WorldWideScience

Sample records for 28s gene sequences

  1. Chromosomal localization and partial sequencing of the 18S and 28S ribosomal genes from Bradysia hygida (Diptera: Sciaridae).

    Science.gov (United States)

    Gaspar, V P; Shimauti, E L T; Fernandez, M A

    2014-03-26

    In insects, ribosomal genes are usually detected in sex chromosomes, but have also or only been detected in autosomal chromosomes in some cases. Previous results from our research group indicated that in Bradysia hygida, nucleolus organizer regions were associated with heterochromatic regions of the autosomal C chromosome, using the silver impregnation technique. The present study confirmed this location of the ribosomal genes using fluorescence in situ hybridization analysis. This analysis also revealed the partial sequences of the 18S and 28S genes for this sciarid. The sequence alignment showed that the 18S gene has 98% identity to Corydalus armatus and 91% identity to Drosophila persimilis and Drosophila melanogaster. The partial sequence analysis of the 28S gene showed 95% identity with Bradysia amoena and 93% identity with Schwenckfeldina sp. These results confirmed the location of ribosomal genes of B. hygida in an autosomal chromosome, and the partial sequence analysis of the 18S and 28S genes demonstrated a high percentage of identity among several insect ribosomal genes.

  2. Phylogenetic Relationships of the Marine Haplosclerida (Phylum Porifera) Employing Ribosomal (28S rRNA) and Mitochondrial (cox1, nad1) Gene Sequence Data

    OpenAIRE

    Redmond, Niamh E.; Jean Raleigh; Van Soest, Rob W.M.; Michelle Kelly; Travers, Simon A A; Brian Bradshaw; Salla Vartia; Kelly M Stephens; McCormack, Grace P.

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, ...

  3. A combination of morphology and 28S rRNA gene sequences provide grouping and ranking criteria to merge eight into three Ambispora species (Ambisporaceae, Glomeromycota).

    Science.gov (United States)

    Bills, Robert J; Morton, Joseph B

    2015-08-01

    Ambispora, the only genus in Ambisporaceae and one of three deeply rooted families in Archaeosporales, Glomeromycetes, is amended. Analysis of the morphology of specimens from types and living cultures and 28S ribosomal DNA (rDNA; LSU) sequences resulted in two major changes that redefined Ambispora to include only species with the potential for spore dimorphism (acaulosporoid and glomoid). First, species described as producing only glomoid spores (Ambispora leptoticha, Ambispora fecundispora, and Ambispora callosa), only acaulosporoid spores (Ambispora jimgerdemannii), or both spore morphotypes (Ambispora appendicula) were synonymized with a redefined dimorphic species, A. leptoticha. LSU sequences and more conserved SSU gene data indicated little divergence between genotypes formerly classified as separate species. Second, Ambispora fennica was synonymized with Ambispora gerdemannii based on morphological and LSU sequence variation equivalent to that measured in the sister clade A. leptoticha. With this analysis, Ambispora was reduced to three species: A. leptoticha, A. gerdemannii, and Ambispora granatensis. Morphological and molecular characters were given equal treatment in this study, as each data set informed and clarified grouping and ranking decisions. The two inner layers of the acaulosporoid spore wall were the only structural characters uniquely defining each of these three species; all other characters were shared. Phenotypes of glomoid spores were indistinguishable between species, and thus were informative only at the genus level. Distinct subclade structure of the LSU gene tree suggests fixation of discrete variants typical of clonal reproduction and possible retention of polymorphisms in rDNA repeats, so that not all discrete genetic variants are indicative of speciation. PMID:25638691

  4. Chromosomal localization of the 18S-28S and 5S rRNA genes and (TTAGGGn sequences of butterfly lizards (Leiolepis belliana belliana and Leiolepis boehmei, Agamidae, Squamata

    Directory of Open Access Journals (Sweden)

    Kornsorn Srikulnath

    2011-01-01

    Full Text Available Chromosomal mapping of the butterfly lizards Leiolepis belliana belliana and L. boehmei was done using the 18S-28S and 5S rRNA genes and telomeric (TTAGGGn sequences. The karyotype of L. b. belliana was 2n = 36, whereas that of L. boehmei was 2n = 34. The 18S-28S rRNA genes were located at the secondary constriction of the long arm of chromosome 1, while the 5S rRNA genes were found in the pericentromeric region of chromosome 6 in both species. Hybridization signals for the (TTAGGGn sequence were observed at the telomeric ends of all chromosomes, as well as interstitially at the same position as the 18S-28S rRNA genes in L. boehmei. This finding suggests that in L. boehmei telomere-to-telomere fusion probably occurred between chromosome 1 and a microchromosome where the 18S-28S rRNA genes were located or, alternatively, at the secondary constriction of chromosome 1. The absence of telomeric sequence signals in chromosome 1 of L. b. belliana suggested that its chromosomes may have only a few copies of the (TTAGGGn sequence or that there may have been a gradual loss of the repeat sequences during chromosomal evolution.

  5. Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

    Science.gov (United States)

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

    2013-10-01

    Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

  6. Phylogenetic relationships of the marine Haplosclerida (Phylum Porifera employing ribosomal (28S rRNA and mitochondrial (cox1, nad1 gene sequence data.

    Directory of Open Access Journals (Sweden)

    Niamh E Redmond

    Full Text Available The systematics of the poriferan Order Haplosclerida (Class Demospongiae has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae, Amphimedon queenslandica (Family Niphatidae and Tabulocalyx (Family Phloeodictyidae, Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here.

  7. Intraspecies Diversity of Cryptococcus laurentii as Revealed by Sequences of Internal Transcribed Spacer Regions and 28S rRNA Gene and Taxonomic Position of C. laurentii Clinical Isolates

    OpenAIRE

    Sugita, Takashi; Takashima, Masako; Ikeda, Reiko; Nakase, Takashi; Shinoda, Takako

    2000-01-01

    The intraspecies diversity of an opportunistic yeast pathogen, Cryptococcus laurentii, was revealed by analysis of the sequences of the internal transcribed spacer regions and the 28S rRNA gene. Ten strains of C. laurentii were grouped into two major phylogenetic groups and were further divided into at least seven species. Four of the strains isolated from patients did not represent a single species but showed heterogeneity. These results suggest that C. laurentii is a genetically heterogeneo...

  8. Higher-level phylogeny of the Therevidae (Diptera: insecta) based on 28S ribosomal and elongation factor-1 alpha gene sequences.

    Science.gov (United States)

    Yang, L; Wiegmann, B M; Yeates, D K; Irwin, M E

    2000-06-01

    Therevidae (stilleto flies) are a little-known family of asiloid brachyceran Diptera (Insecta). Separate and combined phylogenetic analyses of 1200 bases of the 28S ribosomal DNA and 1100 bases of elongation factor-1alpha were used to infer phylogenetic relationships within the family. The position of the enigmatic taxon Apsilocephala Kröber is evaluated in light of the molecular evidence. In all analyses, molecular data strongly support the monophyly of Therevidae, excluding Apsilocephala, and the division of Therevidae into two main clades corresponding to a previous classification of the family into the subfamilies Phycinae and Therevinae. Despite strong support for some relationships within these groups, relationships at the base of the two main clades are weakly supported. Short branch lengths for Australasian clades at the base of the Therevinae may represent a rapid radiation of therevids in Australia. PMID:10860652

  9. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    Science.gov (United States)

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  10. Phylogenetic reconstruction of the wolf spiders (Araneae: Lycosidae) using sequences from the 12S rRNA, 28S rRNA, and NADH1 genes: implications for classification, biogeography, and the evolution of web building behavior.

    Science.gov (United States)

    Murphy, Nicholas P; Framenau, Volker W; Donnellan, Stephen C; Harvey, Mark S; Park, Yung-Chul; Austin, Andrew D

    2006-03-01

    Current knowledge of the evolutionary relationships amongst the wolf spiders (Araneae: Lycosidae) is based on assessment of morphological similarity or phylogenetic analysis of a small number of taxa. In order to enhance the current understanding of lycosid relationships, phylogenies of 70 lycosid species were reconstructed by parsimony and Bayesian methods using three molecular markers; the mitochondrial genes 12S rRNA, NADH1, and the nuclear gene 28S rRNA. The resultant trees from the mitochondrial markers were used to assess the current taxonomic status of the Lycosidae and to assess the evolutionary history of sheet-web construction in the group. The results suggest that a number of genera are not monophyletic, including Lycosa, Arctosa, Alopecosa, and Artoria. At the subfamilial level, the status of Pardosinae needs to be re-assessed, and the position of a number of genera within their respective subfamilies is in doubt (e.g., Hippasa and Arctosa in Lycosinae and Xerolycosa, Aulonia and Hygrolycosa in Venoniinae). In addition, a major clade of strictly Australasian taxa may require the creation of a new subfamily. The analysis of sheet-web building in Lycosidae revealed that the interpretation of this trait as an ancestral state relies on two factors: (1) an asymmetrical model favoring the loss of sheet-webs and (2) that the suspended silken tube of Pirata is directly descended from sheet-web building. Paralogous copies of the nuclear 28S rRNA gene were sequenced, confounding the interpretation of the phylogenetic analysis and suggesting that a cautionary approach should be taken to the further use of this gene for lycosid phylogenetic analysis.

  11. PCR primers for metazoan nuclear 18S and 28S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. METHODOLOGY/PRINCIPAL FINDINGS: Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. CONCLUSIONS/SIGNIFICANCE: The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other

  12. Identification of Dermatophyte Species by 28S Ribosomal DNA Sequencing with a Commercial Kit

    Science.gov (United States)

    Ninet, Béatrice; Jan, Isabelle; Bontems, Olympia; Léchenne, Barbara; Jousson, Olivier; Panizzon, Renato; Lew, Daniel; Monod, Michel

    2003-01-01

    We have shown that dermatophyte species can be easily identified on the basis of a DNA sequence encoding a part of the large-subunit (LSU) rRNA (28S rRNA) by using the MicroSeq D2 LSU rRNA Fungal Sequencing Kit. Two taxa causing distinct dermatophytoses were clearly distinguished among isolates of the Trichophyton mentagrophytes species complex. PMID:12574293

  13. Identification of Dermatophyte Species by 28S Ribosomal DNA Sequencing with a Commercial Kit

    OpenAIRE

    Ninet, Béatrice; Jan, Isabelle; Bontems, Olympia; Léchenne, Barbara; Jousson, Olivier; Panizzon, Renato; Lew, Daniel; Monod, Michel

    2003-01-01

    We have shown that dermatophyte species can be easily identified on the basis of a DNA sequence encoding a part of the large-subunit (LSU) rRNA (28S rRNA) by using the MicroSeq D2 LSU rRNA Fungal Sequencing Kit. Two taxa causing distinct dermatophytoses were clearly distinguished among isolates of the Trichophyton mentagrophytes species complex.

  14. Molecular Phylogeny of Cypridoid Freshwater Ostracods (Crustacea: Ostracoda), Inferred from 18S and 28S rDNA Sequences.

    Science.gov (United States)

    Hiruta, Shimpei F; Kobayashi, Norio; Katoh, Toru; Kajihara, Hiroshi

    2016-04-01

    With the aim of exploring phylogenetic relationships within Cypridoidea, the most species-rich superfamily among the podocopidan ostracods, we sequenced nearly the entire 18S rRNA gene (18S) and part of the 28S rRNA gene (28S) for 22 species in the order Podocopida, with representatives from all the major cypridoid families. We conducted phylogenetic analyses using the methods of maximum likelihood, minimum evolution, and Bayesian analysis. Our analyses showed monophyly for Cyprididae, one of the four families currently recognized in Cypridoidea. Candonidae turned out to be paraphyletic, and included three clades corresponding to the subfamilies Candoninae, Paracypridinae, and Cyclocypridinae. We propose restricting the name Candonidae s. str. to comprise what is now Candoninae, and raising Paracypridinae and Cyclocyprininae to family rank within the superfamily Cypridoidea.

  15. Evolutionary relationships of the coelacanth, lungfishes, and tetrapods based on the 28S ribosomal RNA gene.

    Science.gov (United States)

    Zardoya, R; Meyer, A

    1996-05-28

    The origin of land vertebrates was one of the major transitions in the history of vertebrates. Yet, despite many studies that are based on either morphology or molecules, the phylogenetic relationships among tetrapods and the other two living groups of lobe-finned fishes, the coelacanth and the lungfishes, are still unresolved and debated. Knowledge of the relationships among these lineages, which originated back in the Devonian, has profound implications for the reconstruction of the evolutionary scenario of the conquest of land. We collected the largest molecular data set on this issue so far, about 3,500 base pairs from seven species of the large 28S nuclear ribosomal gene. All phylogenetic analyses (maximum parsimony, neighbor-joining, and maximum likelihood) point toward the hypothesis that lungfishes and coelacanths form a monophyletic group and are equally closely related to land vertebrates. This evolutionary hypothesis complicates the identification of morphological or physiological preadaptations that might have permitted the common ancestor of tetrapods to colonize land. This is because the reconstruction of its ancestral conditions would be hindered by the difficulty to separate uniquely derived characters from shared derived characters in the coelacanth/lungfish and tetrapod lineages. This molecular phylogeny aids in the reconstruction of morphological evolutionary steps by providing a framework; however, only paleontological evidence can determine the sequence of morphological acquisitions that allowed lobe-finned fishes to colonize land.

  16. Genetic relationship between Neobenedenia girellae and N.melleni inferred from 28S rRNA sequences

    Institute of Scientific and Technical Information of China (English)

    WANG Jun; ZHANG Wen; SU Yongquan; DING Shaoxiong

    2004-01-01

    The fragments of 350 bp in 28S rRNA from the closely related monogenea of trematoda, Neobenedenia girellae and N. melleni are obtained by polymerase chain reaction (PCR) amplified using a couple of special primers and then sequenced. The results show that the comparison of 28S rRNA sequences, with only a base varying in 337bp accounting for 0.3% genetic difference, from the relative species N. girellae and N. melleni parasitized on the different fishes in different farms displays that they possess a very high genetic similarity of 99.7%, higher than that of 99.41% for the single species N. melleni sampled in different areas, and the intraspecific divergence of N.melleni is 0.59%. Meanwhile, the interspecific differences between the two Neobenedenia and three Benedenia (i.e., B. lutjani, B. rohdei and B. seriolae) range from 2.08% to11.73%. In addition, UPGMA and MP molecular phylogenetic trees are constructed and proved to be consistent with each other. Though the morphological characteristics and the results of genetic diversity for the two Neobenedenia show a high similarity, whether they belong to a single species or not are still undefined, and the more genes of them should be further investigated, in combination with the systematical and detailed morphological study.

  17. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. PMID:27071492

  18. Phylogeny of the major lineages of Membracoidea (Insecta: Hemiptera: Cicadomorpha) based on 28S rDNA sequences.

    Science.gov (United States)

    Dietrich, C H; Rakitov, R A; Holmes, J L; Black, W C

    2001-02-01

    Analysis of sequences from a 3.5-kb region of the nuclear ribosomal 28S DNA gene spanning divergent domains D2-D10 supports the hypothesis, based on fossil, biogeographic, and behavioral evidence, that treehoppers (Aetalionidae and Membracidae) are derived from leafhoppers (Cicadellidae). Maximum-parsimony analysis indicated that treehoppers are the sister group of a lineage comprising the currently recognized cicadellid subfamilies Agalliinae, Megophthalminae, Adelungiinae, and Ulopinae. Based on this phylogenetic estimate, the derivation of treehoppers approximately coincided with shifts in physiology and behavior, including loss of brochosome production and a reversal from active, jumping nymphs to sessile, nonjumping nymphs. Myerslopiidae, traditionally placed as a tribe of the cicadellid subfamily Ulopinae, represented a basal lineage distinct from other extant membracoids. The analysis recovered a large leafhopper lineage comprising a polyphyletic Deltocephalinae (sensu stricto) and its apparent derivatives Koebeliinae, Eupelicinae (polyphyletic), Selenocephalinae, and Penthimiinae. Clades comprising Macropsinae, Neocoelidiinae, Scarinae, Iassinae, Coelidiinae, Eurymelinae + Idiocerinae, Evacanthini + Pagaroniini, Aphrodinae + Ledrinae (in part), Stenocotini + Tartessinae, and Cicadellini + Proconiini were also recovered with moderate to high branch support. Cicadellinae (sensu lato), Ledrinae, Typhlocybinae, and Xestocephalinae were consistently polyphyletic on the most-parsimonious topologies, but constraining these groups to be monophyletic did not significantly increase the length of the cladograms. Relationships among the major lineages received low branch support, suggesting that more data are needed to provide a robust phylogenetic estimate.

  19. D2 Region of the 28S RNA Gene: A Too-Conserved Fragment for Inferences on Phylogeny of South American Triatomines.

    Science.gov (United States)

    Guerra, Ana Letícia; Alevi, Kaio Cesar Chaboli; Banho, Cecília Artico; de Oliveira, Jader; da Rosa, João Aristeu; Vilela de Azeredo-Oliveira, Maria Tercília

    2016-09-01

    The brasiliensis complex is composed of five triatomine species, and different approaches suggest that Triatoma lenti and Triatoma petrochiae may be the new members. Therefore, this study sought to analyze the phylogenetic relationships within this complex by means of the D2 region of the 28S RNA gene, and to analyze the degree of polymorphism and phylogenetic significance of this gene for South American triatomines. Phylogenetic analysis by using sequence fragments of the D2 domain did not allow to perform phylogenetic inferences on species within the brasiliensis complex, because the gene alignment composed of a matrix with 37 specimens exhibited only two variable sites along the 567 base pairs used. Furthermore, if all South American species are included, only four variable sites were detected, reflecting the high degree of gene conservation. Therefore, we do not recommend the use of this gene for phylogenetic reconstruction for this group of Chagas disease vectors. PMID:27382073

  20. Phylogenetic Relationships of Two Earth Tiger Tarantulas, Haplopelma lividum and H. longipes (Araneae, Theraphosidae, within the Infraorder Mygalomorph Using 28S Ribosomal DNA Sequences

    Directory of Open Access Journals (Sweden)

    Arin Ngamniyom

    2014-01-01

    Full Text Available Haplopelma lividum and H. longipes (Araneae: Mygalomorphae: Theraphosidae are tarantulas that are distributed throughout Southeast Asia and are important carnivorous predators in ecological systems. The present study aimed to examine the phylogenetic relationships between Mygalomorph spiders using 28S ribosomal DNA sequences. The molecular results supported the placement of both species within a common theraphosid taxon. However, when considering relationships between Haplopelma spp. and related genera, H. schmidti, H. lividum and H. longipes were not monophyletic, suggesting that molecular data are incongruent with phylogenies based on morphological characteristics. These results provide molecular data to help elucidate the phylogenetic relationships between theraphosid tarantulas.

  1. Cloning and application of 28S rRNA gene fragment of Trichinella spiralis on Taxonmy%旋毛虫28S rRNA基因片段的克隆及其在分类学上的应用

    Institute of Scientific and Technical Information of China (English)

    李成; 魏颖; 袁金钱; 宋铭忻

    2011-01-01

    In order to investigate the classification of Trihicnella swine isolate from Heilongjiang Province, the gene fragment in ribosome 28S rRNA was cloned and sequenced. The results showed that Trihicnella swine isolate from Heilongjiang Province was closed and belonged to Trichinella spiralis by sequence analysis. To some extent, the result was consistent with the traditional classfication and provided a base for the traditional taxonomy.%为了探讨所采集旋毛虫的分类,利用PCR方法克隆了猪旋毛虫黑龙江隔离种核糖体28S rRNA序列的基因片段.序列分析结果表明,猪旋毛虫黑龙江隔离种与旋毛形线虫(Trichinella spiralis,T1)的进化关系较近,确定为旋毛形线虫(Trichinella spiralis).结果与传统的分类结果基本一致,为传统的分类学方法提供了新的理论依据.

  2. REDESCRIFTION OF UNICAUDA PELTEOBAGRUS MA, 1998 (MYXOZOA,BIVALVULIDA) , wTTH PHYLOGENIC ANALYSIS INFER.RED FROM 28S RDNA AND ITS-5. 8S SEQUENCE DATA%黄颡单尾虫(粘体门,双壳目)的重描述及基于28S rDNA和ITS-5.8S序列的系统地位分析

    Institute of Scientific and Technical Information of China (English)

    董江丽; 赵元莙; 唐发辉; 索栋

    2011-01-01

    采用形态分类学方法与以28S rDNA和ITS-5.8S序列为基础的分子系统学研究方法,对采自嘉陵江重庆市磁器口江段的黄颡单尾虫Unicauda pelteobagrus Ma,1998进行了形态学和分子生物学的研究.基于28S rDNA数据探讨了黄颡单尾虫以及单尾虫属与相邻种属粘孢子虫间的系统地位;基于5.8S rDNA数据比较分析了粘孢子虫的系统地位.补充了黄颡单尾虫重庆种群形态学信息和28S rDNA、ITS-5.8s rDNA序列的分子信息.%In the present study, the morphology on the Ghongqing population of a myxozoa, Unicauda pelteobagrus Ma, 1998, collected fi.om the muscle of Pelteobagrus fulvidraco in Jialing River near Giqikou,Ghongqing, Ghina, was investigated. Fresh spores of the present population are oval in fi.ont view, 13.5 + 0.67 (12.5-14.5) um in length, 7.4 + 0.46 (7.0 -8.5) um in width and38. 1 + 0.55 (31.5-39.5)um in total length, a single appendage extends posteriorly fi'om the fully developed spore. Two polar capsules, pear-shaped, parallel side by side or one after another arranged in front of spores, containing polar filaments coiled 4 -7 tums. Furthermore, the large subunit ribosomal gene ( 28S rDNA ) and ITS5.8S sequence for Chongqing population were amplified and sequenced. The 28S rDNA contain relatively conservative core segments and 11 highly variable regions designated as divergent domains and the most considerable length variations occurred in D2, D8, and DI0 28S rDNA domains. Phylogenetic analyses of the 28S rDNA sequence placed this species in the dade with Myxobolus longisporus (bootstrap =100 ). This clade with other species of genera,Henneguya and Myxobolus, grouped into the MyxobolusHenneguya-Unicauda clade, which indicates that those spedes could possess a common origin. These dam are supported by D2, D8 and D10 length variations and genetic distance, which also implied that Unicauda might be more closely related to Myxobolus. Here,appendage as an only category pointer

  3. Phylogenetic analysis of the spider mite sub-family Tetranychinae (Acari: Tetranychidae based on the mitochondrial COI gene and the 18S and the 5' end of the 28S rRNA genes indicates that several genera are polyphyletic.

    Directory of Open Access Journals (Sweden)

    Tomoko Matsuda

    Full Text Available The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825-1,901 bp and 28S (the 5' end of 646-743 bp rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp. As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered.

  4. Phylogenetic analysis of the spider mite sub-family Tetranychinae (Acari: Tetranychidae) based on the mitochondrial COI gene and the 18S and the 5' end of the 28S rRNA genes indicates that several genera are polyphyletic.

    Science.gov (United States)

    Matsuda, Tomoko; Morishita, Maiko; Hinomoto, Norihide; Gotoh, Tetsuo

    2014-01-01

    The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI) gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825-1,901 bp) and 28S (the 5' end of 646-743 bp) rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp). As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus) appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered.

  5. Dracula ant phylogeny as inferred by nuclear 28S rDNA sequences and implications for ant systematics (Hymenoptera: Formicidae: Amblyoponinae).

    Science.gov (United States)

    Saux, Corrie; Fisher, Brian L; Spicer, Greg S

    2004-11-01

    Ants are one of the most ecologically and numerically dominant families of organisms in almost every terrestrial habitat throughout the world, though they include only about 1% of all described insect species. The development of eusociality is thought to have been a driving force in the striking diversification and dominance of this group, yet we know little about the evolution of the major lineages of ants and have been unable to clearly determine their primitive characteristics. Ants within the subfamily Amblyoponinae are specialized arthropod predators, possess many anatomically and behaviorally primitive characters and have been proposed as a possible basal lineage within the ants. We investigate the phylogenetic relationships among the members of the subfamily, using nuclear 28S rDNA sequence data. Outgroups for the analysis include members of the poneromorph and leptanillomorph (Apomyrma, Leptanilla) ant subfamilies, as well as three wasp families. Parsimony, maximum likelihood, and Bayesian analyses provide strong support for the monophyly of a clade containing the two genera Apomyrma+Mystrium (100% bpp; 97% ML bs; and 97% MP bs), and moderate support for the monophyly of the Amblyoponinae as long as Apomyrma (Apomyrminae) is included (87% bpp; 57% ML bs; and 76% MP bs). Analyses did not recover evidence of monophyly of the Amblyopone genus, while the monophyly of the other genera in the subfamily is supported. Based on these results we provide a morphological diagnosis of the Amblyoponinae that includes Apomyrma. Among the outgroup taxa, Typhlomyrmex grouped consistently with Ectatomma, supporting the recent placement of Typhlomyrmex in the Ectatomminae. The results of this present study place the included ant subfamilies into roughly two clades with the basal placement of Leptanilla unclear. One clade contains all the Amblyoponinae (including Apomyrma), Ponerinae, and Proceratiinae (Poneroid clade). The other clade contains members from subfamilies

  6. Phylogenetic position of Magnivitellinum Kloss, 1966 and Perezitrema Baruš & Moravec, 1967 (Trematoda: Plagiorchioidea: Macroderoididae) inferred from partial 28S rDNA sequences, with the establishment of Alloglossidiidae n. fam.

    Science.gov (United States)

    Hernández-Mena, David Iván; Mendoza-Garfias, Berenit; Ornelas-García, Claudia Patricia; Pérez-Ponce de León, Gerardo

    2016-07-01

    The systematic position of two genera of Macroderoididae McMullen, 1937, Perezitrema Baruš & Moravec, 1967 and Magnivitellinum Kloss, 1966 is reviewed based on a phylogenetic analysis of the interrelationships of 15 species of the family allocated into six genera, along with 44 species of plagiorchioid trematodes, using partial sequences of the 28S rRNA gene. Sequences were analysed through parsimony, maximum likelihood and Bayesian inference. The obtained topologies show Perezitrema as the sister taxon of three species of Macroderoides Pearse, 1924; the latter genus appears to be paraphyletic since another three species are not included in this group. Instead, Magnivitellinum was placed as the sister taxon of Alloglossidium Simer, 1929. These relationships are well supported by high bootstrap and posterior probability values. The resulting trees demonstrate that the family Macroderoididae, as currently conceived in taxonomic treatments, is not monophyletic. Magnivitellinum simplex Kloss, 1966 and Alloglossidium spp. were nested as sister taxa of members of the family Leptophallidae Dayal, 1938, whereas Perezitrema bychowskii Baruš & Moravec, 1967 and species of Macroderoides and Paramacroderoides Venard, 1941 were grouped with Auridistomum chelydrae (Stafford, 1900), a monotypic member of Auridistomidae Stunkard, 1924. Based on our results, a new family, Alloglossidiidae n. fam. was established to accommodate the genera Magnivitellinum and Alloglossidium. PMID:27307166

  7. Analysis of the genetic polymorphism of Paracoccidioides brasiliensis and Paracoccidioides cerebriformis "Moore" by random amplified polymorphic DNA (RAPD and 28S ribosomal DNA sequencing: Paracoccidioides cerebriformis revisited Análise do polimorfismo genético do Paracoccidioides brasiliensis e Paracoccidioides cerebriformis "Moore" pela técnica de amplificação aleatória do polimorfismo do DNA (RAPD e sequenciamento do DNA ribossomal 28S: Paracoccidioides cerebriformis revisitado

    Directory of Open Access Journals (Sweden)

    Sarah Desirée Barbosa Cavalcanti

    2005-06-01

    Full Text Available Our purpose was to compare the genetic polymorphism of six samples of P. brasiliensis (113, 339, BAT, T1F1, T3B6, T5LN1, with four samples of P. cerebriformis (735, 741, 750, 361 from the Mycological Laboratory of the Instituto de Medicina Tropical de São Paulo, using Random Amplified Polymorphic DNA Analysis (RAPD. RAPD profiles clearly segregated P. brasiliensis and P. cerebriformis isolates. However, the variation on band patterns among P. cerebriformis isolates was high. Sequencing of the 28S rDNA gene showed nucleotide conservancy among P. cerebriformis isolates, providing basis for taxonomical grouping, and disclosing high divergence to P. brasiliensis supporting that they are in fact two distinct species. Moreover, DNA sequence suggests that P. cerebriformis belongs in fact to the Aspergillus genus.Nosso propósito foi comparar o polimorfismo genético de seis amostras de P. brasiliensis (113, 339, BAT, T1F1, T3B6, T5LN1, com quatro amostras de P. cerebriformis (735, 741, 750, 361 do laboratório de micologia do Instituto de Medicina Tropical de São Paulo, utilizando a técnica de Amplificação Aleatória do Polimorfismo de DNA (RAPD. O perfil de bandas do RAPD diferenciou claramente os isolados de P. brasiliensis de P. cerebriformis. Entretanto, ocorreu uma variação significativa no padrão de bandas das amostras de P. cerebriformis. O sequenciamento do gene ribossomal 28S revelou seqüências de nucleotídeos bastante conservadas entre os isolados de P. cerebriformis, fornecendo subsídio para o agrupamento taxonômico destas amostras, diferenciando estas de P. brasiliensis e mostrando que de fato são espécies distintas. A seqüência de DNA sugere que P. cerebriformis pertence ao gênero Aspergillus.

  8. Phylogeny of Deltocephalinae (Hemiptera: Cicadellidae)from China based on partial 16S rDNA and 28S rDNA D2 sequences combined with morphological characters%基于16S rDNA和28S rDNA D2基因序列与形态特征联合分析的中国角顶叶蝉亚科系统发育研究(半翅目:叶蝉科)

    Institute of Scientific and Technical Information of China (English)

    戴仁怀; 陈学新; 李子忠

    2008-01-01

    The phylogeny of 19 genera of Deltocephalinae leafhoppers was analyzed based on 50 adult morphological characters combined with nucleotide sequences of the mitochondrial 16S rDNA and nuclear 28S D2 rDNA genes. One species of Typhlocybinae was included as outgroup. Parsimonian, distance and Bayesian methods were used to estimate the phylogenetic relationships. The topology of the phylogenetic trees generated with different methods was quite similar. We partially resolved the morphologically-defined tribes and the relationships among 19 genera of Deltocephalinae. The genus Macrosteles was well supported to occupy a basal position in the study, so the most primary tribe in Deltocephalinae might be Macrostelini. The phylogenetic analysis trees put all genera of Deltocephalini but Nakaharanus onto a single lineage. The genus Balclutha, corresponding to the tribe Balclnthini,remains unsolved in our analyses. The Euscelini might be a polyphyletic group in the analysis. Analytical result recovered Athysanini and Paralimnini as monophyletic clades. The clade Phlogotettix and Scaphoideus-Nakaharanus was constantly resolved using different methods. We suggested that Scaphoideus, Nakaharanus and Phlogotettix should be included in or into Scaphoideini. But the results resolved poorly the taxonomic status of Xestoeephalini overall.%首次在国内利用28s rDNA D2区段和16s rDNA基因序列,结合50个形态特征对角顶叶蝉亚科(Deltocephalinae)[半翅目(Hemiptera):叶蝉科(cicadellidae)]19个属进行系统发育分析研究.从无水乙醇浸泡保存的标本中提取基因组DNA并扩增了19个内群和1种外群Tyhlocybinae[半翅目(Hemiptera):叶蝉科(cicadelIidae)]种类的28s rDNA D2基因片段并测序,同时扩增了16s rDNA基因片段并测序11条,采用了GenBank中1个种类的16S rDNA同源序列.采用PAuP*4.O和MrBayes3.0两个分析软件和3种建树方法,利用同源28s D2 rDNA和16srDNA两个基因序列与形态特征结合进行系统发

  9. Molecular phylogeny of the butterfly tribe Satyrini (Nymphalidae: Satyrinae) with emphasis on the utility of ribosomal mitochondrial genes 16s rDNA and nuclear 28s rDNA.

    Science.gov (United States)

    Yang, Mingsheng; Zhang, Yalin

    2015-07-09

    The tribe Satyrini is one of the most diverse groups of butterflies, but no robust phylogenetic hypothesis for this group has been achieved. Two rarely used 16s and 28s ribosomal and another seven protein-coding genes were used to reconstruct the phylogeny of the Satyrini, with further aim to evaluate the informativeness of the ribosomal genes. Our maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference (BI) analyses consistently recovered three well-supported clades for the eleven sampled subtribes of Satyrini: clade I includes Eritina and Coenonymphina, being sister to the clade II + clade III; clade II contains Parargina, Mycalesina and Lethina, and the other six subtribes constitute clade III. The placements of the taxonomically unstable Davidina Oberthür and geographically restricted Paroeneis Moore in Satyrina are confirmed for the first time based on molecular evidence. The close relationships of Callerebia Butler, Loxerebia Watkins and Argestina Riley are well-supported. We suggest that Rhaphicera Butler belongs to Lethina. The partitioned Bremer support (PBS) values of MP analysis show that the 16s rDNA contributes well to the nodes representing all the taxa from subtribe to species levels, and the 28s rDNA is informative at the subtribe level. Furthermore, our ML analyses show that the ribosomal genes 16s rDNA and 28s rDNA are informative, because most node support values are lower in the ML tree after the removal of them than that in ML tree constructed based on the full nine-gene dataset. This indicates that some other ribosomal genes should be tentatively used through combining with traditionally used protein-coding genes in further analysis on phylogeny of Satyrini, providing that proper representatives are sampled.

  10. Phylogenetic analysis of three species of Encarsia ( Hymenoptera: Aphelinidae) parasitizing Bemisia tabaci ( Hemiptera: Aleyrodidae) in China based on their 28S rRNA gene%中国寄生烟粉虱的三种恩角蚜小蜂28S rRNA系统发育分析

    Institute of Scientific and Technical Information of China (English)

    薛夏; 彭伟录; Muhammad Z. AHMED; Nasser S. MANDOUR; 任顺祥; Andrew G. S. CUTHBERTSON; 邱宝利

    2012-01-01

    Encarsia F(o)rster consists of important parasitoids of whitefly (Bemisia tabaci) pests,including E.bimaculata,E.formosa and E.sophia,the three most important aphelinid parasitoids in China.Eight populations of Encarsia from the South,Southeast,North and Southwest of China,as well as two populations from Malaysia and Egypt,respectively,were collected in the present study,and their interspecies phylogenetic relationships were analyzed based on 28S rRNA D2 and D3 expansion regions.The D2 and D3 regions were consistent with each other,confirmed a closer genetic relationship between E.sophia and E.bimaculata since they both belong to the Encarisa strenus species group,compared to those between these two species and En.formosa.Results of the genetic distance analysis using 28S rRNA D2 sequences revealed that there are certain genetic divergences within single species of the Encarsia parasitoids.The Guangzhou population of Encarsia sophia is more close to populations from Australia,Spain,Egypt and Ethiopia,but further from the population from Thailand.E. bimaculata populations from Sudan,Egypt and Guatemala as well as one population from Australia cluster together,while E.formosa Hengshui and Kunming populations cluster together with those from USA,UK and Greece,but are further from the Egypt population.The reasons for the inconsistency between the genetic and geographical distances of the Encarsia species are discussed.%蚜小蜂Bemisia tabaci是烟粉虱的重要天敌,其中双斑恩蚜小蜂Encarsia bimaculata,丽蚜小蜂E.forTmosa以及浅黄恩蚜小蜂E.sophia是国内烟粉虱寄生蜂3个优势种.本研究以采自中国华南、华东、华北、西南地区以及马来西亚、埃及的E.bimaculata、E.formosa和E.sophia3个优势种的8个不同地理种群为研究对象,对其28SrRNA D2和D3扩展区序列进行了测定和分析.结果表明:Encarsia属的恩蚜小蜂其28S rRNA D2和D3序列在种间水平上高度保守;与丽蚜小蜂相比,双斑

  11. PHYLOGENETIC ANALYSIS OF PRATYLENCHUS (NEMATODA,PRATYLENCHIDAE) BASED ON RIBOSOMAL INTERNAL TRANSCRIBED SPACERS (ITS) AND D2-D3 EXPANSION SEGMENTS OF 28S RRNA GENE%基于核糖体ITS区和28S rRNA D2~D3区的短体线虫系统发育研究

    Institute of Scientific and Technical Information of China (English)

    王金成; 魏亚东; 顾建锋; 张瑞丰; 黄国明; 王暄; 李红梅; 孙建华

    2012-01-01

    The root lesion nematodes, Pratyknchus Flipjev, 1936, is one of the most widespread and destructive endoparasites that invade and migrate in roots of a variety of crops around the world. 214 nucleotide sequences of ribosomal ITS spacers, 218 sequences of D2 -D3 segments of 28S ribosomal RNA were used for phylogenetic analysis of Pratyknchus nematodes. The phylogenetic trees were constructed using neighbor-joining method in MEGA 4. 0 program. The results revealed that the two trees are broadly similar on the whole except that some divergences in minimal branches exist, and the 25 examined Pratyknchus species could be divided into at least 8 clades based on ITS phylogenetic tree corresponding to the 7 clades of 23 Pratyknchus species based on D2 - D3 phylogenetic tree. Of which, there are 3 large clades with relatively clear phylogenetic relationships within each clade. Accoding to the phylogenetic analysis of this study we are still unable to determine the general phylogenetic relationships of Pratyknchus speceies.%短体线虫又称根腐线虫,是世界分布最为广泛和最具破坏性的迁徙性植物内寄生线虫之一.本研究根据214条核糖体ITS序列,218条核糖体28S大亚基D2~D3序列,应用MEGA 4.0软件,通过邻接法(NJ)构建了短体线虫的系统发育树.结果发现,2个系统树在整体上大致相似,仅在小的分支上存在差异.基于ITS序列的系统树将25种短体线虫至少分为8组,相应的基于D2~D3序列的系统树将23种短体线虫至少分为7组.其中,有3个大组内部的系统发育关系比较清晰.根据本研究的系统发育分析仍然无法从总体上确定短体线虫种间的系统发育关系.

  12. Repetitive sequence environment distinguishes housekeeping genes

    OpenAIRE

    Eller, C. Daniel; Regelson, Moira; Merriman, Barry; Nelson, Stan,; Horvath, Steve; Marahrens, York

    2006-01-01

    Housekeeping genes are expressed across a wide variety of tissues. Since repetitive sequences have been reported to influence the expression of individual genes, we employed a novel approach to determine whether housekeeping genes can be distinguished from tissue-specific genes their repetitive sequence context. We show that Alu elements are more highly concentrated around housekeeping genes while various longer (>400-bp) repetitive sequences ("repeats"), including Long Interspersed Nuclear E...

  13. cis sequence effects on gene expression

    Directory of Open Access Journals (Sweden)

    Jacobs Kevin

    2007-08-01

    Full Text Available Abstract Background Sequence and transcriptional variability within and between individuals are typically studied independently. The joint analysis of sequence and gene expression variation (genetical genomics provides insight into the role of linked sequence variation in the regulation of gene expression. We investigated the role of sequence variation in cis on gene expression (cis sequence effects in a group of genes commonly studied in cancer research in lymphoblastoid cell lines. We estimated the proportion of genes exhibiting cis sequence effects and the proportion of gene expression variation explained by cis sequence effects using three different analytical approaches, and compared our results to the literature. Results We generated gene expression profiling data at N = 697 candidate genes from N = 30 lymphoblastoid cell lines for this study and used available candidate gene resequencing data at N = 552 candidate genes to identify N = 30 candidate genes with sufficient variance in both datasets for the investigation of cis sequence effects. We used two additive models and the haplotype phylogeny scanning approach of Templeton (Tree Scanning to evaluate association between individual SNPs, all SNPs at a gene, and diplotypes, with log-transformed gene expression. SNPs and diplotypes at eight candidate genes exhibited statistically significant (p cis sequence effects in our study, respectively. Conclusion Based on analysis of our results and the extant literature, one in four genes exhibits significant cis sequence effects, and for these genes, about 30% of gene expression variation is accounted for by cis sequence variation. Despite diverse experimental approaches, the presence or absence of significant cis sequence effects is largely supported by previously published studies.

  14. 基于28S rRNA基因的PCR-RFLP分析对赤拟谷盗与杂拟谷盗进行分子鉴定%Molecular identification of Tribolium castaneum and T.confusum based on PCR-RFLP analyses of 28S rRNA gene

    Institute of Scientific and Technical Information of China (English)

    张汉松; 冯照军; 程超

    2014-01-01

    本研究拟利用聚合酶链式反应-限制性片段长度多态性(PCR-RFLP)分析方法对赤拟谷盗Tribolium castaneum (Herbst)和杂拟谷盗Tribolium confusum(Jac du Val)进行分子鉴定,以期为仓储害虫管理和口岸检疫提供技术帮助和支持.采用通用引物对赤拟谷盗和杂拟谷盗的28S rRNA基因进行了PCR扩增、序列测定和分析,结果发现:扩增片段长约1070 bp,该序列种内均无变异位点、种间有76个变异位点,即种内没有核苷酸替换发生、种间核苷酸替换发生76次,其中转换56次,颠换20次,转换/颠换的比值为2.80.用限制性内切酶PvuⅠ对赤拟谷盗和杂拟谷盗的28S rRNA基因扩增产物进行酶切,电泳检测显示,赤拟谷盗和杂拟谷盗的28S rRNA基因扩增产物的PvuⅠ酶切图谱(分别产生2个和3个酶切条带)明显不同,因此本研究建立的28SrRNA基因PCR-RFLP方法可用于赤拟谷盗与杂拟谷盗的分子鉴定.

  15. Genetic differentiation and phylogenesis of Tribolium castaneum and T.confusum based on 28S rRNA and CO Ⅰ genes%基于28S rRNA和COⅠ基因探讨赤拟谷盗与杂拟谷盗的遗传分化和系统发育

    Institute of Scientific and Technical Information of China (English)

    明庆磊; 王阿旻; 程超

    2013-01-01

    赤拟谷盗与杂拟谷盗形态相似且种间生殖隔离不完全,为探明这两个近缘种之间的遗传分化和系统发育关系,对赤拟谷盗与杂拟谷盗30个个体的一个核基因28S核糖体RNA(28S rRNA)和一个线粒体基因细胞色素氧化酶亚基Ⅰ (COⅠ)进行了PCR扩增、测序和分析,发现这两个基因分别有2个和3个单倍型,种间没有相同的单倍型.在28S rRNA基因区,两个种的种内核苷酸序列均没有变异;在COⅠ基因区,种内核苷酸变异位点不超过2个,且核苷酸变异没有导致其编码氨基酸发生改变.然而,在28S rRNA和COⅠ基因区,种间核苷酸序列分别存在76个和144个位点,且COⅠ基因区的核苷酸变异位点导致25个编码氨基酸发生改变.系统发育分析表明,赤拟谷盗与弗氏拟谷盗和黑拟谷盗的亲缘关系要近于与杂拟谷盗的亲缘关系,这与由其形态推导的系统发育关系并不完全一致.表明,尽管赤拟谷盗与杂拟谷盗形态和大小相似,但其种间的分子遗传分化明显,用28S rRNA和COⅠ基因来评价它们的遗传变异与系统发育关系是非常有用的.

  16. Cloning and phylogenetic analysis of 18S rRNA and 28S rRNA genes of Pomacea canaliculata%福寿螺18S rRNA和28S rRNA基因片段的克隆与进化分析

    Institute of Scientific and Technical Information of China (English)

    潘颖瑛; 董胜张; 俞晓平

    2009-01-01

    为从分子水平上明确入侵我国的福寿螺在分类学上的地位,采用分子克隆和序列比对的方法,对来自菲律宾及我国广东、广西、浙江等不同地理种群福寿螺的18S rRNA基因和28S rRNA基因片段进行扩增、克隆和序列测定,并同瓶螺科、田螺科和环口螺科相关物种进行系统发育分析.结果表明,获得的福寿螺18S rRNA基因和28S rRNA基园片段长度分别为602 bp、325 bp,且不同地理种群间碱基序列无差异.通过邻接法(NJ)和最大筒约法(MP)构建的系统树基本一致,证实福寿螺隶属于瓶螺科,与田螺科物种亲缘关系较近,而与环口螺科亲缘关系较远.

  17. Network of tRNA Gene Sequences

    Institute of Scientific and Technical Information of China (English)

    WEI Fang-ping; LI Sheng; MA Hong-ru

    2008-01-01

    A network of 3719 tRNA gene sequences was constructed using simplest alignment. Its topology, degree distribution and clustering coefficient were studied. The behaviors of the network shift from fluctuated distribution to scale-free distribution when the similarity degree of the tRNA gene sequences increases. The tRNA gene sequences with the same anticodon identity are more self-organized than those with different anticodon identities and form local clusters in the network. Some vertices of the local cluster have a high connection with other local clusters, and the probable reason was given. Moreover, a network constructed by the same number of random tRNA sequences was used to make comparisons. The relationships between the properties of the tRNA similarity network and the characters of tRNA evolutionary history were discussed.

  18. DNA sequence of the yeast transketolase gene.

    Science.gov (United States)

    Fletcher, T S; Kwee, I L; Nakada, T; Largman, C; Martin, B M

    1992-02-18

    Transketolase (EC 2.2.1.1) is the enzyme that, together with aldolase, forms a reversible link between the glycolytic and pentose phosphate pathways. We have cloned and sequenced the transketolase gene from yeast (Saccharomyces cerevisiae). This is the first transketolase gene of the pentose phosphate shunt to be sequenced from any source. The molecular mass of the proposed translated protein is 73,976 daltons, in good agreement with the observed molecular mass of about 75,000 daltons. The 5'-nontranslated region of the gene is similar to other yeast genes. There is no evidence of 5'-splice junctions or branch points in the sequence. The 3'-nontranslated region contains the polyadenylation signal (AATAAA), 80 base pairs downstream from the termination codon. A high degree of homology is found between yeast transketolase and dihydroxyacetone synthase (formaldehyde transketolase) from the yeast Hansenula polymorpha. The overall sequence identity between these two proteins is 37%, with four regions of much greater similarity. The regions from amino acid residues 98-131, 157-182, 410-433, and 474-489 have sequence identities of 74%, 66%, 83%, and 82%, respectively. One of these regions (157-182) includes a possible thiamin pyrophosphate (TPP) binding domain, and another (410-433) may contain the catalytic domain. PMID:1737042

  19. Sequencing and Gene Expression Analysis of Leishmania tropica LACK Gene.

    Directory of Open Access Journals (Sweden)

    Nour Hammoudeh

    2014-12-01

    Full Text Available Leishmania Homologue of receptors for Activated C Kinase (LACK antigen is a 36-kDa protein, which provokes a very early immune response against Leishmania infection. There are several reports on the expression of LACK through different life-cycle stages of genus Leishmania, but only a few of them have focused on L.tropica.The present study provides details of the cloning, DNA sequencing and gene expression of LACK in this parasite species. First, several local isolates of Leishmania parasites were typed in our laboratory using PCR technique to verify of Leishmania parasite species. After that, LACK gene was amplified and cloned into a vector for sequencing. Finally, the expression of this molecule in logarithmic and stationary growth phase promastigotes, as well as in amastigotes, was evaluated by Reverse Transcription-PCR (RT-PCR technique.The typing result confirmed that all our local isolates belong to L.tropica. LACK gene sequence was determined and high similarity was observed with the sequences of other Leishmania species. Furthermore, the expression of LACK gene in both promastigotes and amastigotes forms was confirmed.Overall, the data set the stage for future studies of the properties and immune role of LACK gene products.

  20. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O;

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes corresp...

  1. Cloning and sequencing genes related to preeclampsia

    Institute of Scientific and Technical Information of China (English)

    SHI Juan-zi; LIU Yan-fang; YAO Yuan-qing; YAN Wei; ZHU Feng; ZHAO Zhong-liang

    2001-01-01

    To clone genes specifically expressed in the placenta of patients with preeclampsia, and to explain the mechanism in the etiopathology ofpreeclampsia. Methods: The placentae ofpreeclamptic and normotensive subjects with pregnancy were used as models, and the cDNA Library was constructed and 20 differentially expressed fragments were cloned after a new version of PCR-based subtractive hybridization. The false positive clones were identified by reverse dot blot analysis. With one of the obtained gene taken as the probe, the placentas of 10 normal pregnant women and 10 preeclamptic patients were studied by using dot hybridization methods. Results: Six false positive clones were identified by reverse dot blot, and the rest 14 clones were identified as preeclampsia-related genes. These clones were sequenced, and analyzed with BLAST analysis system. Eleven of 14 clones were genes already known, among which one belongs to necdin family; the rest 3 were identified as novel genes. These 3 genes were acknowledged by GenBank, with the accession numbers AF232216, AF232217, AF233648. The results of dot hybridization using necdin gene as probe were as follows: (1) There was this mRNA in the placental tissues of normal pregnancy as well as in that ofpreeclampsia.(2) The intensity of transcription of this mRNA in the placental tissues of preeclampsia increased significantly compared with that of the normal pregnancy (P<0.05). Conclusions: This study for the first time reported this group of genes, especially necdin-expressing gene, which are related to the etiopathology of preeclampsia. In addition, the overtranscription ofnecdin gene has been found in preeclampsia. It is helpful in further studies of the etiology ofpreeclampsia.

  2. Preliminary phylogeny of the thrips parasitoids of Turkey based on some morphological scales and 28S D2 rDNA, with description of a new species

    OpenAIRE

    DOĞANLAR, Oğuzhan; Doğanlar, Mikdat; Frary, Anne

    2010-01-01

    Species of the Ceranisus thrips-attacking genus are difficult to distinguish morphologically. The phylogenetic relationships within the Ceranisus species were explored using nucleotide sequences of the 28S D2 expansion region of the rDNA gene. Bayesian, maximum likelihood, and parsimony inference methods were employed to construct the phylogenetic relationships. Principal component analysis on the Turkish species of Ceranisus, namely antalyacus, menes, bozovaensis, hirsutus, planitianus (a ne...

  3. Metagenomic data of fungal internal transcribed Spacer and 18S rRNA gene sequences from Lonar lake sediment, India.

    Science.gov (United States)

    Dudhagara, Pravin; Ghelani, Anjana; Bhavsar, Sunil; Bhatt, Shreyas

    2015-09-01

    The data in this article contains the sequences of fungal Internal Transcribed Spacer (ITS) and 18S rRNA gene from a metagenome of Lonar soda lake, India. Sequences were amplified using fungal specific primers, which amplified the amplicon lined between the 18S and 28S rRNA genes. Data were obtained using Fungal tag-encoded FLX amplicon pyrosequencing (fTEFAP) technique and used to analyze fungal profile by the culture-independent method. Primary analysis using PlutoF 454 pipeline suggests the Lonar lake mycobiome contained the 29 different fungal species. The raw sequencing data used to perform this analysis along with FASTQ file are located in the NCBI Sequence Read Archive (SRA) under accession No. SRX889598 (http://www.ncbi.nlm.nih.gov/sra/SRX889598).

  4. The first determination of DNA sequence of a specific gene.

    Science.gov (United States)

    Inouye, Masayori

    2016-05-10

    How and when the first DNA sequence of a gene was determined? In 1977, F. Sanger came up with an innovative technology to sequence DNA by using chain terminators, and determined the entire DNA sequence of the 5375-base genome of bacteriophage φX 174 (Sanger et al., 1977). While this Sanger's achievement has been recognized as the first DNA sequencing of genes, we had determined DNA sequence of a gene, albeit a partial sequence, 11 years before the Sanger's DNA sequence (Okada et al., 1966).

  5. Isolation and nucleotide sequence of the gene encoding human rhodopsin.

    OpenAIRE

    Nathans, J; Hogness, D S

    1984-01-01

    We have isolated and completely sequenced the gene encoding human rhodopsin. The coding region of the human rhodopsin gene is interrupted by four introns, which are located at positions analogous to those found in the previously characterized bovine rhodopsin gene. The amino acid sequence of human rhodopsin, deduced from the nucleotide sequence of its gene, is 348 residues long and is 93.4% homologous to that of bovine rhodopsin. Interestingly, those portions of the polypeptide chain predicte...

  6. Fungal community analysis in the deep-sea sediments of the Pacific Ocean assessed by comparison of ITS, 18S and 28S ribosomal DNA regions

    Science.gov (United States)

    Xu, Wei; Luo, Zhu-Hua; Guo, Shuangshuang; Pang, Ka-Lai

    2016-03-01

    We investigated the diversity of fungal communities in 6 different deep-sea sediment samples of the Pacific Ocean based on three different types of clone libraries, including internal transcribed spacer (ITS), 18S rDNA, and 28S rDNA regions. A total of 1978 clones were generated from 18 environmental clone libraries, resulting in 140 fungal operational taxonomic units (OTUs), including 18 OTUs from ITS, 44 OTUs from 18S rDNA, and 78 OTUs from 28S rDNA gene primer sets. The majority of the recovered sequences belonged to diverse phylotypes of the Ascomycota and Basidiomycota. Additionally, our study revealed a total of 46 novel fungal phylotypes, which showed low similarities (gene to describe fungal community in deep-sea environment.

  7. Bioinformatic Identification of Conserved Cis-Sequences in Coregulated Genes.

    Science.gov (United States)

    Bülow, Lorenz; Hehl, Reinhard

    2016-01-01

    Bioinformatics tools can be employed to identify conserved cis-sequences in sets of coregulated plant genes because more and more gene expression and genomic sequence data become available. Knowledge on the specific cis-sequences, their enrichment and arrangement within promoters, facilitates the design of functional synthetic plant promoters that are responsive to specific stresses. The present chapter illustrates an example for the bioinformatic identification of conserved Arabidopsis thaliana cis-sequences enriched in drought stress-responsive genes. This workflow can be applied for the identification of cis-sequences in any sets of coregulated genes. The workflow includes detailed protocols to determine sets of coregulated genes, to extract the corresponding promoter sequences, and how to install and run a software package to identify overrepresented motifs. Further bioinformatic analyses that can be performed with the results are discussed. PMID:27557771

  8. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  9. A Probabilistic Genome-Wide Gene Reading Frame Sequence Model

    DEFF Research Database (Denmark)

    Have, Christian Theil; Mørk, Søren

    using the probabilistic logic programming language and machine learning system PRISM - a fast and efficient model prototyping environment, using bacterial gene finding performance as a benchmark of signal strength. The model is used to prune a set of gene predictions from an underlying gene finder...... and are evaluated by the effect on prediction performance. Since bacterial gene finding to a large extent is a solved problem it forms an ideal proving ground for evaluating the explicit modeling of larger scale gene sequence composition of genomes. We conclude that the sequential composition of gene reading frames......We introduce a new type of probabilistic sequence model, that model the sequential composition of reading frames of genes in a genome. Our approach extends gene finders with a model of the sequential composition of genes at the genome-level -- effectively producing a sequential genome annotation...

  10. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  11. Identification of sequence variants in genetic disease-causing genes using targeted next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Xiaoming Wei

    Full Text Available BACKGROUND: Identification of gene variants plays an important role in research on and diagnosis of genetic diseases. A combination of enrichment of targeted genes and next-generation sequencing (targeted DNA-HiSeq results in both high efficiency and low cost for targeted sequencing of genes of interest. METHODOLOGY/PRINCIPAL FINDINGS: To identify mutations associated with genetic diseases, we designed an array-based gene chip to capture all of the exons of 193 genes involved in 103 genetic diseases. To evaluate this technology, we selected 7 samples from seven patients with six different genetic diseases resulting from six disease-causing genes and 100 samples from normal human adults as controls. The data obtained showed that on average, 99.14% of 3,382 exons with more than 30-fold coverage were successfully detected using Targeted DNA-HiSeq technology, and we found six known variants in four disease-causing genes and two novel mutations in two other disease-causing genes (the STS gene for XLI and the FBN1 gene for MFS as well as one exon deletion mutation in the DMD gene. These results were confirmed in their entirety using either the Sanger sequencing method or real-time PCR. CONCLUSIONS/SIGNIFICANCE: Targeted DNA-HiSeq combines next-generation sequencing with the capture of sequences from a relevant subset of high-interest genes. This method was tested by capturing sequences from a DNA library through hybridization to oligonucleotide probes specific for genetic disorder-related genes and was found to show high selectivity, improve the detection of mutations, enabling the discovery of novel variants, and provide additional indel data. Thus, targeted DNA-HiSeq can be used to analyze the gene variant profiles of monogenic diseases with high sensitivity, fidelity, throughput and speed.

  12. Comparison of methods for genomic localization of gene trap sequences

    Directory of Open Access Journals (Sweden)

    Ferrin Thomas E

    2006-09-01

    Full Text Available Abstract Background Gene knockouts in a model organism such as mouse provide a valuable resource for the study of basic biology and human disease. Determining which gene has been inactivated by an untargeted gene trapping event poses a challenging annotation problem because gene trap sequence tags, which represent sequence near the vector insertion site of a trapped gene, are typically short and often contain unresolved residues. To understand better the localization of these sequences on the mouse genome, we compared stand-alone versions of the alignment programs BLAT, SSAHA, and MegaBLAST. A set of 3,369 sequence tags was aligned to build 34 of the mouse genome using default parameters for each algorithm. Known genome coordinates for the cognate set of full-length genes (1,659 sequences were used to evaluate localization results. Results In general, all three programs performed well in terms of localizing sequences to a general region of the genome, with only relatively subtle errors identified for a small proportion of the sequence tags. However, large differences in performance were noted with regard to correctly identifying exon boundaries. BLAT correctly identified the vast majority of exon boundaries, while SSAHA and MegaBLAST missed the majority of exon boundaries. SSAHA consistently reported the fewest false positives and is the fastest algorithm. MegaBLAST was comparable to BLAT in speed, but was the most susceptible to localizing sequence tags incorrectly to pseudogenes. Conclusion The differences in performance for sequence tags and full-length reference sequences were surprisingly small. Characteristic variations in localization results for each program were noted that affect the localization of sequence at exon boundaries, in particular.

  13. PHYLOGENETIC ANALYSIS OF THE SUBCLASS PTERIOMORPHIA (BIVAVIA) BASED ON PARTIAL 28S rRNA SEQUENCE%基于28SrRNA基因片段的翼形亚纲(Bivalvia:Pteriomorphia)系统发育的初步研究

    Institute of Scientific and Technical Information of China (English)

    薛东秀; 王海艳; 张涛; 张素萍; 徐凤山

    2012-01-01

    The phylogenetic relationships among 11 superfamilies of the subclass Pteriomorphia (Bivavia) were recon-structed based on partial sequences of the nuclear 28S ribosomal DNA retrieved from GenBank. Unambiguously aligned sequences (1252bp) of 80 species were subjected to partitioned maximum likelihood and Bayesian analyses. Sequence analysis showed that there were 359 variable sites, occupying 28.67% of all sites, and 300 parsimony informative sites, occupying 23.96% of all sites. The average content of A+T was 41.6%, obviously lower than G+C, showing that the base compositions were biased in favor of G+C. The genetic distances among species within superfamilies ranged from 0.01 to 0.14, which were obviously smaller than those among superfamilies. The resultant molecular phylogeny was compared with previously published phylogenetic hypotheses inferred from morphological characteristics and other molecular analyses. The molecular phylogenetic analyses strongly supported the monophyly of Pteriomorphia, which were congruent with previous results of based on morphological characters. The resulting trees clearly indicated that the 11 superfamilies were divided into three clades: clade I included Pterioidea, Ostreoidea, and Pinnoidea; clade I1 included Arcoidea, Limop- soidea, and Mytiloidea; and clade m included Pectinoidea, Anomioidea, Dimyoidea, Plicatuloidea, and Limoidea. Based on the results of the present study and information compiled from other's classification system, a revised classification of the extant superfamilies of Pteriomorphia is presented.%采用从GenBank下载的翼形亚纲11个总科80个种类的28S部分序列,对翼形亚纲11个总科贝类进行系统发育关系研究。在获得的1252个序列位点中,去除插入缺失位点,变异位点共359个,其中简约位点300个。翼形亚纲各总科内各种间的遗传距离为0.01—0.14,明显小于各总科间的遗传距离(除蚶总科与拟锉蛤总

  14. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'-32P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  15. Mechanism of Gene Amplification via Yeast Autonomously Replicating Sequences

    Directory of Open Access Journals (Sweden)

    Shelly Sehgal

    2015-01-01

    Full Text Available The present investigation was aimed at understanding the molecular mechanism of gene amplification. Interplay of fragile sites in promoting gene amplification was also elucidated. The amplification promoting sequences were chosen from the Saccharomyces cerevisiae ARS, 5S rRNA regions of Plantago ovata and P. lagopus, proposed sites of replication pausing at Ste20 gene locus of S. cerevisiae, and the bend DNA sequences within fragile site FRA11A in humans. The gene amplification assays showed that plasmid bearing APS from yeast and human beings led to enhanced protein concentration as compared to the wild type. Both the in silico and in vitro analyses were pointed out at the strong bending potential of these APS. In addition, high mitotic stability and presence of TTTT repeats and SAR amongst these sequences encourage gene amplification. Phylogenetic analysis of S. cerevisiae ARS was also conducted. The combinatorial power of different aspects of APS analyzed in the present investigation was harnessed to reach a consensus about the factors which stimulate gene expression, in presence of these sequences. It was concluded that the mechanism of gene amplification was that AT rich tracts present in fragile sites of yeast serve as binding sites for MAR/SAR and DNA unwinding elements. The DNA protein interactions necessary for ORC activation are facilitated by DNA bending. These specific bindings at ORC promote repeated rounds of DNA replication leading to gene amplification.

  16. Sequence and chromosomal localization of the mouse brevican gene

    DEFF Research Database (Denmark)

    Rauch, U; Meyer, H; Brakebusch, C;

    1997-01-01

    Brevican is a brain-specific proteoglycan belonging to the aggrecan family. Phage clones containing the complete mouse brevican open reading frame of 2649 bp and the complete 3'-untranslated region of 341 bp were isolated from a mouse brain cDNA library, and cosmid clones containing the mouse...... brevican gene were isolated from a genomic library using a PCR-generated DNA fragment as probe. The obtained genomic sequence of 13,700 nucleotides revealed that the murine gene has a size of approximately 13 kb and contains the sequence of the mRNA for the secreted brevican isoform on 14 exons. The exon......-intron structure reflected the structural organization of the multidomain protein brevican. No consensus TATA sequence was found upstream of the first exon, and RNase protection experiments revealed multiple transcriptional start sites for the brevican gene. The first part of the sequence of intron 8 corresponded...

  17. Coelacanth genome sequence reveals the evolutionary history of vertebrate genes.

    Science.gov (United States)

    Noonan, James P; Grimwood, Jane; Danke, Joshua; Schmutz, Jeremy; Dickson, Mark; Amemiya, Chris T; Myers, Richard M

    2004-12-01

    The coelacanth is one of the nearest living relatives of tetrapods. However, a teleost species such as zebrafish or Fugu is typically used as the outgroup in current tetrapod comparative sequence analyses. Such studies are complicated by the fact that teleost genomes have undergone a whole-genome duplication event, as well as individual gene-duplication events. Here, we demonstrate the value of coelacanth genome sequence by complete sequencing and analysis of the protocadherin gene cluster of the Indonesian coelacanth, Latimeria menadoensis. We found that coelacanth has 49 protocadherin cluster genes organized in the same three ordered subclusters, alpha, beta, and gamma, as the 54 protocadherin cluster genes in human. In contrast, whole-genome and tandem duplications have generated two zebrafish protocadherin clusters comprised of at least 97 genes. Additionally, zebrafish protocadherins are far more prone to homogenizing gene conversion events than coelacanth protocadherins, suggesting that recombination- and duplication-driven plasticity may be a feature of teleost genomes. Our results indicate that coelacanth provides the ideal outgroup sequence against which tetrapod genomes can be measured. We therefore present L. menadoensis as a candidate for whole-genome sequencing.

  18. SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

    Science.gov (United States)

    Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd

    2015-09-01

    The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

  19. Sequence Variability in Staphylococcal Enterotoxin Genes seb, sec, and sed

    Directory of Open Access Journals (Sweden)

    Sophia Johler

    2016-06-01

    Full Text Available Ingestion of staphylococcal enterotoxins preformed by Staphylococcus aureus in food leads to staphylococcal food poisoning, the most prevalent foodborne intoxication worldwide. There are five major staphylococcal enterotoxins: SEA, SEB, SEC, SED, and SEE. While variants of these toxins have been described and were linked to specific hosts or levels or enterotoxin production, data on sequence variation is still limited. In this study, we aim to extend the knowledge on promoter and gene variants of the major enterotoxins SEB, SEC, and SED. To this end, we determined seb, sec, and sed promoter and gene sequences of a well-characterized set of enterotoxigenic Staphylococcus aureus strains originating from foodborne outbreaks, human infections, human nasal colonization, rabbits, and cattle. New nucleotide sequence variants were detected for all three enterotoxins and a novel amino acid sequence variant of SED was detected in a strain associated with human nasal colonization. While the seb promoter and gene sequences exhibited a high degree of variability, the sec and sed promoter and gene were more conserved. Interestingly, a truncated variant of sed was detected in all tested sed harboring rabbit strains. The generated data represents a further step towards improved understanding of strain-specific differences in enterotoxin expression and host-specific variation in enterotoxin sequences.

  20. The nucleotide sequence of the bacteriophage T5 ltf gene.

    Science.gov (United States)

    Kaliman, A V; Kulshin, V E; Shlyapnikov, M G; Ksenzenko, V N; Kryukov, V M

    1995-06-01

    The nucleotide sequence of the bacteriophage T5 Bg/II-BamHI fragment (4,835 bp in length) known to carry a gene encoding the LTF protein which forms the phage L-shaped tail fibers was determined. It was shown to contain an open reading frame for 1,396 amino acid residues that corresponds to a protein of 147.8 kDa. The coding region of ltf gene is preceded by a typical Shine-Dalgarno sequence. Downstream from the ltf gene there is a strong transcription terminator. Data bank analysis of the LTF protein sequence reveals 55.1% identity to the hypothetical protein ORF 401 of bacteriophage lambda in a segment of 118 amino acids overlap. PMID:7789514

  1. Speeding disease gene discovery by sequence based candidate prioritization

    Directory of Open Access Journals (Sweden)

    Porteous David J

    2005-03-01

    Full Text Available Abstract Background Regions of interest identified through genetic linkage studies regularly exceed 30 centimorgans in size and can contain hundreds of genes. Traditionally this number is reduced by matching functional annotation to knowledge of the disease or phenotype in question. However, here we show that disease genes share patterns of sequence-based features that can provide a good basis for automatic prioritization of candidates by machine learning. Results We examined a variety of sequence-based features and found that for many of them there are significant differences between the sets of genes known to be involved in human hereditary disease and those not known to be involved in disease. We have created an automatic classifier called PROSPECTR based on those features using the alternating decision tree algorithm which ranks genes in the order of likelihood of involvement in disease. On average, PROSPECTR enriches lists for disease genes two-fold 77% of the time, five-fold 37% of the time and twenty-fold 11% of the time. Conclusion PROSPECTR is a simple and effective way to identify genes involved in Mendelian and oligogenic disorders. It performs markedly better than the single existing sequence-based classifier on novel data. PROSPECTR could save investigators looking at large regions of interest time and effort by prioritizing positional candidate genes for mutation detection and case-control association studies.

  2. Diverse nucleotide compositions and sequence fluctuation in Rubisco protein genes

    Science.gov (United States)

    Holden, Todd; Dehipawala, S.; Cheung, E.; Bienaime, R.; Ye, J.; Tremberger, G., Jr.; Schneider, P.; Lieberman, D.; Cheung, T.

    2011-10-01

    The Rubisco protein-enzyme is arguably the most abundance protein on Earth. The biology dogma of transcription and translation necessitates the study of the Rubisco genes and Rubisco-like genes in various species. Stronger correlation of fractal dimension of the atomic number fluctuation along a DNA sequence with Shannon entropy has been observed in the studied Rubisco-like gene sequences, suggesting a more diverse evolutionary pressure and constraints in the Rubisco sequences. The strategy of using metal for structural stabilization appears to be an ancient mechanism, with data from the porphobilinogen deaminase gene in Capsaspora owczarzaki and Monosiga brevicollis. Using the chi-square distance probability, our analysis supports the conjecture that the more ancient Rubisco-like sequence in Microcystis aeruginosa would have experienced very different evolutionary pressure and bio-chemical constraint as compared to Bordetella bronchiseptica, the two microbes occupying either end of the correlation graph. Our exploratory study would indicate that high fractal dimension Rubisco sequence would support high carbon dioxide rate via the Michaelis- Menten coefficient; with implication for the control of the whooping cough pathogen Bordetella bronchiseptica, a microbe containing a high fractal dimension Rubisco-like sequence (2.07). Using the internal comparison of chi-square distance probability for 16S rRNA (~ E-22) versus radiation repair Rec-A gene (~ E-05) in high GC content Deinococcus radiodurans, our analysis supports the conjecture that high GC content microbes containing Rubisco-like sequence are likely to include an extra-terrestrial origin, relative to Deinococcus radiodurans. Similar photosynthesis process that could utilize host star radiation would not compete with radiation resistant process from the biology dogma perspective in environments such as Mars and exoplanets.

  3. A human gut microbial gene catalogue established by metagenomic sequencing

    DEFF Research Database (Denmark)

    dos Santos, Marcelo Bertalan Quintanilha; Sicheritz-Pontén, Thomas; Nielsen, Henrik Bjørn;

    2010-01-01

    To understand the impact of gut microbes on human health and well-being it is crucial to assess their genetic potential. Here we describe the Illumina-based metagenomic sequencing, assembly and characterization of 3.3 million non-redundant microbial genes, derived from 576.7 gigabases of sequence...... minimal gut metagenome and the minimal gut bacterial genome in terms of functions present in all individuals and most bacteria, respectively....

  4. A human gut microbial gene catalogue established by metagenomic sequencing

    DEFF Research Database (Denmark)

    dos Santos, Marcelo Bertalan Quintanilha; Sicheritz-Pontén, Thomas; Nielsen, Henrik Bjørn;

    2010-01-01

    To understand the impact of gut microbes on human health and well-being it is crucial to assess their genetic potential. Here we describe the Illumina-based metagenomic sequencing, assembly and characterization of 3.3 million non-redundant microbial genes, derived from 576.7 gigabases of sequence...... gut metagenome and the minimal gut bacterial genome in terms of functions present in all individuals and most bacteria, respectively....

  5. Illumina MiSeq sequencing disfavours a sequence motif in the GFP reporter gene.

    Science.gov (United States)

    Van den Hoecke, Silvie; Verhelst, Judith; Saelens, Xavier

    2016-01-01

    Green fluorescent protein (GFP) is one of the most used reporter genes. We have used next-generation sequencing (NGS) to analyse the genetic diversity of a recombinant influenza A virus that expresses GFP and found a remarkable coverage dip in the GFP coding sequence. This coverage dip was present when virus-derived RT-PCR product or the parental plasmid DNA was used as starting material for NGS and regardless of whether Nextera XT transposase or Covaris shearing was used for DNA fragmentation. Therefore, the sequence coverage dip in the GFP coding sequence was not the result of emerging GFP mutant viruses or a bias introduced by Nextera XT fragmentation. Instead, we found that the Illumina MiSeq sequencing method disfavours the 'CCCGCC' motif in the GFP coding sequence. PMID:27193250

  6. Sequence and gene expression evolution of paralogous genes in willows.

    Science.gov (United States)

    Harikrishnan, Srilakshmy L; Pucholt, Pascal; Berlin, Sofia

    2015-12-22

    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows.

  7. Automated cleaning and pre-processing of immunoglobulin gene sequences from high-throughput sequencing

    Directory of Open Access Journals (Sweden)

    Miri eMichaeli

    2012-12-01

    Full Text Available High throughput sequencing (HTS yields tens of thousands to millions of sequences that require a large amount of pre-processing work to clean various artifacts. Such cleaning cannot be performed manually. Existing programs are not suitable for immunoglobulin (Ig genes, which are variable and often highly mutated. This paper describes Ig-HTS-Cleaner (Ig High Throughput Sequencing Cleaner, a program containing a simple cleaning procedure that successfully deals with pre-processing of Ig sequences derived from HTS, and Ig-Indel-Identifier (Ig Insertion – Deletion Identifier, a program for identifying legitimate and artifact insertions and/or deletions (indels. Our programs were designed for analyzing Ig gene sequences obtained by 454 sequencing, but they are applicable to all types of sequences and sequencing platforms. Ig-HTS-Cleaner and Ig-Indel-Identifier have been implemented in Java and saved as executable JAR files, supported on Linux and MS Windows. No special requirements are needed in order to run the programs, except for correctly constructing the input files as explained in the text. The programs' performance has been tested and validated on real and simulated data sets.

  8. Thermodynamics-based models of transcriptional regulation with gene sequence.

    Science.gov (United States)

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  9. Cloning and sequence of the human adrenodoxin reductase gene

    International Nuclear Information System (INIS)

    Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon

  10. Sequence variations in the FAD2 gene in seeded pumpkins.

    Science.gov (United States)

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-12-21

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

  11. Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

    Directory of Open Access Journals (Sweden)

    Edberg Jeffrey C

    2010-03-01

    Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

  12. Biased distribution of DNA uptake sequences towards genome maintenance genes

    DEFF Research Database (Denmark)

    Davidsen, T.; Rodland, E.A.; Lagesen, K.;

    2004-01-01

    Repeated sequence signatures are characteristic features of all genomic DNA. We have made a rigorous search for repeat genomic sequences in the human pathogens Neisseria meningitidis, Neisseria gonorrhoeae and Haemophilus influenzae and found that by far the most frequent 9-10mers residing within...... in these organisms. Pasteurella multocida also displayed high frequencies of a putative DUS identical to that previously identified in H. influenzae and with a skewed distribution towards genome maintenance genes, indicating that this bacterium might be transformation competent under certain conditions....

  13. Informational structure of genetic sequences and nature of gene splicing

    Science.gov (United States)

    Trifonov, E. N.

    1991-10-01

    Only about 1/20 of DNA of higher organisms codes for proteins, by means of classical triplet code. The rest of DNA sequences is largely silent, with unclear functions, if any. The triplet code is not the only code (message) carried by the sequences. There are three levels of molecular communication, where the same sequence ``talks'' to various bimolecules, while having, respectively, three different appearances: DNA, RNA and protein. Since the molecular structures and, hence, sequence specific preferences of these are substantially different, the original DNA sequence has to carry simultaneously three types of sequence patterns (codes, messages), thus, being a composite structure in which one had the same letter (nucleotide) is frequently involved in several overlapping codes of different nature. This multiplicity and overlapping of the codes is a unique feature of the Gnomic, language of genetic sequences. The coexisting codes have to be degenerate in various degrees to allow an optimal and concerted performance of all the encoded functions. There is an obvious conflict between the best possible performance of a given function and necessity to compromise the quality of a given sequence pattern in favor of other patterns. It appears that the major role of various changes in the sequences on their ``ontogenetic'' way from DNA to RNA to protein, like RNA editing and splicing, or protein post-translational modifications is to resolve such conflicts. New data are presented strongly indicating that the gene splicing is such a device to resolve the conflict between the code of DNA folding in chromatin and the triplet code for protein synthesis.

  14. Cloning,sequencing and phylogenic analysis of duck prion gene

    Institute of Scientific and Technical Information of China (English)

    WANG Qigui; ZHANG Lei; HU Xiaoxiang; FAN Baoliang; LI Ning; LI Hui; WU Changxin

    2004-01-01

    Duck prion gene was cloned and sequenced. Similar to mammalian prion protein (PrP), duck prion is encoded by a single exon of a single copy in genome, which was confirmed by Southern blot analysis. All of the structural features of mammalian PrP were also identified in the duck PrP. Compared with mammalian PrP, it exhibited a 30 % of general similarity. When compared with chicken PrP, it showed a higher homology of 97%. A phylogenetic tree was constructed to trace evolution of prion gene in animals.

  15. Identification of Driver Genes in Hepatocellular Carcinoma by Exome Sequencing

    OpenAIRE

    Sean P Cleary; Jeck, William R.; Zhao, Xiaobei; Chen, Kui; Selitsky, Sara R.; Savich, Gleb L.; Tan, Ting-Xu; Wu, Michael C.; Getz, Gad; Lawrence, Michael S.; Joel S Parker; Li, Jinyu; Powers, Scott; Kim, Hyeja; Fischer, Sandra

    2013-01-01

    Genetic alterations in specific driver genes lead to disruption of cellular pathways and are critical events in the instigation and progression of hepatocellular carcinoma. As a prerequisite for individualized cancer treatment, we sought to characterize the landscape of recurrent somatic mutations in hepatocellular carcinoma. We performed whole exome sequencing on 87 hepatocellular carcinomas and matched normal adjacent tissues to anaverage coverage of 59x. The overall mutation rate was rough...

  16. Byssochlamys nivea with patulin-producing capability has an isoepoxydon dehydrogenase gene (idh) with sequence homology to Penicillium expansum and P. griseofulvum.

    Science.gov (United States)

    Dombrink-Kurtzman, Mary Ann; Engberg, Amy E

    2006-09-01

    Nucleotide sequences of the isoepoxydon dehydrogenase gene (idh) for eight strains of Byssochlamys nivea were determined by constructing GenomeWalker libraries. A striking finding was that all eight strains of B. nivea examined had identical nucleotide sequences, including those of the two introns present. The length of intron 2 was nearly three times the size of introns in strains of Penicillium expansum and P. griseofulvum, but intron 1 was comparable in size to the number of nucleotides present in introns 1 and 2 of P. expansum and P. griseofulvum. A high degree of amino acid homology (88%) existed for the idh genes of the strains of B. nivea when compared with sequences of P. expansum and P. griseofulvum. There were many nucleotide differences present, but they did not affect the amino acid sequence because they were present in the third position. The identity of the B. nivea isolates was confirmed by sequencing the ITS/partial LSU (28 S) rDNA genes. Four B. nivea strains were analysed for production of patulin, a mycotoxin found primarily in apple juice and other fruit products. The B. nivea strains produced patulin in amounts comparable to P. expansum strains. Interest in the genus Byssochlamys is related to the ability of its ascospores to survive pasteurization and cause spoilage of heat-processed fruit products worldwide.

  17. Nucleotide sequence and temporal expression of a baculovirus regulatory gene.

    Science.gov (United States)

    Guarino, L A; Summers, M D

    1987-07-01

    The nucleotide sequence of a trans-activating regulatory gene (IE-1) of the baculovirus Autographa californica nuclear polyhedrosis virus has been determined. This gene encodes a protein of 581 amino acids with a predicted molecular weight of 66,856. A DNA fragment containing the entire coding sequence of IE-1 was inserted downstream of an RNA promoter. Subsequent cell-free transcription and translation directed the synthesis of a single peptide with an apparent molecular weight of 70,000. Quantitative S1 nuclease analysis indicated that IE-1 was maximally synthesized during a 1-h virus adsorption period and that steady-state levels of IE-1 message were maintained during the first 24 h of infection. Northern blot hybridization indicated that several late transcripts which overlap the IE-1 gene were transcribed from both strands. The precise locations of the 5' and 3' ends of these overlapping transcripts were mapped using S1 nuclease. The overlapping transcripts were grouped in two transcriptional units. One unit was composed of IE-1 and overlapping gamma transcripts which initiated upstream of IE-1 and terminated downstream of IE-1. The other unit, transcribed from the opposite strand, consisted of gamma transcripts with coterminal 5' ends and extended 3' ends. The shorter, more abundant transcripts in this unit overlapped 30 to 40 bases of IE-1 at the 3' end, while the longer transcripts overlapped the entire IE-1 gene. Transcription of several early A. californica nuclear polyhedrosis virus genes, in addition to 39K, was shown to be trans-activated by IE-1, indicating that IE-1 may have a central role in the regulation of beta-gene expression. PMID:16789264

  18. Identification of rat genes by TWINSCAN gene prediction, RT-PCR, and direct sequencing

    DEFF Research Database (Denmark)

    Wu, Jia Qian; Shteynberg, David; Arumugam, Manimozhiyan;

    2004-01-01

    an alternative approach: reverse transcription-polymerase chain reaction (RT-PCR) and direct sequencing based on dual-genome de novo predictions from TWINSCAN. We tested 444 TWINSCAN-predicted rat genes that showed significant homology to known human genes implicated in disease but that were partially...... or completely missed by methods based on protein-to-genome mapping. Using primers in exons flanking a single predicted intron, we were able to verify the existence of 59% of these predicted genes. We then attempted to amplify the complete predicted open reading frames of 136 genes that were verified...

  19. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    Directory of Open Access Journals (Sweden)

    M. Ananda Chitra

    2015-07-01

    Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

  20. Angiosperm phylogeny inferred from sequences of four mitochondrial genes

    Institute of Scientific and Technical Information of China (English)

    Yin-Long QIU; Zhi-Duan CHEN; Libo LI; Bin WANG; Jia-Yu XUE; Tory A. HENDRY; Rui-Qi LI; Joseph W. BROWN; Yang LIU; Geordan T. HUDSON

    2010-01-01

    An angiosperm phylogeny was reconstructed in a maximum likelihood analysis of sequences of four mitochondrial genes, atpl, matR, had5, and rps3, from 380 species that represent 376 genera and 296 families of seed plants. It is largely congruent with the phylogeny of angiosperms reconstructed from chloroplast genes atpB, matK, and rbcL, and nuclear 18S rDNA. The basalmost lineage consists of Amborella and Nymphaeales (including Hydatellaceae). Austrobaileyales follow this clade and are sister to the mesangiosperms, which include Chloranthaceae, Ceratophyllum, magnoliids, monocots, and eudicots. With the exception of Chloranthaceae being sister to Ceratophyllum, relationships among these five lineages are not well supported. In eudicots, Ranunculales, Sabiales, Proteales, Trochodendrales, Buxales, Gunnerales, Saxifragales, Vitales, Berberidopsidales, and Dilleniales form a basal grade of lines that diverged before the diversification of rosids and asterids. Within rosids, the COM (Celastrales-Oxalidales-Malpighiales) clade is sister to malvids (or rosid Ⅱ), instead of to the nitrogen-fixing clade as found in all previous large-scale molecular analyses of angiosperms. Santalales and Caryophyllales are members of an expanded asterid clade. This study shows that the mitochondrial genes are informative markers for resolving relationships among genera, families, or higher rank taxa across angiosperms. The low substitution rates and low homoplasy levels of the mitochondrial genes relative to the chloroplast genes, as found in this study, make them particularly useful for reconstructing ancient phylogenetic relationships. A mitochondrial gene-based angiosperm phylogeny provides an independent and essential reference for comparison with hypotheses of angiosperm phylogeny based on chloroplast genes, nuclear genes, and non-molecular data to reconstruct the underlying organismal phylogeny.

  1. Technology development for gene discovery and full-length sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Marcelo Bento Soares

    2004-07-19

    In previous years, with support from the U.S. Department of Energy, we developed methods for construction of normalized and subtracted cDNA libraries, and constructed hundreds of high-quality libraries for production of Expressed Sequence Tags (ESTs). Our clones were made widely available to the scientific community through the IMAGE Consortium, and millions of ESTs were produced from our libraries either by collaborators or by our own sequencing laboratory at the University of Iowa. During this grant period, we focused on (1) the development of a method for preferential cloning of tissue-specific and/or rare transcripts, (2) its utilization to expedite EST-based gene discovery for the NIH Mouse Brain Molecular Anatomy Project, (3) further development and optimization of a method for construction of full-length-enriched cDNA libraries, and (4) modification of a plasmid vector to maximize efficiency of full-length cDNA sequencing by the transposon-mediated approach. It is noteworthy that the technology developed for preferential cloning of rare mRNAs enabled identification of over 2,000 mouse transcripts differentially expressed in the hippocampus. In addition, the method that we optimized for construction of full-length-enriched cDNA libraries was successfully utilized for the production of approximately fifty libraries from the developing mouse nervous system, from which over 2,500 full-ORF-containing cDNAs have been identified and accurately sequenced in their entirety either by our group or by the NIH-Mammalian Gene Collection Program Sequencing Team.

  2. Cloning, nucleotide sequence, and expression of the Rhodobacter sphaeroides Y thioredoxin gene.

    OpenAIRE

    Pille, S.; Chuat, J C; Breton, A M; Clément-Métral, J D; Galibert, F

    1990-01-01

    Synthetic oligodeoxynucleotide probes based on the known amino acid sequence of Rhodobacter sphaeroides Y thioredoxin were used to identify, clone, and sequence the structural gene. The amino acid sequence derived from the DNA sequence of the R. sphaeroides gene was identical to the known amino acid sequence of R. sphaeroides thioredoxin. An NcoI site was created by directed mutagenesis at the beginning of the thioredoxin gene, inducing in the encoded protein the replacement of serine in posi...

  3. Deep sequencing reveals 50 novel genes for recessive cognitive disorders.

    Science.gov (United States)

    Najmabadi, Hossein; Hu, Hao; Garshasbi, Masoud; Zemojtel, Tomasz; Abedini, Seyedeh Sedigheh; Chen, Wei; Hosseini, Masoumeh; Behjati, Farkhondeh; Haas, Stefan; Jamali, Payman; Zecha, Agnes; Mohseni, Marzieh; Püttmann, Lucia; Vahid, Leyla Nouri; Jensen, Corinna; Moheb, Lia Abbasi; Bienek, Melanie; Larti, Farzaneh; Mueller, Ines; Weissmann, Robert; Darvish, Hossein; Wrogemann, Klaus; Hadavi, Valeh; Lipkowitz, Bettina; Esmaeeli-Nieh, Sahar; Wieczorek, Dagmar; Kariminejad, Roxana; Firouzabadi, Saghar Ghasemi; Cohen, Monika; Fattahi, Zohreh; Rost, Imma; Mojahedi, Faezeh; Hertzberg, Christoph; Dehghan, Atefeh; Rajab, Anna; Banavandi, Mohammad Javad Soltani; Hoffer, Julia; Falah, Masoumeh; Musante, Luciana; Kalscheuer, Vera; Ullmann, Reinhard; Kuss, Andreas Walter; Tzschach, Andreas; Kahrizi, Kimia; Ropers, H Hilger

    2011-10-01

    Common diseases are often complex because they are genetically heterogeneous, with many different genetic defects giving rise to clinically indistinguishable phenotypes. This has been amply documented for early-onset cognitive impairment, or intellectual disability, one of the most complex disorders known and a very important health care problem worldwide. More than 90 different gene defects have been identified for X-chromosome-linked intellectual disability alone, but research into the more frequent autosomal forms of intellectual disability is still in its infancy. To expedite the molecular elucidation of autosomal-recessive intellectual disability, we have now performed homozygosity mapping, exon enrichment and next-generation sequencing in 136 consanguineous families with autosomal-recessive intellectual disability from Iran and elsewhere. This study, the largest published so far, has revealed additional mutations in 23 genes previously implicated in intellectual disability or related neurological disorders, as well as single, probably disease-causing variants in 50 novel candidate genes. Proteins encoded by several of these genes interact directly with products of known intellectual disability genes, and many are involved in fundamental cellular processes such as transcription and translation, cell-cycle control, energy metabolism and fatty-acid synthesis, which seem to be pivotal for normal brain development and function. PMID:21937992

  4. Cloning and sequence analysis of US1 gene in duck enteritis virus%Cloning and sequence analysis of US1gene in duck enteritis virus

    Institute of Scientific and Technical Information of China (English)

    ZHAO Yan; WANG Jun-wei; MA Bo; ZHAO Xiao-yan

    2011-01-01

    In this paper, a 1,860 bp sequence in IRs region of duck enteritis virus(DEV)was amplified by single oligonucleotide nested PCR with a single primer designed according to partial sequence of USI and then a pair of primers designed according to the 3' UTR of US8 gene and 5'end of the new getting sequence were used to amplify a 2,426 bp sequence toward the TRs region.Sequence analysis revealed that the both sequences contained an identical 990 bp open reading frame of DEV US1 gene.The two ORFs were in opposite transcription orientation.Sequence comparison of the nucleotide sequence and the deduced amino acid sequence of US1 gene showed relatively high identity to Mardivirus.Phylogenetic tree analysis showed that the eleven herpesviruses viruses were classified into three groups, and the duck enteritis virus was most closely related to Mardivirus.

  5. Minimum information about a marker gene sequence (MIMARKS) and minimum information about any (x) sequence (MIxS) specifications

    DEFF Research Database (Denmark)

    Yilmaz, Pelin; Kottmann, Renzo; Field, Dawn;

    2011-01-01

    Here we present a standard developed by the Genomic Standards Consortium (GSC) for reporting marker gene sequences--the minimum information about a marker gene sequence (MIMARKS). We also introduce a system for describing the environment from which a biological sample originates. The 'environment...

  6. dcp gene of Escherichia coli: cloning, sequencing, transcript mapping, and characterization of the gene product.

    OpenAIRE

    Henrich, B; S. Becker; Schroeder, U; Plapp, R.

    1993-01-01

    Dipeptidyl carboxypeptidase is a C-terminal exopeptidase of Escherichia coli. We have isolated the respective gene, dcp, from a low-copy-number plasmid library by its ability to complement a dcp mutation preventing the utilization of the unique substrate N-benzoyl-L-glycyl-L-histidyl-L-leucine. Sequence analysis of a 2.9-kb DNA fragment revealed an open reading frame of 2,043 nucleotides which was assigned to the dcp gene by N-terminal amino acid sequencing and electrophoretic molecular mass ...

  7. Candidate gene analysis and exome sequencing confirm LBX1 as a susceptibility gene for idiopathic scoliosis

    DEFF Research Database (Denmark)

    Grauers, Anna; Wang, Jingwen; Einarsdottir, Elisabet;

    2015-01-01

    that are significantly associated with idiopathic scoliosis in Asian and Caucasian populations, rs11190870 close to the LBX1 gene being the most replicated finding. PURPOSE: The aim of the present study was to investigate the genetics of idiopathic scoliosis in a Scandinavian cohort by performing a candidate gene study...... samples from 100 surgically treated idiopathic scoliosis patients. Novel or rare missense, nonsense, or splice site variants were selected for individual genotyping in the 1,739 cases and 1,812 controls. In addition, the 5'UTR, noncoding exon and promoter regions of LBX1, not covered by exome sequencing......, were Sanger sequenced in the 100 pooled samples. RESULTS: Of the four candidate genes, an intergenic variant, rs11190870, downstream of the LBX1 gene, showed a highly significant association to idiopathic scoliosis in 1,739 cases and 1,812 controls (p=7.0×10(-18)). We identified 20 novel variants...

  8. A sequence-based approach to identify reference genes for gene expression analysis

    Directory of Open Access Journals (Sweden)

    Chari Raj

    2010-08-01

    Full Text Available Abstract Background An important consideration when analyzing both microarray and quantitative PCR expression data is the selection of appropriate genes as endogenous controls or reference genes. This step is especially critical when identifying genes differentially expressed between datasets. Moreover, reference genes suitable in one context (e.g. lung cancer may not be suitable in another (e.g. breast cancer. Currently, the main approach to identify reference genes involves the mining of expression microarray data for highly expressed and relatively constant transcripts across a sample set. A caveat here is the requirement for transcript normalization prior to analysis, and measurements obtained are relative, not absolute. Alternatively, as sequencing-based technologies provide digital quantitative output, absolute quantification ensues, and reference gene identification becomes more accurate. Methods Serial analysis of gene expression (SAGE profiles of non-malignant and malignant lung samples were compared using a permutation test to identify the most stably expressed genes across all samples. Subsequently, the specificity of the reference genes was evaluated across multiple tissue types, their constancy of expression was assessed using quantitative RT-PCR (qPCR, and their impact on differential expression analysis of microarray data was evaluated. Results We show that (i conventional references genes such as ACTB and GAPDH are highly variable between cancerous and non-cancerous samples, (ii reference genes identified for lung cancer do not perform well for other cancer types (breast and brain, (iii reference genes identified through SAGE show low variability using qPCR in a different cohort of samples, and (iv normalization of a lung cancer gene expression microarray dataset with or without our reference genes, yields different results for differential gene expression and subsequent analyses. Specifically, key established pathways in lung

  9. Multiple gene sequence analysis using genes of the bacterial DNA repair pathway

    OpenAIRE

    Miguel Rotelok Neto; Carolina Weigert Galvão; Leonardo Magalhães Cruz; Dieval Guizelini; Leilane Caline Silva; Jarem Raul Garcia; Rafael Mazer Etto

    2015-01-01

    The ability to recognize and repair abnormal DNA structures is common to all forms of life. Physiological studies and genomic sequencing of a variety of bacterial species have identified an incredible diversity of DNA repair pathways. Despite the amount of available genes in public database, the usual method to place genomes in a taxonomic context is based mainly on the 16S rRNA or housekeeping genes. Thus, the relationships among genomes remain poorly understood. In this work, an approach of...

  10. Efficient expression of the Saccharomyces cerevisiae PGK gene depends on an upstream activation sequence but does not require TATA sequences.

    OpenAIRE

    Ogden, J E; Stanway, C; Kim, S.; Mellor, J; Kingsman, A J; Kingsman, S M

    1986-01-01

    The Saccharomyces cerevisiae PGK (phosphoglycerate kinase) gene encodes one of the most abundant mRNA and protein species in the cell. To identify the promoter sequences required for the efficient expression of PGK, we undertook a detailed internal deletion analysis of the 5' noncoding region of the gene. Our analysis revealed that PGK has an upstream activation sequence (UASPGK) located between 402 and 479 nucleotides upstream from the initiating ATG sequence which is required for full trans...

  11. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    Science.gov (United States)

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  12. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  13. Cloning, sequencing and expression of a xylanase gene from the maize pathogen Helminthosporium turcicum

    DEFF Research Database (Denmark)

    Degefu, Y.; Paulin, L.; Lübeck, Peter Stephensen

    2001-01-01

    A gene encoding an endoxylanase from the phytopathogenic fungus Helminthosporium turcicum Pass. was cloned and sequenced. The entire nucleotide sequence of a 1991 bp genomic fragment containing an endoxylanase gene was determined. The xylanase gene of 795 bp, interrupted by two introns of 52 and ...... xylan as a sole carbon source. The cloned xylanase gene was expressed in maize plants during infection....

  14. dcp gene of Escherichia coli: cloning, sequencing, transcript mapping, and characterization of the gene product.

    Science.gov (United States)

    Henrich, B; Becker, S; Schroeder, U; Plapp, R

    1993-01-01

    Dipeptidyl carboxypeptidase is a C-terminal exopeptidase of Escherichia coli. We have isolated the respective gene, dcp, from a low-copy-number plasmid library by its ability to complement a dcp mutation preventing the utilization of the unique substrate N-benzoyl-L-glycyl-L-histidyl-L-leucine. Sequence analysis of a 2.9-kb DNA fragment revealed an open reading frame of 2,043 nucleotides which was assigned to the dcp gene by N-terminal amino acid sequencing and electrophoretic molecular mass determination of the purified dcp product. Transcript mapping by primer extension and S1 protection experiments verified the physiological significance of potential initiation and termination signals for dcp transcription and allowed the identification of a single species of monocistronic dcp mRNA. The codon usage pattern and the effects of elevated gene copy number indicated a relatively low level of dcp expression. The predicted amino acid sequence of dipeptidyl carboxypeptidase, containing a potential zinc-binding site, is highly homologous (78.8%) to the corresponding enzyme from Salmonella typhimurium. It also displays significant homology to the products of the S. typhimurium opdA and the E. coli prlC genes and to some metalloproteases from rats and Saccharomyces cerevisiae. No potential export signals could be inferred from the amino acid sequence. Dipeptidyl carboxypeptidase was enriched 80-fold from crude extracts of E. coli and used to investigate some of its biochemical and biophysical properties. Images PMID:8226676

  15. An automated annotation tool for genomic DNA sequences using GeneScan and BLAST

    Indian Academy of Sciences (India)

    Andrew M. Lynn; Chakresh Kumar Jain; K. Kosalai; Pranjan Barman; Nupur Thakur; Harish Batra; Alok Bhattacharya

    2001-04-01

    Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated annotation of genome DNA sequences.

  16. Nucleotide sequence and corresponding amino acid sequence of the gene for the major antigen of foot and mouth disease virus.

    OpenAIRE

    Kurz, C; Forss, S; Küpper, H; K Strohmaier; Schaller, H

    1981-01-01

    A segment of 1160 nucleotides of the FMDV genome has been sequenced using three overlapping fragments of cloned cDNA from FMDV strain O1K. This sequence contains the coding sequence for the viral capsid protein VP1 as shown by its homology to known and newly determined amino acid sequences from this man antigenic polypeptide of the FMDV virion. The structural gene for VP1 comprises 639 nucleotides which specify a sequence of 213 amino acids for the VP1 protein. The coding sequence is not flan...

  17. Solving the molecular diagnostic testing conundrum for Mendelian disorders in the era of next-generation sequencing: single-gene, gene panel, or exome/genome sequencing.

    Science.gov (United States)

    Xue, Yuan; Ankala, Arunkanth; Wilcox, William R; Hegde, Madhuri R

    2015-06-01

    Next-generation sequencing is changing the paradigm of clinical genetic testing. Today there are numerous molecular tests available, including single-gene tests, gene panels, and exome sequencing or genome sequencing. As a result, ordering physicians face the conundrum of selecting the best diagnostic tool for their patients with genetic conditions. Single-gene testing is often most appropriate for conditions with distinctive clinical features and minimal locus heterogeneity. Next-generation sequencing-based gene panel testing, which can be complemented with array comparative genomic hybridization and other ancillary methods, provides a comprehensive and feasible approach for heterogeneous disorders. Exome sequencing and genome sequencing have the advantage of being unbiased regarding what set of genes is analyzed, enabling parallel interrogation of most of the genes in the human genome. However, current limitations of next-generation sequencing technology and our variant interpretation capabilities caution us against offering exome sequencing or genome sequencing as either stand-alone or first-choice diagnostic approaches. A growing interest in personalized medicine calls for the application of genome sequencing in clinical diagnostics, but major challenges must be addressed before its full potential can be realized. Here, we propose a testing algorithm to help clinicians opt for the most appropriate molecular diagnostic tool for each scenario.

  18. Secondary structure and phylogenetic utility of the ribosomal large subunit (28S) in monogeneans of the genus Thaparocleidus and Bifurcohaptor (Monogenea: Dactylogyridae).

    Science.gov (United States)

    Chaudhary, Anshu; Singh, Hridaya Shanker

    2013-04-01

    Present communication deals with secondary structure of 28S rDNA of two already known species of monogeneans viz., Bifurcohaptor indicus and Thaparocleidus parvulus parasitizing gill filaments of a freshwater fish, Mystus vittatus for phylogenetic inference. Secondary structure data are best used as accessory taxonomic characters as their phylogenetic resolving power and confidence in validity. Secondary structure of the 28S rDNA transcript could provide information for identifying homologous nucleotide characters, useful for cladistic inference of relationships. Such structure data could be used as taxonomic character. The study supports that species-level sequence variability renders 28S sequence as a unique window for examining the behavior of fast evolving, non-coding DNA sequences. Apart from this it also confirms that molecular similarity present in various species could be host-induced. PMID:24431545

  19. Transcriptome sequencing and positive selected genes analysis of Bombyx mandarina.

    Science.gov (United States)

    Cheng, Tingcai; Fu, Bohua; Wu, Yuqian; Long, Renwen; Liu, Chun; Xia, Qingyou

    2015-01-01

    The wild silkworm Bombyx mandarina is widely believed to be an ancestor of the domesticated silkworm, Bombyx mori. Silkworms are often used as a model for studying the mechanism of species domestication. Here, we performed transcriptome sequencing of the wild silkworm using an Illumina HiSeq2000 platform. We produced 100,004,078 high-quality reads and assembled them into 50,773 contigs with an N50 length of 1764 bp and a mean length of 941.62 bp. A total of 33,759 unigenes were identified, with 12,805 annotated in the Nr database, 8273 in the Pfam database, and 9093 in the Swiss-Prot database. Expression profile analysis found significant differential expression of 1308 unigenes between the middle silk gland (MSG) and posterior silk gland (PSG). Three sericin genes (sericin 1, sericin 2, and sericin 3) were expressed specifically in the MSG and three fibroin genes (fibroin-H, fibroin-L, and fibroin/P25) were expressed specifically in the PSG. In addition, 32,297 Single-nucleotide polymorphisms (SNPs) and 361 insertion-deletions (INDELs) were detected. Comparison with the domesticated silkworm p50/Dazao identified 5,295 orthologous genes, among which 400 might have experienced or to be experiencing positive selection by Ka/Ks analysis. These data and analyses presented here provide insights into silkworm domestication and an invaluable resource for wild silkworm genomics research. PMID:25806526

  20. Transcriptome sequencing and positive selected genes analysis of Bombyx mandarina.

    Directory of Open Access Journals (Sweden)

    Tingcai Cheng

    Full Text Available The wild silkworm Bombyx mandarina is widely believed to be an ancestor of the domesticated silkworm, Bombyx mori. Silkworms are often used as a model for studying the mechanism of species domestication. Here, we performed transcriptome sequencing of the wild silkworm using an Illumina HiSeq2000 platform. We produced 100,004,078 high-quality reads and assembled them into 50,773 contigs with an N50 length of 1764 bp and a mean length of 941.62 bp. A total of 33,759 unigenes were identified, with 12,805 annotated in the Nr database, 8273 in the Pfam database, and 9093 in the Swiss-Prot database. Expression profile analysis found significant differential expression of 1308 unigenes between the middle silk gland (MSG and posterior silk gland (PSG. Three sericin genes (sericin 1, sericin 2, and sericin 3 were expressed specifically in the MSG and three fibroin genes (fibroin-H, fibroin-L, and fibroin/P25 were expressed specifically in the PSG. In addition, 32,297 Single-nucleotide polymorphisms (SNPs and 361 insertion-deletions (INDELs were detected. Comparison with the domesticated silkworm p50/Dazao identified 5,295 orthologous genes, among which 400 might have experienced or to be experiencing positive selection by Ka/Ks analysis. These data and analyses presented here provide insights into silkworm domestication and an invaluable resource for wild silkworm genomics research.

  1. Identification of novel hereditary cancer genes by whole exome sequencing.

    Science.gov (United States)

    Sokolenko, Anna P; Suspitsin, Evgeny N; Kuligina, Ekatherina Sh; Bizin, Ilya V; Frishman, Dmitrij; Imyanitov, Evgeny N

    2015-12-28

    Whole exome sequencing (WES) provides a powerful tool for medical genetic research. Several dozens of WES studies involving patients with hereditary cancer syndromes have already been reported. WES led to breakthrough in understanding of the genetic basis of some exceptionally rare syndromes; for example, identification of germ-line SMARCA4 mutations in patients with ovarian hypercalcemic small cell carcinomas indeed explains a noticeable share of familial aggregation of this disease. However, studies on common cancer types turned out to be more difficult. In particular, there is almost a dozen of reports describing WES analysis of breast cancer patients, but none of them yet succeeded to reveal a gene responsible for the significant share of missing heritability. Virtually all components of WES studies require substantial improvement, e.g. technical performance of WES, interpretation of WES results, mode of patient selection, etc. Most of contemporary investigations focus on genes with autosomal dominant mechanism of inheritance; however, recessive and oligogenic models of transmission of cancer susceptibility also need to be considered. It is expected that the list of medically relevant tumor-predisposing genes will be rapidly expanding in the next few years. PMID:26427841

  2. Estimating the extent of horizontal gene transfer in metagenomic sequences

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2008-03-01

    Full Text Available Abstract Background Although the extent of horizontal gene transfer (HGT in complete genomes has been widely studied, its influence in the evolution of natural communities of prokaryotes remains unknown. The availability of metagenomic sequences allows us to address the study of global patterns of prokaryotic evolution in samples from natural communities. However, the methods that have been commonly used for the study of HGT are not suitable for metagenomic samples. Therefore it is important to develop new methods or to adapt existing ones to be used with metagenomic sequences. Results We have created two different methods that are suitable for the study of HGT in metagenomic samples. The methods are based on phylogenetic and DNA compositional approaches, and have allowed us to assess the extent of possible HGT events in metagenomes for the first time. The methods are shown to be compatible and quite precise, although they probably underestimate the number of possible events. Our results show that the phylogenetic method detects HGT in between 0.8% and 1.5% of the sequences, while DNA compositional methods identify putative HGT in between 2% and 8% of the sequences. These ranges are very similar to these found in complete genomes by related approaches. Both methods act with a different sensitivity since they probably target HGT events of different ages: the compositional method mostly identifies recent transfers, while the phylogenetic is more suitable for the detections of older events. Nevertheless, the study of the number of HGT events in metagenomic sequences from different communities shows a consistent trend for both methods: the lower amount is found for the sequences of the Sargasso Sea metagenome, while the higher quantity is found in the whale fall metagenome from the bottom of the ocean. The significance of these observations is discussed. Conclusion The computational approaches that are used to find possible HGT events in complete

  3. Sequencing, characterization, and gene expression analysis of the histidine decarboxylase gene cluster of Morganella morganii.

    Science.gov (United States)

    Ferrario, Chiara; Borgo, Francesca; de Las Rivas, Blanca; Muñoz, Rosario; Ricci, Giovanni; Fortina, Maria Grazia

    2014-03-01

    The histidine decarboxylase gene cluster of Morganella morganii DSM30146(T) was sequenced, and four open reading frames, named hdcT1, hdc, hdcT2, and hisRS were identified. Two putative histidine/histamine antiporters (hdcT1 and hdcT2) were located upstream and downstream the hdc gene, codifying a pyridoxal-P dependent histidine decarboxylase, and followed by hisRS gene encoding a histidyl-tRNA synthetase. This organization was comparable with the gene cluster of other known Gram negative bacteria, particularly with that of Klebsiella oxytoca. Recombinant Escherichia coli strains harboring plasmids carrying the M. morganii hdc gene were shown to overproduce histidine decarboxylase, after IPTG induction at 37 °C for 4 h. Quantitative RT-PCR experiments revealed the hdc and hisRS genes were highly induced under acidic and histidine-rich conditions. This work represents the first description and identification of the hdc-related genes in M. morganii. Results support the hypothesis that the histidine decarboxylation reaction in this prolific histamine producing species may play a role in acid survival. The knowledge of the role and the regulation of genes involved in histidine decarboxylation should improve the design of rational strategies to avoid toxic histamine production in foods.

  4. Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

    Science.gov (United States)

    : Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

  5. Detection bias in microarray and sequencing transcriptomic analysis identified by housekeeping genes

    OpenAIRE

    Yijuan Zhang; Oluwafemi S. Akintola; Liu, Ken J.A.; Bingyun Sun

    2015-01-01

    This work includes the original data used to discover the gene ontology bias in transcriptomic analysis conducted by microarray and high throughput sequencing (Zhang et al., 2015) [1]. In the analysis, housekeeping genes were used to examine the differential detection ability by microarray and sequencing because these genes are probably the most reliably detected. The genes included here were compiled from 15 human housekeeping gene studies. The provided tables here comprise of detailed chrom...

  6. Poly purine.pyrimidine sequences upstream of the beta-galactosidase gene affect gene expression in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Brahmachari Samir K

    2001-10-01

    Full Text Available Abstract Background Poly purine.pyrimidine sequences have the potential to adopt intramolecular triplex structures and are overrepresented upstream of genes in eukaryotes. These sequences may regulate gene expression by modulating the interaction of transcription factors with DNA sequences upstream of genes. Results A poly purine.pyrimidine sequence with the potential to adopt an intramolecular triplex DNA structure was designed. The sequence was inserted within a nucleosome positioned upstream of the β-galactosidase gene in yeast, Saccharomyces cerevisiae, between the cycl promoter and gal 10Upstream Activating Sequences (UASg. Upon derepression with galactose, β-galactosidase gene expression is reduced 12-fold in cells carrying single copy poly purine.pyrimidine sequences. This reduction in expression is correlated with reduced transcription. Furthermore, we show that plasmids carrying a poly purine.pyrimidine sequence are not specifically lost from yeast cells. Conclusion We propose that a poly purine.pyrimidine sequence upstream of a gene affects transcription. Plasmids carrying this sequence are not specifically lost from cells and thus no additional effort is needed for the replication of these sequences in eukaryotic cells.

  7. The GeneCards Suite: From Gene Data Mining to Disease Genome Sequence Analyses.

    Science.gov (United States)

    Stelzer, Gil; Rosen, Naomi; Plaschkes, Inbar; Zimmerman, Shahar; Twik, Michal; Fishilevich, Simon; Stein, Tsippi Iny; Nudel, Ron; Lieder, Iris; Mazor, Yaron; Kaplan, Sergey; Dahary, Dvir; Warshawsky, David; Guan-Golan, Yaron; Kohn, Asher; Rappaport, Noa; Safran, Marilyn; Lancet, Doron

    2016-01-01

    GeneCards, the human gene compendium, enables researchers to effectively navigate and inter-relate the wide universe of human genes, diseases, variants, proteins, cells, and biological pathways. Our recently launched Version 4 has a revamped infrastructure facilitating faster data updates, better-targeted data queries, and friendlier user experience. It also provides a stronger foundation for the GeneCards suite of companion databases and analysis tools. Improved data unification includes gene-disease links via MalaCards and merged biological pathways via PathCards, as well as drug information and proteome expression. VarElect, another suite member, is a phenotype prioritizer for next-generation sequencing, leveraging the GeneCards and MalaCards knowledgebase. It automatically infers direct and indirect scored associations between hundreds or even thousands of variant-containing genes and disease phenotype terms. VarElect's capabilities, either independently or within TGex, our comprehensive variant analysis pipeline, help prepare for the challenge of clinical projects that involve thousands of exome/genome NGS analyses. © 2016 by John Wiley & Sons, Inc. PMID:27322403

  8. The Clinical Significance of Unknown Sequence Variants in BRCA Genes

    Energy Technology Data Exchange (ETDEWEB)

    Calò, Valentina; Bruno, Loredana; Paglia, Laura La; Perez, Marco; Margarese, Naomi [Department of Surgery and Oncology, Regional Reference Center for the Biomolecular Characterization and Genetic Screening of Hereditary Tumors, University of Palermo, Via del Vespro 127, 90127 Palermo (Italy); Gaudio, Francesca Di [Department of Medical Biotechnologies and Legal Medicine, University of Palermo, Palermo (Italy); Russo, Antonio, E-mail: lab-oncobiologia@usa.net [Department of Surgery and Oncology, Regional Reference Center for the Biomolecular Characterization and Genetic Screening of Hereditary Tumors, University of Palermo, Via del Vespro 127, 90127 Palermo (Italy)

    2010-09-10

    Germline mutations in BRCA1/2 genes are responsible for a large proportion of hereditary breast and/or ovarian cancers. Many highly penetrant predisposition alleles have been identified and include frameshift or nonsense mutations that lead to the translation of a truncated protein. Other alleles contain missense mutations, which result in amino acid substitution and intronic variants with splicing effect. The discovery of variants of uncertain/unclassified significance (VUS) is a result that can complicate rather than improve the risk assessment process. VUSs are mainly missense mutations, but also include a number of intronic variants and in-frame deletions and insertions. Over 2,000 unique BRCA1 and BRCA2 missense variants have been identified, located throughout the whole gene (Breast Cancer Information Core Database (BIC database)). Up to 10–20% of the BRCA tests report the identification of a variant of uncertain significance. There are many methods to discriminate deleterious/high-risk from neutral/low-risk unclassified variants (i.e., analysis of the cosegregation in families of the VUS, measure of the influence of the VUSs on the wild-type protein activity, comparison of sequence conservation across multiple species), but only an integrated analysis of these methods can contribute to a real interpretation of the functional and clinical role of the discussed variants. The aim of our manuscript is to review the studies on BRCA VUS in order to clarify their clinical relevance.

  9. Hidden Markov Models for Gene Sequence Classification: Classifying the VSG genes in the Trypanosoma brucei Genome

    OpenAIRE

    Mesa, Andrea; Basterrech, Sebastián; Guerberoff, Gustavo; Alvarez-Valin, Fernando

    2015-01-01

    The article presents an application of Hidden Markov Models (HMMs) for pattern recognition on genome sequences. We apply HMM for identifying genes encoding the Variant Surface Glycoprotein (VSG) in the genomes of Trypanosoma brucei (T. brucei) and other African trypanosomes. These are parasitic protozoa causative agents of sleeping sickness and several diseases in domestic and wild animals. These parasites have a peculiar strategy to evade the host's immune system that consists in periodicall...

  10. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.

    Science.gov (United States)

    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting.

  11. Genome-wide gene-gene interaction analysis for next-generation sequencing.

    Science.gov (United States)

    Zhao, Jinying; Zhu, Yun; Xiong, Momiao

    2016-03-01

    The critical barrier in interaction analysis for next-generation sequencing (NGS) data is that the traditional pairwise interaction analysis that is suitable for common variants is difficult to apply to rare variants because of their prohibitive computational time, large number of tests and low power. The great challenges for successful detection of interactions with NGS data are (1) the demands in the paradigm of changes in interaction analysis; (2) severe multiple testing; and (3) heavy computations. To meet these challenges, we shift the paradigm of interaction analysis between two SNPs to interaction analysis between two genomic regions. In other words, we take a gene as a unit of analysis and use functional data analysis techniques as dimensional reduction tools to develop a novel statistic to collectively test interaction between all possible pairs of SNPs within two genome regions. By intensive simulations, we demonstrate that the functional logistic regression for interaction analysis has the correct type 1 error rates and higher power to detect interaction than the currently used methods. The proposed method was applied to a coronary artery disease dataset from the Wellcome Trust Case Control Consortium (WTCCC) study and the Framingham Heart Study (FHS) dataset, and the early-onset myocardial infarction (EOMI) exome sequence datasets with European origin from the NHLBI's Exome Sequencing Project. We discovered that 6 of 27 pairs of significantly interacted genes in the FHS were replicated in the independent WTCCC study and 24 pairs of significantly interacted genes after applying Bonferroni correction in the EOMI study.

  12. Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition.

    Directory of Open Access Journals (Sweden)

    Moses M Muraya

    Full Text Available A major goal of maize genomic research is to identify sequence polymorphisms responsible for phenotypic variation in traits of economic importance. Large-scale detection of sequence variation is critical for linking genes, or genomic regions, to phenotypes. However, due to its size and complexity, it remains expensive to generate whole genome sequences of sufficient coverage for divergent maize lines, even with access to next generation sequencing (NGS technology. Because methods involving reduction of genome complexity, such as genotyping-by-sequencing (GBS, assess only a limited fraction of sequence variation, targeted sequencing of selected genomic loci offers an attractive alternative. We therefore designed a sequence capture assay to target 29 Mb genomic regions and surveyed a total of 4,648 genes possibly affecting biomass production in 21 diverse inbred maize lines (7 flints, 14 dents. Captured and enriched genomic DNA was sequenced using the 454 NGS platform to 19.6-fold average depth coverage, and a broad evaluation of read alignment and variant calling methods was performed to select optimal procedures for variant discovery. Sequence alignment with the B73 reference and de novo assembly identified 383,145 putative single nucleotide polymorphisms (SNPs, of which 42,685 were non-synonymous alterations and 7,139 caused frameshifts. Presence/absence variation (PAV of genes was also detected. We found that substantial sequence variation exists among genomic regions targeted in this study, which was particularly evident within coding regions. This diversification has the potential to broaden functional diversity and generate phenotypic variation that may lead to new adaptations and the modification of important agronomic traits. Further, annotated SNPs identified here will serve as useful genetic tools and as candidates in searches for phenotype-altering DNA variation. In summary, we demonstrated that sequencing of captured DNA is a powerful

  13. Facilitating genome navigation : survey sequencing and dense radiation-hybrid gene mapping

    NARCIS (Netherlands)

    Hitte, C; Madeoy, J; Kirkness, EF; Priat, C; Lorentzen, TD; Senger, F; Thomas, D; Derrien, T; Ramirez, C; Scott, C; Evanno, G; Pullar, B; Cadieu, E; Oza, [No Value; Lourgant, K; Jaffe, DB; Tacher, S; Dreano, S; Berkova, N; Andre, C; Deloukas, P; Fraser, C; Lindblad-Toh, K; Ostrander, EA; Galibert, F

    2005-01-01

    Accurate and comprehensive sequence coverage for large genomes has been restricted to only a few species of specific interest. Lower sequence coverage (survey sequencing) of related species can yield a wealth of information about gene content and putative regulatory elements. But survey sequences la

  14. Structural organization of glycophorin A and B genes: Glycophorin B gene evolved by homologous recombination at Alu repeat sequences

    International Nuclear Information System (INIS)

    Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication

  15. Isolation of Hox cluster genes from insects reveals an accelerated sequence evolution rate.

    Directory of Open Access Journals (Sweden)

    Heike Hadrys

    Full Text Available Among gene families it is the Hox genes and among metazoan animals it is the insects (Hexapoda that have attracted particular attention for studying the evolution of development. Surprisingly though, no Hox genes have been isolated from 26 out of 35 insect orders yet, and the existing sequences derive mainly from only two orders (61% from Hymenoptera and 22% from Diptera. We have designed insect specific primers and isolated 37 new partial homeobox sequences of Hox cluster genes (lab, pb, Hox3, ftz, Antp, Scr, abd-a, Abd-B, Dfd, and Ubx from six insect orders, which are crucial to insect phylogenetics. These new gene sequences provide a first step towards comparative Hox gene studies in insects. Furthermore, comparative distance analyses of homeobox sequences reveal a correlation between gene divergence rate and species radiation success with insects showing the highest rate of homeobox sequence evolution.

  16. Characterization of fusion genes and the significantly expressed fusion isoforms in breast cancer by hybrid sequencing

    OpenAIRE

    Weirather, Jason L.; Afshar, Pegah Tootoonchi; Clark, Tyson A.; Tseng, Elizabeth; Powers, Linda S.; Underwood, Jason G; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai

    2015-01-01

    We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and ...

  17. Nucleotide sequence of the structural gene for tryptophanase of Escherichia coli K-12.

    OpenAIRE

    Deeley, M C; Yanofsky, C

    1981-01-01

    The tryptophanase structural gene, tnaA, of Escherichia coli K-12 was cloned and sequenced. The size, amino acid composition, and sequence of the protein predicted from the nucleotide sequence agree with protein structure data previously acquired by others for the tryptophanase of E. coli B. Physiological data indicated that the region controlling expression of tnaA was present in the cloned segment. Sequence data suggested that a second structural gene of unknown function was located distal ...

  18. Nucleotide Sequence of a Chicken Vitellogenin Gene and Derived Amino Acid Sequence of the Encoded Yolk Precursor Protein

    NARCIS (Netherlands)

    Schip, Fred D. van het; Samallo, John; Broos, Jaap; Ophuis, Jan; Mojet, Mart; Gruber, Max; AB, Geert

    1987-01-01

    The gene encoding the major vitellogenin from chicken has been completely sequenced and its exon-intron organization has been established. The gene is 20,342 base-pairs long and contains 35 exons with a combined length of 5787 base-pairs. They encode the 1850-amino acid pre-peptide of vitellogenin,

  19. CLONING AND SEQUENCING OF THE GENE FOR A LACTOCOCCAL ENDOPEPTIDASE, AN ENZYME WITH SEQUENCE SIMILARITY TO MAMMALIAN ENKEPHALINASE

    NARCIS (Netherlands)

    Mierau, Igor; Tan, Paris S.T.; Haandrikman, Alfred J.; Kok, Jan; Leenhouts, Kees J.; Konings, Wil N.; Venema, Gerard

    1993-01-01

    The gene specifying an endopeptidase of Lactococcus lactis, named pepO, was cloned from a genomic library of L. lactis subsp. cremoris P8-247 in lambdaEMBL3 and was subsequently sequenced. pepO is probably the last gene of an operon encoding the binding-protein-dependent oligopeptide transport syste

  20. Phylogeny of the true water bugs (Nepomorpha: Hemiptera–Heteroptera) based on 16S and 28S rDNA and morphology

    DEFF Research Database (Denmark)

    Hebsgaard, Martin Bay; Andersen, Nils M.; Damgaard, Jakob

    2004-01-01

    the infraorders Gerromorpha and Leptopodomorpha. The morphological data matrix consisted of sixty-five characters obtained from literature sources. Molecular data included approximately 960 bp from the mitochondrial gene 16S and the nuclear gene 28S for all forty-two terminal taxa. The morphological dataset...... was analysed using maximum parsimony and the combined morphological and molecular (16S + 28S rDNA) dataset was analysed using direct optimization. A sensitivity analysis of sixteen different sets of parameters (various combinations of insertion-deletion cost and transversion costs) was undertaken. Character...

  1. Minimum information about a marker gene sequence (MIMARKS) and minimum information about any (x) sequence (MIxS) specifications

    Science.gov (United States)

    Yilmaz, Pelin; Kottmann, Renzo; Field, Dawn; Knight, Rob; Cole, James R; Amaral-Zettler, Linda; Gilbert, Jack A; Karsch-Mizrachi, Ilene; Johnston, Anjanette; Cochrane, Guy; Vaughan, Robert; Hunter, Christopher; Park, Joonhong; Morrison, Norman; Rocca-Serra, Philippe; Sterk, Peter; Arumugam, Manimozhiyan; Bailey, Mark; Baumgartner, Laura; Birren, Bruce W; Blaser, Martin J; Bonazzi, Vivien; Booth, Tim; Bork, Peer; Bushman, Frederic D; Buttigieg, Pier Luigi; Chain, Patrick S G; Charlson, Emily; Costello, Elizabeth K; Huot-Creasy, Heather; Dawyndt, Peter; DeSantis, Todd; Fierer, Noah; Fuhrman, Jed A; Gallery, Rachel E; Gevers, Dirk; Gibbs, Richard A; Gil, Inigo San; Gonzalez, Antonio; Gordon, Jeffrey I; Guralnick, Robert; Hankeln, Wolfgang; Highlander, Sarah; Hugenholtz, Philip; Jansson, Janet; Kau, Andrew L; Kelley, Scott T; Kennedy, Jerry; Knights, Dan; Koren, Omry; Kuczynski, Justin; Kyrpides, Nikos; Larsen, Robert; Lauber, Christian L; Legg, Teresa; Ley, Ruth E; Lozupone, Catherine A; Ludwig, Wolfgang; Lyons, Donna; Maguire, Eamonn; Methé, Barbara A; Meyer, Folker; Muegge, Brian; Nakielny, Sara; Nelson, Karen E; Nemergut, Diana; Neufeld, Josh D; Newbold, Lindsay K; Oliver, Anna E; Pace, Norman R; Palanisamy, Giriprakash; Peplies, Jörg; Petrosino, Joseph; Proctor, Lita; Pruesse, Elmar; Quast, Christian; Raes, Jeroen; Ratnasingham, Sujeevan; Ravel, Jacques; Relman, David A; Assunta-Sansone, Susanna; Schloss, Patrick D; Schriml, Lynn; Sinha, Rohini; Smith, Michelle I; Sodergren, Erica; Spor, Aymé; Stombaugh, Jesse; Tiedje, James M; Ward, Doyle V; Weinstock, George M; Wendel, Doug; White, Owen; Whiteley, Andrew; Wilke, Andreas; Wortman, Jennifer R; Yatsunenko, Tanya; Glöckner, Frank Oliver

    2012-01-01

    Here we present a standard developed by the Genomic Standards Consortium (GSC) for reporting marker gene sequences—the minimum information about a marker gene sequence (MIMARKS). We also introduce a system for describing the environment from which a biological sample originates. The ‘environmental packages’ apply to any genome sequence of known origin and can be used in combination with MIMARKS and other GSC checklists. Finally, to establish a unified standard for describing sequence data and to provide a single point of entry for the scientific community to access and learn about GSC checklists, we present the minimum information about any (x) sequence (MIxS). Adoption of MIxS will enhance our ability to analyze natural genetic diversity documented by massive DNA sequencing efforts from myriad ecosystems in our ever-changing biosphere. PMID:21552244

  2. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  3. Characterizations of Chinese isolates of Coxiella burnetii in the com1 gene sequence

    Institute of Scientific and Technical Information of China (English)

    YU Quan; ZHANG Guo-quan; FUKUSHI Hideto; YAMAGUCHI Tsuyoshi; HIRAI Katsuya

    2002-01-01

    Objective: To know some genetical characterizations of Coxiella burnetii Chinese isolates by comparing the com1 gene sequence. Methods: com1 gene sequences of Chinese isolates were amplified, sequenced, and analyzed by comparing our result and the previous published data. Results: Three different com1 sequences were identified in 7 Chinese isolates. Sequence comparison indicated that the isolates harboring the QpRS plasmid could be defined as a new group and, in addition, the isolates carrying the same plasmid type showed similar com1 gene sequence. Conclusion: Study suggests that the classification of the group based on the com1 gene sequence is highly associated with the plasmid type of the isolates and, however, little related to disease forms and geographical origins of the isolates.

  4. Unresolved orthology and peculiar coding sequence properties of lamprey genes: the KCNA gene family as test case

    Directory of Open Access Journals (Sweden)

    Kuraku Shigehiro

    2011-06-01

    Full Text Available Abstract Background In understanding the evolutionary process of vertebrates, cyclostomes (hagfishes and lamprey occupy crucial positions. Resolving molecular phylogenetic relationships of cyclostome genes with gnathostomes (jawed vertebrates genes is indispensable in deciphering both the species tree and gene trees. However, molecular phylogenetic analyses, especially those including lamprey genes, have produced highly discordant results between gene families. To efficiently scrutinize this problem using partial genome assemblies of early vertebrates, we focused on the potassium voltage-gated channel, shaker-related (KCNA family, whose members are mostly single-exon. Results Seven sea lamprey KCNA genes as well as six elephant shark genes were identified, and their orthologies to bony vertebrate subgroups were assessed. In contrast to robustly supported orthology of the elephant shark genes to gnathostome subgroups, clear orthology of any sea lamprey gene could not be established. Notably, sea lamprey KCNA sequences displayed unique codon usage pattern and amino acid composition, probably associated with exceptionally high GC-content in their coding regions. This lamprey-specific property of coding sequences was also observed generally for genes outside this gene family. Conclusions Our results suggest that secondary modifications of sequence properties unique to the lamprey lineage may be one of the factors preventing robust orthology assessments of lamprey genes, which deserves further genome-wide validation. The lamprey lineage-specific alteration of protein-coding sequence properties needs to be taken into consideration in tackling the key questions about early vertebrate evolution.

  5. Colorimetric biosensing of targeted gene sequence using dual nanoparticle platforms

    Directory of Open Access Journals (Sweden)

    Thavanathan J

    2015-04-01

    Full Text Available Jeevan Thavanathan,1 Nay Ming Huang,1 Kwai Lin Thong2 1Low Dimension Material Research Center, Department of Physics, 2Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia Abstract: We have developed a colorimetric biosensor using a dual platform of gold nanoparticles and graphene oxide sheets for the detection of Salmonella enterica. The presence of the invA gene in S. enterica causes a change in color of the biosensor from its original pinkish-red to a light purplish solution. This occurs through the aggregation of the primary gold nanoparticles–conjugated DNA probe onto the surface of the secondary graphene oxide–conjugated DNA probe through DNA hybridization with the targeted DNA sequence. Spectrophotometry analysis showed a shift in wavelength from 525 nm to 600 nm with 1 µM of DNA target. Specificity testing revealed that the biosensor was able to detect various serovars of the S. enterica while no color change was observed with the other bacterial species. Sensitivity testing revealed the limit of detection was at 1 nM of DNA target. This proves the effectiveness of the biosensor in the detection of S. enterica through DNA hybridization. Keywords: biosensor, DNA hybridization, DNA probe, gold nanoparticles, graphene oxide, Salmonella enterica

  6. Isolation and characterization of gene sequences expressed in cotton fiber

    Directory of Open Access Journals (Sweden)

    Taciana de Carvalho Coutinho

    2016-06-01

    Full Text Available ABSTRACT Cotton fiber are tubular cells which develop from the differentiation of ovule epidermis. In addition to being one of the most important natural fiber of the textile group, cotton fiber afford an excellent experimental system for studying the cell wall. The aim of this work was to isolate and characterise the genes expressed in cotton fiber (Gossypium hirsutum L. to be used in future work in cotton breeding. Fiber of the cotton cultivar CNPA ITA 90 II were used to extract RNA for the subsequent generation of a cDNA library. Seventeen sequences were obtained, of which 14 were already described in the NCBI database (National Centre for Biotechnology Information, such as those encoding the lipid transfer proteins (LTPs and arabinogalactans (AGP. However, other cDNAs such as the B05 clone, which displays homology with the glycosyltransferases, have still not been described for this crop. Nevertheless, results showed that several clones obtained in this study are associated with cell wall proteins, wall-modifying enzymes and lipid transfer proteins directly involved in fiber development.

  7. Gene discovery in the hamster: a comparative genomics approach for gene annotation by sequencing of hamster testis cDNAs

    Directory of Open Access Journals (Sweden)

    Khan Shafiq A

    2003-06-01

    Full Text Available Abstract Background Complete genome annotation will likely be achieved through a combination of computer-based analysis of available genome sequences combined with direct experimental characterization of expressed regions of individual genomes. We have utilized a comparative genomics approach involving the sequencing of randomly selected hamster testis cDNAs to begin to identify genes not previously annotated on the human, mouse, rat and Fugu (pufferfish genomes. Results 735 distinct sequences were analyzed for their relatedness to known sequences in public databases. Eight of these sequences were derived from previously unidentified genes and expression of these genes in testis was confirmed by Northern blotting. The genomic locations of each sequence were mapped in human, mouse, rat and pufferfish, where applicable, and the structure of their cognate genes was derived using computer-based predictions, genomic comparisons and analysis of uncharacterized cDNA sequences from human and macaque. Conclusion The use of a comparative genomics approach resulted in the identification of eight cDNAs that correspond to previously uncharacterized genes in the human genome. The proteins encoded by these genes included a new member of the kinesin superfamily, a SET/MYND-domain protein, and six proteins for which no specific function could be predicted. Each gene was expressed primarily in testis, suggesting that they may play roles in the development and/or function of testicular cells.

  8. Use of gene sequence analyses and genome comparisons for yeast systematics

    Science.gov (United States)

    Detection, identification, and classification of yeasts has undergone a major transformation in the past decade and a half following application of gene sequence analyses and genome comparisons. Development of a database (barcode) of easily determined gene sequences from domains 1 and 2 of large sub...

  9. Cloning and sequencing of the bovine gastrin gene

    DEFF Research Database (Denmark)

    Lund, T; Rehfeld, J F; Olsen, Jørgen

    1989-01-01

    In order to deduce the primary structure of bovine preprogastrin we therefore sequenced a gastrin DNA clone isolated from a bovine liver cosmid library. Bovine preprogastrin comprises 104 amino acids and consists of a signal peptide, a 37 amino acid spacer-sequence, the gastrin-34 sequence followed...

  10. CLONING AND SEQUENCING OF MATURED FRAGMENT OF HUMAN NEVER GROWTH FACTOR GENE

    Institute of Scientific and Technical Information of China (English)

    马巍; 吴玲; 王德利; 刘淼; 任惠民; 杨广笑; 王全颖

    2003-01-01

    Objective Molecular cloning and sequencing of the human matured fragment of human nerve growth factor(NGF) gene. Methods Extracting the human genomic DNA from the white blood cells as templates, the gene of NGF was cloned by using PCR and T-vector cloning method. Screening the positive clones and identified by the restriction enzymes, and then the cloned amplified fragment was sequenced and analyzed. Results DNA sequence comparison the cloned gene of NGF with the GenBank (V01511) sequence demonstrated that both of sequences were identical, 354bp length. Conclusion Cloning the NGF gene from the human genomic DNA has paved the way for further study on gene therapy of nerve system injury.

  11. Complete mitochondrial genome DNA sequence for two ophiuroids and a holothuroid: the utility of protein gene sequence and gene maps in the analyses of deep deuterostome phylogeny.

    Science.gov (United States)

    Scouras, Andrea; Beckenbach, Karen; Arndt, Allan; Smith, Michael J

    2004-04-01

    The complete mitochondrial genome sequences have been determined for the holothuroid Cucumaria miniata and two ophiuroid species Ophiopholis aculeata and Ophiura lütkeni. In addition, the nucleotide sequence of the mitochondrial protein-coding genes for the asteroid Pisaster ochraceus has been completed. Maximum-likelihood and LogDet distance analyses of concatenated protein-coding sequences produced a series of trees that did not conclusively support generally accepted models of echinoderm phylogeny. The ophiuroid data consistently demonstrated accelerated nucleotide divergence rates and lack of stationarity. This confounds the phylogenetic analyses. Molecular investigations using individual protein-coding gene alignments demonstrated that the cytochrome b gene exhibits the least deviation in rate and stationarity and generated some trees consistent with proposed echinoderm phylogenies. Phylogenies based on echinoderm mitochondrial gene rearrangements also proved problematic because of extensive variation in gene order between and within classes. A comparison of the two distinctive ophiuroid mitochondrial gene orders supports the hypothesis that O. lütkeni has a more derived mitochondrial gene order versus O. aculeata. The variation in the echinoderm mitochondrial gene maps reinforces the limitations of the application of mitochondrial gene rearrangements as a global phylogenetic tool. PMID:15019608

  12. Structural analysis of DNA sequence: evidence for lateral gene transfer in Thermotoga maritima

    DEFF Research Database (Denmark)

    Worning, Peder; Jensen, Lars Juhl; Nelson, K. E.;

    2000-01-01

    The recently published complete DNA sequence of the bacterium Thermotoga maritima provides evidence, based on protein sequence conservation, for lateral gene transfer between Archaea and Bacteria. We introduce a new method of periodicity analysis of DNA sequences, based on structural parameters, ...

  13. Neural network predicts sequence of TP53 gene based on DNA chip

    DEFF Research Database (Denmark)

    Spicker, J.S.; Wikman, F.; Lu, M.L.;

    2002-01-01

    We have trained an artificial neural network to predict the sequence of the human TP53 tumor suppressor gene based on a p53 GeneChip. The trained neural network uses as input the fluorescence intensities of DNA hybridized to oligonucleotides on the surface of the chip and makes between zero...... and four errors in the predicted 1300 bp sequence when tested on wild-type TP53 sequence....

  14. Sequencing and bacterial expression of a novel murine alpha interferon gene

    Institute of Scientific and Technical Information of China (English)

    王焱; 王征宇; 周鸣南; 蔡菊娥; 孙兰英; 刘新垣; B.L.Daugherty; S.Pestka

    1997-01-01

    A murine new alpha interferon gene (mIFN-αB) was found by primer-based sequencing method in a murine genomic DNA library. The gene was cloned and its sequence was determined. It was expressed in Escherichia coli under the control of the PL promoter which resulted in antiviral activity on mouse L-cells. The sequence of mlFN-αB has been accepted by GENEBANK.

  15. Complete Sequence Construction of the Highly Repetitive Ribosomal RNA Gene Repeats in Eukaryotes Using Whole Genome Sequence Data.

    Science.gov (United States)

    Agrawal, Saumya; Ganley, Austen R D

    2016-01-01

    The ribosomal RNA genes (rDNA) encode the major rRNA species of the ribosome, and thus are essential across life. These genes are highly repetitive in most eukaryotes, forming blocks of tandem repeats that form the core of nucleoli. The primary role of the rDNA in encoding rRNA has been long understood, but more recently the rDNA has been implicated in a number of other important biological phenomena, including genome stability, cell cycle, and epigenetic silencing. Noncoding elements, primarily located in the intergenic spacer region, appear to mediate many of these phenomena. Although sequence information is available for the genomes of many organisms, in almost all cases rDNA repeat sequences are lacking, primarily due to problems in assembling these intriguing regions during whole genome assemblies. Here, we present a method to obtain complete rDNA repeat unit sequences from whole genome assemblies. Limitations of next generation sequencing (NGS) data make them unsuitable for assembling complete rDNA unit sequences; therefore, the method we present relies on the use of Sanger whole genome sequence data. Our method makes use of the Arachne assembler, which can assemble highly repetitive regions such as the rDNA in a memory-efficient way. We provide a detailed step-by-step protocol for generating rDNA sequences from whole genome Sanger sequence data using Arachne, for refining complete rDNA unit sequences, and for validating the sequences obtained. In principle, our method will work for any species where the rDNA is organized into tandem repeats. This will help researchers working on species without a complete rDNA sequence, those working on evolutionary aspects of the rDNA, and those interested in conducting phylogenetic footprinting studies with the rDNA. PMID:27576718

  16. Contribution of the Caspase Gene Sequence Diversification to the Specifically Antiviral Defense in Invertebrate

    OpenAIRE

    Bin Zhi; Lei Wang; Guangyi Wang; Xiaobo Zhang

    2011-01-01

    Vertebrates achieve adaptive immunity of all sorts against pathogens through the diversification of antibodies. However the mechanism of invertebrates' innate immune defense against various pathogens remains largely unknown. Our study used shrimp and white spot syndrome virus (WSSV) to show that PjCaspase, a caspase gene of shrimp that is crucial in apoptosis, possessed gene sequence diversity. At present, the role of gene sequence diversity in immunity has not been characterized. To address ...

  17. Characterization and phylogenetic analysis of -gliadin gene sequences reveals significant genomic divergence in Triticeae species

    Indian Academy of Sciences (India)

    Guang-Rong Li; Tao Lang; En-Nian Yang; Cheng Liu; Zu-Jun Yang

    2014-12-01

    Although the unique properties of wheat -gliadin gene family are well characterized, little is known about the evolution and genomic divergence of -gliadin gene family within the Triticeae. We isolated a total of 203 -gliadin gene sequences from 11 representative diploid and polyploid Triticeae species, and found 108 sequences putatively functional. Our results indicate that -gliadin genes may have possibly originated from wild Secale species, where the sequences contain the shortest repetitive domains and display minimum variation. A miniature inverted-repeat transposable element insertion is reported for the first time in -gliadin gene sequence of Thinopyrum intermedium in this study, indicating that the transposable element might have contributed to the diversification of -gliadin genes family among Triticeae genomes. The phylogenetic analyses revealed that the -gliadin gene sequences of Dasypyrum, Australopyrum, Lophopyrum, Eremopyrum and Pseudoroengeria species have amplified several times. A search for four typical toxic epitopes for celiac disease within the Triticeae -gliadin gene sequences showed that the -gliadins of wild Secale, Australopyrum and Agropyron genomes lack all four epitopes, while other Triticeae species have accumulated these epitopes, suggesting that the evolution of these toxic epitopes sequences occurred during the course of speciation, domestication or polyploidization of Triticeae.

  18. Strong association between pseudogenization mechanisms and gene sequence length

    OpenAIRE

    Harrison Paul M; Khachane Amit N

    2009-01-01

    Abstract Pseudogenes arise from the decay of gene copies following either RNA-mediated duplication (processed pseudogenes) or DNA-mediated duplication (nonprocessed pseudogenes). Here, we show that long protein-coding genes tend to produce more nonprocessed pseudogenes than short genes, whereas the opposite is true for processed pseudogenes. Protein-coding genes longer than 3000 bp are 6 times more likely to produce nonprocessed pseudogenes than processed ones. Reviewers This article was revi...

  19. Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

    DEFF Research Database (Denmark)

    Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata;

    2000-01-01

    The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...

  20. Cloning, sequence analysis, and hyperexpression of the genes encoding phosphotransacetylase and acetate kinase from Methanosarcina thermophila.

    OpenAIRE

    Latimer, M T; Ferry, J G

    1993-01-01

    The genes for the acetate-activating enzymes, acetate kinase and phosphotransacetylase (ack and pta), from Methanosarcina thermophila TM-1 were cloned and sequenced. Both genes are present in only one copy per genome, with the pta gene adjacent to and upstream of the ack gene. Consensus archaeal promoter sequences are found upstream of the pta coding region. The pta and ack genes encode predicted polypeptides with molecular masses of 35,198 and 44,482 Da, respectively. A hydropathy plot of th...

  1. Experimental Conditions: SE28_S03_M06_D01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE28_S03_M06_D01 SE28 Comparison of leaf metabolites among developmental stages of ...Hevea brasiliensis SE28_S03 Hevea brasiliensis leaf SE28_S03_M06 6.7 mg [MassBase ID] MDLC1_21615 SE28_MS2 LC-FT-ICR-MS ESI posit...ive method 2 SE28_DS1 PowerGet analysis for detection of all peaks (B2) 6|ITMS 2 SE28_AM1 PowerGet annotation A1 ...

  2. Experimental Conditions: SE28_S01_M03_D01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE28_S01_M03_D01 SE28 Comparison of leaf metabolites among developmental stages of ...Hevea brasiliensis SE28_S01 Hevea brasiliensis leaf SE28_S01_M03 6.7 mg [MassBase ID] MDLC1_20371 SE28_MS1 LC-FT-ICR-MS ESI posit...ive method 1 SE28_DS1 PowerGet analysis for detection of all peaks (B2) 6|ITMS 2 SE28_AM1 PowerGet annotation A1 ...

  3. Experimental Conditions: SE28_S04_M01_D01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE28_S04_M01_D01 SE28 Comparison of leaf metabolites among developmental stages of ...Hevea brasiliensis SE28_S04 Hevea brasiliensis leaf SE28_S04_M01 6.7 mg [MassBase ID] MDLC1_20378 SE28_MS1 LC-FT-ICR-MS ESI posit...ive method 1 SE28_DS1 PowerGet analysis for detection of all peaks (B2) 6|ITMS 2 SE28_AM1 PowerGet annotation A1 ...

  4. Experimental Conditions: SE28_S03_M04_D01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE28_S03_M04_D01 SE28 Comparison of leaf metabolites among developmental stages of ...Hevea brasiliensis SE28_S03 Hevea brasiliensis leaf SE28_S03_M04 6.7 mg [MassBase ID] MDLC1_21613 SE28_MS2 LC-FT-ICR-MS ESI posit...ive method 2 SE28_DS1 PowerGet analysis for detection of all peaks (B2) 6|ITMS 2 SE28_AM1 PowerGet annotation A1 ...

  5. Experimental Conditions: SE28_S01_M02_D01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE28_S01_M02_D01 SE28 Comparison of leaf metabolites among developmental stages of ...Hevea brasiliensis SE28_S01 Hevea brasiliensis leaf SE28_S01_M02 6.7 mg [MassBase ID] MDLC1_20370 SE28_MS1 LC-FT-ICR-MS ESI posit...ive method 1 SE28_DS1 PowerGet analysis for detection of all peaks (B2) 6|ITMS 2 SE28_AM1 PowerGet annotation A1 ...

  6. Sequencing analysis reveals a unique gene organization in the gyrB region of Mycoplasma hominis

    DEFF Research Database (Denmark)

    Ladefoged, Søren; Christiansen, Gunna

    1994-01-01

    of which showed similarity to that which encodes the LicA protein of Haemophilus influenzae. The organization of the genes in the region showed no resemblance to that in the corresponding regions of other bacteria sequenced so far. The gyrA gene was mapped 35 kb downstream from the gyrB gene....

  7. Cloning, sequence analysis, and characterization of the genes involved in isoprimeverose metabolism in Lactobacillus pentosus

    NARCIS (Netherlands)

    Chaillou, S.; Lokman, B.C.; Leer, R.J.; Posthuma, C.; Postma, P.W.; Pouwels, P.H.

    1998-01-01

    Two genes, xylP and xylQ, from the xylose regulon of Lactobacillus pentosus were cloned and sequenced. Together with the repressor gene of the regulon, xylR, the xylPQ genes form an operon which is inducible by xylose and which is transcribed from a promoter located 145 bp upstream of xylP. A putati

  8. Nucleotide sequence of a cyanobacterial nifH gene coding for nitrogenase reductase

    OpenAIRE

    Mevarech, Moshe; Rice, Douglas; Haselkorn, Robert

    1980-01-01

    The nucleotide sequence of nifH, the structural gene for nitrogenase reductase (component II or Fe protein of nitrogenase) from the cyanobacterium Anabaena 7120 has been determined. Also reported are 194 bases of the 5′-flanking sequence and 170 bases of the 3′-flanking sequence. The predicted amino acid sequence was compared with that determined for the complete nitrogenase reductase of Clostridium pasteurianum and the cysteine-containing peptides of the protein from Azotobacter vinelandii. ...

  9. Nucleotide sequences of immunoglobulin epsilon genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution.

    OpenAIRE

    Sakoyama, Y; Hong, K J; Byun, S. M.; Hisajima, H; Ueda, S; Yaoita, Y; Hayashida, H; Miyata, T.; Honjo, T

    1987-01-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin epsilon-chain (C epsilon 1) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human epsilon-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regio...

  10. Cloning and sequencing of the gene encoding thermophilic beta-amylase of Clostridium thermosulfurogenes.

    OpenAIRE

    Kitamoto, N; Yamagata, H; Kato, T; Tsukagoshi, N; Udaka, S

    1988-01-01

    A gene coding for thermophilic beta-amylase of Clostridium thermosulfurogenes was cloned into Bacillus subtilis, and its nucleotide sequence was determined. The nucleotide sequence suggested that the thermophilic beta-amylase is translated from monocistronic mRNA as a secretory precursor with a signal peptide of 32 amino acid residues. The deduced amino acid sequence of the mature beta-amylase contained 519 residues with a molecular weight of 57,167. The amino acid sequence of the C. thermosu...

  11. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    Directory of Open Access Journals (Sweden)

    R. Lakshmi

    2016-06-01

    Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

  12. Intergenic DNA sequences flanking the pseudo alpha globin genes of human and chimpanzee.

    OpenAIRE

    Sawada, I; Beal, M P; Shen, C K; Chapman, B.; Wilson, A C; Schmid, C.

    1983-01-01

    We have determined the sequence of 2400 base pairs upstream from the human pseudo alpha globin (psi alpha) gene, and for comparison, 1100 base pairs of DNA within and upstream from the chimpanzee psi alpha gene. The region upstream from the promoter of the psi alpha gene shows no significant homology to the intergenic regions of the adult alpha 2 and alpha 1 globin genes. The chimpanzee gene has a coding defect in common with the human psi alpha gene, showing that the product of this gene, if...

  13. Mouse mammary tumor virus-like gene sequences are present in lung patient specimens

    Directory of Open Access Journals (Sweden)

    Rodríguez-Padilla Cristina

    2011-09-01

    Full Text Available Abstract Background Previous studies have reported on the presence of Murine Mammary Tumor Virus (MMTV-like gene sequences in human cancer tissue specimens. Here, we search for MMTV-like gene sequences in lung diseases including carcinomas specimens from a Mexican population. This study was based on our previous study reporting that the INER51 lung cancer cell line, from a pleural effusion of a Mexican patient, contains MMTV-like env gene sequences. Results The MMTV-like env gene sequences have been detected in three out of 18 specimens studied, by PCR using a specific set of MMTV-like primers. The three identified MMTV-like gene sequences, which were assigned as INER6, HZ101, and HZ14, were 99%, 98%, and 97% homologous, respectively, as compared to GenBank sequence accession number AY161347. The INER6 and HZ-101 samples were isolated from lung cancer specimens, and the HZ-14 was isolated from an acute inflammatory lung infiltrate sample. Two of the env sequences exhibited disruption of the reading frame due to mutations. Conclusion In summary, we identified the presence of MMTV-like gene sequences in 2 out of 11 (18% of the lung carcinomas and 1 out of 7 (14% of acute inflamatory lung infiltrate specimens studied of a Mexican Population.

  14. Identification of true EST alignments and exon regions of gene sequences

    Institute of Scientific and Technical Information of China (English)

    ZHOU Yanhong; JING Hui; LI Yanen; LIU Huailan

    2004-01-01

    Expressed sequence tags (ESTs), which have piled up considerably so far, provide a valuable resource for finding new genes, disease-relevant genes, and for recognizing alternative splicing variants, SNP sites, etc. The prerequisite for carrying out these researches is to correctly ascertain the gene-sequence-related ESTs. Based on analysis of the alignment results between some known gene sequences and ESTs in public database, several measures including Identity Check, Gap Check, Inclusion Check and Length Check have been introduced to judge whether an EST alignment is related to a gene sequence or not. A computational program EDSAc1.0 has been developed to identify true EST alignments and exon regions of query gene sequences. When tested with human gene sequences in the standard dataset HMR195 and evaluated with the standard measures of gene prediction performance, EDSAc1.0 can identify protein- coding regions with specificity of 0.997 and sensitivity of 0.88 at the nucleotide level, which outperform that of the counterpart TAP. A web server of EDSAc1.0 is available at http://infosci.hust.edu.cn.

  15. Cloning, sequencing and identification of single nucleotide polymorphisms of partial sequence on the porcine CACNA1S gene

    Institute of Scientific and Technical Information of China (English)

    FANG XiaoMin; XU NingYing; REN ShouWen

    2008-01-01

    CACNA1S gene encodes the α1 subunit of the calcium channel. The mutation of CACNA1S gene can cause hypokalemic periodic paralysis (HypoKPP) and maliglant hyperthermla synarome (MHS) in human beings. Current research on CACNA1S was mainly in human being and model animal, but rarely in livestock and poultry. In this study, Yorkshire pigs (23), Pietrain pigs (30), Jinhua pigs (115) and the second generation (126) of crossbred of Jinhua and Pietrein were used. Primers were designed according to the sequence of human CACNA1S gene and PCR was carried out using pig genome DNA.PCR products were sequenced and compared with that of human, and then single nucleotide polymorphisms (SNPs) were investigated by PCR-SSCP, while PCR-RFLP tests were performed to validate the mutations. Results indicated: (1) the 5211 bp DNA fragments of porcine CACNA1S gene were acquired (GenBank accession number: DQ767693 ) and the identity of the exon region was 82.6% between human and pig; (2) fifty-seven mutations were found within the cloned sequences, among which 24 were in exon region; (3) the results of PCR-RFLP were in accordance with that of PCR-SSCP. According to the EST of porcine CACNA1S gene published in GenBank (Bx914582, Bx666997), 8 of the 11 SNPs identified in the present study were consistent with the base difference between two EST fragments.

  16. Cloning and Sequence Analysis of Y-box Binding Protein Gene in Min Pig

    Institute of Scientific and Technical Information of China (English)

    Zhang Dong-jie; Liu Di; Wang Liang; He Xin-miao; Wang Wen-tao

    2014-01-01

    In order to study the gene sequence of Min pig Y-box binding protein (YB-1) gene, the complete coding sequence of Min pig YB-1 gene was cloned by RT-PCR, the sequence features were analyzed by some software and online website. The results showed that the complete CDS of Min pig Y-box was found to be 975 bp long, encoding 324 amino acids. It contained a conserved cold shock domain and several phosphorylation sites, but had no transmembrane domains, and was consistent with a protein found in the cytoplasm. Min pig YB-1 nucleotides shared high similarity (61.37%-97.66%) with other mammals.

  17. Sequence composition and gene content of the short arm of rye (Secale cereale chromosome 1.

    Directory of Open Access Journals (Sweden)

    Silvia Fluch

    Full Text Available BACKGROUND: The purpose of the study is to elucidate the sequence composition of the short arm of rye chromosome 1 (Secale cereale with special focus on its gene content, because this portion of the rye genome is an integrated part of several hundreds of bread wheat varieties worldwide. METHODOLOGY/PRINCIPAL FINDINGS: Multiple Displacement Amplification of 1RS DNA, obtained from flow sorted 1RS chromosomes, using 1RS ditelosomic wheat-rye addition line, and subsequent Roche 454FLX sequencing of this DNA yielded 195,313,589 bp sequence information. This quantity of sequence information resulted in 0.43× sequence coverage of the 1RS chromosome arm, permitting the identification of genes with estimated probability of 95%. A detailed analysis revealed that more than 5% of the 1RS sequence consisted of gene space, identifying at least 3,121 gene loci representing 1,882 different gene functions. Repetitive elements comprised about 72% of the 1RS sequence, Gypsy/Sabrina (13.3% being the most abundant. More than four thousand simple sequence repeat (SSR sites mostly located in gene related sequence reads were identified for possible marker development. The existence of chloroplast insertions in 1RS has been verified by identifying chimeric chloroplast-genomic sequence reads. Synteny analysis of 1RS to the full genomes of Oryza sativa and Brachypodium distachyon revealed that about half of the genes of 1RS correspond to the distal end of the short arm of rice chromosome 5 and the proximal region of the long arm of Brachypodium distachyon chromosome 2. Comparison of the gene content of 1RS to 1HS barley chromosome arm revealed high conservation of genes related to chromosome 5 of rice. CONCLUSIONS: The present study revealed the gene content and potential gene functions on this chromosome arm and demonstrated numerous sequence elements like SSRs and gene-related sequences, which can be utilised for future research as well as in breeding of wheat and rye.

  18. Cloning and sequencing of human lambda immunoglobulin genes by the polymerase chain reaction.

    Science.gov (United States)

    Songsivilai, S; Bye, J M; Marks, J D; Hughes-Jones, N C

    1990-12-01

    Universal oligonucleotide primers, designed for amplifying and sequencing genes encoding the rearranged human lambda immunoglobulin variable region, were validated by amplification of the lambda light chain genes from four human heterohybridoma cell lines and in the generation of a cDNA library of human V lambda sequences from Epstein-Barr virus-transformed human peripheral blood lymphocytes. This technique allows rapid cloning and sequencing of human immunoglobulin genes, and has potential applications in the rescue of unstable human antibody-producing cell lines and in the production of human monoclonal antibodies.

  19. Molecular cloning and sequencing of the gene encoding the fimbrial subunit protein of Bacteroides gingivalis.

    OpenAIRE

    Dickinson, D P; Kubiniec, M A; Yoshimura, F; Genco, R J

    1988-01-01

    The gene encoding the fimbrial subunit protein of Bacteroides gingivalis 381, fimbrilin, has been cloned and sequenced. The gene was present as a single copy on the bacterial chromosome, and the codon usage in the gene conformed closely to that expected for an abundant protein. The predicted size of the mature protein was 35,924 daltons, and the secretory form may have had a 10-amino-acid, hydrophilic leader sequence similar to the leader sequences of the MePhe fimbriae family. The protein se...

  20. Escherichia coli rep gene: sequence of the gene, the encoded helicase, and its homology with uvrD.

    OpenAIRE

    Gilchrist, C A; Denhardt, D T

    1987-01-01

    The sequence of a 2.67-kilobase section of the Escherichia coli chromosome that contains the rep gene has been determined. This gene codes for a protein of predicted Mr 72,800, a DNA helicase, which is also a single-stranded DNA-dependent ATPase. The sequenced region contains an open reading frame of the correct length and orientation to encode the Rep protein. A secondary structure for the protein can be formulated from the amino acid sequence. We have compared both the primary and the secon...

  1. Cloning and Sequence Analysis of Glycoprotein D Gene of Bovine Herpesvirus-1 Strain Luojing

    Institute of Scientific and Technical Information of China (English)

    LI Ji-chang; TONG Guang-zhi; QIU Hua-ji; ZHOU Yan-jun; XUE Qiang

    2003-01-01

    By means of PCR,the gene encoding gD of bovine herpesvirus-1 (BHV-1) strain Luojing was amplified,cloned and sequenced.The nucleotide sequence of this gD gene was 1 251 bp,encoding 417 amino acids.Comparied with the published P8-2 strain,the homology of the necleotide sequence is 99.92%,and that of the deduced amino acid sequence is 100%.The results indicated that gD of BHV-1 was highly conservative.

  2. Description and interpretation of various SNPs identified by BRCA2 gene sequencing

    Directory of Open Access Journals (Sweden)

    Anca Negura

    2011-12-01

    Full Text Available Molecular diagnosis for hereditary breast and ovarian cancer (HBOC involves systematic DNA sequencing of predisposition genes like BRCA1 or BRCA2. Deleterious mutations within such genes are responsible for developing the disease, but other sequence variants can also be identified. Common Single Nucleotide Polymorphisms (SNPs are usually present in human genome, defining alleles whose frequencies widely vary in different populations. Either intragenic or intronic, silent or generating aminoacid substitutions, SNPs cannot be afforded themselves a predisposition status. However, prevalent SNPs can be used to define gene haplotypes, with also various frequencies. Since some mutation can easily be assigned to haplotypes (such is the case for BRCA1 gene, SNPs can therefore provide usual information in interpreting gene mutations effects on hereditary predisposition to cancer. Here we describe 10 BRCA2 SNPs identified by complete gene sequencing

  3. Brucella abortus S19 genome sequenced, points toward virulence genes

    OpenAIRE

    Whyte, Barry James

    2008-01-01

    Researchers at the Virginia Bioinformatics Institute at Virginia Tech; the National Animal Disease Center in Ames, Iowa; and collaborators at 454 Life Sciences, Branford, Conn., have sequenced the genome of Brucella abortus strain S19.

  4. Molecular chaperone genes in the sugarcane expressed sequence database (SUCEST)

    OpenAIRE

    Borges, Júlio C; Maria C. Peroto; Ramos, Carlos H. I.

    2001-01-01

    Some newly synthesized proteins require the assistance of molecular chaperones for their correct folding. Chaperones are also involved in the dissolution of protein aggregates making their study significant for both biotechnology and medicine and the identification of chaperones and stress-related protein sequences in different organisms is an important task. We used bioinformatic tools to investigate the information generated by the Sugarcane Expressed Sequence Tag (SUCEST) genome project in...

  5. Sequence Variation in Toxoplasma gondii rop17 Gene among Strains from Different Hosts and Geographical Locations

    Directory of Open Access Journals (Sweden)

    Nian-Zhang Zhang

    2014-01-01

    Full Text Available Genetic diversity of T. gondii is a concern of many studies, due to the biological and epidemiological diversity of this parasite. The present study examined sequence variation in rhoptry protein 17 (ROP17 gene among T. gondii isolates from different hosts and geographical regions. The rop17 gene was amplified and sequenced from 10 T. gondii strains, and phylogenetic relationship among these T. gondii strains was reconstructed using maximum parsimony (MP, neighbor-joining (NJ, and maximum likelihood (ML analyses. The partial rop17 gene sequences were 1375 bp in length and A+T contents varied from 49.45% to 50.11% among all examined T. gondii strains. Sequence analysis identified 33 variable nucleotide positions (2.1%, 16 of which were identified as transitions. Phylogeny reconstruction based on rop17 gene data revealed two major clusters which could readily distinguish Type I and Type II strains. Analyses of sequence variations in nucleotides and amino acids among these strains revealed high ratio of nonsynonymous to synonymous polymorphisms (>1, indicating that rop17 shows signs of positive selection. This study demonstrated the existence of slightly high sequence variability in the rop17 gene sequences among T. gondii strains from different hosts and geographical regions, suggesting that rop17 gene may represent a new genetic marker for population genetic studies of T. gondii isolates.

  6. Comparative genome sequencing of drosophila pseudoobscura: Chromosomal, gene and cis-element evolution

    Energy Technology Data Exchange (ETDEWEB)

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Todd, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catherine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenee; Verduzco, Daniel; Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2004-04-01

    The genome sequence of a second fruit fly, D. pseudoobscura, presents an opportunity for comparative analysis of a primary model organism D. melanogaster. The vast majority of Drosophila genes have remained on the same arm, but within each arm gene order has been extensively reshuffled leading to the identification of approximately 1300 syntenic blocks. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 35 My since divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome wide average consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than control sequences between the species but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a picture of repeat mediated chromosomal rearrangement, and high co-adaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila.

  7. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    Science.gov (United States)

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  8. Genome-wide analysis reveals diverged patterns of codon bias, gene expression, and rates of sequence evolution in Picea gene families

    OpenAIRE

    De La Torre, Amanda R; Lin, Yao-Cheng; van de Peer, Yves; Pär K Ingvarsson

    2015-01-01

    The recent sequencing of several gymnosperm genomes has greatly facilitated studying the evolution of their genes and gene families. In this study, we examine the evidence for expression-mediated selection in the first two fully sequenced representatives of the gymnosperm plant clade (Picea abies and Picea glauca). We use genome-wide estimates of gene expression (> 50,000 expressed genes) to study the relationship between gene expression, codon bias, rates of sequence divergence, protein l...

  9. Gene conversion-like events in the diversification of human rearranged IGHV3-23*01 gene sequences

    Directory of Open Access Journals (Sweden)

    Bhargavi eDuvvuri

    2012-06-01

    Full Text Available Gene conversion (GCV as a mechanism of immunoglobulin diversification is well established in a few species. However, definitive evidence of GCV-like events in human immunoglobulin genes is scarce. GCV is mediated by activation-induced cytidine deaminase (AID. The lack of evidence of GCV in human rearranged immunoglobulin gene sequences is puzzling given the presence of highly similar germline donors and all the enzymatic machinery required for GCV. In this study, we undertook a computational analysis of rearranged IGHV3-23*01 gene sequences from common variable immunodeficiency (CVID patients and healthy individuals to survey ‘GCV-like’ activities. Our search identified strong evidence of GCV-like patterns. Germline VH sequences were identified as potential donors for clustered mutations in rearranged IGHV3-23*01 gene sequences. We identified minimum and maximum sequence identities between donor and recipient sequences that can serve as targets for GCV and our findings are consistent with those reported in literature. We observed that GCV-like tracts are flanked by activation-induced cytidine deaminase (AID hotspot motifs. Structural modeling of IGHV3-23*01 gene sequence revealed that hypermutable bases flanking GCV-like tracts, are in the single stranded DNA (ssDNA of stable stem-loop structures (SLSs. SsDNA is inherently fragile and also an optimal target for AID. We speculate that GCV could have been initiated by the targeting of hypermutable bases in ssDNA state in stable SLSs, plausibly by AID. We have observed that the frequency of GCV-like events is significantly higher in rearranged IGHV323-*01 sequences from healthy individuals compared to that of CVID patients. GCV, unlike SHM, can result in multiple base substitutions that can alter many amino acids. The extensive changes in antibody affinity by GCV-like events, as identified in this study would be instrumental in protecting humans against pathogens that diversify their genome by

  10. Targeting DNA with triplex-forming oligonucleotides to modify gene sequence.

    Science.gov (United States)

    Simon, Philippe; Cannata, Fabio; Concordet, Jean-Paul; Giovannangeli, Carine

    2008-08-01

    Molecules that interact with DNA in a sequence-specific manner are attractive tools for manipulating gene sequence and expression. For example, triplex-forming oligonucleotides (TFOs), which bind to oligopyrimidine.oligopurine sequences via Hoogsteen hydrogen bonds, have been used to inhibit gene expression at the DNA level as well as to induce targeted mutagenesis in model systems. Recent advances in using oligonucleotides and analogs to target DNA in a sequence-specific manner will be discussed. In particular, chemical modification of TFOs has been used to improve binding to chromosomal target sequences in living cells. Various oligonucleotide analogs have also been found to expand the range of sequences amenable to manipulation, including so-called "Zorro" locked nucleic acids (LNAs) and pseudo-complementary peptide nucleic acids (pcPNAs). Finally, we will examine the potential of TFOs for directing targeted gene sequence modification and propose that synthetic nucleases, based on conjugation of sequence-specific DNA ligands to DNA damaging molecules, are a promising alternative to protein-based endonucleases for targeted gene sequence modification. PMID:18460344

  11. Targeting of AID-mediated sequence diversification to immunoglobulin genes.

    Science.gov (United States)

    Kothapalli, Naga Rama; Fugmann, Sebastian D

    2011-04-01

    Activation-induced cytidine deaminase (AID) is a key enzyme for antibody-mediated immune responses. Antibodies are encoded by the immunoglobulin genes and AID acts as a transcription-dependent DNA mutator on these genes to improve antibody affinity and effector functions. An emerging theme in field is that many transcribed genes are potential targets of AID, presenting an obvious danger to genomic integrity. Thus there are mechanisms in place to ensure that mutagenic outcomes of AID activity are specifically restricted to the immunoglobulin loci. Cis-regulatory targeting elements mediate this effect and their mode of action is probably a combination of immunoglobulin gene specific activation of AID and a perversion of faithful DNA repair towards error-prone outcomes.

  12. Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing.

    Science.gov (United States)

    Kanda, Kojun; Pflug, James M; Sproul, John S; Dasenko, Mark A; Maddison, David R

    2015-01-01

    In this paper we explore high-throughput Illumina sequencing of nuclear protein-coding, ribosomal, and mitochondrial genes in small, dried insects stored in natural history collections. We sequenced one tenebrionid beetle and 12 carabid beetles ranging in size from 3.7 to 9.7 mm in length that have been stored in various museums for 4 to 84 years. Although we chose a number of old, small specimens for which we expected low sequence recovery, we successfully recovered at least some low-copy nuclear protein-coding genes from all specimens. For example, in one 56-year-old beetle, 4.4 mm in length, our de novo assembly recovered about 63% of approximately 41,900 nucleotides in a target suite of 67 nuclear protein-coding gene fragments, and 70% using a reference-based assembly. Even in the least successfully sequenced carabid specimen, reference-based assembly yielded fragments that were at least 50% of the target length for 34 of 67 nuclear protein-coding gene fragments. Exploration of alternative references for reference-based assembly revealed few signs of bias created by the reference. For all specimens we recovered almost complete copies of ribosomal and mitochondrial genes. We verified the general accuracy of the sequences through comparisons with sequences obtained from PCR and Sanger sequencing, including of conspecific, fresh specimens, and through phylogenetic analysis that tested the placement of sequences in predicted regions. A few possible inaccuracies in the sequences were detected, but these rarely affected the phylogenetic placement of the samples. Although our sample sizes are low, an exploratory regression study suggests that the dominant factor in predicting success at recovering nuclear protein-coding genes is a high number of Illumina reads, with success at PCR of COI and killing by immersion in ethanol being secondary factors; in analyses of only high-read samples, the primary significant explanatory variable was body length, with small beetles

  13. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    OpenAIRE

    Naveed, Muhammad; Mubeen, Samavia; Khan, Samiullah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relat...

  14. Trichinella pseudospiralis vs. T. spiralis thymidylate synthase gene structure and T. pseudospiralis thymidylate synthase retrogene sequence

    OpenAIRE

    Jagielska, Elżbieta; Płucienniczak, Andrzej; Dąbrowska, Magdalena; Dowierciał, Anna; Rode, Wojciech

    2014-01-01

    Background Thymidylate synthase is a housekeeping gene, designated ancient due to its role in DNA synthesis and ubiquitous phyletic distribution. The genomic sequences were characterized coding for thymidylate synthase in two species of the genus Trichinella, an encapsulating T. spiralis and a non-encapsulating T. pseudospiralis. Methods Based on the sequence of parasitic nematode Trichinella spiralis thymidylate synthase cDNA, PCR techniques were employed. Results Each of the respective gene...

  15. Sequence of the Ampullariella sp. strain 3876 gene coding for xylose isomerase.

    Science.gov (United States)

    Saari, G C; Kumar, A A; Kawasaki, G H; Insley, M Y; O'Hara, P J

    1987-02-01

    The nucleotide sequence of the gene coding for xylose isomerase from Ampullariella sp. strain 3876, a gram-positive bacterium, has been determined. A clone of a fragment of strain 3876 DNA coding for a xylose isomerase activity was identified by its ability to complement a xylose isomerase-defective Escherichia coli strain. One such complementation positive fragment, 2,922 nucleotides in length, was sequenced in its entirety. There are two open reading frames 1,182 and 1,242 nucleotides in length, on opposite strands of this fragment, each of which could code for a protein the expected size of xylose isomerase. The 1,182-nucleotide open reading frame was identified as the coding sequence for the protein from the sequence analysis of the amino-terminal region and selected internal peptides. The gene initiates with GTG and has a high guanine and cytosine content (70%) and an exceptionally strong preference (97%) for guanine or cytosine in the third position of the codons. The gene codes for a 43,210-dalton polypeptide composed of 393 amino acids. The xylose isomerase from Ampullariella sp. strain 3876 is similar in size to other bacterial xylose isomerases and has limited amino acid sequence homology to the available sequences from E. coli, Bacillus subtilis, and Streptomyces violaceus-ruber. In all cases yet studied, the bacterial gene for xylulose kinase is downstream from the gene for xylose isomerase. We present evidence suggesting that in Ampullariella sp. strain 3876 these genes are similarly arranged. PMID:3027039

  16. Therapeutic modulation of endogenous gene function by agents with designed DNA-sequence specificities

    NARCIS (Netherlands)

    Uil, T.G.; Haisma, H.J.; Rots, Marianne

    2003-01-01

    Designer molecules that can specifically target pre-determined DNA sequences provide a means to modulate endogenous gene function. Different classes of sequence-specific DNA-binding agents have been developed, including triplex-forming molecules, synthetic polyamides and designer zinc finger protein

  17. Cloning and Sequence Analysis of Light Variable Region Gene of Anti-human Retinoblastoma Monoclonal Antibody

    Institute of Scientific and Technical Information of China (English)

    Xiufeng Zhong; Yongping Li; Shuqi Huang; Bo Ning; Chunyan Zhang; Jianliang Zheng; Guanguang Feng

    2002-01-01

    Purpose: To clone the variable region gene of light chain of monoclonal antibody against human retinoblastoma and to analyze the characterization of its nucleotide sequence as well as amino acid sequence.Methods: Total RNA was extracted from 3C6 hybridoma cells secreting specific monoclonal antibody(McAb)against human retinoblastoma(RB), then transcripted reversely into cDNA with olig-dT primers.The variable region of the light chain (VL) gene fragments was amplified using polymeerase chain reaction(PCR) and further cloned into pGEM(R) -T Easy vector. Then, 3C6 VL cDNA was sequenced by Sanger's method.Homologous analysis was done by NCBI BLAST.Results: The complete nucleotide sequence of 3C6 VL cDNA consisted of 321 bp encoding 107 amino acid residues, containing four workframe regions(FRs)and three complementarity-determining regions (CDRs) as well as the typical structure of two cys residues. The sequence is most homological to a member of the Vk9 gene family, and its chain utilizes the Jkl gene segment.Conclusion: The light chain variable region gene of the McAb against human RB was amplified successfully , which belongs to the Vk9 gene family and utilizes Vk-Jk1 gene rearrangement. This study lays a good basis for constructing a recombinant antibody and for making a new targeted therapeutic agents against retinoblastoma.

  18. Identification of a New Variable Sequence in the P1 Cytadhesin Gene of Mycoplasma pneumoniae: Evidence for the Generation of Antigenic Variation by DNA Recombination between Repetitive Sequences

    OpenAIRE

    Kenri, Tsuyoshi; Taniguchi, Rie; Sasaki, Yuko; Okazaki, Norio; Narita, Mitsuo; Izumikawa, Kinichi; Umetsu, Masao; Sasaki, Tsuguo

    1999-01-01

    A Mycoplasma pneumoniae cytadhesin P1 gene with novel nucleotide sequence variation has been identified. Four clinical strains of M. pneumoniae were found to carry this type of P1 gene. This new P1 gene is similar to the known group II P1 genes but possesses novel sequence variation of approximately 300 bp in the RepMP2/3 region. The position of the new variable region is distant from the previously reported variable regions known to differ between group I and II P1 genes. Two sequences close...

  19. Identification of genes in anonymous DNA sequences. Annual performance report, February 1, 1991--January 31, 1992

    Energy Technology Data Exchange (ETDEWEB)

    Fields, C.A.

    1996-06-01

    The objective of this project is the development of practical software to automate the identification of genes in anonymous DNA sequences from the human, and other higher eukaryotic genomes. A software system for automated sequence analysis, gm (gene modeler) has been designed, implemented, tested, and distributed to several dozen laboratories worldwide. A significantly faster, more robust, and more flexible version of this software, gm 2.0 has now been completed, and is being tested by operational use to analyze human cosmid sequence data. A range of efforts to further understand the features of eukaryoyic gene sequences are also underway. This progress report also contains papers coming out of the project including the following: gm: a Tool for Exploratory Analysis of DNA Sequence Data; The Human THE-LTR(O) and MstII Interspersed Repeats are subfamilies of a single widely distruted highly variable repeat family; Information contents and dinucleotide compostions of plant intron sequences vary with evolutionary origin; Splicing signals in Drosophila: intron size, information content, and consensus sequences; Integration of automated sequence analysis into mapping and sequencing projects; Software for the C. elegans genome project.

  20. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    Science.gov (United States)

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  1. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    Science.gov (United States)

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples.

  2. Detecting Sequence Homology at the Gene Cluster Level with MultiGeneBlast

    NARCIS (Netherlands)

    Medema, Marnix H.; Takano, Eriko; Breitling, Rainer; Nowick, Katja

    2013-01-01

    The genes encoding many biomolecular systems and pathways are genomically organized in operons or gene clusters. With MultiGeneBlast, we provide a user-friendly and effective tool to perform homology searches with operons or gene clusters as basic units, instead of single genes. The contextualizatio

  3. Isolation and nucleotide sequence of a mouse histidine tRNA gene.

    OpenAIRE

    Han, J. H.; Harding, J D

    1982-01-01

    We have sequenced a 1307 base pair mouse genomic DNA fragment which contains a histidine tRNA gene. The sequence of the putative mouse histidine tRNA differs from the published sequence of sheep liver histidine tRNA by a single base change in the D-loop. It does not contain an unpaired 5' terminal G residue, as reported for Drosophila and sheep histidine tRNAs. The gene does not contain introns. The 3' flanking region contains a typical RNA polymerase III termination site of 6 consecutive T r...

  4. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  5. Disparate sequence characteristics of the Erysiphe graminis f.sp. hordei glyceraldehyde-3-phosphate dehydrogenase gene

    DEFF Research Database (Denmark)

    Christiansen, S.K.; Justesen, A.F.; Giese, H.

    1997-01-01

    to be similar for all four genes. The results of the codon-usage analysis suggest that Egh is more flexible than other fungi in the choice of nucleotides at the wobble position. Codon-usage preferences in Egh and barley genes indicate a level of difference which may be exploited to discriminate between fungal...... and plant genes in sequence mixtures. The Egh gpd promoter appears to be superior to that of the Egh beta-tubulin gene (tub2) for driving the E. coli beta-glucuronidase (GUS) gene in transformation experiments....

  6. Combined sequence and sequence-structure based methods for analyzing FGF23, CYP24A1 and VDR genes.

    Science.gov (United States)

    Nagamani, Selvaraman; Singh, Kh Dhanachandra; Muthusamy, Karthikeyan

    2016-09-01

    FGF23, CYP24A1 and VDR altogether play a significant role in genetic susceptibility to chronic kidney disease (CKD). Identification of possible causative mutations may serve as therapeutic targets and diagnostic markers for CKD. Thus, we adopted both sequence and sequence-structure based SNP analysis algorithm in order to overcome the limitations of both methods. We explore the functional significance towards the prediction of risky SNPs associated with CKD. We assessed the performance of four widely used pathogenicity prediction methods. We compared the performances of the programs using Mathews correlation Coefficient ranged from poor (MCC = 0.39) to reasonably good (MCC = 0.42). However, we got the best results for the combined sequence and structure based analysis method (MCC = 0.45). 4 SNPs from FGF23 gene, 8 SNPs from VDR gene and 13 SNPs from CYP24A1 gene were predicted to be the causative agents for human diseases. This study will be helpful in selecting potential SNPs for experimental study from the SNP pool and also will reduce the cost for identification of potential SNPs as a genetic marker. PMID:27114920

  7. Cloning, sequencing and identification of single nu-cleotide polymorphisms of partial sequence on the porcine CACNA1S gene

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    CACNA1S gene encodes the α1 subunit of the calcium channel. The mutation of CACNA1S gene can cause hypokalemic periodic paralysis (HypoKPP) and maliglant hyperthermia synarome (MHS) in hu-man beings. Current research on CACNA1S was mainly in human being and model animal, but rarely in livestock and poultry. In this study, Yorkshire pigs (23), Pietrain pigs (30), Jinhua pigs (115) and the second generation (126) of crossbred of Jinhua and Pietrain were used. Primers were designed ac-cording to the sequence of human CACNA1S gene and PCR was carried out using pig genome DNA. PCR products were sequenced and compared with that of human, and then single nucleotide poly-morphisms (SNPs) were investigated by PCR-SSCP, while PCR-RFLP tests were performed to validate the mutations. Results indicated: (1) the 5211 bp DNA fragments of porcine CACNA1S gene were ac-quired (GenBank accession number: DQ767693 ) and the identity of the exon region was 82.6% be-tween human and pig; (2) fifty-seven mutations were found within the cloned sequences, among which 24 were in exon region; (3) the results of PCR-RFLP were in accordance with that of PCR-SSCP. Ac-cording to the EST of porcine CACNA1S gene published in GenBank (Bx914582, Bx666997), 8 of the 11 SNPs identified in the present study were consistent with the base difference between two EST frag-ments.

  8. Molecular cloning and analysis of the partial sequence of Rhinopithecus roxellanae growth hormone gene

    Institute of Scientific and Technical Information of China (English)

    徐来祥; 孔繁华; 华育平

    2000-01-01

    Growth hormone gene (GH) of Rhinopithecus roxellanae was amplified by PCR based on the sequences of the reported mammalian growth hormone gene for the first time. The amplified fragment was about 1.8 kb. It was cloned and its upper stream was sequenced. This sequencing region consists of a 5¢ flanking regulatory region, exon I and part of exon II, intron I of growth hormone gene. Comparing the corresponding sequences of growth hormone gene between Rhinopithecus roxellanae and the porcine, we concluded that the homology reached 81% in the region, and there was high conservation in the 5¢ flanking sequence. The kinds of amino acids of exon I and exon II for about 90% were the same to those in pig. Many mutations occurred in the degenerate site of the triplet code. In the nucleotides of intron I, there were only 72% homologies with those in pig. It means that introns and 3¢ flanking sequence maybe play an important part in growth hormone gene regulation of the different animals.

  9. Possible origin of sequence divergence in the P1 cytadhesin gene of Mycoplasma pneumoniae.

    OpenAIRE

    Su, C J; Dallo, S F; Chavoya, A; Baseman, J B

    1993-01-01

    Specific regions of the P1 adhesin structural gene of Mycoplasma pneumoniae hybridize to various parts of the mycoplasma genome, indicating their multiple-copy nature. In addition, restriction fragment length polymorphisms and sequence divergence have been observed in the P1 gene, permitting the classification of clinical isolates of M. pneumoniae into two groups, I and II. These data suggest that the observed P1 gene diversity may be explained by homologous recombination between similar but ...

  10. Multi-species microarrays reveal the effect of sequence divergence on gene expression profiles

    OpenAIRE

    Gilad, Yoav; Rifkin, Scott A.; Bertone, Paul; Gerstein, Mark; White, Kevin P

    2005-01-01

    Interspecies comparisons of gene expression levels will increase our understanding of the evolution of transcriptional mechanisms and help to identify targets of natural selection. This approach holds particular promise for apes, as many human-specific adaptations are thought to result from differences in gene expression rather than in coding sequence. To date, however, all studies directly comparing interspecies gene expression have been performed on single-species arrays, so that it has bee...

  11. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  12. Sequence Analysis of α-gliadin Genes from Aegilops tauschii Native to China

    Directory of Open Access Journals (Sweden)

    Zujun Yang

    2010-11-01

    Full Text Available Aegilops tauschii was a D-genome progenitor for cultivated wheat (Triticum aestivum L. The accessions of Ae. tauschii native to China contained novel agronomically important traits including unique seed storage proteins for modern wheat improvement. Total 19 α-gliadin gene sequences were isolated from Ae. tauschii accession from Henan province. Five of 19 sequences contained in-frame stop condons and were predicted to be pseudogenes, suggesting the high variation of gliadin genes in Ae. tauschii genome. The Open Reading Frame (ORF lengths of these sequences encoded 281-303 residues, with the repetitive polyglutamine from 17-28 residues. There are two α-gliadin sequences present either 5 or 7 cysteine residues, which possibly related to high quality. Four peptides of T cell stimulatory epitopes in Celiac Disease (CD patients were distributed in most Ae. tauschii α-gliadin gene sequences. In comparison with the reported α-gliadin sequences in wheat ancestral species, the sequences of Ae. tauschii displayed high haplotypes diversity and significant deviation from a neutral distribution, indicative of the fast evolution of α-gliadin genes in Ae. tauschii species.

  13. The Cloning and Sequencing of Read-through Protein Gene from BYDV-GAV Virus

    Institute of Scientific and Technical Information of China (English)

    CHANG Sheng-jun; WANG Xi-feng; LI Li; MA Zhan-hong; ZHOU Guang-he

    2001-01-01

    The cDNA of BYDV-GAV read-through protein (RTP) gene was amplified from the extracted RNA of BYDV-GAV by using the polymerase chain reaction (PCR), and cloned into pGEM-7zf( + ). Its complete nucleotide sequence was determined by dideoxynucleotide chain-termination method. The BYDV-GAV RTP gene consists of 1377nt. Its sequences were most similar to that of the RTP gene of BYDV - MAV with identities of 87.4% and 87.1% at the nucleotide and amino acid levels, respectively.

  14. Influences on gene expression in vivo by a Shine-Dalgarno sequence

    DEFF Research Database (Denmark)

    Jin, Haining; Zhao, Qing; Gonzalez de Valdivia, Ernesto I;

    2006-01-01

    The Shine-Dalgarno (SD+: 5'-AAGGAGG-3') sequence anchors the mRNA by base pairing to the 16S rRNA in the small ribosomal subunit during translation initiation. We have here compared how an SD+ sequence influences gene expression, if located upstream or downstream of an initiation codon....... The positive effect of an upstream SD+ is confirmed. A downstream SD+ gives decreased gene expression. This effect is also valid for appropriately modified natural Escherichia coli genes. If an SD+ is placed between two potential initiation codons, initiation takes place predominantly at the second start site...

  15. Presence and Expression of Microbial Genes Regulating Soil Nitrogen Dynamics Along the Tanana River Successional Sequence

    Science.gov (United States)

    Boone, R. D.; Rogers, S. L.

    2004-12-01

    We report on work to assess the functional gene sequences for soil microbiota that control nitrogen cycle pathways along the successional sequence (willow, alder, poplar, white spruce, black spruce) on the Tanana River floodplain, Interior Alaska. Microbial DNA and mRNA were extracted from soils (0-10 cm depth) for amoA (ammonium monooxygenase), nifH (nitrogenase reductase), napA (nitrate reductase), and nirS and nirK (nitrite reductase) genes. Gene presence was determined by amplification of a conserved sequence of each gene employing sequence specific oligonucleotide primers and Polymerase Chain Reaction (PCR). Expression of the genes was measured via nested reverse transcriptase PCR amplification of the extracted mRNA. Amplified PCR products were visualized on agarose electrophoresis gels. All five successional stages show evidence for the presence and expression of microbial genes that regulate N fixation (free-living), nitrification, and nitrate reduction. We detected (1) nifH, napA, and nirK presence and amoA expression (mRNA production) for all five successional stages and (2) nirS and amoA presence and nifH, nirK, and napA expression for early successional stages (willow, alder, poplar). The results highlight that the existing body of previous process-level work has not sufficiently considered the microbial potential for a nitrate economy and free-living N fixation along the complete floodplain successional sequence.

  16. cDNA cloning and sequence analysis of NIb gene of soybean mosaic virus

    Institute of Scientific and Technical Information of China (English)

    刘俊君; 彭学贤; 莽克强

    1995-01-01

    cDNA of soybean mosaic virus (Beijing isolate, SMV-BJ) has been synthesized, using viralgenomic RNA as template and random hexanucleotides as primers. Based on the sequences of SMV-BJ coat protein (CP) gene as well as SMV- and WMV-II-related regions, oligonucleotides were made as primers for polymerase chain reaction (PCR). NIb gene of SMV-BJ was amplified by PCR, and cloned into pBluescript SK. The complete sequence was determined. The comparison of NIb genes between SMV-BJ and WMV-II . (USA) shows that similarities for nucleotide sequence reach 80.3%, and the deduced amino acid sequence. 91 3%. In consideration of the high identities in between the CP gene and the 3’-non-coding region between them, WMV-II might be considered as a watermelon strain of SMV Besides, some unexpected sequences were found in the 3’-region of 2 NIb gene clones. Following modification and splicing, a binary vector of NIb gene has been constructed for its expression in higher plant for the purpose of studying the possible repl

  17. Bidirectional gene sequences with similar homology to functional proteins of alkane degrading bacterium pseudomonas fredriksbergensis DNA

    International Nuclear Information System (INIS)

    The potential for two overlapping fragments of DNA from a clone of newly isolated alkanes degrading bacterium Pseudomonas frederiksbergensis encoding sequences with similar homology to two parts of functional proteins is described. One strand contains a sequence with high homology to alkanes monooxygenase (alkB), a member of the alkanes hydroxylase family, and the other strand contains a sequence with some homology to alcohol dehydrogenase gene (alkJ). Overlapping of the genes on opposite strands has been reported in eukaryotic species, and is now reported in a bacterial species. The sequence comparisons and ORFS results revealed that the regulation and the genes organization involved in alkane oxidation represented in Pseudomonas frederiksberghensis varies among the different known alkane degrading bacteria. The alk gene cluster containing homologues to the known alkane monooxygenase (alkB), and rubredoxin (alkG) are oriented in the same direction, whereas alcohol dehydrogenase (alkJ) is oriented in the opposite direction. Such genomes encode messages on both strands of the DNA, or in an overlapping but different reading frames, of the same strand of DNA. The possibility of creating novel genes from pre-existing sequences, known as overprinting, which is a widespread phenomenon in small viruses. Here, the origin and evolution of the gene overlap to bacteriophages belonging to the family Microviridae have been investigated. Such a phenomenon is most widely described in extremely small genomes such as those of viruses or small plasmids, yet here is a unique phenomenon. (author)

  18. Complexity of rice Hsp100 gene family: lessons from rice genome sequence data

    Indian Academy of Sciences (India)

    Gaurav Batra; Vineeta Singh Chauhan; Amanjot Singh; Neelam K Sarkar; Anil Grover

    2007-04-01

    Elucidation of genome sequence provides an excellent platform to understand detailed complexity of the various gene families. Hsp100 is an important family of chaperones in diverse living systems. There are eight putative gene loci encoding for Hsp100 proteins in Arabidopsis genome. In rice, two full-length Hsp100 cDNAs have been isolated and sequenced so far. Analysis of rice genomic sequence by in silico approach showed that two isolated rice Hsp100 cDNAs correspond to Os05g44340 and Os02g32520 genes in the rice genome database. There appears to be three additional proteins (encoded by Os03g31300, Os04g32560 and Os04g33210 gene loci) that are variably homologous to Os05g44340 and Os02g32520 throughout the entire amino acid sequence. The above five rice Hsp100 genes show significant similarities in the signature sequences known to be conserved among Hsp100 proteins. While Os05g44340 encodes cytoplasmic Hsp100 protein, those encoded by the other four genes are predicted to have chloroplast transit peptides.

  19. The impact of gene duplication, insertion, deletion, lateral gene transfer and sequencing error on orthology inference: a simulation study.

    Science.gov (United States)

    Dalquen, Daniel A; Altenhoff, Adrian M; Gonnet, Gaston H; Dessimoz, Christophe

    2013-01-01

    The identification of orthologous genes, a prerequisite for numerous analyses in comparative and functional genomics, is commonly performed computationally from protein sequences. Several previous studies have compared the accuracy of orthology inference methods, but simulated data has not typically been considered in cross-method assessment studies. Yet, while dependent on model assumptions, simulation-based benchmarking offers unique advantages: contrary to empirical data, all aspects of simulated data are known with certainty. Furthermore, the flexibility of simulation makes it possible to investigate performance factors in isolation of one another.Here, we use simulated data to dissect the performance of six methods for orthology inference available as standalone software packages (Inparanoid, OMA, OrthoInspector, OrthoMCL, QuartetS, SPIMAP) as well as two generic approaches (bidirectional best hit and reciprocal smallest distance). We investigate the impact of various evolutionary forces (gene duplication, insertion, deletion, and lateral gene transfer) and technological artefacts (ambiguous sequences) on orthology inference. We show that while gene duplication/loss and insertion/deletion are well handled by most methods (albeit for different trade-offs of precision and recall), lateral gene transfer disrupts all methods. As for ambiguous sequences, which might result from poor sequencing, assembly, or genome annotation, we show that they affect alignment score-based orthology methods more strongly than their distance-based counterparts.

  20. Hindered proton collectivity in 28S: Possible magic number at Z=16

    CERN Document Server

    Togano, Y; Iwasa, N; Yamada, K; Motobayashi, T; Aoi, N; Baba, H; Bishop, S; Cai, X; Doornenbal, P; Fang, D; Furukawa, T; Ieki, K; Kawabata, T; Kanno, S; Kobayashi, N; Kondo, Y; Kuboki, T; Kume, N; Kurita, K; Kurokawa, M; Ma, Y G; Matsuo, Y; Murakami, H; Matsushita, M; Nakamura, T; Okada, K; Ota, S; Satou, Y; Shimoura, S; Shioda, R; Tanaka, K N; Takeuchi, S; Tian, W; Wang, H; Wang, J; Yoneda, K

    2012-01-01

    The reduced transition probability B(E2;0 ->2+) for 28S was obtained experimentally using Coulomb excitation at 53 MeV/nucleon. The resultant B(E2) value 181(31) e2fm4 is smaller than the expectation based on empirical B(E2) systematics. The double ratio |M_n/M_p|/(N/Z) of the 0+ ->2+ transition in 28S was determined to be 1.9(2) by evaluating the M_n value from the known B(E2) value of the mirror nucleus 28Mg, showing the hindrance of proton collectivity relative to that of neutrons. These results indicate the emergence of the magic number Z=16 in the |T_z|=2 nucleus 28S.

  1. Sequence and secondary structure of the mitochondrial 16S ribosomal RNA gene of Ixodes scapularis.

    Science.gov (United States)

    Krakowetz, Chantel N; Chilton, Neil B

    2015-02-01

    The complete DNA sequences and secondary structure of the mitochondrial (mt) 16S ribosomal (r) RNA gene were determined for six Ixodes scapularis adults. There were 44 variable nucleotide positions in the 1252 bp sequence alignment. Most (95%) nucleotide alterations did not affect the integrity of the secondary structure of the gene because they either occurred at unpaired positions or represented compensatory changes that maintained the base pairing in helices. A large proportion (75%) of the intraspecific variation in DNA sequence occurred within Domains I, II and VI of the 16S gene. Therefore, several regions within this gene may be highly informative for studies of the population genetics and phylogeography of I. scapularis, a major vector of pathogens of humans and domestic animals in North America.

  2. Genomic organization and sequence analysis of the vomeronasal receptor V2R genes in mouse genome

    Institute of Scientific and Technical Information of China (English)

    YANG Hui; Zhang YaPing

    2007-01-01

    Two multigene superfamilies, named V1R and V2R, encoding seven-transmembrane-domain G-protein coupled receptors (GPCRs) have been identified as pheromone receptors in mammals. Three V2R gene families have been described in mouse and rat. Here we screened the updated mouse genome sequence database and finally retrieved 63 putative functional V2R genes including three newly identified genes which formed a new additional family. We described the genomic organization of these genes and also characterized the conservation of mouse V2R protein sequences. These genomic and sequence information we described are useful as part of the evidence to speculate the functional domain of V2Rs and should give aid to the functionality study in the future.

  3. Analysis of hepatitis B virus genotyping and drug resistance gene mutations based on massively parallel sequencing.

    Science.gov (United States)

    Han, Yingxin; Zhang, Yinxin; Mei, Yanhua; Wang, Yuqi; Liu, Tao; Guan, Yanfang; Tan, Deming; Liang, Yu; Yang, Ling; Yi, Xin

    2013-11-01

    Drug resistance to nucleoside analogs is a serious problem worldwide. Both drug resistance gene mutation detection and HBV genotyping are helpful for guiding clinical treatment. Total HBV DNA from 395 patients who were treated with single or multiple drugs including Lamivudine, Adefovir, Entecavir, Telbivudine, Tenofovir and Emtricitabine were sequenced using the HiSeq 2000 sequencing system and validated using the 3730 sequencing system. In addition, a mixed sample of HBV plasmid DNA was used to determine the cutoff value for HiSeq-sequencing, and 52 of the 395 samples were sequenced three times to evaluate the repeatability and stability of this technology. Of the 395 samples sequenced using both HiSeq and 3730 sequencing, the results from 346 were consistent, and the results from 49 were inconsistent. Among the 49 inconsistent results, 13 samples were detected as drug-resistance-positive using HiSeq but negative using 3730, and the other 36 samples showed a higher number of drug-resistance-positive gene mutations using HiSeq 2000 than using 3730. Gene mutations had an apparent frequency of 1% as assessed by the plasmid testing. Therefore, a 1% cutoff value was adopted. Furthermore, the experiment was repeated three times, and the same results were obtained in 49/52 samples using the HiSeq sequencing system. HiSeq sequencing can be used to analyze HBV gene mutations with high sensitivity, high fidelity, high throughput and automation and is a potential method for hepatitis B virus gene mutation detection and genotyping.

  4. Gene discovery and transcript analyses in the corn smut pathogen Ustilago maydis: expressed sequence tag and genome sequence comparison

    Directory of Open Access Journals (Sweden)

    Saville Barry J

    2007-09-01

    Full Text Available Abstract Background Ustilago maydis is the basidiomycete fungus responsible for common smut of corn and is a model organism for the study of fungal phytopathogenesis. To aid in the annotation of the genome sequence of this organism, several expressed sequence tag (EST libraries were generated from a variety of U. maydis cell types. In addition to utility in the context of gene identification and structure annotation, the ESTs were analyzed to identify differentially abundant transcripts and to detect evidence of alternative splicing and anti-sense transcription. Results Four cDNA libraries were constructed using RNA isolated from U. maydis diploid teliospores (U. maydis strains 518 × 521 and haploid cells of strain 521 grown under nutrient rich, carbon starved, and nitrogen starved conditions. Using the genome sequence as a scaffold, the 15,901 ESTs were assembled into 6,101 contiguous expressed sequences (contigs; among these, 5,482 corresponded to predicted genes in the MUMDB (MIPS Ustilago maydis database, while 619 aligned to regions of the genome not yet designated as genes in MUMDB. A comparison of EST abundance identified numerous genes that may be regulated in a cell type or starvation-specific manner. The transcriptional response to nitrogen starvation was assessed using RT-qPCR. The results of this suggest that there may be cross-talk between the nitrogen and carbon signalling pathways in U. maydis. Bioinformatic analysis identified numerous examples of alternative splicing and anti-sense transcription. While intron retention was the predominant form of alternative splicing in U. maydis, other varieties were also evident (e.g. exon skipping. Selected instances of both alternative splicing and anti-sense transcription were independently confirmed using RT-PCR. Conclusion Through this work: 1 substantial sequence information has been provided for U. maydis genome annotation; 2 new genes were identified through the discovery of 619

  5. Sequence diversities of serine-aspartate repeat genes among Staphylococcus aureus isolates from different hosts presumably by horizontal gene transfer.

    Directory of Open Access Journals (Sweden)

    Huping Xue

    Full Text Available BACKGROUND: Horizontal gene transfer (HGT is recognized as one of the major forces for bacterial genome evolution. Many clinically important bacteria may acquire virulence factors and antibiotic resistance through HGT. The comparative genomic analysis has become an important tool for identifying HGT in emerging pathogens. In this study, the Serine-Aspartate Repeat (Sdr family has been compared among different sources of Staphylococcus aureus (S. aureus to discover sequence diversities within their genomes. METHODOLOGY/PRINCIPAL FINDINGS: Four sdr genes were analyzed for 21 different S. aureus strains and 218 mastitis-associated S. aureus isolates from Canada. Comparative genomic analyses revealed that S. aureus strains from bovine mastitis (RF122 and mastitis isolates in this study, ovine mastitis (ED133, pig (ST398, chicken (ED98, and human methicillin-resistant S. aureus (MRSA (TCH130, MRSA252, Mu3, Mu50, N315, 04-02981, JH1 and JH9 were highly associated with one another, presumably due to HGT. In addition, several types of insertion and deletion were found in sdr genes of many isolates. A new insertion sequence was found in mastitis isolates, which was presumably responsible for the HGT of sdrC gene among different strains. Moreover, the sdr genes could be used to type S. aureus. Regional difference of sdr genes distribution was also indicated among the tested S. aureus isolates. Finally, certain associations were found between sdr genes and subclinical or clinical mastitis isolates. CONCLUSIONS: Certain sdr gene sequences were shared in S. aureus strains and isolates from different species presumably due to HGT. Our results also suggest that the distributional assay of virulence factors should detect the full sequences or full functional regions of these factors. The traditional assay using short conserved regions may not be accurate or credible. These findings have important implications with regard to animal husbandry practices that may

  6. Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ

    Directory of Open Access Journals (Sweden)

    Qing-Ming An

    2015-11-01

    Full Text Available The adiponectin gene (ADIPOQ plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5 of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2 were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3 and three SNPs were observed. Two patterns (A4-B4, A5-B5 and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg. In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits.

  7. Transcriptome Sequencing and Positive Selected Genes Analysis of Bombyx mandarina

    OpenAIRE

    Tingcai Cheng; Bohua Fu; Yuqian Wu; Renwen Long; Chun Liu; Qingyou Xia

    2015-01-01

    The wild silkworm Bombyx mandarina is widely believed to be an ancestor of the domesticated silkworm, Bombyx mori. Silkworms are often used as a model for studying the mechanism of species domestication. Here, we performed transcriptome sequencing of the wild silkworm using an Illumina HiSeq2000 platform. We produced 100,004,078 high-quality reads and assembled them into 50,773 contigs with an N50 length of 1764 bp and a mean length of 941.62 bp. A total of 33,759 unigenes were identified, wi...

  8. Evolution at Two Levels in Fire Ants: The Relationship between Patterns of Gene Expression and Protein Sequence Evolution

    OpenAIRE

    Hunt, B. G.; Ometto, L.; Keller, L.; Goodisman, M. A. D.

    2013-01-01

    Variation in protein sequence and gene expression each contribute to phenotypic diversity, and may be subject to similar selective pressures. Eusocial insects are particularly useful for investigating the evolutionary link between protein sequence and condition-dependent patterns of gene expression because gene expression plays a central role in determining differences between eusocial insect sexes and castes. We investigated the relationship between protein coding sequence evolution and gene...

  9. The nucleotide sequence of the uvrD gene of E. coli.

    OpenAIRE

    Finch, P W; Emmerson, P T

    1984-01-01

    The nucleotide sequence of a cloned section of the E. coli chromosome containing the uvrD gene has been determined. The coding region for the UvrD protein consists of 2,160 nucleotides which would direct the synthesis of a polypeptide 720 amino acids long with a calculated molecular weight of 82 kd. The predicted amino acid sequence of the UvrD protein has been compared with the amino acid sequences of other known adenine nucleotide binding proteins and a common sequence has been identified, ...

  10. Myelin protein zero gene sequencing diagnoses Charcot-Marie-Tooth Type 1B disease

    Energy Technology Data Exchange (ETDEWEB)

    Su, Y.; Zhang, H.; Madrid, R. [Univ. of California, San Francisco, CA (United States)] [and others

    1994-09-01

    Charcot-Marie-Tooth disease (CMT), the most common genetic neuropathy, affects about 1 in 2600 people in Norway and is found worldwide. CMT Type 1 (CMT1) has slow nerve conduction with demyelinated Schwann cells. Autosomal dominant CMT Type 1B (CMT1B) results from mutations in the myelin protein zero gene which directs the synthesis of more than half of all Schwann cell protein. This gene was mapped to the chromosome 1q22-1q23.1 borderline by fluorescence in situ hybridization. The first 7 of 7 reported CMT1B mutations are unique. Thus the most effective means to identify CMT1B mutations in at-risk family members and fetuses is to sequence the entire coding sequence in dominant or sporadic CMT patients without the CMT1A duplication. Of the 19 primers used in 16 pars to uniquely amplify the entire MPZ coding sequence, 6 primer pairs were used to amplify and sequence the 6 exons. The DyeDeoxy Terminator cycle sequencing method used with four different color fluorescent lables was superior to manual sequencing because it sequences more bases unambiguously from extracted genomic DNA samples within 24 hours. This protocol was used to test 28 CMT and Dejerine-Sottas patients without CMT1A gene duplication. Sequencing MPZ gene-specific amplified fragments identified 9 polymorphic sites within the 6 exons that encode the 248 amino acid MPZ protein. The large number of major CMT1B mutations identified by single strand sequencing are being verified by reverse strand sequencing and when possible, by restriction enzyme analysis. This protocol can be used to distringuish CMT1B patients from othre CMT phenotypes and to determine the CMT1B status of relatives both presymptomatically and prenatally.

  11. A pilot study of gene testing of genetic bone dysplasia using targeted next-generation sequencing.

    Science.gov (United States)

    Zhang, Huiwen; Yang, Rui; Wang, Yu; Ye, Jun; Han, Lianshu; Qiu, Wenjuan; Gu, Xuefan

    2015-12-01

    Molecular diagnosis of genetic bone dysplasia is challenging for non-expert. A targeted next-generation sequencing technology was applied to identify the underlying molecular mechanism of bone dysplasia and evaluate the contribution of these genes to patients with bone dysplasia encountered in pediatric endocrinology. A group of unrelated patients (n=82), characterized by short stature, dysmorphology and X-ray abnormalities, of which mucopolysacharidoses, GM1 gangliosidosis, mucolipidosis type II/III and achondroplasia owing to FGFR3 G380R mutation had been excluded, were recruited in this study. Probes were designed to 61 genes selected according to the nosology and classification of genetic skeletal disorders of 2010 by Illumina's online DesignStudio software. DNA was hybridized with probes and then a library was established following the standard Illumina protocols. Amplicon library was sequenced on a MiSeq sequencing system and the data were analyzed by MiSeq Reporter. Mutations of 13 different genes were found in 44 of the 82 patients (54%). Mutations of COL2A1 gene and PHEX gene were found in nine patients, respectively (9/44=20%), followed by COMP gene in 8 (18%), TRPV4 gene in 4 (9%), FBN1 gene in 4 (9%), COL1A1 gene in 3 (6%) and COL11A1, TRAPPC2, MATN3, ARSE, TRPS1, SMARCAL1, ENPP1 gene mutations in one patient each (2% each). In conclusion, mutations of COL2A1, PHEX and COMP gene are common for short stature due to bone dysplasia in outpatient clinics in pediatric endocrinology. Targeted next-generation sequencing is an efficient way to identify the underlying molecular mechanism of genetic bone dysplasia. PMID:26377240

  12. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    Directory of Open Access Journals (Sweden)

    Kaas Rolf S

    2012-10-01

    Full Text Available Abstract Background Escherichia coli exists in commensal and pathogenic forms. By measuring the variation of individual genes across more than a hundred sequenced genomes, gene variation can be studied in detail, including the number of mutations found for any given gene. This knowledge will be useful for creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps more biologically relevant, especially considering that many of these genome sequences are draft quality. The E. coli pan-genome for this set of isolates contains 16,373 gene clusters. A core-gene tree, based on alignment and a pan-genome tree based on gene presence/absence, maps the relatedness of the 186 sequenced E. coli genomes. The core-gene tree displays high confidence and divides the E. coli strains into the observed MLST type clades and also separates defined phylotypes. Conclusion The results of comparing a large and diverse E. coli dataset support the theory that reliable and good resolution phylogenies can be inferred from the core-genome. The results further suggest that the resolution at the isolate level may, subsequently be improved by targeting more variable genes. The use of whole genome sequencing will make it possible to eliminate, or at least reduce, the need for several typing steps used in traditional epidemiology.

  13. Sequence and organization of coelacanth neurohypophysial hormone genes: Evolutionary history of the vertebrate neurohypophysial hormone gene locus

    Directory of Open Access Journals (Sweden)

    Brenner Sydney

    2008-03-01

    Full Text Available Abstract Background The mammalian neurohypophysial hormones, vasopressin and oxytocin are involved in osmoregulation and uterine smooth muscle contraction respectively. All jawed vertebrates contain at least one homolog each of vasopressin and oxytocin whereas jawless vertebrates contain a single neurohypophysial hormone called vasotocin. The vasopressin homolog in non-mammalian vertebrates is vasotocin; and the oxytocin homolog is mesotocin in non-eutherian tetrapods, mesotocin and [Phe2]mesotocin in lungfishes, and isotocin in ray-finned fishes. The genes encoding vasopressin and oxytocin genes are closely linked in the human and rodent genomes in a tail-to-tail orientation. In contrast, their pufferfish homologs (vasotocin and isotocin are located on the same strand of DNA with isotocin gene located upstream of vasotocin gene separated by five genes, suggesting that this locus has experienced rearrangements in either mammalian or ray-finned fish lineage, or in both lineages. The coelacanths occupy a unique phylogenetic position close to the divergence of the mammalian and ray-finned fish lineages. Results We have sequenced a coelacanth (Latimeria menadoensis BAC clone encompassing the neurohypophysial hormone genes and investigated the evolutionary history of the vertebrate neurohypophysial hormone gene locus within a comparative genomics framework. The coelacanth contains vasotocin and mesotocin genes like non-mammalian tetrapods. The coelacanth genes are present on the same strand of DNA with no intervening genes, with the vasotocin gene located upstream of the mesotocin gene. Nucleotide sequences of the second exons of the two genes are under purifying selection implying a regulatory function. We have also analyzed the neurohypophysial hormone gene locus in the genomes of opossum, chicken and Xenopus tropicalis. The opossum contains two tandem copies of vasopressin and mesotocin genes. The vasotocin and mesotocin genes in chicken and

  14. Automated DNA mutation detection using universal conditions direct sequencing: application to ten muscular dystrophy genes

    Directory of Open Access Journals (Sweden)

    Wu Bai-Lin

    2009-10-01

    Full Text Available Abstract Background One of the most common and efficient methods for detecting mutations in genes is PCR amplification followed by direct sequencing. Until recently, the process of designing PCR assays has been to focus on individual assay parameters rather than concentrating on matching conditions for a set of assays. Primers for each individual assay were selected based on location and sequence concerns. The two primer sequences were then iteratively adjusted to make the individual assays work properly. This generally resulted in groups of assays with different annealing temperatures that required the use of multiple thermal cyclers or multiple passes in a single thermal cycler making diagnostic testing time-consuming, laborious and expensive. These factors have severely hampered diagnostic testing services, leaving many families without an answer for the exact cause of a familial genetic disease. A search of GeneTests for sequencing analysis of the entire coding sequence for genes that are known to cause muscular dystrophies returns only a small list of laboratories that perform comprehensive gene panels. The hypothesis for the study was that a complete set of universal assays can be designed to amplify and sequence any gene or family of genes using computer aided design tools. If true, this would allow automation and optimization of the mutation detection process resulting in reduced cost and increased throughput. Results An automated process has been developed for the detection of deletions, duplications/insertions and point mutations in any gene or family of genes and has been applied to ten genes known to bear mutations that cause muscular dystrophy: DMD; CAV3; CAPN3; FKRP; TRIM32; LMNA; SGCA; SGCB; SGCG; SGCD. Using this process, mutations have been found in five DMD patients and four LGMD patients (one in the FKRP gene, one in the CAV3 gene, and two likely causative heterozygous pairs of variations in the CAPN3 gene of two other

  15. Multiple Cis-Acting Sequences Contribute to Evolved Regulatory Variation for Drosophila Adh Genes

    Science.gov (United States)

    Fang, X. M.; Brennan, M. D.

    1992-01-01

    Drosophila affinidisjuncta and Drosophila hawaiiensis are closely related species that display distinct tissue-specific expression patterns for their homologous alcohol dehydrogenase genes (Adh genes). In Drosophila melanogaster transformants, both genes are expressed at high levels in the larval and adult fat bodies, but the D. affinidisjuncta gene is expressed 10-50-fold more strongly in the larval and adult midguts and Malpighian tubules. The present study reports the mapping of cis-acting sequences contributing to the regulatory differences between these two genes in transformants. Chimeric genes were constructed and introduced into the germ line of D. melanogaster. Stage- and tissue-specific expression patterns were determined by measuring steady-state RNA levels in larvae and adults. Three portions of the promoter region make distinct contributions to the tissue-specific regulatory differences between the native genes. Sequences immediately upstream of the distal promoter have a strong effect in the adult Malpighian tubules, while sequences between the two promoters are relatively important in the larval Malpighian tubules. A third gene segment, immediately upstream of the proximal promoter, influences levels of the proximal Adh transcript in all tissues and developmental stages examined, and largely accounts for the regulatory difference in the larval and adult midguts. However, these as well as other sequences make smaller contributions to various aspects of the tissue-specific regulatory differences. In addition, some chimeric genes display aberrant RNA levels for the whole organism, suggesting close physical association between sequences involved in tissue-specific regulatory differences and those important for Adh expression in the larval and adult fat bodies. PMID:1644276

  16. Application of gene sequencing directly to identify the pathogens in specimens

    Institute of Scientific and Technical Information of China (English)

    LU Xin-xin; YUAN Liang; WAN Xiao-hua; GENG Jia-jing

    2010-01-01

    Background Accurate identification of bacterial isolates is an essential task in clinical microbiology. This study compared culturing to analyzing 16S rRNA gene sequences as methods to identify bacteria in clinical samples. We developed a key technique to directly identify bacteria in clinical samples via nucleic acid sequences, thus improving the ability to confirm pathogens.Methods We obtained 225 samples from Beijing Tongran Hospital and examined them by conventional culture and 16S rDNA sequencing to identify pathogens. This study made use of a modified sample pre-treatment technique which came from our laboratory to extract DNA. 16S rDNA was amplified by PCR. The amplified product was sequenced on a CEQ8000 capillary sequencer. Sequences were uploaded to the GenBank BLAST database for comparison.Results Among the positively cultivated bacterial strains, seven strains were identified differently by Vitek32 and by 16S rDNA sequencing. Twelve samples that were negative by standard culturing were determined to have pathogens by sequence analysis.Conclusion The use of 16S rRNA gene sequencing can improve clinical microbiology by providing better identification of unidentified bacteria or providing reference identification of unusual strains.

  17. Isolation and characterization of gene sequences expressed in cotton fiber

    OpenAIRE

    Taciana de Carvalho Coutinho; Marcelo de Almeida Guimarães; Marcia Soares Vidal

    2016-01-01

    ABSTRACT Cotton fiber are tubular cells which develop from the differentiation of ovule epidermis. In addition to being one of the most important natural fiber of the textile group, cotton fiber afford an excellent experimental system for studying the cell wall. The aim of this work was to isolate and characterise the genes expressed in cotton fiber (Gossypium hirsutum L.) to be used in future work in cotton breeding. Fiber of the cotton cultivar CNPA ITA 90 II were used to extract RNA for th...

  18. Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

    DEFF Research Database (Denmark)

    Fromont-Racine, M; Bucchini, D; Madsen, O;

    1990-01-01

    Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific tra...... of the transgene was observed in cell types other than beta-islet cells.......Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific......, and -168 allowed correct initiation of the transcripts and cell specificity of expression, while quantitative expression gradually decreased. Deletion to -58 completely abolished the expression of the gene. The amount of human product that in mice harboring the longest fragment contributes up to 50...

  19. IS21-558 insertion sequences are involved in the mobility of the multiresistance gene cfr

    DEFF Research Database (Denmark)

    Kehrenberg, Corinna; Aarestrup, Frank Møller; Schwarz, Stefan

    2007-01-01

    exporter gene lsa(B) and the gene cfr for combined resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A antibiotics bracketed by IS21-558 insertion sequences orientated in the same direction. A 6-bp target site duplication was detected at the integration site within...... was detected on the ca. 43-kb plasmid pSCFS6 in S. warneri and S. simulans isolates. Sequence analysis of a 22,010-bp segment revealed that the new Tn558 variant harbored an additional resistance gene region integrated into the tnpC reading frame. This resistance gene region consisted of the clindamycin......During a study of florfenicol-resistant porcine staphylococci from Denmark, the genes cfr and fexA were detected in the chromosomal DNA or on plasmids of Staphylococcus hyicus, Staphylococcus warneri, and Staphylococcus simulans. A novel variant of the phenicol resistance transposon Tn558...

  20. Sequence and expression analyses of the UL37 and UL38 genes of Aujeszky's disease virus.

    Science.gov (United States)

    Braun, A; Kaliman, A; Boldogköi, Z; Aszódi, A; Fodor, I

    2000-01-01

    Previously, we sequenced the HSV-1 Ul39-Ul40 homologue genes of Aujeszky's disease virus (ADV), also designated as pseudorabies virus (Kaliman et al., 1994a, b). Now we report the nucleotide sequence of the adjacent DNA that encodes Ul38, the 5'-region (750 bp) of Ul37, and the promoter regions between these divergently arranged two genes. The ADV Ul38 gene encodes a protein of 368 amino acids. Amino acid sequence comparison of ADV Ul38 with that of other herpesviruses revealed significant structural homology. In a transcription study using RNase protection assay and Northern blot hybridization, we found that the Ul38 gene had one initiation site, but the Ul37 gene was initiated at two transcription sites with two potential initiator AUGs, one of which was dominant. Comparison of ADV Ul37, Ul38 and ribonucleotide reductase gene expression showed that these genes belong to the same temporal class with early kinetics. Data of structural and transcriptional studies suggest that regulation of the expression of these two ADV genes could differ from that of the HSV-1 virus. PMID:11402671

  1. Cloning and sequence analysis of a gene encoding polygalacturonase-inhibiting protein from cotton

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Polygalacturonase-inhibiting proteins (PGIP) play important roles in plant defense of pathogen, especially fungi. A pair of degenerated primers is designed based on the conserved sequence of 20 other known pgip genes and used to amplify Gossypium barbadense cultivation 7124 cDNA library by touch-down PCR. A 561 bp internal fragment of the pgip gene is obtained and used to design the primers for rapid amplification of cDNA ends. A composite pgip gene sequence is constructed from the products of 5′ and 3′ RACE, which are 666 bp and 906 bp respectively. Analysis of nucleic acid sequence shows 69.2% and 68.7% similarity to Citrus and Poncirus pgip genes, respectively. Its open reading frame of the gene encodes a polypeptide of 330 amino acids, in which 10 leucine-rich repeats arrange tandemly. A new set of primers is designed to the 5′ and 3′ ends of the gene, which allows amplification of the full-length gene from the cotton cDNA library. Genomic DNA analysis reveals that this gene has no intron.

  2. Phylogenetic analysis of Mexican Babesia bovis isolates using msa and ssrRNA gene sequences.

    Science.gov (United States)

    Genis, Alma D; Mosqueda, Juan J; Borgonio, Verónica M; Falcón, Alfonso; Alvarez, Antonio; Camacho, Minerva; de Lourdes Muñoz, Maria; Figueroa, Julio V

    2008-12-01

    Variable merozoite surface antigens of Babesia bovis are exposed glycoproteins having a role in erythrocyte invasion. Members of this gene family include msa-1 and msa-2 (msa-2c, msa-2a(1), msa-2a(2), and msa-2b). Small subunit ribosomal (ssr)RNA gene is subject to evolutive pressure and has been used in phylogenetic studies. To determine the phylogenetic relationship among B. bovis Mexican isolates using different genetic markers, PCR amplicons, corresponding to msa-1, msa-2c, msa-2b, and ssrRNA genes, were cloned and plasmids carrying the corresponding inserts were sequenced. Comparative analysis of nucleotide and deduced amino acid sequences revealed distinct degrees of variability and identity among the coding gene sequences obtained from 12 geographically different B. bovis isolates and a reference strain. Overall sequence identities of 47.7%, 72.3%, 87.7%, and 94% were determined for msa-1, msa-2b, msa-2c, and ssrRNA, respectively. A robust phylogenetic tree was obtained with msa-2b sequences. The phylogenetic analysis suggests that Mexican B. bovis isolates group in clades not concordant with the Mexican geography. However, the Mexican isolates group together in an American clade separated from the Australian clade. Sequence heterogeneity in msa-1, msa-2b, and msa-2c coding regions of Mexican B. bovis isolates present in different geographical regions can be a result of either differential evolutive pressure or cattle movement from commercial trade.

  3. Sequence Analysis of the Protein Structure Homology Modeling of Growth Hormone Gene from Salmo trutta caspius

    Directory of Open Access Journals (Sweden)

    Abolhasan Rezaei

    2012-03-01

    Full Text Available In view of the growth hormone protein investigated and characterized from Salmo trutta caspius. Growth hormone gene in the Salmo trutta caspius have six exons in the full length that is translated into a Molecular Weight (kDa: ssDNA: 64.98 and dsDNA: 129.6. There are also 210 amino acid residue. The assembled full length of DNA contains open reading frame of growth hormone gene that contains 15 sequences in the full length. The average GC content is 47% and AT content is 53%. This protein multiple alignment has shown that this peptide is 100% identical to the corresponding homologous protein in the growth hormone protein which including Salmo salar (Accession number: AAA49558.1 and Rainbow trout (Salmo trutta (Accession number: AAA49555.1" sequences. The sequence of protein had deposited in Gene Bank, Accession number: AEK70940. Also we were analyzed second and third structure between sequences reported in Gene Bank Network system. The results are shown, there are homology between second structure in three sequences including: Salmo trutta caspius, Salmo salar and Rainbow trout. Regarding third structure, Salmo trutta caspius and Salmo salar are same type, but Rainbow trout has different homology with Salmo trutta caspius and Salmo salar. However, the sequences were observed three parallel " helix and in second structure there were almost same percent β sheet.

  4. Characterization of the Helicoverpa assulta nucleopolyhedrovirus genome and sequence analysis of the polyhedrin gene region

    Indian Academy of Sciences (India)

    Soo-Dong Woo; Jae Young Choi; Yeon Ho Je; Byung Rae Jin

    2006-09-01

    A local strain of Helicoverpa assulta nucleopolyhedrovirus (HasNPV) was isolated from infected H. assulta larvae in Korea. Restriction endonuclease fragment analysis, using 4 restriction enzymes, estimated that the total genome size of HasNPV is about 138 kb. A degenerate polymerase chain reaction (PCR) primer set for the polyhedrin gene successfully amplified the partial polyhedrin gene of HasNPV. The sequencing results showed that the about 430 bp PCR product was a fragment of the corresponding polyhedrin gene. Using HasNPV partial predicted polyhedrin to probe the Southern blots, we identified the location of the polyhedrin gene within the 6 kb EcoRI, 15 kb NcoI, 20 kb XhoI, 17 kb BglII and 3 kb ClaI fragments, respectively. The 3 kb ClaI fragment was cloned and the nucleotide sequences of the polyhedrin coding region and its flaking regions were determined. Nucleotide sequence analysis indicated the presence of an open reading frame of 735 nucleotides which could encode 245 amino acids with a predicted molecular mass of 29 kDa. The nucleotide sequences within the coding region of HasNPV polyhedrin shared 73.7% identity with the polyhedrin gene from Autographa californica NPV but were most closely related to Helicoverpa and Heliothis species NPVs with over 99% sequence identity.

  5. GeneAnalytics: An Integrative Gene Set Analysis Tool for Next Generation Sequencing, RNAseq and Microarray Data.

    Science.gov (United States)

    Ben-Ari Fuchs, Shani; Lieder, Iris; Stelzer, Gil; Mazor, Yaron; Buzhor, Ella; Kaplan, Sergey; Bogoch, Yoel; Plaschkes, Inbar; Shitrit, Alina; Rappaport, Noa; Kohn, Asher; Edgar, Ron; Shenhav, Liraz; Safran, Marilyn; Lancet, Doron; Guan-Golan, Yaron; Warshawsky, David; Shtrichman, Ronit

    2016-03-01

    Postgenomics data are produced in large volumes by life sciences and clinical applications of novel omics diagnostics and therapeutics for precision medicine. To move from "data-to-knowledge-to-innovation," a crucial missing step in the current era is, however, our limited understanding of biological and clinical contexts associated with data. Prominent among the emerging remedies to this challenge are the gene set enrichment tools. This study reports on GeneAnalytics™ ( geneanalytics.genecards.org ), a comprehensive and easy-to-apply gene set analysis tool for rapid contextualization of expression patterns and functional signatures embedded in the postgenomics Big Data domains, such as Next Generation Sequencing (NGS), RNAseq, and microarray experiments. GeneAnalytics' differentiating features include in-depth evidence-based scoring algorithms, an intuitive user interface and proprietary unified data. GeneAnalytics employs the LifeMap Science's GeneCards suite, including the GeneCards®--the human gene database; the MalaCards-the human diseases database; and the PathCards--the biological pathways database. Expression-based analysis in GeneAnalytics relies on the LifeMap Discovery®--the embryonic development and stem cells database, which includes manually curated expression data for normal and diseased tissues, enabling advanced matching algorithm for gene-tissue association. This assists in evaluating differentiation protocols and discovering biomarkers for tissues and cells. Results are directly linked to gene, disease, or cell "cards" in the GeneCards suite. Future developments aim to enhance the GeneAnalytics algorithm as well as visualizations, employing varied graphical display items. Such attributes make GeneAnalytics a broadly applicable postgenomics data analyses and interpretation tool for translation of data to knowledge-based innovation in various Big Data fields such as precision medicine, ecogenomics, nutrigenomics, pharmacogenomics, vaccinomics

  6. The complete mitochondrial genome sequence and gene organization of Tridentiger trigonocephalus (Gobiidae: Gobionellinae) with phylogenetic consideration.

    Science.gov (United States)

    Wei, Hongqing; Ma, Hongyu; Ma, Chunyan; Zhang, Fengying; Wang, Wei; Chen, Wei; Ma, Lingbo

    2016-09-01

    The complete mitochondrial genome plays an important role in studies of genome-level characteristics and phylogenetic relationships. Here we determined the complete mitogenome sequence of Tridentiger trigonocephalus (Perciformes, Gobiidae), and discovered its phylogenetic relationship. This circular genome was 16 662 bp in length, and consisted of 37 typical genes, including 13 protein-coding genes, 22 tRNA genes, and two rRNA genes. The gene order of T. trigonocephalus mitochondrial genome was identical to those observed in most other vertebrates. Of 37 genes, 28 were encoded by heavy strand, while the others were encoded by light strand. The phylogenetic tree constructed by 13 concatenated protein-coding genes showed that T. trigonocephalus was closest to T. bifasciatus, and then to T. barbatus among the 20 species within suborder Gobioidei. This work should facilitate the studies on population genetic diversity, and molecular evolution in Gobioidei fishes. PMID:26370266

  7. Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

    Science.gov (United States)

    Lau, Yun-Fai; Kan, Yuet Wai

    1983-09-01

    We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

  8. Citrus plastid-related gene profiling based on expressed sequence tag analyses

    Directory of Open Access Journals (Sweden)

    Tercilio Calsa Jr.

    2007-01-01

    Full Text Available Plastid-related sequences, derived from putative nuclear or plastome genes, were searched in a large collection of expressed sequence tags (ESTs and genomic sequences from the Citrus Biotechnology initiative in Brazil. The identified putative Citrus chloroplast gene sequences were compared to those from Arabidopsis, Eucalyptus and Pinus. Differential expression profiling for plastid-directed nuclear-encoded proteins and photosynthesis-related gene expression variation between Citrus sinensis and Citrus reticulata, when inoculated or not with Xylella fastidiosa, were also analyzed. Presumed Citrus plastome regions were more similar to Eucalyptus. Some putative genes appeared to be preferentially expressed in vegetative tissues (leaves and bark or in reproductive organs (flowers and fruits. Genes preferentially expressed in fruit and flower may be associated with hypothetical physiological functions. Expression pattern clustering analysis suggested that photosynthesis- and carbon fixation-related genes appeared to be up- or down-regulated in a resistant or susceptible Citrus species after Xylella inoculation in comparison to non-infected controls, generating novel information which may be helpful to develop novel genetic manipulation strategies to control Citrus variegated chlorosis (CVC.

  9. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    Science.gov (United States)

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173. PMID:15543522

  10. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    Science.gov (United States)

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173.

  11. A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

    Directory of Open Access Journals (Sweden)

    Craig W. Herbold

    2015-07-01

    Full Text Available High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse and high quality sets of amplicon sequence data for modern studies in microbial ecology.

  12. Analysis of human growth hormone gene 5' sequences in isolated growth hormone deficiency patients.

    OpenAIRE

    Wang, Y.; Yu, L L; Sheng, Q.; Meng, C; Sun, J.; S.S. Chen

    1994-01-01

    Human growth hormone (hGH) gene deletion (6.7 to 7.6 kb) is one of the causes of isolated growth hormone deficiency (IGHD), named IGHD IA. IGHD IA, however, only accounts for about 10% of the total IGHD patients. Most IGHD is caused by unknown mechanisms. Here, hGH gene 5' sequences in three IGHD patients without hGH gene deletion were analysed to see if there was any mutation hindering the expression of the hGH gene.

  13. Cloning, nucleotide sequence, and expression of the Bacillus subtilis lon gene.

    OpenAIRE

    Riethdorf, S.; Völker, U; Gerth, U.; Winkler, A; Engelmann, S; Hecker, M.

    1994-01-01

    The lon gene of Escherichia coli encodes the ATP-dependent serine protease La and belongs to the family of sigma 32-dependent heat shock genes. In this paper, we report the cloning and characterization of the lon gene from the gram-positive bacterium Bacillus subtilis. The nucleotide sequence of the lon locus, which is localized upstream of the hemAXCDBL operon, was determined. The lon gene codes for an 87-kDa protein consisting of 774 amino acid residues. A comparison of the deduced amino ac...

  14. Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

    Science.gov (United States)

    2004-01-01

    The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

  15. Cloning and Sequence Analysis of Envelope Glycoprotein E1 Gene of Rubella Virus, JR23 Strain

    Institute of Scientific and Technical Information of China (English)

    王志玉; 薛永磊; 王小凡; 宋艳艳; 温红玲

    2003-01-01

    To construct an expression vector containing the E1 glycoprotein gene of rubella virus for the study on the effectof mutation of the E1 gene glycoprotein and the analysis of phylogenetic differences of sequences, the gene encoding the E1envelope glycoprotein was amplified from rubella virus, Jinan strain JR23, by RT-PCR and ligated into PMD-18T vector.The clones that carried the E1 gene were identified after ampr selection and analysis of restriction enzyme digestion. After sequencing this gene was analyzed by Danstar and Winstar programs, and the map of phylogenetic tree was drawn. The clone of E1 glycoprotein was thus constructed. It was found that the sequence differences between JR23 strain and the TCRB strainfrom Japan and those between JR23 strain and Thomas strain of England were rather small with difference values of 0.9% and 1.2% respectively. Yet those between JR23 strain and BRD2 strain from Beijing and those between JR23 strain and XG379 strain from Hong Kong were comparatively larger with difference values of 7.6% and 7.3% respectively. The sequence of JR23 strain with other strains was less than 3% except the NC strain (3.7%). It concludes that the constructionof E1 glycoprotein gene offers an approach to study the relationship between structures and functions of E1 gene and its gene products. In the phylogenetic tree, it shows that there are significant differences in the sequences of rubella virus isolated in China, and this might be helpful to develop an effective subunit vaccine.

  16. Natural variation in CBF gene sequence, gene expression and freezing tolerance in the Versailles core collection of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Brunel Dominique

    2008-10-01

    Full Text Available Abstract Background Plants from temperate regions are able to withstand freezing temperatures due to a process known as cold acclimation, which is a prior exposure to low, but non-freezing temperatures. During acclimation, a large number of genes are induced, bringing about biochemical changes in the plant, thought to be responsible for the subsequent increase in freezing tolerance. Key regulatory proteins in this process are the CBF1, 2 and 3 transcription factors which control the expression of a set of target genes referred to as the "CBF regulon". Results To assess the role of the CBF genes in cold acclimation and freezing tolerance of Arabidopsis thaliana, the CBF genes and their promoters were sequenced in the Versailles core collection, a set of 48 accessions that maximizes the naturally-occurring genetic diversity, as well as in the commonly used accessions Col-0 and WS. Extensive polymorphism was found in all three genes. Freezing tolerance was measured in all accessions to assess the variability in acclimated freezing tolerance. The effect of sequence polymorphism was investigated by evaluating the kinetics of CBF gene expression, as well as that of a subset of the target COR genes, in a set of eight accessions with contrasting freezing tolerance. Our data indicate that CBF genes as well as the selected COR genes are cold induced in all accessions, irrespective of their freezing tolerance. Although we observed different levels of expression in different accessions, CBF or COR gene expression was not closely correlated with freezing tolerance. Conclusion Our results indicate that the Versailles core collection contains significant natural variation with respect to freezing tolerance, polymorphism in the CBF genes and CBF and COR gene expression. Although there tends to be more CBF and COR gene expression in tolerant accessions, there are exceptions, reinforcing the idea that a complex network of genes is involved in freezing tolerance

  17. Complete nucleotide sequences of two adjacent early vaccinia virus genes located within the inverted terminal repetition.

    Science.gov (United States)

    Venkatesan, S; Gershowitz, A; Moss, B

    1982-11-01

    The proximal part of the 10,000-base pair (bp) inverted terminal repetition of vaccinia virus DNA encodes at least three early mRNAs. A 2,236-bp segment of the repetition was sequenced to characterize two of the genes. This task was facilitated by constructing a series of recombinants containing overlapping deletions; oligonucleotide linkers with synthetic restriction sites provided points for radioactive labeling before sequencing by the chemical degradation method of Maxam and Gilbert (Methods Enzymol. 65:499-560, 1980). The ends of the transcripts were mapped by hybridizing labeled DNA fragments to early viral RNA and resolving nuclease S1-protected fragments in sequencing gels, by sequencing cDNA clones, and from the lengths of the RNAs. The nucleotide sequences for at least 60 bp upstream of both transcriptional initiation sites are more than 80% adenine . thymine rich and contain long runs of adenines and thymines with some homology to procaryotic and eucaryotic consensus sequences. The gene transcribed in the rightward direction encodes an RNA of approximately 530 nucleotides with a single open reading frame of 420 nucleotides. Preceding the first AUG, there is a heptanucleotide that can hybridize to the 3' end of 18S rRNA with only one mismatch. The derived amino acid sequence of the protein indicated a molecular weight of 15,500. The gene transcribed in the leftward direction encodes an RNA 1,000 to 1,100 nucleotides long with an open reading frame of 996 nucleotides and a leader sequence of only 5 to 6 nucleotides. The derived amino acid sequence of this protein indicated a molecular weight of 38,500. The 3' ends of the two transcripts were located within 100 bp of each other. Although there are adenine . thymine-rich clusters near the putative transcriptional termination sites, specific AATAAA polyadenylic acid signal sequences are absent.

  18. Molecular cloning, sequence characterization, and gene expression profiling of a novel water buffalo (Bubalus bubalis) gene, AGPAT6.

    Science.gov (United States)

    Song, S; Huo, J L; Li, D L; Yuan, Y Y; Yuan, F; Miao, Y W

    2013-01-01

    Several 1-acylglycerol-3-phosphate-O-acyltransferases (AGPATs) can acylate lysophosphatidic acid to produce phosphatidic acid. Of the eight AGPAT isoforms, AGPAT6 is a crucial enzyme for glycerolipids and triacylglycerol biosynthesis in some mammalian tissues. We amplified and identified the complete coding sequence (CDS) of the water buffalo AGPAT6 gene by using the reverse transcription-polymerase chain reaction, based on the conversed sequence information of the cattle or expressed sequence tags of other Bovidae species. This novel gene was deposited in the NCBI database (accession No. JX518941). Sequence analysis revealed that the CDS of this AGPAT6 encodes a 456-amino acid enzyme (molecular mass = 52 kDa; pI = 9.34). Water buffalo AGPAT6 contains three hydrophobic transmembrane regions and a signal 37-amino acid peptide, localized in the cytoplasm. The deduced amino acid sequences share 99, 98, 98, 97, 98, 98, 97 and 95% identity with their homologous sequences from cattle, horse, human, mouse, orangutan, pig, rat, and chicken, respectively. The phylogenetic tree analysis based on the AGPAT6 CDS showed that water buffalo has a closer genetic relationship with cattle than with other species. Tissue expression profile analysis shows that this gene is highly expressed in the mammary gland, moderately expressed in the heart, muscle, liver, and brain; weakly expressed in the pituitary gland, spleen, and lung; and almost silently expressed in the small intestine, skin, kidney, and adipose tissues. Four predicted microRNA target sites are found in the water buffalo AGPAT6 CDS. These results will establish a foundation for further insights into this novel water buffalo gene. PMID:24114207

  19. Discrimination of germline V genes at different sequencing lengths and mutational burdens: A new tool for identifying and evaluating the reliability of V gene assignment.

    Science.gov (United States)

    Zhang, Bochao; Meng, Wenzhao; Prak, Eline T Luning; Hershberg, Uri

    2015-12-01

    Immune repertoires are collections of lymphocytes that express diverse antigen receptor gene rearrangements consisting of Variable (V), (Diversity (D) in the case of heavy chains) and Joining (J) gene segments. Clonally related cells typically share the same germline gene segments and have highly similar junctional sequences within their third complementarity determining regions. Identifying clonal relatedness of sequences is a key step in the analysis of immune repertoires. The V gene is the most important for clone identification because it has the longest sequence and the greatest number of sequence variants. However, accurate identification of a clone's germline V gene source is challenging because there is a high degree of similarity between different germline V genes. This difficulty is compounded in antibodies, which can undergo somatic hypermutation. Furthermore, high-throughput sequencing experiments often generate partial sequences and have significant error rates. To address these issues, we describe a novel method to estimate which germline V genes (or alleles) cannot be discriminated under different conditions (read lengths, sequencing errors or somatic hypermutation frequencies). Starting with any set of germline V genes, this method measures their similarity using different sequencing lengths and calculates their likelihood of unambiguous assignment under different levels of mutation. Hence, one can identify, under different experimental and biological conditions, the germline V genes (or alleles) that cannot be uniquely identified and bundle them together into groups of specific V genes with highly similar sequences.

  20. Putative and unique gene sequence utilization for the design of species specific probes as modeled by Lactobacillus plantarum

    Science.gov (United States)

    The concept of utilizing putative and unique gene sequences for the design of species specific probes was tested. The abundance profile of assigned functions within the Lactobacillus plantarum genome was used for the identification of the putative and unique gene sequence, csh. The targeted gene (cs...

  1. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    Energy Technology Data Exchange (ETDEWEB)

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  2. Automated conserved noncoding sequence (CNS discovery reveals differences in gene content and promoter evolution among grasses

    Directory of Open Access Journals (Sweden)

    Gina eTurco

    2013-07-01

    Full Text Available Conserved noncoding sequences (CNS are islands of noncoding sequence that, like protein coding exons, show less divergence in sequence between related species than functionless DNA. Several of CNSs have been demonstrated experimentally to function as cis-regulatory regions. However, the specific functions of most CNSs remain unknown. Previous searchers for CNS in plants have either anchored on exons and only identified nearby sequences or required years of painstaking manual annotation. Here we present an open source tool that can accurately identify CNSs between any two related species with sequenced genomes, including both those immediately adjacent to exons and distal sequences separated by >12 KB of noncoding sequence. We have used this tool to characterize new motifs, associate CNSs with additional functions and identify previously undetected genes encoding RNA and protein in the genomes of five grass species. We provide a list of 15,363 orthologous CNSs conserved across all grasses tested. We were also able to identify regulatory sequences present in the common ancestor of grasses that have been lost in one or more extant grass lineages. Lists of orthologous gene pairs and associated CNSs are provided for reference inbred lines of arabidopsis, Japonica rice, foxtail millet, sorghum, brachypodium and maize.

  3. Resequencing of the common marmoset genome improves genome assemblies and gene-coding sequence analysis.

    Science.gov (United States)

    Sato, Kengo; Kuroki, Yoko; Kumita, Wakako; Fujiyama, Asao; Toyoda, Atsushi; Kawai, Jun; Iriki, Atsushi; Sasaki, Erika; Okano, Hideyuki; Sakakibara, Yasubumi

    2015-11-20

    The first draft of the common marmoset (Callithrix jacchus) genome was published by the Marmoset Genome Sequencing and Analysis Consortium. The draft was based on whole-genome shotgun sequencing, and the current assembly version is Callithrix_jacches-3.2.1, but there still exist 187,214 undetermined gap regions and supercontigs and relatively short contigs that are unmapped to chromosomes in the draft genome. We performed resequencing and assembly of the genome of common marmoset by deep sequencing with high-throughput sequencing technology. Several different sequence runs using Illumina sequencing platforms were executed, and 181 Gbp of high-quality bases including mate-pairs with long insert lengths of 3, 8, 20, and 40 Kbp were obtained, that is, approximately 60× coverage. The resequencing significantly improved the MGSAC draft genome sequence. The N50 of the contigs, which is a statistical measure used to evaluate assembly quality, doubled. As a result, 51% of the contigs (total length: 299 Mbp) that were unmapped to chromosomes in the MGSAC draft were merged with chromosomal contigs, and the improved genome sequence helped to detect 5,288 new genes that are homologous to human cDNAs and the gaps in 5,187 transcripts of the Ensembl gene annotations were completely filled.

  4. Next-generation sequencing approach for connecting secondary metabolites to biosynthetic gene clusters in fungi

    Directory of Open Access Journals (Sweden)

    Ralph A Cacho

    2015-01-01

    Full Text Available Genomics has revolutionized the research on fungal secondary metabolite biosynthesis. To elucidate the molecular and enzymatic mechanisms underlying the biosynthesis of a specific secondary metabolite compound, the important first step is often to find the genes that responsible for its synthesis. The accessibility to fungal genome sequences allows the bypass of the cumbersome traditional library construction and screening approach. The advance in next-generation sequencing (NGS technologies have further improved the speed and reduced the cost of microbial genome sequencing in the past few years, which has accelerated the research in this field. Here, we will present an example work flow for identifying the gene cluster encoding the biosynthesis of secondary metabolites of interest using an NGS approach. We will also review the different strategies that can be employed to pinpoint the targeted gene clusters rapidly by giving several examples stemming from our work.

  5. Preliminary study on mitochondrial 16S rRNA gene sequences and phylogeny of flatfishes (Pleuronectiformes)

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    A 605 bp section of mitochondrial 16S rRNA gene from Paralichthys olivaceus, Pseudorhombus cinnamomeus, Psetta maxima and Kareius bicoloratus, which represent 3 families of Order Pleuronectiformes was amplified by PCR and sequenced to show the molecular systematics of Pleuronectiformes for comparison with related gene sequences of other 6 flatfish downloaded from GenBank. Phylogenetic analysis based on genetic distance from related gene sequences of 10 flatfish showed that this method was ideal to explore the relationship between species, genera and families. Phylogenetic trees set-up is based on neighbor-joining, maximum parsimony and maximum likelihood methods that accords to the general rule of Pleuronectiformes evolution. But they also resulted in some confusion. Unlike data from morphological characters, P. olivaceus clustered with K.bicoloratus, but P. cinnamomeus did not cluster with P. olivaceus, which is worth further studying.

  6. Sequencing and comparative analysis of fugu protocadherin clusters reveal diversity of protocadherin genes among teleosts

    Directory of Open Access Journals (Sweden)

    Rajasegaran Vikneswari

    2007-03-01

    Full Text Available Abstract Background The synaptic cell adhesion molecules, protocadherins, are a vertebrate innovation that accompanied the emergence of the neural tube and the elaborate central nervous system. In mammals, the protocadherins are encoded by three closely-linked clusters (α, β and γ of tandem genes and are hypothesized to provide a molecular code for specifying the remarkably-diverse neural connections in the central nervous system. Like mammals, the coelacanth, a lobe-finned fish, contains a single protocadherin locus, also arranged into α, β and γ clusters. Zebrafish, however, possesses two protocadherin loci that contain more than twice the number of genes as the coelacanth, but arranged only into α and γ clusters. To gain further insight into the evolutionary history of protocadherin clusters, we have sequenced and analyzed protocadherin clusters from the compact genome of the pufferfish, Fugu rubripes. Results Fugu contains two unlinked protocadherin loci, Pcdh1 and Pcdh2, that collectively consist of at least 77 genes. The fugu Pcdh1 locus has been subject to extensive degeneration, resulting in the complete loss of Pcdh1γ cluster. The fugu Pcdh genes have undergone lineage-specific regional gene conversion processes that have resulted in a remarkable regional sequence homogenization among paralogs in the same subcluster. Phylogenetic analyses show that most protocadherin genes are orthologous between fugu and zebrafish either individually or as paralog groups. Based on the inferred phylogenetic relationships of fugu and zebrafish genes, we have reconstructed the evolutionary history of protocadherin clusters in the teleost fish lineage. Conclusion Our results demonstrate the exceptional evolutionary dynamism of protocadherin genes in vertebrates in general, and in teleost fishes in particular. Besides the 'fish-specific' whole genome duplication, the evolution of protocadherin genes in teleost fishes is influenced by lineage

  7. Comparison of the aflR gene sequences of strains in Aspergillus section Flavi.

    Science.gov (United States)

    Lee, Chao-Zong; Liou, Guey-Yuh; Yuan, Gwo-Fang

    2006-01-01

    Aflatoxins are polyketide-derived secondary metabolites produced by Aspergillus parasiticus, Aspergillus flavus, Aspergillus nomius and a few other species. The toxic effects of aflatoxins have adverse consequences for human health and agricultural economics. The aflR gene, a regulatory gene for aflatoxin biosynthesis, encodes a protein containing a zinc-finger DNA-binding motif. Although Aspergillus oryzae and Aspergillus sojae, which are used in fermented foods and in ingredient manufacture, have no record of producing aflatoxin, they have been shown to possess an aflR gene. This study examined 34 strains of Aspergillus section Flavi. The aflR gene of 23 of these strains was successfully amplified and sequenced. No aflR PCR products were found in five A. sojae strains or six strains of A. oryzae. These PCR results suggested that the aflR gene is absent or significantly different in some A. sojae and A. oryzae strains. The sequenced aflR genes from the 23 positive strains had greater than 96.6 % similarity, which was particularly conserved in the zinc-finger DNA-binding domain. The aflR gene of A. sojae has two obvious characteristics: an extra CTCATG sequence fragment and a C to T transition that causes premature termination of AFLR protein synthesis. Differences between A. parasiticus/A. sojae and A. flavus/A. oryzae aflR genes were also identified. Some strains of A. flavus as well as A. flavus var. viridis, A. oryzae var. viridis and A. oryzae var. effuses have an A. oryzae-type aflR gene. For all strains with the A. oryzae-type aflR gene, there was no evidence of aflatoxin production. It is suggested that for safety reasons, the aflR gene could be examined to assess possible aflatoxin production by Aspergillus section Flavi strains.

  8. GeneAnalytics: An Integrative Gene Set Analysis Tool for Next Generation Sequencing, RNAseq and Microarray Data

    Science.gov (United States)

    Ben-Ari Fuchs, Shani; Lieder, Iris; Mazor, Yaron; Buzhor, Ella; Kaplan, Sergey; Bogoch, Yoel; Plaschkes, Inbar; Shitrit, Alina; Rappaport, Noa; Kohn, Asher; Edgar, Ron; Shenhav, Liraz; Safran, Marilyn; Lancet, Doron; Guan-Golan, Yaron; Warshawsky, David; Shtrichman, Ronit

    2016-01-01

    Abstract Postgenomics data are produced in large volumes by life sciences and clinical applications of novel omics diagnostics and therapeutics for precision medicine. To move from “data-to-knowledge-to-innovation,” a crucial missing step in the current era is, however, our limited understanding of biological and clinical contexts associated with data. Prominent among the emerging remedies to this challenge are the gene set enrichment tools. This study reports on GeneAnalytics™ (geneanalytics.genecards.org), a comprehensive and easy-to-apply gene set analysis tool for rapid contextualization of expression patterns and functional signatures embedded in the postgenomics Big Data domains, such as Next Generation Sequencing (NGS), RNAseq, and microarray experiments. GeneAnalytics' differentiating features include in-depth evidence-based scoring algorithms, an intuitive user interface and proprietary unified data. GeneAnalytics employs the LifeMap Science's GeneCards suite, including the GeneCards®—the human gene database; the MalaCards—the human diseases database; and the PathCards—the biological pathways database. Expression-based analysis in GeneAnalytics relies on the LifeMap Discovery®—the embryonic development and stem cells database, which includes manually curated expression data for normal and diseased tissues, enabling advanced matching algorithm for gene–tissue association. This assists in evaluating differentiation protocols and discovering biomarkers for tissues and cells. Results are directly linked to gene, disease, or cell “cards” in the GeneCards suite. Future developments aim to enhance the GeneAnalytics algorithm as well as visualizations, employing varied graphical display items. Such attributes make GeneAnalytics a broadly applicable postgenomics data analyses and interpretation tool for translation of data to knowledge-based innovation in various Big Data fields such as precision medicine, ecogenomics, nutrigenomics

  9. Molecular Identification and Sequencing of Mannose Binding Protein (MBP Gene of Acanthamoeba palestinensis

    Directory of Open Access Journals (Sweden)

    M Rezaeian

    2010-02-01

    Full Text Available "nBackground: Acanthamoeba keratitis develops by pathogenic Acanthamoeba such as A. pal­es­tinen­sis. Indeed this species is one of the known causative agents of amoebic keratitis in Iran. Mannose Binding Protein (MBP is the main pathogenicity factors for developing this sight threatening disease. We aimed to characterize MBP gene in pathogenic Acanthamoeba isolates such as A. palestinensis."nMethods: This experimental research was performed in the School of Public Health, Tehran University of Medical Sciences, Tehran, Iran during 2007-2008.  A. palestinensis was grown on 2% non-nutrient agar overlaid with Escherichia coli. DNA extraction was performed using phenol-chloroform method. PCR reaction and amplification were done using specific primer pairs of MBP. The amplified fragment were purified and sequenced. Finally, the obtained fragment was deposited in the gene data bank."nResults: A 900 bp PCR-product was recovered after PCR reaction. Sequence analysis of the purified PCR product revealed a gene with 943 nucleotides. Homology analysis of the ob­tained sequence showed 81% similarity with the available MBP gene in the gene data bank. The fragment was deposited in the gene data bank under accession number EU678895"nConclusion: MBP is known as the most important factor in Acanthamoeba pathogenesis cas­cade. Therefore, characterization of this gene can aid in developing better therapeutic agents and even immunization of high-risk people.

  10. Transcriptome sequencing uncovers the Avr5 avirulence gene of the tomato leaf mold pathogen Cladosporium fulvum.

    Science.gov (United States)

    Mesarich, Carl H; Griffiths, Scott A; van der Burgt, Ate; Okmen, Bilal; Beenen, Henriek G; Etalo, Desalegn W; Joosten, Matthieu H A J; de Wit, Pierre J G M

    2014-08-01

    The Cf-5 gene of tomato confers resistance to strains of the fungal pathogen Cladosporium fulvum carrying the avirulence gene Avr5. Although Cf-5 has been cloned, Avr5 has remained elusive. We report the cloning of Avr5 using a combined bioinformatic and transcriptome sequencing approach. RNA-Seq was performed on the sequenced race 0 strain (0WU; carrying Avr5), as well as a race 5 strain (IPO 1979; lacking a functional Avr5 gene) during infection of susceptible tomato. Forty-four in planta-induced C. fulvum candidate effector (CfCE) genes of 0WU were identified that putatively encode a secreted, small cysteine-rich protein. An expressed transcript sequence comparison between strains revealed two polymorphic CfCE genes in IPO 1979. One of these conferred avirulence to IPO 1979 on Cf-5 tomato following complementation with the corresponding 0WU allele, confirming identification of Avr5. Complementation also led to increased fungal biomass during infection of susceptible tomato, signifying a role for Avr5 in virulence. Seven of eight race 5 strains investigated escape Cf-5-mediated resistance through deletion of the Avr5 gene. Avr5 is heavily flanked by repetitive elements, suggesting that repeat instability, in combination with Cf-5-mediated selection pressure, has led to the emergence of race 5 strains deleted for the Avr5 gene.

  11. Identification, sequencing and structural analysis of a nifA-like gene of Acetobacter diazotrophicus.

    Science.gov (United States)

    Teixeira, K R; Morgan, T; Meletzus, D; Galler, R; Baldani, J I; Kennedy, C

    1999-01-01

    A recombinant plasmid, pAD101, containing a DNA fragment of Acetobacter diazotrophicus strain PAL5 was isolated by its ability to restore Nif+ phenotype to a nifA- ntrC- double mutant of Azotobacter vinelandii. Hybridization with the nifA genes of Azospirillum brasilense located the nifA gene more precisely to specific fragments of pAD101. DNA sequencing of appropriate subclones of pAD101 revealed that the nifA gene was adjacent to the nifB gene in A. diazotrophicus, and the 5' end of the nifB gene was located downstream of the nitrogenase MoFe subunit gene, nifK. The deduced aminoacid sequence of A. diazotrophicus nifA and nifB gene were most similar to the NifA and NifB proteins of Azorhizobium caulinodans and Rhodobacter capsulatus, respectively. In addition, nucleotide sequences upstream of the A. diazotrophicus nifA-encoding region indicate features similar to those in the A. caulinodans nifA promoter region involved in O2 and fixed N regulation of nifA expression. PMID:10530336

  12. p21WAF1/CIP1 gene DNA sequencing and its expression in human osteosarcoma

    Institute of Scientific and Technical Information of China (English)

    廖威明; 张春林; 李佛保; 曾炳芳; 曾益新

    2004-01-01

    Background Mutation and expression change of p21WAF1/CIP1 may play a role in the growth of osteosarcoma. This study was to investigate the expression of the p21WAF1/CIP1 gene in human osteosarcoma, p21WAF1/CIP1 gene DNA sequence change and their relationships with the phenotype and clinical prognosis.Methods p21WAF1/CIP1 gene in 10 normal people and the tumours of 45 osteosarcoma patients were examined using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) with silver staining. The PCR product with an abnormal strand was sequenced directly. The p21WAF1/CIP1 gene mRNA and P21 protein of 45 cases of osteosarcoma were investigated by using in situ hybridization and immunohistochemistry, respectively. Results The occurrence of P21 protein in osteosarcoma was 17.78% (8/45), and p21WAF1/CIP1 mRNA expression in osteosarcoma was 42.22% (19/45). The p21WAF1/CIP1 gene DNA sequencing of amplified production showed that in p21WAF1/CIP1 gene exon 3 of 36 cases of human osteosarcoma, there were 17 cases (47.22%) with C→T at position 609; 10 normal blood samples' DNA sequence analysis yielded 8 cases (80.00%) with C→T at the same position. Conclusions Along with the increase of malignancy, the expression of p21WAF1/CIP1mRNA and P21 protein in osteosarcoma tends to decrease. It is uncommon for the p21WAF1/CIP1 gene mutation to occur in human osteosarcoma. As a result, the possible existence of tumour subtypes of p21WAF1/CIP1 gene mutation should be investigated. Our research leads to the location of p21WAF1/CIP1 gene polymorphism of Chinese osteosarcoma patients, which can provide a basis for further research.

  13. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of Occidozyga martensii

    Indian Academy of Sciences (India)

    En Li; Xiaoqiang Li; Xiaobing Wu; Ge Feng; Man Zhang; Haitao Shi; Lijun Wang; Jianping Jiang

    2014-12-01

    In this study, the complete nucleotide sequence (18,321 bp) of the mitochondrial (mt) genome of the round-tongued floating frog, Occidozyga martensii was determined. Although, the base composition and codon usage of O. martensii conformed to the typical vertebrate patterns, this mt genome contained 23 tRNAs (a tandem duplication of tRNA-Met gene). The LTPF tRNA-gene cluster, and the derived position of the ND5 gene downstream of the control region, were present in this mitogenome. Moreover, we found that in the WANCY tRNA-gene cluster, the tRNA-Asn gene was located between the tRNA-Tyr and COI genes instead of between the tRNA-Ala and tRNA-Cys genes, which is a novel mtDNA gene rearrangement in vertebrates. Based on the concatenated nucleotide sequences of the 13 protein-coding genes, phylogenetic analysis (BI, ML, MP) was performed to further clarify the phylogenetic relations of this species within anurans.

  14. Next-generation sequencing approach for connecting secondary metabolites to biosynthetic gene clusters in fungi

    OpenAIRE

    Cacho, Ralph A.; Yi eTang; Yit-Heng eChooi

    2015-01-01

    Genomics has revolutionized the research on fungal secondary metabolite biosynthesis. To elucidate the molecular and enzymatic mechanisms underlying the biosynthesis of a specific secondary metabolite compound, the important first step is often to find the genes that responsible for its synthesis. The accessibility to fungal genome sequences allows the bypass of the cumbersome traditional library construction and screening approach. The advance in next-generation sequencing (NGS) technologies...

  15. Next-generation sequencing approach for connecting secondary metabolites to biosynthetic gene clusters in fungi

    OpenAIRE

    Cacho, Ralph A.; Tang, Yi; Chooi, Yit-Heng

    2015-01-01

    Genomics has revolutionized the research on fungal secondary metabolite (SM) biosynthesis. To elucidate the molecular and enzymatic mechanisms underlying the biosynthesis of a specific SM compound, the important first step is often to find the genes that responsible for its synthesis. The accessibility to fungal genome sequences allows the bypass of the cumbersome traditional library construction and screening approach. The advance in next-generation sequencing (NGS) technologies have further...

  16. Hunting down frame shifts: Ecological analysis of diverse functional gene sequences

    Directory of Open Access Journals (Sweden)

    Michal eStrejcek

    2015-11-01

    Full Text Available Functional gene ecological analyses using amplicon sequencing can be challenging as translated sequences are often burdened with shifted reading frames. The aim of this work was to evaluate several bioinformatics tools designed to correct errors which arise during sequencing in an effort to reduce the number of frame-shifts (FS. Genes encoding for alpha subunits of biphenyl (bphA and benzoate (benA dioxygenases were used as model sequences. FrameBot, a FS correction tool, was able to reduce the number of detected FS to zero. However, up to 43.1% of sequences were discarded by FrameBot as non-specific targets. Therefore, we proposed a de novo mode of FrameBot for FS correction, which works on a similar basis as common chimera identifying platforms and is not dependent on reference sequences. By nature of FrameBot de novo design, it is crucial to provide it with data as error free as possible. We tested the ability of several publicly available correction tools to decrease the number of errors in the data sets. The combination of Maximum Expected Error (MEE filtering and single linkage pre-clustering (SLP proved the most efficient read procession. Applying FrameBot de novo on the processed data enabled analysis of BphA sequences with minimal losses of potentially functional sequences not homologous to those previously known. This experiment also demonstrated the extensive diversity of dioxygenases in soil. A script which performs FrameBot de novo is presented in the supplementary material to the study and the tool was implemented into FunGene Pipeline available at http://fungene.cme.msu.edu/FunGenePipeline/ and https://github.com/rdpstaff/Framebot.

  17. Sequence Diversity and Genomic Organization of Vomeronasal Receptor Genes in the Mouse

    OpenAIRE

    Del Punta, Karina; Rothman, Andrea; Rodriguez, Ivan; Mombaerts, Peter

    2000-01-01

    The vomeronasal system of mice is thought to be specialized in the detection of pheromones. Two multigene families have been identified that encode proteins with seven putative transmembrane domains and that are expressed selectively in subsets of neurons of the vomeronasal organ. The products of these vomeronasal receptor (Vr) genes are regarded as candidate pheromone receptors. Little is known about their genomic organization and sequence diversity, and only five sequences of mouse V1r codi...

  18. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    International Nuclear Information System (INIS)

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of α1-antitrypsin and β- and δ-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10-9 substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes

  19. Soluble normal and mutated DNA sequences from single-copy genes in human blood.

    Science.gov (United States)

    Sorenson, G D; Pribish, D M; Valone, F H; Memoli, V A; Bzik, D J; Yao, S L

    1994-01-01

    Healthy individuals have soluble (extracellular) DNA in their blood, and increased amounts are present in cancer patients. Here we report the detection of specific sequences of the cystic fibrosis and K-ras genes in plasma DNA from normal donors by amplification with the polymerase chain reaction. In addition, mutated K-ras sequences are identified by polymerase chain reaction utilizing allele-specific primers in the plasma or serum from three patients with pancreatic carcinoma that contain mutated K-ras genes. The mutations are confirmed by direct sequencing. These results indicate that sequences of single-copy genes can be identified in normal plasma and that the sequences of mutated oncogenes can be detected and identified with allele-specific amplification by polymerase chain reaction in plasma or serum from patients with malignant tumors containing identical mutated genes. Mutated oncogenes in plasma and serum may represent tumor markers that could be useful for diagnosis, determining response to treatment, and predicting prognosis. PMID:8118388

  20. Analysis and comparison of fragrant gene sequence in some rice cultivars

    Directory of Open Access Journals (Sweden)

    Karami Noushafarin

    2016-01-01

    Full Text Available It is known that the fragrant trait in rice (Oryza sativa L. is largely controlled by fgr gene on chromosome 8 and it has been specified that the existence of an 8 bp deletion and three single nucleotide polymorphism (SNP in exon 7 is effective on this trait. In this study, sequence alignment analysis of fgr exon7 on chromosome 8 for 11 different fragrant and non-fragrant cultivars revealed that 5 aromatic rice cultivars carried 3 SNPs and 8 bp deletion in exon7 which terminates prematurely at a TAA stop codon. However, 5 of the non-aromatics showed a sequence identical to the published Nipponbare, being non-fragrant Japonica variety sequence. An exception among them was Bejar, which had 8 bp deletion and 3SNPs but it was non-aromatic. Sequencing can determine nucleotide alignment of a gene and give beneficial information about gene function. In silico prediction showed proteins sequences alignment of fgr gene for Khazar and Domsiah genotypes were different. Betaine aldehyde dehydrogenase complete enzyme belongs to Khazar non-fragrant genotype that has complete length and 503 amino acids while non-functional BADH2 enzyme for Domsiah fragrant genotype has 251 amino acids that result in accumulate 2-acetyl-1-pyrroline (2AP and produces aroma in fragrant genotypes.

  1. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  2. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Science.gov (United States)

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  3. Nucleotide sequence of the gene for the b subunit of human factor XIII

    Energy Technology Data Exchange (ETDEWEB)

    Bottenus, R.E.; Ichinose, A.; Davie, E.W. (Univ. of Washington, Seattle (USA))

    1990-12-01

    Factor XIII (M{sub r} 320 000) is a blood coagulation factor that stabilizes and strengthens the fibrin clot. It circulates in blood as a tetramer composed of two a subunits (M{sub r} 75 000 each) and two b subunits (M{sub r} 80 000 each). The b subunit consists of 641 amino acids and includes 10 tandem repeats of 60 amino acids known as GP-I structures, short consensus repeats (SCR), or sushi domains. In the present study, the human gene for the b subunit has been isolated from three different genomic libraries prepared in {lambda} phage. Fifteen independent phage with inserts coding for the entire gene were isolated and characterized by restriction mapping, Southern blotting, and DNA sequencing. The gene was found to be 28 kilobases in length and consisted of 12 exons (I-XII) separated by 11 intervening sequences. The leader sequence was encoded by exon I, while the carbonyl-terminal region of the protein was encoded by exon XII. Exons II-XI each coded for a single sushi domain, suggesting that the gene evolved through exon shuffling and duplication. The 12 exons in the gene ranged in size from 64 to 222 base pairs, while the introns ranged in size from 87 to 9970 nucleotides and made up 92{percent} of the gene. One nucleotide change was found in the coding region of the gene when its sequence was compared to that of the cDNA. This difference, however, did not result in a change in the amino acid sequence of the protein.

  4. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Science.gov (United States)

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  5. Molecular genotyping of human Ureaplasma species based on multiple-banded antigen (MBA) gene sequences.

    Science.gov (United States)

    Kong, F; Ma, Z; James, G; Gordon, S; Gilbert, G L

    2000-09-01

    Ureaplasma urealyticum has been divided into 14 serovars. Recently, subdivision of U. urealyticum into two species has been proposed: U. parvum (previously U. urealyticum parvo biovar), comprising four serovars (1, 3, 6, 14) and U. urealyticum (previously U. urealyticum T-960 biovar), 10 serovars (2, 4, 5, 7-13). The multiple-banded antigen (MBA) genes of these species contain both species and serovar/subtype specific sequences. Based on whole sequences of the 5'-ends of MBA genes of U. parvum serovars and partial sequences of the 5'-ends of MBA genes of U. urealyticum serovars, we previously divided each of these species into three MBA genotypes. To further elucidate the relationships between serovars, we sequenced the whole 5'-ends of MBA genes of all 10 U. urealyticum serovars and partial repetitive regions of these genes from all serovars of U. parvum and U. urealyticum. For the first time, all four serovars of U. parvum were clearly differentiated from each other. In addition, the 10 serovars of U. urealyticum were divided into five MBA genotypes, as follows: MBA genotype A comprises serovars 2, 5, 8; MBA genotype B, serovar 10 only; MBA genotype C, serovars 4, 12, 13; MBA genotype D, serovar 9 only; and MBA genotype E comprises serovars 7 and 11. There were no sequence differences between members within each MBA genotype. Further work is required to identify other genes or other regions of the MBA genes that may be used to differentiate U. urealyticum serovars within MBA genotypes A, C and E. A better understanding of the molecular basis of serotype differentiation will help to improve subtyping methods for use in studies of the pathogenesis and epidemiology of these organisms.

  6. Sequence of the PV2 gene of rice hoja blanca tenuivirus RNA-2.

    Science.gov (United States)

    De Miranda, J R; Hull, R; Espinoza, A M

    1995-01-01

    Comparison of a partial sequence of rice hoja blanca tenuivirus RNA-2 with 40% similarity to rice stripe tenuivirus RNA-2 revealed regions of high local sequence homology at the 5' terminus, within the coding region (the pv2 gene), and in the intergenic region separating this gene from the other protein (pc2) encoded by this ambisense RNA. Analysis of the conserved regions of the pv2 protein identified two motifs found principally in viral membrane glycoproteins and six motifs found each in a wide variety of proteins. The possible significance of these results is discussed. PMID:8560781

  7. Sequencing of 16S rRNA Gene: A Rapid Tool for Identification of Bacillus anthracis

    OpenAIRE

    Sacchi, Claudio T.; Whitney, Anne M.; Mayer, Leonard W.; Morey, Roger; Steigerwalt, Arnold; Boras, Ariana; Weyant, Robin S.; Popovic, Tanja

    2002-01-01

    In a bioterrorism event, a tool is needed to rapidly differentiate Bacillus anthracis from other closely related spore-forming Bacillus species. During the recent outbreak of bioterrorism-associated anthrax, we sequenced the 16S rRNA generom these species to evaluate the potential of 16S rRNA gene sequencing as a diagnostic tool. We found eight distinct 16S types among all 107 16S rRNA gene seqs fuences that differed from each other at 1 to 8 positions (0.06% to 0.5%). All 86 B. anthracis had...

  8. Isolation, sequencing and overexpression of the gene encoding the theta subunit of DNA polymerase III holoenzyme.

    OpenAIRE

    J.R. Carter; Franden, M A; Aebersold, R.; Kim, D.R.; McHenry, C S

    1993-01-01

    The gene encoding the theta subunit of DNA polymerase III holoenzyme, designated holE, was isolated using a strategy in which peptide sequence was used to derive a DNA hybridization probe. Sequencing of the gene, which maps to 41.43 centisomes of the chromosome, revealed a 76-codon open reading frame predicted to produce a protein of 8,846 Da. When placed in a tac promoter expression vector, the open reading frame directed expression of a protein, that comigrated with authentic theta subunit ...

  9. In-depth cDNA Library Sequencing Provides Quantitative Gene Expression Profiling in Cancer Biomarker Discovery

    Institute of Scientific and Technical Information of China (English)

    Wanling Yang; Dingge Ying; Yu-Lung Lau

    2009-01-01

    procedures may allow detection of many expres-sion features for less abundant gene variants. With the reduction of sequencing cost and the emerging of new generation sequencing technology, in-depth sequencing of cDNA pools or libraries may represent a better and powerful tool in gene expression profiling and cancer biomarker detection. We also propose using sequence-specific subtraction to remove hundreds of the most abundant housekeeping genes to in-crease sequencing depth without affecting relative expression ratio of other genes, as transcripts from as few as 300 most abundantly expressed genes constitute about 20% of the total transcriptome. In-depth sequencing also represents a unique ad-vantage of detecting unknown forms of transcripts, such as alternative splicing variants, fusion genes, and regulatory RNAs, as well as detecting mutations and polymorphisms that may play important roles in disease pathogenesis.

  10. Cloning and sequencing of cagA gene fragment of Helicobacter pylori with coccoid form

    Institute of Scientific and Technical Information of China (English)

    Ke-Xia Wang; Xue-Feng Wang

    2004-01-01

    AIM: To clone and sequence the cagA gene fragment of Helicobacter pylori ( H pylori) with coccoid form.METHODS: H pylori strain NCTC11637 were transformed to coccoid form by exposure to antibiotics in subinhibitory concentrations. The coccoid H pyloriwas collected. cagA gene of the coccoid H pylori strain was amplified by PCR.After purified, the target fragment was cloned into plasmid pMD-18T. The recombinant plasmid pMD-18T-cagA was transformed into E. coli JM109. Positive clones were screened and identified by PCR and digestion with restriction endonucleases. The sequence of inserted fragment was then analysed.RESULTS: cagA gene of 3 444 bp was obtained from the coccoid H pylori genome DNA. The recombinant plasmid pMD-18T-cagA was constructed, then it was digested by BamH Ⅰ+Sac Ⅰ, and the product of digestion was identical with the predicted one. Sequence analysis showed that the homology of coccoid and the reported original sequence H pylori was 99.7%.CONCLUSION: The recombinant plasmid containing cagA gene from coccoid H pylori has been constructed successfully.The coccoid H pylori contain completed cagA gene, which may be related to pathogenicity of them.

  11. POLYMORPHISM IN THE CODING REGION SEQUENCE OF GDF8 GENE IN INDIAN SHEEP.

    Science.gov (United States)

    Pothuraju, M; Mishra, S K; Kumar, S N; Mohamed, N F; Kataria, R S; Yadav, D K; Arora, R

    2015-11-01

    The present study was undertaken to identify polymorphism in the coding sequence of GDF8gene across indigenous meat type sheep breeds. A 1647 bp sequence was generated, encompassing 208 bp of the 5'UTR, 1128 bp of coding region (exon1, 2 and 3) as well as 311 bp of 3'UTR. The sheep and goat GDF8 gene sequences were observed to be highly conserved as compared to cattle, buffalo, horse and pig. Several nucleotide variations were observed across coding sequence of GDF8 gene in Indian sheep. Three polymorphic sites were identified in the 5'UTR, one in exon 1 and one in the exon 2 regions. Both SNPs in the exonic region were found to be non-synonymous. The mutations c.539T > G and c.821T > A discovered in this study in the exon 1 and exon 2, respectively, have not been previously reported. The information generated provides preliminary indication of the functional diversity present in Indian sheep at the coding region of GDF8gene. The novel as well as the previously reported SNPs discovered in the Indian sheep warrant further analysis to see whether they affect the phenotype. Future studies will need to establish the affect of reported SNPs in the expression of the GDF8 gene in Indian sheep population. PMID:26845859

  12. Sequence Comparison of Partial Cytochrome b Genes of Two Coilia species

    Institute of Scientific and Technical Information of China (English)

    LIU Jinxian; GAO Tianxiang; WANG Yujiang; ZHANG Yaping

    2005-01-01

    Sequence variation of partial cytochrome b genes between two Coilia species, C. ectenes and C. mystus, was investigated. Of the 402 nucleotides, twenty-seven (6.72%) are polymorphic and all are synonymous substitutions. At the third positions of genetic condon of cytochrome b gene, the two species show an extreme anti-G bias (< 4 % ) and a pronounced bias towards A and C (>68%). There is no amino acid sequence divergence between the partial cytochrome b genes of the two species, indicating a close genetic relationship between them. The k-2p genetic distance of partial cytochrome b segment of the two species is 0.072, suggesting that the species were separated 3.6 Ma ago, in the middle Pliocene. Our result reveals that the cytochrome b gene is an appropriate marker for studies of population genetic structures and phylogeographic patterns of the two species.

  13. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  14. Discovery of sequence motifs related to coexpression of genes using evolutionary computation

    Science.gov (United States)

    Fogel, Gary B.; Weekes, Dana G.; Varga, Gabor; Dow, Ernst R.; Harlow, Harry B.; Onyia, Jude E.; Su, Chen

    2004-01-01

    Transcription factors are key regulatory elements that control gene expression. Recognition of transcription factor binding site (TFBS) motifs in the upstream region of coexpressed genes is therefore critical towards a true understanding of the regulations of gene expression. The task of discovering eukaryotic TFBSs remains a challenging problem. Here, we demonstrate that evolutionary computation can be used to search for TFBSs in upstream regions of genes known to be coexpressed. Evolutionary computation was used to search for TFBSs of genes regulated by octamer-binding factor and nuclear factor kappa B. The discovered binding sites included experimentally determined known binding motifs as well as lists of putative, previously unknown TFBSs. We believe that this method to search nucleotide sequence information efficiently for similar motifs will be useful for discovering TFBSs that affect gene regulation. PMID:15266008

  15. Biologic: Gene circuits and feedback in an introductory physics sequence for biology and premedical students

    CERN Document Server

    Cahn, S B

    2013-01-01

    Two synthetic gene circuits -- the genetic toggle switch and the repressilator -- are analyzed quantitatively and discussed in the context of an educational module on gene circuits and feedback that constitutes the final topic of a year-long introductory physics sequence, aimed at biology and premedical undergraduate students. The genetic toggle switch consists of two genes, each of whose protein product represses the other's expression, while the repressilator consists of three genes, each of whose protein product represses the next gene's expression. Analytic, numerical, and electronic treatments of the genetic toggle switch shows that this gene circuit realizes bistability. A simplified treatment of the repressilator reveals that this circuit can realize sustained oscillations. In both cases, a "phase diagram" is obtained, that specifies the region of parameter space in which bistability or oscillatory behavior, respectively, occurs.

  16. Defining the minimal length of sequence homology required for selective gene isolation by TAR cloning

    OpenAIRE

    Noskov, V. N.; Koriabine, M.; Solomon, G.; Randolph, M; Barrett, J C; Leem, S.-H.; Stubbs, L; Kouprina, N; Larionov, V.

    2001-01-01

    The transformation-associated recombination (TAR) cloning technique allows selective and accurate isolation of chromosomal regions and genes from complex genomes. The technique is based on in vivo recombination between genomic DNA and a linearized vector containing homologous sequences, or hooks, to the gene of interest. The recombination occurs during transformation of yeast spheroplasts that results in the generation of a yeast artificial chromosome (YAC) contain...

  17. SeqGene: a comprehensive software solution for mining exome- and transcriptome- sequencing data

    OpenAIRE

    Deng Xutao

    2011-01-01

    Abstract Background The popularity of massively parallel exome and transcriptome sequencing projects demands new data mining tools with a comprehensive set of features to support a wide range of analysis tasks. Results SeqGene, a new data mining tool, supports mutation detection and annotation, dbSNP and 1000 Genome data integration, RNA-Seq expression quantification, mutation and coverage visualization, allele specific expression (ASE), differentially expressed genes (DEGs) identification, c...

  18. Sequences of the coat protein gene from brazilian isolates of Papaya ringspot virus

    OpenAIRE

    LIMA ROBERTO C. A.; SOUZA JR. MANOEL T.; PIO-RIBEIRO GILVAN; LIMA J. ALBERSIO A.

    2002-01-01

    Papaya ringspot virus (PRSV) is the causal agent of the main papaya (Carica papaya) disease in the world. Brazil is currently the world's main papaya grower, responsible for about 40% of the worldwide production. Resistance to PRSV on transgenic plants expressing the PRSV coat protein (cp) gene was shown to be dependent on the sequence homology between the cp transgene expressed in the plant genome and the cp gene from the incoming virus, in an isolate-specific fashion. Therefore, knowledge o...

  19. The Genome Sequence of Leishmania (Leishmania) amazonensis: Functional Annotation and Extended Analysis of Gene Models

    OpenAIRE

    Real, Fernando; Vidal, Ramon Oliveira; Carazzolle, Marcelo Falsarella; Mondego, Jorge Maurício Costa; Costa, Gustavo Gilson Lacerda; Herai, Roberto Hirochi; Würtele, Martin; de Carvalho, Lucas Miguel; e Ferreira, Renata Carmona; Mortara, Renato Arruda; Barbiéri, Clara Lucia; Mieczkowski, Piotr; da Silveira, José Franco; Briones, Marcelo Ribeiro da Silva; Pereira, Gonçalo Amarante Guimarães

    2013-01-01

    We present the sequencing and annotation of the Leishmania (Leishmania) amazonensis genome, an etiological agent of human cutaneous leishmaniasis in the Amazon region of Brazil. L. (L.) amazonensis shares features with Leishmania (L.) mexicana but also exhibits unique characteristics regarding geographical distribution and clinical manifestations of cutaneous lesions (e.g. borderline disseminated cutaneous leishmaniasis). Predicted genes were scored for orthologous gene families and conserved...

  20. Local synteny and codon usage contribute to asymmetric sequence divergence of Saccharomyces cerevisiae gene duplicates

    Directory of Open Access Journals (Sweden)

    Bergthorsson Ulfar

    2011-09-01

    Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.

  1. Cloning, Sequencing, and Disruption of the Bacillus subtilis psd Gene Coding for Phosphatidylserine Decarboxylase

    OpenAIRE

    Matsumoto, Kouji; Okada, Masahiro; Horikoshi, Yuko; Matsuzaki, Hiroshi; Kishi, Tsutomu; Itaya, Mitsuhiro; Shibuya, Isao

    1998-01-01

    The psd gene of Bacillus subtilis Marburg, encoding phosphatidylserine decarboxylase, has been cloned and sequenced. It encodes a polypeptide of 263 amino acid residues (deduced molecular weight of 29,689) and is located just downstream of pss, the structural gene for phosphatidylserine synthase that catalyzes the preceding reaction in phosphatidylethanolamine synthesis (M. Okada, H. Matsuzaki, I. Shibuya, and K. Matsumoto, J. Bacteriol. 176:7456–7461, 1994). Introduction of a plasmid contain...

  2. Nucleotide sequence and taxonomical distribution of the bacteriocin gene lin cloned from Brevibacterium linens M18.

    OpenAIRE

    Valdes-Stauber, N; Scherer, S

    1996-01-01

    Linocin M18 is an antilisterial bacteriocin produced by the red smear cheese bacterium Brevibacterium linens M18. Oligonucleotide probes based on the N-terminal amino acid sequence were used to locate its single copy gene, lin, on the chromosomal DNA. The amino acid composition, N-terminal sequence, and molecular mass derived from the nucleotide sequence of an open reading frame of 798 nucleotides coding for 266 amino acids found on a 3-kb BamHI restriction fragment correspond closely to thos...

  3. Cloning, sequence analysis, and expression of the genes encoding lytic functions of Bacteriophage Fg1e

    OpenAIRE

    OKI, Masaya; Kakikawa, Makiko; Yamada, Kazuyo; Taketo, Akira; KODAIRA, Ken-Ichi

    1996-01-01

    The lysis genes of a Lactobacillus phage Fgle were cloned, sequenced, and expressed in Escherichia coli. Nucleotide sequencing of a 3813-bp Fgle DNA revealed five successive open reading frames (ORF), Rorf50, Rorf118, hol, and lys and Rorf175, in the same DNA strand. By comparative analysis of the DNA sequence, the putative hol product (holin) has an estimated molecular weight is 14.2 kDa, and contains two potential transmembrane helices and highly charged N- and C-termini, resembling predict...

  4. Cloning and sequencing of the ferredoxin gene of blue-green alga Anabaena siamensis

    Science.gov (United States)

    Li, Shou-Dong; Song, Li-Rong; Liu, Yong-Ding; Zhao, Jin-Dong

    1998-03-01

    The structure gene for ferredoxin, petFI, from Anabaena siamensis has been amplified by polymerase chain reaction(PCR) and cloned into cloning vector pGEM-3zf(+). The nucleotide sequence of petFI has been determined with silver staining sequencing method. There is 96.8% homology between coding region of petFI from A. siamensis and that of petFI from A. sp. 7120. Amino acid sequences of seven strains of blue-green algae are compared.

  5. Cloning and Sequence Analysis on 3' Coding Region of Wild Boar and Cross Bred Pig Myostatin Gene

    Institute of Scientific and Technical Information of China (English)

    LIU Di; YANG Xiu-qin; YANG Jia-fang

    2004-01-01

    Myostatin, with a highly conservative gene among breeds is a negative regulator of muscle. The 3' coding regions of wild boar and crossbred pig myostatin were cloned by RT-PCR and sequenced respectively. The homology of the nucleotide sequence between wild boar and crossbred pig was 100% and there was no difference in this region compared with pig myostatin gene of Genbank. This indicated that there was not change of gene sequence in this region during the evolution processes.

  6. Molecular cloning and long terminal repeat sequences of human endogenous retrovirus genes related to types A and B retrovirus genes

    Energy Technology Data Exchange (ETDEWEB)

    Ono, M.

    1986-06-01

    By using a DNA fragment primarily encoding the reverse transcriptase (pol) region of the Syrian hamster intracisternal A particle (IAP; type A retrovirus) gene as a probe, human endogenous retrovirus genes, tentatively termed HERV-K genes, were cloned from a fetal human liver gene library. Typical HERV-K genes were 9.1 or 9.4 kilobases in length, having long terminal repeats (LTRs) of ca. 970 base pairs. Many structural features commonly observed on the retrovirus LTRs, such as the TATAA box, polyadenylation signal, and terminal inverted repeats, were present on each LTR, and a lysine (K) tRNA having a CUU anticodon was identified as a presumed primer tRNA. The HERV-K LTR, however, had little sequence homology to either the IAP LTR or other typical oncovirus LTRs. By filter hybridization, the number of HERV-K genes was estimated to be ca. 50 copies per haploid human genome. The cloned mouse mammary tumor virus (type B) gene was found to hybridize with both the HERV-K and IAP genes to essentially the same extent.

  7. WebScipio: An online tool for the determination of gene structures using protein sequences

    Directory of Open Access Journals (Sweden)

    Waack Stephan

    2008-09-01

    Full Text Available Abstract Background Obtaining the gene structure for a given protein encoding gene is an important step in many analyses. A software suited for this task should be readily accessible, accurate, easy to handle and should provide the user with a coherent representation of the most probable gene structure. It should be rigorous enough to optimise features on the level of single bases and at the same time flexible enough to allow for cross-species searches. Results WebScipio, a web interface to the Scipio software, allows a user to obtain the corresponding coding sequence structure of a here given a query protein sequence that belongs to an already assembled eukaryotic genome. The resulting gene structure is presented in various human readable formats like a schematic representation, and a detailed alignment of the query and the target sequence highlighting any discrepancies. WebScipio can also be used to identify and characterise the gene structures of homologs in related organisms. In addition, it offers a web service for integration with other programs. Conclusion WebScipio is a tool that allows users to get a high-quality gene structure prediction from a protein query. It offers more than 250 eukaryotic genomes that can be searched and produces predictions that are close to what can be achieved by manual annotation, for in-species and cross-species searches alike. WebScipio is freely accessible at http://www.webscipio.org.

  8. Sequence evolution and expression regulation of stress-responsive genes in natural populations of wild tomato.

    Directory of Open Access Journals (Sweden)

    Iris Fischer

    Full Text Available The wild tomato species Solanum chilense and S. peruvianum are a valuable non-model system for studying plant adaptation since they grow in diverse environments facing many abiotic constraints. Here we investigate the sequence evolution of regulatory regions of drought and cold responsive genes and their expression regulation. The coding regions of these genes were previously shown to exhibit signatures of positive selection. Expression profiles and sequence evolution of regulatory regions of members of the Asr (ABA/water stress/ripening induced gene family and the dehydrin gene pLC30-15 were analyzed in wild tomato populations from contrasting environments. For S. chilense, we found that Asr4 and pLC30-15 appear to respond much faster to drought conditions in accessions from very dry environments than accessions from more mesic locations. Sequence analysis suggests that the promoter of Asr2 and the downstream region of pLC30-15 are under positive selection in some local populations of S. chilense. By investigating gene expression differences at the population level we provide further support of our previous conclusions that Asr2, Asr4, and pLC30-15 are promising candidates for functional studies of adaptation. Our analysis also demonstrates the power of the candidate gene approach in evolutionary biology research and highlights the importance of wild Solanum species as a genetic resource for their cultivated relatives.

  9. Transcriptome sequencing and expression analysis of terpenoid biosynthesis genes in Litsea cubeba.

    Directory of Open Access Journals (Sweden)

    Xiao-Jiao Han

    Full Text Available BACKGROUND: Aromatic essential oils extracted from fresh fruits of Litsea cubeba (Lour. Pers., have diverse medical and economic values. The dominant components in these essential oils are monoterpenes and sesquiterpenes. Understanding the molecular mechanisms of terpenoid biosynthesis is essential for improving the yield and quality of terpenes. However, the 40 available L. cubeba nucleotide sequences in the public databases are insufficient for studying the molecular mechanisms. Thus, high-throughput transcriptome sequencing of L. cubeba is necessary to generate large quantities of transcript sequences for the purpose of gene discovery, especially terpenoid biosynthesis related genes. RESULTS: Using Illumina paired-end sequencing, approximately 23.5 million high-quality reads were generated. De novo assembly yielded 68,648 unigenes with an average length of 834 bp. A total of 38,439 (56% unigenes were annotated for their functions, and 35,732 and 25,806 unigenes could be aligned to the GO and COG database, respectively. By searching against the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG, 16,130 unigenes were assigned to 297 KEGG pathways, and 61 unigenes, which contained the mevalonate and 2-C-methyl-D-erythritol 4-phosphate pathways, could be related to terpenoid backbone biosynthesis. Of the 12,963 unigenes, 285 were annotated to the terpenoid pathways using the PlantCyc database. Additionally, 14 terpene synthase genes were identified from the transcriptome. The expression patterns of the 16 genes related to terpenoid biosynthesis were analyzed by RT-qPCR to explore their putative functions. CONCLUSION: RNA sequencing was effective in identifying a large quantity of sequence information. To our knowledge, this study is the first exploration of the L. cubeba transcriptome, and the substantial amount of transcripts obtained will accelerate the understanding of the molecular mechanisms of essential oils biosynthesis. The

  10. Isolation and characterisation of the Xenopus laevis albumin genes: loss of 74K albumin gene sequences by library amplification.

    OpenAIRE

    May, F E; Weber, R.; Westley, B. R.

    1982-01-01

    The blood of the frog X.laevis contains 2 albumins of 68,000 and 74,000 daltons which are encoded in the liver by two related mRNAs. When an amplified X.laevis DNA library was screened with cloned albumin cDNA only 68,000 dalton albumin gene sequences were isolated. Hybridisation of the albumin cDNA to Southern-blots of Eco R1 digested X.laevis DNA showed that the sequences present in the recombinants did not account for all the fragments which hybridised on the Southern-blots. This indicated...

  11. Discovery of clubroot-resistant genes in Brassica napus by transcriptome sequencing.

    Science.gov (United States)

    Chen, S W; Liu, T; Gao, Y; Zhang, C; Peng, S D; Bai, M B; Li, S J; Xu, L; Zhou, X Y; Lin, L B

    2016-01-01

    Clubroot significantly affects plants of the Brassicaceae family and is one of the main diseases causing serious losses in B. napus yield. Few studies have investigated the clubroot-resistance mechanism in B. napus. Identification of clubroot-resistant genes may be used in clubroot-resistant breeding, as well as to elucidate the molecular mechanism behind B. napus clubroot-resistance. We used three B. napus transcriptome samples to construct a transcriptome sequencing library by using Illumina HiSeq™ 2000 sequencing and bioinformatic analysis. In total, 171 million high-quality reads were obtained, containing 96,149 unigenes of N50-value. We aligned the obtained unigenes with the Nr, Swiss-Prot, clusters of orthologous groups, and gene ontology databases and annotated their functions. In the Kyoto encyclopedia of genes and genomes database, 25,033 unigenes (26.04%) were assigned to 124 pathways. Many genes, including broad-spectrum disease-resistance genes, specific clubroot-resistant genes, and genes related to indole-3-acetic acid (IAA) signal transduction, cytokinin synthesis, and myrosinase synthesis in the Huashuang 3 variety of B. napus were found to be related to clubroot-resistance. The effective clubroot-resistance observed in this variety may be due to the induced increased expression of these disease-resistant genes and strong inhibition of the IAA signal transduction, cytokinin synthesis, and myrosinase synthesis. The homology observed between unigenes 0048482, 0061770 and the Crr1 gene shared 94% nucleotide similarity. Furthermore, unigene 0061770 could have originated from an inversion of the Crr1 5'-end sequence. PMID:27525940

  12. Discovery of clubroot-resistant genes in Brassica napus by transcriptome sequencing.

    Science.gov (United States)

    Chen, S W; Liu, T; Gao, Y; Zhang, C; Peng, S D; Bai, M B; Li, S J; Xu, L; Zhou, X Y; Lin, L B

    2016-01-01

    Clubroot significantly affects plants of the Brassicaceae family and is one of the main diseases causing serious losses in B. napus yield. Few studies have investigated the clubroot-resistance mechanism in B. napus. Identification of clubroot-resistant genes may be used in clubroot-resistant breeding, as well as to elucidate the molecular mechanism behind B. napus clubroot-resistance. We used three B. napus transcriptome samples to construct a transcriptome sequencing library by using Illumina HiSeq™ 2000 sequencing and bioinformatic analysis. In total, 171 million high-quality reads were obtained, containing 96,149 unigenes of N50-value. We aligned the obtained unigenes with the Nr, Swiss-Prot, clusters of orthologous groups, and gene ontology databases and annotated their functions. In the Kyoto encyclopedia of genes and genomes database, 25,033 unigenes (26.04%) were assigned to 124 pathways. Many genes, including broad-spectrum disease-resistance genes, specific clubroot-resistant genes, and genes related to indole-3-acetic acid (IAA) signal transduction, cytokinin synthesis, and myrosinase synthesis in the Huashuang 3 variety of B. napus were found to be related to clubroot-resistance. The effective clubroot-resistance observed in this variety may be due to the induced increased expression of these disease-resistant genes and strong inhibition of the IAA signal transduction, cytokinin synthesis, and myrosinase synthesis. The homology observed between unigenes 0048482, 0061770 and the Crr1 gene shared 94% nucleotide similarity. Furthermore, unigene 0061770 could have originated from an inversion of the Crr1 5'-end sequence.

  13. Nucleotide sequence of the Syrian hamster intracisternal A-particle gene: close evolutionary relationship of type A particle gene to types B and D oncovirus genes.

    Science.gov (United States)

    Ono, M; Toh, H; Miyata, T; Awaya, T

    1985-08-01

    We determined the complete nucleotide sequence of the intracisternal A-particle gene, IAP-H18, cloned from the normal Syrian hamster liver DNA. IAP-H18 was 7,951 base pairs in length with two identical long terminal repeats of 376 base pairs at both ends. On the coding strand, imperfect open reading frames corresponding to gag and pol of the retrovirus genome were observed, whereas many stop codons were present in the region corresponding to env. The putative H18 gag gene (809 amino acids) had a sequence homologous to the N-terminal half of the mouse mammary tumor virus gag gene and locally to the Rous sarcoma virus gag gene. The putative H18 pol gene (900 residues) was homologous to the Rous sarcoma virus pol gene almost throughout the entire region. Two conserved regions among the retrovirus pol genes have been reported. One presumably corresponds to the DNA polymerase and the RNase H domain, and the other corresponds to the DNA endonuclease domain of the multifunctional protein pol. By the comparison of the deduced amino acid sequences of the putative endonuclease domain of six representative oncovirus genomes, a phylogenetic tree of the oncovirus genomes was constructed, and the intracisternal A-particle (type A) genome was found to be more closely related to the mouse mammary tumor virus (type B) and squirrel monkey retrovirus (type D) genomes.

  14. De Novo Transcriptome Sequencing of Oryza officinalis Wall ex Watt to Identify Disease-Resistance Genes

    Directory of Open Access Journals (Sweden)

    Bin He

    2015-12-01

    Full Text Available Oryza officinalis Wall ex Watt is one of the most important wild relatives of cultivated rice and exhibits high resistance to many diseases. It has been used as a source of genes for introgression into cultivated rice. However, there are limited genomic resources and little genetic information publicly reported for this species. To better understand the pathways and factors involved in disease resistance and accelerating the process of rice breeding, we carried out a de novo transcriptome sequencing of O. officinalis. In this research, 137,229 contigs were obtained ranging from 200 to 19,214 bp with an N50 of 2331 bp through de novo assembly of leaves, stems and roots in O. officinalis using an Illumina HiSeq 2000 platform. Based on sequence similarity searches against a non-redundant protein database, a total of 88,249 contigs were annotated with gene descriptions and 75,589 transcripts were further assigned to GO terms. Candidate genes for plant–pathogen interaction and plant hormones regulation pathways involved in disease-resistance were identified. Further analyses of gene expression profiles showed that the majority of genes related to disease resistance were all expressed in the three tissues. In addition, there are two kinds of rice bacterial blight-resistant genes in O. officinalis, including two Xa1 genes and three Xa26 genes. All 2 Xa1 genes showed the highest expression level in stem, whereas one of Xa26 was expressed dominantly in leaf and other 2 Xa26 genes displayed low expression level in all three tissues. This transcriptomic database provides an opportunity for identifying the genes involved in disease-resistance and will provide a basis for studying functional genomics of O. officinalis and genetic improvement of cultivated rice in the future.

  15. Structural features of conopeptide genes inferred from partial sequences of the Conus tribblei genome.

    Science.gov (United States)

    Barghi, Neda; Concepcion, Gisela P; Olivera, Baldomero M; Lluisma, Arturo O

    2016-02-01

    The evolvability of venom components (in particular, the gene-encoded peptide toxins) in venomous species serves as an adaptive strategy allowing them to target new prey types or respond to changes in the prey field. The structure, organization, and expression of the venom peptide genes may provide insights into the molecular mechanisms that drive the evolution of such genes. Conus is a particularly interesting group given the high chemical diversity of their venom peptides, and the rapid evolution of the conopeptide-encoding genes. Conus genomes, however, are large and characterized by a high proportion of repetitive sequences. As a result, the structure and organization of conopeptide genes have remained poorly known. In this study, a survey of the genome of Conus tribblei was undertaken to address this gap. A partial assembly of C. tribblei genome was generated; the assembly, though consisting of a large number of fragments, accounted for 2160.5 Mb of sequence. A large number of repetitive genomic elements consisting of 642.6 Mb of retrotransposable elements, simple repeats, and novel interspersed repeats were observed. We characterized the structural organization and distribution of conotoxin genes in the genome. A significant number of conopeptide genes (estimated to be between 148 and 193) belonging to different superfamilies with complete or nearly complete exon regions were observed, ~60 % of which were expressed. The unexpressed conopeptide genes represent hidden but significant conotoxin diversity. The conotoxin genes also differed in the frequency and length of the introns. The interruption of exons by long introns in the conopeptide genes and the presence of repeats in the introns may indicate the importance of introns in facilitating recombination, evolution and diversification of conotoxins. These findings advance our understanding of the structural framework that promotes the gene-level molecular evolution of venom peptides.

  16. Dose-sensitivity, conserved noncoding sequences and duplicate gene retention through multiple tetraploidies in the grasses.

    Directory of Open Access Journals (Sweden)

    James C Schnable

    2011-03-01

    Full Text Available Whole genome duplications, or tetraplodies, are an important source of increased gene content. Following whole genome duplication, duplicate copies of many genes are lost from the genome. This loss of genes is biased both in the classes of genes deleted and the subgenome from which they are lost. Many or all classes are genes preferentially retained as duplicate copies are engaged in dose sensitive protein-protein interactions, such that deletion of any one duplicate upsets the status quo of subunit concentrations, and presumably lowers fitness as a result. Transcription factors are also preferentially retained following every whole genome duplications studied. This has been explained as a consequence of protein-protein interactions, just as for other highly retained classes of genes. We show that the quantity of conserved non-coding sequences (CNSs associated with genes predicts the likelyhood of their retention as duplicate pairs following whole genome duplication. As many CNSs likely represent binding sites for transcriptional regulators, we propose that the likelyhood of gene retention following tetraploidy may also be influenced by dose-sensitive protein-DNA interactions between the regulatory regions of CNS-rich genes -- nicknamed "bigfoot genes" – and the proteins that bind to them. Using grass genomes, we show that differential loss of CNSs from one member of a pair following the pregrass tetraploidy reduces its chance of retention in the subsequent maize-lineage tetraploidy.

  17. Molecular cloning of gyrA and gyrB genes of mycobacterium tuberculosis: analysis of nucleotide sequence

    OpenAIRE

    Madhusudan, K.; Ramesh, V.; Nagaraja, V

    1994-01-01

    We have recently reported the cloning of gyrA and gyrB genes from Mycobacterium tuberculosis H37Ra [Curr. Science, (1994) 66, 664-667). Here, we present the complete nucleotide sequence of gyrB gene from M.tuberculosis H37Ra along with the flanking regions. The gyrA gene has been located 34 nucleotides downstream of gyrB and has been partially sequenced; both the genes seem to be transcribed from the promoter elements located upstream of gyrB coding sequence. The gyrB gene encodes a polypepti...

  18. Distribution of Genes and Repetitive Elements in the Diabrotica virgifera virgifera Genome Estimated Using BAC Sequencing

    Directory of Open Access Journals (Sweden)

    Brad S. Coates

    2012-01-01

    Full Text Available Feeding damage caused by the western corn rootworm, Diabrotica virgifera virgifera, is destructive to corn plants in North America and Europe where control remains challenging due to evolution of resistance to chemical and transgenic toxins. A BAC library, DvvBAC1, containing 109,486 clones with 104±34.5 kb inserts was created, which has an ~4.56X genome coverage based upon a 2.58 Gb (2.80 pg flow cytometry-estimated haploid genome size. Paired end sequencing of 1037 BAC inserts produced 1.17 Mb of data (~0.05% genome coverage and indicated ~9.4 and 16.0% of reads encode, respectively, endogenous genes and transposable elements (TEs. Sequencing genes within BAC full inserts demonstrated that TE densities are high within intergenic and intron regions and contribute to the increased gene size. Comparison of homologous genome regions cloned within different BAC clones indicated that TE movement may cause haplotype variation within the inbred strain. The data presented here indicate that the D. virgifera virgifera genome is large in size and contains a high proportion of repetitive sequence. These BAC sequencing methods that are applicable for characterization of genomes prior to sequencing may likely be valuable resources for genome annotation as well as scaffolding.

  19. Sub-genomic level sequence analysis of the aquaporin multi-gene family in cotton

    Science.gov (United States)

    Aquaporins function mainly as water transport channel proteins that facilitate water movement across intracellular and intercellular membranes in most living organisms. Plant aquaporins belong to a multi-gene family and are commonly categorized into 5 subfamilies according to sequence similarity. Re...

  20. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne;

    2010-01-01

    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...

  1. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    Science.gov (United States)

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  2. Molecular cloning, sequence characteristics, and tissue expression analysis of ECE1 gene in Tibetan pig.

    Science.gov (United States)

    Wang, Yan-Dong; Zhang, Jian; Li, Chuan-Hao; Xu, Hai-Peng; Chen, Wei; Zeng, Yong-Qing; Wang, Hui

    2015-10-25

    Low air pressure and low oxygen partial pressure at high altitude seriously affect the survival and development of human beings and animals. ECE1 is a recently discovered gene that is involved in anti-hypoxia, but the full-length cDNA sequence has not been obtained. For a better understanding of the structure and function of the ECE1 gene and to study its effect in Tibetan pig, the cDNA of the ECE1 gene from the muscle of Tibetan pig was cloned, sequenced and characterized. The ECE1 full-length cDNA sequence consists of 2262 bp coding sequence (CDS) that encodes 753 amino acids with a molecular mass of 85,449 kD, 2 bp 5'UTR and 1507 bp 3'UTR. In addition, the phylogenetic tree analysis revealed that the Tibetan pig ECE1 has a closer genetic relationship and evolution distance with the land mammals ECE1. Furthermore, analysis by qPCR showed that the ECE1 transcript is constitutively expressed in the 10 tissues tested: the liver, subcutaneous fat, kidney, muscle, stomach, heart, brain, spleen, pancreas, and lung. These results serve as a foundation for further insight into the Tibetan pig ECE1 gene. PMID:26115769

  3. Isolation and Analysis of α-Gliadin Gene Coding Sequences from Triticum durum

    Institute of Scientific and Technical Information of China (English)

    WANG Han-yan; WEI Yu-ming; ZE Hong-yan; ZHENG You-liang

    2007-01-01

    Three coding sequences of gliadins genes, designed as Gli2_Du1, Gli2_Du2 and Gli2_Du3, were isolated from the genomic DNA of Triticum durum accessions CItr5083. Gli2_Du1 and Gli2_Du2 contain 945 and 864 bp, encoding the mature proteins with 314 and 287 amino acid residues, respectively. Gli2_Du3 is recognized as a pseudogene due to the stop codon occurring in the coding region. The pseudogenes, commonly occurring in gliadins family, are attributed to the single base change C → T. The amino acid sequences deduced from these gene sequences were characterized with the typical structure of α-gliadin proteins, including the toxic sequences (PSQQQP). The peptide fraction PF(Y)PP(Q)is thought to be an extra unit of repetitive domain, slightly diverging from the previous report. Six cysteine residues were observed within two unique domains. Phylogenetic analysis showed Gli2_Du2 and Gli2_Du3 were closely related to the genes on chromosome 6A, whereas Gli2_Du1 seems to be more homologous with the genes on chromosome 6B.

  4. Transcriptomic sequencing reveals a set of unique genes activated by butyrate-induced histone modification

    Science.gov (United States)

    Butyrate is a nutritional element with strong epigenetic regulatory activity as an inhibitor of histone deacetylases (HDACs). Based on the analysis of differentially expressed genes induced by butyrate in the bovine epithelial cell using deep RNA-sequencing technology (RNA-seq), a set of unique gen...

  5. Immunoscintigraphy with anti-225.28S for ocular melanoma - a comparison with histology and immunohistochemistry

    International Nuclear Information System (INIS)

    Aim: The purpose of this prospective study was to evaluate the value of immunoscintigraphy (ISG) with anti-225.28S in clinically suspected ocular melanoma. Methods: For this purpose standardized ISG was performed in 36 patients using both planar acquisition and emission computed tomography (ECT). Ocular melanoma was present in 31 patients. In 21 patients therapy was enucleation of the eye. These specimens were evaluated by histology and immunohistochemistry in 11 of 21 patients. Results: Regarding the clinical diagnosis, ISG was positive only in 15 of 31 patients with ocular melanoma, regarding histology in 11 of 21 and regarding immunohistochemistry in 5 of 6 patients with a positive immunoreaction. 5 patients showed no immunoreactivity, their ISG was negative. Conclusion: Thus a good correlation between ISG and immunohistochemistry was observed. However ISG using the cutaneous melanoma antibody 225.28S cannot be recommended for the diagnostic work-up of an ocular melanoma considering the poor immunoreactivity. (orig.)

  6. Defining the Sequence Elements and Candidate Genes for the Coloboma Mutation.

    Directory of Open Access Journals (Sweden)

    Elizabeth A. Robb

    Full Text Available The chicken coloboma mutation exhibits features similar to human congenital developmental malformations such as ocular coloboma, cleft-palate, dwarfism, and polydactyly. The coloboma-associated region and encoded genes were investigated using advanced genomic, genetic, and gene expression technologies. Initially, the mutation was linked to a 990 kb region encoding 11 genes; the application of the genetic and genomic tools led to a reduction of the linked region to 176 kb and the elimination of 7 genes. Furthermore, bioinformatics analyses of capture array-next generation sequence data identified genetic elements including SNPs, insertions, deletions, gaps, chromosomal rearrangements, and miRNA binding sites within the introgressed causative region relative to the reference genome sequence. Coloboma-specific variants within exons, UTRs, and splice sites were studied for their contribution to the mutant phenotype. Our compiled results suggest three genes for future studies. The three candidate genes, SLC30A5 (a zinc transporter, CENPH (a centromere protein, and CDK7 (a cyclin-dependent kinase, are differentially expressed (compared to normal embryos at stages and in tissues affected by the coloboma mutation. Of these genes, two (SLC30A5 and CENPH are considered high-priority candidate based upon studies in other vertebrate model systems.

  7. Evaluation and update of cutoff values for methanotrophic pmoA gene sequences.

    Science.gov (United States)

    Wen, Xi; Yang, Sizhong; Liebner, Susanne

    2016-09-01

    The functional pmoA gene is frequently used to probe the diversity and phylogeny of methane-oxidizing bacteria (MOB) in various environments. Here, we compared the similarities between the pmoA gene and the corresponding 16S rRNA gene sequences of 77 described species covering gamma- and alphaproteobacterial methanotrophs (type I and type II MOB, respectively) as well as methanotrophs from the phylum Verrucomicrobia. We updated and established the weighted mean pmoA gene cutoff values on the nucleotide level at 86, 82, and 71 % corresponding to the 97, 95, and 90 % similarity of the 16S rRNA gene. Based on these cutoffs, the functional gene fragments can be entirely processed at the nucleotide level throughout software platforms such as Mothur or QIIME which provide a user-friendly and command-based alternative to amino acid-based pipelines. Type II methanotrophs are less divergent than type I both with regard to ribosomal and functional gene sequence similarity and GC content. We suggest that this agrees with the theory of different life strategies proposed for type I and type II MOB. PMID:27098810

  8. Sequencing and complementation analysis of the nifUSV genes from Azospirillum brasilense.

    Science.gov (United States)

    Frazzon, J; Schrank, I S

    1998-02-15

    The functionality of nitrogenase in diazotrophic bacteria is dependent upon nif genes other than the structural nifH, D, and K genes which encode the enzyme subunit proteins. Such genes are involved in the activation of nif gene expression, maturation of subunit proteins, cofactor biosynthesis, and electron transport. In this work, approximately 5500 base pairs located within the major nif gene cluster of Azospirillum brasilense Sp7 have been sequenced. The deduced open reading frames were compared to the nif gene products of Azotobacter vinelandii and other diazotrophs. This analysis indicates the presence of five ORFs encoding ORF2, nifU, nifS, nifV, and ORF4 in the same sequential organization as found in other organisms. Consensus sigma 54 and NifA binding sites are present in the putative promoter region upstream of ORF2 in the A. brasilense sequence. The nifV gene of A. brasilense but not nifU or nifS complemented corresponding mutants strains of A. vinelandii. PMID:9503607

  9. Nucleotide sequence of maize dwarf mosaic virus capsid protein gene and its expression in Escherichia coli

    Institute of Scientific and Technical Information of China (English)

    赛吉庆; 康良仪; 黄忠; 史春霖; 田波; 谢友菊

    1995-01-01

    The 3’-terminal 1 279 nucleotide sequence of maize dwarf mosaic virus (MDMV) genome has been determined. This sequence contains an open reading frame of 1023 nudeotides and a 3’ -non-coding region of 256 nucleotides. The open reading frame includes all of the coding regions for the viral capsid protein (CP) and part of the viral nuclear inclusion protein (Nib). The predicted viral CP consists of 313 amino acid residues with a calculated molecular weight of 35400. The amino acid sequence of the viral CP derived from MDMV cDNA shows about 47%-54% homology to that of 4 other potyviruses. The viral CP gene was constructed in frame with the lacZ gene in pUC19 plasmid and expressed in E. coli cells. The fusion polypeptide positively reacted in Western blot with an antiserum prepared against the native viral CP.

  10. Analyzing Plasmodium falciparum erythrocyte membrane protein 1 gene expression by a next generation sequencing based method

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Petersen, Bent; Seguin-Orlando, Andaine;

    2013-01-01

    Plasmodium falciparum is responsible for most cases of severe malaria and causes >1 million deaths every year. The particular virulence of this Plasmodium species is highly associated with the expression of certain members of the Plasmodium falciparum erythrocyte membrane protein 1(PfEMP1) family......, encoded by ~60 highly variable 'var' genes per haploid genome. PfEMP1 is exported to the surface of infected erythrocytes and is thought to be fundamental to immune evasion by adhesion to host and parasite factors. The highly variable nature has constituted a roadblock in var expression studies aimed...... at identifying PfEMP1 features associated with high virulence. Here we present the first effective method for sequence analysis of var genes expressed in field samples: a sequential PCR and next generation sequencing based technique applied on expressed var sequence tags and subsequently on long range PCR...

  11. Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence

    International Nuclear Information System (INIS)

    Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time

  12. Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence

    Energy Technology Data Exchange (ETDEWEB)

    Ruvolo, M.; Disotell, T.R.; Allard, M.W. (Harvard Univ., Cambridge, MA (United States)); Brown, W.M. (Univ. of Michigan, Ann Arbor (United States)); Honeycutt, R.L. (Texas A and M Univ., College Station (United States))

    1991-02-15

    Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time.

  13. Mining and gene ontology based annotation of SSR markers from expressed sequence tags of Humulus lupulus.

    Science.gov (United States)

    Singh, Swati; Gupta, Sanchita; Mani, Ashutosh; Chaturvedi, Anoop

    2012-01-01

    Humulus lupulus is commonly known as hops, a member of the family moraceae. Currently many projects are underway leading to the accumulation of voluminous genomic and expressed sequence tag sequences in public databases. The genetically characterized domains in these databases are limited due to non-availability of reliable molecular markers. The large data of EST sequences are available in hops. The simple sequence repeat markers extracted from EST data are used as molecular markers for genetic characterization, in the present study. 25,495 EST sequences were examined and assembled to get full-length sequences. Maximum frequency distribution was shown by mononucleotide SSR motifs i.e. 60.44% in contig and 62.16% in singleton where as minimum frequency are observed for hexanucleotide SSR in contig (0.09%) and pentanucleotide SSR in singletons (0.12%). Maximum trinucleotide motifs code for Glutamic acid (GAA) while AT/TA were the most frequent repeat of dinucleotide SSRs. Flanking primer pairs were designed in-silico for the SSR containing sequences. Functional categorization of SSRs containing sequences was done through gene ontology terms like biological process, cellular component and molecular function.

  14. SeqGene: a comprehensive software solution for mining exome- and transcriptome- sequencing data

    Directory of Open Access Journals (Sweden)

    Deng Xutao

    2011-06-01

    Full Text Available Abstract Background The popularity of massively parallel exome and transcriptome sequencing projects demands new data mining tools with a comprehensive set of features to support a wide range of analysis tasks. Results SeqGene, a new data mining tool, supports mutation detection and annotation, dbSNP and 1000 Genome data integration, RNA-Seq expression quantification, mutation and coverage visualization, allele specific expression (ASE, differentially expressed genes (DEGs identification, copy number variation (CNV analysis, and gene expression quantitative trait loci (eQTLs detection. We also developed novel methods for testing the association between SNP and expression and identifying genotype-controlled DEGs. We showed that the results generated from SeqGene compares favourably to other existing methods in our case studies. Conclusion SeqGene is designed as a general-purpose software package. It supports both paired-end reads and single reads generated on most sequencing platforms; it runs on all major types of computers; it supports arbitrary genome assemblies for arbitrary organisms; and it scales well to support both large and small scale sequencing projects. The software homepage is http://seqgene.sourceforge.net.

  15. Cloning and Sequence Analysis of Capsid Protein Gene of Iridovirus Indonesian Isolates

    Directory of Open Access Journals (Sweden)

    Murwantoko .

    2015-11-01

    Full Text Available generated by an Adobe application 11.5606 Iridovirus was known as agents that caused serious systemic disease in freshwater and marine fishes. The mortality up to 100% of orange-spotted grouper (Epinephelus coioides due to iridovirus infection has been reported in Indonesia. The gene encoding capsid protein of iridovirus is supposed to be conserved and has the potency for the development of control methods. The objectives of this study are to clone the gene encoding capsid protein iridovirus and to analyze their sequences. The   spleen tissues of orange-spotted grouper were collected and extracted their DNA. The DNA fragment of capsid protein of iridovirus genes were amplified by PCR using designed primers with the extraction DNA as templates. The amplified DNA fragments were cloned in pBSKSII and sequenced.  The genes encoding capsid protein of iridovirus from Jepara and Bali were successfully amplified and cloned. The Jepara clone (IJP03 contained complete open reading frame (ORF of the gene composed by 1362 bp nucleotides which encoded 453 amino acids. Those Jepara and Bali (IGD01 clones shared 99.8% similarity in nucleotide level and 99.4% at amino acid level. Based on those sequences, Indonesian iridovirus was belonged to genus Megalocystivirus and shared 99,6-99,9% similarity on nucleotide level with DGIV, ISKNV, MCIV, and ALIV Normal 0 36 false false false

  16. Two lamprey Hedgehog genes share non-coding regulatory sequences and expression patterns with gnathostome Hedgehogs.

    Directory of Open Access Journals (Sweden)

    Shungo Kano

    Full Text Available Hedgehog (Hh genes play major roles in animal development and studies of their evolution, expression and function point to major differences among chordates. Here we focused on Hh genes in lampreys in order to characterize the evolution of Hh signalling at the emergence of vertebrates. Screening of a cosmid library of the river lamprey Lampetra fluviatilis and searching the preliminary genome assembly of the sea lamprey Petromyzon marinus indicate that lampreys have two Hh genes, named Hha and Hhb. Phylogenetic analyses suggest that Hha and Hhb are lamprey-specific paralogs closely related to Sonic/Indian Hh genes. Expression analysis indicates that Hha and Hhb are expressed in a Sonic Hh-like pattern. The two transcripts are expressed in largely overlapping but not identical domains in the lamprey embryonic brain, including a newly-described expression domain in the nasohypophyseal placode. Global alignments of genomic sequences and local alignment with known gnathostome regulatory motifs show that lamprey Hhs share conserved non-coding elements (CNE with gnathostome Hhs albeit with sequences that have significantly diverged and dispersed. Functional assays using zebrafish embryos demonstrate gnathostome-like midline enhancer activity for CNEs contained in intron2. We conclude that lamprey Hh genes are gnathostome Shh-like in terms of expression and regulation. In addition, they show some lamprey-specific features, including duplication and structural (but not functional changes in the intronic/regulatory sequences.

  17. IDENTIFICATION OF UTERIN MILK PROTEIN (UTMT GENE IN BALI CATTLE USING DIRECT SEQUENCING

    Directory of Open Access Journals (Sweden)

    Jakaria

    2016-03-01

    Full Text Available The objective of this research was to identify diversity of exon 5 UTMP gene fragment in Bali cattle using direct sequencing. The total 60 blood samples of Bali Cattle derived from BPTU Bali in Bali siland (20 heads, BPTU Serading in Sumbawa island (20 heads and Village Breeding Center in Barru District South Sulawesi (20 heads were used to evaluate their genetic diversity at exon 5 UTMP gene. The forward and reverse data sequences were analyzed using Bioedit program and alignment analysis was carried out using MEGA5 program. Meanwhile haplotype analysis was performed by DnaSPv5 program. The result showed that partial sequences in exon 5 UTMP gene had 16 haplotypes with the highest number of haplotypes ware found in VBC Barru district South Sulawesi (8 haplotypes. Moreover, the highest average of haplotype (h and nucleotide (p diversity were found in VBC Barru district South Sulawesi were 0.7949 and 0.0016, respectively. In addition, minisatellite insersion was found in exon 5 UTMP gene fragment on Bali cattle which are consist of 5'-CCA GTC ATG AAG AAG GCA GAG GTC GTC GTG CCG GCG AAA-3'. According to our results, haplotype and minisatellite variation in exon 5 UTMP gene fragment can be used as a candidate genetic marker specific for reproductive trait in the Bali cattle and for its strategy breeding program in the future.

  18. Expressed sequences tags of the anther smut fungus, Microbotryum violaceum, identify mating and pathogenicity genes

    Directory of Open Access Journals (Sweden)

    Devier Benjamin

    2007-08-01

    Full Text Available Abstract Background The basidiomycete fungus Microbotryum violaceum is responsible for the anther-smut disease in many plants of the Caryophyllaceae family and is a model in genetics and evolutionary biology. Infection is initiated by dikaryotic hyphae produced after the conjugation of two haploid sporidia of opposite mating type. This study describes M. violaceum ESTs corresponding to nuclear genes expressed during conjugation and early hyphal production. Results A normalized cDNA library generated 24,128 sequences, which were assembled into 7,765 unique genes; 25.2% of them displayed significant similarity to annotated proteins from other organisms, 74.3% a weak similarity to the same set of known proteins, and 0.5% were orphans. We identified putative pheromone receptors and genes that in other fungi are involved in the mating process. We also identified many sequences similar to genes known to be involved in pathogenicity in other fungi. The M. violaceum EST database, MICROBASE, is available on the Web and provides access to the sequences, assembled contigs, annotations and programs to compare similarities against MICROBASE. Conclusion This study provides a basis for cloning the mating type locus, for further investigation of pathogenicity genes in the anther smut fungi, and for comparative genomics.

  19. Cloning, sequencing, and characterization of the Azospirillum brasilense fhuE gene.

    Science.gov (United States)

    Cui, Yanhua; Tu, Ran; Guan, Yue; Ma, Luyan; Chen, Sanfeng

    2006-03-01

    The fhuE gene of Escherichia coli encodes the FhuE protein, which is a receptor protein in the coprogen-mediated siderophore iron-transport system. A fhuE gene homologue from Azospirillum brasilense, a nitrogen-fixing soil bacterium that lives in association with the roots of cereal grasses, was cloned, sequenced, and characterized. The A. brasilense fhuE encodes a protein of 802 amino acids with a predicted molecular weight of approximately 87 kDa. The deduced amino-acid sequence showed a high level of homology to the sequences of all the known fhuE gene products. The fhuE mutant was sensitive to iron starvation and defective in coprogen-mediated iron uptake. The mutant failed to express one membrane protein of approximately 78 kDa that was induced by iron starvation in the wild type. Complementation studies showed that the A. brasilense fhuE gene, when present on a low-copy number plasmid, could restore the functions of the mutant. Mutation in fhuE gene did not affect nitrogen fixation.

  20. Multidimensional metrics for estimating phage abundance, distribution, gene density, and sequence coverage in metagenomes

    Directory of Open Access Journals (Sweden)

    Ramy Karam Aziz

    2015-05-01

    Full Text Available Phages are the most abundant biological entities on Earth and play major ecological roles, yet the current sequenced phage genomes do not adequately represent their diversity, and little is known about the abundance and distribution of these sequenced genomes in nature. Although the study of phage ecology has benefited tremendously from the emergence of metagenomic sequencing, a systematic survey of phage genes and genomes in various ecosystems is still lacking, and fundamental questions about phage biology, lifestyle, and ecology remain unanswered. To address these questions and improve comparative analysis of phages in different metagenomes, we screened a core set of publicly available metagenomic samples for sequences related to completely sequenced phages using the web tool, Phage Eco-Locator. We then adopted and deployed an array of mathematical and statistical metrics for a multidimensional estimation of the abundance and distribution of phage genes and genomes in various ecosystems. Experiments using those metrics individually showed their usefulness in emphasizing the pervasive, yet uneven, distribution of known phage sequences in environmental metagenomes. Using these metrics in combination allowed us to resolve phage genomes into clusters that correlated with their genotypes and taxonomic classes as well as their ecological properties. We propose adding this set of metrics to current metaviromic analysis pipelines, where they can provide insight regarding phage mosaicism, habitat specificity, and evolution.

  1. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  2. Sequencing, physical organization and kinetic expression of the patulin biosynthetic gene cluster from Penicillium expansum

    International Nuclear Information System (INIS)

    Patulin is a polyketide-derived mycotoxin produced by numerous filamentous fungi. Among them, Penicillium expansum is by far the most problematic species. This fungus is a destructive phytopathogen capable of growing on fruit, provoking the blue mold decay of apples and producing significant amounts of patulin. The biosynthetic pathway of this mycotoxin is chemically well-characterized, but its genetic bases remain largely unknown with only few characterized genes in less economic relevant species. The present study consisted of the identification and positional organization of the patulin gene cluster in P. expansum strain NRRL 35695. Several amplification reactions were performed with degenerative primers that were designed based on sequences from the orthologous genes available in other species. An improved genome Walking approach was used in order to sequence the remaining adjacent genes of the cluster. RACE-PCR was also carried out from mRNAs to determine the start and stop codons of the coding sequences. The patulin gene cluster in P. expansum consists of 15 genes in the following order: patH, patG, patF, patE, patD, patC, patB, patA, patM, patN, patO, patL, patI, patJ, and patK. These genes share 60–70% of identity with orthologous genes grouped differently, within a putative patulin cluster described in a non-producing strain of Aspergillus clavatus. The kinetics of patulin cluster genes expression was studied under patulin-permissive conditions (natural apple-based medium) and patulin-restrictive conditions (Eagle's minimal essential medium), and demonstrated a significant association between gene expression and patulin production. In conclusion, the sequence of the patulin cluster in P. expansum constitutes a key step for a better understanding of themechanisms leading to patulin production in this fungus. It will allow the role of each gene to be elucidated, and help to define strategies to reduce patulin production in apple-based products

  3. An ancient repeat sequence in the ATP synthase beta-subunit gene of forcipulate sea stars.

    Science.gov (United States)

    Foltz, David W

    2007-11-01

    A novel repeat sequence with a conserved secondary structure is described from two nonadjacent introns of the ATP synthase beta-subunit gene in sea stars of the order Forcipulatida (Echinodermata: Asteroidea). The repeat is present in both introns of all forcipulate sea stars examined, which suggests that it is an ancient feature of this gene (with an approximate age of 200 Mya). Both stem and loop regions show high levels of sequence constraint when compared to flanking nonrepetitive intronic regions. The repeat was also detected in (1) the family Pterasteridae, order Velatida and (2) the family Korethrasteridae, order Velatida. The repeat was not detected in (1) the family Echinasteridae, order Spinulosida, (2) the family Astropectinidae, order Paxillosida, (3) the family Solasteridae, order Velatida, or (4) the family Goniasteridae, order Valvatida. The repeat lacks similarity to published sequences in unrestricted GenBank searches, and there are no significant open reading frames in the repeat or in the flanking intron sequences. Comparison via parametric bootstrapping to a published phylogeny based on 4.2 kb of nuclear and mitochondrial sequence for a subset of these species allowed the null hypothesis of a congruent phylogeny to be rejected for each repeat, when compared separately to the published phylogeny. In contrast, the flanking nonrepetitive sequences in each intron yielded separate phylogenies that were each congruent with the published phylogeny. In four species, the repeat in one or both introns has apparently experienced gene conversion. The two introns also show a correlated pattern of nucleotide substitutions, even after excluding the putative cases of gene conversion.

  4. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    Science.gov (United States)

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  5. Cloning and sequencing of an ice nucleation active gene of Erwinia uredovora.

    Science.gov (United States)

    Michigami, Y; Watabe, S; Abe, K; Obata, H; Arai, S

    1994-04-01

    An ice nucleation activity gene, named inaU, of the bacterium Erwinia uredovora KUIN-3 has been sequenced. This gene encodes a protein of 1034 amino acid residues, and its expression product, inaU protein, has an 832-amino acid residue segment consisting of 52 repeats of closely related 16-amino acid motifs (R-domain), flanked by N- and C-terminal sequences (N- and C-domains, respectively). The primary structure of the inaU protein is similar to those of the inaA, inaW, and inaZ gene products of Erwinia ananas, Pseudomonas fluorescens, and Pseudomonas syringae, respectively, but is smaller than any of these products in terms of the size of the R-domain. PMID:7764866

  6. Sequencing and analysis of the gene-rich space of cowpea

    Directory of Open Access Journals (Sweden)

    Cheung Foo

    2008-02-01

    Full Text Available Abstract Background Cowpea, Vigna unguiculata (L. Walp., is one of the most important food and forage legumes in the semi-arid tropics because of its drought tolerance and ability to grow on poor quality soils. Approximately 80% of cowpea production takes place in the dry savannahs of tropical West and Central Africa, mostly by poor subsistence farmers. Despite its economic and social importance in the developing world, cowpea remains to a large extent an underexploited crop. Among the major goals of cowpea breeding and improvement programs is the stacking of desirable agronomic traits, such as disease and pest resistance and response to abiotic stresses. Implementation of marker-assisted selection and breeding programs is severely limited by a paucity of trait-linked markers and a general lack of information on gene structure and organization. With a nuclear genome size estimated at ~620 Mb, the cowpea genome is an ideal target for reduced representation sequencing. Results We report here the sequencing and analysis of the gene-rich, hypomethylated portion of the cowpea genome selectively cloned by methylation filtration (MF technology. Over 250,000 gene-space sequence reads (GSRs with an average length of 610 bp were generated, yielding ~160 Mb of sequence information. The GSRs were assembled, annotated by BLAST homology searches of four public protein annotation databases and four plant proteomes (A. thaliana, M. truncatula, O. sativa, and P. trichocarpa, and analyzed using various domain and gene modeling tools. A total of 41,260 GSR assemblies and singletons were annotated, of which 19,786 have unique GenBank accession numbers. Within the GSR dataset, 29% of the sequences were annotated using the Arabidopsis Gene Ontology (GO with the largest categories of assigned function being catalytic activity and metabolic processes, groups that include the majority of cellular enzymes and components of amino acid, carbohydrate and lipid metabolism. A

  7. Stable intronic sequence RNAs (sisRNAs): a new layer of gene regulation.

    Science.gov (United States)

    Osman, Ismail; Tay, Mandy Li-Ian; Pek, Jun Wei

    2016-09-01

    Upon splicing, introns are rapidly degraded. Hence, RNAs derived from introns are commonly deemed as junk sequences. However, the discoveries of intronic-derived small nucleolar RNAs (snoRNAs), small Cajal body associated RNAs (scaRNAs) and microRNAs (miRNAs) suggested otherwise. These non-coding RNAs are shown to play various roles in gene regulation. In this review, we highlight another class of intron-derived RNAs known as stable intronic sequence RNAs (sisRNAs). sisRNAs have been observed since the 1980 s; however, we are only beginning to understand their biological significance. Recent studies have shown or suggested that sisRNAs regulate their own host's gene expression, function as molecular sinks or sponges, and regulate protein translation. We propose that sisRNAs function as an additional layer of gene regulation in the cells. PMID:27147469

  8. Nucleotide sequence of the Pseudomonas fluorescens signal peptidase II gene (lsp) and flanking genes.

    OpenAIRE

    Isaki, L; Beers, R; Wu, H.C.

    1990-01-01

    The lsp gene encoding prolipoprotein signal peptidase (signal peptidase II) is organized into an operon consisting of ileS and three open reading frames, designated genes x, orf149, and orf316 in both Escherichia coli and Enterobacter aerogenes. A plasmid, pBROC128, containing a 5.8-kb fragment of Pseudomonas fluorescens DNA was found to confer pseudomonic acid resistance on E. coli host cells and to contain the structural gene of ileS from P. fluorescens. In addition, E. coli strains carryin...

  9. Driver Gene Mutations in Stools of Colorectal Carcinoma Patients Detected by Targeted Next-Generation Sequencing.

    Science.gov (United States)

    Armengol, Gemma; Sarhadi, Virinder K; Ghanbari, Reza; Doghaei-Moghaddam, Masoud; Ansari, Reza; Sotoudeh, Masoud; Puolakkainen, Pauli; Kokkola, Arto; Malekzadeh, Reza; Knuutila, Sakari

    2016-07-01

    Detection of driver gene mutations in stool DNA represents a promising noninvasive approach for screening colorectal cancer (CRC). Amplicon-based next-generation sequencing (NGS) is a good option to study mutations in many cancer genes simultaneously and from a low amount of DNA. Our aim was to assess the feasibility of identifying mutations in 22 cancer driver genes with Ion Torrent technology in stool DNA from a series of 65 CRC patients. The assay was successful in 80% of stool DNA samples. NGS results showed 83 mutations in cancer driver genes, 29 hotspot and 54 novel mutations. One to five genes were mutated in 75% of cases. TP53, KRAS, FBXW7, and SMAD4 were the top mutated genes, consistent with previous studies. Of samples with mutations, 54% presented concomitant mutations in different genes. Phosphatidylinositol 3-kinase/mitogen-activated protein kinase pathway genes were mutated in 70% of samples, with 58% having alterations in KRAS, NRAS, or BRAF. Because mutations in these genes can compromise the efficacy of epidermal growth factor receptor blockade in CRC patients, identifying mutations that confer resistance to some targeted treatments may be useful to guide therapeutic decisions. In conclusion, the data presented herein show that NGS procedures on stool DNA represent a promising tool to detect genetic mutations that could be used in the future for diagnosis, monitoring, or treating CRC. PMID:27155048

  10. Species identification using genetic tools: the value of nuclear and mitochondrial gene sequences in whale conservation.

    Science.gov (United States)

    Palumbi, S R; Cipriano, F

    1998-01-01

    DNA sequence analysis is a powerful tool for identifying the source of samples thought to be derived from threatened or endangered species. Analysis of mitochondrial DNA (mtDNA) from retail whale meat markets has shown consistently that the expected baleen whale in these markets, the minke whale, makes up only about half the products analyzed. The other products are either unregulated small toothed whales like dolphins or are protected baleen whales such as humpback, Bryde's, fin, or blue whales. Independent verification of such mtDNA identifications requires analysis of nuclear genetic loci, but this is technically more difficult than standard mtDNA sequencing. In addition, evolution of species-specific sequences (i.e., fixation of sequence differences to produce reciprocally monophyletic gene trees) is slower in nuclear than in mitochondrial genes primarily because genetic drift is slower at nuclear loci. When will use of nuclear sequences allow forensic DNA identification? Comparison of neutral theories of coalescence of mitochondrial and nuclear loci suggests a simple rule of thumb. The "three-times rule" suggests that phylogenetic sorting at nuclear loci is likely to produce species-specific sequences when mitochondrial alleles are reciprocally monophyletic and the branches leading to the mtDNA sequences of a species are three times longer than the average difference observed within species. A preliminary test of the three-times rule, which depends on many assumptions about the species and genes involved, suggests that blue and fin whales should have species-specific sequences at most neutral nuclear loci, whereas humpback and fin whales should show species-specific sequences at fewer nuclear loci. Partial sequences of actin introns from these species confirm the predictions of the three-times rule and show that blue and fin whales are reciprocally monophyletic at this locus. These intron sequences are thus good tools for the identification of these species

  11. Nucleotide sequence of an immediate-early frog virus 3 gene.

    Science.gov (United States)

    Willis, D; Foglesong, D; Granoff, A

    1984-12-01

    We have used "gene walking" with synthetic oligonucleotides and M13 dideoxynucleotide sequencing techniques to obtain the complete coding and flanking sequences of the gene encoding a major immediate-early RNA (molecular weight, 169,000) of frog virus 3. R-loop mapping of the cloned XbaI K fragment of frog virus 3 DNA with immediate-early RNA from infected cells showed that an RNA of approximately 500 to 600 nucleotides (the right size to code for the immediate-early viral 18-kilodalton protein of unknown function) hybridized to a region within 100 base pairs of one end of the XbaI K fragment; no evidence for splicing was observed in the electron microscope or by single-strand nuclease analysis. Further restriction mapping narrowed the location of the gene to the XbaI end of a 2-kilobase-pair XbaI-Bg/II fragment, which was bidirectionally subcloned into the bacteriophage pair mp10 and mp11 for sequencing. Mung bean nuclease mapping was used to identify both the 5' and the 3' ends of the mRNA. The 5' end mapped within an AT-rich region 19 base pairs upstream from two in-phase AUG start codons that were immediately followed by an open reading frame of 157 amino acids. Another AT-rich sequence was found at -29 base pairs from the 5' end of the mRNA start site; this sequence may function as a TATA box. The 3' end of the message displayed considerable microheterogeneity, but clearly terminated within a third AT-rich region 50 to 60 base pairs from the translation stop codon. The eucaryotic polyadenylic acid addition signal (AATAAA) was not present, a finding to be expected since frog virus 3 mRNA is not polyadenylated. Both the single-stranded mp10 clone of the XbaI-Bg/II fragment and a 15-base oligonucleotide complementary to the region flanking the two AUG translation start codons inhibited translation of the immediate-early 18-kilodalton protein in vitro, confirming the identity of the sequenced gene. As the regulatory sequences of this gene did not resemble those of

  12. Molecular cloning and primary sequence analysis of a gene encoding a putative shitinase gene in Brassica oleracea var.capitata

    Institute of Scientific and Technical Information of China (English)

    TANGGUOQING; YONGYANBAI; 等

    1996-01-01

    Chitinase,which catalyzes the hydrolysis of the β-1,4-acetyl-D-glucosamine linkages of the fungal cell wall polymer chitin,is involved in inducible plants defense system.By construction of cabbage(Brassica oleracea var. capitata) genomic library and screening the library with pRCH8,a probe of rice chitinase gene fragment,a chitinase genomic sequence was isolated.The complete uncleotide sequence of the putative cabbage chitinase gene (cabch29) was determined,with its longest open reading frame (ORF) encoding a polypeptide of 413 aa.This polypeptide consists of a 21 aa N-terminal signal peptide,two chitin-binding domains different from those of other classes of plant chitinases,and a catalytic domain.Homology analysis illustrated that this cabch29 gene has 58.8% identity at the nucleotide level with the pRCH8 ORF probe and has 50% identity at the amino acid level tiwh the catalytic domains of chitinase from bean,maize and sugar beet.Meanwhile,several kinds of cis-elements,such as TATA box,CAAT box,GATA motif,ASF-1 binding site,wound-response elements and AATAAA,have also been discovered in the flanking region of cabch29 gene.

  13. Nucleotide sequence specifying the glycoprotein gene, gB, of herpes simplex virus type 1.

    Science.gov (United States)

    Bzik, D J; Fox, B A; DeLuca, N A; Person, S

    1984-03-01

    The nucleotide sequence thought to specify the glycoprotein gene, gB, of the KOS strain of herpes simplex virus type 1 (HSV-1) has been determined. A 3.1-kilobase (kb), viral-specified RNA was mapped to the left half of the BamHI-G fragment (0.345 to 0.399 map units). TATA, CAT-box, and possible mRNA start sequences characteristic of HSV-1 genes are found near 0.368 map units. The first available ATG codon is at 0.366 and the first in-phase chain terminator at 0.348 map units. A polyA-addition signal (AATAAA) occurs 17 nucleotides past the chain terminator. Translation of these sequences would yield a 100.3-kilodalton (kDa) polypeptide characterized by a 5' signal sequence, nine N-linked saccharide addition sites, a strongly hydrophobic membrane-spanning sequence, and a highly charged 3' cytoplasmic anchor sequence. Two mutants of KOS, tsJ12 and tsJ20, that are temperature-sensitive for viral growth and for the production of gB, have been physically mapped to 0.357 to 0.360 and 0.360 to 0.364 map units, respectively (DeLuca et al., in preparation). The nucleotide sequence of the mutants was determined in these regions. In both cases a single amino acid replacement within the 100.3-kDa polypeptide is predicted from the sequence analysis. PMID:6324454

  14. Complete exon sequencing of all known Usher syndrome genes greatly improves molecular diagnosis

    Directory of Open Access Journals (Sweden)

    Lacombe Didier

    2011-05-01

    Full Text Available Abstract Background Usher syndrome (USH combines sensorineural deafness with blindness. It is inherited in an autosomal recessive mode. Early diagnosis is critical for adapted educational and patient management choices, and for genetic counseling. To date, nine causative genes have been identified for the three clinical subtypes (USH1, USH2 and USH3. Current diagnostic strategies make use of a genotyping microarray that is based on the previously reported mutations. The purpose of this study was to design a more accurate molecular diagnosis tool. Methods We sequenced the 366 coding exons and flanking regions of the nine known USH genes, in 54 USH patients (27 USH1, 21 USH2 and 6 USH3. Results Biallelic mutations were detected in 39 patients (72% and monoallelic mutations in an additional 10 patients (18.5%. In addition to biallelic mutations in one of the USH genes, presumably pathogenic mutations in another USH gene were detected in seven patients (13%, and another patient carried monoallelic mutations in three different USH genes. Notably, none of the USH3 patients carried detectable mutations in the only known USH3 gene, whereas they all carried mutations in USH2 genes. Most importantly, the currently used microarray would have detected only 30 of the 81 different mutations that we found, of which 39 (48% were novel. Conclusions Based on these results, complete exon sequencing of the currently known USH genes stands as a definite improvement for molecular diagnosis of this disease, which is of utmost importance in the perspective of gene therapy.

  15. Targeted enrichment of the black cottonwood (Populus trichocarpa gene space using sequence capture

    Directory of Open Access Journals (Sweden)

    Zhou Lecong

    2012-12-01

    Full Text Available Abstract Background High-throughput re-sequencing is rapidly becoming the method of choice for studies of neutral and adaptive processes in natural populations across taxa. As re-sequencing the genome of large numbers of samples is still cost-prohibitive in many cases, methods for genome complexity reduction have been developed in attempts to capture most ecologically-relevant genetic variation. One of these approaches is sequence capture, in which oligonucleotide baits specific to genomic regions of interest are synthesized and used to retrieve and sequence those regions. Results We used sequence capture to re-sequence most predicted exons, their upstream regulatory regions, as well as numerous random genomic intervals in a panel of 48 genotypes of the angiosperm tree Populus trichocarpa (black cottonwood, or ‘poplar’. A total of 20.76Mb (5% of the poplar genome was targeted, corresponding to 173,040 baits. With 12 indexed samples run in each of four lanes on an Illumina HiSeq instrument (2x100 paired-end, 86.8% of the bait regions were on average sequenced at a depth ≥10X. Few off-target regions (>250bp away from any bait were present in the data, but on average ~80bp on either side of the baits were captured and sequenced to an acceptable depth (≥10X to call heterozygous SNPs. Nucleotide diversity estimates within and adjacent to protein-coding genes were similar to those previously reported in Populus spp., while intergenic regions had higher values consistent with a relaxation of selection. Conclusions Our results illustrate the efficiency and utility of sequence capture for re-sequencing highly heterozygous tree genomes, and suggest design considerations to optimize the use of baits in future studies.

  16. Cloning and Sequencing of a Gene Encoding GOBP2 in the Antenna of Spodoptera exigua

    Institute of Scientific and Technical Information of China (English)

    WANG Gui-rong; GUO Yu-yuan; XU Guang; WU Kong-ming

    2002-01-01

    A pair of degenerate primers was designed, based on the comparison of five insects' GOBP2 gene sequences reported previously. A specific band (about 400bp in length) was amplified from cDNA of Spodoptera exigua antenna and another specific band (about 2kb in length) was amplified from genomic DNA.The two segments were cloned into T-easy vector, respectively. Results of sequencing and structural analysis showed that the full-length of GOBP2Sexi ORF is 426bp, 141 amino acid residues were encoded. The predicted MW and pI are 16.07ku and 5.09, respectively. There are six conservative Cys locus in the sequence, which is the typical characteristic of OBPs. GOBP2Sexi gene was inserted by two introns between amino acid residue 22 and 23 and between 82 and 83. The length of two introns is 160bp and 1403bp. Results of Northern blot showed that GOBP2 gene expressed specifically in the antenna of Spodoptera exigua, and the expression level is nearly equal in the antenna of male and female moths. The sequence was deposited in GenBank/EMBL and the accession number is AJ294809.

  17. Analysis of mutations in the entire coding sequence of the factor VIII gene

    Energy Technology Data Exchange (ETDEWEB)

    Bidichadani, S.I.; Lanyon, W.G.; Connor, J.M. [Glascow Univ. (United Kingdom)] [and others

    1994-09-01

    Hemophilia A is a common X-linked recessive disorder of bleeding caused by deleterious mutations in the gene for clotting factor VIII. The large size of the factor VIII gene, the high frequency of de novo mutations and its tissue-specific expression complicate the detection of mutations. We have used a combination of RT-PCR of ectopic factor VIII transcripts and genomic DNA-PCRs to amplify the entire essential sequence of the factor VIII gene. This is followed by chemical mismatch cleavage analysis and direct sequencing in order to facilitate a comprehensive search for mutations. We describe the characterization of nine potentially pathogenic mutations, six of which are novel. In each case, a correlation of the genotype with the observed phenotype is presented. In order to evaluate the pathogenicity of the five missense mutations detected, we have analyzed them for evolutionary sequence conservation and for their involvement of sequence motifs catalogued in the PROSITE database of protein sites and patterns.

  18. Massive parallel IGHV gene sequencing reveals a germinal center pathway in origins of human multiple myeloma.

    Science.gov (United States)

    Cowan, Graeme; Weston-Bell, Nicola J; Bryant, Dean; Seckinger, Anja; Hose, Dirk; Zojer, Niklas; Sahota, Surinder S

    2015-05-30

    Human multiple myeloma (MM) is characterized by accumulation of malignant terminally differentiated plasma cells (PCs) in the bone marrow (BM), raising the question when during maturation neoplastic transformation begins. Immunoglobulin IGHV genes carry imprints of clonal tumor history, delineating somatic hypermutation (SHM) events that generally occur in the germinal center (GC). Here, we examine MM-derived IGHV genes using massive parallel deep sequencing, comparing them with profiles in normal BM PCs. In 4/4 presentation IgG MM, monoclonal tumor-derived IGHV sequences revealed significant evidence for intraclonal variation (ICV) in mutation patterns. IGHV sequences of 2/2 normal PC IgG populations revealed dominant oligoclonal expansions, each expansion also displaying mutational ICV. Clonal expansions in MM and in normal BM PCs reveal common IGHV features. In such MM, the data fit a model of tumor origins in which neoplastic transformation is initiated in a GC B-cell committed to terminal differentiation but still targeted by on-going SHM. Strikingly, the data parallel IGHV clonal sequences in some monoclonal gammopathy of undetermined significance (MGUS) known to display on-going SHM imprints. Since MGUS generally precedes MM, these data suggest origins of MGUS and MM with IGHV gene mutational ICV from the same GC B-cell, arising via a distinctive pathway.

  19. Development and analytical validation of a 25-gene next generation sequencing panel that includes the BRCA1 and BRCA2 genes to assess hereditary cancer risk

    OpenAIRE

    Judkins, Thaddeus; Leclair, Benoît; Bowles, Karla; Gutin, Natalia; Trost, Jeff; McCulloch, James; Bhatnagar, Satish; Murray, Adam; Craft, Jonathan; Wardell, Bryan; Bastian, Mark; Mitchell, Jeffrey; Jian CHEN; Tran, Thanh; Williams, Deborah

    2015-01-01

    Background Germline DNA mutations that increase the susceptibility of a patient to certain cancers have been identified in various genes, and patients can be screened for mutations in these genes to assess their level of risk for developing cancer. Traditional methods using Sanger sequencing focus on small groups of genes and therefore are unable to screen for numerous genes from several patients simultaneously. The goal of the present study was to validate a 25-gene panel to assess genetic r...

  20. Comparative organization of nitrogen fixation-specific genes from Azotobacter vinelandii and Klebsiella pneumoniae: DNA sequence of the nifUSV genes.

    OpenAIRE

    Beynon, J; Ally, A; Cannon, M; Cannon, F.; Jacobson, M.; Cash, V; Dean, D.

    1987-01-01

    In the facultative anaerobe Klebsiella pneumoniae 17 nitrogen fixation-specific genes (nif genes) have been identified. Homologs to 12 of these genes have now been isolated from the aerobic diazotroph Azotobacter vinelandii. Comparative studies have indicated that these diverse microorganisms share striking similarities in the genetic organization of their nif genes and in the primary structure of their individual nif gene products. In this study the complete nucleotide sequence of the nifUSV...

  1. Zooplankton diversity analysis through single-gene sequencing of a community sample

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2009-09-01

    Full Text Available Abstract Background Oceans cover more than 70% of the earth's surface and are critical for the homeostasis of the environment. Among the components of the ocean ecosystem, zooplankton play vital roles in energy and matter transfer through the system. Despite their importance, understanding of zooplankton biodiversity is limited because of their fragile nature, small body size, and the large number of species from various taxonomic phyla. Here we present the results of single-gene zooplankton community analysis using a method that determines a large number of mitochondrial COI gene sequences from a bulk zooplankton sample. This approach will enable us to estimate the species richness of almost the entire zooplankton community. Results A sample was collected from a depth of 721 m to the surface in the western equatorial Pacific off Pohnpei Island, Micronesia, with a plankton net equipped with a 2-m2 mouth opening. A total of 1,336 mitochondrial COI gene sequences were determined from the cDNA library made from the sample. From the determined sequences, the occurrence of 189 species of zooplankton was estimated. BLASTN search results showed high degrees of similarity (>98% between the query and database for 10 species, including holozooplankton and merozooplankton. Conclusion In conjunction with the Census of Marine Zooplankton and Barcode of Life projects, single-gene zooplankton community analysis will be a powerful tool for estimating the species richness of zooplankton communities.

  2. Breaking the 1000-gene barrier for Mimivirus using ultra-deep genome and transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Claverie Jean-Michel

    2011-03-01

    Full Text Available Abstract Background Mimivirus, a giant dsDNA virus infecting Acanthamoeba, is the prototype of the mimiviridae family, the latest addition to the family of the nucleocytoplasmic large DNA viruses (NCLDVs. Its 1.2 Mb-genome was initially predicted to encode 917 genes. A subsequent RNA-Seq analysis precisely mapped many transcript boundaries and identified 75 new genes. Findings We now report a much deeper analysis using the SOLiD™ technology combining RNA-Seq of the Mimivirus transcriptome during the infectious cycle (202.4 Million reads, and a complete genome re-sequencing (45.3 Million reads. This study corrected the genome sequence and identified several single nucleotide polymorphisms. Our results also provided clear evidence of previously overlooked transcription units, including an important RNA polymerase subunit distantly related to Euryarchea homologues. The total Mimivirus gene count is now 1018, 11% greater than the original annotation. Conclusions This study highlights the huge progress brought about by ultra-deep sequencing for the comprehensive annotation of virus genomes, opening the door to a complete one-nucleotide resolution level description of their transcriptional activity, and to the realistic modeling of the viral genome expression at the ultimate molecular level. This work also illustrates the need to go beyond bioinformatics-only approaches for the annotation of short protein and non-coding genes in viral genomes.

  3. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  4. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

    Science.gov (United States)

    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

  5. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    International Nuclear Information System (INIS)

    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

  6. Amplification of complete gag gene sequences from geographically distinct equine infectious anemia virus isolates.

    Science.gov (United States)

    Boldbaatar, Bazartseren; Bazartseren, Tsevel; Koba, Ryota; Murakami, Hironobu; Oguma, Keisuke; Murakami, Kenji; Sentsui, Hiroshi

    2013-04-01

    In the current study, primers described previously and modified versions of these primers were evaluated for amplification of full-length gag genes from different equine infectious anemia virus (EIAV) strains from several countries, including the USA, Germany and Japan. Each strain was inoculated into a primary horse leukocyte culture, and the full-length gag gene was amplified by reverse transcription polymerase chain reaction. Each amplified gag gene was cloned into a plasmid vector for sequencing, and the detectable copy numbers of target DNA were determined. Use of a mixture of two forward primers and one reverse primer in the polymerase chain reaction enabled the amplification of all EIAV strains used in this study. However, further study is required to confirm these primers as universal for all EIAV strains. The nucleotide sequence of gag is considered highly conserved, as evidenced by the use of gag-encoded capsid proteins as a common antigen for the detection of EIAV in serological tests. However, significant sequence variation in the gag genes of different EIAV strains was found in the current study. PMID:23318370

  7. Comparative sequence analyses of the neurotoxin complex genes in Clostridium botulinum serotypes A, B, E, and F

    Directory of Open Access Journals (Sweden)

    Ajay K. Singh

    2012-09-01

    Full Text Available Neurotoxin complex (NTC genes are arranged in two known hemagglutinin (HA and open reading frame X (ORFX clusters. NTC genes have been analyzed in four serotypes A, B, E and F of Clostridium botulinum causing human botulism. Analysis of amino acid sequences of NT genes demonstrated significant differences among subtypes and four serotypes. Phylogram tree of NT genes reveals that serotypes A1 and B1 are much closer compared to serotype E1 and F1. However, non-toxic non-hemagglutinin (NTNH gene is highly conserved among four serotypes. Analysis of phylogram tree of NTNH gene reveals that serotypes A and F are more closely related compared to serotype B and E. Additionally, sequences of HAs and ORFX genes are very divergent but these genes are specific in subtypes and serotypes of Clostridium botulinum. Information derived from sequence analyses of NTC has direct implication in development of detection tools and therapeutic countermeasures for botulism.

  8. Use of dedicated gene panel sequencing using next generation sequencing to improve the personalized care of lung cancer

    Science.gov (United States)

    Beltjens, Françoise; Chevrier, Sandy; Arnould, Laurent; Favier, Laure; Lagrange, Aurélie

    2016-01-01

    Advances in Next Generation Sequencing (NGS) technologies have improved the ability to detect potentially targetable mutations. However, the integration of NGS into clinical management in an individualized manner remains challenging. In this single-center observational study, we performed a dedicated NGS panel studying 41 cancer-related genes in 50 consecutive patients with metastatic non-small-cell lung cancer between May 2012 and October 2014. Molecular analysis could be performed in 48 patients with a good quality check. One hundred and thirty-three mutations, whose twenty-four unique mutations, were detected. At least one mutation was found in 46 patients. In 58% of cases, the Molecular Tumor Board (MTB) was able to recommend treatment with a targeted agent based on the evaluation of the tumor genetic profile and treatment history. Nine patients (18%) were subsequently treated with a MTB-recommended targeted therapy; four patients experienced a clinical benefit with a partial response or stabilization lasting more than 4 months. In this case series involving patients with metastatic non-small cell lung cancer, we show that including integrative clinical sequencing data into routine clinical management was feasible and could impact on patient therapeutic proposal. PMID:27027238

  9. Gene Profiling of Bone around Orthodontic Mini-Implants by RNA-Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    Kyung-Yen Nahm

    2015-01-01

    Full Text Available This study aimed to evaluate the genes that were expressed in the healing bones around SLA-treated titanium orthodontic mini-implants in a beagle at early (1-week and late (4-week stages with RNA-sequencing (RNA-Seq. Samples from sites of surgical defects were used as controls. Total RNA was extracted from the tissue around the implants, and an RNA-Seq analysis was performed with Illumina TruSeq. In the 1-week group, genes in the gene ontology (GO categories of cell growth and the extracellular matrix (ECM were upregulated, while genes in the categories of the oxidation-reduction process, intermediate filaments, and structural molecule activity were downregulated. In the 4-week group, the genes upregulated included ECM binding, stem cell fate specification, and intramembranous ossification, while genes in the oxidation-reduction process category were downregulated. GO analysis revealed an upregulation of genes that were related to significant mechanisms, including those with roles in cell proliferation, the ECM, growth factors, and osteogenic-related pathways, which are associated with bone formation. From these results, implant-induced bone formation progressed considerably during the times examined in this study. The upregulation or downregulation of selected genes was confirmed with real-time reverse transcription polymerase chain reaction. The RNA-Seq strategy was useful for defining the biological responses to orthodontic mini-implants and identifying the specific genetic networks for targeted evaluations of successful peri-implant bone remodeling.

  10. Identification of Genetic Causes of Inherited Peripheral Neuropathies by Targeted Gene Panel Sequencing

    Science.gov (United States)

    Nam, Soo Hyun; Hong, Young Bin; Hyun, Young Se; Nam, Da Eun; Kwak, Geon; Hwang, Sun Hee; Choi, Byung-Ok; Chung, Ki Wha

    2016-01-01

    Inherited peripheral neuropathies (IPN), which are a group of clinically and genetically heterogeneous peripheral nerve disorders including Charcot-Marie-Tooth disease (CMT), exhibit progressive degeneration of muscles in the extremities and loss of sensory function. Over 70 genes have been reported as genetic causatives and the number is still growing. We prepared a targeted gene panel for IPN diagnosis based on next generation sequencing (NGS). The gene panel was designed to detect mutations in 73 genes reported to be genetic causes of IPN or related peripheral neuropathies, and to detect duplication of the chromosome 17p12 region, the major genetic cause of CMT1A. We applied the gene panel to 115 samples from 63 non-CMT1A families, and isolated 15 pathogenic or likely-pathogenic mutations in eight genes from 25 patients (17 families). Of them, eight mutations were unreported variants. Of particular interest, this study revealed several very rare mutations in the SPTLC2, DCTN1, and MARS genes. In addition, the effectiveness of the detection of CMT1A was confirmed by comparing five 17p12-nonduplicated controls and 15 CMT1A cases. In conclusion, we developed a gene panel for one step genetic diagnosis of IPN. It seems that its time- and cost-effectiveness are superior to previous tiered-genetic diagnosis algorithms, and it could be applied as a genetic diagnostic system for inherited peripheral neuropathies. PMID:27025386

  11. Patterns of homoeologous gene expression shown by RNA sequencing in hexaploid bread wheat.

    KAUST Repository

    Leach, Lindsey J

    2014-04-11

    BACKGROUND: Bread wheat (Triticum aestivum) has a large, complex and hexaploid genome consisting of A, B and D homoeologous chromosome sets. Therefore each wheat gene potentially exists as a trio of A, B and D homoeoloci, each of which may contribute differentially to wheat phenotypes. We describe a novel approach combining wheat cytogenetic resources (chromosome substitution \\'nullisomic-tetrasomic\\' lines) with next generation deep sequencing of gene transcripts (RNA-Seq), to directly and accurately identify homoeologue-specific single nucleotide variants and quantify the relative contribution of individual homoeoloci to gene expression. RESULTS: We discover, based on a sample comprising ~5-10% of the total wheat gene content, that at least 45% of wheat genes are expressed from all three distinct homoeoloci. Most of these genes show strikingly biased expression patterns in which expression is dominated by a single homoeolocus. The remaining ~55% of wheat genes are expressed from either one or two homoeoloci only, through a combination of extensive transcriptional silencing and homoeolocus loss. CONCLUSIONS: We conclude that wheat is tending towards functional diploidy, through a variety of mechanisms causing single homoeoloci to become the predominant source of gene transcripts. This discovery has profound consequences for wheat breeding and our understanding of wheat evolution.

  12. Sequence analysis of mitochondrial 16S ribosomal RNA gene fragment from seven mosquito species

    Indian Academy of Sciences (India)

    Yogesh S Shouche; Milind S Patole

    2000-12-01

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence analysis of the mitochondrial 16S rRNA gene has been used for molecular taxonomy in many insects. In this paper, we have analysed a 450 bp hypervariable region of the mitochondrial 16S rRNA gene in three major genera of mosquitoes, Aedes, Anopheles and Culex. The sequence was found to be unusually A + T rich and in substitutions the rate of transversions was higher than the transition rate. A phylogenetic tree was constructed with these sequences. An interesting feature of the sequences was a stretch of Ts that distinguished between Aedes and Culex on the one hand, and Anopheles on the other. This is the first report of mitochondrial rRNA sequences from these medically important genera of mosquitoes.

  13. CLONING AND SEQUENCING OF MATURE FRAGMENT OF HUMAN BMP4 GENE

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective To study the cloning and sequencing of mature fragment of human bone morphogenetic protein-4 gene. Methods The template DNA was obtained from the human osteosarcoma cell line U2OS. By using RT- PCR method, the cDNA coding for the mature fragment of BMP-4 was amplified, cloned into the vector pUC19, and sequenced by Sanger Dideoxy-mediated Chain Termination method. Results The mature fragment of BMP4 cDNA was obtained by RT-PCR and determined by sequencing. Through the computer search on Genebank, the analysis showed that the homology of nucleotides and amino acids between cDNA of rhBMP4 mature fragment of this study and the published sequence was 99%. Sequence analysis showed that there were two differences, one was at base 1154 (201): G→C, which had no influence on the corresponding amino acids (Val). Another was at basel222 (269):C→T, the mutation at the base 1222 had the change of Ala to Val. Conclusion The mature fragment of BMP4 gene has been cloned. The results will be of great significance in treatment of skeletal injuries and diseases.

  14. Cloning and sequence analysis of β-actin gene from Aedes albopictus (Diptera: Culicidae)

    Institute of Scientific and Technical Information of China (English)

    Weijie Wang; Xiaobang Hu; Donghui Zhang; Jianhua Jiao; Yan Sun; Lei Ma; Changliang Zhu

    2007-01-01

    Objective: To obtain the complete β-actin gene from Aedes albopictus. Methods: Total RNA was extracted from C6/36 cells. Degenerate primers were designed based on the β-actin sequences of An. gambiae, Ae. aegypti, Cx. pipiens pallens and D.melanogaster. By RT-PCR, the product was amplified, purified, cloned into the pGT vector and sequenced. The β-actin sequence was aligned and phylogenetically analyzed by the BLAST program and the CLUSTAL W program. Results: A sequence of 1132 bp including an open reading frame of 1131 bp was obtained (GenBank DQ657949). The deduced protein had 376 amino acids.Aligned to SWISS-PROT, it exhibited a high level of identity with β-actins from Anopheles, Drosophila and Culex at the amino acid sequence level. Phylogenetic analysis indicated that Ae. albopictus β-actin was much more homologous with invertebrate β-actin than with vertebrate β-actin. Conclusion: The gene may be used as the internal control in the experiments of Ae. albopictus.

  15. Molecular characterization, tissue expression and sequence variability of the barramundi (Lates calcarifer myostatin gene

    Directory of Open Access Journals (Sweden)

    Smith-Keune Carolyn

    2008-02-01

    Full Text Available Abstract Background Myostatin (MSTN is a member of the transforming growth factor-β superfamily that negatively regulates growth of skeletal muscle tissue. The gene encoding for the MSTN peptide is a consolidate candidate for the enhancement of productivity in terrestrial livestock. This gene potentially represents an important target for growth improvement of cultured finfish. Results Here we report molecular characterization, tissue expression and sequence variability of the barramundi (Lates calcarifer MSTN-1 gene. The barramundi MSTN-1 was encoded by three exons 379, 371 and 381 bp in length and translated into a 376-amino acid peptide. Intron 1 and 2 were 412 and 819 bp in length and presented typical GT...AG splicing sites. The upstream region contained cis-regulatory elements such as TATA-box and E-boxes. A first assessment of sequence variability suggested that higher mutation rates are found in the 5' flanking region with several SNP's present in this species. A putative micro RNA target site has also been observed in the 3'UTR (untranslated region and is highly conserved across teleost fish. The deduced amino acid sequence was conserved across vertebrates and exhibited characteristic conserved putative functional residues including a cleavage motif of proteolysis (RXXR, nine cysteines and two glycosilation sites. A qualitative analysis of the barramundi MSTN-1 expression pattern revealed that, in adult fish, transcripts are differentially expressed in various tissues other than skeletal muscles including gill, heart, kidney, intestine, liver, spleen, eye, gonad and brain. Conclusion Our findings provide valuable insights such as sequence variation and genomic information which will aid the further investigation of the barramundi MSTN-1 gene in association with growth. The finding for the first time in finfish MSTN of a miRNA target site in the 3'UTR provides an opportunity for the identification of regulatory mutations on the

  16. Gene discovery in the threatened elkhorn coral: 454 sequencing of the Acropora palmata transcriptome.

    Directory of Open Access Journals (Sweden)

    Nicholas R Polato

    Full Text Available BACKGROUND: Cnidarians, including corals and anemones, offer unique insights into metazoan evolution because they harbor genetic similarities with vertebrates beyond that found in model invertebrates and retain genes known only from non-metazoans. Cataloging genes expressed in Acropora palmata, a foundation-species of reefs in the Caribbean and western Atlantic, will advance our understanding of the genetic basis of ecologically important traits in corals and comes at a time when sequencing efforts in other cnidarians allow for multi-species comparisons. RESULTS: A cDNA library from a sample enriched for symbiont free larval tissue was sequenced on the 454 GS-FLX platform. Over 960,000 reads were obtained and assembled into 42,630 contigs. Annotation data was acquired for 57% of the assembled sequences. Analysis of the assembled sequences indicated that 83-100% of all A. palmata transcripts were tagged, and provided a rough estimate of the total number genes expressed in our samples (~18,000-20,000. The coral annotation data contained many of the same molecular components as in the Bilateria, particularly in pathways associated with oxidative stress and DNA damage repair, and provided evidence that homologs of p53, a key player in DNA repair pathways, has experienced selection along the branch separating Cnidaria and Bilateria. Transcriptome wide screens of paralog groups and transition/transversion ratios highlighted genes including: green fluorescent proteins, carbonic anhydrase, and oxidative stress proteins; and functional groups involved in protein and nucleic acid metabolism, and the formation of structural molecules. These results provide a starting point for study of adaptive evolution in corals. CONCLUSIONS: Currently available transcriptome data now make comparative studies of the mechanisms underlying coral's evolutionary success possible. Here we identified candidate genes that enable corals to maintain genomic integrity despite

  17. Hypoxia-induced protein binding to O2-responsive sequences on the tyrosine hydroxylase gene.

    Science.gov (United States)

    Norris, M L; Millhorn, D E

    1995-10-01

    We reported recently that the gene that encodes tyrosine hydroxylase (TH), the rate-limiting enzyme in the biosynthesis of catecholamines, is regulated by hypoxia in the dopaminergic cells of the mammalian carotid body (Czyzyk-Krzeska, M. F., Bayliss, D. A., Lawson, E. E. & Millhorn, D. E. (1992) J. Neurochem. 58, 1538-1546) and in pheochromocytoma (PC12) cells (Czyzyk-Krzeska, M. F., Furnari, B. A., Lawson, E. E. & Millhorn, D. E. (1994) J. Biol. Chem. 269, 760-764). Regulation of this gene during low O2 conditions occurs at both the level of transcription and RNA stability. Increased transcription during hypoxia is regulated by a region of the proximal promoter that extends from -284 to + 27 bases, relative to transcription start site. The present study was undertaken to further characterize the sequences that confer O2 responsiveness of the TH gene and to identify hypoxia-induced protein interactions with these sequences. Results from chloramphenicol acetyltransferase assays identified a region between bases -284 and -150 that contains the essential sequences for O2 regulation. This region contains a number of regulatory elements including AP1, AP2, and HIF-1. Gel shift assays revealed enhanced protein interactions at the AP1 and HIF-1 elements of the native gene. Further investigations using supershift and shift-Western analysis showed that c-Fos and JunB bind to the AP1 element during hypoxia and that these protein levels are stimulated by hypoxia. Mutation of the AP1 sequence prevented stimulation of transcription of the TH-chloramphenicol acetyltransferase reporter gene by hypoxia. PMID:7559551

  18. Gene identification and protein classification in microbial metagenomic sequence data via incremental clustering

    Directory of Open Access Journals (Sweden)

    Li Weizhong

    2008-04-01

    Full Text Available Abstract Background The identification and study of proteins from metagenomic datasets can shed light on the roles and interactions of the source organisms in their communities. However, metagenomic datasets are characterized by the presence of organisms with varying GC composition, codon usage biases etc., and consequently gene identification is challenging. The vast amount of sequence data also requires faster protein family classification tools. Results We present a computational improvement to a sequence clustering approach that we developed previously to identify and classify protein coding genes in large microbial metagenomic datasets. The clustering approach can be used to identify protein coding genes in prokaryotes, viruses, and intron-less eukaryotes. The computational improvement is based on an incremental clustering method that does not require the expensive all-against-all compute that was required by the original approach, while still preserving the remote homology detection capabilities. We present evaluations of the clustering approach in protein-coding gene identification and classification, and also present the results of updating the protein clusters from our previous work with recent genomic and metagenomic sequences. The clustering results are available via CAMERA, (http://camera.calit2.net. Conclusion The clustering paradigm is shown to be a very useful tool in the analysis of microbial metagenomic data. The incremental clustering method is shown to be much faster than the original approach in identifying genes, grouping sequences into existing protein families, and also identifying novel families that have multiple members in a metagenomic dataset. These clusters provide a basis for further studies of protein families.

  19. FrameD: a flexible program for quality check and gene prediction in prokaryotic genomes and noisy matured eukaryotic sequences

    Science.gov (United States)

    Schiex, Thomas; Gouzy, Jérôme; Moisan, Annick; de Oliveira, Yannick

    2003-01-01

    We describe FrameD, a program that predicts coding regions in prokaryotic and matured eukaryotic sequences. Initially targeted at gene prediction in bacterial GC rich genomes, the gene model used in FrameD also allows to predict genes in the presence of frameshifts and partially undetermined sequences which makes it also very suitable for gene prediction and frameshift correction in unfinished sequences such as EST and EST cluster sequences. Like recent eukaryotic gene prediction programs, FrameD also includes the ability to take into account protein similarity information both in its prediction and its graphical output. Its performances are evaluated on different bacterial genomes. The web site (http://genopole.toulouse.inra.fr/bioinfo/FrameD/FD) allows direct prediction, sequence correction and translation and the ability to learn new models for new organisms. PMID:12824407

  20. Mycoplasma pneumoniae P1 Type 1- and Type 2-Specific Sequences within the P1 Cytadhesin Gene of Individual Strains

    OpenAIRE

    Dorigo-Zetsma, J. Wendelien; Wilbrink, Berry; Dankert, Jacob; Zaat, Sebastian A.J.

    2001-01-01

    Mycoplasma pneumoniae strains traditionally are divided into two types, based on sequence variation in the P1 gene. Recently, however, we have identified 8 P1 subtypes by restriction fragment length polymorphism analysis. In the present study the P1 gene sequences of three P1 type 1 and two P1 type 2 M. pneumoniae strains were analyzed. A new P1 gene sequence in a type 1 strain with partial similarity to a recently reported variable region in the P1 gene of an M. pneumoniae type 2 strain (T. ...

  1. Transposable elements: an abundant and natural source of regulatory sequences for host genes.

    Science.gov (United States)

    Rebollo, Rita; Romanish, Mark T; Mager, Dixie L

    2012-01-01

    The fact that transposable elements (TEs) can influence host gene expression was first recognized more than 50 years ago. However, since that time, TEs have been widely regarded as harmful genetic parasites-selfish elements that are rarely co-opted by the genome to serve a beneficial role. Here, we survey recent findings that relate to TE impact on host genes and remind the reader that TEs, in contrast to other noncoding parts of the genome, are uniquely suited to gene regulatory functions. We review recent studies that demonstrate the role of TEs in establishing and rewiring gene regulatory networks and discuss the overall ubiquity of exaptation. We suggest that although individuals within a population can be harmed by the deleterious effects of new TE insertions, the presence of TE sequences in a genome is of overall benefit to the population. PMID:22905872

  2. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Bell, D.A. (National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States))

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  3. Identification of a DNA binding protein that recognizes the nonamer recombinational signal sequence of immunoglobulin genes.

    Science.gov (United States)

    Halligan, B D; Desiderio, S V

    1987-10-01

    Extracts of nuclei from B- and T-lymphoid cells contain a protein that binds specifically to the conserved nonamer DNA sequence within the recombinational signals of immunoglobulin genes. Complexes with DNA fragments from four kappa light-chain joining (J) segments have the same electrophoretic mobility. Nonamer-containing DNA fragments from heavy-chain and light-chain genes compete for binding. Within the 5'-flanking DNA of the J kappa 4 gene segment, the binding site has been localized to a 27-base-pair interval spanning the nonamer region. The binding activity is recovered as a single peak after ion-exchange chromatography. The site of binding of the protein and its presence in nuclei of lymphoid cells suggest that it may function in the assembly of immunoglobulin genes.

  4. Hematological- and Neurological-Expressed Sequence 1 Gene Products in Progenitor Cells during Newt Retinal Development

    Directory of Open Access Journals (Sweden)

    Tatsushi Goto

    2012-01-01

    Full Text Available Urodele amphibians such as Japanese common newts have a remarkable ability to regenerate their injured neural retina, even as adults. We found that hematological- and neurological-expressed sequence 1 (Hn1 gene was induced in depigmented retinal pigment epithelial (RPE cells, and its expression was maintained at later stages of newt retinal regeneration. In this study, we investigated the distribution of the HN1 protein, the product of the Hn1 gene, in the developing retinas. Our immunohistochemical analyses suggested that the HN1 protein was highly expressed in an immature retina, and the subcellular localization changed during this retinogenesis as observed in newt retinal regeneration. We also found that the expression of Hn1 gene was not induced in mouse after retinal removal. Our results showed that Hn1 gene can be useful for detection of undifferentiated and dedifferentiated cells during both newt retinal development and regeneration.

  5. Genepleio Software for Effective Estimation of Gene Pleiotropy from Protein Sequences

    Directory of Open Access Journals (Sweden)

    Wenhai Chen

    2015-01-01

    Full Text Available Though pleiotropy, which refers to the phenomenon of a gene affecting multiple traits, has long played a central role in genetics, development, and evolution, estimation of the number of pleiotropy components remains a hard mission to accomplish. In this paper, we report a newly developed software package, Genepleio, to estimate the effective gene pleiotropy from phylogenetic analysis of protein sequences. Since this estimate can be interpreted as the minimum pleiotropy of a gene, it is used to play a role of reference for many empirical pleiotropy measures. This work would facilitate our understanding of how gene pleiotropy affects the pattern of genotype-phenotype map and the consequence of organismal evolution.

  6. Sequence of the Ampullariella sp. strain 3876 gene coding for xylose isomerase.

    OpenAIRE

    Saari, G C; Kumar, A A; Kawasaki, G H; Insley, M Y; O'Hara, P J

    1987-01-01

    The nucleotide sequence of the gene coding for xylose isomerase from Ampullariella sp. strain 3876, a gram-positive bacterium, has been determined. A clone of a fragment of strain 3876 DNA coding for a xylose isomerase activity was identified by its ability to complement a xylose isomerase-defective Escherichia coli strain. One such complementation positive fragment, 2,922 nucleotides in length, was sequenced in its entirety. There are two open reading frames 1,182 and 1,242 nucleotides in le...

  7. Transcriptome profiling of bovine milk oligosaccharide metabolism genes using RNA-sequencing.

    Directory of Open Access Journals (Sweden)

    Saumya Wickramasinghe

    Full Text Available This study examines the genes coding for enzymes involved in bovine milk oligosaccharide metabolism by comparing the oligosaccharide profiles with the expressions of glycosylation-related genes. Fresh milk samples (n = 32 were collected from four Holstein and Jersey cows at days 1, 15, 90 and 250 of lactation and free milk oligosaccharide profiles were analyzed. RNA was extracted from milk somatic cells at days 15 and 250 of lactation (n = 12 and gene expression analysis was conducted by RNA-Sequencing. A list was created of 121 glycosylation-related genes involved in oligosaccharide metabolism pathways in bovine by analyzing the oligosaccharide profiles and performing an extensive literature search. No significant differences were observed in either oligosaccharide profiles or expressions of glycosylation-related genes between Holstein and Jersey cows. The highest concentrations of free oligosaccharides were observed in the colostrum samples and a sharp decrease was observed in the concentration of free oligosaccharides on day 15, followed by progressive decrease on days 90 and 250. Ninety-two glycosylation-related genes were expressed in milk somatic cells. Most of these genes exhibited higher expression in day 250 samples indicating increases in net glycosylation-related metabolism in spite of decreases in free milk oligosaccharides in late lactation milk. Even though fucosylated free oligosaccharides were not identified, gene expression indicated the likely presence of fucosylated oligosaccharides in bovine milk. Fucosidase genes were expressed in milk and a possible explanation for not detecting fucosylated free oligosaccharides is the degradation of large fucosylated free oligosaccharides by the fucosidases. Detailed characterization of enzymes encoded by the 92 glycosylation-related genes identified in this study will provide the basic knowledge for metabolic network analysis of oligosaccharides in mammalian milk. These candidate

  8. Extensive 16S rRNA gene sequence diversity in Campylobacter hyointestinalis strains: taxonomic and applied implications

    DEFF Research Database (Denmark)

    Harrington, C.S.; On, Stephen L.W.

    1999-01-01

    Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96...... of the genus Campylobacter, emphasizing the need for multiple strain analysis when using 16S rRNA gene sequence comparisons for taxonomic investigations....

  9. Large-scale Gene Ontology analysis of plant transcriptome-derived sequences retrieved by AFLP technology

    Directory of Open Access Journals (Sweden)

    Ramina Angelo

    2008-07-01

    Full Text Available Abstract Background After 10-year-use of AFLP (Amplified Fragment Length Polymorphism technology for DNA fingerprinting and mRNA profiling, large repertories of genome- and transcriptome-derived sequences are available in public databases for model, crop and tree species. AFLP marker systems have been and are being extensively exploited for genome scanning and gene mapping, as well as cDNA-AFLP for transcriptome profiling and differentially expressed gene cloning. The evaluation, annotation and classification of genomic markers and expressed transcripts would be of great utility for both functional genomics and systems biology research in plants. This may be achieved by means of the Gene Ontology (GO, consisting in three structured vocabularies (i.e. ontologies describing genes, transcripts and proteins of any organism in terms of their associated cellular component, biological process and molecular function in a species-independent manner. In this paper, the functional annotation of about 8,000 AFLP-derived ESTs retrieved in the NCBI databases was carried out by using GO terminology. Results Descriptive statistics on the type, size and nature of gene sequences obtained by means of AFLP technology were calculated. The gene products associated with mRNA transcripts were then classified according to the three main GO vocabularies. A comparison of the functional content of cDNA-AFLP records was also performed by splitting the sequence dataset into monocots and dicots and by comparing them to all annotated ESTs of Arabidopsis and rice, respectively. On the whole, the statistical parameters adopted for the in silico AFLP-derived transcriptome-anchored sequence analysis proved to be critical for obtaining reliable GO results. Such an exhaustive annotation may offer a suitable platform for functional genomics, particularly useful in non-model species. Conclusion Reliable GO annotations of AFLP-derived sequences can be gathered through the optimization

  10. Nematode Diversity of Qingdao Coast Inferred from the 18S Ribosomal RNA Gene Sequence Analysis

    Institute of Scientific and Technical Information of China (English)

    SHEN Xiquan; YANG Guanpin; LIU Yongjian

    2007-01-01

    The 18S ribosomal DNA gene (18S rDNA) sequences (approximately 1300 bp in length) were amplified from the DNA extracted from the free-living marine nematodes collected from the inter-tidal sediment of Qingdao coast in bulk with nematode specific primers. The PCR products were cloned, re-amplified, digested with Rsa I and Hin6Ⅰ restriction endonucleases and separated in agarose gel. Among 17 restriction fragment length types, types 1, 2 and 6 covered 61.2%, 14.4% and 9.3% of the clones analyzed, respectively, while the remaining 14 only covered 21 clones, which accounted for 15.1% of the total. Twenty-four representative clones were sequenced and phylogenetically analyzed by referring to those currently available in RDP and GenBank databases. Although it was hard to assign these sequences to known species or genera due to the lack of the 18S rDNA sequence data of known marine free-living nematodes, the obtained sequences were assigned to the nematodes of Adenophorea. Among them, twelve sequences were close to Pontonema vulgare and Adoncholaimus sp., four to Daptonemaprocerus and two (identical) to Enoplus brevis. Our results showed that free-living marine nematode diversities could be determined by PCR retrieving and analysis of the 18S rDNA sequences and an 18S rDNA sequence could be assigned to a species or a genus only if the 18S rDNA sequences of the free-living marine nematodes were accumulated to some extent.

  11. Deep RNA sequencing analysis of readthrough gene fusions in human prostate adenocarcinoma and reference samples

    Directory of Open Access Journals (Sweden)

    Nacu Serban

    2011-01-01

    Full Text Available Abstract Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs, have been estimated using expressed sequence tag (EST libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal

  12. Cloning and Sequence of Glycoprotein H Gene of Duck Plague Virus

    Institute of Scientific and Technical Information of China (English)

    HAN Xian-jie; WANG Jun-wei; MA Bo

    2006-01-01

    The glycoprotein H (gH) gene homologue of duck plague virus (DPV) was cloned by degenerate polymerase chain reaction (PCR) and sequenced. It was located immediately downstream from the thymidine kinase gene (TK). In addition,the 3'-end of the gene homologue to herpesvirus UL21 was located downstream from the gH gene. DPV gH gene open reading frame (ORF) was 2 505 bp in length and its primary translation product was a polypeptide of 834 amino acids long.It possessed several characteristics of membrane glycoproteins, including an N-terminal hydrophobic signal sequence,an external domain containing eight putative N-linked glycosylation sites, a C-terminal transmembrane domain, and a charged cytoplasmic tail. Comparison with other herpesvirus revealed identities of 20.2, 25.1, 23.0, 23.0, 26.5 and 26.0% with the gH counterparts of the human herpesvirus virus 1 (HSV1), equine herpesvirus 4 (EHV4), bovine herpesvirus 1 (BHV1), pseudorabies virus (PRV), gallid herpesvirus 2 (GHV2) and gallid herpesvirus 3 (GHV3), respectively.

  13. Sequencing of Candidate Genes Selected by Beta Cell Experts in Monogenic Diabetes of Unknown Aetiology

    Directory of Open Access Journals (Sweden)

    Emma L Edghill

    2010-01-01

    Full Text Available Context Approximately 39% of cases with permanent neonatal diabetes (PNDM and about 11% with maturity onset diabetes of the young (MODY have an unknown genetic aetiology. Many of the known genes causing MODY and PNDM were identified as being critical for beta cell function before their identification as a cause of monogenic diabetes. Objective We used nominations from the EU beta cell consortium EURODIA project partners to guide gene candidacy. Subjects Seventeen cases with permanent neonatal diabetes and 8 cases with maturity onset diabetes of the young. Main outcome measures The beta cell experts within the EURODIA consortium were asked to nominate 3 “gold”, 3 “silver” and 4 “bronze” genes based on biological or genetic grounds. We sequenced twelve candidate genes from the list based on evidence for candidacy. Results Sequencing ISL1, LMX1A, MAFA, NGN3, NKX2.2, NKX6.1, PAX4, PAX6, SOX2, SREBF1, SYT9 and UCP2 did not identify any pathogenic mutations. Conclusion Further work is needed to identify novel causes of permanent neonatal diabetes and maturity onset diabetes of the young utilising genetic approaches as well as further candidate genes.

  14. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae Inferred from Multiple Nuclear Gene Sequences

    Directory of Open Access Journals (Sweden)

    Keun-Yong Kim

    2013-01-01

    Full Text Available Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1, recombination activating gene 2 (rag2, and early growth response 1 gene (egr1, from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia.

  15. Transcriptome Sequencing Identified Genes and Gene Ontologies Associated with Early Freezing Tolerance in Maize

    Science.gov (United States)

    Li, Zhao; Hu, Guanghui; Liu, Xiangfeng; Zhou, Yao; Li, Yu; Zhang, Xu; Yuan, Xiaohui; Zhang, Qian; Yang, Deguang; Wang, Tianyu; Zhang, Zhiwu

    2016-01-01

    Originating in a tropical climate, maize has faced great challenges as cultivation has expanded to the majority of the world's temperate zones. In these zones, frost and cold temperatures are major factors that prevent maize from reaching its full yield potential. Among 30 elite maize inbred lines adapted to northern China, we identified two lines of extreme, but opposite, freezing tolerance levels—highly tolerant and highly sensitive. During the seedling stage of these two lines, we used RNA-seq to measure changes in maize whole genome transcriptome before and after freezing treatment. In total, 19,794 genes were expressed, of which 4550 exhibited differential expression due to either treatment (before or after freezing) or line type (tolerant or sensitive). Of the 4550 differently expressed genes, 948 exhibited differential expression due to treatment within line or lines under freezing condition. Analysis of gene ontology found that these 948 genes were significantly enriched for binding functions (DNA binding, ATP binding, and metal ion binding), protein kinase activity, and peptidase activity. Based on their enrichment, literature support, and significant levels of differential expression, 30 of these 948 genes were selected for quantitative real-time PCR (qRT-PCR) validation. The validation confirmed our RNA-Seq-based findings, with squared correlation coefficients of 80% and 50% in the tolerance and sensitive lines, respectively. This study provided valuable resources for further studies to enhance understanding of the molecular mechanisms underlying maize early freezing response and enable targeted breeding strategies for developing varieties with superior frost resistance to achieve yield potential. PMID:27774095

  16. Gene Identification and Expression Analysis of 86,136 Expressed Sequence Tags (EST) from the Rice Genome

    Institute of Scientific and Technical Information of China (English)

    Yan Zhou; Lin Ye; Li Lin; Jun Li; Xuegang Wang; Hao Xu; Yibin Pan; Wei Lin; Wei Tian; Jing Liu; Liping Wei; Jiabin Tang; Siqi Liu; Huanming Yang; Jun Yu; Jian Wang; Michael G. Walker; Xiuqing Zhang; Jun Wang; Songnian Hu; Huayong Xu; Yajun Deng; Jianhai Dong

    2003-01-01

    Expressed Sequence Tag (EST) analysis has pioneered genome-wide gene discovery and expression profiling. In order to establish a gene expression index in the rice cultivar indica, we sequenced and analyzed 86,136 ESTs from nine rice cDNA libraries from the super hybrid cultivar LYP9 and its parental cultivars. We assembled these ESTs into 13,232 contigs and leave 8,976 singletons. Overall, 7,497 sequences were found similar to the existing sequences in GenBank and 14,711 are novel. These sequences are classified by molecular function, biological process and pathways according to the Gene Ontology. We compared our sequenced ESTs with the publicly available 95,000 ESTs from japonica, and found little sequence variation, despite the large difference between genome sequences. We then assembled the combined 173,000 rice ESTs for further analysis. Using the pooled ESTs, we compared gene expression in metabolism pathway between rice and Avabidopsis according to KEGG. We further profiled gene expression patterns in different tis sues, developmental stages, and in a conditional sterile mutant, after checking the libraries are comparable by means of sequence coverage. We also identified some possible library specific genes and a number of enzymes and transcription factors that contribute to rice development.

  17. Gene Expression Analysis in the Age of Mass Sequencing: An Introduction.

    Science.gov (United States)

    Pilarsky, Christian; Nanduri, Lahiri Kanth; Roy, Janine

    2016-01-01

    During the last years the technology used for gene expression analysis has changed dramatically. The old mainstay, DNA microarray, has served its due course and will soon be replaced by next-generation sequencing (NGS), the Swiss army knife of modern high-throughput nucleic acid-based analysis. Therefore preparation technologies have to adapt to suit the emerging NGS technology platform. Moreover, interpretation of the results is still time consuming and employs the use of high-end computers usually not found in molecular biology laboratories. Alternatively, cloud computing might solve this problem. Nevertheless, these new challenges have to be embraced for gene expression analysis in general. PMID:26667455

  18. Captured metagenomics: large-scale targeting of genes based on ‘sequence capture’ reveals functional diversity in soils

    OpenAIRE

    Manoharan, Lokeshwaran; Kushwaha, Sandeep K; Hedlund, Katarina; Ahrén, Dag

    2015-01-01

    Microbial enzyme diversity is a key to understand many ecosystem processes. Whole metagenome sequencing (WMG) obtains information on functional genes, but it is costly and inefficient due to large amount of sequencing that is required. In this study, we have applied a captured metagenomics technique for functional genes in soil microorganisms, as an alternative to WMG. Large-scale targeting of functional genes, coding for enzymes related to organic matter degradation, was applied to two agric...

  19. Sequencing of rhesus macaque Y chromosome clarifies origins and evolution of the DAZ (Deleted in AZoospermia) genes

    OpenAIRE

    Hughes, Jennifer F.; Skaletsky, Helen; Page, David C.

    2012-01-01

    Studies of Y chromosome evolution often emphasize gene loss, but this loss has been counterbalanced by addition of new genes. The DAZ genes, which are critical to human spermatogenesis, were acquired by the Y chromosome in the ancestor of Old World monkeys and apes. We and our colleagues recently sequenced the rhesus macaque Y chromosome, and comparison of this sequence to human and chimpanzee enables us to reconstruct much of the evolutionary history of DAZ. We report that DAZ arrived on the...

  20. Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

    DEFF Research Database (Denmark)

    Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P

    1991-01-01

    After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....

  1. Sequence analysis of the inversion region containing the pilin genes of Moraxella bovis.

    Science.gov (United States)

    Fulks, K A; Marrs, C F; Stevens, S P; Green, M R

    1990-01-01

    Moraxella bovis EPP63 is able to produce two antigenically distinct pili called Q and I pili (previously called beta and alpha pili). Hybridization studies have shown that the transition between the types is due to inversion of a 2.1-kilobase segment of chromosomal DNA. We present the sequence of a 4.1-kilobase region of cloned DNA spanning the entire inversion region in orientation 1 (Q pilin expressed). Comparison of this sequence with the sequence of the polymerase chain reaction-amplified genomic DNA from orientation 2 (I pilin expressed) allows the site-specific region of recombination to be localized to a 26-base-pair region in which sequence similarity to the left inverted repeat of the Salmonella typhimurium hin system was previously noted. In addition, 50% sequence similarity was seen in a 60-base-pair segment of our sequence to the recombinational enhancer of bacteriophage P1, an inversion system related to the hin system of S. typhimurium. Finally, two open reading frames representing potential genes were identified.

  2. Comparison of inherently essential genes of Porphyromonas gingivalis identified in two transposon-sequencing libraries.

    Science.gov (United States)

    Hutcherson, J A; Gogeneni, H; Yoder-Himes, D; Hendrickson, E L; Hackett, M; Whiteley, M; Lamont, R J; Scott, D A

    2016-08-01

    Porphyromonas gingivalis is a Gram-negative anaerobe and keystone periodontal pathogen. A mariner transposon insertion mutant library has recently been used to define 463 genes as putatively essential for the in vitro growth of P. gingivalis ATCC 33277 in planktonic culture (Library 1). We have independently generated a transposon insertion mutant library (Library 2) for the same P. gingivalis strain and herein compare genes that are putatively essential for in vitro growth in complex media, as defined by both libraries. In all, 281 genes (61%) identified by Library 1 were common to Library 2. Many of these common genes are involved in fundamentally important metabolic pathways, notably pyrimidine cycling as well as lipopolysaccharide, peptidoglycan, pantothenate and coenzyme A biosynthesis, and nicotinate and nicotinamide metabolism. Also in common are genes encoding heat-shock protein homologues, sigma factors, enzymes with proteolytic activity, and the majority of sec-related protein export genes. In addition to facilitating a better understanding of critical physiological processes, transposon-sequencing technology has the potential to identify novel strategies for the control of P. gingivalis infections. Those genes defined as essential by two independently generated TnSeq mutant libraries are likely to represent particularly attractive therapeutic targets.

  3. Activation of the lac genes of Tn951 by insertion sequences from Pseudomonas cepacia.

    Science.gov (United States)

    Wood, M S; Lory, C; Lessie, T G

    1990-04-01

    We have identified three transposable gene-activating elements from Pseudomonas cepacia on the basis of their abilities to increase expression of the lac genes of the broad-host-range plasmid pGC91.14 (pRP1::Tn951). When introduced into auxotrophic derivatives of P. cepacia 249 (ATCC 17616), this plasmid failed to confer the ability to utilize lactose. The lac genes of Tn951 were poorly expressed in P. cepacia and were not induced by isopropyl-beta-D-thiogalactopyranoside. Lac+ variants of the pGC91.14-containing strains which formed beta-galactosidase at high constitutive levels as a consequence of transposition of insertion sequences from the P. cepacia genome to sites upstream of the lacZ gene of Tn951 were isolated. Certain of the elements also increased gene expression in other bacteria. For example, IS407 strongly activated the lacZ gene of Tn951 in Pseudomonas aeruginosa and Escherichia coli, and IS406 (but not IS407) did so in Zymomonas mobilis. The results indicate that IS elements from P. cepacia have potential for turning on the expression of foreign genes in a variety of gram-negative bacteria. PMID:2156800

  4. Comparison of inherently essential genes of Porphyromonas gingivalis identified in two transposon-sequencing libraries.

    Science.gov (United States)

    Hutcherson, J A; Gogeneni, H; Yoder-Himes, D; Hendrickson, E L; Hackett, M; Whiteley, M; Lamont, R J; Scott, D A

    2016-08-01

    Porphyromonas gingivalis is a Gram-negative anaerobe and keystone periodontal pathogen. A mariner transposon insertion mutant library has recently been used to define 463 genes as putatively essential for the in vitro growth of P. gingivalis ATCC 33277 in planktonic culture (Library 1). We have independently generated a transposon insertion mutant library (Library 2) for the same P. gingivalis strain and herein compare genes that are putatively essential for in vitro growth in complex media, as defined by both libraries. In all, 281 genes (61%) identified by Library 1 were common to Library 2. Many of these common genes are involved in fundamentally important metabolic pathways, notably pyrimidine cycling as well as lipopolysaccharide, peptidoglycan, pantothenate and coenzyme A biosynthesis, and nicotinate and nicotinamide metabolism. Also in common are genes encoding heat-shock protein homologues, sigma factors, enzymes with proteolytic activity, and the majority of sec-related protein export genes. In addition to facilitating a better understanding of critical physiological processes, transposon-sequencing technology has the potential to identify novel strategies for the control of P. gingivalis infections. Those genes defined as essential by two independently generated TnSeq mutant libraries are likely to represent particularly attractive therapeutic targets. PMID:26358096

  5. Genome sequence surveys of Brachiola algerae and Edhazardia aedis reveal microsporidia with low gene densities

    Directory of Open Access Journals (Sweden)

    Fast Naomi M

    2008-04-01

    Full Text Available Abstract Background Microsporidia are well known models of extreme nuclear genome reduction and compaction. The smallest microsporidian genomes have received the most attention, but genomes of different species range in size from 2.3 Mb to 19.5 Mb and the nature of the larger genomes remains unknown. Results Here we have undertaken genome sequence surveys of two diverse microsporidia, Brachiola algerae and Edhazardia aedis. In both species we find very large intergenic regions, many transposable elements, and a low gene-density, all in contrast to the small, model microsporidian genomes. We also find no recognizable genes that are not also found in other surveyed or sequenced microsporidian genomes. Conclusion Our results demonstrate that microsporidian genome architecture varies greatly between microsporidia. Much of the genome size difference could be accounted for by non-coding material, such as intergenic spaces and retrotransposons, and this suggests that the forces dictating genome size may vary across the phylum.

  6. Exome sequencing of ion channel genes reveals complex variant profiles confounding personal risk assessment in epilepsy

    Science.gov (United States)

    Klassen, Tara; Davis, Caleb; Goldman, Alica; Burgess, Dan; Chen, Tim; Wheeler, David; McPherson, John; Bourquin, Traci; Lewis, Lora; Villasana, Donna; Morgan, Margaret; Muzny, Donna; Gibbs, Richard; Noebels, Jeffrey

    2011-01-01

    Ion channel mutations are an important cause of rare Mendelian disorders affecting brain, heart, and other tissues. We performed parallel exome sequencing of 237 channel genes in a well characterized human sample, comparing variant profiles of unaffected individuals to those with the most common neuronal excitability disorder, sporadic idiopathic epilepsy. Rare missense variation in known Mendelian disease genes is prevalent in both groups at similar complexity, revealing that even deleterious ion channel mutations confer uncertain risk to an individual depending on the other variants with which they are combined. Our findings indicate that variant discovery via large scale sequencing efforts is only a first step in illuminating the complex allelic architecture underlying personal disease risk. We propose that in silico modeling of channel variation in realistic cell and network models will be crucial to future strategies assessing mutation profile pathogenicity and drug response in individuals with a broad spectrum of excitability disorders. PMID:21703448

  7. Coptotermes gestroi (Isoptera: Rhinotermitidae) in Brazil: possible origins inferred by mitochondrial cytochrome oxidase II gene sequences.

    Science.gov (United States)

    Martins, C; Fontes, L R; Bueno, O C; Martins, V G

    2010-09-01

    The Asian subterranean termite, Coptotermes gestroi, originally from northeast India through Burma, Thailand, Malaysia, and the Indonesian archipelago, is a major termite pest introduced in several countries around the world, including Brazil. We sequenced the mitochondrial COII gene from individuals representing 23 populations. Phylogenetic analysis of COII gene sequences from this and other studies resulted in two main groups: (1) populations of Cleveland (USA) and four populations of Malaysia and (2) populations of Brazil, four populations of Malaysia, and one population from each of Thailand, Puerto Rico, and Key West (USA). Three new localities are reported here, considerably enlarging the distribution of C. gestroi in Brazil: Campo Grande (state of Mato Grosso do Sul), Itajaí (state of Santa Catarina), and Porto Alegre (state of Rio Grande do Sul).

  8. Rapid high resolution genotyping of Francisella tularensis by whole genome sequence comparison of annotated genes ("MLST+".

    Directory of Open Access Journals (Sweden)

    Markus H Antwerpen

    Full Text Available The zoonotic disease tularemia is caused by the bacterium Francisella tularensis. This pathogen is considered as a category A select agent with potential to be misused in bioterrorism. Molecular typing based on DNA-sequence like canSNP-typing or MLVA has become the accepted standard for this organism. Due to the organism's highly clonal nature, the current typing methods have reached their limit of discrimination for classifying closely related subpopulations within the subspecies F. tularensis ssp. holarctica. We introduce a new gene-by-gene approach, MLST+, based on whole genome data of 15 sequenced F. tularensis ssp. holarctica strains and apply this approach to investigate an epidemic of lethal tularemia among non-human primates in two animal facilities in Germany. Due to the high resolution of MLST+ we are able to demonstrate that three independent clones of this highly infectious pathogen were responsible for these spatially and temporally restricted outbreaks.

  9. Coptotermes gestroi (Isoptera: Rhinotermitidae) in Brazil: possible origins inferred by mitochondrial cytochrome oxidase II gene sequences.

    Science.gov (United States)

    Martins, C; Fontes, L R; Bueno, O C; Martins, V G

    2010-09-01

    The Asian subterranean termite, Coptotermes gestroi, originally from northeast India through Burma, Thailand, Malaysia, and the Indonesian archipelago, is a major termite pest introduced in several countries around the world, including Brazil. We sequenced the mitochondrial COII gene from individuals representing 23 populations. Phylogenetic analysis of COII gene sequences from this and other studies resulted in two main groups: (1) populations of Cleveland (USA) and four populations of Malaysia and (2) populations of Brazil, four populations of Malaysia, and one population from each of Thailand, Puerto Rico, and Key West (USA). Three new localities are reported here, considerably enlarging the distribution of C. gestroi in Brazil: Campo Grande (state of Mato Grosso do Sul), Itajaí (state of Santa Catarina), and Porto Alegre (state of Rio Grande do Sul). PMID:20924414

  10. An abundance of ubiquitously expressed genes revealed by tissue transcriptome sequence data.

    Directory of Open Access Journals (Sweden)

    Daniel Ramsköld

    2009-12-01

    Full Text Available The parts of the genome transcribed by a cell or tissue reflect the biological processes and functions it carries out. We characterized the features of mammalian tissue transcriptomes at the gene level through analysis of RNA deep sequencing (RNA-Seq data across human and mouse tissues and cell lines. We observed that roughly 8,000 protein-coding genes were ubiquitously expressed, contributing to around 75% of all mRNAs by message copy number in most tissues. These mRNAs encoded proteins that were often intracellular, and tended to be involved in metabolism, transcription, RNA processing or translation. In contrast, genes for secreted or plasma membrane proteins were generally expressed in only a subset of tissues. The distribution of expression levels was broad but fairly continuous: no support was found for the concept of distinct expression classes of genes. Expression estimates that included reads mapping to coding exons only correlated better with qRT-PCR data than estimates which also included 3' untranslated regions (UTRs. Muscle and liver had the least complex transcriptomes, in that they expressed predominantly ubiquitous genes and a large fraction of the transcripts came from a few highly expressed genes, whereas brain, kidney and testis expressed more complex transcriptomes with the vast majority of genes expressed and relatively small contributions from the most expressed genes. mRNAs expressed in brain had unusually long 3'UTRs, and mean 3'UTR length was higher for genes involved in development, morphogenesis and signal transduction, suggesting added complexity of UTR-based regulation for these genes. Our results support a model in which variable exterior components feed into a large, densely connected core composed of ubiquitously expressed intracellular proteins.

  11. Advancing Eucalyptus genomics: identification and sequencing of lignin biosynthesis genes from deep-coverage BAC libraries

    Directory of Open Access Journals (Sweden)

    Kudrna David

    2011-03-01

    Full Text Available Abstract Background Eucalyptus species are among the most planted hardwoods in the world because of their rapid growth, adaptability and valuable wood properties. The development and integration of genomic resources into breeding practice will be increasingly important in the decades to come. Bacterial artificial chromosome (BAC libraries are key genomic tools that enable positional cloning of important traits, synteny evaluation, and the development of genome framework physical maps for genetic linkage and genome sequencing. Results We describe the construction and characterization of two deep-coverage BAC libraries EG_Ba and EG_Bb obtained from nuclear DNA fragments of E. grandis (clone BRASUZ1 digested with HindIII and BstYI, respectively. Genome coverages of 17 and 15 haploid genome equivalents were estimated for EG_Ba and EG_Bb, respectively. Both libraries contained large inserts, with average sizes ranging from 135 Kb (Eg_Bb to 157 Kb (Eg_Ba, very low extra-nuclear genome contamination providing a probability of finding a single copy gene ≥ 99.99%. Libraries were screened for the presence of several genes of interest via hybridizations to high-density BAC filters followed by PCR validation. Five selected BAC clones were sequenced and assembled using the Roche GS FLX technology providing the whole sequence of the E. grandis chloroplast genome, and complete genomic sequences of important lignin biosynthesis genes. Conclusions The two E. grandis BAC libraries described in this study represent an important milestone for the advancement of Eucalyptus genomics and forest tree research. These BAC resources have a highly redundant genome coverage (> 15×, contain large average inserts and have a very low percentage of clones with organellar DNA or empty vectors. These publicly available BAC libraries are thus suitable for a broad range of applications in genetic and genomic research in Eucalyptus and possibly in related species of Myrtaceae

  12. Multiple, non-allelic, intein-coding sequences in eukaryotic RNA polymerase genes

    Directory of Open Access Journals (Sweden)

    Butler Margaret I

    2006-10-01

    Full Text Available Abstract Background Inteins are self-splicing protein elements. They are translated as inserts within host proteins that excise themselves and ligate the flanking portions of the host protein (exteins with a peptide bond. They are encoded as in-frame insertions within the genes for the host proteins. Inteins are found in all three domains of life and in viruses, but have a very sporadic distribution. Only a small number of intein coding sequences have been identified in eukaryotic nuclear genes, and all of these are from ascomycete or basidiomycete fungi. Results We identified seven intein coding sequences within nuclear genes coding for the second largest subunits of RNA polymerase. These sequences were found in diverse eukaryotes: one is in the second largest subunit of RNA polymerase I (RPA2 from the ascomycete fungus Phaeosphaeria nodorum, one is in the RNA polymerase III (RPC2 of the slime mould Dictyostelium discoideum and four intein coding sequences are in RNA polymerase II genes (RPB2, one each from the green alga Chlamydomonas reinhardtii, the zygomycete fungus Spiromyces aspiralis and the chytrid fungi Batrachochytrium dendrobatidis and Coelomomyces stegomyiae. The remaining intein coding sequence is in a viral relic embedded within the genome of the oomycete Phytophthora ramorum. The Chlamydomonas and Dictyostelium inteins are the first nuclear-encoded inteins found outside of the fungi. These new inteins represent a unique dataset: they are found in homologous proteins that form a paralogous group. Although these paralogues diverged early in eukaryotic evolution, their sequences can be aligned over most of their length. The inteins are inserted at multiple distinct sites, each of which corresponds to a highly conserved region of RNA polymerase. This dataset supports earlier work suggesting that inteins preferentially occur in highly conserved regions of their host proteins. Conclusion The identification of these new inteins

  13. Low-pass shotgun sequencing of the barley genome facilitates rapid identification of genes, conserved non-coding sequences and novel repeats

    Directory of Open Access Journals (Sweden)

    Graner Andreas

    2008-10-01

    Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular

  14. Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

    Science.gov (United States)

    Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

    2000-12-01

    The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

  15. Genome Sequencing Highlights Genes Under Selection and the Dynamic Early History of Dogs

    OpenAIRE

    Freedman AH1; Gronau I2; Schweizer RM1; Ortega-Del Vecchyo D1; Han E1; Silva PM3; Galaverni M4; Fan Z; Marx P6; Lorente-Galdos B; Beale H8; Ramirez O7; Hormozdiari F; Alkan C; Vil\\xe0 C11

    2013-01-01

    To identify genetic changes underlying dog domestication and reconstruct their early evolutionary history, we analyzed novel high-quality genome sequences of three gray wolves, one from each of three putative centers of dog domestication, two ancient dog lineages (Basenji and Dingo) and a golden jackal as an outgroup. We find dogs and wolves diverged through a dynamic process involving population bottlenecks in both lineages and post-divergence gene flow, which confounds previous inferences o...

  16. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences.

    OpenAIRE

    Escalante, A A; Ayala, F. J.

    1994-01-01

    Malaria is among mankind's worst scourges, affecting many millions of people, particularly in the tropics. Human malaria is caused by several species of Plasmodium, a parasitic protozoan. We analyze the small subunit rRNA gene sequences of 11 Plasmodium species, including three parasitic to humans, to infer their evolutionary relationships. Plasmodium falciparum, the most virulent of the human species, is closely related to Plasmodium reichenowi, which is parasitic to chimpanzee. The estimate...

  17. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation.

    OpenAIRE

    Macke, J. P.; Hu, N; S. Hu; Bailey, M.; King, V L; Brown, T.; Hamer, D; Nathans, J

    1993-01-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, we have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the the entire androgen receptor cod...

  18. Molecular analysis of the bovine coronavirus S1 gene by direct sequencing of diarrheic fecal specimens

    Directory of Open Access Journals (Sweden)

    E. Takiuchi

    2008-04-01

    Full Text Available Bovine coronavirus (BCoV causes severe diarrhea in newborn calves, is associated with winter dysentery in adult cattle and respiratory infections in calves and feedlot cattle. The BCoV S protein plays a fundamental role in viral attachment and entry into the host cell, and is cleaved into two subunits termed S1 (amino terminal and S2 (carboxy terminal. The present study describes a strategy for the sequencing of the BCoV S1 gene directly from fecal diarrheic specimens that were previously identified as BCoV positive by RT-PCR assay for N gene detection. A consensus sequence of 2681 nucleotides was obtained through direct sequencing of seven overlapping PCR fragments of the S gene. The samples did not undergo cell culture passage prior to PCR amplification and sequencing. The structural analysis was based on the genomic differences between Brazilian strains and other known BCoV from different geographical regions. The phylogenetic analysis of the entire S1 gene showed that the BCoV Brazilian strains were more distant from the Mebus strain (97.8% identity for nucleotides and 96.8% identity for amino acids and more similar to the BCoV-ENT strain (98.7% for nucleotides and 98.7% for amino acids. Based on the phylogenetic analysis of the hypervariable region of the S1 subunit, these strains clustered with the American (BCoV-ENT, 182NS and Canadian (BCQ20, BCQ2070, BCQ9, BCQ571, BCQ1523 calf diarrhea and the Canadian winter dysentery (BCQ7373, BCQ2590 strains, but clustered on a separate branch of the Korean and respiratory BCoV strains. The BCoV strains of the present study were not clustered in the same branch of previously published Brazilian strains (AY606193, AY606194. These data agree with the genealogical construction and suggest that at least two different BCoV strains are circulating in Brazil.

  19. How the Sequence of a Gene Specifies Structural Symmetry in Proteins.

    Directory of Open Access Journals (Sweden)

    Xiaojuan Shen

    Full Text Available Internal symmetry is commonly observed in the majority of fundamental protein folds. Meanwhile, sufficient evidence suggests that nascent polypeptide chains of proteins have the potential to start the co-translational folding process and this process allows mRNA to contain additional information on protein structure. In this paper, we study the relationship between gene sequences and protein structures from the viewpoint of symmetry to explore how gene sequences code for structural symmetry in proteins. We found that, for a set of two-fold symmetric proteins from left-handed beta-helix fold, intragenic symmetry always exists in their corresponding gene sequences. Meanwhile, codon usage bias and local mRNA structure might be involved in modulating translation speed for the formation of structural symmetry: a major decrease of local codon usage bias in the middle of the codon sequence can be identified as a common feature; and major or consecutive decreases in local mRNA folding energy near the boundaries of the symmetric substructures can also be observed. The results suggest that gene duplication and fusion may be an evolutionarily conserved process for this protein fold. In addition, the usage of rare codons and the formation of higher order of secondary structure near the boundaries of symmetric substructures might have coevolved as conserved mechanisms to slow down translation elongation and to facilitate effective folding of symmetric substructures. These findings provide valuable insights into our understanding of the mechanisms of translation and its evolution, as well as the design of proteins via symmetric modules.

  20. Whole-exome sequencing for the identification of susceptibility genes of Kashin-Beck disease.

    Directory of Open Access Journals (Sweden)

    Zhenxing Yang

    Full Text Available OBJECTIVE: To identify and investigate the susceptibility genes of Kashin-Beck disease (KBD in Chinese population. METHODS: Whole-exome capturing and sequencing technology was used for the detection of genetic variations in 19 individuals from six families with high incidence of KBD. A total of 44 polymorphisms from 41 genes were genotyped from a total of 144 cases and 144 controls by using MassARRAY under the standard protocol from Sequenom. Association was applied on the data by using PLINK1.07. RESULTS: In the sequencing stage, each sample showed approximately 70-fold coverage, thus covering more than 99% of the target regions. Among the single nucleotide polymorphisms (SNPs used in the transmission disequilibrium test, 108 had a p-value of <0.01, whereas 1056 had a p-value of <0.05. Kyoto Encyclopedia of Genes and Genomes(KEGG pathway analysis indicates that these SNPs focus on three major pathways: regulation of actin cytoskeleton, focal adhesion, and metabolic pathways. In the validation stage, single locus effects revealed that two of these polymorphisms (rs7745040 and rs9275295 in the human leukocyte antigen (HLA-DRB1 gene and one polymorphism (rs9473132 in CD2-associated protein (CD2AP gene have a significant statistical association with KBD. CONCLUSIONS: HLA-DRB1 and CD2AP gene were identified to be among the susceptibility genes of KBD, thus supporting the role of the autoimmune response in KBD and the possibility of shared etiology between osteoarthritis, rheumatoid arthritis, and KBD.

  1. IS406 and IS407, two gene-activating insertion sequences for Pseudomonas cepacia.

    Science.gov (United States)

    Wood, M S; Byrne, A; Lessie, T G

    1991-08-30

    We have determined the nucleotide sequences of IS406 (1368 bp) and IS407 (1236 bp), two insertion sequence (IS) elements isolated from Pseudomonas cepacia 249 on the basis of their abilities to activate the expression of the lac genes of Tn951. IS406 and IS407 when inserted into the lac promoter/operator region of Tn951 generated, respectively, duplications of 8 and 4 bp of target DNA. IS406 had 41-bp terminal inverted repeat (IR) sequences with eleven mismatches. IR-L (left) contained a 12-bp motif present at the ends of Tn2501. In other respects, IS406 was distinct from previously described bacterial IS elements listed in the GenBank and EMBL databases. IS407 had 49-bp terminal IRs with 18 mismatches. IR-R (right) contained an outwardly directed sigma 70-like promoter. IS407 was closely related to IS476 and ISR1 from Xanthomonas and Rhizobium sp., respectively. PMID:1718819

  2. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    Science.gov (United States)

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  3. Nucleotide sequence of the gene encoding the F72 fimbrial subunit of a uropathogenic Escherichia coli strain

    NARCIS (Netherlands)

    Die, Irma van; Bergmans, Hans

    1984-01-01

    The cloned DNA fragment encoding the F72 fimbrial subunit from the uropathogenic Escherichia coli strain AD110 has been identified. The nucleotide sequence of the structural gene and of 196 bp of the noncoding region preceding the gene was determined. The structural gene codes for a polypeptide of 1

  4. Molecular cloning and sequence analysis of a phenylalanine ammonia-lyase gene from dendrobium.

    Directory of Open Access Journals (Sweden)

    Qing Jin

    Full Text Available In this study, a phenylalanine ammonia-lyase (PAL gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748 has 2,458 bps and contains a complete open reading frame (ORF of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum.

  5. When is it MODY? Challenges in the Interpretation of Sequence Variants in MODY Genes.

    Science.gov (United States)

    Althari, Sara; Gloyn, Anna L

    2015-01-01

    The genomics revolution has raised more questions than it has provided answers. Big data from large population-scale resequencing studies are increasingly deconstructing classic notions of Mendelian disease genetics, which support a simplistic correlation between mutational severity and phenotypic outcome. The boundaries are being blurred as the body of evidence showing monogenic disease-causing alleles in healthy genomes, and in the genomes of individu-als with increased common complex disease risk, continues to grow. In this review, we focus on the newly emerging challenges which pertain to the interpretation of sequence variants in genes implicated in the pathogenesis of maturity-onset diabetes of the young (MODY), a presumed mono-genic form of diabetes characterized by Mendelian inheritance. These challenges highlight the complexities surrounding the assignments of pathogenicity, in particular to rare protein-alerting variants, and bring to the forefront some profound clinical diagnostic implications. As MODY is both genetically and clinically heterogeneous, an accurate molecular diagnosis and cautious extrapolation of sequence data are critical to effective disease management and treatment. The biological and translational value of sequence information can only be attained by adopting a multitude of confirmatory analyses, which interrogate variant implication in disease from every possible angle. Indeed, studies which have effectively detected rare damaging variants in known MODY genes in normoglycemic individuals question the existence of a sin-gle gene mutation scenario: does monogenic diabetes exist when the genetic culprits of MODY have been systematical-ly identified in individuals without MODY? PMID:27111119

  6. Sequences of cytochrome b gene for primitive cyprinid fishes in East Asia and their phylogenetic concerning

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    1140 bp of cytochrome b gene were amplified and sequenced from 14species of primitive cyprinid fishes in East Asia. Aligned with other ten cytochrome b gene sequences of cyprinid fish from Europe and North America retrieved from Gene bank, we obtained a matrix of 24 DNA sequences. A cladogram was generated by the method of Maximum likelihood for the primitive cyprinid fishes. The result indicated that subfamily Leuciscinae and Danioninae do not form a monophyletic group. In the subfamily Danioninae, Opsariichthys biden and Zacco platypus are very primitive and form a natural group and located at the root. But the genera in subfamily Danioninae are included in different groups and have not direct relationship. Among them, Aphyocypris chinensis and Yaoshanicus arcus form a monophyletic group. Tanichthys albonubes and Gobiocypris rarus have a close relation to Gobioninae. The genus Danio is far from other genera in Danioninae. In our cladogram, the genera in Leuciscinae were divided into two groups that have no direct relationship. The genera in Leuciscinae distributed in Europe, Sibera and North America, including Leuciscus, Rutilus, Phoxinus, N. crysole, Opsopoeodus emilae, form a monophyletic group. And the Leuciscinae in southern China including Ctenopharyngodon idellus, Mylopharyngodon piceus, Squalibarbus and Ochetobius elongatus have a common origination.

  7. Cloning, sequence analysis and radiation hybrid mapping of a mammalian KRT2p gene.

    Science.gov (United States)

    Miller, A B; Lowe, J K; Ostrander, E A; Galibert, F; Murphy, K E

    2001-09-01

    We report here on the cloning, characterization and radiation hybrid mapping of the canine basic keratin gene KRT2p. The gene spans 8.3 kb, consists of nine exons and eight introns, and is characterized by the typical features of both basic keratins and keratins in general, including glycine-rich head and tail domains, which flank an alpha-helical rod domain of approximately 310 amino acids. Comparisons of sequence and structure reveal that canine KRT2p is strikingly similar to human KRT2p. Alignment of the predicted amino acid sequences for human and dog reveals greater than 80% identity. In the rod domain, the amino acid identity exceeds 90%. We note, however, that canine KRT2p encodes a protein 21 residues longer than human K2p due to the insertion of a glycine repeat motif, GG(G)X, in the head and tail domains of the canine gene. This is the first report of the nearly complete genome sequence for KRT2p of any organism. Radiation hybrid mapping of canine KRT2p to chromosome 27 of the dog is also reported. PMID:11793249

  8. Sequence Analysis of Bitter Taste Receptor Gene Repertoires in Different Ruminant Species.

    Directory of Open Access Journals (Sweden)

    Ana Monteiro Ferreira

    Full Text Available Bitter taste has been extensively studied in mammalian species and is associated with sensitivity to toxins and with food choices that avoid dangerous substances in the diet. At the molecular level, bitter compounds are sensed by bitter taste receptor proteins (T2R present at the surface of taste receptor cells in the gustatory papillae. Our work aims at exploring the phylogenetic relationships of T2R gene sequences within different ruminant species. To accomplish this goal, we gathered a collection of ruminant species with different feeding behaviors and for which no genome data is available: American bison, chamois, elk, European bison, fallow deer, goat, moose, mouflon, muskox, red deer, reindeer and white tailed deer. The herbivores chosen for this study belong to different taxonomic families and habitats, and hence, exhibit distinct foraging behaviors and diet preferences. We describe the first partial repertoires of T2R gene sequences for these species obtained by direct sequencing. We then consider the homology and evolutionary history of these receptors within this ruminant group, and whether it relates to feeding type classification, using MEGA software. Our results suggest that phylogenetic proximity of T2R genes corresponds more to the traditional taxonomic groups of the species rather than reflecting a categorization by feeding strategy.

  9. Cloning and sequence analysis of the Antheraea pernyi nucleopolyhedrovirus gp64 gene

    Indian Academy of Sciences (India)

    Wenbing Wang; Shanying Zhu; Liqun Wang; Feng Yu; Weide Shen

    2005-12-01

    Frequent outbreaks of the purulence disease of Chinese oak silkworm are reported in Middle and Northeast China. The disease is produced by the pathogen Antheraea pernyi nucleopolyhedrovirus (AnpeNPV). To obtain molecular information of the virus, the polyhedra of AnpeNPV were purified and characterized. The genomic DNA of AnpeNPV was extracted and digested with HindIII. The genome size of AnpeNPV is estimated at 128 kb. Based on the analysis of DNA fragments digested with HindIII, 23 fragments were bigger than 564 bp. A genomic library was generated using HindIII and the positive clones were sequenced and analysed. The gp64 gene, encoding the baculovirus envelope protein GP64, was found in an insert. The nucleotide sequence analysis indicated that the AnpeNPV gp64 gene consists of a 1530 nucleotide open reading frame (ORF), encoding a protein of 509 amino acids. Of the eight gp64 homologues, the AnpeNPV gp64 ORF shared the most sequence similarity with the gp64 gene of Anticarsia gemmatalis NPV, but not Bombyx mori NPV. The upstream region of the AnpeNPV gp64 ORF encoded the conserved transcriptional elements for early and late stage of the viral infection cycle. These results indicated that AnpeNPV belongs to group I NPV and was far removed in molecular phylogeny from the BmNPV.

  10. Cloning,Sequencing and Phylogenetic Study of rbcL Gene from Cyanobacteria Arthrospira and Spirulina

    Institute of Scientific and Technical Information of China (English)

    Liu Jinjie(刘金姐); Zhang Xuecheng; Sui Zhenghong; Mao Yunxiang; Sun Xue

    2004-01-01

    Large subunit gene of rubisco (rbcL) of cyanobacteria Arthrospira platensis FACHB341, A. Platensis FACHB439, A. Maxima OUQDSM and Spirulina sp. FACHB440 is cloned, sequenced and characterized. Results show that GC content of the gene in strain Spirulina sp. FACHB440 is higher than that in the others. The alignments based on deduced amino acid sequences indicate that Spirulina sp. FACHB440 is different from that in other three samples of Arthrospira, though they have the same conserved functional sites (95, 98, 121, 124, 221, 257). The nucleotide sequence similarity among the three strains of the genus of Arthrospira (96.5~99.6%) is higher than that between Arthrospira and Spirulina (78.1~78.5%). By comparison of the corresponding sequence of other cyanobacteria, a phylogenetic tree with two clusters is constructed. A. Platensis FACHB341, A. Maxima OUQDSM and A. Platensis FACHB439 form the monophyletic linage, which is fully supported by bootstrap values (1000), while Spirulina sp. FACHB440 and Anabaena sp. PCC7120 cluster in another linage with the bootstrap value of 909.

  11. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    Science.gov (United States)

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods.

  12. c-myc gene sequences and the phylogeny of bats and other eutherian mammals.

    Science.gov (United States)

    Miyamoto, M M; Porter, C A; Goodman, M

    2000-09-01

    The complete protein-coding sequences of the c-myc proto-oncogene were determined for five species of four new orders of eutherian (placental) mammals. These newly obtained sequences were aligned to each other and to other available orthologs for the phylogenetic estimation of eutherian interordinal relationships. Several measures of sequence difference and base composition were first calculated to assess the major evolutionary properties of the three codon positions and two protein-coding exons of the gene. On the basis of these calculations, different parsimony, distance, and maximum likelihood approaches were adopted, with the most sophisticated involving the separate, then combined, likelihood analyses of the third codon positions of exon 2 versus all other sites. These phylogenetic approaches provided clear support for the grouping of Chiroptera (bats) with Artiodactyla (ruminants, camels, and pigs) and Carnivora (cats, dogs, and their allies), an interordinal arrangement that receives strong corroboration from other lines of evidence including complete mitochondrial DNA sequences. In contrast, these analyses failed to provide strong to reasonable support for any other interordinal group. This study concludes with specific recommendations about sampling and other strategies for maximizing the phylogenetic contributions of the c-myc gene to the continued resolution of the eutherian ordinal tree. PMID:12116424

  13. Operator Sequence Alters Gene Expression Independently of Transcription Factor Occupancy in Bacteria

    Directory of Open Access Journals (Sweden)

    Hernan G. Garcia

    2012-07-01

    Full Text Available A canonical quantitative view of transcriptional regulation holds that the only role of operator sequence is to set the probability of transcription factor binding, with operator occupancy determining the level of gene expression. In this work, we test this idea by characterizing repression in vivo and the binding of RNA polymerase in vitro in experiments where operators of various sequences were placed either upstream or downstream from the promoter in Escherichia coli. Surprisingly, we find that operators with a weaker binding affinity can yield higher repression levels than stronger operators. Repressor bound to upstream operators modulates promoter escape, and the magnitude of this modulation is not correlated with the repressor-operator binding affinity. This suggests that operator sequences may modulate transcription by altering the nature of the interaction of the bound transcription factor with the transcriptional machinery, implying a new layer of sequence dependence that must be confronted in the quantitative understanding of gene expression.

  14. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Energy Technology Data Exchange (ETDEWEB)

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  15. Medical sequencing of candidate genes for nonsyndromic cleft lip and palate.

    Directory of Open Access Journals (Sweden)

    Alexandre R Vieira

    2005-12-01

    Full Text Available Nonsyndromic or isolated cleft lip with or without cleft palate (CL/P occurs in wide geographic distribution with an average birth prevalence of 1/700. We used direct sequencing as an approach to study candidate genes for CL/P. We report here the results of sequencing on 20 candidate genes for clefts in 184 cases with CL/P selected with an emphasis on severity and positive family history. Genes were selected based on expression patterns, animal models, and/or role in known human clefting syndromes. For seven genes with identified coding mutations that are potentially etiologic, we performed linkage disequilibrium studies as well in 501 family triads (affected child/mother/father. The recently reported MSX1 P147Q mutation was also studied in an additional 1,098 cleft cases. Selected missense mutations were screened in 1,064 controls from unrelated individuals on the Centre d'Etude du Polymorphisme Humain (CEPH diversity cell line panel. Our aggregate data suggest that point mutations in these candidate genes are likely to contribute to 6% of isolated clefts, particularly those with more severe phenotypes (bilateral cleft of the lip with cleft palate. Additional cases, possibly due to microdeletions or isodisomy, were also detected and may contribute to clefts as well. Sequence analysis alone suggests that point mutations in FOXE1, GLI2, JAG2, LHX8, MSX1, MSX2, SATB2, SKI, SPRY2, and TBX10 may be rare causes of isolated cleft lip with or without cleft palate, and the linkage disequilibrium data support a larger, as yet unspecified, role for variants in or near MSX2, JAG2, and SKI. This study also illustrates the need to test large numbers of controls to distinguish rare polymorphic variants and prioritize functional studies for rare point mutations.

  16. Medical Sequencing of Candidate Genes for Nonsyndromic Cleft Lip and Palate.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available Nonsyndromic or isolated cleft lip with or without cleft palate (CL/P occurs in wide geographic distribution with an average birth prevalence of 1/700. We used direct sequencing as an approach to study candidate genes for CL/P. We report here the results of sequencing on 20 candidate genes for clefts in 184 cases with CL/P selected with an emphasis on severity and positive family history. Genes were selected based on expression patterns, animal models, and/or role in known human clefting syndromes. For seven genes with identified coding mutations that are potentially etiologic, we performed linkage disequilibrium studies as well in 501 family triads (affected child/mother/father. The recently reported MSX1 P147Q mutation was also studied in an additional 1,098 cleft cases. Selected missense mutations were screened in 1,064 controls from unrelated individuals on the Centre d'Etude du Polymorphisme Humain (CEPH diversity cell line panel. Our aggregate data suggest that point mutations in these candidate genes are likely to contribute to 6% of isolated clefts, particularly those with more severe phenotypes (bilateral cleft of the lip with cleft palate. Additional cases, possibly due to microdeletions or isodisomy, were also detected and may contribute to clefts as well. Sequence analysis alone suggests that point mutations in FOXE1, GLI2, JAG2, LHX8, MSX1, MSX2, SATB2, SKI, SPRY2, and TBX10 may be rare causes of isolated cleft lip with or without cleft palate, and the linkage disequilibrium data support a larger, as yet unspecified, role for variants in or near MSX2, JAG2, and SKI. This study also illustrates the need to test large numbers of controls to distinguish rare polymorphic variants and prioritize functional studies for rare point mutations.

  17. Quantitative sequence-function relationships in proteins based on gene ontology

    Directory of Open Access Journals (Sweden)

    Lesk Arthur M

    2007-08-01

    Full Text Available Abstract Background The relationship between divergence of amino-acid sequence and divergence of function among homologous proteins is complex. The assumption that homologs share function – the basis of transfer of annotations in databases – must therefore be regarded with caution. Here, we present a quantitative study of sequence and function divergence, based on the Gene Ontology classification of function. We determined the relationship between sequence divergence and function divergence in 6828 protein families from the PFAM database. Within families there is a broad range of sequence similarity from very closely related proteins – for instance, orthologs in different mammals – to very distantly-related proteins at the limit of reliable recognition of homology. Results We correlated the divergence in sequences determined from pairwise alignments, and the divergence in function determined by path lengths in the Gene Ontology graph, taking into account the fact that many proteins have multiple functions. Our results show that, among homologous proteins, the proportion of divergent functions decreases dramatically above a threshold of sequence similarity at about 50% residue identity. For proteins with more than 50% residue identity, transfer of annotation between homologs will lead to an erroneous attribution with a totally dissimilar function in fewer than 6% of cases. This means that for very similar proteins (about 50 % identical residues the chance of completely incorrect annotation is low; however, because of the phenomenon of recruitment, it is still non-zero. Conclusion Our results describe general features of the evolution of protein function, and serve as a guide to the reliability of annotation transfer, based on the closeness of the relationship between a new protein and its nearest annotated relative.

  18. tRNADB-CE: tRNA gene database well-timed in the era of big sequence data

    Directory of Open Access Journals (Sweden)

    Takashi eAbe

    2014-05-01

    Full Text Available The tRNA Gene Data Base Curated by Experts tRNADB-CE (http://trna.ie.niigata-u.ac.jp was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses’, 121 chloroplasts’, and 12 eukaryotes’ genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that BLSOM with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.

  19. Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution

    DEFF Research Database (Denmark)

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.;

    2005-01-01

    years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences......We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each...... between the species-but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence...

  20. Expressed sequence tag analysis of functional genes associated with adventitious rooting in Liriodendron hybrids.

    Science.gov (United States)

    Zhong, Y D; Sun, X Y; Liu, E Y; Li, Y Q; Gao, Z; Yu, F X

    2016-06-24

    Liriodendron hybrids (Liriodendron chinense x L. tulipifera) are important landscaping and afforestation hardwood trees. To date, little genomic research on adventitious rooting has been reported in these hybrids, as well as in the genus Liriodendron. In the present study, we used adventitious roots to construct the first cDNA library for Liriodendron hybrids. A total of 5176 expressed sequence tags (ESTs) were generated and clustered into 2921 unigenes. Among these unigenes, 2547 had significant homology to the non-redundant protein database representing a wide variety of putative functions. Homologs of these genes regulated many aspects of adventitious rooting, including those for auxin signal transduction and root hair development. Results of quantitative real-time polymerase chain reaction showed that AUX1, IRE, and FB1 were highly expressed in adventitious roots and the expression of AUX1, ARF1, NAC1, RHD1, and IRE increased during the development of adventitious roots. Additionally, 181 simple sequence repeats were identified from 166 ESTs and more than 91.16% of these were dinucleotide and trinucleotide repeats. To the best of our knowledge, the present study reports the identification of the genes associated with adventitious rooting in the genus Liriodendron for the first time and provides a valuable resource for future genomic studies. Expression analysis of selected genes could allow us to identify regulatory genes that may be essential for adventitious rooting.

  1. Identification of functional SNPs in the 5-prime flanking sequences of human genes

    Directory of Open Access Journals (Sweden)

    Lenhard Boris

    2005-02-01

    Full Text Available Abstract Background Over 4 million single nucleotide polymorphisms (SNPs are currently reported to exist within the human genome. Only a small fraction of these SNPs alter gene function or expression, and therefore might be associated with a cell phenotype. These functional SNPs are consequently important in understanding human health. Information related to functional SNPs in candidate disease genes is critical for cost effective genetic association studies, which attempt to understand the genetics of complex diseases like diabetes, Alzheimer's, etc. Robust methods for the identification of functional SNPs are therefore crucial. We report one such experimental approach. Results Sequence conserved between mouse and human genomes, within 5 kilobases of the 5-prime end of 176 GPCR genes, were screened for SNPs. Sequences flanking these SNPs were scored for transcription factor binding sites. Allelic pairs resulting in a significant score difference were predicted to influence the binding of transcription factors (TFs. Ten such SNPs were selected for mobility shift assays (EMSA, resulting in 7 of them exhibiting a reproducible shift. The full-length promoter regions with 4 of the 7 SNPs were cloned in a Luciferase based plasmid reporter system. Two out of the 4 SNPs exhibited differential promoter activity in several human cell lines. Conclusions We propose a method for effective selection of functional, regulatory SNPs that are located in evolutionary conserved 5-prime flanking regions (5'-FR regions of human genes and influence the activity of the transcriptional regulatory region. Some SNPs behave differently in different cell types.

  2. A note on gene pleiotropy estimation from phylogenetic analysis of protein sequences

    Institute of Scientific and Technical Information of China (English)

    Wen-Hai CHEN; Zhi-Xi SU; Xun GU

    2013-01-01

    Recently,several statistical methods have been independently proposed for estimating the degree (n) of gene pleiotropy (i.e.the capacity of a gene to affect many phenotypes) without knowing measurable phenotypic traits.However,the theoretical limitation of these approaches has not been well demonstrated.In this short note,we show that our previous method based on the phylogeny of protein sequences is,in fact,an effective estimate of a parameter that can be written symbolically as K =min(n,r),where r is the rank of mutations at an amino acid site.Hence,understanding of r is crucial for appropriate interpretation of the estimated K,denoted by Ke (the effective gene pleiotropy).Indeed,when protein sequence alignment is used to estimate effective gene pleiotropy (Ke) by this method,Ke can be interpreted as an effective estimate of n when n ≤ 20,as long as the phylogeny is sufficiently large.If n > 20,Ke → 20,although the true n could be much higher.

  3. In silico phylogenetic and virulence gene profile analyses of avian pathogenic Escherichia coli genome sequences

    Directory of Open Access Journals (Sweden)

    Thaís C.G. Rojas

    2014-02-01

    Full Text Available Avian pathogenic Escherichia coli (APEC infections are responsible for significant losses in the poultry industry worldwide. A zoonotic risk has been attributed to APEC strains because they present similarities to extraintestinal pathogenic E. coli (ExPEC associated with illness in humans, mainly urinary tract infections and neonatal meningitis. Here, we present in silico analyses with pathogenic E. coli genome sequences, including recently available APEC genomes. The phylogenetic tree, based on multi-locus sequence typing (MLST of seven housekeeping genes, revealed high diversity in the allelic composition. Nevertheless, despite this diversity, the phylogenetic tree was able to cluster the different pathotypes together. An in silico virulence gene profile was also determined for each of these strains, through the presence or absence of 83 well-known virulence genes/traits described in pathogenic E. coli strains. The MLST phylogeny and the virulence gene profiles demonstrated a certain genetic similarity between Brazilian APEC strains, APEC isolated in the United States, UPEC (uropathogenic E. coli and diarrheagenic strains isolated from humans. This correlation corroborates and reinforces the zoonotic potential hypothesis proposed to APEC.

  4. Analysis of breast cancer metastasis candidate genes from next generation-sequencing via systematic functional genomics

    DEFF Research Database (Denmark)

    Blomstrøm, Monica Marie

    2016-01-01

    Metastatic breast cancer remains an incurable disease accounting for the vast majority of deaths from breast cancer. Understanding the molecular mechanisms for metastatic spread is important to improve diagnosis and for generating starting points for novel treatment strategies. Inhibition...... advantage of mutations is that they are most likely stable in the metastatic cancer cell population, whereas miRNA, mRNA and protein expression profiles may change substantially prior to, throughout, or after the complex metastatic process as well as between subpopulations such as cancer stem cells (CSCs......) and non-CSCs. The main goal of this project was to functionally characterize a set of candidate genes recovered from next-generation sequencing analysis for their role in breast cancer metastasis formation. The starting gene set comprised 104 gene variants; i.e. 57 wildtype and 47 mutated variants. During...

  5. Cloning and Sequencing of the Pokeweed Antiviral Protein Gene and Its Expression in E. coli

    Institute of Scientific and Technical Information of China (English)

    CHEN Ding-hu; WANG Xi-feng; LI Li; ZHOU Guang-he

    2002-01-01

    The total RNA was isolated from pokeweed (Phytolacca americana ) leaves using the method of guanidine isothiocyanite and used as a template to amplify the deleted mutant pokeweed antiviral protein (PAP) gene by RT-PCR and then the gene was cloned into the pGEMR-T vector. The sequencing results showed that the PAP gene consisted of 711nt, which was 99.6% identical to the PAP gene reported by Lin et al (1991). The IPTG-inducible expression vector containing the PAP gene was constructed and transferred into the E. coli strain BL21 (DE3)-plysS. A specific protein was produced after induction with 0.4m mol/L IPTG and its molecular weight was 26ku. The results of the double diffusion on the agar plate and the western blotting test showed that the protein produced in E. coli was highly identical with the PAP extracted by a Frenchman from French pokeweed leaves. These revealed that PAP gene was actually achieved and exactly expressed in E . coli.

  6. A genetic similarity algorithm for searching the Gene Ontology terms and annotating anonymous protein sequences.

    Science.gov (United States)

    Othman, Razib M; Deris, Safaai; Illias, Rosli M

    2008-02-01

    A genetic similarity algorithm is introduced in this study to find a group of semantically similar Gene Ontology terms. The genetic similarity algorithm combines semantic similarity measure algorithm with parallel genetic algorithm. The semantic similarity measure algorithm is used to compute the similitude strength between the Gene Ontology terms. Then, the parallel genetic algorithm is employed to perform batch retrieval and to accelerate the search in large search space of the Gene Ontology graph. The genetic similarity algorithm is implemented in the Gene Ontology browser named basic UTMGO to overcome the weaknesses of the existing Gene Ontology browsers which use a conventional approach based on keyword matching. To show the applicability of the basic UTMGO, we extend its structure to develop a Gene Ontology -based protein sequence annotation tool named extended UTMGO. The objective of developing the extended UTMGO is to provide a simple and practical tool that is capable of producing better results and requires a reasonable amount of running time with low computing cost specifically for offline usage. The computational results and comparison with other related tools are presented to show the effectiveness of the proposed algorithm and tools.

  7. Exon-intron organization and sequence comparison of human and murine T11 (CD2) genes

    International Nuclear Information System (INIS)

    Genomic DNA clones containing the human and murine genes coding for the 50-kDa T11 (CD2) T-cell surface glycoprotein were characterized. The human T11 gene is ≅ 12 kilobases long and comprised of five exons. A leader exon (L) contains the 5'-untranslated region and most of the nucleotides defining the signal peptide [amino acids (aa) -24 to -5]. Two exons encode the extracellular segment; exon Ex1 is 321 base pairs (bp) long and codes for four residues of the leader peptide and aa 1-103 of the mature protein, and exon Ex2 is 231 bp long and encodes aa 104-180. Exon TM is 123 bp long and codes for the single transmembrane region of the molecule (aa 181-221). Exon C is a large 765-bp exon encoding virtually the entire cytoplasmic domain (aa 222-327) and the 3'-untranslated region. The murine region T11 gene has a similar organization with exon-intron boundaries essentially identical to the human gene. Substantial conservation of nucleotide sequences between species in both 5'- and 3'-gene flanking regions equivalent to that among homologous exons suggests that murine and human genes may be regulated in a similar fashion. The probable relationship of the individual T11 exons to functional and structural protein domains is discussed

  8. Gene Expression Profiling of Development and Anthocyanin Accumulation in Kiwifruit (Actinidia chinensis Based on Transcriptome Sequencing.

    Directory of Open Access Journals (Sweden)

    Wenbin Li

    Full Text Available Red-fleshed kiwifruit (Actinidia chinensis Planch. 'Hongyang' is a promising commercial cultivar due to its nutritious value and unique flesh color, derived from vitamin C and anthocyanins. In this study, we obtained transcriptome data of 'Hongyang' from seven developmental stages using Illumina sequencing. We mapped 39-54 million reads to the recently sequenced kiwifruit genome and other databases to define gene structure, to analyze alternative splicing, and to quantify gene transcript abundance at different developmental stages. The transcript profiles throughout red kiwifruit development were constructed and analyzed, with a focus on the biosynthesis and metabolism of compounds such as phytohormones, sugars, starch and L-ascorbic acid, which are indispensable for the development and formation of quality fruit. Candidate genes for these pathways were identified through MapMan and phylogenetic analysis. The transcript levels of genes involved in sucrose and starch metabolism were consistent with the change in soluble sugar and starch content throughout kiwifruit development. The metabolism of L-ascorbic acid was very active, primarily through the L-galactose pathway. The genes responsible for the accumulation of anthocyanin in red kiwifruit were identified, and their expression levels were investigated during kiwifruit development. This survey of gene expression during kiwifruit development paves the way for further investigation of the development of this uniquely colored and nutritious fruit and reveals which factors are needed for high quality fruit formation. This transcriptome data and its analysis will be useful for improving kiwifruit genome annotation, for basic fruit molecular biology research, and for kiwifruit breeding and improvement.

  9. Sequence analysis of the gene for the glucan-binding protein of Streptococcus mutans Ingbritt.

    Science.gov (United States)

    Banas, J A; Russell, R R; Ferretti, J J

    1990-01-01

    The nucleotide sequence of the gbp gene, which encodes the glucan-binding protein (GBP) of Streptococcus mutans, was determined. The reading frame for gbp was 1,689 bases. A ribosome-binding site and putative promoter preceded the start codon, and potential stem-loop structures were identified downstream from the termination codon. The deduced amino acid sequence of the GBP revealed the presence of a signal peptide of 35 amino acids. The molecular weight of the processed protein was calculated to be 59,039. Two series of repeats spanned three-quarters of the carboxy-terminal end of the protein. The repeats were 32 to 34 and 17 to 20 amino acids in length and shared partial identity within each series. The repeats were found to be homologous to sequences hypothesized to be involved in glucan binding in the GTF-I of S. downei and to sequences within the protein products encoded by gtfB and gtfC of S. mutans. The repeated sequences may represent peptide segments that are important to glucan binding and may be distributed among GBPs from other bacterial inhabitants of plaque or the oral cavity. PMID:2307516

  10. Probing the effect of promoters on noise in gene expression using thousands of designed sequences.

    Science.gov (United States)

    Sharon, Eilon; van Dijk, David; Kalma, Yael; Keren, Leeat; Manor, Ohad; Yakhini, Zohar; Segal, Eran

    2014-10-01

    Genetically identical cells exhibit large variability (noise) in gene expression, with important consequences for cellular function. Although the amount of noise decreases with and is thus partly determined by the mean expression level, the extent to which different promoter sequences can deviate away from this trend is not fully known. Here, we present a high-throughput method for measuring promoter-driven noise for thousands of designed synthetic promoters in parallel. We use it to investigate how promoters encode different noise levels and find that the noise levels of promoters with similar mean expression levels can vary more than one order of magnitude, with nucleosome-disfavoring sequences resulting in lower noise and more transcription factor binding sites resulting in higher noise. We propose a kinetic model of gene expression that takes into account the nonspecific DNA binding and one-dimensional sliding along the DNA, which occurs when transcription factors search for their target sites. We show that this assumption can improve the prediction of the mean-independent component of expression noise for our designed promoter sequences, suggesting that a transcription factor target search may affect gene expression noise. Consistent with our findings in designed promoters, we find that binding-site multiplicity in native promoters is associated with higher expression noise. Overall, our results demonstrate that small changes in promoter DNA sequence can tune noise levels in a manner that is predictable and partly decoupled from effects on the mean expression levels. These insights may assist in designing promoters with desired noise levels.

  11. Extensive sequence variation in rice blast resistance gene Pi54 makes it broad spectrum in nature

    Directory of Open Access Journals (Sweden)

    Shallu eThakur

    2015-05-01

    Full Text Available Rice blast resistant gene, Pi54 cloned from rice line, Tetep, is effective against diverse isolates of Magnaporthe oryzae. In this study, we prospected the allelic variants of the dominant blast resistance gene from a set of 92 rice lines to determine the nucleotide diversity, pattern of its molecular evolution, phylogenetic relationships and evolutionary dynamics, and to develop allele specific markers. High quality sequences were generated for homologs of Pi54 gene. Using comparative sequence analysis, InDels of variable sizes in all the alleles were observed. Profiling of the selected sites of SNP (Single Nucleotide Polymorphism and amino acids (N sites ≥ 10 exhibited constant frequency distribution of mutational and substitutional sites between the resistance and susceptible rice lines, respectively. A total of 50 new haplotypes based on the nucleotide polymorphism was also identified. A unique haplotype (H_3 was found to be linked to all the resistant alleles isolated from indica rice lines. Unique leucine zipper and tyrosine sulfation sites were identified in the predicted Pi54 proteins. Selection signals were observed in entire coding sequence of resistance alleles, as compared to LRR domains for susceptible alleles. This is a maiden report of extensive variability of Pi54 alleles in different landraces and cultivated varieties, possibly, attributing broad-spectrum resistance to Magnaporthe oryzae. The sequence variation in two consensus region: 163 bp and 144 bp were used for the development of allele specific DNA markers. Validated markers can be used for the selection and identification of better allele(s and their introgression in commercial rice cultivars employing marker assisted selection.

  12. Revised Mimivirus major capsid protein sequence reveals intron-containing gene structure and extra domain

    Directory of Open Access Journals (Sweden)

    Suzan-Monti Marie

    2009-05-01

    Full Text Available Abstract Background Acanthamoebae polyphaga Mimivirus (APM is the largest known dsDNA virus. The viral particle has a nearly icosahedral structure with an internal capsid shell surrounded with a dense layer of fibrils. A Capsid protein sequence, D13L, was deduced from the APM L425 coding gene and was shown to be the most abundant protein found within the viral particle. However this protein remained poorly characterised until now. A revised protein sequence deposited in a database suggested an additional N-terminal stretch of 142 amino acids missing from the original deduced sequence. This result led us to investigate the L425 gene structure and the biochemical properties of the complete APM major Capsid protein. Results This study describes the full length 3430 bp Capsid coding gene and characterises the 593 amino acids long corresponding Capsid protein 1. The recombinant full length protein allowed the production of a specific monoclonal antibody able to detect the Capsid protein 1 within the viral particle. This protein appeared to be post-translationnally modified by glycosylation and phosphorylation. We proposed a secondary structure prediction of APM Capsid protein 1 compared to the Capsid protein structure of Paramecium Bursaria Chlorella Virus 1, another member of the Nucleo-Cytoplasmic Large DNA virus family. Conclusion The characterisation of the full length L425 Capsid coding gene of Acanthamoebae polyphaga Mimivirus provides new insights into the structure of the main Capsid protein. The production of a full length recombinant protein will be useful for further structural studies.

  13. Detection of Tropical Fungi in Formalin-Fixed, Paraffin-Embedded Tissue: Still an Indication for Microscopy in Times of Sequence-Based Diagnosis?

    OpenAIRE

    Hagen Frickmann; Ulrike Loderstaedt; Paul Racz; Klara Tenner-Racz; Petra Eggert; Alexandra Haeupler; Ralf Bialek; Ralf Matthias Hagen

    2015-01-01

    Introduction. The aim of the study was the evaluation of panfungal PCR protocols with subsequent sequence analysis for the diagnostic identification of invasive mycoses in formalin-fixed, paraffin-embedded tissue samples with rare tropical mycoses. Materials and Methods. Five different previously described panfungal PCR/sequencing protocols targeting 18S and 28S ribosomal RNA gene fragments as well as internal transcribed spacer 1 and 2 fragments were evaluated with a collection of 17 formali...

  14. Gene identification and analysis of transcripts differentially regulated in fracture healing by EST sequencing in the domestic sheep

    Directory of Open Access Journals (Sweden)

    Hecht Jochen

    2006-07-01

    Full Text Available Abstract Background The sheep is an important model animal for testing novel fracture treatments and other medical applications. Despite these medical uses and the well known economic and cultural importance of the sheep, relatively little research has been performed into sheep genetics, and DNA sequences are available for only a small number of sheep genes. Results In this work we have sequenced over 47 thousand expressed sequence tags (ESTs from libraries developed from healing bone in a sheep model of fracture healing. These ESTs were clustered with the previously available 10 thousand sheep ESTs to a total of 19087 contigs with an average length of 603 nucleotides. We used the newly identified sequences to develop RT-PCR assays for 78 sheep genes and measured differential expression during the course of fracture healing between days 7 and 42 postfracture. All genes showed significant shifts at one or more time points. 23 of the genes were differentially expressed between postfracture days 7 and 10, which could reflect an important role for these genes for the initiation of osteogenesis. Conclusion The sequences we have identified in this work are a valuable resource for future studies on musculoskeletal healing and regeneration using sheep and represent an important head-start for genomic sequencing projects for Ovis aries, with partial or complete sequences being made available for over 5,800 previously unsequenced sheep genes.

  15. Bioinformatic identification of microRNAs and their target genes from Solanum tuberosum expressed sequence tags

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    MicroRNAs (miRNAs) are a class of non-coding RNAs that regulate gene post-transcriptional expression in plants and animals. Low levels of some miRNAs and time- and tissue-specific expression patterns lead to the difficulty for experimental identification of miRNAs. Here we present a bioinformatic approach for expressed sequence tags (ESTs) prediction of novel miRNAs as well as their targets in Solanum tuberosum. We blasted the databases of S. Tuberosum ESTs to search for potential miRNAs, using previously known miRNA sequences from Arabidopsis, rice and other plant species. By analyzing parameters of plant precursors, including secondary structure, stem length and conservation of miRNAs, and following a variety of filtering criteria, a total of 22 potential miRNAs were detected. Using the newly identified miRNA sequences, we were able to further blast the S. Tuberosum mRNA database and detected 75 potential targets of miRNAs in S. Tuberosum. According to the mRNA annotations provided by the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/), most of the miRNA target genes were predicted to encode transcription factors that regulate cell growth and development, signaling, and metabolism.

  16. Computational prediction of miRNA genes from small RNA sequencing data

    Directory of Open Access Journals (Sweden)

    Wenjing eKang

    2015-01-01

    Full Text Available Next-generation sequencing now for the first time allows researchers to gauge the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. miRNAs are 22 nucleotide small RNAs (sRNAs that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq, which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field.

  17. Rarity of DNA sequence alterations in the promoter region of the human androgen receptor gene

    Directory of Open Access Journals (Sweden)

    D.F. Cabral

    2004-12-01

    Full Text Available The human androgen receptor (AR gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR may contribute to the development of prostate cancer by changing the rates of gene transcription and/or translation. In order to investigate this question, the aim of the present study was to search for the presence of mutations or polymorphisms at the AR-5'UTR in 92 prostate cancer patients, where histological diagnosis of adenocarcinoma was established in specimens obtained from transurethral resection or after prostatectomy. The AR-5'UTR was amplified by PCR from genomic DNA samples of the patients and of 100 healthy male blood donors, included as controls. Conformation-sensitive gel electrophoresis was used for DNA sequence alteration screening. Only one band shift was detected in one individual from the blood donor group. Sequencing revealed a new single nucleotide deletion (T in the most conserved portion of the promoter region at position +36 downstream from the transcription initiation site I. Although the effect of this specific mutation remains unknown, its rarity reveals the high degree of sequence conservation of the human androgen promoter region. Moreover, the absence of detectable variation within the critical 5'UTR in prostate cancer patients indicates a low probability of its involvement in prostate cancer etiology.

  18. Tetrachloroethene Dehalogenase from Dehalospirillum multivorans: Cloning, Sequencing of the Encoding Genes, and Expression of the pceA Gene in Escherichia coli

    Science.gov (United States)

    Neumann, Anke; Wohlfarth, Gert; Diekert, Gabriele

    1998-01-01

    The genes encoding tetrachloroethene reductive dehalogenase, a corrinoid-Fe/S protein, of Dehalospirillum multivorans were cloned and sequenced. The pceA gene is upstream of pceB and overlaps it by 4 bp. The presence of a ς70-like promoter sequence upstream of pceA and of a ρ-independent terminator downstream of pceB indicated that both genes are cotranscribed. This assumption is supported by reverse transcriptase PCR data. The pceA and pceB genes encode putative 501- and 74-amino-acid proteins, respectively, with calculated molecular masses of 55,887 and 8,354 Da, respectively. Four peptides obtained after trypsin treatment of tetrachloroethene (PCE) dehalogenase were found in the deduced amino acid sequence of pceA. The N-terminal amino acid sequence of the PCE dehalogenase isolated from D. multivorans was found 30 amino acids downstream of the N terminus of the deduced pceA product. The pceA gene contained a nucleotide stretch highly similar to binding motifs for two Fe4S4 clusters or for one Fe4S4 cluster and one Fe3S4 cluster. A consensus sequence for the binding of a corrinoid was not found in pceA. No significant similarities to genes in the databases were detected in sequence comparisons. The pceB gene contained two membrane-spanning helices as indicated by two hydrophobic stretches in the hydropathic plot. Sequence comparisons of pceB revealed no sequence similarities to genes present in the databases. Only in the presence of pUBS 520 supplying the recombinant bacteria with high levels of the rare Escherichia coli tRNA4Arg was pceA expressed, albeit nonfunctionally, in recombinant E. coli BL21 (DE3). PMID:9696761

  19. Sequencing, Expression and Diagnostic Application of the Nucleoprotein Gene of Xinjiang Hemorrhagic Fever Virus

    Institute of Scientific and Technical Information of China (English)

    马本江; 杭长寿; 解燕乡; 王世文

    2004-01-01

    In order to analyze the nucleoprotein (NP) gene of Crimean-Congo hemorrhagic fever virus (CCHFV), viral RNA was amplified by RT-PCR by using the proof-reading DNA polymerase to produce the complete NP gene. The PCR product was sequenced, analyzed for phylogenesis and cloned into the expression vector pE132a and the recombinant plasmid expressed in E. coil BL-21 with high yield. The primarily purified fused protein.was used to coat ELISA plates for the detect antibodies. It was found the similarities between NP gene of BA88166 and other XHFVs in nucleotide level and amino acid contents were very significant, and the NP gene of BA88166 encoded a nucleoprotein with 482 amino acid and a deduced molecular weight (MW) of 54 kDa. Western blot assay showed that the fusion protein expressed in bacteria possessed good antigenicity. The results with ELISA for the detection of the human and animal sera collected in endemic areas were found to be in good accordance to the clinical diagnosis. It concluded that the relations of NP genes of XHFV BA88166 and other XHFVs appeared to be evolutionally close. The methodologies established in this study were accurate, specific, rapid and reproducible for the clinical examinations and epidemiological survey.

  20. Next-generation sequencing identifies transportin 3 as the causative gene for LGMD1F.

    Directory of Open Access Journals (Sweden)

    Annalaura Torella

    Full Text Available Limb-girdle muscular dystrophies (LGMD are genetically and clinically heterogeneous conditions. We investigated a large family with autosomal dominant transmission pattern, previously classified as LGMD1F and mapped to chromosome 7q32. Affected members are characterized by muscle weakness affecting earlier the pelvic girdle and the ileopsoas muscles. We sequenced the whole exome of four family members and identified a shared heterozygous frame-shift variant in the Transportin 3 (TNPO3 gene, encoding a member of the importin-β super-family. The TNPO3 gene is mapped within the LGMD1F critical interval and its 923-amino acid human gene product is also expressed in skeletal muscle. In addition, we identified an isolated case of LGMD with a new missense mutation in the same gene. We localized the mutant TNPO3 around the nucleus, but not inside. The involvement of gene related to the nuclear transport suggests a novel disease mechanism leading to muscular dystrophy.

  1. Cloning,sequencing and analyzing of the heavy chain V region genes of human polyreactive antibodies

    Institute of Scientific and Technical Information of China (English)

    ZHANGJINSONG; MINGYEH

    1994-01-01

    The heavy chain variable region genes of 5 human polyreactive mAbs generated in our laboratory have been cloned and sequenced using polymerase chain reaction(PCR) technique.We found that 2 and 3 mAbs utilized genes of the VHIV and VHⅢ families,respectively.The former 2 VH segments were in germline configuration.A common VH segment,with the best similarity of 90.1% to the published VHⅢ germline genes,was utilized by 2 different rearranged genes encoding the V regions of other 3 mAbs.This strongly suggests that the common VH segment is a unmutated copy of an unidentified germline VHⅢ gene.All these polyreactive mAbs displayed a large NDN region(VH-D-JH junction).The entire H chain V regions of these polyreactive mAbs are unusually basic.The analysis of the charge properties of these mAbs as well as those of other poly-and mono-reactive mAbs from literatures prompts us to propose that the charged amino acids with a particular distribution along the H chain V region,especially the binding sites(CDRs),may be an important structural feature involved in antibody polyreactivity.

  2. Novel and functional DNA sequence variants within the GATA5 gene promoter in ventricular septal defects

    Institute of Scientific and Technical Information of China (English)

    Ji-Ping Shan; Xiao-Li Wang; Yuan-Gang Qiao; Hong-Xin Wan Yan; Wen-Hui Huang; Shu-Chao Pang; Bo Yan

    2014-01-01

    Background: Congenital heart disease (CHD) is the most common human birth defect. Genetic causes for CHD remain largely unknown. GATA transcription factor 5 (GATA 5) is an essential regulator for the heart development. Mutations in the GATA5 gene have been reported in patients with a variety of CHD. Since misregulation of gene expression have been associated with human diseases, we speculated that changed levels of cardiac transcription factors, GATA5, may mediate the development of CHD. Methods: In this study, GATA5 gene promoter was genetically and functionally analyzed in large cohorts of patients with ventricular septal defect (VSD) (n=343) and ethnic-matched healthy controls (n=348). Results: Two novel and heterozygous DNA sequence variants (DSVs), g.61051165A>G and g.61051463delC, were identified in three VSD patients, but not in the controls. In cultured cardiomyocytes, GATA5 gene promoter activities were significantly decreased by DSV g.61051165A>G and increased by DSV g.61051463delC. Moreover, fathers of the VSD patients carrying the same DSVs had reduced diastolic function of left ventricles. Three SNPs, g.61051279C>T (rs77067995), g.61051327A>C (rs145936691) and g.61051373G>A (rs80197101), and one novel heterozygous DSV, g.61051227C>T, were found in both VSD patients and controls with similar frequencies. Conclusion: Our data suggested that the DSVs in the GATA5 gene promoter may increase the susceptibility to the development of VSD as a risk factor.

  3. RNA sequencing analysis of human podocytes reveals glucocorticoid regulated gene networks targeting non-immune pathways

    Science.gov (United States)

    Jiang, Lulu; Hindmarch, Charles C. T.; Rogers, Mark; Campbell, Colin; Waterfall, Christy; Coghill, Jane; Mathieson, Peter W.; Welsh, Gavin I.

    2016-01-01

    Glucocorticoids are steroids that reduce inflammation and are used as immunosuppressive drugs for many diseases. They are also the mainstay for the treatment of minimal change nephropathy (MCN), which is characterised by an absence of inflammation. Their mechanisms of action remain elusive. Evidence suggests that immunomodulatory drugs can directly act on glomerular epithelial cells or ‘podocytes’, the cell type which is the main target of injury in MCN. To understand the nature of glucocorticoid effects on non-immune cell functions, we generated RNA sequencing data from human podocyte cell lines and identified the genes that are significantly regulated in dexamethasone-treated podocytes compared to vehicle-treated cells. The upregulated genes are of functional relevance to cytoskeleton-related processes, whereas the downregulated genes mostly encode pro-inflammatory cytokines and growth factors. We observed a tendency for dexamethasone-upregulated genes to be downregulated in MCN patients. Integrative analysis revealed gene networks composed of critical signaling pathways that are likely targeted by dexamethasone in podocytes. PMID:27774996

  4. An Updated Collection of Sequence Barcoded Temperature-Sensitive Alleles of Yeast Essential Genes.

    Science.gov (United States)

    Kofoed, Megan; Milbury, Karissa L; Chiang, Jennifer H; Sinha, Sunita; Ben-Aroya, Shay; Giaever, Guri; Nislow, Corey; Hieter, Philip; Stirling, Peter C

    2015-09-01

    Systematic analyses of essential gene function using mutant collections in Saccharomyces cerevisiae have been conducted using collections of heterozygous diploids, promoter shut-off alleles, through alleles with destabilized mRNA, destabilized protein, or bearing mutations that lead to a temperature-sensitive (ts) phenotype. We previously described a method for construction of barcoded ts alleles in a systematic fashion. Here we report the completion of this collection of alleles covering 600 essential yeast genes. This resource covers a larger gene repertoire than previous collections and provides a complementary set of strains suitable for single gene and genomic analyses. We use deep sequencing to characterize the amino acid changes leading to the ts phenotype in half of the alleles. We also use high-throughput approaches to describe the relative ts behavior of the alleles. Finally, we demonstrate the experimental usefulness of the collection in a high-content, functional genomic screen for ts alleles that increase spontaneous P-body formation. By increasing the number of alleles and improving the annotation, this ts collection will serve as a community resource for probing new aspects of biology for essential yeast genes. PMID:26175450

  5. Understanding gene sequence variation in the context of transcription regulation in yeast.

    Directory of Open Access Journals (Sweden)

    Irit Gat-Viks

    2010-01-01

    Full Text Available DNA sequence polymorphism in a regulatory protein can have a widespread transcriptional effect. Here we present a computational approach for analyzing modules of genes with a common regulation that are affected by specific DNA polymorphisms. We identify such regulatory-linkage modules by integrating genotypic and expression data for individuals in a segregating population with complementary expression data of strains mutated in a variety of regulatory proteins. Our procedure searches simultaneously for groups of co-expressed genes, for their common underlying linkage interval, and for their shared regulatory proteins. We applied the method to a cross between laboratory and wild strains of S. cerevisiae, demonstrating its ability to correctly suggest modules and to outperform extant approaches. Our results suggest that middle sporulation genes are under the control of polymorphism in the sporulation-specific tertiary complex Sum1p/Rfm1p/Hst1p. In another example, our analysis reveals novel inter-relations between Swi3 and two mitochondrial inner membrane proteins underlying variation in a module of aerobic cellular respiration genes. Overall, our findings demonstrate that this approach provides a useful framework for the systematic mapping of quantitative trait loci and their role in gene expression variation.

  6. Sequence Variation and Expression of the Gimap Gene Family in the BB Rat

    Directory of Open Access Journals (Sweden)

    Elizabeth A. Rutledge

    2009-01-01

    Full Text Available Positional cloning of lymphopenia (lyp in the BB rat revealed a frameshift mutation in Gimap5, a member of at least seven related GTPase Immune Associated Protein genes located on rat chromosome 4q24. Our aim was to clone and sequence the cDNA of the BB diabetes prone (DP and diabetes resistant (DR alleles of all seven Gimap genes in the congenic DR.lyp rat line with 2 Mb of BB DP DNA introgressed onto the DR genetic background. All (100% DR.lyp/lyp rats are lymphopenic and develop type 1 diabetes (T1D by 84 days of age while DR.+/+ rats remain T1D and lyp resistant. Among the seven Gimap genes, the Gimap5 frameshift mutation, a mutant allele that produces no protein, had the greatest impact on lymphopenia in the DR.lyp/lyp rat. Gimap4 and Gimap1 each had one amino acid substitution of unlikely significance for lymphopenia. Quantitative RT-PCR analysis showed a reduction in expression of all seven Gimap genes in DR.lyp/lyp spleen and mesenteric lymph nodes when compared to DR.+/+. Only four; Gimap1, Gimap4, Gimap5, and Gimap9 were reduced in thymus. Our data substantiates the Gimap5 frameshift mutation as the primary defect with only limited contributions to lymphopenia from the remaining Gimap genes.

  7. Genes contributing to pain sensitivity in the normal population: an exome sequencing study.

    Directory of Open Access Journals (Sweden)

    Frances M K Williams

    Full Text Available Sensitivity to pain varies considerably between individuals and is known to be heritable. Increased sensitivity to experimental pain is a risk factor for developing chronic pain, a common and debilitating but poorly understood symptom. To understand mechanisms underlying pain sensitivity and to search for rare gene variants (MAF<5% influencing pain sensitivity, we explored the genetic variation in individuals' responses to experimental pain. Quantitative sensory testing to heat pain was performed in 2,500 volunteers from TwinsUK (TUK: exome sequencing to a depth of 70× was carried out on DNA from singletons at the high and low ends of the heat pain sensitivity distribution in two separate subsamples. Thus in TUK1, 101 pain-sensitive and 102 pain-insensitive were examined, while in TUK2 there were 114 and 96 individuals respectively. A combination of methods was used to test the association between rare variants and pain sensitivity, and the function of the genes identified was explored using network analysis. Using causal reasoning analysis on the genes with different patterns of SNVs by pain sensitivity status, we observed a significant enrichment of variants in genes of the angiotensin pathway (Bonferroni corrected p = 3.8×10(-4. This pathway is already implicated in animal models and human studies of pain, supporting the notion that it may provide fruitful new targets in pain management. The approach of sequencing extreme exome variation in normal individuals has provided important insights into gene networks mediating pain sensitivity in humans and will be applicable to other common complex traits.

  8. Genes contributing to pain sensitivity in the normal population: an exome sequencing study.

    Science.gov (United States)

    Williams, Frances M K; Scollen, Serena; Cao, Dandan; Memari, Yasin; Hyde, Craig L; Zhang, Baohong; Sidders, Benjamin; Ziemek, Daniel; Shi, Yujian; Harris, Juliette; Harrow, Ian; Dougherty, Brian; Malarstig, Anders; McEwen, Robert; Stephens, Joel C; Patel, Ketan; Menni, Cristina; Shin, So-Youn; Hodgkiss, Dylan; Surdulescu, Gabriela; He, Wen; Jin, Xin; McMahon, Stephen B; Soranzo, Nicole; John, Sally; Wang, Jun; Spector, Tim D

    2012-01-01

    Sensitivity to pain varies considerably between individuals and is known to be heritable. Increased sensitivity to experimental pain is a risk factor for developing chronic pain, a common and debilitating but poorly understood symptom. To understand mechanisms underlying pain sensitivity and to search for rare gene variants (MAF<5%) influencing pain sensitivity, we explored the genetic variation in individuals' responses to experimental pain. Quantitative sensory testing to heat pain was performed in 2,500 volunteers from TwinsUK (TUK): exome sequencing to a depth of 70× was carried out on DNA from singletons at the high and low ends of the heat pain sensitivity distribution in two separate subsamples. Thus in TUK1, 101 pain-sensitive and 102 pain-insensitive were examined, while in TUK2 there were 114 and 96 individuals respectively. A combination of methods was used to test the association between rare variants and pain sensitivity, and the function of the genes identified was explored using network analysis. Using causal reasoning analysis on the genes with different patterns of SNVs by pain sensitivity status, we observed a significant enrichment of variants in genes of the angiotensin pathway (Bonferroni corrected p = 3.8×10(-4)). This pathway is already implicated in animal models and human studies of pain, supporting the notion that it may provide fruitful new targets in pain management. The approach of sequencing extreme exome variation in normal individuals has provided important insights into gene networks mediating pain sensitivity in humans and will be applicable to other common complex traits.

  9. Sequence and molecular analysis of the nifL gene of Azotobacter vinelandii.

    Science.gov (United States)

    Blanco, G; Drummond, M; Woodley, P; Kennedy, C

    1993-08-01

    In both Klebsiella pneumoniae and Azotobacter vinelandii the nifL gene, which encodes a negative regulator of nitrogen fixation, lies immediately upstream of nifA. We have sequenced the A. vinelandii nifL gene and found that it is more homologous in its C-terminal domain to the histidine protein kinases (HPKs) than is K. pneumoniae NifL. In particular A. vinelandii NifL contains a conserved histidine at a position shown to be phosphorylated in other systems. Both NifL proteins are homologous in their N-termini to a part of the Halobacterium halobium bat gene product; Bat is involved in regulation of bacterio-opsin, the expression of which is oxygen sensitive. The same region showed homology to the haem-binding N-terminal domain of the Rhizobium meliloti fixL gene product, an oxygen-sensing protein. Like K. pneumoniae NifL, A. vinelandii NifL is shown here to prevent expression of nif genes in the presence of NH+4 or oxygen. The sequences found homologous in the C-terminal regions of NifL, FixL and Bat might therefore be involved in oxygen binding or sensing. An in-frame deletion mutation in the nifL coding region resulted in loss of repression by NH+4 and the mutant excreted high amounts of ammonia during nitrogen fixation, thus confirming a phenotype reported earlier for an insertion mutation. In addition, nifLA are cotranscribed in A. vinelandii as in K. pneumoniae, but expression from the A. vinelandii promoter requires neither RpoN nor NtrC. PMID:8231815

  10. Clinical Next-Generation Sequencing Pipeline Outperforms a Combined Approach Using Sanger Sequencing and Multiplex Ligation-Dependent Probe Amplification in Targeted Gene Panel Analysis.

    Science.gov (United States)

    Schenkel, Laila C; Kerkhof, Jennifer; Stuart, Alan; Reilly, Jack; Eng, Barry; Woodside, Crystal; Levstik, Alexander; Howlett, Christopher J; Rupar, Anthony C; Knoll, Joan H M; Ainsworth, Peter; Waye, John S; Sadikovic, Bekim

    2016-09-01

    Advances in next-generation sequencing (NGS) have facilitated parallel analysis of multiple genes enabling the implementation of cost-effective, rapid, and high-throughput methods for the molecular diagnosis of multiple genetic conditions, including the identification of BRCA1 and BRCA2 mutations in high-risk patients for hereditary breast and ovarian cancer. We clinically validated a NGS pipeline designed to replace Sanger sequencing and multiplex ligation-dependent probe amplification analysis and to facilitate detection of sequence and copy number alterations in a single test focusing on a BRCA1/BRCA2 gene analysis panel. Our custom capture library covers 46 exons, including BRCA1 exons 2, 3, and 5 to 24 and BRCA2 exons 2 to 27, with 20 nucleotides of intronic regions both 5' and 3' of each exon. We analyzed 402 retrospective patients, with previous Sanger sequencing and multiplex ligation-dependent probe amplification results, and 240 clinical prospective patients. One-hundred eighty-three unique variants, including sequence and copy number variants, were detected in the retrospective (n = 95) and prospective (n = 88) cohorts. This standardized NGS pipeline demonstrated 100% sensitivity and 100% specificity, uniformity, and high-depth nucleotide coverage per sample (approximately 7000 reads per nucleotide). Subsequently, the NGS pipeline was applied to the analysis of larger gene panels, which have shown similar uniformity, sample-to-sample reproducibility in coverage distribution, and sensitivity and specificity for detection of sequence and copy number variants. PMID:27376475

  11. Clinical Next-Generation Sequencing Pipeline Outperforms a Combined Approach Using Sanger Sequencing and Multiplex Ligation-Dependent Probe Amplification in Targeted Gene Panel Analysis.

    Science.gov (United States)

    Schenkel, Laila C; Kerkhof, Jennifer; Stuart, Alan; Reilly, Jack; Eng, Barry; Woodside, Crystal; Levstik, Alexander; Howlett, Christopher J; Rupar, Anthony C; Knoll, Joan H M; Ainsworth, Peter; Waye, John S; Sadikovic, Bekim

    2016-09-01

    Advances in next-generation sequencing (NGS) have facilitated parallel analysis of multiple genes enabling the implementation of cost-effective, rapid, and high-throughput methods for the molecular diagnosis of multiple genetic conditions, including the identification of BRCA1 and BRCA2 mutations in high-risk patients for hereditary breast and ovarian cancer. We clinically validated a NGS pipeline designed to replace Sanger sequencing and multiplex ligation-dependent probe amplification analysis and to facilitate detection of sequence and copy number alterations in a single test focusing on a BRCA1/BRCA2 gene analysis panel. Our custom capture library covers 46 exons, including BRCA1 exons 2, 3, and 5 to 24 and BRCA2 exons 2 to 27, with 20 nucleotides of intronic regions both 5' and 3' of each exon. We analyzed 402 retrospective patients, with previous Sanger sequencing and multiplex ligation-dependent probe amplification results, and 240 clinical prospective patients. One-hundred eighty-three unique variants, including sequence and copy number variants, were detected in the retrospective (n = 95) and prospective (n = 88) cohorts. This standardized NGS pipeline demonstrated 100% sensitivity and 100% specificity, uniformity, and high-depth nucleotide coverage per sample (approximately 7000 reads per nucleotide). Subsequently, the NGS pipeline was applied to the analysis of larger gene panels, which have shown similar uniformity, sample-to-sample reproducibility in coverage distribution, and sensitivity and specificity for detection of sequence and copy number variants.

  12. Agouti signalling protein (ASIP) gene: molecular cloning, sequence characterisation and tissue distribution in domestic goose.

    Science.gov (United States)

    Zhang, J; Wang, C; Liu, Y; Liu, J; Wang, H Y; Liu, A F; He, D Q

    2016-06-01

    Agouti signalling protein (ASIP) is an endogenous antagonist of melanocortin-1 receptor (MC1R) and is involved in the regulation of pigmentation in mammals. The objective of this study was to identify and characterise the ASIP gene in domestic goose. The goose ASIP cDNA consisted of a 44-nucleotide 5'-terminal untranslated region (UTR), a 390-nucleotide open-reading frame (ORF) and a 45-nucleotide 3'-UTR. The length of goose ASIP genomic DNA was 6176 bp, including three coding exons and two introns. Bioinformatic analysis indicated that the ORF encodes a protein of 130 amino-acid residues with a molecular weight of 14.88 kDa and an isoelectric point of 9.73. Multiple sequence alignments and phylogenetic analysis showed that the amino-acid sequence of ASIP was conserved in vertebrates, especially in the avian species. RT-qPCR showed that the goose ASIP mRNA was differentially expressed in the pigment deposition tissues, including eye, foot, feather follicle, skin of the back, as well as in skin of the abdomen. The expression level of the ASIP gene in skin of the abdomen was higher than that in skin of the back. Those findings will contribute to further understanding the functions of the ASIP gene in geese plumage colouring. PMID:26750999

  13. Targeted next generation sequencing reveals a novel intragenic deletion of the TPO gene in a family with intellectual disability

    NARCIS (Netherlands)

    Iqbal, Z.; Neveling, K.; Razzaq, A.; Shahzad, M.; Zahoor, M.Y.; Qasim, M.; Gilissen, C.; Wieskamp, N.; Kwint, M.P.; Gijsen, S.; Brouwer, A.P. de; Veltman, J.A.; Riazuddin, S.; Bokhoven, J.H.L.M. van

    2012-01-01

    BACKGROUNDS AND AIMS: Next generation sequencing (NGS) approaches have revolutionized the identification of mutations underlying genetic disorders. This technology is particularly useful for the identification of mutations in known and new genes for conditions with extensive genetic heterogeneity. I

  14. Gene Sequence Based Clustering Assists in Dereplication of Pseudoalteromonas luteoviolacea Strains with Identical Inhibitory Activity and Antibiotic Production

    DEFF Research Database (Denmark)

    Vynne, Nikolaj Grønnegaard; Månsson, Maria; Gram, Lone

    2012-01-01

    Some microbial species are chemically homogenous, and the same secondary metabolites are found in all strains. In contrast, we previously found that five strains of P. luteoviolacea were closely related by 16S rRNA gene sequence but produced two different antibiotic profiles. The purpose...... antibacterial profiles based on inhibition assays against Vibrio anguillarum and Staphylococcus aureus. To determine whether chemotype and inhibition profile are reflected by phylogenetic clustering we sequenced 16S rRNA, gyrB and recA genes. Clustering based on 16S rRNA gene sequences alone showed little...... correlation to chemotypes and inhibition profiles, while clustering based on concatenated 16S rRNA, gyrB, and recA gene sequences resulted in three clusters, two of which uniformly consisted of strains of identical chemotype and inhibition profile. A major time sink in natural products discovery is the effort...

  15. Cloning and sequencing of the trpE gene from Arthrobacter globiformis ATCC 8010 and several related subsurface Arthrobacter isolates

    Energy Technology Data Exchange (ETDEWEB)

    Chernova, T.; Viswanathan, V.K.; Austria, N.; Nichols, B.P.

    1998-09-01

    Tryptophan dependent mutants of Arthrobacter globiformis ATCC 8010 were isolated and trp genes were cloned by complementation and marker rescue of the auxotrophic strains. Rescue studies and preliminary sequence analysis reveal that at least the genes trpE, trpC, and trpB are clustered together in this organism. In addition, sequence analysis of the entire trpE gene, which encodes component I of anthranilate synthase, is described. Segments of the trpE gene from 17 subsurface isolates of Arthrobacter sp. were amplified by PCR and sequenced. The partial trpE sequences from the various strains were aligned and subjected to phylogenetic analysis. The data suggest that in addition to single base changes, recombination and genetic exchange play a major role in the evolution of the Arthrobacter genome.

  16. Barcode Sequencing Screen Identifies SUB1 as a Regulator of Yeast Pheromone Inducible Genes.

    Science.gov (United States)

    Sliva, Anna; Kuang, Zheng; Meluh, Pamela B; Boeke, Jef D

    2016-01-01

    The yeast pheromone response pathway serves as a valuable model of eukaryotic mitogen-activated protein kinase (MAPK) pathways, and transcription of their downstream targets. Here, we describe application of a screening method combining two technologies: fluorescence-activated cell sorting (FACS), and barcode analysis by sequencing (Bar-Seq). Using this screening method, and pFUS1-GFP as a reporter for MAPK pathway activation, we readily identified mutants in known mating pathway components. In this study, we also include a comprehensive analysis of the FUS1 induction properties of known mating pathway mutants by flow cytometry, featuring single cell analysis of each mutant population. We also characterized a new source of false positives resulting from the design of this screen. Additionally, we identified a deletion mutant, sub1Δ, with increased basal expression of pFUS1-GFP. Here, in the first ChIP-Seq of Sub1, our data shows that Sub1 binds to the promoters of about half the genes in the genome (tripling the 991 loci previously reported), including the promoters of several pheromone-inducible genes, some of which show an increase upon pheromone induction. Here, we also present the first RNA-Seq of a sub1Δ mutant; the majority of genes have no change in RNA, but, of the small subset that do, most show decreased expression, consistent with biochemical studies implicating Sub1 as a positive transcriptional regulator. The RNA-Seq data also show that certain pheromone-inducible genes are induced less in the sub1Δ mutant relative to the wild type, supporting a role for Sub1 in regulation of mating pathway genes. The sub1Δ mutant has increased basal levels of a small subset of other genes besides FUS1, including IMD2 and FIG1, a gene encoding an integral membrane protein necessary for efficient mating. PMID:26837954

  17. A Plasmid Bearing the bla(CTX-M-15) Gene and Phage P1-Like Sequences from a Sequence Type 11 Klebsiella pneumoniae Isolate.

    Science.gov (United States)

    Shin, Juyoun; Ko, Kwan Soo

    2015-10-01

    Plasmid pKP12226 was extracted and analyzed from a CTX-M-15-producing Klebsiella pneumoniae sequence type 11 (ST11) isolate collected in South Korea. The plasmid represents chimeric characteristics consisting of a pIP1206-like backbone and lysogenized phage P1-like sequences. It bears a resistance region that includes resistance genes to several antibiotics and is different from previously characterized plasmids from South Korea bearing blaCTX-M-15. It may have resulted from recombination between an Escherichia coli plasmid backbone, a blaCTX-M-15-bearing resistance region, and lysogenized phage P1-like sequences. PMID:26195513

  18. Cladistic biogeography of Gleditsia (Leguminosae) based on ndhF and rpl16 chloroplast gene sequences.

    Science.gov (United States)

    Schnabel, A; Wendel, J F

    1998-12-01

    We used cladistic analysis of chloroplast gene sequences (ndhF and rpl16) to test biogeographic hypotheses in the woody genus Gleditsia. Previous morphological comparisons suggested the presence of two eastern Asian-eastern North American species pairs among the 13 known species, as well as other intra- and inter-continental disjunctions. Results from phylogenetic analyses, interpreted in light of the amount of sequence divergence observed, led to the following conclusions. First, there is a fundamental division of the genus into three clades, only one of which contains both Asian and North American species. Second, the widespread and polymorphic Asian species, G. japonica, is sister to the two North American species, G. triacanthos and G. aquatica, which themselves are closely related inter se, but are both polymorphic and paraphyletic. Third, the lone South American Gleditsia species, G. amorphoides, forms a clade with two eastern Asian species. Gleditsia thus appears to have only one Asian-North American disjunction and no intercontinental species pairs. Low sequence divergence between G. amorphoides and its closest Asian relatives implicates long-distance dispersal in the origin of this unusual disjunction. Sequence divergence between Asian and North American Gleditsia is much lower than between Asian and North American species of its closest relative, Gymnocladus. Estimates of Asian-North American divergence times for Gymnocladus are in general accordance with fossil data, but estimates for Gleditsia suggest recent divergences that conflict with ages of known North American Gleditsia fossils.

  19. Detection of sequences homologous to human retroviral DNA in multiple sclerosis by gene amplification

    International Nuclear Information System (INIS)

    Twenty-one patients with multiple sclerosis, chronic progressive type, were examined for DNA sequences homologous to a human retrovirus. Genomic DNA from peripheral blood mononuclear cells was analyzed for the presence of homologous sequences to the human T-cell leukemia/lymphoma virus type I (HTLV-I) long terminal repeat, 3' gag, pol, and env domains by the enzymatic in vitro gene amplification technique, polymerase chain reaction. Positive identification of homologous pol sequences was made in the amplified DNA from six of these patients (29%). Three of these six patients (14%) also tested positive for the env region, but not for the other regions tested. In contrast, none of the samples from 35 normal individuals studied was positive when amplified and tested with the same primers and probes. Comparison of patterns obtained from controls and from patients with adult T-cell leukemia or tropical spastic paraparesis suggests that the DNA sequences identified are exogenous to the human genome and may correspond to a human retroviral species. The data support the detection of a human retroviral agent in some patients with multiple sclerosis

  20. DNA sequence templates adjacent nucleosome and ORC sites at gene amplification origins in Drosophila.

    Science.gov (United States)

    Liu, Jun; Zimmer, Kurt; Rusch, Douglas B; Paranjape, Neha; Podicheti, Ram; Tang, Haixu; Calvi, Brian R

    2015-10-15

    Eukaryotic origins of DNA replication are bound by the origin recognition complex (ORC), which scaffolds assembly of a pre-replicative complex (pre-RC) that is then activated to initiate replication. Both pre-RC assembly and activation are strongly influenced by developmental changes to the epigenome, but molecular mechanisms remain incompletely defined. We have been examining the activation of origins responsible for developmental gene amplification in Drosophila. At a specific time in oogenesis, somatic follicle cells transition from genomic replication to a locus-specific replication from six amplicon origins. Previous evidence indicated that these amplicon origins are activated by nucleosome acetylation, but how this affects origin chromatin is unknown. Here, we examine nucleosome position in follicle cells using micrococcal nuclease digestion with Ilumina sequencing. The results indicate that ORC binding sites and other essential origin sequences are nucleosome-depleted regions (NDRs). Nucleosome position at the amplicons was highly similar among developmental stages during which ORC is or is not bound, indicating that being an NDR is not sufficient to specify ORC binding. Importantly, the data suggest that nucleosomes and ORC have opposite preferences for DNA sequence and structure. We propose that nucleosome hyperacetylation promotes pre-RC assembly onto adjacent DNA sequences that are disfavored by nucleosomes but favored by ORC.

  1. Detection and Quantification of Mosaic Mutations in Disease Genes by Next-Generation Sequencing.

    Science.gov (United States)

    Qin, Lan; Wang, Jing; Tian, Xia; Yu, Hui; Truong, Cavatina; Mitchell, John J; Wierenga, Klaas J; Craigen, William J; Zhang, Victor Wei; Wong, Lee-Jun C

    2016-05-01

    The identification of mosaicism is important in establishing a disease diagnosis, assessing recurrence risk, and genetic counseling. Next-generation sequencing (NGS) with deep sequence coverage enhances sensitivity and allows for accurate quantification of the level of mosaicism. NGS identifies low-level mosaicism that would be undetectable by conventional Sanger sequencing. A customized DNA probe library was used for capturing targeted genes, followed by deep NGS analysis. The mean coverage depth per base was approximately 800×. The NGS sequence data were analyzed for single-nucleotide variants and copy number variations. Mosaic mutations in 10 cases/families were detected and confirmed by NGS analysis. Mosaicism was identified for autosomal dominant (JAG1, COL3A1), autosomal recessive (PYGM), and X-linked (PHKA2, PDHA1, OTC, and SLC6A8) disorders. The mosaicism was identified either in one or more tissues from the probands or in a parent of an affected child. When analyzing data from patients with unusual testing results or inheritance patterns, it is important to further evaluate the possibility of mosaicism. Deep NGS analysis not only provides insights into the spectrum of mosaic mutations but also underlines the importance of the detection of mosaicism as an integral part of clinical molecular diagnosis and genetic counseling. PMID:26944031

  2. Sequence analysis of the msp4 gene of Anaplasma ovis strains

    Science.gov (United States)

    de la Fuente, J.; Atkinson, M.W.; Naranjo, V.; Fernandez de Mera, I. G.; Mangold, A.J.; Keating, K.A.; Kocan, K.M.

    2007-01-01

    Anaplasma ovis (Rickettsiales: Anaplasmataceae) is a tick-borne pathogen of sheep, goats and wild ruminants. The genetic diversity of A. ovis strains has not been well characterized due to the lack of sequence information. In this study, we evaluated bighorn sheep (Ovis canadensis) and mule deer (Odocoileus hemionus) from Montana for infection with A. ovis by serology and sequence analysis of the msp4 gene. Antibodies to Anaplasma spp. were detected in 37% and 39% of bighorn sheep and mule deer analyzed, respectively. Four new msp4 genotypes were identified. The A. ovis msp4 sequences identified herein were analyzed together with sequences reported previously for the characterization of the genetic diversity of A. ovis strains in comparison with other Anaplasma spp. The results of these studies demonstrated that although A. ovis msp4 genotypes may vary among geographic regions and between sheep and deer hosts, the variation observed was less than the variation observed between A. marginale and A. phagocytophilum strains. The results reported herein further confirm that A. ovis infection occurs in natural wild ruminant populations in Western United States and that bighorn sheep and mule deer may serve as wildlife reservoirs of A. ovis. ?? 2006.

  3. Genetic Diversity in Populations of Sepiella maindroni Using 16S rRNA Gene Sequence Analysis

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Part of the 16S rRNA gene is amplified with PCR and sequenced for 5 populations of common Chinese cuttlefish Sepiella maindroni: three from the South China Sea, one from East China Sea and one from Japan. The result shows that a total of 5 nucleotide positions are found to have gaps or insertions of base pairs among these individuals, and 13 positions are examined to be variable in all the sequences, which range from 494 to 509 base pairs. All of the individuals are grouped into 7 haplotypes (h1-h7). No marked genetic difference is observed among those populations. All of the individuals from Nagasaki belong to h1 and the h3 haplotype is found only in the coastal waters of China. AG transition in Nucleotide 255 is suggested to be taken as a kind of genetic marker to identify the populations distributed in East-South China Sea and the Nagasaki waters of Japan.

  4. discussion on validity of rana maoershanensis based on partial sequence of 16s rrna gene

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    rana maoershanensis found in mt.maoershan in guangxi,china was reported as a new species in 2007,but there was no molecular data for this frog.the partial sequences (543 bp) of 16s rrna gene from 12 specimens of 3 brown frog species (rana hanluica,r.maoershanensis and r.chensinensis) were analyzed with 17 specimens of 9 species from genbank.the nucleotide sequence divergence between r.maoershanensis and the other brown frog species were 4.5%-6.5%,with 22-30 nucleotide substitutions at this locus.the phylogenetic relationships based on mp,ml,and bayesian inference indicate that the brown frogs from southern china were diverged into three groups (clades a,b and c).r.maoershanensis was clustered together a well-supported subclade (b-l).it is suggested that r.maoershanensis is a valid species.

  5. Analysis of unstable DNA sequence in FRM1 gene in Polish families with fragile X syndrome

    International Nuclear Information System (INIS)

    The unstable DNA sequence in the FMR1 gene was analyzed in 85 individuals from Polish families with fragile X syndrome in order to characterize mutations responsible for the disease in Poland. In all affected individuals classified on the basis of clinical features and expression of the fragile site at X(q27.3) a large expansion of the unstable sequence (full mutation) was detected. About 5% (2 of 43) of individuals with full mutation did not express the fragile site. Among normal alleles, ranging in size from 20 to 41 CGC repeats, allele with 29 repeats was the most frequent (37%). Transmission of premutated and fully mutated alleles to the offspring was always associated with size increase. No change in repeat number was found when normal alleles were transmitted. (author). 19 refs., 4 figs, 1 tab

  6. Development of primers for sequencing the NSP1, NSP3, and VP6 genes of the group A porcine rotavirus

    OpenAIRE

    Fernanda Dornelas Florentino Silva; Paloma Oliveira Tonietti; Luis Ramiro Luna Espinoza; Paulo Eduardo Brandão; Leonardo José Richtzenhain; Fabio Gregori

    2014-01-01

    Rotavirus is the causative pathogen of diarrhea in humans and in several animal species. Eight pairs of primers were developed and used for Sanger sequencing of the coding region of the NSP1, NSP3, and VP6 genes based on the conserved regions of the genome of the group A porcine rotavirus. Three samples previously screened as positive for group A rotaviruses were subjected to gene amplification and sequencing to characterize the pathogen. The information generated from this study is crucial f...

  7. Implications of using whole genome sequencing to test unselected populations for high risk breast cancer genes: a modelling study

    OpenAIRE

    Warren-Gash, Charlotte; Kroese, Mark; Burton, Hilary; Pharoah, Paul

    2016-01-01

    Background The decision to test for high risk breast cancer gene mutations is traditionally based on risk scores derived from age, family and personal cancer history. Next generation sequencing technologies such as whole genome sequencing (WGS) make wider population testing more feasible. In the UK’s 100,000 Genomes Project, mutations in 16 genes including BRCA1 and BRCA2 are to be actively sought regardless of clinical presentation. The implications of deploying this approach at scale for pa...

  8. Cloning, sequencing, and expression of the gene encoding amylopullulanase from Pyrococcus furiosus and biochemical characterization of the recombinant enzyme.

    OpenAIRE

    Dong, G.; Vieille, C; Zeikus, J G

    1997-01-01

    The gene encoding the Pyrococcus furiosus hyperthermophilic amylopullulanase (APU) was cloned, sequenced, and expressed in Escherichia coli. The gene encoded a single 827-residue polypeptide with a 26-residue signal peptide. The protein sequence had very low homology (17 to 21% identity) with other APUs and enzymes of the alpha-amylase family. In particular, none of the consensus regions present in the alpha-amylase family could be identified. P. furiosus APU showed similarity to three protei...

  9. The Structure and Sequence Analysis of TLR4 Gene in Cattle

    Institute of Scientific and Technical Information of China (English)

    WANG Xing-ping; LUO RENG Zhuo-ma; XU Shang-zhong; GAO Xue; LI Jun-ya; REN Hong-yan; CHEN Jin-bao

    2009-01-01

    Toll-like receptor 4 (TLR4) is essential for initiating the innate response to lipopolysaccharide (LPS) from Gram-negative bacteria by acting as a signal transducting receptor.In order to help in investigating TLR4 as a candidate disease-resistance gene in cows,we isolated the cDNA (GenBank accession no.DQ839566) by RT-PCR and rapid amplification of cDNA ends (RACE) experiments and analyzed the sequence characters by bioinformatics.The results showed that cattle TLR4 gene about 3 739 bp contains an open reading frame of 2 526 bp encoded 841 amino acids (aa),470 bp 5" untranslated region (UTR),and 743 bp 3' UTR.Tissue expression profile by RT-PCR indicated that TLR4 gene expresses in mammary glands,liver,muscle,duodenum,fats,uterus,kidneys,hearts,lungs,pancreas,and ovary.TLR4 protein domain predicted by bioinformatics consists of signal peptide,transmembrane helices domain,3 sorts of leucine-rich repeat domains (LRR,LRR-TYP,and LRRCT),and a toll-interleukinl-resistance domain (TIR).Leucine-rich repeat domains were related with recognizing a broad of pathogen-associated molecular patterns (PAMP) from pathogen,and TIR domain for downstream signaling transduction was most conservative (98% identify) than other domains after alignment of protein from ovine,porcine,human,and mouse.In addition,a 470 bp 5'-flanking region sequence was amplified by PCR,and 15 putative DNA binding sites were predicted,but this sequence lacks TATA box,CCAAT character,and GC-rich regions.

  10. Phylogeny of the cuttlefishes (Mollusca:Cephalopoda) based on mitochondrial COI and 16S rRNA gene sequence data

    Institute of Scientific and Technical Information of China (English)

    LIN Xiangzhi; ZHENG Xiaodong; XIAO Shu; WANG Rucai

    2004-01-01

    To clarify cuttlefish phylogeny, mitochondrial cytochrome c oxidase subunit I (COI) gene and partial 16S rRNA gene are sequenced for 13 cephalopod species. Phylogenetic trees are constructed, with the neighbor-joining method.Coleoids are divided into two main lineages, Decabrachia and Octobrachia. The monophyly of the order Sepioidea,which includes the families Sepiidae, Sepiolidae and Idiosepiidae, is not supported. From the two families of Sepioidea examined, the Sepiolidae are polyphyletic and are excluded from the order. On the basis of 16S rRNA and amino acid of COI gene sequences data, the two genera (Sepiella and Sepia) from the Sepiidae can be distinguished, but do not have a visible boundary using COI gene sequences. The reason is explained. This suggests that the 16S rDNA of cephalopods is a precious tool to analyze taxonomic relationships at the genus level, and COI gene is fitter at a higher taxonomic level (i.e., family).

  11. Cis-acting sequences from a human surfactant protein gene confer pulmonary-specific gene expression in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Korfhagen, T.R.; Glasser, S.W.; Wert, S.E.; Bruno, M.D.; Daugherty, C.C.; McNeish, J.D.; Stock, J.L.; Potter, S.S.; Whitsett, J.A. (Cincinnati College of Medicine, OH (USA))

    1990-08-01

    Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5{prime}-flanking sequences of the human SP-C gene was used to express diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.

  12. Analysis of the chromatin domain organisation around the plastocyanin gene reveals an MAR-specific sequence element in Arabidopsis thaliana.

    Science.gov (United States)

    van Drunen, C M; Oosterling, R W; Keultjes, G M; Weisbeek, P J; van Driel, R; Smeekens, S C

    1997-10-01

    The Arabidopsis thaliana genome is currently being sequenced, eventually leading towards the unravelling of all potential genes. We wanted to gain more insight into the way this genome might be organized at the ultrastructural level. To this extent we identified matrix attachment regions demarking potential chromatin domains, in a 16 kb region around the plastocyanin gene. The region was cloned and sequenced revealing six genes in addition to the plastocyanin gene. Using an heterologous in vitro nuclear matrix binding assay, to search for evolutionary conserved matrix attachment regions (MARs), we identified three such MARs. These three MARs divide the region into two small chromatin domains of 5 kb, each containing two genes. Comparison of the sequence of the three MARs revealed a degenerated 21 bp sequence that is shared between these MARs and that is not found elsewhere in the region. A similar sequence element is also present in four other MARs of Arabidopsis.Therefore, this sequence may constitute a landmark for the position of MARs in the genome of this plant. In a genomic sequence database of Arabidopsis the 21 bp element is found approximately once every 10 kb. The compactness of the Arabidopsis genome could account for the high incidence of MARs and MRSs we observed.

  13. Partial Sequence Analysis of Merozoite Surface Proteine-3α Gene in Plasmodium vivax Isolates from Malarious Areas of Iran

    Directory of Open Access Journals (Sweden)

    H Mirhendi

    2008-12-01

    Full Text Available Background: Approximately 85-90% of malaria infections in Iran are attributed to Plasmodium vivax, while little is known about the genetic of the parasite and its strain types in this region. This study was designed and performed for describing genetic characteristics of Plasmodium vivax population of Iran based on the merozoite surface protein-3α gene sequence. Methods: Through a descriptive study we analyzed partial P. vivax merozoite surface protein-3α gene sequences from 17 clinical P. vivax isolates collected from malarious areas of Iran. Genomic DNA was extracted by Q1Aamp® DNA blood mini kit, amplified through nested PCR for a partial nucleotide sequence of PvMSP-3 gene in P. vivax. PCR-amplified products were sequenced with an ABI Prism Perkin-Elmer 310 sequencer machine and the data were analyzed with clustal W software. Results: Analysis of PvMSP-3 gene sequences demonstrated extensive polymorphisms, but the sequence identity between isolates of same types was relatively high. We identified specific insertions and deletions for the types A, B and C variants of P. vivax in our isolates. In phylogenetic comparison of geographically separated isolates, there was not a significant geo­graphical branching of the parasite populations. Conclusion: The highly polymorphic nature of isolates suggests that more investigations of the PvMSP-3 gene are needed to explore its vaccine potential.

  14. Cloning and nucleotide sequence of the Salmonella typhimurium dcp gene encoding dipeptidyl carboxypeptidase.

    OpenAIRE

    Hamilton, S.; Miller, C G

    1992-01-01

    Plasmids carrying the Salmonella typhimurium dcp gene were isolated from a pBR328 library of Salmonella chromosomal DNA by screening for complementation of a peptide utilization defect conferred by a dcp mutation. Strains carrying these plasmids overproduced dipeptidyl carboxypeptidase approximately 50-fold. The nucleotide sequence of a 2.8-kb region of one of these plasmids contained an open reading frame coding for a protein of 77,269 Da, in agreement with the 80-kDa size for dipeptidyl car...

  15. Novel Acanthamoeba 18S rRNA gene sequence type from an environmental isolate.

    Science.gov (United States)

    Magnet, A; Henriques-Gil, N; Galván-Diaz, A L; Izquiedo, F; Fenoy, S; del Aguila, C

    2014-08-01

    The free-living amoebae, Acanthamoeba, can act as opportunistic parasites on a wide range of vertebrates and are becoming a serious threat to human health due to the resistance of their cysts to harsh environmental conditions, disinfectants, some water treatment practices, and their ubiquitous distribution. Subgenus classification based on morphology is being replaced by a classification based on the sequences of the 18S rRNA gene with a total of 18 different genotypes (T1-T18). A new environmental strain of Acanthamoeba isolated from a waste water treatment plant is presented in this study as a candidate for the description of the novel genotype T19 after phylogenetic analysis.

  16. Globicatella sanguinis bacteraemia identified by partial 16S rRNA gene sequencing

    DEFF Research Database (Denmark)

    Abdul-Redha, Rawaa Jalil; Balslew, Ulla; Christensen, Jens Jørgen;

    2007-01-01

    Globicatella sanguinis is a gram-positive coccus, resembling non-haemolytic streptococci. The organism has been isolated infrequently from normally sterile sites of humans. Three isolates obtained by blood culture could not be identified by Rapid 32 ID Strep, but partial sequencing of the 16S r......RNA gene revealed the identity of the isolated bacteria, and supplementary biochemical tests confirmed the species identification. The cases histories illustrate the dilemma of finding relevant, newly recognized, opportunistic pathogens and the identification achievement (s) that can be obtained by using...

  17. Sequence and structural requirements for high-affinity DNA binding by the WT1 gene product.

    OpenAIRE

    Nakagama, H; Heinrich, G.; Pelletier, J; Housman, D E

    1995-01-01

    The Wilms' tumor suppressor gene, WT1, encodes a zinc finger polypeptide which plays a key role regulating cell growth and differentiation in the urogenital system. Using the whole-genome PCR approach, we searched murine genomic DNA for high-affinity WT1 binding sites and identified a 10-bp motif 5'GCGTGGGAGT3' which we term WTE). The WTE motif is similar to the consensus binding sequence 5'GCG(G/T)GGGCG3' recognized by EGR-1 and is also suggested to function as a binding site for WT1, settin...

  18. New splicing mutation in the choline kinase beta (CHKB) gene causing a muscular dystrophy detected by whole-exome sequencing.

    Science.gov (United States)

    Oliveira, Jorge; Negrão, Luís; Fineza, Isabel; Taipa, Ricardo; Melo-Pires, Manuel; Fortuna, Ana Maria; Gonçalves, Ana Rita; Froufe, Hugo; Egas, Conceição; Santos, Rosário; Sousa, Mário

    2015-06-01

    Muscular dystrophies (MDs) are a group of hereditary muscle disorders that include two particularly heterogeneous subgroups: limb-girdle MD and congenital MD, linked to 52 different genes (seven common to both subgroups). Massive parallel sequencing technology may avoid the usual stepwise gene-by-gene analysis. We report the whole-exome sequencing (WES) analysis of a patient with childhood-onset progressive MD, also presenting mental retardation and dilated cardiomyopathy. Conventional sequencing had excluded eight candidate genes. WES of the trio (patient and parents) was performed using the ion proton sequencing system. Data analysis resorted to filtering steps using the GEMINI software revealed a novel silent variant in the choline kinase beta (CHKB) gene. Inspection of sequence alignments ultimately identified the causal variant (CHKB:c.1031+3G>C). This splice site mutation was confirmed using Sanger sequencing and its effect was further evaluated with gene expression analysis. On reassessment of the muscle biopsy, typical abnormal mitochondrial oxidative changes were observed. Mutations in CHKB have been shown to cause phosphatidylcholine deficiency in myofibers, causing a rare form of CMD (only 21 patients reported). Notwithstanding interpretative difficulties that need to be overcome before the integration of WES in the diagnostic workflow, this work corroborates its utility in solving cases from highly heterogeneous groups of diseases, in which conventional diagnostic approaches fail to provide a definitive diagnosis. PMID:25740612

  19. Rare Variants in Neurodegeneration Associated Genes Revealed by Targeted Panel Sequencing in a German ALS Cohort

    Science.gov (United States)

    Krüger, Stefanie; Battke, Florian; Sprecher, Andrea; Munz, Marita; Synofzik, Matthis; Schöls, Ludger; Gasser, Thomas; Grehl, Torsten; Prudlo, Johannes; Biskup, Saskia

    2016-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive fatal multisystemic neurodegenerative disorder caused by preferential degeneration of upper and lower motor neurons. To further delineate the genetic architecture of the disease, we used comprehensive panel sequencing in a cohort of 80 German ALS patients. The panel covered 39 confirmed ALS genes and candidate genes, as well as 238 genes associated with other entities of the neurodegenerative disease spectrum. In addition, we performed repeat length analysis for C9orf72. Our aim was to (1) identify potentially disease-causing variants, to (2) assess a proposed model of polygenic inheritance in ALS and to (3) connect ALS with other neurodegenerative entities. We identified 79 rare potentially pathogenic variants in 27 ALS associated genes in familial and sporadic cases. Five patients had pathogenic C9orf72 repeat expansions, a further four patients harbored intermediate length repeat expansions. Our findings demonstrate that a genetic background of the disease can actually be found in a large proportion of seemingly sporadic cases and that it is not limited to putative most frequently affected genes such as C9orf72 or SOD1. Assessing the polygenic nature of ALS, we identified 15 patients carrying at least two rare potentially pathogenic variants in ALS associated genes including pathogenic or intermediate C9orf72 repeat expansions. Multiple variants might influence severity or duration of disease or could account for intrafamilial phenotypic variability or reduced penetrance. However, we could not observe a correlation with age of onset in this study. We further detected potentially pathogenic variants in other neurodegeneration associated genes in 12 patients, supporting the hypothesis of common pathways in neurodegenerative diseases and linking ALS to other entities of the neurodegenerative spectrum. Most interestingly we found variants in GBE1 and SPG7 which might represent differential diagnoses. Based on our

  20. Maximal sequence length of exact match between members from a gene family during early evolution

    Institute of Scientific and Technical Information of China (English)

    WEN Xiao; GUO Xing-yi; FAN Long-jiang

    2005-01-01

    Mutation (substitution, deletion, insertion, etc.) in nucleotide acid causes the maximal sequence lengths of exact match (MALE) between paralogous members from a duplicate event to become shorter during evolution. In this work, MALE changes between members of 26 gene families from four representative species (Arabidopsis thaliana, Oryza sativa, Mus musculus and Homo sapiens) were investigated. Comparative study ofparalogous' MALE and amino acid substitution rate (dA<0.5)indicated that a close relationship existed between them. The results suggested that MALE could be a sound evolutionary scale for the divergent time for paralogous genes during their early evolution. A reference table between MALE and divergent time for the four species was set up, which would be useful widely, for large-scale genome alignment and comparison. As an example, detection of large-scale duplication events of rice genome based on the table was illustrated.

  1. Sequence characterization of heat shock protein gene of Cyclospora cayetanensis isolates from Nepal, Mexico, and Peru.

    Science.gov (United States)

    Sulaiman, Irshad M; Torres, Patricia; Simpson, Steven; Kerdahi, Khalil; Ortega, Ynes

    2013-04-01

    We have described the development of a 2-step nested PCR protocol based on the characterization of the 70-kDa heat shock protein (HSP70) gene for rapid detection of the human-pathogenic Cyclospora cayetanensis parasite. We tested and validated these newly designed primer sets by PCR amplification followed by nucleotide sequencing of PCR-amplified HSP70 fragments belonging to 16 human C. cayetanensis isolates from 3 different endemic regions that include Nepal, Mexico, and Peru. No genetic polymorphism was observed among the isolates at the characterized regions of the HSP70 locus. This newly developed HSP70 gene-based nested PCR protocol provides another useful genetic marker for the rapid detection of C. cayetanensis in the future. PMID:22924935

  2. Delineation of the species Haemophilus influenzae by phenotype, multilocus sequence phylogeny, and detection of marker genes

    DEFF Research Database (Denmark)

    Nørskov-Lauritsen, Niels; Overballe, MD; Kilian, Mogens

    2009-01-01

    To obtain more information on the much-debated definition of prokaryotic species, we investigated the borders of Haemophilus influenzae by comparative analysis of H. influenzae reference strains with closely related bacteria including strains assigned to Haemophilus haemolyticus, cryptic...... genospecies biotype IV, and the never formally validated species "Haemophilus intermedius". Multilocus sequence phylogeny based on six housekeeping genes separated a cluster encompassing the type and the reference strains of H. influenzae from 31 more distantly related strains. Comparison of 16S rRNA gene...... branching cluster, intermingled with strains of "H. intermedius" and cryptic genospecies biotype IV. Although H. influenzae is phenotypically more homogenous than some other Haemophilus species, the genetic diversity and multicluster structure of strains traditionally associated with H. influenzae make...

  3. Phylogenetic analysis of Thai oyster (Ostreidae) based on partial sequences of the mitochondrial 16S rDNA gene

    DEFF Research Database (Denmark)

    Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik;

    2006-01-01

    Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen...

  4. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    DEFF Research Database (Denmark)

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa;

    2010-01-01

    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times...

  5. Molecular phylogenetic and sequence variation analysis of dimeric α-amylase inhibitor genes in wheat and its wild relative species

    Directory of Open Access Journals (Sweden)

    Bharati Pandey

    2016-06-01

    Full Text Available Dimeric alpha-amylase inhibitors serve protection against insects that are highly dependent on starch for their energy. In order to study the molecular evolution and sequence variation, we have sequenced dimeric α-amylase inhibitors gene from different genomes in Triticeae including Indian bread and durum wheat genotypes. Using BLAST, obtained sequences show very high homology with other inhibitors available at GenBank database and had common conserved 10 cysteine residues. Investigated frequency of significant SNPs in the α-amylase inhibitor gene was 1 out of 60 bases. The phylogenetic analysis based on deduced amino acid sequences revealed that the genes encoding dimeric α-amylase inhibitors formed three groups and genes isolated from Indian bread wheat clustered with 0.19 inhibitors. In addition, we predicted that dimeric α-amylase inhibitors co-localized into chloroplast and mitochondria expect for the sequences isolated from Aegilops tauschii. Fingerprinting analysis done with ScanProsite confirmed biologically meaningful signatures. Multiple sequence alignment of dimeric α-amylase proteins from different plant species revealed a conserved secondary structure region, indicating homology at the sequence and structural levels. Analysis of the protein sequences obtained from wheat and its wild related species are very similar, indicates a highest conservation of these proteins.

  6. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  7. Methylation-sensitive linking libraries enhance gene-enriched sequencing of complex genomes and map DNA methylation domains

    Directory of Open Access Journals (Sweden)

    Bharti Arvind K

    2008-12-01

    Full Text Available Abstract Background Many plant genomes are resistant to whole-genome assembly due to an abundance of repetitive sequence, leading to the development of gene-rich sequencing techniques. Two such techniques are hypomethylated partial restriction (HMPR and methylation spanning linker libraries (MSLL. These libraries differ from other gene-rich datasets in having larger insert sizes, and the MSLL clones are designed to provide reads localized to "epigenetic boundaries" where methylation begins or ends. Results A large-scale study in maize generated 40,299 HMPR sequences and 80,723 MSLL sequences, including MSLL clones exceeding 100 kb. The paired end reads of MSLL and HMPR clones were shown to be effective in linking existing gene-rich sequences into scaffolds. In addition, it was shown that the MSLL clones can be used for anchoring these scaffolds to a BAC-based physical map. The MSLL end reads effectively identified epigenetic boundaries, as indicated by their preferential alignment to regions upstream and downstream from annotated genes. The ability to precisely map long stretches of fully methylated DNA sequence is a unique outcome of MSLL analysis, and was also shown to provide evidence for errors in gene identification. MSLL clones were observed to be significantly more repeat-rich in their interiors than in their end reads, confirming the correlation between methylation and retroelement content. Both MSLL and HMPR reads were found to be substantially gene-enriched, with the SalI MSLL libraries being the most highly enriched (31% align to an EST contig, while the HMPR clones exhibited exceptional depletion of repetitive DNA (to ~11%. These two techniques were compared with other gene-enrichment methods, and shown to be complementary. Conclusion MSLL technology provides an unparalleled approach for mapping the epigenetic status of repetitive blocks and for identifying sequences mis-identified as genes. Although the types and natures of

  8. The complete nucleotide sequence of the rat 18S ribosomal RNA gene and comparison with the respective yeast and frog genes.

    OpenAIRE

    Torczynski, R; Bollon, A P; Fuke, M

    1983-01-01

    The complete nucleotide sequence of the rat 18S ribosomal RNA gene has been determined. A comparison of the rat 18S ribosomal RNA gene sequence with the known sequences of yeast and frog revealed three conserved (stable) regions, two unstable regions, and three large inserts. (A,T) leads to (G,C) changes were more frequent than (G,C) leads to (A,T) changes for three comparisons (yeast leads to frog, frog leads to rat, and yeast leads to rat). GC pairs were inserted preferentially over AT pair...

  9. Nucleotide sequence of the plasminogen activator gene of Yersinia pestis: relationship to ompT of Escherichia coli and gene E of Salmonella typhimurium.

    OpenAIRE

    Sodeinde, O A; Goguen, J.D.

    1989-01-01

    We have determined the nucleotide sequence of the 1.4-kilobase DNA fragment containing the plasminogen activator gene (pla) of Yersinia pestis, which determines both plasminogen activator and coagulase activities of the species. The sequence revealed the presence of a 936-base-pair open reading frame that constitutes the pla gene. This reading frame encodes a 312-amino-acid protein of 34.6 kilodaltons and containing a putative 20-amino-acid signal sequence. The presence of a single large open...

  10. Comparisons between Arabidopsis thaliana and Drosophila melanogaster in relation to Coding and Noncoding Sequence Length and Gene Expression

    Directory of Open Access Journals (Sweden)

    Rachel Caldwell

    2015-01-01

    Full Text Available There is a continuing interest in the analysis of gene architecture and gene expression to determine the relationship that may exist. Advances in high-quality sequencing technologies and large-scale resource datasets have increased the understanding of relationships and cross-referencing of expression data to the large genome data. Although a negative correlation between expression level and gene (especially transcript length has been generally accepted, there have been some conflicting results arising from the literature concerning the impacts of different regions of genes, and the underlying reason is not well understood. The research aims to apply quantile regression techniques for statistical analysis of coding and noncoding sequence length and gene expression data in the plant, Arabidopsis thaliana, and fruit fly, Drosophila melanogaster, to determine if a relationship exists and if there is any variation or similarities between these species. The quantile regression analysis found that the coding sequence length and gene expression correlations varied, and similarities emerged for the noncoding sequence length (5′ and 3′ UTRs between animal and plant species. In conclusion, the information described in this study provides the basis for further exploration into gene regulation with regard to coding and noncoding sequence length.

  11. Shotgun Metagenomic Sequencing Reveals Functional Genes and Microbiome Associated with Bovine Digital Dermatitis.

    Directory of Open Access Journals (Sweden)

    Martin Zinicola

    Full Text Available Metagenomic methods amplifying 16S ribosomal RNA genes have been used to describe the microbial diversity of healthy skin and lesion stages of bovine digital dermatitis (DD and to detect critical pathogens involved with disease pathogenesis. In this study, we characterized the microbiome and for the first time, the composition of functional genes of healthy skin (HS, active (ADD and inactive (IDD lesion stages using a whole-genome shotgun approach. Metagenomic sequences were annotated using MG-RAST pipeline. Six phyla were identified as the most abundant. Firmicutes and Actinobacteria were the predominant bacterial phyla in the microbiome of HS, while Spirochetes, Bacteroidetes and Proteobacteria were highly abundant in ADD and IDD. T. denticola-like, T. vincentii-like and T. phagedenis-like constituted the most abundant species in ADD and IDD. Recruitment plots comparing sequences from HS, ADD and IDD samples to the genomes of specific Treponema spp., supported the presence of T. denticola and T. vincentii in ADD and IDD. Comparison of the functional composition of HS to ADD and IDD identified a significant difference in genes associated with motility/chemotaxis and iron acquisition/metabolism. We also provide evidence that the microbiome of ADD and IDD compared to that of HS had significantly higher abundance of genes associated with resistance to copper and zinc, which are commonly used in footbaths to prevent and control DD. In conclusion, the results from this study provide new insights into the HS, ADD and IDD microbiomes, improve our understanding of the disease pathogenesis and generate unprecedented knowledge regarding the functional genetic composition of the digital dermatitis microbiome.

  12. Stem loop sequences specific to transposable element IS605 are found linked to lipoprotein genes in Borrelia plasmids.

    Directory of Open Access Journals (Sweden)

    Nicholas Delihas

    Full Text Available BACKGROUND: Plasmids of Borrelia species are dynamic structures that contain a large number of repetitive genes, gene fragments, and gene fusions. In addition, the transposable element IS605/200 family, as well as degenerate forms of this IS element, are prevalent. In Helicobacter pylori, flanking regions of the IS605 transposase gene contain sequences that fold into identical small stem loops. These function in transposition at the single-stranded DNA level. METHODOLOGY/PRINCIPAL FINDINGS: In work reported here, bioinformatics techniques were used to scan Borrelia plasmid genomes for IS605 transposable element specific stem loop sequences. Two variant stem loop motifs are found in the left and right flanking regions of the transposase gene. Both motifs appear to have dispersed in plasmid genomes and are found "free-standing" and phylogenetically conserved without the associated IS605 transposase gene or the adjacent flanking sequence. Importantly, IS605 specific stem loop sequences are also found at the 3' ends of lipoprotein genes (PFam12 and PFam60, however the left and right sequences appear to develop their own evolutionary patterns. The lipoprotein gene-linked left stem loop sequences maintain the IS605 stem loop motif in orthologs but only at the RNA level. These show mutations whereby variants fold into phylogenetically conserved RNA-type stem loops that contain the wobble non-Watson-Crick G-U base-pairing. The right flanking sequence is associated with the family lipoprotein-1 genes. A comparison of homologs shows that the IS605 stem loop motif rapidly dissipates, but a more elaborate secondary structure appears to develop in its place. CONCLUSIONS/SIGNIFICANCE: Stem loop sequences specific to the transposable element IS605 are present in plasmid regions devoid of a transposase gene and significantly, are found linked to lipoprotein genes in Borrelia plasmids. These sequences are evolutionarily conserved and/or structurally developed in

  13. Comparative sequence analysis of nitrogen fixation-related genes in six legumes.

    Science.gov (United States)

    Kim, Dong Hyun; Parupalli, Swathi; Azam, Sarwar; Lee, Suk-Ha; Varshney, Rajeev K

    2013-01-01

    Legumes play an important role as food and forage crops in international agriculture especially in developing countries. Legumes have a unique biological process called nitrogen fixation (NF) by which they convert atmospheric nitrogen to ammonia. Although legume genomes have undergone polyploidization, duplication and divergence, NF-related genes, because of their essential functional role for legumes, might have remained conserved. To understand the relationship of divergence and evolutionary processes in legumes, this study analyzes orthologs and paralogs for selected 20 NF-related genes by using comparative genomic approaches in six legumes i.e., Medicago truncatula (Mt), Cicer arietinum, Lotus japonicus, Cajanus cajan (Cc), Phaseolus vulgaris (Pv), and Glycine max (Gm). Subsequently, sequence distances, numbers of synonymous substitutions per synonymous site (Ks) and non-synonymous substitutions per non-synonymous site (Ka) between orthologs and paralogs were calculated and compared across legumes. These analyses suggest the closest relationship between Gm and Cc and the highest distance between Mt and Pv in six legumes. Ks proportional plots clearly showed ancient genome duplication in all legumes, whole genome duplication event in Gm and also speciation pattern in different legumes. This study also reports some interesting observations e.g., no peak at Ks 0.4 in Gm-Gm, location of two independent genes next to each other in Mt and low Ks values for outparalogs for three genes as compared to other 12 genes. In summary, this study underlines the importance of NF-related genes and provides important insights in genome organization and evolutionary aspects of six legume species analyzed. PMID:23986765

  14. Comparative sequence analysis of nitrogen fixation-related genes in six legumes

    Directory of Open Access Journals (Sweden)

    Dong Hyun eKim

    2013-08-01

    Full Text Available Legumes play an important role as food and forage crops in international agriculture especially in developing countries. Legumes have a unique biological process called nitrogen fixation (NF by which they convert atmospheric nitrogen to ammonia. Although legume genomes have undergone polyploidization, duplication and divergence, NF-related genes, because of their essential functional role for legumes, might have remained conserved. To understand the relationship of divergence and evolutionary processes in legumes, this study analyzes orthologs and paralogs for selected 20 NF-related genes by using comparative genomic approaches in six legumes i.e. Medicago truncatula (Mt, Cicer arietinum, Lotus japonicus, Cajanus cajan (Cc, Phaseolus vulgaris (Pv and Glycine max (Gm. Subsequently, sequence distances, numbers of synonymous substitutions per synonymous site (Ks and nonsynonymous substitutions per nonsynonymous site (Ka between orthologs and paralogs were calculated and compared across legumes. These analyses suggest the closest relationship between Gm and Cc and the farthest distance between Mt and Pv in 6 legumes. Ks proportional plots clearly showed ancient genome duplication in all legumes, whole genome duplication event in Gm and also speciation pattern in different legumes. This study also reported some interesting observations e.g. no peak at Ks 0.4 in Gm-Gm, location of two independent genes next to each other in Mt and low Ks values for outparalogs for three genes as compared to other 12 genes. In summary, this study underlines the importance of NF-related genes and provides important insights in genome organization and evolutionary aspects of six legume species analyzed.

  15. Sequence analysis and molecular characterization of Wnt4 gene in metacestodes of Taenia solium.

    Science.gov (United States)

    Hou, Junling; Luo, Xuenong; Wang, Shuai; Yin, Cai; Zhang, Shaohua; Z