示出了12条CPD带纹.有丝分裂中期染色体上的CPD带纹与粗线期染色体上显著的带纹具有对应性.用改良的CPD染色程序清晰而稳定地显示出这些特征性的CPD带纹为番茄的染色体,特别是有丝分裂中期染色体提供了新的识别标记.用番茄的一个45S rDNA克隆进行的荧光原位杂交,不仅在位于2号染色体短臂的随体上显示了强的杂交信号,而且在粗线期染色体的5个CPD带区或有丝分裂中期染色体的4对CPD带区显示了弱的杂交信号.然而,用来自小麦的45S rDNA克隆pTa71进行的原位杂交却只在随体上显示了杂交信号.鉴于所用的两个45S rDNA克隆在序列上的差异,推断在番茄基因组中只有随体含有45S rDNA单位的编码区,即番茄只有一对45S rDNA位点.%In this study,we performed sequentially combined PI and DAPI (CPD) staining and FiSH with two different 45S rDNA clones on meiotic pachytene and mitotic metaphase chromosomes in tomato. Ten red CPD bands were shown on eight pachytene bivalents,and 12 bands were shown on six pairs of mitotic metaphase chromosomes. The CPD bands exhibited on mitotic metaphase chromosomes corresponded to the prominent bands exhibited on the pachytene chromosomes. The distinctive CPD bands, which could be constantly and clearly detected using the CPD staining procedure we improved, provided new landmarks for chromosome identification in tomato. FISH with the tomato 45S rDNA clone revealed very strong signal(s) in the satellite(s) on the short arm of chromosome 2 as well as weak signals in five CPD banded regions at pachytene or four pairs of CPD banded regions at

  6. A Study of the Impact of Implementing 5s on Efficiency and Effectiveness of Constabularies' Workers

    Directory of Open Access Journals (Sweden)

    Milad Aghaee

    2013-01-01

    Full Text Available IntroductionPeople always seek ways for improving and using optimally the current facilities which are available. KAIZEN is a Japanese expression which means improvement. In fact, KAIZEN is a continuous improvement which encompasses all people, managers and employees alike, and its philosophy is based on continuous improvement in lifestyle of human beings. Like an umbrella, KAIZEN encompasses all principles for moving to promotion and organizational excellence. 5s is one of these principles, which is an abbreviation for 5 Japanese values, including a set of standards and activities directed at creating a systemic, clean, enjoyable and creative environment. What causes 5s to be included in KAIZEN is implementation of changes and having small but continuous improvements; an improvement which keeps business in competition and helps increase the competitive power of the organization to perform effective and efficient improvements. This research aims to consider the impact of 5s on the efficiency and effectiveness of police forces. In other words, this research is based on considering the relationships between 5s and police force efficiency and effectiveness. Material & MethodsThis research examines a new conceptual model using scientific resources. This is a practical research from the point of its goal. Also, it is a descriptive and survey research which considers the impact of one variable on other variables. So, two groups from two constabularies were selected and a special educational course was implemented relating to the main topic of the research (5s implementation for workers of these constabularies. The data of research were analyzed using SPSS software. Statistical society of this research include all employees in 134 and 140 of the Great Tehran Police Commanding Center. The volume of sample is selected by KOKRAN formula which is a sample volume determination technique. Totally, 132 individuals were chosen from police forces for

  7. Genomic and Haplotype Comparison of Butanol Producing Bacteria Based on 16S rDNA

    Directory of Open Access Journals (Sweden)

    Ekwan Nofa Wiratno

    2016-04-01

    Full Text Available High butanol demand for transportation fuel triggers butanol production development. Exploration of butanolproducing bacteria using genomic comparison and biogeography will help to develop butanol industry. The objectives of this research were butanol production, genome comparison and haplotype analysis of butanolproducing bacteria from Ranu Pani Lake sediment using 16S rDNA sequences. The highest butanol concentrations were showed by Paenibacillus polymyxa RP 2.2 isolate (10.34 g.L-1, followed by Bacillus methylotrophicus RP 3.2 and B. methylotrophicus RP 7.2 isolate (10.11 g.L-1 and 9.63 g.L-1 respectively. Paenibacillus polymyxa RP 2.2 showed similarity in nucleotide composition (ATGC with B. methylotrophicus RP 3.2, B. methylotrophicus RP 7.2, P. polymyxa CR1, Bacillus amyloliquefaciens NELB-12, and Paenibacillus polymyxa WR-2. Clostridium acetobutylicum ATCC 824 showed similarity in nucleotide composition (ATGC with Clostridium saccharoperbutylacetonicum N1-4, and Clostridium saccharobutylicum Ox29. The lowest G+C content was C. saccharobutylicum Ox29 (51.35%, and the highest was B. methylotrophicus RP 7.2 (55.33%. Conserved region of 16S rDNA (1044 bp were consisted of 17 conserved sequences. The number of Parsimony Informative Site (PIS was 319 spot and single tone was 48 spot. We found in this study that all of butanolproducing bacterial DNA sequences have clustered to 8 haplotypes. Based on the origin of sample, there were three haplotype groups. Bacteria from group A were could produce butanol 8.9-10.34 g.L-1, group B 9.2-14.2 g.L-1 and group C was could produce butanol 0.47 g.L-1. The haplotype analysis of bacteria based on 16S rDNA sequences in this study could predict capability of butanol production.

  8. Phylogenetic relationships among higher Nemertean (Nemertea) Taxa inferred from 18S rDNA sequences.

    Science.gov (United States)

    Sundberg, P; Turbeville, J M; Lindh, S

    2001-09-01

    We estimated the phylogenetic relationships of 15 nemertean (phylum Nemertea) species from the four subclasses Hoplo-, Hetero-, Palaeo-, and Bdellonemertea with 18S rDNA sequence data. Three outgroup taxa were used for rooting: Annelida, Platyhelminthes, and Mollusca. Parsimony and maximum-likelihood analyses supported the monophyletic status of the Heteronemertea and a taxon consisting of hoplonemerteans and Bdellonemertea, while indicating that Palaeonemertea is paraphyletic. The monophyletic status of the two nemertean classes Anopla and Enopla is not supported by the data. The unambiguous clades are well supported, as assessed by a randomization test (bootstrapping) and branch support values. Copyright 2001 Academic Press.

  9. Cockayne syndrome protein A is a transcription factor of RNA polymerase I and stimulates ribosomal biogenesis and growth

    Science.gov (United States)

    Koch, Sylvia; Garcia Gonzalez, Omar; Assfalg, Robin; Schelling, Adrian; Schäfer, Patrick; Scharffetter-Kochanek, Karin; Iben, Sebastian

    2014-01-01

    Mutations in the Cockayne syndrome A (CSA) protein account for 20% of Cockayne syndrome (CS) cases, a childhood disorder of premature aging and early death. Hitherto, CSA has exclusively been described as DNA repair factor of the transcription-coupled branch of nucleotide excision repair. Here we show a novel function of CSA as transcription factor of RNA polymerase I in the nucleolus. Knockdown of CSA reduces pre-rRNA synthesis by RNA polymerase I. CSA associates with RNA polymerase I and the active fraction of the rDNA and stimulates re-initiation of rDNA transcription by recruiting the Cockayne syndrome proteins TFIIH and CSB. Moreover, compared with CSA deficient parental CS cells, CSA transfected CS cells reveal significantly more rRNA with induced growth and enhanced global translation. A previously unknown global dysregulation of ribosomal biogenesis most likely contributes to the reduced growth and premature aging of CS patients. PMID:24781187

  10. DeltaGamma_s Measurement at the Upsilon(5S) from Belle

    CERN Document Server

    Esen, Sevda

    2013-01-01

    Using the full Belle Upsilon(5S) data sample of 121 fb^-1we have measured exclusive branching fractions for the decays B_s^0 -> D_s^(*)+D_s^(*)-. Assuming these decay modes saturate decays to CP-even final states, the branching fraction determines the relative width difference between the CP-odd and -even eigenstates of the B_s.

  11. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    Science.gov (United States)

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Purine and pyrimidine composition in 5S rRNA and its mutational significance

    Directory of Open Access Journals (Sweden)

    Subacius Sandra Maria Rodrigues

    1998-01-01

    Full Text Available Variations observed in 5S rRNA base compositions are almost entirely due to fixation of point mutations. As a consequence, 5S rRNA size has remained relatively constant during evolution and, therefore, dependencies among the four bases can be predicted. In order to characterize the nature and to determine the degree of such dependencies, correlation analysis followed by principal component factorial analysis was conducted on a large sample of 5S rRNA sequences. The results show that the purine and pyrimidine contents tend to remain constant, so that A + G = Kpur and C + U = Kpyr. The composition of the four bases expressed now by Kpur/Kpyr relationships is also constant (Ks. These relationships imply that the behavior of the mutations in the variable sites of the molecule follows rules imposed by the chemical nature of the bases involved. Consequently, transition mutations would be more favored than substitutions in transversion sites and also than insertion-deletion (rare in 5S rRNAs, since transitions would not significantly alter the values of the Ks-index.

  13. The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.

    Science.gov (United States)

    Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

    2017-07-12

    The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD.

  14. Discriminatory profile of rDNA sites and trend for acrocentric chromosome formation in the genus Trachinotus Lacépède, 1801 (Perciformes, Carangidae

    Directory of Open Access Journals (Sweden)

    Uedson Jacobina

    2012-10-01

    Full Text Available Chromosomal traits have provided valuable information for phylogeny and taxonomy of several fish groups. Three Atlantic Carangidae species of the genus Trachinotus Lacépède, 1801 (T. goodei Jordan et Evermann, 1896, T. carolinus (Linnaeus, 1766 and T. falcatus (Linnaeus, 1758 were investigated,2n=48 chromosomes but different chromosomal arms (FN number, i.e., 52, 56 and 58, respectively, in view of the different number of two-armed chromosomes found in their karyotypes. Thus, T. goodei, T. carolinus and T. falcatus present a progressive distance from the probable basal karyotype proposed for Perciformes (2n=48 acrocentrics, FN=48. At first sight, these findings do not agree with the phylogenetic hypothesis based on mitochondrial sequences, where T. goodei appear as the most derived species, followed by T. falcatus and T. carolinus, respectively. However, the chromosomal mapping of ribosomal DNAs was informative for clarifying this apparent conflict. Indeed, the multiple 5S and 18S rDNA sites found in T. goodei corroborate the most derived condition for this species. In this sense, the occurrence of the unexpected number of two-armed chromosomes and FN value for this species, as well as for T. carolinus, must be due to additional rounds of acrocentric formation in these species, modifying the macrostructure of their karyotypes.

  15. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  16. Internal Audit of Quality in 5s Environment: Perception on Critical Factors, Effectiveness and Impact on Organizational Performance

    OpenAIRE

    2015-01-01

    Quality Environment (5S) Practice is a concept which has been widely adopted by organizations as one way to achieve Total Quality Management (TQM) and business excellence. 5S refers to 5 principles to maintain quality which emanate from Japanese word Seiri (sorting), Seiton (straightening), Seiso (shining), Seiketsu (standardize) and Shitsuke (sustain). 5s concept aims to create a conducive, clean and tidy workplace which in turn can improve work quality and performance. Internal audit of 5S ...

  17. Protein purification in multicompartment electrolyzers for crystal growth of r-DNA products in microgravity

    Science.gov (United States)

    Righetti, Pier Giorgio; Casale, Elena; Carter, Daniel; Snyder, Robert S.; Wenisch, Elisabeth; Faupel, Michel

    1990-01-01

    Recombinant-DNA (deoxyribonucleic acid) (r-DNA) proteins, produced in large quantities for human consumption, are now available in sufficient amounts for crystal growth. Crystallographic analysis is the only method now available for defining the atomic arrangements within complex biological molecules and decoding, e.g., the structure of the active site. Growing protein crystals in microgravity has become an important aspect of biology in space, since crystals that are large enough and of sufficient quality to permit complete structure determinations are usually obtained. However even small amounts of impurities in a protein preparation are anathema for the growth of a regular crystal lattice. A multicompartment electrolyzer with isoelectric, immobiline membranes, able to purify large quantities of r-DNA proteins is described. The electrolyzer consists of a stack of flow cells, delimited by membranes of very precise isoelectric point (pI, consisting of polyacrylamide supported by glass fiber filters containing Immobiline buffers and titrants to uniquely define a pI value) and very high buffering power, able to titrate all proteins tangent or crossing such membranes. By properly selecting the pI values of two membranes delimiting a flow chamber, a single protein can be kept isoelectric in a single flow chamber and thus, be purified to homogeneity (by the most stringent criterion, charge homogeneity).

  18. Nonviral Gene Targeting at rDNA Locus of Human Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Youjin Hu

    2013-01-01

    Full Text Available Background. Genetic modification, such as the addition of exogenous genes to the MSC genome, is crucial to their use as cellular vehicles. Due to the risks associated with viral vectors such as insertional mutagenesis, the safer nonviral vectors have drawn a great deal of attention. Methods. VEGF, bFGF, vitamin C, and insulin-transferrin-selenium-X were supplemented in the MSC culture medium. The cells’ proliferation and survival capacity was measured by MTT, determination of the cumulative number of cells, and a colony-forming efficiency assay. The plasmid pHr2-NL was constructed and nucleofected into MSCs. The recombinants were selected using G418 and characterized using PCR and Southern blotting. Results. BFGF is critical to MSC growth and it acted synergistically with vitamin C, VEGF, and ITS-X, causing the cells to expand significantly. The neomycin gene was targeted to the rDNA locus of human MSCs using a nonviral human ribosomal targeting vector. The recombinant MSCs retained multipotential differentiation capacity, typical levels of hMSC surface marker expression, and a normal karyotype, and none were tumorigenic in nude mice. Conclusions. Exogenous genes can be targeted to the rDNA locus of human MSCs while maintaining the characteristics of MSCs. This is the first nonviral gene targeting of hMSCs.

  19. Endolithic bacterial rDNA components associated with the mid-Cretaceous Oceanic Anoxic Event (OAE)

    Science.gov (United States)

    Nealson, K.; Inagaki, F.

    2003-04-01

    While it was not possible to obtain viable cultures from any samples tested, we were successful in the isolation and sequencing of bacterial rDNAs from endolithic from Cretacious-age black shales (˜ 100 million years old) in southeastern France. Sequences rDNA isolated from this endolithic habitat demonstrated that the marine gamma-proteobacterial rDNA were predominant bacterial components and that the community structures were lithostratigraphically shifted to sulfate reducing bacteria within delta-Proteobacteria at the black layer of the OAE (ocean anoxic event). On the basis of molecular ecological and paleontrogical studies, the endolithic rDNAs were presumably ancient buried relics. To stimulate discussion of this process, we have called this collection of sequences the "Paleobe", asking the question of whether it preserves the past biological record for geologic time scale through the sedimentation process. Here we also discuss the progress of the study of "Paleobe" for better understanding of the history of life and past environments on Earth and other planet, as well as the robustness of living organisms and their genetic signatures.

  20. Karyotype analysis and physical mapping of 45S rDNA in eight species of Sophora,Robinia,and Amorpha

    Institute of Scientific and Technical Information of China (English)

    LIU Bo; CHEN Chengbin; LI Xiulan; QI Liwang; HAN Suying

    2006-01-01

    The karyotype analysis and physical locations of 45S rDNA were carried out by means of fluorescence in situ hybridization in three species,and two forms of Sophora,two species of Robina,and one species of Amorpha.S.japonica L.,S.japonica L.f.oligophylla Franch.,S.japonica L.f.pendula Loud.,and S.xanthantha C.Y.Ma.are all tetraploids with 2n=28.There were four 45S rDNA sites in pericentromeric regions of two Pairs of chromosomes in each of them.S.rubriflora Tsoong.is a triploid with 2n=21,and three sites were located in each satellite of group 5 chromosomes.In R.pseudoacacia L.(2n=2x=22),we examined four intensive signals in telomeric regions of two pairs of satellite chromosomes.In R.hispida L.(2n=2x=30),there were four other signals in centromeric regions besides those like in R.pseudoacacia.Amorpha fruticosa L.has most chromosomes(2n=40)among the eight materials,however,there were only six 45S rDNA loci and they laid in centromeric regions,and satellites of three pairs of chromosomes.45S rDNA is a valuable chromosomal landmark in karyotype analysis.The distribution and genomic organization Of rDNA in the three genera were also discussed.

  1. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice

    Directory of Open Access Journals (Sweden)

    Julie M. Allen

    2016-07-01

    Full Text Available Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura. We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain.

  2. Disentangling sources of variation in SSU rDNA sequences from single cell analyses of ciliates: impact of copy number variation and experimental error.

    Science.gov (United States)

    Wang, Chundi; Zhang, Tengteng; Wang, Yurui; Katz, Laura A; Gao, Feng; Song, Weibo

    2017-07-26

    Small subunit ribosomal DNA (SSU rDNA) is widely used for phylogenetic inference, barcoding and other taxonomy-based analyses. Recent studies indicate that SSU rDNA of ciliates may have a high level of sequence variation within a single cell, which impacts the interpretation of rDNA-based surveys. However, sequence variation can come from a variety of sources including experimental errors, especially the mutations generated by DNA polymerase in PCR. In the present study, we explore the impact of four DNA polymerases on sequence variation and find that low-fidelity polymerases exaggerate the estimates of single-cell sequence variation. Therefore, using a polymerase with high fidelity is essential for surveys of sequence variation. Another source of variation results from errors during amplification of SSU rDNA within the polyploidy somatic macronuclei of ciliates. To investigate further the impact of SSU rDNA copy number variation, we use a high-fidelity polymerase to examine the intra-individual SSU rDNA polymorphism in ciliates with varying levels of macronuclear amplification: Halteria grandinella, Blepharisma americanum and Strombidium stylifer We estimate the rDNA copy numbers of these three species by single-cell quantitative PCR. The results indicate that: (i) sequence variation of SSU rDNA within a single cell is authentic in ciliates, but the level of intra-individual SSU rDNA polymorphism varies greatly among species; (ii) rDNA copy numbers vary greatly among species, even those within the same class; (iii) the average rDNA copy number of Halteria grandinella is about 567 893 (s.d. = 165 481), which is the highest record of rDNA copy number in ciliates to date; and (iv) based on our data and the records from previous studies, it is not always true in ciliates that rDNA copy numbers are positively correlated with cell or genome size. © 2017 The Author(s).

  3. On the Promotion of "5S" Management Activity in Oilfield Enterprises%谈油田企业推广"5S"管理活动

    Institute of Scientific and Technical Information of China (English)

    王春新

    2009-01-01

    @@ 在企业由粗放型管理向精细化管理转型过程中,胜利油田不断探索引入新的管理方法、新的管理理念,以"整理、整顿、清扫、清洁、自律"为内容的"5S"现场管理方法,以其创造并保持干净整洁、条理有序的现场环境、保证安全、消除无效劳动、培养员工养成认真规范的工作习惯,提升员工的满意度与企业品牌为目标的管理方法,引起油田各级领导和员工的重视,2005年油田将其作为一项提升油田现场管理水平的重点工作,在全油田各专业系统进行推进.

  4. Observation of two charged bottomonium-like resonances in Y(5S) decays

    CERN Document Server

    ,

    2011-01-01

    We report the observation of two narrow structures in the mass spectra of the pi+-Y(nS) (n=1,2,3) and pi+-hb(mP)(m$ (m=1,2) pairs that are produced in association with a single charged pion in Y(5S) decays. The measured masses and widths of the two structures averaged over the five final states are M_1=(10607.2+-2.0) MeV/c2, Gamma_1=(18.4+-2.4) MeV and M_2=(10652.2+-1.5) MeV/c2, Gamma_2=(11.5+-2.2) MeV. The results are obtained with a 121.4 1/fb data sample collected with the Belle detector in the vicinity of the Y(5S) resonance at the KEKB asymmetric-energy e+e- collider.

  5. The blue light indicator in rubidium 5S-5P-5D cascade excitation

    Science.gov (United States)

    Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan

    2017-07-01

    The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S → 5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.

  6. PERANCANGAN ULANG TATA LETAK FASILITAS PABRIK TAHU DAN PENERAPAN METODE 5S

    Directory of Open Access Journals (Sweden)

    Merry Siska

    2012-12-01

    Full Text Available UD. Dhika Putra merupakan perusahaan yang bergerak dalam pembuatan tahu. Saat ini kondisi layout fasilitas produksi dan kondisi fisik lingkungan kerja di perusahaan mengalami kendala. Penelitian ini bertujuan untuk merancang ulang tata letak fasilitas pabrik pembuatan tahu yang dapat meminimalkan panjang lintasan material handling serta menerapkan metode 5S untuk meningkatkan produktivitas kerja, dengan menggunakan pendekatan Systematic Layout Planning (SLP. Sedangkan metode 5S untuk mengatur kondisi tempat kerja yang berdampak terhadap efektivitas kerja, efisiensi, produktivitas dan keselamatan kerja. Hasil penelitian ini menyimpulkan bahwa layout usulan yang terpilih untuk dijadikan layout akhir dalam penelitian ini menunjukkan penurunan panjang lintasan material handling yang cukup signifikan yaitu 45 m atau sekitar 19,2% lebih pendek dari layout awal.

  7. Perception and analysis of the 5S program at a business service provider

    Directory of Open Access Journals (Sweden)

    André Luiz Emmel Silva

    2016-09-01

    Full Text Available Given the importance that the service sector represents in our economy, the application of concepts and techniques for its administration and models aimed at improving its quality is growing. This article aims to analyze the main aspects of the 5S program in the implementation phase and in the course of its evolution at a service company. The methodology used is qualitative, implemented through a case study structured in 6 steps. The company under study performs strongly on the national market and therefore has a large amount of documents circulating daily through different sectors, which generated the need to implement a methodology capable of streamlining document flow management and reducing the time spent on bureaucracy by its employees. The 5S program was shown to have brought the company greater administrative efficiency and a more pleasant, safe and organized working environment, motivating employees, reducing costs and providing competitive advantages.

  8. Riding the Populist Web: Contextualizing the Five Star Movement (M5S in Italy

    Directory of Open Access Journals (Sweden)

    Liza Lanzone

    2015-08-01

    Full Text Available This article focuses on three mechanisms to explain the rise of populist movements across Europe. They are politicization of resentment, exploitation of social cleavages, and polarization of resentment and feelings of non-representation. We conceptualize populism as a strategic power game aiming to transform potential majorities into real ones by creating or reframing social cleavages. Our theoretical model is used to explain the rise of the Five Star Movement (M5S. Beppe Grillo’s M5S gained notoriety on the national political scene in Italy just before the 2013 elections and succeeded in get-ting nearly 25 percent of the overall vote. Moreover, it was the only political force that was able to attract votes across the different regions in Italy, making it the country’s only truly national party.

  9. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    OpenAIRE

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  10. Energy-dependent relative charge transfer cross sections of Cs+ + Rb(5s, 5p)

    CERN Document Server

    Nguyen, H; Fléchard, X; DePaola, B D

    2013-01-01

    Magneto optical trap recoil ion momentum spectroscopy is used to measure energy-dependent charge exchange cross sections in the Cs+ + Rb(5s, 5p) system over a range of projectile energies from 3.2 to 6.4 keV. The measurements are kinematically complete and yield cross sections that are differential in collision energy, scattering angle, and initial and final states.

  11. Uudised : Eesti muusikalistaarid Euroopas. Tüüri 5.sümfoonia Tallinnas

    Index Scriptorium Estoniae

    2005-01-01

    Koit Toome, Ele Millistver ja Lauri Liiv alustavad 1. detsembril Brnos rahvusvahelises muusikalitrupis "Hairi" proovidega. Esietendus on 26. dets. Iserlohni linnas Saksamaal ning etendusi antakse järgmise aasta 16. aprillini Saksa linnades, Austrias, Šveitsis ja Taanis. Erkki-Sven Tüüri 5. sümfoonia tuleb Eestis esiettekandele 10. dets. Estonia Kontserdisaalis, teose esiettekannet selle aasta veebruaris Stuttgardis dirigeeris Olari Elts

  12. IMPLEMENTATION OF LEAN CONSTRUCTION THEORY: BY USING 5'S METHODOLOGY AS TOOL - CASE STUDY

    OpenAIRE

    Mr. Prashant S. Kuklare*, Dr. M. N. Hedaoo

    2017-01-01

    This study presents a implementation of lean construction theory by using 5'S methodology as tool in construction management. 5’S is a systematic technique used by organizations comes from five Japanese words, Seiri (sort), Seiton (set in order), Seiso (shine), Seiketsu (standardize), and Shitsuke(sustain). This system helps to organize a workplace for efficiency and decrease wasting and optimize quality and productivity via monitoring an organized environment. It also provides useful visual ...

  13. Why are our children wasting: Determinants of wasting among under 5s in Ghana.

    Science.gov (United States)

    Darteh, Eugene Kofuor Maafo; Acquah, Evelyn; Darteh, Florie

    2017-09-01

    Wasting is one of the indicators of malnutrition known to contribute to the deaths occurring from childhood malnutrition. It is the measure of body mass in relation to body length used to explain recent nutritional status. This paper examines the determinants of wasting among under 5s in Ghana. Data were drawn from the 2014 Ghana Demographic and Health Survey children's records file to examine the determinants of wasting among children. A total of 2720 children under 5 years with valid anthropometric data were used. Data on wasting were collected by measuring the weight and height of all children under 5 years of age. Bi-variate and multi-variate statistics are used to examine the determinants of wasting. The bi-variate analysis showed significant differences ( p 5s according to age of the child, region, and wealth status. On the other hand, the multi-variate analysis revealed that the odds of wasting were lower among children aged 24-35 months (Odds ratio (OR) = 0.37; p 5s. Also, efforts should be made by the relevant government agencies and other stakeholders to strengthen the socio-economic status of mothers to enable them to provide adequate nutrition and improve access to health insurance for their children in order to reduce the incidence of wasting among these children.

  14. Axial interbody arthrodesis of the L5-S1 segment: a systematic review of the literature.

    Science.gov (United States)

    Schroeder, Gregory D; Kepler, Christopher K; Vaccaro, Alexander R

    2015-09-01

    The object of this study was to determine the fusion rate and safety profile of an axial interbody arthrodesis of the L5-S1 motion segment. A systematic search of MEDLINE was conducted for literature published between January 1, 2000, and August 17, 2014. All peer-reviewed articles related to the fusion rate of L5-S1 and the safety profile of an axial interbody arthrodesis were evaluated. Seventy-four articles were identified, but only 15 (13 case series and 2 retrospective cohort studies) met the study inclusion criteria. The overall pseudarthrosis rate at L5-S1 was 6.9%, and the rate of all other complications was 12.9%. A total of 14.4% of patients required additional surgery, and the infection rate was 5.4%. Deformity studies reported a significantly increased rate of complications (46.3%), and prospectively collected data demonstrated significantly higher complication (36.8%) and revision (22.6%) rates. Lastly, studies with a conflict of interest reported lower complication rates (12.4%). A systematic review of the literature indicates that an axial interbody fusion performed at the lumbosacral junction is associated with a high fusion rate (93.15%) and an acceptable complication rate (12.90%). However, these results are based mainly on retrospective case series by authors with a conflict of interest. The limited prospective data available indicate that the actual fusion rate may be lower and the complication rate may be higher than currently reported.

  15. Crystallization and X-ray diffraction data of Thermus flavus 5S rRNA helices

    Science.gov (United States)

    Vallazza, Marco; Senge, Andrea; Lippmann, Corinna; Perbandt, Markus; Betzel, Christian; Bald, Rolf; Erdmann, Volker A.

    2001-11-01

    5S rRNA is an essential component of the large ribosomal subunit in prokaryotes and eukaryotes. Its unknown function in the ribosome will eventually be revealed in part by structural studies. To promote crystallization and enhance resolution in X-ray diffraction the molecule was subdivided into five domains A-E. Several RNA oligonucleotides were chemically produced by solid-phase phosphoramidite synthesis in order to construct the domains of the 5S rRNA. An improved RNA-MPD-screen was applied in crystallization which covers a complete 2D matrix for the components used. Crystallization analysis resulted in preferred combinations of pH, polyamine, monovalent and divalent cations for short RNA molecules. Six types of crystals corresponding to the domains B, C and E of Thermus flavus 5S rRNA could be obtained which were suitable for X-ray diffraction. Four RNA helices consist of seven base pairs and two of eight base pairs. As special features, they contain two adenines in a bulge position or G : U wobble base pairs assumed to be involved in RNA-protein recognition. With an increase in crystal size an increase in resolution by X-ray analysis was observed. X-ray diffraction data were collected to 1.5 Å resolution using synchrotron radiation and cryogenic cooling techniques.

  16. Evidence-based management of otitis media: a 5S model approach.

    Science.gov (United States)

    Wasson, J D; Yung, M W

    2015-02-01

    The 5S model proposes five hierarchical levels (systems, summaries, synopses, syntheses and studies) of pre-appraised evidence to guide evidence-based practice. This review aimed to identify and summarise pre-appraised evidence at the highest available 5S level for the management of different subsets of otitis media: acute otitis media, otitis media with effusion, chronic suppurative otitis media and cholesteatoma in both adults and children. Data sources were pre-appraised evidence resources. Evidence freely available from sources at the highest available level of the 5S model were summarised for this review. System level evidence exists for acute otitis media and otitis media with effusion. Summary level evidence exists for recurrent acute otitis media and medical management of chronic suppurative otitis media. There is an absence of randomised controlled trials to prove the efficacy of surgical management of chronic suppurative otitis media and cholesteatoma. Until randomised controlled trial data are generated, consensus publications on the surgical management of chronic suppurative otitis media and cholesteatoma should be used to guide best practice.

  17. lncRNA-Induced Nucleosome Repositioning Reinforces Transcriptional Repression of rRNA Genes upon Hypotonic Stress

    Directory of Open Access Journals (Sweden)

    Zhongliang Zhao

    2016-03-01

    Full Text Available The activity of rRNA genes (rDNA is regulated by pathways that target the transcription machinery or alter the epigenetic state of rDNA. Previous work has established that downregulation of rRNA synthesis in quiescent cells is accompanied by upregulation of PAPAS, a long noncoding RNA (lncRNA that recruits the histone methyltransferase Suv4-20h2 to rDNA, thus triggering trimethylation of H4K20 (H4K20me3 and chromatin compaction. Here, we show that upregulation of PAPAS in response to hypoosmotic stress does not increase H4K20me3 because of Nedd4-dependent ubiquitinylation and proteasomal degradation of Suv4-20h2. Loss of Suv4-20h2 enables PAPAS to interact with CHD4, a subunit of the chromatin remodeling complex NuRD, which shifts the promoter-bound nucleosome into the transcriptional “off” position. Thus, PAPAS exerts a “stress-tailored” dual function in rDNA silencing, facilitating either Suv4-20h2-dependent chromatin compaction or NuRD-dependent changes in nucleosome positioning.

  18. Molecular characterization of the full-length 23S and 5S ribosomal RNA (rRNA) genes of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, Akihiro; Saito, Satoru; Sekizuka, Tsuyoshi; Murayama, Ohoshi; Takamiya, Shinzaburo; Moore, John E; Millar, B Cherie; Matsuda, Motoo

    2007-08-01

    An approximately 4.2 kbp region encoding 23S and 5S rRNA genes was identified when recombinant plasmid DNAs from two genomic DNA libraries and an inverse PCR product of Taylorella asinigenitalis UK-1 isolate were analyzed. Full-length genes of 23S rRNA (3,225 bp) and 5S rRNA (117 bp) of T. asinigenitalis are described. The present sequence analysis identified a non-coding hypothetically intrinsic transcription terminator region downstream of the 5S rRNA gene. The sequence, however, downstream of the 5S rRNA gene did not show any distal tRNA genes. Surprisingly, an intervening sequence (IVS) of 270 bp in length, including two specific tandem repeat units of 80 bp and one partial unit of 48 bp with unknown functions was identified in the first quarter of the 23S rRNA gene sequence. A second IVS of 70 bp in length was also identified in the central region of the 23S rRNA gene. In addition, by using PCR and sequencing procedures, two T. asinigenitalis isolates, UK-1 and UK-2, carried multiple IVSs in the first quarter and central regions. Moreover, the 23S rRNA fragmentation occurred in the UK-1 isolate. A phylogenetic analysis was first carried out based on the 23S rRNA sequence data from T. asinigenitalis UK-1 and 13 other beta-Proteobacteria. This is the first report of IVSs in the 23S rRNA gene from the beta-Proteobacteria.

  19. Sequence analysis of the rDNA intergenic spacer of Metarhizium strains isolated in Brazil

    Directory of Open Access Journals (Sweden)

    Fabiana Y. Yanaka-Schäfer

    2008-01-01

    Full Text Available To assess the extent of genetic variability of rDNA intergenic spacer (IGS in Metarhizium sp., 34 strains (27 isolated in Brazil were sequenced and analyzed together with an additional 20 Metarhizium anisopliae var. anisopliae sequences retrieved from GenBank. Overall, the global nucleotide diversity for the region under study was of 0.090, while for the Brazilian isolates it was only 0.016. Phylogenetic analyses showed four well-supported groups (A, B, C, and D, one of which (D has not been previously identified. All but one of the Brazilian strains cluster in this novel D phylogroup, suggesting that the genetic variation found in Brazil is a subset of the worldwide M. anisopiliae var. anisopliae variation.

  20. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters

    Directory of Open Access Journals (Sweden)

    Daniel Searle

    2016-03-01

    Full Text Available Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI’s SRA database (BioProject PRJNA294919.

  1. [PCR rDNA 16S used for the etiological diagnosis of blood culture negative endocarditis].

    Science.gov (United States)

    Baty, G; Lanotte, P; Hocqueloux, L; Prazuck, T; Bret, L; Romano, M; Mereghetti, L

    2010-06-01

    We report the case of a 55 year-old man presenting with a double aortic and mitral endocarditis for which resected valve culture was repeatedly negative. Specific PCR made on valves because of highly positive blood tests for Bartonella henselae remained negative. A molecular approach was made with 16S rDNA PCR, followed by sequencing. Bartonella quintana was identified as the etiology of endocarditis. B. quintana, "fastidious" bacteria, even if hard to identify in a laboratory, is often reported as a blood culture negative endocarditis (BCNE) agent. Molecular biology methods have strongly improved the diagnosis of BCNE. We propose a review of the literature focusing on the interest of broad-spectrum PCR on valve for the etiological diagnosis of BCNE.

  2. Phylogenetic analysis of the sequences of rDNA internal transcribed spacer (ITS) of Phytophthora sojae.

    Science.gov (United States)

    Xu, Pengfei; Han, Yingpeng; Wu, Junjiang; Lv, Huiying; Qiu, Lijuan; Chang, Ruzhen; Jin, Limei; Wang, Jinsheng; Yu, Anliang; Chen, Chen; Nan, Haiyang; Xu, Xiuhong; Wang, Ping; Zhang, Dayong; Zhang, Shuzhen; Li, Wenbin; Chen, Weiyuan

    2007-02-01

    The internal transcribed spacer (ITS) region (ITS1, ITS2 and 5.8S rDNA) of the nuclear ribosomal DNA (nrDNA) was amplified via the PCR method in seventeen different isolates of Phytophthora sojae using the common primers of the ITS of fungi. Around 800 bp-1,000 bp fragments were obtained based on the DL2000 marker and the sequences of the PCR products were tested. Taking isolate USA as outgroup, the phylogenetic tree was constructed by means of maximum parsimony analysis, and the genetic evolution among isolates was analyzed. The results showed that there is a great difference between the base constitution of ITS1 and ITS2 among various isolates. The seventeen isolates are classified into three groups, and the isolates from the same region belong to the same group, which shows the variation in geography.

  3. Diversity of 16S rDNA and environmental factor influencing microorganisms in Malan ice core

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The research on extrempholic microorganisms in glacial low-temperature environment receives more attention than ever before. Due to the successive chronological records in ice core, it is important to initiate microbiological studies on ice core samples. 23 samples from one ice core, drilled from central Qinghai-Tibetan Plateau, were analyzed. The number of total microorganisms and culturable microorganisms in different layers showed that it related with the content of dust in ice. It is suggested that the distribution of microorganisms in ice depends on the transportation of materials during glacier development. The bacteria diversity in Malan Glacier was analyzed by 16S rDNA sequencing methods, which showed that many sequences were similar to known psychrophilic bacteria.

  4. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p){sup 3}P{sub 2}-(5s4d){sup 3}D{sub 2} transition

    Energy Technology Data Exchange (ETDEWEB)

    Mickelson, P G; De Escobar, Y N Martinez; Anzel, P; DeSalvo, B J; Nagel, S B; Traverso, A J; Yan, M; Killian, T C, E-mail: killian@rice.ed [Department of Physics and Astronomy, Rice University, Houston, TX 77251 (United States)

    2009-12-14

    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p){sup 3}P{sub 2}-(5s4d){sup 3}D{sub 2} transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p){sup 3}P{sub 2} dark state are repumped back into the (5s{sup 2}){sup 1}S{sub 0} ground state. Spectroscopy of {sup 84}Sr, {sup 86}Sr, {sup 87}Sr and {sup 88}Sr improves the value of the (5s5p){sup 3}P{sub 2}-(5s4d){sup 3}D{sub 2} transition frequency and determines the isotope shifts for the transition accurately enough to guide laser-cooling experiments with less abundant isotopes.

  5. Hosts, distribution and genetic divergence (16S rDNA) of Amblyomma dubitatum (Acari: Ixodidae).

    Science.gov (United States)

    Nava, Santiago; Venzal, José M; Labruna, Marcelo B; Mastropaolo, Mariano; González, Enrique M; Mangold, Atilio J; Guglielmone, Alberto A

    2010-08-01

    We supply information about hosts and distribution of Amblyomma dubitatum. In addition, we carry out an analysis of genetic divergence among specimens of A. dubitatum from different localities and with respect to other Neotropical Amblyomma species, using sequences of 16S rDNA gene. Although specimens of A. dubitatum were collected on several mammal species as cattle horse, Tapirus terrestris, Mazama gouazoubira, Tayassu pecari, Sus scrofa, Cerdocyon thous, Myocastor coypus, Allouata caraya, Glossophaga soricina and man, most records of immature and adult stages of A. dubitatum were made on Hydrochoerus hydrochaeris, making this rodent the principal host for all parasitic stages of this ticks. Cricetidae rodents (Lundomys molitor, Scapteromys tumidus), opossums (Didelphis albiventris) and vizcacha (Lagostomus maximus) also were recorded as hosts for immature stages. All findings of A. dubitatum correspond to localities of Argentina, Brazil, Paraguay and Uruguay, and they were concentrated in the Biogeographical provinces of Pampa, Chaco, Cerrado, Brazilian Atlantic Forest, Parana Forest and Araucaria angustifolia Forest. The distribution of A. dubitatum is narrower than that of its principal host, therefore environmental variables rather than hosts determine the distributional ranges of this tick. The intraspecific genetic divergence among 16S rDNA sequences of A. dubitatum ticks collected in different localities from Argentina, Brazil and Uruguay was in all cases lower than 0.8%, whereas the differences with the remaining Amblyomma species included in the analysis were always bigger than 6.8%. Thus, the taxonomic status of A. dubitatum along its distribution appears to be certain at the specific level.

  6. Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

    Science.gov (United States)

    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

    2013-11-01

    Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai.

  7. Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

    Science.gov (United States)

    Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

    2013-10-01

    According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10.

  8. Design and Comparison of a 1 MW / 5s HTS SMES with Toroidal and Solenoidal Geometry

    CERN Document Server

    Morandi, Antonio; Gholizad, Babak; Grilli, Francesco; Sirois, Frédéric; Zermeño, Víctor M R

    2015-01-01

    The design of a HTS SMES coil with solenoidal and toroidal geometry is carried out based on a commercially available 2G HTS conductor. A SMES system of practical interest (1 MW / 5 s) is considered. The comparison between ideal toroidal and solenoidal geometry is first discussed and the criteria used for choosing the geometrical parameters of the coils' bore are explained. The design of the real coil is then carried out and the final amount of conductor needed is compared. A preliminary comparison of the two coils in terms of AC loss during one charge discharge cycle is also discussed.

  9. Magic wavelengths for the $5s-18s$ transition in rubidium

    CERN Document Server

    Goldschmidt, E A; Koller, S B; Wyllie, R; Brown, R C; Porto, J V; Safronova, U I; Safronova, M S

    2015-01-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the $5s-18s$ transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  10. The Tetrahedral Zamolodchikov Algebra and the {AdS_5× S^5} S-matrix

    Science.gov (United States)

    Mitev, Vladimir; Staudacher, Matthias; Tsuboi, Zengo

    2017-08-01

    The S-matrix of the {AdS_5× S^5} string theory is a tensor product of two centrally extended su{(2|2)\\ltimes R^2 S-matrices, each of which is related to the R-matrix of the Hubbard model. The R-matrix of the Hubbard model was first found by Shastry, who ingeniously exploited the fact that, for zero coupling, the Hubbard model can be decomposed into two XX models. In this article, we review and clarify this construction from the AdS/CFT perspective and investigate the implications this has for the {AdS_5× S^5} S-matrix.

  11. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region...

  12. Ethical and psychological factors in 5S and total productive maintenance

    OpenAIRE

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-01-01

    Purpose: The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a l...

  13. The Tetrahedron Zamolodchikov Algebra and the AdS5 x S5 S-matrix

    CERN Document Server

    Mitev, Vladimir; Tsuboi, Zengo

    2012-01-01

    The S-matrix of the AdS5 x S5 string theory is a tensor product of two centrally extended su(2|2) S-matrices, each of which is related to the R-matrix of the Hubbard model. The R-matrix of the Hubbard model was first found by Shastry, who ingeniously exploited the fact that, for zero coupling, the Hubbard model can be decomposed into two XX models. In this article, we review and clarify this construction from the AdS/CFT perspective and investigate the implications this has for the AdS5 x S5 S-matrix.

  14. Ichthyophonus parasite phylogeny based on ITS rDNA structure prediction and alignment identifies six clades, with a single dominant marine type

    Science.gov (United States)

    Gregg, Jacob; Thompson, Rachel L.; Purcell, Maureen; Friedman, Carolyn S.; Hershberger, Paul

    2016-01-01

    Despite their widespread, global impact in both wild and cultured fishes, little is known of the diversity, transmission patterns, and phylogeography of parasites generally identified as Ichthyophonus. This study constructed a phylogeny based on the structural alignment of internal transcribed spacer (ITS) rDNA sequences to compare Ichthyophonus isolates from fish hosts in the Atlantic and Pacific oceans, and several rivers and aquaculture sites in North America, Europe, and Japan. Structure of the Ichthyophonus ITS1–5.8S–ITS2 transcript exhibited several homologies with other eukaryotes, and 6 distinct clades were identified within Ichthyophonus. A single clade contained a majority (71 of 98) of parasite isolations. This ubiquitous Ichthyophonus type occurred in 13 marine and anadromous hosts and was associated with epizootics in Atlantic herring, Chinook salmon, and American shad. A second clade contained all isolates from aquaculture, despite great geographic separation of the freshwater hosts. Each of the 4 remaining clades contained isolates from single host species. This study is the first to evaluate the genetic relationships among Ichthyophonus species across a significant portion of their host and geographic range. Additionally, parasite infection prevalence is reported in 16 fish species.

  15. The ribosomal RNA transcription unit of Entamoeba invadens: accumulation of unprocessed pre-rRNA and a long non coding RNA during encystation.

    Science.gov (United States)

    Ojha, Sandeep; Singh, Nishant; Bhattacharya, Alok; Bhattacharya, Sudha

    2013-01-01

    The ribosomal RNA genes in Entamoeba spp. are located on extrachromosomal circular molecules. Unlike model organisms where rRNA transcription stops during growth stress, Entamoeba histolytica continues transcription; but unprocessed pre-rRNA accumulates during stress, along with a novel class of circular transcripts from the 5'-external transcribed spacer (ETS). To determine the fate of rRNA transcription during stage conversion between trophozoite to cyst we analyzed Entamoeba invadens, a model system for differentiation studies in Entamoeba. We characterized the complete rDNA transcription unit by mapping the ends of pre-rRNA and mature rRNAs. The 3' end of mature 28S rRNA was located 321 nt downstream of the end predicted by sequence homology with E. histolytica. The major processing sites were mapped in external and internal transcribed spacers. The promoter located within 146 nt upstream of 5' ETS was used to transcribe the pre-rRNA. On the other hand, a second promoter located at the 3' end of 28S rDNA was used to transcribe almost the entire intergenic spacer into a long non coding (nc) RNA (>10 kb). Interestingly we found that the levels of pre-rRNA and long ncRNA, measured by northern hybridization, decreased initially in cells shifted to encystation medium, after which they began to increase and reached high levels by 72 h when mature cysts were formed. Unlike E. histolytica, no circular transcripts were found in E. invadens. E. histolytica and E. invadens express fundamentally different ncRNAs from the rDNA locus, which may reflect their adaptation to different hosts (human and reptiles, respectively). This is the first description of rDNA organization and transcription in E. invadens, and provides the framework for further studies on regulation of rRNA synthesis during cyst formation.

  16. Boosting transcription by transcription: enhancer-associated transcripts.

    Science.gov (United States)

    Darrow, Emily M; Chadwick, Brian P

    2013-12-01

    Enhancers are traditionally viewed as DNA sequences located some distance from a promoter that act in cis and in an orientation-independent fashion to increase utilization of specific promoters and thereby regulate gene expression. Much progress has been made over the last decade toward understanding how these distant elements interact with target promoters, but how transcription is enhanced remains an object of active inquiry. Recent reports convey the prevalence and diversity of enhancer transcription and transcripts and support both as key factors with mechanistically distinct, but not mutually exclusive roles in enhancer function. Decoupling the causes and effects of transcription on the local chromatin landscape and understanding the role of enhancer transcripts in the context of long-range interactions are challenges that require additional attention. In this review, we focus on the possible functions of enhancer transcription by highlighting several recent enhancer RNA papers and, within the context of other enhancer studies, speculate on the role of enhancer transcription in regulating differential gene expression.

  17. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

    Science.gov (United States)

    Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

    2015-12-21

    5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  18. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  19. Sequencing of 16S rDNA of Klebsiella: taxonomic relations within the genus and to other Enterobacteriaceae.

    Science.gov (United States)

    Boye, Kit; Hansen, Dennis S

    2003-02-01

    The 16S rDNAs of 20 strains of Klebsiella were sequenced and used for construction of a phylogenetic tree together with already published Enterobacteriaceae 16S rDNA sequences. The taxonomy within the Klebsiella genus, as reflected by the 16S rDNA tree, was in agreement with existing DNA-DNA hybridisation and numerical taxonomy data, indicating that for Klebsiella, 16S rDNA sequencing is a valid method for identification and taxonomical purposes. Five closely related clusters were found in the Klebsiella genus; Cluster I, K. oxytoca; Cluster II, K. terrigena, Cluster III, K. planticola and K. ornithinolytica; Cluster IV, Enterobacter aerogenes (K. mobilis); and Cluster V, K. pneumoniae. The position of Calymmatobacterium granulomatis within the genus and closest to K. pneumoniae was confirmed. For the species K. oxytoca, data seem to indicate a subdivision into two subspecies. In addition, a biochemically aberrant Klebsiella strain (BEC441) that was included in the analysis could not be assigned to any of the known species, but was found to be closest related to K. oxytoca. Furthermore, the high sequence similarity between the two environmental species K. planticola and K. ornithinolytica does not justify a distinction of the two species. Finally, within a 165-bp stretch of the 16S rDNA sequences, species-specific nucleotides were found.

  20. Radiolaria Divided into Polycystina and Spasmaria in Combined 18S and 28S rDNA Phylogeny

    Science.gov (United States)

    Dolven, Jane K.; Ose, Randi F.; Klaveness, Dag; Kristensen, Tom; Bjørklund, Kjell R.; Shalchian-Tabrizi, Kamran

    2011-01-01

    Radiolarians are marine planktonic protists that belong to the eukaryote supergroup Rhizaria together with Foraminifera and Cercozoa. Radiolaria has traditionally been divided into four main groups based on morphological characters; i.e. Polycystina, Acantharia, Nassellaria and Phaeodaria. But recent 18S rDNA phylogenies have shown that Phaeodaria belongs within Cerocozoa, and that the previously heliozoan group Taxopodida should be included in Radiolaria. 18S rDNA phylogenies have not yet resolved the sister relationship between the main Radiolaria groups, but nevertheless suggests that Spumellaria, and thereby also Polycystina, are polyphyletic. Very few sequences other than 18S rDNA have so far been generated from radiolarian cells, mostly due to the fact that Radiolaria has been impossible to cultivate and single cell PCR has been hampered by low success rate. Here we have therefore investigated the mutual evolutionary relationship of the main radiolarian groups by using the novel approach of combining single cell whole genome amplification with targeted PCR amplification of the 18S and 28S rDNA genes. Combined 18S and 28S phylogeny of sequences obtained from single cells shows that Radiolaria is divided into two main lineages: Polycystina (Spumellaria+Nassellaria) and Spasmaria (Acantharia+Taxopodida). Further we show with high support that Foraminifera groups within Radiolaria supporting the Retaria hypothesis. PMID:21853146

  1. Sequence analysis of rDNA intergenic spacer region (IGS) as a tool for phylogenetic studies in Trichoderma spp.

    Institute of Scientific and Technical Information of China (English)

    Mercatelli Elisabetta; Pecchia Susanna; Ciliegi Sandro; Vannacci Giovanni

    2004-01-01

    @@ Different from ribosomal genes, which contain highly conserved sequences that are detected in all organisms, the intergenic spacer of rDNA (IGS) appears to be the most rapidly-evolving spacer region. For this reason we tested this region for phylogenetic studies.

  2. Phylogenetic analysis of Thai oyster (Ostreidae) based on partial sequences of the mitochondrial 16S rDNA gene

    DEFF Research Database (Denmark)

    Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik;

    2006-01-01

    Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen...

  3. ASSESSMENT OF FECAL POLLUTION SOURCES IN PLUM CREEK WATERSHED USING BACTEROIDETES 16S RDNA-BASED ASSAYS

    Science.gov (United States)

    Recently, 16S rDNA Bacteroidetes-targeted PCR assays were developed to discriminate between ruminant and human fecal pollution. These assays are rapid and relatively inexpensive but have been used in a limited number of studies. In this study, we evaluated the efficacy o...

  4. ASSESSMENT OF FECAL POLLUTION SOURCES IN PLUM CREEK WATERSHED USING PCR AND PHYLOGENETIC ANALYSES OF BACTEROIDETES 16S RDNA

    Science.gov (United States)

    Traditional methods for assessing fecal pollution in environmental systems, such as monitoring for fecal coliforms are not capable of discriminating between different sources fecal pollution. Recently, 16S rDNA Bacteroidetes-targeted PCR assays were developed to discriminate betw...

  5. Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in the internal transcribed spacer rDNA region in fungi

    Science.gov (United States)

    Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud

    2013-01-01

    The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...

  6. Bottomonium physics at Υ(4S, 5S, 6S) energies with the Belle detector

    Science.gov (United States)

    Tamponi, Umberto

    2016-08-01

    The description of quarkonia as pure quark anti-quark bound states has been recently challenged by the observation of charged states in both the charmonium and bottomonium region and large violations of the heavy quark spin symmetry in hadronic transitions. All these effects can be ascribable to non-negligible contributions from the light quark degrees of freedom in the description of both charmonia and bottomonia. We will report the most recent experimental measurements performed by the Belle collaboration in the Y(4S), Y(5S) and Y(6S) regions, including the measurement of the ratio σ[e+e- → bb̅]/σ[e+e- → μ+ μ- ], the search for neutral states near the B0B̅0 threshold, the first observation of the transition ϒ(4S) → ηhb (lP) and the study of the η transitions at the ϒ(5S) energy. The contribution to the study of the structure of these states coming from the measurement of hadronic transitions will be discussed.

  7. Origin of highly efficient photoluminescence in AgIn5S8 nanoparticles.

    Science.gov (United States)

    Han, Noh Soo; Yoon, Hee Chang; Jeong, Seonghyun; Oh, Ji Hye; Park, Seung Min; Do, Young Rag; Song, Jae Kyu

    2017-07-27

    The photoluminescence of AgIn5S8 nanoparticles was examined to clarify the emissive relaxation processes of defect states and to explain the highly efficient photoluminescence of defect states. The large Stokes shift of the defect emission was explained by strong electron-phonon coupling in the nanoparticles. Steady-state and time-resolved photoluminescence spectroscopy indicated two emissive defect states with characteristic emission energies and lifetimes. Change of the surface-to-volume ratio in the nanoparticles affected the relative contribution of the two states, implying that defect emission in higher energy was attributable to surface-related defects. The defect emission in lower energy was attributable to intrinsic defects, which were also present in bulk. The quantum yield of the surface defects was larger than that of the intrinsic defects, which accounted for the unusually high quantum yield of AgIn5S8 nanoparticles, although the origin of emission was the defect states, not the exciton recombination found in typical semiconductor nanoparticles.

  8. 铟离子5s21S0-5s5p3P0参考用跃迁频率的精密测量%Absolute Frequency Measurements of the Clock Transition 5s2 1S0-5s5p 3P0 in Singly Ionized Indium

    Institute of Scientific and Technical Information of China (English)

    王延辉; 刘涛; A.Stejskal; 赵燕宁; R.Dumke; 张洁; 陆泽晃; 王力军; 董太乾

    2008-01-01

    报道了建立铟单离子(115In+)光频标实验系统的实验进展.单个离子囚禁在Paul-Straubel型离子阱中,利用激光边带冷却技术将其冷却至最低振动能态.为了探测和测量铟离子参考用跃迁5s2 1S0-5s5p 3P0的频率,使用一台Hz量级超窄线宽激光作为探测激光,用以获得量子跳跃信号.用一台以商用铯原子钟为基准的飞秒光频梳作为测量工具,对其频率进行了20次的精密测量,相对不确定度为5.0×10-14.

  9. Coevolution in RNA molecules driven by selective constraints: evidence from 5S rRNA.

    Directory of Open Access Journals (Sweden)

    Nan Cheng

    Full Text Available Understanding intra-molecular coevolution helps to elucidate various structural and functional constraints acting on molecules and might have practical applications in predicting molecular structure and interactions. In this study, we used 5S rRNA as a template to investigate how selective constraints have shaped the RNA evolution. We have observed the nonrandom occurrence of paired differences along the phylogenetic trees, the high rate of compensatory evolution, and the high TIR scores (the ratio of the numbers of terminal to intermediate states, all of which indicate that significant positive selection has driven the evolution of 5S rRNA. We found three mechanisms of compensatory evolution: Watson-Crick interaction (the primary one, complex interactions between multiple sites within a stem, and interplay of stems and loops. Coevolutionary interactions between sites were observed to be highly dependent on the structural and functional environment in which they occurred. Coevolution occurred mostly in those sites closest to loops or bulges within structurally or functionally important helices, which may be under weaker selective constraints than other stem positions. Breaking these pairs would directly increase the size of the adjoining loop or bulge, causing a partial or total structural rearrangement. In conclusion, our results indicate that sequence coevolution is a direct result of maintaining optimal structural and functional integrity.

  10. Coevolution in RNA molecules driven by selective constraints: evidence from 5S rRNA.

    Science.gov (United States)

    Cheng, Nan; Mao, Yuanhui; Shi, Youyi; Tao, Shiheng

    2012-01-01

    Understanding intra-molecular coevolution helps to elucidate various structural and functional constraints acting on molecules and might have practical applications in predicting molecular structure and interactions. In this study, we used 5S rRNA as a template to investigate how selective constraints have shaped the RNA evolution. We have observed the nonrandom occurrence of paired differences along the phylogenetic trees, the high rate of compensatory evolution, and the high TIR scores (the ratio of the numbers of terminal to intermediate states), all of which indicate that significant positive selection has driven the evolution of 5S rRNA. We found three mechanisms of compensatory evolution: Watson-Crick interaction (the primary one), complex interactions between multiple sites within a stem, and interplay of stems and loops. Coevolutionary interactions between sites were observed to be highly dependent on the structural and functional environment in which they occurred. Coevolution occurred mostly in those sites closest to loops or bulges within structurally or functionally important helices, which may be under weaker selective constraints than other stem positions. Breaking these pairs would directly increase the size of the adjoining loop or bulge, causing a partial or total structural rearrangement. In conclusion, our results indicate that sequence coevolution is a direct result of maintaining optimal structural and functional integrity.

  11. Variations of 18S rDNA Loci Among Six Populations of Paeonia obovata Maxim. (Paeoniaceae) Revealed by Fluorescence In Situ Hybridization

    Institute of Scientific and Technical Information of China (English)

    Rui Luo; Chao Wang; Daming Zhang

    2006-01-01

    The localization of 18S ribosomal RNA genes (rDNA) by fluorescence in situ hybridization (FISH) had been performed for some species of Paeonia. However, the pattern of 18S rDNA loci among populations is indistinct. In the present study, we localized 18S rDNA loci on meiotic or mitotic chromosomes of six populations of Paeonia obovata Maxim. (Paeoniaceae). Different numbers of rDNA loci were found with different diploid (2n=10) populations, namely eight (Lushi and Mt. Jiuhua populations), 10 (Mt. Taibai population), and seven (Mt. Guandi population), whereas tetraploid (2n=20) populations were all found with 16 loci. All rDNA loci were mapped near telomeres of mitotic chromosomes and there was no chromosome with two loci. The present results show that molecular cytological polymorphism exists among P. obovata diploid populations, indicating that structural variations occurred frequently during the evolutionary history of this species, accompanied with differentiation among populations.

  12. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S

    1991-01-01

    4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....

  13. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  14. Protein CTC from Aquifex aeolicus possesses a full-sized 5S rRNA-binding domain.

    Science.gov (United States)

    Korobeinikova, A V; Shestakov, S A; Korepanov, A P; Garber, M B; Gongadze, G M

    2009-03-01

    Ribosomal 5S RNA is the only identified target for proteins of the CTC family. All known proteins of this family, except for CTC from Aquifex aeolicus, contain a full-sized 5S rRNA-binding domain. In the present study a mistake in the published A. aeolicus genome is corrected. It has been demonstrated that the ctc gene of this organism encodes the protein with a full-length 5S rRNA-binding domain. This protein binds specifically to the bacterial 5S rRNA. Thereby, our data show that CTC A. aeolicus is not an exception from the other known CTC proteins.

  15. The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes.

    OpenAIRE

    Krol, A; Gallinaro, H; Lazar, E; Jacob, M.; Branlant, C

    1981-01-01

    Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently a...

  16. Comparing the Potential for Identification of Lactobacillus spp. of 16S rDNA Variable Regions

    Directory of Open Access Journals (Sweden)

    Diego Mauricio Riaño-Pachón

    2013-07-01

    Full Text Available 0 0 1 248 1368 Universidad de los Andes 11 3 1613 14.0 Normal 0 21 false false false ES-TRAD JA X-NONE 16s rDNA is used for bacterial identification because its variation rate between species allows differentiation. The gene for this ribosomal subunit has 9 variable regions and some of them give more information than others. We were interested in evaluating the potential for species identification of each region and their combinations. We extracted the V1 to V8 regions of 16s rDNA from different strains and species of Lactobacillus and analyzed them using STAP (ss-RNA Taxonomy Assigning Pipeline and RDP (Ribosomal Database Project multiclassifier packages. Phylogenetic trees obtained by maximum likelihood analyses were compared. Classification results show that many regions give the correct genus classification using RDP and STAP, however they are not enough to classify up to the level of species. V5V6 region presents the highest quantity of informative fragments but also present the highest rate of false negatives. V1V3 region presents the highest rate of true positives (species using STAP and the region V5V8 in RDP (genus.The phylogenetic result shows that the reference topology could be obtained using different combination of regions as V1V3 and V1V8.The experimental validation was done using commercial strains from a probiotic tampon. Sequencing analysis show that the V1V3 region gives the same information and result as the complete 16s rDNA; the three isolated strains correspond to the strains indicated in the product. We conclude that the V1V3 region is the minimum required region to classify Lactobacillus spp. in the correct way and this region is useful in metagenomics to analyze probiotics samples  COMPARACIÓN ENTRE EL POTENCIAL DE LAS REGIONES VARIABLES DEL 16S rDNA PARA LA IDENTIFICACIÓN DE Lactobacillus spp (LactobacilliaceaeEl 16s rDNA es utilizado para la identificación bacteriana dada su tasa de variaci

  17. Minimally Invasive Approach For Extraforaminal Synovial Cyst L5-S1.

    Science.gov (United States)

    Torres Campa-Santamarina, Jose; Towne, Sara; Alimi, Marjan; Navarro-Ramirez, Rodrigo; Härtl, Roger

    2015-10-22

    Symptoms from synovial cysts are produced by neural compression in the spinal canal or the foramen. Few cases of extraforaminal synovial cyst have been published in the literature. This is a case report of a 65-year-old female who presented with a three-month history of sciatic pain and no relief with conservative treatment. MRI showed a left-sided extraforaminal synovial cyst at L5-S1 with compression of the L5 nerve root at the lateral portion of the foramen. Minimally invasive surgery for resection was performed using an extraforaminal tubular microscopic endoscopy-assisted approach. The patient improved clinically and remained symptom-free for the entire follow-up of 30 months.

  18. Donor-acceptor pair recombination in AgIn5S8 single crystals

    Science.gov (United States)

    Gasanly, N. M.; Serpengüzel, A.; Aydinli, A.; Gürlü, O.; Yilmaz, I.

    1999-03-01

    Photoluminescence (PL) spectra of AgIn5S8 single crystals were investigated in the 1.44-1.91 eV energy region and in the 10-170 K temperature range. The PL band was observed to be centered at 1.65 eV at 10 K and an excitation intensity of 0.97 W cm-2. The redshift of this band with increasing temperature and with decreasing excitation intensity was observed. To explain the observed PL behavior, we propose that the emission is due to radiative recombination of a donor-acceptor pair, with an electron occupying a donor level located at 0.06 eV below the conduction band, and a hole occupying an acceptor level located at 0.32 eV above the valence band.

  19. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    Energy Technology Data Exchange (ETDEWEB)

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  20. Low-temperature photoluminescence in CuIn$_5$S$_8$ single crystals

    Indian Academy of Sciences (India)

    GASANLY N M

    2016-06-01

    Photoluminescence (PL) spectra of CuIn$_5$S$_8$ single crystals grown by Bridgman method have been studied in the wavelength region of 720–1020 nm and in the temperature range of 10–34 K. A broad PL band centred at 861 nm (1.44 eV) was observed at $T$ = 10 K. Variations of emission band has been studied as a function of excitation laser intensity in the 0.5–60.2 mW cm$^{−2}$ range. Radiative transitions from shallow donor level located at 17 meV below thebottom of the conduction band to the acceptor level located at 193 meV above the top of the valence band were suggested to be responsible for the observed PL band. An energy level diagram showing transitions in the band gap of the crystal has been presented.

  1. Direct lateral interbody fusion (DLIF) at the lumbosacral junction L5-S1.

    Science.gov (United States)

    Shirzadi, Ali; Birch, Kurtis; Drazin, Doniel; Liu, John C; Acosta, Frank

    2012-07-01

    The direct lateral interbody fusion (DLIF), a minimally invasive lateral approach for placement of an interbody fusion device, does not require nerve root retraction or any contact with the great vessels and can lead to short operative times with little blood loss. Due to anatomical restrictions, this procedure has not been used at the lumbosacral (L5-S1) junction. Lumbosacral transitional vertebrae (LSTV), a structural anomaly of the lumbosacral spine associated with low back pain, can result in a level being wrongly identified pre-operatively due to misnumbering of the vertebral levels. To our knowledge, use of the DLIF graft in this patient is the first report of an interbody fusion graft being placed at the disc space between the LSTV and S1 via the transpsoas route. We present a review of the literature regarding the LSTV variation as well as the lateral placement of interbody fusion grafts at the lumbosacral junction.

  2. "5S"--一个值得借鉴的管理理念

    Institute of Scientific and Technical Information of China (English)

    张平

    2003-01-01

    @@ 我曾在一外资企业上班,工作时间不能干私事、不能会客、不能接打私人电话,各部门除最高主管外一律不得配戴手机,即使是与业务相关的知识也只能利用工余时间"充电",凡有违者,老板或温柔地祝福:"请你一路走好!"或无情地安慰:"公司下次招工,请你再来."自然,打工的日子紧张劳苦.但深深打动我记忆的倒不是此,而是所见高效管理、忙碌有序的"5S"运动.

  3. Trends in evolution of 5S rRNA of deuterostomes: bases and homogeneous clusters

    Directory of Open Access Journals (Sweden)

    Sandra Maria Rodrigues Subacius

    2002-01-01

    Full Text Available Evolution of metazoan 5S rRNA sequences was analyzed through base composition and types, location and frequency of clustered bases. Characters from sequences of protostomes did not show regular trends as compared with paleontology dating or organism complexity. Trends of increasing G and C, stronger in G clusters, and decreasing A and U, were detected in deuterostomes, in parallel with evolution of complexity. The multifunctional domain 71-104 was highlighted among conserved stretches. Clusters of C were typical of helices. Those of G were longer, extending from helices into loops or related to bulges, which is suggestive of functional significance. Deuterostomian trends were installed early in the lineage and reached full development in aquatic organisms, not increasing further after reptiles. It can be suggested that ribosomal RNA structures participated in deuterostomian high regulatory complexity, either specifically or as part of the widespread processes of chromosomal regionalization.

  4. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    Science.gov (United States)

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  5. Transcription in archaea

    Science.gov (United States)

    Kyrpides, N. C.; Ouzounis, C. A.; Woese, C. R. (Principal Investigator)

    1999-01-01

    Using the sequences of all the known transcription-associated proteins from Bacteria and Eucarya (a total of 4,147), we have identified their homologous counterparts in the four complete archaeal genomes. Through extensive sequence comparisons, we establish the presence of 280 predicted transcription factors or transcription-associated proteins in the four archaeal genomes, of which 168 have homologs only in Bacteria, 51 have homologs only in Eucarya, and the remaining 61 have homologs in both phylogenetic domains. Although bacterial and eukaryotic transcription have very few factors in common, each exclusively shares a significantly greater number with the Archaea, especially the Bacteria. This last fact contrasts with the obvious close relationship between the archaeal and eukaryotic transcription mechanisms per se, and in particular, basic transcription initiation. We interpret these results to mean that the archaeal transcription system has retained more ancestral characteristics than have the transcription mechanisms in either of the other two domains.

  6. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  7. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  8. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    Science.gov (United States)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  9. The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

    OpenAIRE

    Takaiwa, F.; Kusuda, M; SUGIURA, M.

    1982-01-01

    The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

  10. Differential effects of high-temperature stress on nuclear topology and transcription of repetitive noncoding and coding rye sequences.

    Science.gov (United States)

    Tomás, D; Brazão, J; Viegas, W; Silva, M

    2013-01-01

    The plant stress response has been extensively characterized at the biochemical and physiological levels. However, knowledge concerning repetitive sequence genome fraction modulation during extreme temperature conditions is scarce. We studied high-temperature effects on subtelomeric repetitive sequences (pSc200) and 45S rDNA in rye seedlings submitted to 40°C during 4 h. Chromatin organization patterns were evaluated through fluorescent in situ hybridization and transcription levels were assessed using quantitative real-time PCR. Additionally, the nucleolar dynamics were evaluated through fibrillarin immunodetection in interphase nuclei. The results obtained clearly demonstrated that the pSc200 sequence organization is not affected by high-temperature stress (HTS) and proved for the first time that this noncoding subtelomeric sequence is stably transcribed. Conversely, it was demonstrated that HTS treatment induces marked rDNA chromatin decondensation along with nucleolar enlargement and a significant increase in ribosomal gene transcription. The role of noncoding and coding repetitive rye sequences in the plant stress response that are suggested by their clearly distinct behaviors is discussed. While the heterochromatic conformation of pSc200 sequences seems to be involved in the stabilization of the interphase chromatin architecture under stress conditions, the dynamic modulation of nucleolar and rDNA topology and transcription suggest their role in plant stress response pathways.

  11. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  12. mTOR associates with TFIIIC, is found at tRNA and 5S rRNA genes, and targets their repressor Maf1.

    Science.gov (United States)

    Kantidakis, Theodoros; Ramsbottom, Ben A; Birch, Joanna L; Dowding, Sarah N; White, Robert J

    2010-06-29

    Synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is regulated by the mTOR pathway in mammalian cells. The mTOR kinase localizes to tRNA and 5S rRNA genes, providing an opportunity for direct control. Its presence at these sites can be explained by interaction with TFIIIC, a DNA-binding factor that recognizes the promoters of these genes. TFIIIC contains a TOR signaling motif that facilitates its association with mTOR. Maf1, a repressor that binds and inhibits pol III, is phosphorylated in a mTOR-dependent manner both in vitro and in vivo at serine 75, a site that contributes to its function as a transcriptional inhibitor. Proximity ligation assays confirm the interaction of mTOR with Maf1 and TFIIIC in nuclei. In contrast to Maf1 regulation in yeast, no evidence is found for nuclear export of Maf1 in response to mTOR signaling in HeLa cells. We conclude that mTOR associates with TFIIIC, is recruited to pol III-transcribed genes, and relieves their repression by Maf1.

  13. Changes in the conformation of 5S rRNA cause alterations in principal functions of the ribosomal nanomachine.

    Science.gov (United States)

    Kouvela, Ekaterini C; Gerbanas, George V; Xaplanteri, Maria A; Petropoulos, Alexandros D; Dinos, George P; Kalpaxis, Dimitrios L

    2007-01-01

    5S rRNA is an integral component of the large ribosomal subunit in virtually all living organisms. Polyamine binding to 5S rRNA was investigated by cross-linking of N1-azidobenzamidino (ABA)-spermine to naked 5S rRNA or 50S ribosomal subunits and whole ribosomes from Escherichia coli cells. ABA-spermine cross-linking sites were kinetically measured and their positions in 5S rRNA were localized by primer extension analysis. Helices III and V, and loops A, C, D and E in naked 5S rRNA were found to be preferred polyamine binding sites. When 50S ribosomal subunits or poly(U)-programmed 70S ribosomes bearing tRNA(Phe) at the E-site and AcPhe-tRNA at the P-site were targeted, the susceptibility of 5S rRNA to ABA-spermine was greatly reduced. Regardless of 5S rRNA assembly status, binding of spermine induced significant changes in the 5S rRNA conformation; loop A adopted an apparent 'loosening' of its structure, while loops C, D, E and helices III and V achieved a more compact folding. Poly(U)-programmed 70S ribosomes possessing 5S rRNA cross-linked with spermine were more efficient than control ribosomes in tRNA binding, peptidyl transferase activity and translocation. Our results support the notion that 5S rRNA serves as a signal transducer between regions of 23S rRNA responsible for principal ribosomal functions.

  14. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    Science.gov (United States)

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  15. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Jie Hong

    Full Text Available Mechanisms of the progression from Barrett's esophagus (BE to esophageal adenocarcinoma (EA are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  16. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Science.gov (United States)

    Hong, Jie; Li, Dan; Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett's esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  17. Molecular phylogeny of black flies (Diptera: Simuliidae) from Thailand, using ITS2 rDNA.

    Science.gov (United States)

    Thanwisai, Aunchalee; Kuvangkadilok, Chaliow; Baimai, Visut

    2006-01-01

    The sequences of the second internal transcribed spacer (ITS2) of ribosomal DNA (rDNA) were determined for 40 black fly species from Thailand, belonging to 4 subgenera of the genus Simulium, namely Gomphostilbia (12 species), Nevermannia (5 species), Montisimulium (1 species), Simulium sensu stricto (21 species), and an unknown subgenus with one species (Simulium baimaii). The length of the ITS2 ranged from 247 to 308 bp. All black fly species had high AT content, ranging from 71 to 83.8%. Intraindividual variation (clonal variation) occurred in 13 species, ranging from 0.3 to 1.1%. Large intrapopulation and interpopulation heterogeneities exist in S. feuerboni from the same and different locations in Doi Inthanon National Park, northern Thailand. Phylogenetic relationships among 40 black fly species were examined using PAUP (version 4.0b10) and MrBAYS (version 3.0B4). The topology of the trees revealed two major monophyletic clades. The subgenus Simulium and Simulium baimaii were placed in the first monophyletic clade, whereas the subgenera Nevermannia + Montisimulium were placed as the sister group to the subgenus Gomphostilbia in the second monophyletic clade. Our results suggest that S. baimaii belongs to the malyschevi-group or variegatum-group in the subgenus Simulium. The molecular phylogeny generally agrees with existing morphology-based phylogenies.

  18. CONTRIBUTION TO THE PHYLOGENY OF THE PANGASIIDAE BASED ON MITOCHONDRIAL 12S RDNA

    Directory of Open Access Journals (Sweden)

    L. Pouyaud

    2016-10-01

    Full Text Available Catfishes are generally one of the economically important groups of fresh and brackish water fishes in the world. In many countries, they form a significant part of inland fisheries, and several species have been  introduced in fish culture. Judging from literature, the main constraint to cultivate wild species and to optimise the production of pangasiid catfishes is due to the poorly documented systematics of this family. In the present contribution, the phylogenetic relationships within Pangasiidae are studied to contribute to a better insight in their taxonomy and evolution. The genetic relatedness is inferred using mitochondrial 12S rDNA gene sequences. To resolve the phylogenetic position of Laides in this group of catfish, five genera of Asian and African Schilbeidae are also considered. The results showed that a species group (complex could be clearly seen in the genetic tree. Pangasius is more derive than the other genera. By using approximate molecular clock/evolutionary calibration from  mitochondrial gene, a new episode of  speciation for the family marked explosive radiation about 5- 8 million years ago (mya. This adaptive radiation extended until the Late Pleistocene. Regarding the relationships between the Pangasiidae and Schilbeidae, two families show an allopatric distribution with slight overlap. The Pangasiidae occur mainly in Southeast Asia, while the Schilbeidae are seen mainly on the Indian subcontinent (including Myanmar and Africa. It confirms the separation between  Schilbeidae and Pangasiidae occurred in the Early Miocene.

  19. The 18S rDNA sequences support polyphyly of the Hypsibiidae (Eutardigrada

    Directory of Open Access Journals (Sweden)

    Hartmut GREVEN

    2007-09-01

    Full Text Available To extend data on 18S rDNA gene phylogeny within the Eutardigrada and to provide additional information on unclear taxonomic status of a glacier tardigrade Hypsibius klebelsbergi, gene sequences from seven tardigrade species of the family Hypsibiidae (Hypsibius klebelsbergi, Hypsibius cf. convergens 1, Hypsibius cf. convergens 2, Hypsibius scabropygus, Hebensuncus conjungens, Isohypsibius cambrensis, Isohypsibius granulifer were analysed together with previously published sequences from ten further eutardigrade species or species groups. Three distinctly separated clades within the Hypsibiidae, 1 the Ramazzottius - Hebesuncus clade, 2 the Isohypsibius clade (Isohypsibius, Halobiotus, Thulinius, and 3 the Hypsibius clade (Hypsibius spp. have been obtained in each of four phylogenetic trees recovered by Maximum Parsimony, Neighbour Joining, Minimum Evolution and UPGMA. Hybsibius klebelsbergi has been located always within the Hypsibius clade. The detailed sister group relationship was not resolved adequately, but there is robust support for a sister group relationship between the Hypsibius clade and the remaining clades. We cannot exclude that the Ramazzottius - Hebesuncus clade is a sister group of the Macrobiotus clade. Our findings suggest polyphyly of the Hypsibiidae, and thus multiple evolutions of some structures currently applied as diagnostic characters (e.g., claws, buccal apophyses.

  20. 18S rDNA phylogeny of lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa).

    Science.gov (United States)

    Fiore-Donno, Anna Maria; Kamono, Akiko; Meyer, Marianne; Schnittler, Martin; Fukui, Manabu; Cavalier-Smith, Thomas

    2012-01-01

    The phylogenetic position of the slime-mould genus Lamproderma (Myxomycetes, Amoebozoa) challenges traditional taxonomy: although it displays the typical characters of the order Stemonitales, it appears to be sister to Physarales. This study provides a small subunit (18S or SSU) ribosomal RNA gene-based phylogeny of Lamproderma and its allies, with new sequences from 49 specimens in 12 genera. We found that the order Stemonitales and Lamproderma were both ancestral to Physarales and that Lamproderma constitutes several clades intermingled with species of Diacheopsis, Colloderma and Elaeomyxa. We suggest that these genera may have evolved from Lamproderma by multiple losses of fruiting body stalks and that many taxonomic revisions are needed. We found such high genetic diversity within three Lamproderma species that they probably consist of clusters of sibling species. We discuss the contrasts between genetic and morphological divergence and implications for the morphospecies concept, highlighting the phylogenetically most reliable morphological characters and pointing to others that have been overestimated. In addition, we showed that the first part (~600 bases) of the SSU rDNA gene is a valuable tool for phylogeny in Myxomycetes, since it displayed sufficient variability to distinguish closely related taxa and never failed to cluster together specimens considered of the same species.

  1. 18S rDNA phylogeny of lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa.

    Directory of Open Access Journals (Sweden)

    Anna Maria Fiore-Donno

    Full Text Available The phylogenetic position of the slime-mould genus Lamproderma (Myxomycetes, Amoebozoa challenges traditional taxonomy: although it displays the typical characters of the order Stemonitales, it appears to be sister to Physarales. This study provides a small subunit (18S or SSU ribosomal RNA gene-based phylogeny of Lamproderma and its allies, with new sequences from 49 specimens in 12 genera. We found that the order Stemonitales and Lamproderma were both ancestral to Physarales and that Lamproderma constitutes several clades intermingled with species of Diacheopsis, Colloderma and Elaeomyxa. We suggest that these genera may have evolved from Lamproderma by multiple losses of fruiting body stalks and that many taxonomic revisions are needed. We found such high genetic diversity within three Lamproderma species that they probably consist of clusters of sibling species. We discuss the contrasts between genetic and morphological divergence and implications for the morphospecies concept, highlighting the phylogenetically most reliable morphological characters and pointing to others that have been overestimated. In addition, we showed that the first part (~600 bases of the SSU rDNA gene is a valuable tool for phylogeny in Myxomycetes, since it displayed sufficient variability to distinguish closely related taxa and never failed to cluster together specimens considered of the same species.

  2. Rate accelerations in nuclear 18S rDNA of mycoheterotrophic and parasitic angiosperms.

    Science.gov (United States)

    Lemaire, Benny; Huysmans, Suzy; Smets, Erik; Merckx, Vincent

    2011-09-01

    Rate variation in genes from all three genomes has been observed frequently in plant lineages with a parasitic and mycoheterotrophic mode of life. While the loss of photosynthetic ability leads to a relaxation of evolutionary constraints in genes involved in the photosynthetic apparatus, it remains to be determined how prevalent increased substitution rates are in nuclear DNA of non-photosynthetic angiosperms. In this study we infer rates of molecular evolution of 18S rDNA of all parasitic and mycoheterotorphic plant families (except Lauraceae and Polygalaceae) using relative rate tests. In several holoparasitic and mycoheterotrophic plant lineages extremely high substitution rates are observed compared to other photosynthetic angiosperms. The position and frequency of these substitutions have been identified to understand the mutation dynamics of 18S rRNA in achlorophyllous plants. Despite the presence of significantly elevated substitution rates, very few mutations occur in major functional and structural regions of the small ribosomal molecule, providing evidence that the efficiency of the translational apparatus in non-photosynthetic plants has not been affected.

  3. Karyotypes, heterochromatin, and physical mapping of 18S-26S rDNA in Cactaceae.

    Science.gov (United States)

    Las Peñas, M L; Urdampilleta, J D; Bernardello, G; Forni-Martins, E R

    2009-01-01

    Karyotype analyses in members of the four Cactaceae subfamilies were performed. Numbers and karyotype formula obtained were: Pereskioideae = Pereskiaaculeata(2n = 22; 10 m + 1 sm), Maihuenioideae = Maihuenia patagonica (2n = 22, 9 m + 2 sm; 2n = 44, 18 m + 4 sm), Opuntioideae = Cumulopuntia recurvata(2n = 44; 20 m + 2 sm), Cactoideae = Acanthocalycium spiniflorum (2n = 22; 10 m + 1 sm),Echinopsis tubiflora (2n = 22; 10 m + 1 sm), Trichocereus candicans (2n = 22, 22 m). Chromosomes were small, the average chromosome length was 2.3 mum. Diploid species and the tetraploid C. recurvata had one terminal satellite, whereas the remaining tetraploid species showed four satellited chromosomes. Karyotypes were symmetrical. No CMA(-)/DAPI(+) bands were detected, but CMA(+)/DAPI(-) bands associated with NOR were always found. Pericentromeric heterochromatin was found in C. recurvata, A. spiniflorum, and the tetraploid cytotype of M. patagonica. The locations of the 18S-26S rDNA sites in all species coincided with CMA(+)/DAPI(-) bands; the same occurred with the sizes and numbers of signals for each species. This technique was applied for the first time in metaphase chromosomes in cacti. NOR-bearing pair no.1 may be homeologous in all species examined. In Cactaceae, the 18S-26S loci seem to be highly conserved.

  4. Molecular phylogeny of the butterfly tribe Satyrini (Nymphalidae: Satyrinae) with emphasis on the utility of ribosomal mitochondrial genes 16s rDNA and nuclear 28s rDNA.

    Science.gov (United States)

    Yang, Mingsheng; Zhang, Yalin

    2015-07-09

    The tribe Satyrini is one of the most diverse groups of butterflies, but no robust phylogenetic hypothesis for this group has been achieved. Two rarely used 16s and 28s ribosomal and another seven protein-coding genes were used to reconstruct the phylogeny of the Satyrini, with further aim to evaluate the informativeness of the ribosomal genes. Our maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference (BI) analyses consistently recovered three well-supported clades for the eleven sampled subtribes of Satyrini: clade I includes Eritina and Coenonymphina, being sister to the clade II + clade III; clade II contains Parargina, Mycalesina and Lethina, and the other six subtribes constitute clade III. The placements of the taxonomically unstable Davidina Oberthür and geographically restricted Paroeneis Moore in Satyrina are confirmed for the first time based on molecular evidence. The close relationships of Callerebia Butler, Loxerebia Watkins and Argestina Riley are well-supported. We suggest that Rhaphicera Butler belongs to Lethina. The partitioned Bremer support (PBS) values of MP analysis show that the 16s rDNA contributes well to the nodes representing all the taxa from subtribe to species levels, and the 28s rDNA is informative at the subtribe level. Furthermore, our ML analyses show that the ribosomal genes 16s rDNA and 28s rDNA are informative, because most node support values are lower in the ML tree after the removal of them than that in ML tree constructed based on the full nine-gene dataset. This indicates that some other ribosomal genes should be tentatively used through combining with traditionally used protein-coding genes in further analysis on phylogeny of Satyrini, providing that proper representatives are sampled.

  5. Prediction of anomalous $\\Upsilon(5S)\\to\\Upsilon(1^3D_J)\\eta$ transitions

    CERN Document Server

    Wang, Bo; Liu, Xiang

    2016-01-01

    In this work, we study the hadronic loop contribution to the $\\Upsilon(5S)\\to \\Upsilon(1^3D_J)\\eta$ ($J=1,2,3$) transitions. We predict that the branching ratios of $\\Upsilon(5S)\\to \\Upsilon(1^3D_1)\\eta$, $\\Upsilon(5S)\\to \\Upsilon(1^3D_2)\\eta$ and $\\Upsilon(5S)\\to \\Upsilon(1^3D_3)\\eta$ can reach up to $(0.5\\sim5.1)\\times10^{-3}$, $(0.7\\sim7.5)\\times10^{-3}$ and $(0.9\\sim9.6)\\times10^{-4}$, respectively. Since these predicted hadronic transitions of $\\Upsilon(5S)$ are comparable with these observed $\\Upsilon(5S)\\to \\Upsilon(nS)\\pi^+\\pi^-$ $(n=1,2,3)$, we suggest future experiment like Belle and BelleII to carry out the search for these anomalous $\\Upsilon(5S)\\to \\Upsilon(1^3D_J)\\eta$ transitions.

  6. Primers are designed for amplification and direct sequencing of ITS region of rDNA from Myxomycetes.

    Science.gov (United States)

    Martín, María P; Lado, Carlos; Johansen, Steinar

    2003-01-01

    Four new primers were designed, based on comparison of Physarum polycephalum sequences retrieved from Genbank (primers PHYS-5 and PHYS-4) and our own sequences (primers PHYS-3 and PHYS-2), to amplify the ITS regions of rDNA, including the 5.8S gene segment from Lamproderma species. Sequencing analysis shows that Lamproderma contains ITS1-5.8S-ITS2 regions of approximately 900 bp, which is similar in size to most eukaryotes. However, the corresponding region in another common myxomycete, Fuligo septica, is more than 2000 bp due to the presence of large direct-repeat motifs in ITS1. Myxomycete rDNA ITS regions are interesting both as phylogenetic markers in taxonomic studies and as model sequences for molecular evolution.

  7. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    Science.gov (United States)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  8. Effect of prosthesis endplate lordosis angles on L5-S1 kinematics after disc arthroplasty.

    Science.gov (United States)

    Tsitsopoulos, Parmenion P; Wojewnik, Bartosz; Voronov, Leonard I; Havey, Robert M; Renner, Susan M; Zelenakova, Julia; McIntosh, Braden; Carandang, Gerard; Abjornson, Celeste; Patwardhan, Avinash G

    2012-06-01

    We hypothesized that L5-S1 kinematics will not be affected by the lordosis distribution between the prosthesis endplates. Twelve cadaveric lumbosacral spines (51.3 ± 9.8 years) were implanted with 6° or 11° prostheses (ProDisc-L) with four combinations of superior/inferior lordosis (6°/0°, 3°/3°, 11°/0°, 3°/8°). Specimens were tested intact and after prostheses implantation with different lordosis distributions. Center of rotation (COR) and range of motion (ROM) were quantified. Six-degree lordosis prostheses (n = 7) showed no difference in flexion-extension ROM, regardless of design (6°/0° or 3°/3°) (p > 0.05). In lateral bending (LB), both designs reduced ROM (p lordosis prostheses (n = 5) showed no difference in flexion-extension ROM for either design (p > 0.05). LB ROM decreased with distributed lordosis prostheses (3°/8°) (p lordosis distribution among the two prosthesis endplates. The ProDisc-L prosthesis design where all lordosis is concentrated in the superior endplate yielded COR locations that were anterior and caudal to intact controls. The prosthesis with lordosis distributed between the two endplates yielded a COR that tended to be closer to intact. Further clinical and biomechanical studies are needed to assess the long-term impact of lordosis angle distribution on the fate of the facet joints.

  9. Application of "5 S" Management in University Based in Chemical Laboratory%将"5S"管理方法引入高校基础化学实验室

    Institute of Scientific and Technical Information of China (English)

    刘明星

    2016-01-01

    阐述了源自日本的"5S"管理的含义、 目的和要点.指出了和目前高校基础化学实验室存在现状和问题.结合基础化学实验室的特点和实际情况提出了"5S"管理在化学实验室中具体实施的措施和方法.介绍了"5S"管理在有机化学实验室试点实施中取得的的效果.指出了管理层在基础化学实验室全面推广"5S"管理的过程中需要承担的责任和需要解决的问题.

  10. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    DEFF Research Database (Denmark)

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

  11. Authentication of Curcuma species (Zingiberaceae) based on nuclear 18S rDNA and plastid trnK sequences.

    Science.gov (United States)

    Cao, Hui; Sasaki, Yohei; Fushimi, Hirotoshi; Komatsu, Katsuko

    2010-07-01

    Curcuma drugs have been used discriminatingly for invigorating blood circulation, promoting digestion, and as a cholagogic in China. However, there is confusion about the drug's botanical origins and clinical uses because of morphological similarity of Curcuma plants and drugs. Comparative sequencing of the 18S rRNA gene in nuclear ribosomal DNA (rDNA) and trnK gene in chloroplast DNA (cpDNA) was carried out in order to examine interspecies phylogeny and to identify ultimately Curcuma species. A total of a hundred of accessions of eighteen species were analyzed. This resulted in an aligned matrix of 1810 bp for 18S rDNA and 2 800 bp for trnK. 18S rDNA sequence divergence within the ingroup ranged from 0-0.05%, trnK ranged from 0-0.19%. One base transversion-substituted site (from cytosine to thymine) was observed from the upstream of 18S rDNA at nucleotide position 234 in C. kwangsiensis and Japanese population of C. zedoaria which have separated genetic distance to other Curcuma taxa. Two noncoding regions embedded in trnK intron showed higher variability, including nucleotide substitutions, repeat insertion and deletions. Based on consensus of relationship, eighteen major lineages within Curcuma are recognized at the species level. The results suggest that Curcuma is monophyletic with 100% bootstrap support and sister to the genera Hedychium and Zingiber. The trnK sequences showed considerable variations between Curcuma species and thus were revealed as a promising candidate for barcoding of Curcuma species, which provide valuable characters for inferring relationship within species but are insufficient to resolve relationships among closely related taxa.

  12. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs.

  13. Sequence analysis of the ITS region and 5.8S rDNA of Porphyra haitanensis

    Institute of Scientific and Technical Information of China (English)

    LI Yanyan; SHEN Songdong; HE Lihong; XU Pu; WANG Guangce

    2009-01-01

    The sequences of the ITS (internal transcribed spacer) and 5.8S rDNA of three cultivated strains of Porphyra haitanensis thalli (NB, PT and ST) were amplified, sequenced and analyzed. In addition, the phylogenic relationships of the sequences identified in this study with those of other Porphyra retrieved from GenBank were evaluated. The results are as follows: the sequences of the ITS and 5.8S rDNA were essentially identical among the three strains. The sequences of ITS1 were 331 bp to 334 bp, while those of the 5.8S rDNA were 158 bp and the sequences of ITS2 ranged from 673 bp to 681 bp. The sequences of the ITS had a high level of homology (up to 99.5%) with that of P. haitanensis (DQ662228) retrieved from GenBank, but were only approximately 50% homologous with those of other species of Porphyra. The results obtained when a phylogenetic tree was constructed coincided with the results of the homology analysis. These results suggest that the three cultivated strains of P. haitanensis evolved conservatively and that the ITS showed evolutionary consistency. However, the sequences of the ITS and 5.8S rDNA of different Porphyra species showed great variations. Therefore, the relationship of Porphyra interspecies phyletic evolution could be judged, which provides the proof for Porphyra identification study. However, proper classifications of the subspecies and the populations of Porphyra should be determined through the use of other molecular techniques to determine the genetic variability and rational phylogenetic relationships.

  14. Phylogenetic position of the family Orientocreadiidae within the superfamily Plagiorchioidea (Trematoda) based on partial 28S rDNA sequence.

    Science.gov (United States)

    Sokolov, S G; Shchenkov, S V

    2017-08-22

    Trematodes of the family Orientocreadiidae are mostly parasites of freshwater fishes. Here, the phylogenetic position of this family is inferred based on the partial 28S rDNA sequence from a representative of the genus Orientocreadium s. str.-О. pseudobagri Yamaguti, 1934. Sequences were analysed by maximum likelihood and Bayesian inference algorithms. Both approaches placed the Orientocreadiidae within a clade corresponding to the superfamily Plagiorchioidea and supported the family Leptophallidae as a sister taxon.

  15. Intragenomic Profiling Using Multicopy Genes: The rDNA Internal Transcribed Spacer Sequences of the Freshwater Sponge Ephydatia fluviatilis.

    Directory of Open Access Journals (Sweden)

    Liisi Karlep

    Full Text Available Multicopy genes, like ribosomal RNA genes (rDNA, are widely used to describe and distinguish individuals. Despite concerted evolution that homogenizes a large number of rDNA gene copies, the presence of different gene variants within a genome has been reported. Characterization of an organism by defining every single variant of tens to thousands of rDNA repeat units present in a eukaryotic genome would be quite unreasonable. Here we provide an alternative approach for the characterization of a set of internal transcribed spacer sequences found within every rDNA repeat unit by implementing direct sequencing methodology. The prominent allelic variants and their relative amounts characterizing an individual can be described by a single sequencing electropherogram of the mixed amplicon containing the variants present within the genome. We propose a method for rational analysis of heterogeneity of multicopy genes by compiling a profile based on quantification of different sequence variants of the internal transcribed spacers of the freshwater sponge Ephydatia fluviatilis as an example. In addition to using conventional substitution analysis, we have developed a mathematical method, the proportion model method, to quantify the relative amounts of allelic variants of different length using data from direct sequencing of the heterogeneous amplicon. This method is based on determining the expected signal intensity values (corresponding to peak heights from the sequencing electropherogram by sequencing clones from the same or highly similar amplicon and comparing hypothesized combinations against the values obtained by direct sequencing of the heterogeneous amplicon. This method allowed to differentiate between all specimens analysed.

  16. Usefulness of 16S rDNA sequencing for the diagnosis of infective endocarditis caused by Corynebacterium diphtheriae.

    Science.gov (United States)

    Pathipati, Padmaja; Menon, Thangam; Kumar, Naveen; Francis, Thara; Sekar, Prem; Cherian, Kotturathu Mammen

    2012-08-01

    We report a rare case of infective endocarditis caused by Corynebacterium diphtheriae in an 8-year-old boy, 2 years after a right ventricular outflow tract reconstruction with a bovine Contegra valved conduit. The patient recovered well after an RV-PA conduit enblock explantation and replacement with an aortic homograft with antibiotic treatment. All bacteriological cultures of excised tissue and blood were negative. The aetiological agent was identified as C. diphtheriae subsp. gravis by 16s rDNA sequencing.

  17. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J

    2010-09-01

    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  18. Comparison of rDNA sequences from colchicine treated and untreated sporocysts of Phyllodistomum folium and Bucephalus polymorphus (Digenea).

    Science.gov (United States)

    Stunzenas, Virmantas; Cryan, Jason R; Molloy, Daniel P

    2004-09-01

    The most frequently used antimitotic agent in cytogenetic studies is colchicine. We investigated whether the initial treatment of trematodes for karyological analysis with colchicine would have mutagenic or degradational effect on rDNA sequences. Dreissena polymorpha is the intermediate host of Phyllodistomum folium and Bucephalus polymorphus, and the sporocyst stage of these trematode species develop, respectively, in the gills and gonads of this mussel. Sporocysts of P. folium and B. polymorphus were obtained from D. polymorpha collected from waterbodies in Belarus and in Lithuania. 5.8S and 28S rDNA genes, ITS1 and ITS2 of P folium and B. polymorphus were sequenced and compared, and no nucleotide sequence differences between colchicine treated and untreated trematodes were found. Based on these results, we conclude that colchicine treatment for 3-5 h has no mutagenic or degradational effect on rDNA sequences. During the course of this investigation, two genetically different P. folium samples were noted in Belarus.

  19. Immunological inter-strain crossreactivity correlated to 18S rDNA sequence types in Acanthamoeba spp.

    Science.gov (United States)

    Walochnik, J; Obwaller, A; Aspöck, H

    2001-02-01

    Various species of the genus Acanthamoeba have been described as potential pathogens; however, differentiation of acanthamoebae remains problematic. The genus has been divided into 12 18S rDNA sequence types, most keratitis causing strains exhibiting sequence type T4. We recently isolated a keratitis causing Acanthamoeba strain showing sequence type T6, but being morphologically identical to a T4 strain. The aim of our study was to find out, whether the 18S rDNA sequence based identification correlates to immunological differentiation. The protein and antigen profiles of the T6 isolate and three reference Acanthamoeba strains were investigated using two sera from Acanthamoeba keratitis patients and one serum from an asymptomatic individual. It was shown, that the T6 strain produces a distinctly different immunological pattern, while patterns within T4 were identical. Affinity purified antibodies were used to further explore immunological cross-reactivity between sequence types. Altogether, the results of our study support the Acanthamoeba 18S rDNA sequence type classification in the investigated strains.

  20. Chromosome evolution in tiger beetles: Karyotypes and localization of 18S rDNA loci in Neotropical Megacephalini (Coleoptera, Cicindelidae

    Directory of Open Access Journals (Sweden)

    Sónia J.R. Proença

    2005-12-01

    Full Text Available Four Neotropical tiger beetle species, three from the genus Megacephala and one from the genus Oxycheila, currently assigned to the tribe Megacephalini were examined cytogenetically. All three Megacephala species showed simple sex chromosome systems of the X0/XX type but different numbers of autosomal pairs (15 in M. cruciata, 14 in M. sobrina and 12 in M. rutilans, while Oxycheila tristis was inferred to have a multiple sex chromosome system with four X chromosomes (2n = 24 + X1X2X3X4Y/X1X1X2X2X3X3X4X4. Fluorescence in situ hybridization (FISH using a PCR-amplified 18S rDNA fragment as a probe revealed the presence of rDNA clusters located exclusively on the autosomes in all the Megacephala species (five clusters in M. cruciata, eight in M. sobrina and three in M. rutilans, indicating variability in the number of clusters and the presence of structural polymorphisms. The same methodology showed that O. tristis had six rDNA clusters, apparently also located on the autosomes. Although our data also show cytogenetic variability within the genus Megacephala, our findings support the most accepted hypothesis for chromosome evolution in the family Cicindelidae. The description of multiple sex chromosomes in O. tristis along with phylogenetic analyses and larval morphological characters may be assumed as an additional evidence for the exclusion of the genus Oxycheila and related taxa from the tribe Megacephalini.

  1. New Paramecium quadecaurelia strains (P. aurelia spp. complex, Ciliophora) identified by molecular markers (rDNA and mtDNA).

    Science.gov (United States)

    Przyboś, Ewa; Tarcz, Sebastian; Dusi, Eike

    2013-08-01

    Paramecium quadecaurelia is a rare species (previously known only from two locations) belonging to the P. aurelia species complex. In the present paper, fragments of an rDNA gene (ITS1-5.8S-ITS2-5' rDNA) and mtDNA genes (cytochrome oxidase subunit I and cytochrome b regions) were employed to assist in the identification and characterization of three new strains collected from Ecuador and Thailand. Molecular data were confirmed by mating reactions. In rDNA and mtDNA trees constructed for species of the P. aurelia complex, all P. quadecaurelia strains, including the three new strains discussed in this study and two known previously from Australia and Africa, form a monophyletic but differentiated clade. The present study shows that genetic differentiation among the strains of P. quadecaurelia is equal to or even greater than the distances between some other P. aurelia species, e.g., P. primaurelia and P. pentaurelia. Such great intra-specific differentiation may indicate a future splitting of the P. quadecaurelia species into reproductively isolated lines. Copyright © 2012 Elsevier GmbH. All rights reserved.

  2. Molecular characterization of Stictodora tridactyla (Trematoda: Heterophyidae) from Kuwait Bay using rDNA ITS and mtCO1.

    Science.gov (United States)

    Al-Kandari, Wafa Y; Alnaqeeb, Majed A; Isaac, Asha M; Al-Bustan, Suzanne A

    2015-11-01

    Stictodora tridactyla is an intestinal fluke in the family Heterophyidae that parasitizes shorebirds and mammals, including humans. Its metacercarial cyst stage was reported in the Arabian killifish, Aphanius dispar, at Kuwait Bay. In the present study, Cerithidea cingulata was found to serve as the first intermediate host of S. tridactyla. In order to establish the snail-fish link in the life cycle of S. tridactyla, complete sequences of ribosomal DNA internal transcribed spacer region 1 and 2 (rDNA ITS1 and ITS2) and partial sequence of cytochrome oxidase subunit 1 were obtained for metacercarial cysts isolated from the fish A. dispar and rediae isolated from the snail C. cingulata. Sequence alignment demonstrated that these larval stages belong to the same heterophyid species, S. tridactyla. Phylogenetic analysis based on rDNA ITS1, ITS2, and mtCO1 confirmed the position of S. tridactyla within the Heterophyidae and found it to cluster with Haplorchis spp. The present study represents the first molecular study correlating the larval stages of S. tridactyla using rDNA ITS1, ITS2, and mtCO1 and examining the phylogenetic relationships of S. tridactyla with different heterophyid species.

  3. Targeting of the human coagulation factor IX gene at rDNA locus of human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Xionghao Liu

    Full Text Available BACKGROUND: Genetic modification is a prerequisite to realizing the full potential of human embryonic stem cells (hESCs in human genetic research and regenerative medicine. Unfortunately, the random integration methods that have been the primary techniques used keep creating problems, and the primary alternative method, gene targeting, has been effective in manipulating mouse embryonic stem cells (mESCs but poorly in hESCs. METHODOLOGY/PRINCIPAL FINDINGS: Human ribosomal DNA (rDNA repeats are clustered on the short arm of acrocentric chromosomes. They consist of approximately 400 copies of the 45S pre-RNA (rRNA gene per haploid. In the present study, we targeted a physiological gene, human coagulation factor IX, into the rDNA locus of hESCs via homologous recombination. The relative gene targeting efficiency (>50% and homologous recombination frequency (>10(-5 were more than 10-fold higher than those of loci targeted in previous reports. Meanwhile, the targeted clones retained both a normal karyotype and the main characteristics of ES cells. The transgene was found to be stably and ectopically expressed in targeted hESCs. CONCLUSION/SIGNIFICANCE: This is the first targeting of a human physiological gene at a defined locus on the hESC genome. Our findings indicate that the rDNA locus may serve as an ideal harbor for transgenes in hESCs.

  4. Species-genomic relationships among the tribasic diploid and polyploid Carthamus taxa based on physical mapping of active and inactive 18S-5.8S-26S and 5S ribosomal RNA gene families, and the two tandemly repeated DNA sequences.

    Science.gov (United States)

    Agrawal, Renuka; Tsujimoto, Hisashi; Tandon, Rajesh; Rao, Satyawada Rama; Raina, Soom Nath

    2013-05-25

    In the genus Carthamus (2n=20, 22, 24, 44, 64; x=10, 11, 12), most of the homologues within and between the chromosome complements are difficult to be identified. In the present work, we used fluorescent in situ hybridisation (FISH) to determine the chromosome distribution of the two rRNA gene families, and the two isolated repeated DNA sequences in the 14 Carthamus taxa. The distinctive variability in the distribution, number and signal intensity of hybridisation sites for 18S-26S and 5S rDNA loci could generally distinguish the 14 Carthamus taxa. Active 18S-26S rDNA sites were generally associated with NOR loci on the nucleolar chromosomes. The two A genome taxa, C. glaucus ssp. anatolicus and C. boissieri with 2n=20, and the two botanical varieties of B genome C. tinctorius (2n=24) had diagnostic FISH patterns. The present results support the origin of C. tinctorius from C. palaestinus. FISH patterns of C. arborescens vis-à-vis the other taxa indicate a clear division of Carthamus taxa into two distinct lineages. Comparative distribution and intensity pattern of 18S-26S rDNA sites could distinguish each of the tetraploid and hexaploid taxa. The present results indicate that C. boissieri (2n=20) is one of the genome donors for C. lanatus and C. lanatus ssp. lanatus (2n=44), and C. lanatus is one of the progenitors for the hexaploid (2n=64) taxa. The association of pCtKpnI-2 repeated sequence with rRNA gene cluster (orphon) in 2-10 nucleolar and non-nucleolar chromosomes and the consistent occurrence of pCtKpnI-1 repeated sequence at the subtelomeric region in all the taxa analysed indicate some functional role of these sequences.

  5. Identification of Swertia mussotii and its adulterant Swertia species by 5S rRNA gene spacer.

    Science.gov (United States)

    Yu, Man-Tang; Wong, Ka-Lok; Zong, Yu-Ying; Shaw, Pang-Chui; Che, Chun-Tao

    2008-03-01

    This research focused on analyzing the differences of 5S rRNA gene spacer sequences on Swertia mussotii and its commonly used adulterants, including S. franchetiana, S. wolfangiana and S. chirayita. DNA was extracted from the collected Swertia samples. 5S rRNA intergenic spacers were amplified by PCR, sequenced and analyzed. 5S rRNA gene spacer sequences were different between S. mussotii and its other three adulterants. Sequence divergence among species ranged from 30.6% to 65.0%. 5S rRNA spacers may be used as molecular authentication markers to differentiate S. mussotii and other commonly used Swertia adulterants. This result provides reliable and simple reference for the authentication of Swertia genus species.

  6. Leanin 5S toimistoympäristössä : Kehittämistyön tulokset

    OpenAIRE

    Korhonen, Tommi

    2014-01-01

    Tämän opinnäytetyön tavoitteena oli raportoida 5S-toimintamallin käyttöönotto Aditro Oy:n Kajaanin toimistolla. Opinnäytetyössä kuvataan 5S-toimintamallin käyttöönoton vaiheet ja niiden vaikutukset toimistoympäristössä. Lisäksi tarkastellaan miten Lean–ajattelulla ja 5S-toimintamallilla voidaan tehostaa toimistoympäristön työprosesseja. Lopuksi arvioidaan 5S-toimintamallista saatuja hyötyjä sekä käyttöönottoon liittyviä ongelmia. Teoreettisena taustana oli Lean-filosofian mukainen kirjal...

  7. Analysis of the unexplored features of rrs (16S rDNA) of the Genus Clostridium

    Science.gov (United States)

    2011-01-01

    Background Bacterial taxonomy and phylogeny based on rrs (16S rDNA) sequencing is being vigorously pursued. In fact, it has been stated that novel biological findings are driven by comparison and integration of massive data sets. In spite of a large reservoir of rrs sequencing data of 1,237,963 entries, this analysis invariably needs supplementation with other genes. The need is to divide the genetic variability within a taxa or genus at their rrs phylogenetic boundaries and to discover those fundamental features, which will enable the bacteria to naturally fall within them. Within the large bacterial community, Clostridium represents a large genus of around 110 species of significant biotechnological and medical importance. Certain Clostridium strains produce some of the deadliest toxins, which cause heavy economic losses. We have targeted this genus because of its high genetic diversity, which does not allow accurate typing with the available molecular methods. Results Seven hundred sixty five rrs sequences (> 1200 nucleotides, nts) belonging to 110 Clostridium species were analyzed. On the basis of 404 rrs sequences belonging to 15 Clostridium species, we have developed species specific: (i) phylogenetic framework, (ii) signatures (30 nts) and (iii) in silico restriction enzyme (14 Type II REs) digestion patterns. These tools allowed: (i) species level identification of 95 Clostridium sp. which are presently classified up to genus level, (ii) identification of 84 novel Clostridium spp. and (iii) potential reduction in the number of Clostridium species represented by small populations. Conclusions This integrated approach is quite sensitive and can be easily extended as a molecular tool for diagnostic and taxonomic identification of any microbe of importance to food industries and health services. Since rapid and correct identification allows quicker diagnosis and consequently treatment as well, it is likely to lead to reduction in economic losses and mortality

  8. 18S rDNA sequences from microeukaryotes reveal oil indicators in mangrove sediment.

    Science.gov (United States)

    Santos, Henrique F; Cury, Juliano C; Carmo, Flavia L; Rosado, Alexandre S; Peixoto, Raquel S

    2010-08-26

    Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. We believe that the microeukaryotic targets indicated by our work will be of great

  9. Investigating bacterial populations in styrene-degrading biofilters by 16S rDNA tag pyrosequencing.

    Science.gov (United States)

    Portune, Kevin J; Pérez, M Carmen; Álvarez-Hornos, F Javier; Gabaldón, Carmen

    2015-01-01

    Microbial biofilms are essential components in the elimination of pollutants within biofilters, yet still little is known regarding the complex relationships between microbial community structure and biodegradation function within these engineered ecosystems. To further explore this relationship, 16S rDNA tag pyrosequencing was applied to samples taken at four time points from a styrene-degrading biofilter undergoing variable operating conditions. Changes in microbial structure were observed between different stages of biofilter operation, and the level of styrene concentration was revealed to be a critical factor affecting these changes. Bacterial genera Azoarcus and Pseudomonas were among the dominant classified genera in the biofilter. Canonical correspondence analysis (CCA) and correlation analysis revealed that the genera Brevundimonas, Hydrogenophaga, and Achromobacter may play important roles in styrene degradation under increasing styrene concentrations. No significant correlations (P > 0.05) could be detected between biofilter operational/functional parameters and biodiversity measurements, although biological heterogeneity within biofilms and/or technical variability within pyrosequencing may have considerably affected these results. Percentages of selected bacterial taxonomic groups detected by fluorescence in situ hybridization (FISH) were compared to results from pyrosequencing in order to assess the effectiveness and limitations of each method for identifying each microbial taxon. Comparison of results revealed discrepancies between the two methods in the detected percentages of numerous taxonomic groups. Biases and technical limitations of both FISH and pyrosequencing, such as the binding of FISH probes to non-target microbial groups and lack of classification of sequences for defined taxonomic groups from pyrosequencing, may partially explain some differences between the two methods.

  10. 18S rDNA sequences from microeukaryotes reveal oil indicators in mangrove sediment.

    Directory of Open Access Journals (Sweden)

    Henrique F Santos

    Full Text Available BACKGROUND: Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. CONCLUSIONS

  11. Factors Contributing To The Sustainability Of 5S Programmes In Government Hospitals In Regional Director Of Health Services Area Kurunegala

    Directory of Open Access Journals (Sweden)

    Dr. K.W.C.U.K Kendangamuwa

    2015-03-01

    Full Text Available Abstract Introduction 5S is the stepping stone for many quality improvement concepts and its roots date back to 16th century. When successfully implemented 5S gives many benefits to the organization as well as its stakeholders. Though 5S itself has a tool to sustain most of the organizations find it difficult to sustain the 5S practice over the time. Therefore the objective of this study was to find out the factors contributing to sustainability of 5S programmes in Government Hospitals in RDHS area Kurunegala. Methodology This study was a descriptive cross sectional study with two components. First component was to identify the 5S sustaining hospitals from not sustaining hospitals by validated evaluation sheet. Second component was to determine the factors contributing to sustainability of 5S programmes in selected study setting. Self-administrated questionnaire was used for this purpose. Total study population was 543 employees of all the categories of hospital staff. Calculated sample size was 422 and 375 were responded to the questionnaire giving response rate of 88.9. Results The study revealed that the implemented 5S programmes were sustaining in eight hospitals out of ten i.e. sustaining rate was 80. When it considered the degree of sustainability 50 of the selected hospitals reported more than 70 sustainability. This was considered as favourable trend in government health sector in healthcare quality point of view. Ten factors were studied as contributing factors for the 5S sustainability. Socio- demographic factors were also considered. Those ten factors were top management commitment leadership of the organization commitment of middle amp frontline managers commitment amp satisfaction of employees training amp changing attitude of employees motivation of employees organizational culture group cohesiveness community participation and customer satisfaction. Study revealed that organizational leadership customer satisfaction community

  12. Results in $B_s$ physics and bottomonium spectroscopy using the Belle $\\Upsilon({\\rm 5S})$ data

    CERN Document Server

    Oswald, Christian

    2013-01-01

    The Belle experiment at KEK accumulated a $121.4~{\\rm fb}^{-1}$ sample of $e^+e^-$ collisions at the $\\Upsilon(5S)$ resonance. This sample provides ample opportunity for improving the understanding of both the properties of $B_s$ mesons and the spectroscopy of bottomonium states. In this article we describe the recent results obtained from the Belle $\\Upsilon(5S)$ data.

  13. Acid-induced p16 hypermethylation contributes to development of esophageal adenocarcinoma via activation of NADPH oxidase NOX5-S.

    Science.gov (United States)

    Hong, Jie; Resnick, Murray; Behar, Jose; Wang, Li Juan; Wands, Jack; DeLellis, Ronald A; Souza, Rhonda F; Spechler, Stuart J; Cao, Weibiao

    2010-09-01

    Inactivation of tumor suppressor gene p16 may play an important role in the progression from Barrett's esophagus (BE) to esophageal adenocarcinoma (EA). Hypermethylation of p16 gene promoter is an important mechanism inactivating p16. However, the mechanisms of p16 hypermethylation in EA are not known. Therefore, we examined whether acid increases methylation of p16 gene promoter and whether NADPH oxidase NOX5-S mediates acid-induced p16 hypermethylation in a Barrett's cell line BAR-T and an EA cell line OE33. We found that NOX5-S was present in BAR-T and OE33 cells. Acid-induced increase in H(2)O(2) production and cell proliferation was significantly reduced by knockdown of NOX5-S. Exogenous H(2)O(2) remarkably increased p16 promoter methylation and cell proliferation. In addition, acid treatment significantly increased p16 promoter methylation and decreased p16 mRNA level. Knockdown of NOX5-S significantly increased p16 mRNA, inhibited acid-induced downregulation of p16 mRNA, and blocked acid-induced increase in p16 methylation and cell proliferation. Conversely, overexpression of NOX5-S significantly decreased p16 mRNA and increased p16 methylation and cell proliferation. In conclusion, NOX5-S is present in BAR-T cells and OE33 cells and mediates acid-induced H(2)O(2) production and cell proliferation. NOX5-S is also involved in acid-induced hypermethylation of p16 gene promoter and downregulation of p16 mRNA. It is possible that acid reflux present in BE patients may activate NOX5-S and increase production of reactive oxygen species, which in turn increase p16 promoter methylation, downregulate p16 expression, and increase cell proliferation, thereby contributing to the progression from BE to EA.

  14. Nucleotide sequences of chloroplast 5S ribosomal RNA from cell suspension cultures of the liverworts Marchantia polymorpha and Jungermannia subulata.

    OpenAIRE

    Yamano, Y; Ohyama, K; Komano, T

    1984-01-01

    The nucleotide sequences of chloroplast 5S rRNAs from cell suspension cultures of the liverworts Marchantia polymorpha and Jungermannia subulata were determined. Their nucleotide sequences, 119 nucleotides long, were highly homologous to each other (96% identity) and had high homology with those from chloroplast 5S rRNAs of two higher plants, tobacco (92% identity) and spinach (92-91% identity), but less homology (87-85% identity) with that from a lower plant, the fern Dryopteris acuminata.