WorldWideScience

Sample records for 23s rrna nucleotide

  1. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid-coded Escheri...

  2. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid-coded Escheri...

  3. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    by introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents...... of this region to the chemical reagents. The data indicate that a less-exposed conformation at A2058 leads to reduction in methylation by ErmE. Nucleotide G2057 and its interaction with C2611 maintain the conformation at A2058, and are thus important in forming the structural motif that is recognized by the Erm...

  4. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A

    1995-01-01

    assigned to the donor substrate binding site and a possible base-pairing interaction between the 3'-terminal sequence of the peptidyl-tRNA and the sequence psi/U-G-G2582, that is conserved in all the non-mitochondrial 23 S-like rRNA sequences, is proposed. Three sites that have been implicated in aminoacyl-tRNA...

  5. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M

    2008-01-01

    . coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  6. Resistance to the macrolide antibiotic tylosin is conferred by single methylations at 23S rRNA nucleotides G748 and A2058 acting in synergy

    Science.gov (United States)

    Liu, Mingfu; Douthwaite, Stephen

    2002-01-01

    The macrolide antibiotic tylosin has been used extensively in veterinary medicine and exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin-synthesizing strains of the Gram-positive bacterium Streptomyces fradiae protect themselves from their own product by differential expression of four resistance determinants, tlrA, tlrB, tlrC, and tlrD. The tlrB and tlrD genes encode methyltransferases that add single methyl groups at 23S rRNA nucleotides G748 and A2058, respectively. Here we show that methylation by neither TlrB nor TlrD is sufficient on its own to give tylosin resistance, and resistance is conferred by the G748 and A2058 methylations acting together in synergy. This synergistic mechanism of resistance is specific for the macrolides tylosin and mycinamycin that possess sugars extending from the 5- and 14-positions of the macrolactone ring and is not observed for macrolides, such as carbomycin, spiramycin, and erythromycin, that have different constellations of sugars. The manner in which the G748 and A2058 methylations coincide with the glycosylation patterns of tylosin and mycinamycin reflects unambiguously how these macrolides fit into their binding site within the bacterial 50S ribosomal subunit. PMID:12417742

  7. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... and chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...... "eukaryal" (1005G.1138C or 1006U.1137A) pair and one "bacterial" C.G pair largely restores the structure and function of the rRNA. Bacterial ribosomes containing both these eukaryal pairs also participate in protein synthesis, although at much reduced efficiency, and the structure of their pseudoknot region...

  8. Recognition determinants for proteins and antibiotics within 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, Stephen Roger; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of molecu......Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  9. Interaction of tRNA with domain II of 23S rRNA.

    Science.gov (United States)

    Hill, W E; Tassanakajohn, A; Tapprich, W E

    1990-08-27

    The interaction of tRNA with domain II of 23S rRNA in E. coli ribosomes has been probed using short, complementary DNA oligodeoxyribonucleotides. Specifically, cDNA oligomers to the region 801-811 of the 23S rRNA were used to ascertain the interaction of this region with tRNA. It was found that when tRNA was bound to the P site, considerable competition occurred between tRNA and the cDNA oligomers which base paired with the nucleotides 807-811. However, A-site bound tRNA neither displaced, nor was displaced, by cDNA oligomers to this region. Additionally, the binding of tRNA lacking the CACCA nucleotides on the 3' terminus was unaffected by the presence a cDNA oligomer complementary to nucleotides 803-811, indicating that the cDNA-tRNA competition was dependent on the 3' terminal nucleotides of tRNA.

  10. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    DEFF Research Database (Denmark)

    Dam, M; Douthwaite, S; Tenson, T

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  11. Diversity of 23S rRNA genes within individual prokaryotic genomes.

    Directory of Open Access Journals (Sweden)

    Anna Pei

    Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

  12. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    Science.gov (United States)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  13. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification...

  14. YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407

    DEFF Research Database (Denmark)

    Andersen, Niels Møller; Douthwaite, Stephen

    2006-01-01

    The rRNAs in Escherichia coli contain methylations at 24 nucleotides, which collectively are important for ribosome function. Three of these methylations are m5C modifications located at nucleotides C967 and C1407 in 16S rRNA and at nucleotide C1962 in 23S rRNA. Bacterial rRNA modifications gener...... methyltransferase gene rsmF, and that the nomenclature system be extended to include the rRNA methyltransferases that still await identification....

  15. Intragenomic heterogeneity of the 16S rRNA-23S rRNA internal transcribed spacer among Pseudomonas syringae and Pseudomonas fluorescens strains.

    Science.gov (United States)

    Milyutina, Irina A; Bobrova, Vera K; Matveeva, Eugenia V; Schaad, Norman W; Troitsky, Alexey V

    2004-10-01

    The 16S-23S rRNA internal transcribed spacer regions (ITS1) from 14 strains of Pseudomonas syringae and P. fluorescens were sequenced. ITS1 exhibited significant sequence variability among different operons within a single genome. From 1 to 4 types of ITS1 were found in individual genomes of the P. syringae and P. fluorescens strains. A total of eight ITS1 types were identified among strains studied. The ITS1 nucleotide sequences consisted of conserved blocks including, among others, a stem-forming region of box B, tRNAIle and tRNAAla genes and several variable blocks. The differences in the variable regions were mostly due to insertions and/or deletions of nucleotide blocks. The intragenomic heterogeneity of ITS1 was brought about by different combinations of variable blocks, which possibly have resulted from recombination and horizontal transfer.

  16. Functional interactions within 23S rRNA involving the peptidyltransferase center

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... that also confer antibiotic resistance. Both the domain II deletion and the 2057A mutation relieve the hypersensitive effect of the 2032A mutation, producing an erythromycin-resistant phenotype; in addition, the combination of the 2032A and 2057A mutations confers a higher level of chloramphenicol...... and chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  17. Mutations in 23S rRNA Confer Resistance against Azithromycin in Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Marvig, Rasmus Lykke; Søndergaard, Mette S. R.; Pedersen, Søren Damkiær

    2012-01-01

    The emergence of antibiotic-resistant Pseudomonas aeruginosa is an important concern in the treatment of long-term airway infections in cystic fibrosis patients. In this study, we report the occurrence of azithromycin resistance among clinical P. aeruginosa DK2 isolates. We demonstrate that resis...... that resistance is associated with specific mutations (A2058G, A2059G, and C2611T in Escherichia coli numbering) in domain V of 23S rRNA and that introduction of A2058G and C2611T into strain PAO1 results in azithromycin resistance....

  18. Rapid differentiation of Francisella species and subspecies by fluorescent in situ hybridization targeting the 23S rRNA

    Directory of Open Access Journals (Sweden)

    Trebesius Karlheinz

    2010-03-01

    Full Text Available Abstract Background Francisella (F. tularensis is the causative agent of tularemia. Due to its low infectious dose, ease of dissemination and high case fatality rate, F. tularensis was the subject in diverse biological weapons programs and is among the top six agents with high potential if misused in bioterrorism. Microbiological diagnosis is cumbersome and time-consuming. Methods for the direct detection of the pathogen (immunofluorescence, PCR have been developed but are restricted to reference laboratories. Results The complete 23S rRNA genes of representative strains of F. philomiragia and all subspecies of F. tularensis were sequenced. Single nucleotide polymorphisms on species and subspecies level were confirmed by partial amplification and sequencing of 24 additional strains. Fluorescent In Situ Hybridization (FISH assays were established using species- and subspecies-specific probes. Different FISH protocols allowed the positive identification of all 4 F. philomiragia strains, and more than 40 F. tularensis strains tested. By combination of different probes, it was possible to differentiate the F. tularensis subspecies holarctica, tularensis, mediasiatica and novicida. No cross reactivity with strains of 71 clinically relevant bacterial species was observed. FISH was also successfully applied to detect different F. tularensis strains in infected cells or tissue samples. In blood culture systems spiked with F. tularensis, bacterial cells of different subspecies could be separated within single samples. Conclusion We could show that FISH targeting the 23S rRNA gene is a rapid and versatile method for the identification and differentiation of F. tularensis isolates from both laboratory cultures and clinical samples.

  19. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Karminska, K. H.; Purta, E.; Hansen, L .H.

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... of a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension analysis...

  20. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    conserved nucleotides. With a view to investigate the function of this RNA region further, four of these conserved nucleotides, including one indirectly implicated in chloramphenicol binding, were selected for mutation in Escherichia coli 23S rRNA using oligonucleotide primers. Mutant RNAs were expressed......The peptidyl transfer site has been localized at the centre of domain V of 23S-like ribosomal RNA (rRNA) primarily on the basis of a chloramphenicol binding site. The implicated region constitutes an unstructured circle in the current secondary structural model which contains several universally...... in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...

  1. Pentamidine inhibits Coxiella burnetii growth and 23S rRNA intron splicing in vitro.

    Science.gov (United States)

    Minnick, Michael F; Hicks, Linda D; Battisti, James M; Raghavan, Rahul

    2010-10-01

    Coxiella burnetii is the bacterial agent of Q fever in humans. Acute Q fever generally manifests as a flu-like illness and is typically self-resolving. In contrast, chronic Q fever usually presents with endocarditis and is often life-threatening without appropriate antimicrobial therapy. Unfortunately, available options for the successful treatment of chronic Q fever are both limited and protracted (>18 months). Pentamidine, an RNA splice inhibitor used to treat fungal and protozoal infections, was shown to reduce intracellular growth of Coxiella by ca. 73% at a concentration of 1 microM (ca. 0.6 microg/mL) compared with untreated controls, with no detectable toxic effects on host cells. Bacterial targets of pentamidine include Cbu.L1917 and Cbu.L1951, two group I introns that disrupt the 23S rRNA gene of Coxiella, as demonstrated by the drug's ability to inhibit intron RNA splicing in vitro. Since both introns are highly conserved amongst all eight genotypes of the pathogen, pentamidine is predicted to be efficacious against numerous strains of C. burnetii. To our knowledge, this is the first report describing antibacterial activity for this antifungal/antiprotozoal agent.

  2. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    Science.gov (United States)

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  3. 23S rRNA gene mutations contributing to macrolide resistance in Campylobacter jejuni and Campylobacter coli

    Science.gov (United States)

    Operon specific 23S rRNA mutations affecting minimum inhibitory concentrations (MICs) of macrolides (erythromycin [ERY], azithromycin [AZM], tylosin [TYL]) and a lincosamide (clindamycin [CLI]) were examined in a collection of Campylobacter jejuni and C. coli isolates. The three copies of the Campy...

  4. Structure of 23S rRNA hairpin 35 and its interaction with the tylosin-resistance methyltransferase RlmAII

    Science.gov (United States)

    Lebars, Isabelle; Yoshizawa, Satoko; Stenholm, Anne R.; Guittet, Eric; Douthwaite, Stephen; Fourmy, Dominique

    2003-01-01

    The bacterial rRNA methyltransferase RlmAII (formerly TlrB) contributes to resistance against tylosin-like 16-membered ring macrolide antibiotics. RlmAII was originally discovered in the tylosin-producer Streptomyces fradiae, and members of this subclass of methyltransferases have subsequently been found in other Gram-positive bacteria, including Streptococcus pneumoniae. In all cases, RlmAII methylates 23S rRNA at nucleotide G748, which is situated in a stem–loop (hairpin 35) at the macrolide binding site of the ribosome. The conformation of hairpin 35 recognized by RlmAII is shown here by NMR spectroscopy to resemble the anticodon loop of tRNA. The loop folds independently of the rest of the 23S rRNA, and is stabilized by a non-canonical G–A pair and a U-turn motif, rendering G748 accessible. Binding of S.pneumoniae RlmAII induces changes in NMR signals at specific nucleotides that are involved in the methyltransferase–RNA interaction. The conformation of hairpin 35 that interacts with RlmAII is radically different from the structure this hairpin adopts within the 50S subunit. This indicates that the hairpin undergoes major structural rearrangement upon interaction with ribosomal proteins during 50S assembly. PMID:12514124

  5. A DEAD box protein is required for formation of a hidden break in Arabidopsis chloroplast 23S rRNA.

    Science.gov (United States)

    Nishimura, Kenji; Ashida, Hiroki; Ogawa, Taro; Yokota, Akiho

    2010-09-01

    In plant chloroplasts, the ribosomal RNA (rRNA) of the large subunit of the ribosome undergoes post-maturation fragmentation processing. This processing consists of site-specific cleavage that generates gapped, discontinuous rRNA molecules. However, the molecular mechanism underlying introduction of the gap structure (the 'hidden break') is poorly understood. Here, we found that the DEAD box protein RH39 plays a key role in introduction of the hidden break into the 23S rRNA in Arabidopsis chloroplasts. Genetic screening for an Arabidopsis plant with a drastically reduced level of ribulose-1,5-bisphosphate carboxylase/oxygenase identified an RH39 mutant. The levels of other chloroplast-encoded photosynthetic proteins were also severely reduced. The reductions were not due to a failure of transcription, but rather inefficiency in translation. RNA gel blotting revealed incomplete fragmentation of 23S rRNA in chloroplasts during maturation. In vitro analysis with recombinant RH39 suggested that the protein binds to the adjacent sequence upstream of the hidden break site to exert its function. We propose a molecular mechanism for the RH39-mediated fragmentation processing of 23S rRNA in chloroplasts.

  6. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    Science.gov (United States)

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  7. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Energy Technology Data Exchange (ETDEWEB)

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  8. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...

  9. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...

  10. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex.......The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...

  11. Sequence Analysis and Comparison of 16S rRNA, 23S rRNA and 16S/23S Intergenic Spacer Region of Greening Bacterium Associated with Yellowing Disease (Huanglongbing) of Kinnow Mandarin.

    Science.gov (United States)

    Gupta, K N; Baranwal, V K; Haq, Q M R

    2012-03-01

    High incidence (up to 40%) of symptoms of yellowing and yellow mottling was observed in 5-8 years old orchards of kinnow mandarin {Citrus reticulate Balanco ('King' × 'Willow mandarin')} in the Punjab state of India during a survey in January 2007. These symptoms are often confused with nutrient deficiency and other stress related disorders. However, a greening bacterium has been attributed to cause the disease. The disease was graft transmissible and sequencing of 16S rRNA, 16S/23S intergenic spacer region and 23S rRNA of the greening bacterium associated with yellowing disease in kinnow mandarin confirmed it to be Candidatus Liberibacter asiaticus ('Ca L. asiaticus') showing maximum identity of 95.9% with 'Ca L. asiaticus' from USA and Brazil in 16S rRNA. The study indicates definite association of 'Ca L. asiaticus' with yellowing/chlorotic mottling symptoms of greening disease of kinnow mandarin in Punjab state of India.

  12. Sites of interaction of the CCA end of peptidyl-tRNA with 23S rRNA.

    Science.gov (United States)

    Moazed, D; Noller, H F

    1991-05-01

    Oligonucleotide fragments derived from the 3' CCA terminus of acylated tRNA, such as CACCA-(AcPhe), UACCA-(AcLeu), and CAACCA-(fMet), bind specifically to ribosomes in the presence of sparsomycin and methanol [Monro, R. E., Celma, M. L. & Vazquez, D. (1969) Nature (London) 222, 356-358]. All three oligonucleotides protect a characteristic set of bases in 23S rRNA from chemical probes: G2252, G2253, A2439, A2451, U2506, and U2585. A2602 shows enhanced reactivity. These account for most of the same bases that are protected when peptidyl-tRNA analogues such as AcPhe-tRNA are bound to the ribosomal P site, and correspond precisely to those bases whose protection is abolished by removal of the 3'-CA end of tRNA. We conclude that most of the observed interactions between tRNA and 23S rRNA in the 50S ribosomal P site involve the conserved CCA terminus of tRNA. Sparsomycin may inhibit protein synthesis by stabilizing interaction between the peptidyl-CCA and the 23S P site, preventing formation of the intermediate A/P hybrid state.

  13. Chloroplast RNA-Binding Protein RBD1 Promotes Chilling Tolerance through 23S rRNA Processing in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    2016-05-01

    Full Text Available Plants have varying abilities to tolerate chilling (low but not freezing temperatures, and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance.

  14. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    Energy Technology Data Exchange (ETDEWEB)

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  15. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    Science.gov (United States)

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence.

  16. New mutation points in 23S rRNA gene associated with Helicobacter Pylori resistance to clarithromycin in northeast China

    Institute of Scientific and Technical Information of China (English)

    Qing Hao; Yan Li; Zhi-Jie Zhang; Yong Liu; Hong Gao

    2004-01-01

    AIM: To investigate the resistance rate of Helicobacter pylori (Hpylori) to clarithromycin, metronidazole, amoxicillin and tetracycline to guide clinical practice, and to study the mechanism of H pyloriresistant to clarithromycin.METHODS: Thirty H pyloristrains were isolated from the mucosa of peptic ulcer, gastric tumor and chronic gastritis patients, then the minimal inhibitory concentration (MIC) to clarithromycin, metronidazole, amoxicillin and tetracycline was evaluated by E-test method. The sequence analysis of PCR fragments was conducted in 23S rRNA gene of H pylori resistant to clarithromycin to get the resistance mechanism of the bacteria.RESULTS: Among 30 H pyloristrains, 7 cases were resistant to clarithromycin, 12 to metronidazole, 2 to tetracycline and no strain was found to be resistant to amoxicillin. The resistance rates were 23.3%, 40%, 6.7% and 0%,respectively. Three new mutation points were found to be related to the clarithromycin resistance in H pyloriisolates,which were G2224A, C2245T and T2289C.CONCLUSION: In northeast China, H pylorishows high resistance to metronidazole, while sensitive to amoxicillin.The mechanism of resistance to clarithromycin may be related to the mutation of G2224A, C2245T and T2289C in the 23S rRNA gene.

  17. Sequence variation of the 16S to 23S rRNA spacer region in Salmonella enterica.

    Science.gov (United States)

    Christensen, H; Møller, P L; Vogensen, F K; Olsen, J E

    2000-01-01

    The possibility for identification of Salmonella enterica serotypes by sequence analysis of the 16S to 23S rRNA internal transcribed spacer was investigated by direct sequencing of polymerase chain reaction-amplified DNA from all operons simultaneously in a collection of 25 strains of 18 different serotypes of S. enterica, and by sequencing individual cloned operons from a single strain. It was only possible to determine the first 117 bases upstream from the 23S rRNA gene by direct sequencing because of variation between the rrn operons. Comparison of sequences from this region allowed separation of only 15 out of the 18 serotypes investigated and was not specific even at the subspecies level of S. enterica. To determine the differences between internal transcribed spacers in more detail, the individual rrn operons of strain JEO 197, serotype IV 43:z4,z23:-, were cloned and sequenced. The strain contained four short internal transcribed spacer fragments of 382-384 bases in length, which were 98.4-99.7% similar to each other and three long fragments of 505 bases with 98.0-99.8% similarity. The study demonstrated a higher degree of interbacterial variation than intrabacterial variation between operons for serotypes of S. enterica.

  18. Molecular characterization of the full-length 23S and 5S ribosomal RNA (rRNA) genes of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, Akihiro; Saito, Satoru; Sekizuka, Tsuyoshi; Murayama, Ohoshi; Takamiya, Shinzaburo; Moore, John E; Millar, B Cherie; Matsuda, Motoo

    2007-08-01

    An approximately 4.2 kbp region encoding 23S and 5S rRNA genes was identified when recombinant plasmid DNAs from two genomic DNA libraries and an inverse PCR product of Taylorella asinigenitalis UK-1 isolate were analyzed. Full-length genes of 23S rRNA (3,225 bp) and 5S rRNA (117 bp) of T. asinigenitalis are described. The present sequence analysis identified a non-coding hypothetically intrinsic transcription terminator region downstream of the 5S rRNA gene. The sequence, however, downstream of the 5S rRNA gene did not show any distal tRNA genes. Surprisingly, an intervening sequence (IVS) of 270 bp in length, including two specific tandem repeat units of 80 bp and one partial unit of 48 bp with unknown functions was identified in the first quarter of the 23S rRNA gene sequence. A second IVS of 70 bp in length was also identified in the central region of the 23S rRNA gene. In addition, by using PCR and sequencing procedures, two T. asinigenitalis isolates, UK-1 and UK-2, carried multiple IVSs in the first quarter and central regions. Moreover, the 23S rRNA fragmentation occurred in the UK-1 isolate. A phylogenetic analysis was first carried out based on the 23S rRNA sequence data from T. asinigenitalis UK-1 and 13 other beta-Proteobacteria. This is the first report of IVSs in the 23S rRNA gene from the beta-Proteobacteria.

  19. Mutations in 23S rRNA at the Peptidyl Transferase Center and Their Relationship to Linezolid Binding and Cross-Resistance

    DEFF Research Database (Denmark)

    Long, Katherine; Munck, Christian

    2010-01-01

    The oxazolidinone antibiotic linezolid targets the peptidyl transferase center (PTC) on the bacterial ribosome. Thirteen single and four double 23S rRNA mutations were introduced into a Mycobacterium smegmatis strain with a single rRNA operon. Converting bacterial base identity by single mutations...

  20. Establishment and analysis of specific DNA patterns in 16S-23S rRNA gene spacer regions for differentiating different bacteria

    Institute of Scientific and Technical Information of China (English)

    尚世强; 付君芬; 董关萍; 洪文澜; 杜立中; 俞锡林

    2003-01-01

    Objective To establish the specific 16S-23S rRNA gene spacer regions in different bacteria using polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP), DNA cloning and sequences analysis. Methods A pair of primers were selected from highly conserved sequences adjacent to the 16S-23S rRNA spacer region. Bacterial DNA from sixty-one strains of standard bacteria and corresponding clinical isolates representative of 20 genera and 26 species was amplified by PCR, and further analyzed by RFLP, DNA cloning and sequences analysis. Furthermore, all specimens were examined by bacterial culturing and PCR-RFLP analysis. The evaluation of these assays in practical clinic practice was also discussed.Results Restriction enzyme analysis revealed one, two or three bands or more observed among the 26 different standard strains. The sensitivity of PCR reached 2.5 colony-forming unit (CFU), and there was no cross reaction with human genomic DNA, fungus or virus. Fourteen species could be distinguished immediately by PCR, while another 10 species were further identified by Hinf Ⅰ or Alu Ⅰ digestion. The only difference between K.pneumoniae and E.durans was located at the site of the 779th nucleotide according to the sequence analysis and only XmaⅢ digestion could distinguish one from another. Of 42 specimens from septicemic neonates, 15 were identified as positive by blood culture at a rate of 35.7%. However, 27 specimens identified as positive by PCR, with a rate of 64.2%, a method significantly more effective than blood culture (P<0.01). Of 6 cerebrospinal fluid (CSF) specimens, one tested positive for S.epidermidis was also positive by PCR, two culture negative were positive by PCR and diagnosed as S.epidermidis according to the DNA pattern. One positive for C.neoformans was negative by PCR. The other two specimens were negative by both PCR and culture.Conclusions The method of detecting bacterial 16S-23S rRNA spacer regions using PCR

  1. 116S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    Directory of Open Access Journals (Sweden)

    Sima eTokajian

    2016-02-01

    Full Text Available Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 to 849 bp, while their G+C content was 42.2 mol% to 57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes, ITSAla(TGC, ITSAla (TGC+Ile (GAT, ITSIle (GAT+Ala (TGC and ITS Ile (GAT+Pseudo. All of the identified tRNAAla (TGC molecules consisted of 73 bases, and all of the tRNAIle (GAT molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2.

  2. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    Science.gov (United States)

    Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

  3. Analysis of the 16S-23S rRNA gene internal transcribed spacer region in Klebsiella species.

    Science.gov (United States)

    Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-11-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types-ITS(none) (without tRNA genes), ITS(glu) [with a tRNA(Glu (UUC)) gene], and ITS(ile+ala) [with tRNA(Ile (GAU)) and tRNA(Ala (UGC)) genes]-were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITS(glu) and ITS(ile+ala). The presence of ITS(none) in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITS(none), from 0.967 to 1.000 for ITS(glu), and from 0.968 to 1.000 for ITS(ile+ala). Interspecies sequence identities range from 0.775 to 0.989 for ITS(none), from 0.798 to 0.997 for ITS(glu), and from 0.712 to 0.985 for ITS(ile+ala). Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes.

  4. Clinical and Microbiological Aspects of Linezolid Resistance Mediated by the cfr Gene Encoding a 23S rRNA Methyltransferase▿

    Science.gov (United States)

    Arias, Cesar A.; Vallejo, Martha; Reyes, Jinnethe; Panesso, Diana; Moreno, Jaime; Castañeda, Elizabeth; Villegas, Maria V.; Murray, Barbara E.; Quinn, John P.

    2008-01-01

    The cfr (chloramphenicol-florfenicol resistance) gene encodes a 23S rRNA methyltransferase that confers resistance to linezolid. Detection of linezolid resistance was evaluated in the first cfr-carrying human hospital isolate of linezolid and methicillin-resistant Staphylococcus aureus (designated MRSA CM-05) by dilution and diffusion methods (including Etest). The presence of cfr was investigated in isolates of staphylococci colonizing the patient's household contacts and clinical isolates recovered from patients in the same unit where MRSA CM-05 was isolated. Additionally, 68 chloramphenicol-resistant Colombian MRSA isolates recovered from hospitals between 2001 and 2004 were screened for the presence of the cfr gene. In addition to erm(B), the erm(A) gene was also detected in CM-05. The isolate belonged to sequence type 5 and carried staphylococcal chromosomal cassette mec type I. We were unable to detect the cfr gene in any of the human staphylococci screened (either clinical or colonizing isolates). Agar and broth dilution methods detected linezolid resistance in CM-05. However, the Etest and disk diffusion methods failed to detect resistance after 24 h of incubation. Oxazolidinone resistance mediated by the cfr gene is rare, and acquisition by a human isolate appears to be a recent event in Colombia. The detection of cfr-mediated linezolid resistance might be compromised by the use of the disk diffusion or Etest method. PMID:18174304

  5. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  6. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H.

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  7. Development of an endpoint genotyping assay to detect the Mycoplasma pneumoniae 23S rRNA gene and distinguish the existence of macrolide resistance-associated mutations at position 2063.

    Science.gov (United States)

    Suzuki, Yu; Seto, Junji; Shimotai, Yoshitaka; Ikeda, Tatsuya; Yahagi, Kazue; Mizuta, Katsumi; Matsuzaki, Yoko; Hongo, Seiji

    2016-12-01

    The prevalence of macrolide-resistant Mycoplasma pneumoniae harboring a mutation in the 23S rRNA gene is increasing, and rapid detection assays are needed for clinical management. We developed an endpoint genotyping assay to detect the M. pneumoniae 23S rRNA gene and determine the existence of macrolide resistance-associated mutations at position 2063 (A2063G, A2063T and A2063C mutations). This A2063B genotyping assay detected more than 50 copies/reaction of the M. pneumoniae gene in every nucleotide mutation at position 2063. Of 42 clinical specimens, 3 were positive without mutation, 6 were positive with the A2063G mutation, and 33 were negative. The results were confirmed using nested PCR with the sequencing of the M. pneumoniae 23S rRNA gene, and a high sensitivity (90%), specificity (100%), and coincidence ratio (kappa coefficient=0.93) were obtained. Therefore, the A2063B genotyping assay is useful for the rapid discrimination of macrolide resistance mutations at position 2063.

  8. Mutations in conserved helix 69 of 23S rRNA of Thermus thermophilus that affect capreomycin resistance but not posttranscriptional modifications

    DEFF Research Database (Denmark)

    Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen

    2008-01-01

    of previously reported capreomycin resistance base substitutions. Capreomycin resistance in other bacteria has been shown to result from inactivation of the TlyA methyltransferase which 2'-O methylates C1920 of 23S rRNA. Inactivation of the tlyA gene in T. thermophilus does not affect its sensitivity...

  9. Differentiation of non-pylori Helicobacter species based on PCR-restriction fragment length polymorphism of the 23S rRNA gene.

    Science.gov (United States)

    Yadegar, Abbas; Alebouyeh, Masoud; Lawson, Andy J; Mirzaei, Tabassom; Nazemalhosseini Mojarad, Ehsan; Zali, Mohammad Reza

    2014-06-01

    Phenotypic identification of non-pylori Helicobacter species has always been problematic and time-consuming in comparison with many other bacteria. We developed a rapid two-step identification assay based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 23S rRNA gene for differentiating between non-pylori Helicobacter species. A new genus-specific primer pair based on all available complete and partial 23S rRNA sequences of Helicobacter species was designed. In silico restriction analysis of variable regions of the 23S rRNA gene suggested SmaI and HindIII endonucleases would provide a good level of differentiation. Analysis of the obtained 23S rRNA RFLP patterns divided all Helicobacter study strains into three species groups (groups A-C) and 12 unique restriction patterns. Wolinella succinogenes also gave a unique pattern. Our proposed PCR-RFLP method was found to be as a valuable tool for routine identification of non-pylori Helicobacter species from human or animal samples.

  10. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Douthwaite, S

    1994-01-01

    The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  11. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    DEFF Research Database (Denmark)

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N......-Ac-Phe-tRNA were derivatized at the 2 position with an azido group and the tRNAs were cross-linked to the ribosome on irradiation with ultraviolet light at 365 nm. The cross-links were localized on the rRNA within extended versions of three previously characterized 23S rRNA fragments F1', F2', and F4......' at nucleotides C2601/A2602, U2584/U2585 (F1'), U2506 (F2'), and A2062/C2063 (F4'). Each of these nucleotides lies within the peptidyl transferase loop region of the 23S rRNA. Cross-links were also formed with ribosomal proteins L27 (strong) and L33 (weak), as shown earlier. The antibiotics sparsomycin...

  12. The sequence of Methanospirillum hungatei 23S rRNA confirms the specific relationship between the extreme halophiles and the Methanomicrobiales

    Science.gov (United States)

    Burggraf, S.; Ching, A.; Stetter, K. O.; Woese, C. R.

    1991-01-01

    We have determined the sequence of the 23S rRNA from the methanogenic archaeon Methanospirillum hungatei. This is the first such sequence from a member of the Methanomicrobiales. Moreover, it brings additional evidence to bear on the possible specific relationship between this particular group of methanogens and the extreme halophiles. Such evidence is critical in that several new (and relatively untested) methods of phylogenetic inference have lead to the controversial conclusion that the extreme halophiles are either not related to the archaea, or are only peripherally so. Analysis of the Methanospirillum hungatei 23S rRNA sequence shows the Methanomicrobiales are indeed a sister group of the extreme halophiles, further strengthening the conclusions reached from analysis of 16S rRNA sequences.

  13. Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...... within the peptidyl transferase loop region of 23S-like rRNA by using a combination of a primer extension approach, RNase H fragment analysis, and crosslinking with radioactive [(125)I]phenol-alanine-sparsomycin. Crosslinking of several sparsomycin derivatives, modified near the sulfoxy group, implicated...

  14. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    Science.gov (United States)

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis.

  15. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    in the latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop...... the functionally important peptidyl transferase loop of 23S rRNA at positions m2A2503/psi2504 and G2061/A2062. The modification yields are influenced strongly, and differentially, by P-site-bound tRNA and strongly by some of the peptidyl transferase antibiotics tested, with chloramphenicol producing a shift...... that was excised from the mature rRNA using RNAse H. In contrast, no antibiotic-induced effects were observed on in vitro T7 transcripts of full-length 23S rRNA, domain V, or on a fragment extending from positions approximately 2496-2566, which indicates that one or more posttranscriptional modifications within...

  16. The study of mutation in 23S rRNA resistance gene of Helicobacter pylori to clarithromycin in patients with gastrointestinal disorders in Isfahan - Iran.

    Science.gov (United States)

    Khademi, Farzad; Faghri, Jamshid; Moghim, Sharareh; Esfahani, Bahram Nasr; Fazeli, Hossein; Poursina, Farkhondeh; Adibi, Peyman; Madhi, Masoumeh; Safaei, Hajieh Ghasemian

    2014-01-01

    Helicobacter pylori antimicrobial resistance is an important factor responsible for treatment failure. The purpose of this study was evaluating the prevalence of point mutations in clarithromycin-resistant clinical isolates of H. pylori in Isfahan city of Iran. Thirty isolates of H. pylori from 130 biopsy specimens were isolated by culture and confirmed by biochemical and PCR tests. The MIC of clarithromycin antibiotic for 30 clinical isolates of H. pylori was determined by E-test method. The point mutations in the 288 bp of 23S rRNA gene of H. pylori were investigated in four clarithromycin-resistant clinical isolates by PCR followed by sequencing. Among 30 isolates of H. pylori, 4 cases were resistant to clarithromycin. One point mutation was found at position T2243C in the 23S rRNA gene in all resistance isolates. In our study, H. pylori resistance to clarithromycin associated with point mutation at position 2243 (T2243C).

  17. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  18. Methylation of 23S rRNA caused by tlrA (ermSF), a tylosin resistance determinant from Streptomyces fradiae.

    Science.gov (United States)

    Zalacain, M; Cundliffe, E

    1989-01-01

    Ribosomes from Streptomyces griseofuscus expressing tlrA, a resistance gene isolated from the tylosin producer Streptomyces fradiae, are resistant to macrolide and lincosamide antibiotics in vitro. The tlrA product was found to be a methylase that introduces two methyl groups into a single base within 23S rRNA, generating N6,N6-dimethyladenine at position 2058. This activity is therefore similar to the ermE resistance mechanism in Saccharopolyspora erythraea (formerly Streptomyces erythraeus). Images PMID:2753855

  19. Rapid assay of A2058T-mutated 23S rRNA allelic profiles associated with high-level macrolide resistance in Moraxella catarrhalis.

    Science.gov (United States)

    Saito, Ryoichi; Kasai, Ayako; Ogihara, Shinji; Yamada, Kageto; Tao, Kazuyuki

    2015-09-01

    We report on a restriction fragment-length polymorphism (HpyCH4III) assay for profile analysis of 23S rRNA gene A2058T-mutated alleles associated with high-level macrolide resistance in Moraxella catarrhalis. Our assay results were supported by DNA sequencing analysis, allowed for simultaneous testing of many strains, and produced results from pure-cultured colonies within 4 h.

  20. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S rRNA, a...

  1. Pseudouridylation of helix 69 of 23S rRNA is necessary for an effective translation termination

    DEFF Research Database (Denmark)

    Ejby, Morten; Sørensen, Michael A; Pedersen, Steen

    2007-01-01

    Escherichia coli strains with inactivated rluD genes were previously found to lack the conserved pseudouridines in helix 69 of 23S ribosomal RNA and to grow slowly. A suppressor mutant was isolated with a near normal growth rate that had changed the conserved Glu-172 codon to a Lys codon in prfB,...

  2. Differentiation of acetic acid bacteria based on sequence analysis of 16S-23S rRNA gene internal transcribed spacer sequences.

    Science.gov (United States)

    González, Angel; Mas, Albert

    2011-06-30

    The 16S-23S gene internal transcribed spacer sequence of sixty-four strains belonging to different acetic acid bacteria genera were analyzed, and phylogenetic trees were generated for each genera. The topologies of the different trees were in accordance with the 16S rRNA gene trees, although the similarity percentages obtained between the species was shown to be much lower. These values suggest the usefulness of including the 16S-23S gene internal transcribed spacer region as a part of the polyphasic approach required for the further classification of acetic acid bacteria. Furthermore, the region could be a good target for primer and probe design. It has also been validated for use in the identification of unknown samples of this bacterial group from wine vinegar and fruit condiments.

  3. Identification of a novel G2073A mutation in 23S rRNA in amphenicol-selected mutants of Campylobacter jejuni.

    Directory of Open Access Journals (Sweden)

    Licai Ma

    Full Text Available OBJECTIVES: This study was conducted to examine the development and molecular mechanisms of amphenicol resistance in Campylobacter jejuni by using in vitro selection with chloramphenicol and florfenicol. The impact of the resistance development on growth rates was also determined using in vitro culture. METHODS: Chloramphenicol and florfenicol were used as selection agents to perform in vitro stepwise selection. Mutants resistant to the selective agents were obtained from the selection process. The mutant strains were compared with the parent strain for changes in MICs and growth rates. The 23S rRNA gene and the L4 and L22 ribosomal protein genes in the mutant strains and the parent strain were amplified and sequenced to identify potential resistance-associated mutations. RESULTS: C. jejuni strains that were highly resistant to chloramphenicol and florfenicol were obtained from in vitro selection. A novel G2073A mutation in all three copies of the 23S rRNA gene was identified in all the resistant mutants examined, which showed resistance to both chloramphenicol and florfenicol. In addition, all the mutants selected by chloramphenicol also exhibited the G74D modification in ribosomal protein L4, which was previously shown to confer a low-level erythromycin resistance in Campylobacter species. The mutants selected by florfenicol did not have the G74D mutation in L4. Notably, the amphenicol-resistant mutants also exhibited reduced susceptibility to erythromycin, suggesting that the selection resulted in cross resistance to macrolides. CONCLUSIONS: This study identifies a novel point mutation (G2073A in 23S rRNA in amphenicol-selected mutants of C. jejuni. Development of amphenicol resistance in Campylobacter likely incurs a fitness cost as the mutant strains showed slower growth rates in antibiotic-free media.

  4. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    Institute of Scientific and Technical Information of China (English)

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平

    2002-01-01

    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  5. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    Science.gov (United States)

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  6. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.

    Science.gov (United States)

    Bae, Hee-Sung; Hou, Aixin

    2013-02-01

    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods.

  7. The study of mutation in 23S rRNA resistance gene of Helicobacter pylori to clarithromycin in patients with gastrointestinal disorders in Isfahan — Iran

    Science.gov (United States)

    Khademi, Farzad; Faghri, Jamshid; Moghim, Sharareh; Esfahani, Bahram Nasr; Fazeli, Hossein; Poursina, Farkhondeh; Adibi, Peyman; Madhi, Masoumeh; Safaei, Hajieh Ghasemian

    2014-01-01

    Background: Helicobacter pylori antimicrobial resistance is an important factor responsible for treatment failure. The purpose of this study was evaluating the prevalence of point mutations in clarithromycin-resistant clinical isolates of H. pylori in Isfahan city of Iran. Materials and Methods: Thirty isolates of H. pylori from 130 biopsy specimens were isolated by culture and confirmed by biochemical and PCR tests. The MIC of clarithromycin antibiotic for 30 clinical isolates of H. pylori was determined by E-test method. The point mutations in the 288 bp of 23S rRNA gene of H. pylori were investigated in four clarithromycin-resistant clinical isolates by PCR followed by sequencing. Results: Among 30 isolates of H. pylori, 4 cases were resistant to clarithromycin. One point mutation was found at position T2243C in the 23S rRNA gene in all resistance isolates. Conclusions: In our study, H. pylori resistance to clarithromycin associated with point mutation at position 2243 (T2243C). PMID:24800187

  8. The study of mutation in 23S rRNA resistance gene of Helicobacter pylori to clarithromycin in patients with gastrointestinal disorders in Isfahan - Iran

    Directory of Open Access Journals (Sweden)

    Farzad Khademi

    2014-01-01

    Full Text Available Background: Helicobacter pylori antimicrobial resistance is an important factor responsible for treatment failure. The purpose of this study was evaluating the prevalence of point mutations in clarithromycin-resistant clinical isolates of H. pylori in Isfahan city of Iran. Materials and Methods: Thirty isolates of H. pylori from 130 biopsy specimens were isolated by culture and confirmed by biochemical and PCR tests. The MIC of clarithromycin antibiotic for 30 clinical isolates of H. pylori was determined by E-test method. The point mutations in the 288 bp of 23S rRNA gene of H. Pylori were investigated in four clarithromycin-resistant clinical isolates by PCR followed by sequencing. Results: Among 30 isolates of H. pylori, 4 cases were resistant to clarithromycin. One point mutation was found at position T2243C in the 23S rRNA gene in all resistance isolates. Conclusions: In our study, H. pylori resistance to clarithromycin associated with point mutation at position 2243 (T2243C.

  9. Dual detection of Legionella pneumophila and Legionella species by real-time PCR targeting the 23S-5S rRNA gene spacer region.

    Science.gov (United States)

    Yang, G; Benson, R; Pelish, T; Brown, E; Winchell, J M; Fields, B

    2010-03-01

    Although the majority of cases of Legionnaires' disease (LD) are caused by Legionella pneumophila, an increasing number of other Legionella species have been reported to cause human disease. There are no clinical presentations unique to LD and hence accurate laboratory tests are required for early diagnosis. Therefore, we designed a real-time PCR assay that targets the 23S-5S rRNA intergenic spacer region (23S-5S PCR) and allows for detection of all Legionella species and discrimination of L. pneumophila from other Legionella species. In total, 271 isolates representing 50 Legionella species were tested and the assay was validated using 39 culture-positive and 110 culture-negative patient specimens collected between 1989 and 2006. PCR-positive results were obtained with all 39 culture-positive samples (100% sensitivity). Specimens that tested positive according to 23S-5S PCR, but were culture-negative, were further analysed by DNA sequencing of the amplicon or the macrophage infectivity potentiator (mip) gene. In addition to L. pneumophila, Legionella longbeachae, Legionella cincinnatiensis and Legionella micdadei were identified in the specimens. The assay showed a 7-log dynamic range displaying a sensitivity of 7.5 CFU/mL or three genome equivalents per reaction. Sixty-one specimens containing viruses or bacteria other than Legionellae were negative according to 23S-5S PCR, demonstrating its specificity. Use of this assay should contribute to the earlier detection of respiratory disease caused by Legionella species, as well as to increased rates of detection.

  10. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    DEFF Research Database (Denmark)

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  11. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA.

    Science.gov (United States)

    Sunita, S; Zhenxing, H; Swaathi, J; Cygler, Miroslaw; Matte, Allan; Sivaraman, J

    2006-06-16

    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine (Psi) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E.coli RluF at 2.6A resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. The structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of Psi-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.

  12. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Sunita,S.; Zhenxing, H.; Swaathi, J.; Cygler, M.; Matte, A.; Sivaraman, J.

    2006-01-01

    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine ({psi}) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E. coli RluF at 2.6 Angstroms resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. The structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of {psi}-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.

  13. SrmB, a DEAD-box helicase involved in Escherichia coli ribosome assembly, is specifically targeted to 23S rRNA in vivo.

    Science.gov (United States)

    Trubetskoy, Dmitrii; Proux, Florence; Allemand, Frédéric; Dreyfus, Marc; Iost, Isabelle

    2009-10-01

    DEAD-box proteins play specific roles in remodeling RNA or ribonucleoprotein complexes. Yet, in vitro, they generally behave as nonspecific RNA-dependent ATPases, raising the question of what determines their specificity in vivo. SrmB, one of the five Escherichia coli DEAD-box proteins, participates in the assembly of the large ribosomal subunit. Moreover, when overexpressed, it compensates for a mutation in L24, the ribosomal protein (r-protein) thought to initiate assembly. Here, using the tandem affinity purification (TAP) procedure, we show that SrmB forms a complex with r-proteins L4, L24 and a region near the 5'-end of 23S rRNA that binds these proteins. In vitro reconstitution experiments show that the stability of this complex reflects cooperative interactions of SrmB with L4, L24 and rRNA. These observations are consistent with an early role of SrmB in assembly and explain the genetic link between SrmB and L24. Besides its catalytic core, SrmB possesses a nonconserved C-terminal extension that, we show, is not essential for SrmB function and specificity. In this regard, SrmB differs from DbpA, another DEAD-box protein involved in ribosome assembly.

  14. Development of a multiplex PCR assay based on the 16S-23S rRNA internal transcribed spacer for the detection and identification of rodent Pasteurellaceae.

    Science.gov (United States)

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Bleich, André; Gougoula, Christina; Sager, Martin

    2013-11-01

    The rodents Pasteurellaceae have to be excluded from the specified pathogen free experimental animal facilities. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals just a few molecular based methods are available for their detection and identification. The aim of the present investigation was to develop a multiplex PCR assay allowing detection of all rodent Pasteurellaceae and identification of [Pasteurella] pneumotropica biotype Jawetz, [P.] pneumotropica biotype Heyl and [Actinobacillus] muris, as the most prevalent members of the group. For this, a Pasteurellaceae common forward primer located on the 16S rRNA gene was used in conjunction with four different reverse primers specific for [P.] pneumotropica biotype Jawetz, [P.] pneumotropica biotype Heyl, [A.] muris and a common reverse primer for all rodent Pasteurellaceae, all targeting the 16S-23S rRNA internal transcribed spacer sequences. The performance characteristics of the assay were tested against 125 Pasteurellaceae isolates belonging to eleven different species and including 34 strains of [P.] pneumotropica biotype Jawetz, 44 strains of [P.] pneumotropica biotype Heyl and 37 strains of [A.] muris. Additionally, eight other mouse associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA gene sequencing. This multiplex PCR represents the first molecular tool able to detect and differentiate in a single assay among the Pasteurellaceae found in laboratory mouse and may become a reliable alternative to the present diagnostic methods. © 2013.

  15. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  16. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    DEFF Research Database (Denmark)

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller

    2011-01-01

    rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...

  17. Genotyping of Salmonella spp.by 16S-23S rRNA assay%沙门菌PCR-dHPLC基因分型方法建立

    Institute of Scientific and Technical Information of China (English)

    张东方; 袁飞; 王娉; 杨海荣; 胡玥; 赵勇胜; 陈颖; 葛毅强

    2012-01-01

    Objective To develop a polymerase chain reaction-denaturing high performance liquid chromatography (PCR-dHPLC) genotyping method for genotyping of Salmonella spp. Methods Specific primers of 16S-23S rRNA in-tergenic spacer sequence (ITS) region were used to subtype Salmonella spp. The PCR amplification products of experimental strains were separated by dHPLC. The results of genotyping achieved through the differences between dHPLC peaks and were comparaed to the results obtained by serological typing and biochemical typing. Results Totally 89 Salmonella spp. strains were successfully genotyped into 12 dHPLC types(D type). All the Salmonella spp. strains had one same chromatographic peak,while other food-born pathogens showed no similar peak. DNA sequence analysis showed that the sequence was 600bp. The results indicate that the chromatographic peak is specific to Salmonella spp. Comparing the dHPLC genotyping results with those of serological typing and biochemical typing, we found dHPLC genotyping results were significantly differ from the serological typing results, while were consistent with that of the biochemical typing. Conclusion DHPLC is a novel, rapid, highly accurate, and cost-effective genotyping method for genotyping of Salmonella spp.%目的 建立沙门菌聚合酶链反应-变性高效液相色谱(PCR-dHPLC)基因分型方法.方法 采用16S ~23S rRNA内转录间隔(ITS)作为沙门菌分型目的基因,确定特异性扩增引物,进行PCR扩增,扩增产物经dHPLC分离,根据dHPLC图谱峰型差异进行分型,并与血清学和生化分型结果比较.结果 89株沙门菌共分为12个dHPLC型(D型);所有沙门菌均有1个相同色谱峰,克隆测序结果表明,其片断大小为600 bp,其他8种食源性致病菌对照株无此色谱峰,应为沙门菌16S~23S rRNA基因序列的特征性条带,分型结果与血清学差异较大,与生化分型结果有一定一致性.结论 所建立的沙门菌PCR-dHPLC基因分型方法具快速

  18. The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

    OpenAIRE

    Takaiwa, F.; Kusuda, M; SUGIURA, M.

    1982-01-01

    The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

  19. Identification of Carnobacterium Species by Restriction Fragment Length Polymorphism of the 16S-23S rRNA Gene Intergenic Spacer Region and Species-Specific PCR

    OpenAIRE

    Rachman, Cinta; Kabadjova, Petia; Valcheva, Rosica; Prévost, Hervé; Dousset, Xavier

    2004-01-01

    The genus Carnobacterium is currently divided into the following eight species: Carnobacterium piscicola, C. divergens, C. gallinarum, C. mobile, C. funditum, C. alterfunditum, C. inhibens, and C. viridans. An identification tool for the rapid differentiation of these eight Carnobacterium species was developed, based on the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR). PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of this 16S-23S rDNA ISR was performed in ord...

  20. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...

  1. Cooperative assembly of proteins in the ribosomal GTPase centre demonstrated by their interactions with mutant 23S rRNAs

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1995-01-01

    The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions) and nume......The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions...

  2. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O 139 outbreak based on the inter-genomic heterogeneity of the 16S-23S rRNA intergenic spacer regions.

    Science.gov (United States)

    Ghatak, Atreyi; Majumdar, Anasuya; Ghosh, Ranajit K

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O 139 outbreak. ISR classes 'a' and 'g' were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O 139 serogroup and post-O 139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  3. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A

    1999-01-01

    Streptogramin antibiotics contain two active A and B components that inhibit peptide elongation synergistically. Mutants resistant to the A component (virginiamycin M1 and pristinamycin IIA) were selected for the archaeon Halobacterium halobium. The mutations mapped to the universally conserved...... and within the bacterial cells. It is inferred that position 2058 and the sites of mutation, A2059 and A2503, are involved in the synergistic inhibition by the two antibiotics. A structural model is presented which links A2059 and A2503 and provides a structural rationale for the rRNA footprints....

  4. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    DEFF Research Database (Denmark)

    Xiong, L; Kloss, P; Douthwaite, S

    2000-01-01

    Oxazolidinone antibiotics inhibit bacterial protein synthesis by interacting with the large ribosomal subunit. The structure and exact location of the oxazolidinone binding site remain obscure, as does the manner in which these drugs inhibit translation. To investigate the drug-ribosome interaction...... in the wild-type rRNA operon produced an oxazolidinone resistance phenotype, establishing that the G2032A substitution was the determinant of resistance. Engineered U and C substitutions at G2032, as well as a G2447-to-U mutation, also conferred resistance to oxazolidinone. All the characterized resistance...

  5. An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Yih-Horng Shiao

    Full Text Available BACKGROUND: Ribosomal RNA (rRNA is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. METHODOLOGY/PRINCIPAL FINDINGS: Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1 and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014. During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014. Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. CONCLUSIONS/SIGNIFICANCE: The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

  6. Use of PCR primers and probes based on the 23S rRNA and internal transcription spacer (ITS) gene sequence for the detection and enumerization of Lactobacillus acidophilus and Lactobacillus plantarum in feed supplements.

    Science.gov (United States)

    Tsai, Cheng-Chih; Lai, Chieh-Hsien; Yu, Bi; Tsen, Hau-Yang

    2010-06-01

    Novel polymerase chain reaction (PCR) primers designed from the 16S-23S internal transcription spacer (ITS) rRNA and 23S rRNA genes, respectively, were used for the specific detection of Lactobacillus acidophilus and Lactobacillus plantarum. Molecular weights of the PCR products were 221 and 599 bp, respectively. Strains of L. acidophilus and L. plantarum obtained from the culture center, dairy products, infant stool and other samples, could be identified with these PCR primers. DNAs from other lactic acid bacteria (LAB) species including strains of Lactobacillus pentosus which was closely related to L. plantarum, and bacteria species other than LAB, would not generate the false positive results. When this PCR primer set was used for the detection of L. acidophilus and L. plantarum in feed supplement or feed starter samples, reliable results were obtained. Furthermore, when these L. acidophilus or L. plantarum specific primers were used as DNA probes for the colony hybridization of L. acidophilus and L. plantarum, the viable cells of these LAB species in culture and feed supplements or starter products could be identified and enumerized. The method described here thus offers a rapid and economic way to inspect and assure the quality of the feed supplements or fermentation starters.

  7. Multicentre surveillance of prevalence of the 23S rRNA A2058G and A2059G point mutations and molecular subtypes of Treponema pallidum in Taiwan, 2009-2013.

    Science.gov (United States)

    Wu, B-R; Yang, C-J; Tsai, M-S; Lee, K-Y; Lee, N-Y; Huang, W-C; Wu, H; Lee, C-H; Chen, T-C; Ko, W-C; Lin, H-H; Lu, P-L; Chen, Y-H; Liu, W-C; Yang, S-P; Wu, P-Y; Su, Y-C; Hung, C-C; Chang, S-Y

    2014-08-01

    Resistance mutations A2058G and A2059G, within the 23S rRNA gene of Treponema pallidum, have been reported to cause treatment failures in patients receiving azithromycin for syphilis. Genotyping of T. pallidum strains sequentially isolated from patients with recurrent syphilis is rarely performed. From September 2009 to August 2013, we collected 658 clinical specimens from 375 patients who presented with syphilis for genotyping to examine the number of 60-bp repeats in the acidic repeat protein (arp) gene, T. pallidum repeat (tpr) polymorphism, and tp0548 gene, and to detect A2058G and A2059G point mutations by restriction fragment length polymorphism. Treponemal DNA was identified in 45.2% (n = 298) of the specimens that were collected from 216 (57.6%) patients; 268 (40.7%) specimens tested positive for the 23S rRNA gene, and were examined for macrolide resistance. Two isolates (0.7%) harboured the A2058G mutation, and no A2059G mutation was identified. A total of 14 strains of T. pallidum were identified, with 14f/f (57.5%) and 14b/c (10.0%) being the two predominant strains. Forty patients who presented with recurrent episodes of syphilis had T. pallidum DNA identified from the initial and subsequent episodes, with five cases showing strain discrepancies. One patient had two strains identified from different clinical specimens collected in the same episode. Our findings show that 14f/f is the most common T. pallidum strain in Taiwan, where the prevalence of T. pallidum strains that show A2058G or A2059G mutation remains low. Different genotypes of T. pallidum can be identified in patients with recurrent episodes of syphilis.

  8. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.

    Science.gov (United States)

    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu

    2015-02-01

    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis.

  9. Analysis of Free Energy Signals Arising from Nucleotide Hybridization Between rRNA and mRNA Sequences during Translation in Eubacteria

    Directory of Open Access Journals (Sweden)

    Stomp Anne-Marie

    2006-01-01

    Full Text Available A decoding algorithm is tested that mechanistically models the progressive alignments that arise as the mRNA moves past the rRNA tail during translation elongation. Each of these alignments provides an opportunity for hybridization between the single-stranded, -terminal nucleotides of the 16S rRNA and the spatially accessible window of mRNA sequence, from which a free energy value can be calculated. Using this algorithm we show that a periodic, energetic pattern of frequency 1/3 is revealed. This periodic signal exists in the majority of coding regions of eubacterial genes, but not in the non-coding regions encoding the 16S and 23S rRNAs. Signal analysis reveals that the population of coding regions of each bacterial species has a mean phase that is correlated in a statistically significant way with species ( content. These results suggest that the periodic signal could function as a synchronization signal for the maintenance of reading frame and that codon usage provides a mechanism for manipulation of signal phase.

  10. Analysis of Free Energy Signals Arising from Nucleotide Hybridization Between rRNA and mRNA Sequences during Translation in Eubacteria

    Directory of Open Access Journals (Sweden)

    Mladen A. Vouk

    2006-11-01

    Full Text Available A decoding algorithm is tested that mechanistically models the progressive alignments that arise as the mRNA moves past the rRNA tail during translation elongation. Each of these alignments provides an opportunity for hybridization between the single-stranded, 3′-terminal nucleotides of the 16S rRNA and the spatially accessible window of mRNA sequence, from which a free energy value can be calculated. Using this algorithm we show that a periodic, energetic pattern of frequency 1/3 is revealed. This periodic signal exists in the majority of coding regions of eubacterial genes, but not in the non-coding regions encoding the 16S and 23S rRNAs. Signal analysis reveals that the population of coding regions of each bacterial species has a mean phase that is correlated in a statistically significant way with species (G + C content. These results suggest that the periodic signal could function as a synchronization signal for the maintenance of reading frame and that codon usage provides a mechanism for manipulation of signal phase.

  11. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O139 outbreak based on the intergenomic heterogeneity of the 16S-23S rRNA intergenic spacer regions

    Indian Academy of Sciences (India)

    Atreyi Ghatak; Anasuya Majumdar; Ranajit K Ghosh

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O139 outbreak. ISR classes ‘a’ and ‘g’ were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O139 serogroup and post-O139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  12. 16S rRNA、16S-23S rRNA基因测序分析检测主要血流感染病原菌比较%Comparison of the role of 16S rRNA and 16S-23S rRNA gene sequence-based identification of bacteria in bloodsteam infection

    Institute of Scientific and Technical Information of China (English)

    金中淦; 葛平; 徐蓉; 陈蓉; 宣瑛; 刘学杰; 王庆忠

    2012-01-01

    目的 比较细菌16S rRNA、16S-23S rRNA基因测序分析在血流感染病原菌检测中的作用.方法 提取临床上血流感染常见的金黄色葡萄菌、表皮葡萄球菌、大肠埃希菌、粪肠球菌、肺炎链球菌、铜绿假单胞菌、阴沟肠杆菌、鲍曼不动杆菌、洛菲不动杆菌、肺炎克雷伯杆菌、化脓性链球菌、奇异变形杆菌、潘尼变形杆菌、屎肠球菌、粘质沙雷菌、宋内志贺菌、产气肠杆菌、小肠结肠炎耶尔森菌、腐生葡萄球菌基因组DNA,运用16S rRNA、16S-23S rRNA基因进行PCR扩增.扩增产物经测序后在美国国家生物技术中心( NCBI)上进行比对分析,确定菌种.结果 在所分析的19种临床血流感染常见细菌中,16S rRNA基因测序分析可将除粘质沙雷菌外的细菌鉴定到种的水平,但无法完全区分近缘种属;16S-23SrRNA成功鉴定17种细菌,除大肠埃希菌、宋内志贺菌外所有细菌均成功鉴定到单一种的水平.结论 16S-23S rRNA基因可作为血流感染细菌检测较好的分子靶标.

  13. Detection of the A2058G and A2059G 23S rRNA gene point mutations associated with azithromycin resistance in Treponema pallidum by use of a TaqMan real-time multiplex PCR assay.

    Science.gov (United States)

    Chen, Cheng-Yen; Chi, Kai-Hua; Pillay, Allan; Nachamkin, Eli; Su, John R; Ballard, Ronald C

    2013-03-01

    Macrolide treatment failure in syphilis patients is associated with a single point mutation (either A2058G or A2059G) in both copies of the 23S rRNA gene in Treponema pallidum strains. The conventional method for the detection of both point mutations uses nested PCR combined with restriction enzyme digestions, which is laborious and time-consuming. We initially developed a TaqMan-based real-time duplex PCR assay for detection of the A2058G mutation, and upon discovery of the A2059G mutation, we modified the assay into a triplex format to simultaneously detect both mutations. The point mutations detected by the real-time triplex PCR were confirmed by pyrosequencing. A total of 129 specimens PCR positive for T. pallidum that were obtained from an azithromycin resistance surveillance study conducted in the United States were analyzed. Sixty-six (51.2%) of the 129 samples with the A2058G mutation were identified by both real-time PCR assays. Of the remaining 63 samples that were identified as having a macrolide-susceptible genotype by the duplex PCR assay, 17 (27%) were found to contain the A2059G mutation by the triplex PCR. The proportions of macrolide-susceptible versus -resistant genotypes harboring either the A2058G or the A2059G mutation among the T. pallidum strains were 35.6, 51.2, and 13.2%, respectively. None of the T. pallidum strains examined had both point mutations. The TaqMan-based real-time triplex PCR assay offers an alternative to conventional nested PCR and restriction fragment length polymorphism analyses for the rapid detection of both point mutations associated with macrolide resistance in T. pallidum.

  14. Crystal structure of the RluD pseudouridine synthase catalytic module, an enzyme that modifies 23S rRNA and is essential for normal cell growth of Escherichia coli.

    Science.gov (United States)

    Sivaraman, J; Iannuzzi, Pietro; Cygler, Miroslaw; Matte, Allan

    2004-01-01

    Pseudouridine (5-beta-D-ribofuranosyluracil, Psi) is the most commonly found modified base in RNA. Conversion of uridine to Psi is performed enzymatically in both prokaryotes and eukaryotes by pseudouridine synthases (EC 4.2.1.70). The Escherichia coli Psi-synthase RluD modifies uridine to Psi at positions 1911, 1915 and 1917 within 23S rRNA. RluD also possesses a second function related to proper assembly of the 50S ribosomal subunit that is independent of Psi-synthesis. Here, we report the crystal structure of the catalytic module of RluD (residues 68-326; DeltaRluD) refined at 1.8A to a final R-factor of 21.8% (R(free)=24.3%). DeltaRluD is a monomeric enzyme having an overall mixed alpha/beta fold. The DeltaRluD molecule consists of two subdomains, a catalytic subdomain and C-terminal subdomain with the RNA-binding cleft formed by loops extending from the catalytic sub-domain. The catalytic sub-domain of DeltaRluD has a similar fold as in TruA, TruB and RsuA, with the location of the RNA-binding cleft, active-site and conserved, catalytic Asp residue superposing in all four structures. Superposition of the crystal structure of TruB bound to a T-stem loop with RluD reveals that similar RNA-protein interactions for the flipped-out uridine base would exist in both structures, implying that base-flipping is necessary for catalysis. This observation also implies that the specificity determinants for site-specific RNA-binding and recognition likely reside in parts of RluD beyond the active site.

  15. Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes

    DEFF Research Database (Denmark)

    Lee, C H; Helweg-Larsen, J; Tang, X

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the...

  16. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  17. Identification of the RsmG methyltransferase target as 16S rRNA nucleotide G527 and characterization of Bacillus subtilis rsmG mutants

    DEFF Research Database (Denmark)

    Nishimura, Kenji; Johansen, Shanna K; Inaoka, Takashi;

    2007-01-01

    The methyltransferase RsmG methylates the N7 position of nucleotide G535 in 16S rRNA of Bacillus subtilis (corresponding to G527 in Escherichia coli). Disruption of rsmG resulted in low-level resistance to streptomycin. A growth competition assay revealed that there are no differences in fitness...

  18. Quick identification of acetic acid bacteria based on nucleotide sequences of the 16S-23S rDNA internal transcribed spacer region and of the PQQ-dependent alcohol dehydrogenase gene.

    Science.gov (United States)

    Trcek, Janja

    2005-10-01

    Acetic acid bacteria (AAB) are well known for oxidizing different ethanol-containing substrates into various types of vinegar. They are also used for production of some biotechnologically important products, such as sorbose and gluconic acids. However, their presence is not always appreciated since certain species also spoil wine, juice, beer and fruits. To be able to follow AAB in all these processes, the species involved must be identified accurately and quickly. Because of inaccuracy and very time-consuming phenotypic analysis of AAB, the application of molecular methods is necessary. Since the pairwise comparison among the 16S rRNA gene sequences of AAB shows very high similarity (up to 99.9%) other DNA-targets should be used. Our previous studies showed that the restriction analysis of 16S-23S rDNA internal transcribed spacer region is a suitable approach for quick affiliation of an acetic acid bacterium to a distinct group of restriction types and also for quick identification of a potentially novel species of acetic acid bacterium (Trcek & Teuber 2002; Trcek 2002). However, with the exception of two conserved genes, encoding tRNAIle and tRNAAla, the sequences of 16S-23S rDNA are highly divergent among AAB species. For this reason we analyzed in this study a gene encoding PQQ-dependent ADH as a possible DNA-target. First we confirmed the expression of subunit I of PQQ-dependent ADH (AdhA) also in Asaia, the only genus of AAB which exhibits little or no ADH-activity. Further we analyzed the partial sequences of adhA among some representative species of the genera Acetobacter, Gluconobacter and Gluconacetobacter. The conserved and variable regions in these sequences made possible the construction of A. acetispecific oligonucleotide the specificity of which was confirmed in PCR-reaction using 45 well-defined strains of AAB as DNA-templates. The primer was also successfully used in direct identification of A. aceti from home made cider vinegar as well as for

  19. Identification of single nucleotide polymorphisms (SNPs) in the 16S rRNA gene of foodborne Bacillus spp.

    Science.gov (United States)

    Fernández-No, I C; Böhme, K; Caamaño-Antelo, S; Barros-Velázquez, J; Calo-Mata, P

    2015-04-01

    The main goal of this work was the identification of single nucleotide polymorphisms (SNPs) in the 16S rRNA gene of foodborne Bacillus spp. that may be useful for typing purposes. These species include, among others, Bacillus cereus, an important pathogenic species involved in food poisoning, and Bacillus licheniformis, Bacillus subtilis and Bacillus pumilus, which are causative agents of food spoilage described as responsible for foodborne disease outbreaks. With this purpose in mind, 52 Bacillus strains isolated from culture collections and fresh and processed food were considered. SNP type "Y" at sites 212 and 476 appeared in the majority of B. licheniformis studied strains. SNP type "R" at site 278 was detected in many strains of the B. subtilis/Bacillus amyloliquefaciens group, while polymorphism "Y" at site 173 was characteristic of the majority of strains of B. cereus/Bacillus thuringiensis group. The analysis of SNPs provided more intra-specific information than phylogenetic analysis in the cases of B. cereus and B. subtilis. Moreover, this study describes novel SNPs that should be considered when designing 16S rRNA-based primers and probes for multiplex-PCR, Real-Time PCR and microarray systems for foodborne Bacillus spp.

  20. A single methyltransferase YefA (RlmCD) catalyses both m5U747 and m5U1939 modifications in Bacillus subtilis 23S rRNA

    DEFF Research Database (Denmark)

    Desmolaize, Benoit; Fabret, Céline; Brégeon, Damien;

    2011-01-01

    . However, as previously shown, the m(5)U54 modification in B. subtilis tRNAs is catalysed in a fundamentally different manner by the folate-dependent enzyme TrmFO, which is unrelated to the E. coli TrmA. Here, we show that methylation of U747 and U1939 in B. subtilis rRNA is catalysed by a single enzyme...

  1. Analysis of the genotypes among different strains of common Mycobacteria based on 16S rRNA gene and 16S-23S rRNA gene internal transcribed spacer sequences%常见分枝杆菌种内不同株之间16S rRNA基因和16S-23SrRNA ITS序列分析结果的比较

    Institute of Scientific and Technical Information of China (English)

    黄至澄; 徐黔宁; 闫李侠; 陈保文; 王国治

    2011-01-01

    目的 针对常见分枝杆菌不同株对其基因序列进行分析,比较分析结果.方法 利用16S rRNA Gene和16S-23S rRNAITS(转录间隔区序列)分析法分别对97株共7种DSMZ/ATCC引进的常见分枝杆菌进行种内不同株之间基因差异性分析,对比两种分型结果的异同.结果 16S rRNA基因可将13株草分枝杆菌分为3个型别,18株偶发分枝杆菌分为6个型别,17株耻垢分枝杆菌分为4个型别,8株戈登分枝杆菌分为3个型别,9株龟分枝杆菌龟亚种分为3个型别,15株堪萨斯分枝杆菌分为2个型别,17株产鼻疽分枝杆菌分为1个型别;而16S-23S rRNA ITS可依次将上述分枝杆菌分为3个、15个、7个、3个、4个、3个、5个型别.结论 16S rRNA G ene分析和16S-23S rRNA ITS分析均是分枝杆菌基因型分析的可靠方法,此外,16S-23SrRNA ITS的种内多态性高于16S rRNA Gene.

  2. 动物性食品源弓形菌23S rRNA基因PCR检测方法的建立%Establishment of PCR Method for Detecting Animal Food-Borne Arcobacter Based on the 23S rRNA Gene

    Institute of Scientific and Technical Information of China (English)

    毕水莲

    2014-01-01

    建立了一种快速、准确检测弓形菌(Arcobacter)的PCR方法.根据弓形菌23S rRNA基因序列设计引物,对弓形菌标准菌株、弓形菌食品分离株及非弓形菌属菌株进行PCR扩增.结果表明,弓形菌标准菌株和35株弓形菌食品分离株扩增后均可得到688 bp的目的条带,11株非弓形菌属菌株均未见任何扩增条带,对弓形菌的最低检测限为1.12× 103 CFU/mL.该方法操作简单、检测周期短、灵敏度高、特异性好,可用于食品中弓形菌的快速检测.

  3. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary

    2015-03-01

    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals.

  4. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species.

    Science.gov (United States)

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi

    2016-08-01

    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method.

  5. Events during eucaryotic rRNA transcription initiation and elongation: Conversion from the closed to the open promoter complex requires nucleotide substrates

    Energy Technology Data Exchange (ETDEWEB)

    Bateman, E.; Paule, M.R.

    1988-05-01

    Chemical footprinting and topological analysis were carried out on the Acanthamoeba castellanii rRNA transcription initiation factor (TIF) and RNA polymerase I complexes with DNA during transcription initiation and elongation. The results show that the binding of TIF and polymerase to the promoter does not alter the supercoiling of the DNA template and the template does not become sensitive to modification by diethylpyro-carbonate, which can identify melted DNA regions. Thus, in contrast to bacterial RNA polymerase, the eucaryotic RNA polymerase I-promoter complex is in a closed configuration preceding addition of nucleotides in vitro. Initiation and 3'-O-methyl CTP-limited translocation by RNA polymerase I results in separation of the polymerase-TIF footprints, leaving the TIF footprint unaltered. In contrast, initiation and translocation result in a significant change in the conformation of the polymerase-DNA complex, culminating in an unwound DNA region of at least 10 base pairs.

  6. Mutations at three sites in the Escherichia coli 23S ribosomal RNA binding region for protein L11 cause UGA-specific suppression and conditional lethality.

    Science.gov (United States)

    Murgola, E J; Xu, W; Arkov, A L

    1995-01-01

    A single nucleotide change, G to A, at nucleotide position 1093 of E. coli 23S ribosomal RNA was found to cause UGA-specific suppression (D.K. Jemiolo, F.T. Pagel and E.J. Murgola, Proc. Natl. Acad. Sci. USA, in press). To obtain new kinds of UGA-specific suppressors in 23S rRNA, we used segment-directed mutagenic PCR, and targeted first the 1405 nucleotide SnaBI/I-CeuI segment, which includes position 1093, of the rrnB operon cloned into a multicopy plasmid. The mutagenized fragments were subcloned into the plasmid vector and used to transform to ampicillin resistance (Ampr) a recipient strain containing a UGA mutation in trpA. The Ampr transformants were then screened for suppression of UGA. After purification, Trp+ transformants were tested for association of the suppressor phenotype first with the plasmid and then specifically with the SnaBI/I-CeuI fragment. In one screening, four different kinds of mutational change were found, all at three sites within a highly conserved hexanucleotide loop in domain II of 23S rRNA. This region is part of the site for binding of the large subunit protein L11, which has been shown to be involved in peptide chain termination in a specific way. All of the mutants (G1093A, G1093 delta, A1095 delta, and U1097 delta) suppress UGA mutations, but not UAA or UAG mutations, and all four types exhibit high-temperature conditional lethality when highly expressed. Several mechanisms can be suggested for the UGA-specific suppression exhibited by these mutants, including altered interaction with protein L11, Second-site mutations that overcome the conditional lethality of G1093A indicate that intramolecular interactions within 23S rRNA may play a role in peptide chain termination at the UGA stop codon.

  7. Helix 69 of Escherichia coli 23S ribosomal RNA as a peptide nucleic acid target.

    Science.gov (United States)

    Kulik, Marta; Markowska-Zagrajek, Agnieszka; Wojciechowska, Monika; Grzela, Renata; Wituła, Tomasz; Trylska, Joanna

    2017-07-01

    A fragment of 23S ribosomal RNA (nucleotides 1906-1924 in E. coli), termed Helix 69, forms a hairpin that is essential for ribosome function. Helix 69 forms a conformationally flexible inter-subunit connection with helix 44 of 16S ribosomal RNA, and the nucleotide A1913 of Helix 69 influences decoding accuracy. Nucleotides U1911 and U1917 are post-transcriptionally modified with pseudouridines (Ψ) and U1915 with 3-methyl-Ψ. We investigated Helix 69 as a target for a complementary synthetic oligonucleotide - peptide nucleic acid (PNA). We determined thermodynamic properties of Helix 69 and its complexes with PNA and tested the performance of PNA targeted at Helix 69 in inhibiting translation in cell-free extracts and growth of E. coli cells. First, we examined the interactions of a PNA oligomer complementary to the G1907-A1919 fragment of Helix 69 with the sequences corresponding to human and bacterial species (with or without pseudouridine modifications). PNA invades the Helix 69 hairpin creating stable complexes and PNA binding to the pseudouridylated bacterial sequence is stronger than to Helix 69 without any modifications. Second, we confirmed the binding of PNA to 23S rRNA and 70S ribosomes. Third, we verified the efficiency of translation inhibition of these PNA oligomers in the cell-free translation/transcription E. coli system, which were in a similar range as tetracycline. Next, we confirmed that PNA conjugated to the (KFF)3K transporter peptide inhibited E. coli growth in micromolar concentrations. Overall, targeting Helix 69 with PNA or other sequence-specific oligomers could be a promising way to inhibit bacterial translation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  8. Interaction of the tylosin-resistance methyltransferase RlmA II at its rRNA target differs from the orthologue RlmA I

    DEFF Research Database (Denmark)

    Douthwaite, Stephen; Jakobsen, Lene; Yoshizawa, Satoko

    2008-01-01

    RlmA(II) methylates the N1-position of nucleotide G748 in hairpin 35 of 23 S rRNA. The resultant methyl group extends into the peptide channel of the 50 S ribosomal subunit and confers resistance to tylosin and other mycinosylated macrolide antibiotics. Methylation at G748 occurs in several groups...... of Gram-positive bacteria, including the tylosin-producer Streptomyces fradiae and the pathogen Streptococcus pneumoniae. Recombinant S. pneumoniae RlmA(II) was purified and shown to retain its activity and specificity in vitro when tested on unmethylated 23 S rRNA substrates. RlmA(II) makes multiple...

  9. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA....... Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... to form translationally active ribosomes. The function of 23S rRNA is largely reestablished by introduction of an alternative G1262.C2017 or U1262.A2017 pair, although neither of these supports polysome formation quite as effectively as the wild-type pair. A 23S rRNA with a C1262.G2017 pair...

  10. Nuclear Ribosomal RNA Small Subunit (18S rRNA) Nucleotide Sequen Nuclear Ribosomal RNA Small Subunit (18S rRNA) Nucleotide Sequen cing and Characterization of Sailonggu(Whole Bone of Myospalax baileyi Thomas)cing%塞隆骨原动物高原鼢鼠核基因18S rRNA序列测定与分析

    Institute of Scientific and Technical Information of China (English)

    曹晖; 刘玉萍; 张绍来; 周开亚

    2001-01-01

    目的:测定仓鼠科动物高原鼢鼠Myospalax b aileyi的核rDNA基因序列,为塞隆骨正品基原检定提供分子依据。方法:采用PCR直接测序技术测定高原鼢鼠18S rRNA基因核苷酸序列并作序列特征分析。[ HT5”H〗结果:高原鼢鼠的18S rRNA序列长度为1 851 bp。根据排序比较,高原鼢鼠与2种鼠科动物间的DNA序列同源性 为72.04%~72.18%。结论:通过基因序列分析,DNA测序技术可成为 塞隆骨正品基原检定的准确有效手段。%Objective: Sequencing the nuclear ribosomal RNA small subunit (18S r RNA) gene of Myospalax baileyi (Cricetidae) to develop an ultimate and defi nitive means for origin identification of genuine Sailonggu. Methods: The total DNA wa s prepared from dried tail tissues. The nuclear 18S rRNA gene region was amplifi ed by PCR using a consensus primer set and its nucleotide sequence was determine d by PCR direct sequencing. The characteristic analysis of 18S rRNA sequences wa s generated usin software program Genetyx-SV/R Version 10.1. Results: The entire 18S rRNA gene region of M. baileyi spanned 1851 bp in length. Althou gh m ultiple alignment of sequence indicates that there are only lower homology (72.0 4%~72.18%)comparing with its two alias Mus musculus (GenBank Accession numb er X 00686)and Rattus norvegicus (M11188)(Muridae), their highly conservative dom ain i s located in 1020~1509 nt. There are many variable sites from upstream of 5'-e nd , which coud provide a novel information for molecular recognition of Sailonggu. Conclusion:DNA sequencing could be a useful and reliable tool in the origin identification of genuine Sailonggu.

  11. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function...

  12. Specific features of 5S rRNA structure - its interactions with macromolecules and possible functions.

    Science.gov (United States)

    Smirnov, A V; Entelis, N S; Krasheninnikov, I A; Martin, R; Tarassov, I A

    2008-12-01

    Small non-coding RNAs are today a topic of great interest for molecular biologists because they can be regarded as relicts of a hypothetical "RNA world" which, apparently, preceded the modern stage of organic evolution on Earth. The small molecule of 5S rRNA (approximately 120 nucleotides) is a component of large ribosomal subunits of all living beings (5S rRNAs are not found only in mitoribosomes of fungi and metazoans). This molecule interacts with various protein factors and 23S (28S) rRNA. This review contains the accumulated data to date concerning 5S rRNA structure, interactions with other biological macromolecules, intracellular traffic, and functions in the cell.

  13. Identification of two Escherichia coli pseudouridine synthases that show multisite specificity for 23S RNA.

    Science.gov (United States)

    Huang, L; Ku, J; Pookanjanatavip, M; Gu, X; Wang, D; Greene, P J; Santi, D V

    1998-11-10

    Several putative Escherichia coli pseudouridine (Psi) synthases have been identified by iterative searching of genomic databases for ORFs homologous to known Psi synthases [Gustafsson et al. (1996) Nucleic Acids Res. 24, 3756-3762]. Of these, yceC and yfiI were proposed to encode Psi synthases which modify 23S rRNA. In the present work, yceC and yfiI were cloned and overexpressed in E. coli, and the encoded enzymes, YceC and YfiI, were purified to homogeneity. Both proteins converted Urd residues of rRNA to Psi, thus confirming their identities as Psi synthases. However, in in vitro experiments both enzymes extensively modified Urd residues of both 23S rRNA and 16S rRNA. Gene-disruption of yceCresulted in the absence of Psi modification at positions U955, 2504, and 2580 of 23S RNA, thus identifying these sites as in vivo targets for YceC. Likewise, yfiI disruption resulted in the absence of Psi modification at positions U1911, 1917, and possibly 1915 of 23S RNA. Disruption of yceC did not affect the growth under the conditions tested, whereas yfiI-disrupted cells showed a dramatic decrease in growth rate. Since YceC and YfiI hypermodify RNA in vitro, factors in addition to ribonucleotide sequence must contribute to the in vivo specificity of these enzymes.

  14. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Science.gov (United States)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  15. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    Science.gov (United States)

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A

    2013-11-18

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  16. Specificity shifts in the rRNA and tRNA nucleotide targets of archaeal and bacterial m5U methyltransferases

    DEFF Research Database (Denmark)

    Auxilien, Sylvie; Rasmussen, Anette; Rose, Simon;

    2011-01-01

    Methyltransferase enzymes that use S-adenosylmethionine as a cofactor to catalyze 5-methyl uridine (m(5)U) formation in tRNAs and rRNAs are widespread in Bacteria and Eukaryota, but are restricted to the Thermococcales and Nanoarchaeota groups amongst the Archaea. The RNA m(5)U methyltransferases...... appear to have arisen in Bacteria and were then dispersed by horizontal transfer of an rlmD-type gene to the Archaea and Eukaryota. The bacterium Escherichia coli has three gene paralogs and these encode the methyltransferases TrmA that targets m(5)U54 in tRNAs, RlmC (formerly RumB) that modifies m(5)U......, however, neither of the two P. abyssi enzymes displays RlmD-like activity in vitro. PAB0719 acts in a TrmA-like manner to catalyze m(5)U54 methylation in P. abyssi tRNAs, and here we show that PAB0760 possesses RlmC-like activity and specifically methylates the nucleotide equivalent to U747 in P. abyssi...

  17. Amplification and direct sequence analysis of the 23S rRNA gene from thermophilic bacteria

    DEFF Research Database (Denmark)

    Ibrahim, Ashraf; Hofman-Bang, H. Jacob Peider; Ahring, Birgitte Kiær

    2001-01-01

    We present a simplified and fast method to obtain high-quality sequences directly from PCRs without the traditional gel purification. We also report on an improved method to obtain sequence-quality PCR products from microorganisms that are difficult to lyse with no need for DNA extraction. The te....... The technique uses exonuclease I and shrimp alkaline phosphatase to degrade residual dNTPs and primers. Our technique is shown to work on both Gram-positive and Gram-negative bacteria...

  18. Phylogenetic analysis of 23S rRNA gene sequences of some ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-08-31

    Aug 31, 2016 ... genetic distance among the studied isolates was very narrow (ranged from ... with concentrations 10, 20 and 30% of polyethylene glycol plus control. ... among bacteria since their evolution are slow and their ... improve the yield of legumes in stressed environments ... New Al Menia City, Menia Governorate.

  19. Structural and functional analysis of Escherichia coli ribosomes containing small deletions around position 1760 in the 23S ribosomal RNA.

    Science.gov (United States)

    Zweib, C; Dahlberg, A E

    1984-09-25

    Three different small deletions were produced at a single Pvu 2 restriction site in E. coli 23S rDNA of plasmid pKK 3535 using exonuclease Bal 31. The deletions were located around position 1760 in 23S rRNA and were characterized by DNA sequencing as well as by direct fingerprinting and S1-mapping of the rRNA. Two of the mutant plasmids, Pvu 2-32 and Pvu 2-33, greatly reduced the growth rate of transformed cells while the third mutant, Pvu 2-14 grew as fast as cells containing the wild-type plasmid pKK 3535. All three mutant 23S rRNAs were incorporated into 50S-like particles and were even found in 70S ribosomes and polysomes in vivo. The conformation of mutant 23S rRNA in 50S subunits was probed with a double-strand specific RNase from cobra venom. These analyses revealed changes in the accessibility of cleavage sites near the deletions around position 1760 and in the area around position 800 in all three mutant rRNAs. We suggest, that an altered conformation of the rRNAs at the site of the deletion is responsible for the slow growth of cells containing mutant plasmids Pvu 2-32 and Pvu 2-33.

  20. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    Science.gov (United States)

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  1. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on peptide bond...

  2. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C;

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  3. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  4. Assignment of Isodoublet of 23S1 Meson Nonet

    Institute of Scientific and Technical Information of China (English)

    FENG Xue-Chao; JIANG Feng-Chun

    2007-01-01

    Inserting the masses of some states, which have been established in the experiments or the theory of lattice QCD, we investigate the mass of the isodoublet of the 23S1 meson nonet. The agreement results, 1567 ± 22.6 MeV and 1576.8 MeV, are given by two different approaches. We suggest that the assignment of 23S1 meson nonet should be re-examined in future experiments.

  5. USE OF 16S-23S INTERGENIC TRANSCRIBED SPACER IN IDENTIFICATION AND COMMUNITY ANALYSIS OF BACTERIA%基因间隔序列(ITS)在细菌分类鉴定和种群分析中的应用

    Institute of Scientific and Technical Information of China (English)

    郑雪松; 杨虹; 李道棠; 韩文卿

    2003-01-01

    Use of 16S -23S intergenic transcribed spacer (ITS) variability, as a relatively new method, is becoming an important supplement to the molecular methods based on 16S rRNA for which has a fairly constant size and is not divergent enough to give good separation in close relationships. This paper summarizes the structures and characteristics of ITS regions that are extremely variable in copy number, length and sequence per genome. The ITS region can be amplified easily taking advantage of conserved nucleotide stretches at the 5′of the 16S and 3′of the 23S gene, and the amplicon can contain different amounts of the 16S rDNA by choosing primers at different conserved areas within this gene. These primers are listed and discussed for perfecting the methodology of ITS. Furthermore, some recent progresses on the taxonomy, identification and community analysis of bacteria by means of ITS in epidemiology, ecology and artificial environment are reviewed, as well, the virtues and limitations of that method are discussed. Fig 2, Tab 1, Ref 51

  6. Macrolides and lincomycin susceptibility of Mycoplasma hyorhinis and variable mutation of domain II and V in 23S ribosomal RNA.

    Science.gov (United States)

    Kobayashi, Hideki; Nakajima, Hiromi; Shimizu, Yuka; Eguchi, Masashi; Hata, Eiji; Yamamoto, Koshi

    2005-08-01

    A total of 151 strains of Mycoplasma hyorhinis isolated from porcine lung lesions (weaned pigs, n=71, and finishers, n=80) were investigated for their in vitro susceptibility to 10 antimicrobial agents. Thirty-one strains (28 from weaned pigs and 3 from finishers) showed resistance to 16-membered macrolide antibiotics and lincomycin. The prevalence of the 16-membered macrolide-resistant M. hyorhinis strain in weaned pigs from Japanese herds has approximately quadrupled in the past 10 years. Several of the 31 strains were examined for mutations in the 23S ribosomal RNA (rRNA). All field strains tested showed a transition of A to G at position 2059 of 23S rRNA-rendered Escherichia coli. On the other hand, individual tylosin- and lincomycin-resistant mutants of M. hyorhinis were selected in vitro from the susceptible type strain BTS7 by 3 to 9 serial passages in subinhibitory concentrations of each antibiotic. The 23S rRNA sequences of both tylosin and lincomycin-resistant mutants were compared with that of the radical BTS7 strain. The BTS7 mutant strain selected by tylosin showed the same transition as the field-isolated strains of A2059G. However, the transition selected in lincomycin showed mutations in domains II and V of 23S rRNA, G2597U, C2611U in domain V, and the addition of an adenine at the pentameric adenine loop in domain II. The strain selected by lincomycin showed an additional point mutation of A2062G selected by tylosin.

  7. Evolutionary relationships among Chlamydophila abortus variant strains inferred by rRNA secondary structure-based phylogeny.

    Science.gov (United States)

    Siarkou, Victoria I; Stamatakis, Alexandros; Kappas, Ilias; Hadweh, Paul; Laroucau, Karine

    2011-01-01

    The evolutionary relationships among known Chlamydophila abortus variant strains including the LLG and POS, previously identified as being highly distinct, were investigated based on rRNA secondary structure information. PCR-amplified overlapping fragments of the 16S, 16S-23S intergenic spacer (IS), and 23S domain I rRNAs were subjected to cloning and sequencing. Secondary structure analysis revealed the presence of transitional single nucleotide variations (SNVs), two of which occurred in loops, while seven in stem regions that did not result in compensatory substitutions. Notably, only two SNVs, in 16S and 23S, occurred within evolutionary variable regions. Maximum likelihood and Bayesian phylogeny reconstructions revealed that C. abortus strains could be regarded as representing two distinct lineages, one including the "classical" C. abortus strains and the other the "LLG/POS variant", with the type strain B577(T) possibly representing an intermediate of the two lineages. The two C. abortus lineages shared three unique (apomorphic) characters in the 23S domain I and 16S-23S IS, but interestingly lacked synapomorphies in the 16S rRNA. The two lineages could be distinguished on the basis of eight positions; four of these comprised residues that appeared to be signature or unique for the "classical" lineage, while three were unique for the "LLG/POS variant". The U277 (E. coli numbering) signature character, corresponding to a highly conserved residue of the 16S molecule, and the unique G681 residue, conserved in a functionally strategic region also of 16S, are the most pronounced attributes (autapomorphies) of the "classical" and the "LLG/POS variant" lineages, respectively. Both lineages were found to be descendants of a common ancestor with the Prk/Daruma C. psittaci variant. Compared with the "classical", the "LLG/POS variant" lineage has retained more ancestral features. The current rRNA secondary structure-based analysis and phylogenetic inference reveal new

  8. Evolutionary relationships among Chlamydophila abortus variant strains inferred by rRNA secondary structure-based phylogeny.

    Directory of Open Access Journals (Sweden)

    Victoria I Siarkou

    Full Text Available The evolutionary relationships among known Chlamydophila abortus variant strains including the LLG and POS, previously identified as being highly distinct, were investigated based on rRNA secondary structure information. PCR-amplified overlapping fragments of the 16S, 16S-23S intergenic spacer (IS, and 23S domain I rRNAs were subjected to cloning and sequencing. Secondary structure analysis revealed the presence of transitional single nucleotide variations (SNVs, two of which occurred in loops, while seven in stem regions that did not result in compensatory substitutions. Notably, only two SNVs, in 16S and 23S, occurred within evolutionary variable regions. Maximum likelihood and Bayesian phylogeny reconstructions revealed that C. abortus strains could be regarded as representing two distinct lineages, one including the "classical" C. abortus strains and the other the "LLG/POS variant", with the type strain B577(T possibly representing an intermediate of the two lineages. The two C. abortus lineages shared three unique (apomorphic characters in the 23S domain I and 16S-23S IS, but interestingly lacked synapomorphies in the 16S rRNA. The two lineages could be distinguished on the basis of eight positions; four of these comprised residues that appeared to be signature or unique for the "classical" lineage, while three were unique for the "LLG/POS variant". The U277 (E. coli numbering signature character, corresponding to a highly conserved residue of the 16S molecule, and the unique G681 residue, conserved in a functionally strategic region also of 16S, are the most pronounced attributes (autapomorphies of the "classical" and the "LLG/POS variant" lineages, respectively. Both lineages were found to be descendants of a common ancestor with the Prk/Daruma C. psittaci variant. Compared with the "classical", the "LLG/POS variant" lineage has retained more ancestral features. The current rRNA secondary structure-based analysis and phylogenetic

  9. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    DEFF Research Database (Denmark)

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    Erm methyltransferases modify bacterial 23S ribosomal RNA at adenosine 2058 (A2058, Escherichia coli numbering) conferring resistance to macrolide, lincosamide, and streptogramin B (MLS) antibiotics. The motif that is recognized by Erm methyltransferases is contained within helix 73 of 23S rRNA a...

  10. Comparison of the nucleotide sequences of 16S rRNA, 444 Ep-ank, and groESL heat shock operon genes in naturally occurring Ehrlichia equi and human granulocytic ehrlichiosis agent isolates from Northern California.

    Science.gov (United States)

    Chae, J S; Foley, J E; Dumler, J S; Madigan, J E

    2000-04-01

    We examined 11 naturally occurring isolates of Ehrlichia equi in horses and two human granulocytic ehrlichiosis agent isolates in California for sequence diversity in three genes. Ehrlichia equi isolates were from Sierra (n = 6), Mendocino (n = 3), Sonoma (n = 1), and Marin (n = 1) counties, and human granulocytic ehrlichiosis (HGE) agent isolates were obtained from Humboldt county. PCR with specific primers for 16S rRNA, 444 Ep-ank and groESL heat shock operon genes successfully produced amplicons for all 13 clinical samples. The 444 Ep-ank gene of the HGE agent and E. equi isolates from northern California is different from the eastern U.S. isolates BDS and USG3. The translated amino acid sequence of the groESL heat shock operon gene fragment is identical among E. equi, the HGE agent, and E. phagocytophila, with the exception of the northern Californian equine CASOLJ isolate. Microheterogeneity was observed in the 16S rRNA gene sequences of HGE agent and E. equi isolates from northern California. These results suggest that E. equi and the HGE agent found in California are similar or identical but may differ from the isolates of equine and human origin found in the eastern United States.

  11. Higher-order structure in the 3'-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

    DEFF Research Database (Denmark)

    Garrett, R A; Christensen, A; Douthwaite, S

    1984-01-01

    An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large ...

  12. VapC20 of Mycobacterium tuberculosis Cleaves the Sarcin Ricin Loop of 23S rRNA

    DEFF Research Database (Denmark)

    Winther, Kristoffer Skovbo; Brodersen, Ditlev E.; Brown, Alistair K;

    2013-01-01

    The highly persistent and often lethal human pathogen, Mycobacterium tuberculosis contains at least 88 toxin–antitoxin genes. More than half of these encode VapC PIN domain endoribonucleases that inhibit cell growth by unknown mechanisms. Here we show that VapC20 of M. tuberculosis inhibits...... exhibited by M. tuberculosis. VapC20 cleavage is inhibited by mutations in the SRL that flank the cleavage site but not by changes elsewhere in the loop. Disruption of the SRL stem abolishes cleavage; however, further mutations that restore the SRL stem structure restore cleavage, revealing...

  13. Analysis of 16S-23S rRNA internal transcribed spacer regions in Pasteurellaceae isolated from laboratory rodents.

    Science.gov (United States)

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Christensen, Henrik; Sager, Martin

    2012-09-01

    The internal transcribed spacer (ITS) regions of members of Pasteurellaceae isolated from rodents, including the [Pasteurella] pneumotropica biotypes Jawetz and Heyl, [Actinobacillus] muris, "Hemophilus influenzaemurium" and Bisgaard taxon 17 were studied and their feasibility to discriminate these species was analyzed. The reference strains of all species analyzed showed unique species-specific ITS patterns which were further present in 49 clinical isolates of [P.] pneumotropica biotypes Jawetz and Heyl and [A.] muris allowing their identification by comparison to the reference strains pattern. Sequence analysis of the amplified fragments revealed in all species, with exception of "H. influenzaemurium", a larger ITS(ile+ala) which contained the genes for tRNA(Ile(GAU)) and tRNA(Ala(UGC)) and a smaller ITS(glu) with the tRNA(Glu(UUC)) gene. "H. influenzaemurium" revealed two each of the larger and respectively the smaller ITS fragments. Both the length and the sequence of each ITS type were highly conserved within the [P.] pneumotropica biotypes Jawetz and Heyl and [A.] muris strains tested. On the contrary, ITS sequences revealed significant interspecies variations with identity levels ranging from 61.2 to 89.5% for ITS(ile+ala) and 56.5 to 86.8% for ITS(glu). Sequences regions with significant interspecies variation but highly conserved within the species were identified and might be used to design probes for the identification of rodent Pasteurellaceae to the species level. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Crystal structure of the Escherichia coli 23S rRNA:m5C methyltransferase RlmI (YccW) reveals evolutionary links between RNA modification enzymes

    DEFF Research Database (Denmark)

    Sunita, S; Tkaczuk, Karolina L; Purta, Elzbieta

    2008-01-01

    Methylation is the most common RNA modification in the three domains of life. Transfer of the methyl group from S-adenosyl-l-methionine (AdoMet) to specific atoms of RNA nucleotides is catalyzed by methyltransferase (MTase) enzymes. The rRNA MTase RlmI (rRNA large subunit methyltransferase gene I...... that the evolutionary paths of RNA and DNA 5-methyluridine and 5-methylcytosine MTases have been closely intertwined....

  15. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolism....... The aim of this article is to provide knowledge of nucleotide metabolism and its regulation to facilitate interpretation of data arising from genetics, proteomics, and transcriptomics in connection with biotechnological processes and beyond....

  16. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolism....... The aim of this article is to provide knowledge of nucleotide metabolism and its regulation to facilitate interpretation of data arising from genetics, proteomics, and transcriptomics in connection with biotechnological processes and beyond....

  17. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides.

    Science.gov (United States)

    Almutairi, Mashal M; Park, Sung Ryeol; Rose, Simon; Hansen, Douglas A; Vázquez-Laslop, Nora; Douthwaite, Stephen; Sherman, David H; Mankin, Alexander S

    2015-10-20

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces venezuelae strain ATCC 15439. The producer avoids the inhibitory effects of its own antibiotics by expressing two paralogous rRNA methylase genes pikR1 and pikR2 with seemingly redundant functions. We show here that the PikR1 and PikR2 enzymes mono- and dimethylate, respectively, the N6 amino group in 23S rRNA nucleotide A2058. PikR1 monomethylase is constitutively expressed; it confers low resistance at low fitness cost and is required for ketolide-induced activation of pikR2 to attain high-level resistance. The regulatory mechanism controlling pikR2 expression has been evolutionary optimized for preferential activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism.

  18. Sequence length variation of internal genic space of 16S rDNA-23S rDNA in biohydrogen-bacterium%产氢菌的16S -23S rDNA间隔区的长度变异性分析

    Institute of Scientific and Technical Information of China (English)

    李永峰; 郑国香; 张文启; 李建政; 胡立杰

    2005-01-01

    生物制氢细菌Rennanqilyf3的16S rRNA gene (rDNA)-23S rDNA间隔区碱基序列被测定.利用PCR扩增间隔区DNA,间隔区碱基序列存在长度多态现象.用这一长度多态现象进行产氢发酵细菌的辨认和识别.产氢发酵细菌Rennanqilyf3的16S rRNA gene (rDNA)-23S rDNA间隔区的PCR产品从1 270 到398 bp,共有5个序列.碱基数目分别为1 270、398、638、437 和 436 bp.%A method based on PCR amplification of the 16S rRNA gene (rDNA)-23S rDNA intergenic regions was developed for the identification of species for fermentative biohydrogen-producing bacterium. The sizes of the PCR products varied from 1 270 to 398 bp. Strain of Rennanqilyf3 were characterized as having products of 1 270,398,638, 437 and 436bp.

  19. The use of 16S and 16S-23S rDNA to easily detect and differentiate common Gram-negative orchard epiphytes.

    Science.gov (United States)

    Jeng, R S; Svircev, A M; Myers, A L; Beliaeva, L; Hunter, D M; Hubbes, M

    2001-02-01

    The identification of Gram-negative pathogenic and non-pathogenic bacteria commonly isolated from an orchard phylloplane may result in a time consuming and tedious process for the plant pathologist. The paper provides a simple "one-step" protocol that uses the polymerase chain reaction (PCR) to amplify intergenic spacer regions between 16S and 23S genes and a portion of 16S gene in the prokaryotic rRNA genetic loci. Amplified 16S rDNA, and restriction fragment length polymorphisms (RFLP) following EcoRI digestion produced band patterns that readily distinguished between the plant pathogen Erwinia amylovora (causal agent of fire blight in pear and apple) and the orchard epiphyte Pantoea agglomerans (formerly E. herbicola). The amplified DNA patterns of 16S-23S spacer regions may be used to differentiate E. amylovora at the intraspecies level. Isolates of E. amylovora obtained from raspberries exhibited two major fragments while those obtained from apples showed three distinct amplified DNA bands. In addition, the size of the 16S-23S spacer region differs between Pseudomonas syringae and Pseudomonas fluorescens. The RFLP pattern generated by HaeIII digestion may be used to provide a rapid and accurate identification of these two common orchard epiphytes.

  20. Molecular analysis of the 16S-23S rDNA internal spacer region (ISR) and truncated tRNA(Ala) gene segments in Campylobacter lari.

    Science.gov (United States)

    Hayashi, K; Tazumi, A; Nakanishi, S; Nakajima, T; Matsubara, K; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

    2012-06-01

    Following PCR amplification and sequencing, nucleotide sequence alignment analyses demonstrated the presence of two kinds of 16S-23S rDNA internal spacer regions (ISRs), namely, long length ISRs of 837-844 base pair (bp) [n = six for urease-negative (UN) Campylobacter lari isolates, UN C. lari JCM2530(T), RM2100, 176, 293, 299 and 448] and short length ISRs of 679-725 bp [n = six for UN C. lari: n = 14 for urease-positive thermophilic Campylobacter (UPTC) isolates]. The analyses also indicated that the short length ISRs mainly lacked the 156 bp sequence from the nucleotide positions 122-277 bp in long length ISRs for UN C. lari JCM2530(T). The 156 bp sequences shared 94.9-96.8 % sequence similarity among six isolates. Surprisingly, atypical tRNA(Ala) gene segment (5' end 35 bp), which was extremely truncated, occurred within the 156 bp sequences in the long length ISRs, as an unexpected tRNA(Ala) pseudogene. An order of the intercistronic tRNA genes within the short nucleotide spacer of 5'-16S rDNA-tRNA(Ala)-tRNA(Ile)-23S rDNA-3' occurred in all the C. lari isolates examined.

  1. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    OpenAIRE

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A.

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 speci...

  2. Heterogeneity within the gram-positive anaerobic cocci demonstrated by analysis of 16S-23S intergenic ribosomal RNA polymorphisms.

    Science.gov (United States)

    Hill, K E; Davies, C E; Wilson, M J; Stephens, P; Lewis, M A O; Hall, V; Brazier, J; Thomas, D W

    2002-11-01

    Peptostreptococci are gram-positive, strictly anaerobic bacteria which, although regarded as members of the commensal human microflora, are also frequently isolated from sites of clinical infection. The study of this diverse group of opportunist pathogens has been hindered by an inadequate taxonomy and the lack of a valid identification scheme. Recent re-classification of the Peptostreptococcus family into five distinct genus groups has helped to clarify the situation. However, this has been on the basis of 16S rRNA sequence determinations, which are both time-consuming and expensive. The aim of the present study was to evaluate the use of PCR-amplified ribosomal DNA spacer polymorphisms for the rapid differentiation of the currently recognised taxa within the group of anaerobic gram-positive cocci. A collection comprising 19 reference strains with representatives of each of the 15 species, two close relatives and two of the well-characterised groups, together with 38 test strains was studied. All strains were identified to species group level by phenotypic means. Amplification of the 16S-23S intergenic spacer region (ISR) with universal primers produced distinct banding patterns for all the 19 reference strains and the patterns could be differentiated easily visually. However, of the 38 test strains, less than half could be speciated from ISR analysis alone. Only five groups produced correlating banding patterns for all members tested (Peptoniphilus lacrimalis, P. ivorii, Anaerococcus octavius, Peptostreptococcus anaerobius and Micromonas micros). For other species, either the type strain differed significantly from other species members (e.g., A. hydrogenalis) or there appeared to be considerable intra-species variation (e.g., A. vaginalis). Partial 16S rRNA gene sequences for the 'trisimilis' and 'betaGAL' groups showed that both are most closely related to the Anaerococcus group. This work highlights the heterogeneous nature of a number of Peptostreptococcus

  3. Changes in Bacillus Spore Small Molecules, rRNA, Germination, and Outgrowth after Extended Sublethal Exposure to Various Temperatures: Evidence that Protein Synthesis Is Not Essential for Spore Germination.

    Science.gov (United States)

    Korza, George; Setlow, Barbara; Rao, Lei; Li, Qiao; Setlow, Peter

    2016-12-15

    rRNAs of dormant spores of Bacillus subtilis were >95% degraded during extended incubation at 50°C, as reported previously (E. Segev, Y. Smith, and S. Ben-Yehuda, Cell 148:139-114, 2012, doi:http://dx.doi.org/10.1016/j.cell.2011.11.059), and this was also true of spores of Bacillus megaterium Incubation of spores of these two species for ∼20 h at 75 to 80°C also resulted in the degradation of all or the great majority of the 23S and 16S rRNAs, although this rRNA degradation was slower than nonenzymatic hydrolysis of purified rRNAs at these temperatures. This rRNA degradation at high temperature generated almost exclusively oligonucleotides with minimal levels of mononucleotides. RNase Y, suggested to be involved in rRNA hydrolysis during B. subtilis spore incubation at 50°C, did not play a role in B. subtilis spore rRNA breakdown at 80°C. Twenty hours of incubation of Bacillus spores at 70°C also decreased the already minimal levels of ATP in dormant spores 10- to 30-fold, to ≤0.01% of the total free adenine nucleotide levels. Spores depleted of rRNA were viable and germinated relatively normally, often even faster than starting spores. Their return to vegetative growth was also similar to that of untreated spores for B. megaterium spores and slower for heat-treated B. subtilis spores; accumulation of rRNA took place only after completion of spore germination. These findings thus strongly suggest that protein synthesis is not essential for Bacillus spore germination.IMPORTANCE A recent report (L. Sinai, A. Rosenberg, Y. Smith, E. Segev, and S. Ben-Yehuda, Mol Cell 57:3486-3495, 2015, doi:http://dx.doi.org/10.1016/j.molcel.2014.12.019) suggested that protein synthesis is essential for early steps in the germination of dormant spores of Bacillus subtilis If true, this would be a paradigm shift in our understanding of spore germination. We now show that essentially all of the rRNA can be eliminated from spores of Bacillus megaterium or B. subtilis, and these

  4. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    DEFF Research Database (Denmark)

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim;

    1999-01-01

    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems...... growth. The amounts of 23S rRNA and pre-16S rRNA measured for E. coli growing in intestinal mucus corresponded to that expected for bacteria with the observed growth rate. In contrast, the slow-growing E. coli cells present in intestinal contents turned out to have an approximately ninefold higher...

  5. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    Science.gov (United States)

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  6. rRNA gene restriction patterns of Haemophilus influenzae biogroup aegyptius strains associated with Brazilian purpuric fever.

    Science.gov (United States)

    Irino, K; Grimont, F; Casin, I; Grimont, P A

    1988-08-01

    The rRNA gene restriction patterns of 92 isolates of Haemophilus influenzae biogroup aegyptius, associated with conjunctivitis or Brazilian purpuric fever in the State of São Paulo, Brazil, were studied with 16 + 23S rRNA from Escherichia coli as a probe. All strains were classified into 15 patterns. Isolates from Brazilian purpuric fever cases were seen only in patterns 3 (most frequently) and 4 (rarely), whereas isolates from conjunctivitis were found in all 15 patterns. The study demonstrated that rRNA from E. coli can serve as a probe for molecular epidemiology.

  7. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Karminska, K. H.; Purta, E.; Hansen, L .H.

    2010-01-01

    of a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension analysis....... The investigation has identified essential amino acids and Cfr variants with altered reaction mechanisms and represents a first step towards understanding the structural basis of Cfr activity....

  8. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    to A752 via alkyl-aryl groups linked to a carbamate at the drug 11/12 position (in the ketolide antibiotics HMR 3647 and HMR 3004). The data indicate that simultaneous drug interactions with domains II and V strengthen binding and that the domain II contact is of particular importance to achieve...

  9. Length polymorphisms for intergenic spacer regions of 16S-23S rDNA in members of the new hydrogen-producing bacteria

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A method based on PCR amplification of the 16S rRNA gene (rDNA) -23S rDNA intergenic spacer regions (ISR) was developed for the identification of species within the novel group hydrogen-producing anaerobes. The sizes of the PCR products varied from 1264 to 398 bp. Strain of isolate Rennanqilyf 3 was characterized as having products of 1262, 398, 638, 437 and 436 bp. The isolate Rennanqilyf 1 had product of 1264 bp. The isolate Rennanqilyf 13 had products of 1261, 579 and 485 bp. Of the 3 species of the novel group hydrogenproducing anaerobes examined, no one was indistinguishable. Two environmental isolates were identified as hydrogen-producing bacteria, which were new species in present taxon. Rennanqilyf 3 could not be associated With any Clostridium sp. Studied. Rennanqilyf 1 could be classified into Clostridium genus. The combination between 16S rDNA equencing and length polymorphisms of IRS in 16S-23S rDNA is a better method for determining species of the hydrogen-producing bacteria.

  10. Improved identification of rapidly growing mycobacteria by a 16S-23S internal transcribed spacer region PCR and capillary gel electrophoresis.

    Directory of Open Access Journals (Sweden)

    Timothy J Gray

    Full Text Available The identification of rapidly growing mycobacteria (RGM remains problematic because of evolving taxonomy, limitations of current phenotypic methods and absence of a universal gene target for reliable speciation. This study evaluated a novel method of identification of RGM by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS followed by resolution of amplified fragments by capillary gel electrophoresis (CGE. Nineteen American Type Culture Collection (ATCC Mycobacterium strains and 178 clinical isolates of RGM (12 species were studied. All RGM ATCC strains generated unique electropherograms with no overlap with slowly growing mycobacteria species, including M. tuberculosis. A total of 47 electropherograms for the 178 clinical isolates were observed allowing the speciation of 175/178 (98.3% isolates, including the differentiation of the closely related species, M. massiliense (M. abscessus subspecies bolletii and M. abscessus (M. abscessus sensu stricto. ITS fragment size ranged from 332 to 534 bp and 33.7% of clinical isolates generated electropherograms with two distinct peaks, while the remainder where characterized with a single peak. Unique peaks (fragment lengths were identified for 11/12 (92% RGM species with only M. moriokaense having an indistinguishable electropherogram from a rarely encountered CGE subtype of M. fortuitum. We conclude that amplification of the 16S-23S ITS gene region followed by resolution of fragments by CGE is a simple, rapid, accurate and reproducible method for species identification and characterization of the RGM.

  11. Higher-order structure of rRNA

    Science.gov (United States)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  12. Changes in the conformation of 5S rRNA cause alterations in principal functions of the ribosomal nanomachine.

    Science.gov (United States)

    Kouvela, Ekaterini C; Gerbanas, George V; Xaplanteri, Maria A; Petropoulos, Alexandros D; Dinos, George P; Kalpaxis, Dimitrios L

    2007-01-01

    5S rRNA is an integral component of the large ribosomal subunit in virtually all living organisms. Polyamine binding to 5S rRNA was investigated by cross-linking of N1-azidobenzamidino (ABA)-spermine to naked 5S rRNA or 50S ribosomal subunits and whole ribosomes from Escherichia coli cells. ABA-spermine cross-linking sites were kinetically measured and their positions in 5S rRNA were localized by primer extension analysis. Helices III and V, and loops A, C, D and E in naked 5S rRNA were found to be preferred polyamine binding sites. When 50S ribosomal subunits or poly(U)-programmed 70S ribosomes bearing tRNA(Phe) at the E-site and AcPhe-tRNA at the P-site were targeted, the susceptibility of 5S rRNA to ABA-spermine was greatly reduced. Regardless of 5S rRNA assembly status, binding of spermine induced significant changes in the 5S rRNA conformation; loop A adopted an apparent 'loosening' of its structure, while loops C, D, E and helices III and V achieved a more compact folding. Poly(U)-programmed 70S ribosomes possessing 5S rRNA cross-linked with spermine were more efficient than control ribosomes in tRNA binding, peptidyl transferase activity and translocation. Our results support the notion that 5S rRNA serves as a signal transducer between regions of 23S rRNA responsible for principal ribosomal functions.

  13. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    Science.gov (United States)

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  14. Cloning, Sequencing and Analysis of the 16S-23S rDNA Intergenic Spacers (IGSs) of Two Strains of Vibrio vulnificus%2株创伤弧菌的16S-23S rDNA间区的克隆、测序及分析

    Institute of Scientific and Technical Information of China (English)

    邓先余; 陈晓艳; 王智学; 欧普; 何建国

    2006-01-01

    . vulnificus ATCC27562 available at GenBank revealed several highly conserved sequence blocks in the non- coding regions flanking the tRNA genes within all of strains, most notably the first 40 and last 200 nucleotides, which can be targeted to design species-specific PCR primers or detection probes. The structural variations of the 16S-23S rDNA intergenic spacers lay a foundation for developing diagnostic methods for V. vulnificus.

  15. Analysis of the 16S-23S rDNA intergenic spacers (IGSs) of marine vibrios for species-specific signature DNA sequences.

    Science.gov (United States)

    Lee, Simon K Y; Wang, H Z; Law, Sheran H W; Wu, Rudolf S S; Kong, Richard Y C

    2002-05-01

    Vibrios are widespread in the marine environment and a few pathogenic species are known to be commonly associated with outbreaks of diarrheal diseases in humans due to the consumption of raw or improperly cooked seafood. However, there are also many Vibrio species which are potentially pathogenic to vertebrate and invertebrate aquatic animals, and of which little is known. In an attempt to develop rapid PCR detection methods for these latter class of vibrios, we have examined the 16S-23S intergenic spacers (IGSs) of 10 lesser-known Vibrio species and successfully developed species-specific primers for eight of them--Vibrio costicola, V. diazotrophicus, V. fluvialis, V. nigripulchritudo, V. proteolyticus, V. salmonicida, V. splendidus and V. tubiashii. The IGS amplicons were amplified using primers complementary to conserved regions of the 16S and 23S rRNA genes, and cloned into plasmid vectors and sequenced. Analysis of the IGS sequences showed that 37 ribosomal RNA (rrn) operons representing seven different IGS types have been cloned from the 10 vibrios. The three IGS types--IGS(0), IGS(IA) and IGS(Glu)--were the most prevalent forms detected. Multiple alignment of representative sequences of these three IGS types from different Vibrio species revealed several domains of high sequence variability, which were used to design species-specific primers for PCR. The specificity of the primers were evaluated using total DNA prepared from different Vibrio species and bacterial genera. The results showed that the PCR method can be used to reliably detect eight of the 10 Vibrio species in marine waters in this study.

  16. A second function for pseudouridine synthases: A point mutant of RluD unable to form pseudouridines 1911, 1915, and 1917 in Escherichia coli 23S ribosomal RNA restores normal growth to an RluD-minus strain.

    Science.gov (United States)

    Gutgsell, N S; Del Campo, M; Raychaudhuri, S; Ofengand, J

    2001-07-01

    This laboratory previously showed that truncation of the gene for RluD, the Escherichia coli pseudouridine synthase responsible for synthesis of 23S rRNA pseudouridines 1911, 1915, and 1917, blocks pseudouridine formation and inhibits growth. We now show that RluD mutants at the essential aspartate 139 allow these two functions of RluD to be separated. In vitro, RluD with aspartate 139 replaced by threonine or asparagine is completely inactive. In vivo, the growth defect could be completely restored by transformation of an RluD-inactive strain with plasmids carrying genes for RluD with aspartate 139 replaced by threonine or asparagine. Pseudouridine sequencing of the 23S rRNA from these transformed strains demonstrated the lack of these pseudouridines. Pseudoreversion, which has previously been shown to restore growth without pseudouridine formation by mutation at a distant position on the chromosome, was not responsible because transformation with empty vector under identical conditions did not alter the growth rate.

  17. Chicken rRNA Gene Cluster Structure.

    Directory of Open Access Journals (Sweden)

    Alexander G Dyomin

    Full Text Available Ribosomal RNA (rRNA genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5'ETS (1836 bp, 18S rRNA gene (1823 bp, ITS1 (2530 bp, 5.8S rRNA gene (157 bp, ITS2 (733 bp, 28S rRNA gene (4441 bp and 3'ETS (343 bp. The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region. The results have confirmed the chicken rRNA gene cluster validity.

  18. RISSC: a novel database for ribosomal 16S-23S RNA genes spacer regions.

    Science.gov (United States)

    García-Martínez, J; Bescós, I; Rodríguez-Sala, J J; Rodríguez-Valera, F

    2001-01-01

    A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S-23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documentation tool for studies on evolution, identification, typing and strain characterization, among others.

  19. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    Science.gov (United States)

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  20. Dicistronic tRNA-5S rRNA genes in Yarrowia lipolytica: an alternative TFIIIA-independent way for expression of 5S rRNA genes.

    Science.gov (United States)

    Acker, Joël; Ozanne, Christophe; Kachouri-Lafond, Rym; Gaillardin, Claude; Neuvéglise, Cécile; Marck, Christian

    2008-10-01

    In eukaryotes, genes transcribed by RNA polymerase III (Pol III) carry their own internal promoters and as such, are transcribed as individual units. Indeed, a very few cases of dicistronic Pol III genes are yet known. In contrast to other hemiascomycetes, 5S rRNA genes of Yarrowia lipolytica are not embedded into the tandemly repeated rDNA units, but appear scattered throughout the genome. We report here an unprecedented genomic organization: 48 over the 108 copies of the 5S rRNA genes are located 3' of tRNA genes. We show that these peculiar tRNA-5S rRNA dicistronic genes are expressed in vitro and in vivo as Pol III transcriptional fusions without the need of the 5S rRNA gene-specific factor TFIIIA, the deletion of which displays a viable phenotype. We also report the existence of a novel putative non-coding Pol III RNA of unknown function about 70 nucleotide-long (RUF70), the 13 genes of which are devoid of internal Pol III promoters and located 3' of the 13 copies of the tDNA-Trp (CCA). All genes embedded in the various dicistronic genes, fused 5S rRNA genes, RUF70 genes and their leader tRNA genes appear to be efficiently transcribed and their products correctly processed in vivo.

  1. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    Science.gov (United States)

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  2. rRNA operons and genome size of 'Candidatus Liberibacter americanus', a bacterium associated with citrus huanglongbing in Brazil.

    Science.gov (United States)

    Wulff, N A; Eveillard, S; Foissac, X; Ayres, A J; Bové, J-M

    2009-08-01

    Huanglongbing is one of the most severe diseases of citrus worldwide and is associated with 'Candidatus (Ca.) Liberibacter africanus' in Africa, 'Ca. Liberibacter asiaticus' in Asia and the Americas (Brazil, USA and Cuba) and 'Ca. Liberibacter americanus' (Lam) in Brazil. In the absence of axenic cultures, genetic information on liberibacters is scarce. The sequences of the entire 23S rRNA and 5S rRNA genes from Lam have now been obtained, using a consensus primer designed on known tRNAMet sequences of rhizobia. The size of the Lam genome was determined by PFGE, using Lam-infected periwinkle plants for bacterial enrichment, and was found to be close to 1.31 Mbp. In order to determine the number of ribosomal operons on the Lam genome, probes designed to detect the 16S rRNA gene and the 3' end of the 23S rRNA gene were developed and used for Southern hybridization with I-CeuI-treated genomic DNA. Our results suggest that there are three ribosomal operons in a circular genome. Lam is the first liberibacter species for which such data are available.

  3. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  4. Inter- and intraspecific genomic variability of the 16S-23S intergenic spacer regions (ISR) in representatives of Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans.

    Science.gov (United States)

    Ni, Yong-Qing; Yang, Yuan; Bao, Jing-Ting; He, Kai-Yu; Li, Hong-Yu

    2007-05-01

    The complete sequences of 32 intergenic spacer regions (ISR) from Acidithiobacillus strains, including 29 field strains isolated from coal, copper, molybdenum mine wastes or sediment of different geoclimatic regions in China, reference strain ATCC19859 and the type strains of the two species were determined. These data, together with other sequences available in the GenBank database, were used to carry out the first detailed assessment of the inter- and intraspecific genomic variability of the ISR sequences and to infer phylogenetic relationships within the genus. The total length of the 16S-23S rRNA intergenic spacer regions of the Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans strains ranged from 451 to 490 bp, and from 434 to 456 bp, respectively. The degree of intrageneric ISR sequence similarity was higher than the degree of intergeneric similarity, and the overall similarity values of the ISRs varied from 60.49% to 84.71% between representatives of different species of the genus Acidithiobacillus. Sequences from the spacer of the A. thiooxidans and A. ferrooxidans strains ranged from 86.71% to 99.56% and 92.36% to 100% similarity, respectively. All Acidithiobacillus strains were separated into three phylogenetic major clusters and seven phylogenetic groups. ISR may be a potential target for the development of in situ hybridization probe aimed at accurately detecting acidithiobacilli in the various acidic environments.

  5. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  6. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available -acting regulatory DNA elements Database kome_place_search_result.zip kome_place_search_result ... ...Nucleotide Analysis PLACE search result Result of signal search against PLACE : cis

  7. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against japon...ica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  8. Phylogenetic analysis of freshwater mussel corbicula regularis by 18s rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Magare V N

    2015-04-01

    Full Text Available Corbicula regularis is a freshwater mussel found in the Indian sub-continent. In the present study, phylogenetic characterization of this important bivalve was attempted using 18S ribosomal RNA gene markers. Genomic DNA was extracted and 18S rRNA gene was amplified by universal primers. The amplification product was sequenced and compared with the nucleotide databases available online to evaluate phylogenetic relationship of the animal under study. Results indicated that 18S rRNA gene sequences of C. regularis showed high degree of similarity to another freshwater mussel, C. fluminea. This work constitutes the first ever sequence deposition of the C. regularis in the nucleotide databases highlighting the usefulness of 18S ribosomal gene markers for phylogenetic analysis.

  9. The weak measurement process and the weak value of spin for metastable helium 23S1

    Science.gov (United States)

    Monachello, Vincenzo; Barker, Peter; Flack, Robert; Hiley, Basil

    2016-05-01

    An experiment is being designed and constructed in order to measure the weak value of spin for an atomic system. The principle of the ``weak measurement'' process was first proposed by Aharonov, Albert and Vaidman, and describes a scenario in which a system is weakly coupled to a pointer between well-defined pre- and post-selected states. This experiment will utilise a pulsed supersonic beam of spin-1 metastable Helium (He*) atoms in the 23S1 state. The spin of the pre-selected He* atoms will be weakly coupled to its centre-of-mass. During its flight, the atomic beam will be prepared in a desired quantum state and travel through two inhomogeneous magnets (weak and strong) which both comprise the ``weak measurement'' process. The deviation of the post-selected ms = + 1 state as measured using a micro-channel plate, phosphor screen and CCD camera setup will allow for the determination of the weak value of spin. This poster will report on the methods used and the experimental realisation.

  10. DNA Amplification and Nucleotide Sequence Determination of a Region of Mitochondrial DNA in the Sea Snake, Laticauda Semifasciata

    OpenAIRE

    Eguchi, Tomoko; Eguchi, Yukinori; Oshiro, Minoru; Asato, Tsuyoshi; Takei, Hiroshi; Nakashima, Yasutsugu

    1993-01-01

    We determined the nucleotide sequence of a region of the 12S ribosomal RNA (rRNA) gene in the mitochondrial DNA (mtDNA) of the sea snake, Laticauda semifasciata, using the polymerase chain reaction (PCR). We synthesized oligonucleotide primers according to the nucleotide sequence of human mt DNA 12S rRNA gene and found that the target sequence (386bp) of the sea snake mtDNA could be amplified with these primers. The nucleotide sequence of the amplified region of the sea snake mt DNA was deter...

  11. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    OpenAIRE

    Triman, K L; Peister, A; Goel, R A

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  12. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  13. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification and bri...

  14. A plasmid-coded and site-directed mutation in Escherichia coli 23S RNA that confers resistance to erythromycin

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1987-01-01

    Primer-directed mutagenesis was employed to introduce an A2058----G transition in plasmid-encoded Escherichia coli 23S RNA at a site that has been implicated, indirectly, in erythromycin binding. The mutation raises the growth tolerance of cells from 30 to 300 micrograms/ml of erythromycin, and c...

  15. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    Science.gov (United States)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  16. Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

    Science.gov (United States)

    Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

    2014-05-04

    The tomato (Solanum lycopersicum) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

  17. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    Science.gov (United States)

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  18. Phylogenetic diversity based on rrs, atpD, recA genes and 16S-23S intergenic sequence analyses of rhizobial strains isolated from Vicia faba and Pisum sativum in Peru.

    Science.gov (United States)

    Santillana, Nery; Ramírez-Bahena, Martha Helena; García-Fraile, Paula; Velázquez, Encarna; Zúñiga, Doris

    2008-03-01

    In this study 17 isolates from effective nodules of Vicia faba and Pisum sativum var. macrocarpum growing in different soils from Peru were isolated and characterized. The isolates, presenting 11 different RAPD profiles, were distributed in three groups on the basis of their 16S-RFLP patterns. The 16S rRNA gene sequences of strains from 16S-RFLP groups I, II and III were closely related (identities higher than 99.5%) to Rhizobium leguminosarum bv. trifolii DSM 30141 (=ATCC 14480), R. leguminosarum bv. viciae DSM 30132(T) and Rhizobium etli CFN42(T) (=USDA 9032(T)), respectively. The analysis of the 16S-23S intergenic spacer (ITS) and two housekeeping genes, atpD and recA, confirmed the identification of strains from group I, however those from groups II and III were phylogenetically divergent to strains DSM 30132(T) and CFN42(T). These results support the fact that the 16S rRNA gene is not adequate for identification at species level within genus Rhizobium and suggest the existence of putative new species within the phylogenetic group of R. leguminosarum. They also confirm the need of a taxonomic revision of R. leguminosarum since the reference strains of the three biovars included in this study are phylogenetically divergent according to their ITS, atpD and recA gene sequences.

  19. Differentiation of Closely Related Carnobacterium Food Isolates Based on 16S-23S Ribosomal DNA Intergenic Spacer Region Polymorphism

    OpenAIRE

    Kabadjova, Petia; Dousset, Xavier; Le Cam, Virginie; Prevost, Hervé

    2002-01-01

    A novel strategy for identification of Carnobacterium food isolates based on restriction fragment length polymorphism (RFLP) of PCR-amplified 16S-23S ribosomal intergenic spacer regions (ISRs) was developed. PCR amplification from all Carnobacterium strains studied always yielded three ISR amplicons, which were designated the small ISR (S-ISR), the medium ISR (M-ISR), and the large ISR (L-ISR). The lengths of these ISRs varied from one species to another. Carnobacterium divergens NCDO 2763T a...

  20. Molecular characterization of gap region in 28S rRNA molecules in brine shrimp Artemia parthenogenetica and planarian Dugesia japonica.

    Science.gov (United States)

    Sun, Shuhong; Xie, Hui; Sun, Yan; Song, Jing; Li, Zhi

    2012-04-01

    In most insects and some other protostomes, a small stretch of nucleotides can be removed from mature 28S rRNA molecules, which could create two 28S rRNA subunits (28Sα and 28Sβ). Thus, during electrophoresis, the rRNA profiles of these organisms may differ significantly from the standard benchmark since the two subunits co-migrate with the 18S rRNA. To understand the structure and mechanism of the atypical 28S rRNA molecule, partial fragments of 28Sα and 28Sβ in brine shrimp Artemia parthenogenetica and planarian Dugesia japonica were cloned using a modified technology based on terminal transferase. Alignment with the corresponding sequences of 28S rDNAs indicates that there are 41 nucleotides in A. parthenogenetica and 42 nucleotides in D. japonica absent from the mature rRNAs. The AU content of the gap sequences of D. japonica and A. parthenogenetica is high. Both the gaps may form stem-loop structure. In D. japonica a UAAU cleavage signal is identified in the loop, but it is absent in A. parthenogenetica. Thus, it is proposed that the gap processing of 28S rRNA was a late enzyme-dependent cleavage event in the rRNA maturational process based on the AU rich gap sequence and the formation of the stem-loop structure to expose the processing segment, while the deletion of the gap region would not affect the structure and function of the 28S rRNA molecule.

  1. Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates

    Science.gov (United States)

    Bar-Yaacov, Dan; Frumkin, Idan; Yashiro, Yuka; Schlesinger, Orr; Bieri, Philipp; Greber, Basil; Ban, Nenad; Zarivach, Raz; Alfonta, Lital; Pilpel, Yitzhak; Suzuki, Tsutomu; Mishmar, Dan

    2016-01-01

    The mitochondrial ribosome, which translates all mitochondrial DNA (mtDNA)-encoded proteins, should be tightly regulated pre- and post-transcriptionally. Recently, we found RNA-DNA differences (RDDs) at human mitochondrial 16S (large) rRNA position 947 that were indicative of post-transcriptional modification. Here, we show that these 16S rRNA RDDs result from a 1-methyladenosine (m1A) modification introduced by TRMT61B, thus being the first vertebrate methyltransferase that modifies both tRNA and rRNAs. m1A947 is conserved in humans and all vertebrates having adenine at the corresponding mtDNA position (90% of vertebrates). However, this mtDNA base is a thymine in 10% of the vertebrates and a guanine in the 23S rRNA of 95% of bacteria, suggesting alternative evolutionary solutions. m1A, uridine, or guanine may stabilize the local structure of mitochondrial and bacterial ribosomes. Experimental assessment of genome-edited Escherichia coli showed that unmodified adenine caused impaired protein synthesis and growth. Our findings revealed a conserved mechanism of rRNA modification that has been selected instead of DNA mutations to enable proper mitochondrial ribosome function. PMID:27631568

  2. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  3. Eukaryotic 5S rRNA biogenesis.

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2011-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. Copyright © 2011 John Wiley & Sons, Ltd.

  4. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  5. 16S and 23S plastid rDNA phylogenies of Prototheca species and their auxanographic phenotypes1

    Science.gov (United States)

    Ewing, Aren; Brubaker, Shane; Somanchi, Aravind; Yu, Esther; Rudenko, George; Reyes, Nina; Espina, Karen; Grossman, Arthur; Franklin, Scott

    2014-01-01

    Because algae have become more accepted as sources of human nutrition, phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied. This can help establish algal evolutionary relationships. Here, we compare Auxenochlorella protothecoides and 23 strains of Prototheca based on their complete 16S and partial 23S plastid rDNA sequences along with nutrient utilization (auxanographic) profiles. These data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships. PMID:25937672

  6. Development of a species-specific polymerase chain reaction assay for Gardnerella vaginalis

    NARCIS (Netherlands)

    A.F. van Belkum (Alex); A. Koeken (A.); A.M. Vandamme (Anne Mieke); M. van Esbroeck (M.); H. Goossens; J. Koopmans (J.); J.C. Kuijpers (Johan); E. Falsen (E.); W.G.V. Quint (Wim)

    1995-01-01

    textabstractThe nucleotide sequence of the region between the 16S and 23S rRNA genes of the facultative anaerobic bacteriumGardnerella vaginalishas been determined, together with the 5′ proximal 500 nucleotides of the 23S rRNA gene. Regions suited for the development of specific, probe-confirmable

  7. Development of a species-specific polymerase chain reaction assay for Gardnerella vaginalis

    NARCIS (Netherlands)

    A.F. van Belkum (Alex); A. Koeken (A.); A.M. Vandamme (Anne Mieke); M. van Esbroeck (M.); H. Goossens; J. Koopmans (J.); J.C. Kuijpers (Johan); E. Falsen (E.); W.G.V. Quint (Wim)

    1995-01-01

    textabstractThe nucleotide sequence of the region between the 16S and 23S rRNA genes of the facultative anaerobic bacteriumGardnerella vaginalishas been determined, together with the 5′ proximal 500 nucleotides of the 23S rRNA gene. Regions suited for the development of specific, probe-confirmable p

  8. Genetic Diversity in Populations of Sepiella maindroni Using 16S rRNA Gene Sequence Analysis

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Part of the 16S rRNA gene is amplified with PCR and sequenced for 5 populations of common Chinese cuttlefish Sepiella maindroni: three from the South China Sea, one from East China Sea and one from Japan. The result shows that a total of 5 nucleotide positions are found to have gaps or insertions of base pairs among these individuals, and 13 positions are examined to be variable in all the sequences, which range from 494 to 509 base pairs. All of the individuals are grouped into 7 haplotypes (h1-h7). No marked genetic difference is observed among those populations. All of the individuals from Nagasaki belong to h1 and the h3 haplotype is found only in the coastal waters of China. AG transition in Nucleotide 255 is suggested to be taken as a kind of genetic marker to identify the populations distributed in East-South China Sea and the Nagasaki waters of Japan.

  9. discussion on validity of rana maoershanensis based on partial sequence of 16s rrna gene

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    rana maoershanensis found in mt.maoershan in guangxi,china was reported as a new species in 2007,but there was no molecular data for this frog.the partial sequences (543 bp) of 16s rrna gene from 12 specimens of 3 brown frog species (rana hanluica,r.maoershanensis and r.chensinensis) were analyzed with 17 specimens of 9 species from genbank.the nucleotide sequence divergence between r.maoershanensis and the other brown frog species were 4.5%-6.5%,with 22-30 nucleotide substitutions at this locus.the phylogenetic relationships based on mp,ml,and bayesian inference indicate that the brown frogs from southern china were diverged into three groups (clades a,b and c).r.maoershanensis was clustered together a well-supported subclade (b-l).it is suggested that r.maoershanensis is a valid species.

  10. Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

    Science.gov (United States)

    Schnare, M N; Gray, M W

    1982-01-01

    In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

  11. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  12. Increased 5S rRNA oxidation in Alzheimer's disease.

    Science.gov (United States)

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  13. Differentiation of Acidithiobacillus ferrooxidans and A. thiooxidans strains based on 16S-23S rDNA spacer polymorphism analysis.

    Science.gov (United States)

    Bergamo, Rogério F; Novo, Maria Teresa M; Veríssimo, Ricardo V; Paulino, Luciana C; Stoppe, Nancy C; Sato, Maria Inês Z; Manfio, Gilson P; Prado, Paulo Inácio; Garcia, Oswaldo; Ottoboni, Laura M M

    2004-09-01

    Restriction fragment length polymorphism (RFLP) and sequence analyses of the PCR-amplified 16S-23S rDNA intergenic spacer (ITS) were used for differentiating Acidithiobacillus thiooxidans strains from other related acidithiobacilli, including A. ferrooxidans and A. caldus. RFLP fingerprints obtained with AluI, DdeI, HaeIII, HinfI and MspI enabled the differentiation of all Acidithiobacillus reference strains into species groups. The A. thiooxidans strains investigated (metal mine isolates) yielded identical RFLP patterns to the A. thiooxidans type strain (ATCC 19377(T)), except for strain DAMS, which had a distinct pattern for all enzymes tested. Fourteen A. ferrooxidans mine strains were assigned to 3 RFLP groups, the majority of which were grouped with A. ferrooxidans ATCC 23270(T). The spacer region of one representative strain from each of the RFLP groups obtained was subjected to sequence analysis, in addition to eleven additional A. thiooxidans strains isolated from sediment and water samples, and A. caldus DSM 8584(T). The tRNA(IIe) and tRNA(Ala) genes, present in all strains analyzed, showed high sequence similarity. Phylogenetic analysis of the ITS sequences differentiated all three Acidithiobacillus species. Inter- and infraspecific genetic variations detected were mainly due to the size and sequence polymorphism of the ITS3 region. Mantel tests showed no significant correlation between ITS sequence similarity and the geographical origin of strains. The results showed that the 16S-23S rDNA spacer region is a useful target for the development of molecular-based methods aimed at the detection, rapid differentiation and identification of acidithiobacilli.

  14. Structure of the bifunctional methyltransferase YcbY (RlmKL) that adds the m7G2069 and m2G2445 modifications in Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Wang, Kai-Tuo; Desmolaize, Benoit; Nan, Jie;

    2012-01-01

    to be fusions from two separate proteins found in Gram-positives. The crystal structures described here show that both the N- and C-terminal halves of E. coli YcbY have a methyltransferase active site and their folding patterns respectively resemble the Streptococcus mutans proteins Smu472 and Smu776. Mass...

  15. Evaluation of Borrelia real time PCR DNA targeting OspA, FlaB and 5S-23S IGS and Borrelia 16S rRNA RT-qPCR.

    Science.gov (United States)

    de Leeuw, Bertie H C G M; Maraha, Boulos; Hollemans, Leonie; Sprong, Hein; Brandenburg, Afke H; Westenend, Pieter J; Kusters, Johannes G

    2014-12-01

    Borrelia burgdorferi non-sensu lato (s.l.) strains occurred in the Netherlands. A multiplex OspA, FlaB, IGS real time PCR was compared to 16S rRNA/rDNA RT-qPCR with lower average Cycle threshold (Ct) and LOD on strain dilutions. Multiplexing increased sensitivity on CSF samples (n=74), distinguishing B. burgdorferi s.l. from non-s.l. strains. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences

    National Research Council Canada - National Science Library

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-01-01

    ...) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough...

  17. Evaluation of a fluorescence-labelled oligonucleotide tide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears

    DEFF Research Database (Denmark)

    Nordentoft, Steen; Christensen, H.; Wegener, Henrik Caspar

    1997-01-01

    -embedded tissue from experimentally infected mice or from animals with a history of clinical salmonellosis. In these tissue sections the probe hybridized specifically to Salmonella serovars, allowing for the detection of single bacterial cells. The development of a fluorescence-labelled specific oligonucleotide...

  18. Unusual features of the sequences of copies of the 16S-23S rRNA internal transcribed spacer regions of Acinetobacter bereziniae, Acinetobacter guillouiae and Acinetobacter baylyi arise from horizontal gene transfer events.

    Science.gov (United States)

    Maslunka, Christopher; Gürtler, Volker; Seviour, Robert

    2015-02-01

    The highly variable nature of the internal transcribed spacer region (ITS) has been claimed to represent an ideal target for designing species-specific probes/primers capable of differentiating between closely related Acinetobacter species. However, several Acinetobacter species contain multiple ITS copies of variable lengths, and these include Acinetobacter bereziniae, Acinetobacter guillouiae and Acinetobacter baylyi. This study shows these length variations result from inter-genomic insertion/deletion events (indels) involving horizontal transfer of ITS fragments of other Acinetobacter species and possibly unrelated bacteria, as shown previously by us. In some instances, indel incorporation results in the loss of probe target sites in the recipient cell ITS. In other cases, some indel sequences contain target sites for probes designed from a single ITS sequence to target other Acinetobacter species. Hence, these can generate false positives. The largest of the indels that remove probe sites is 683 bp (labelled bay/i1-0), and it derives from the horizontal transfer of a complete ITS between A. bereziniae BCRC15423(T) and A. baylyi strain ADP1. As a consequence, ITS sequencing or fingerprinting cannot be used to distinguish between the 683 bp ITS in these two strains.

  19. [Nucleotide receptors and renal function].

    Science.gov (United States)

    Jankowski, Maciej

    2014-01-01

    Kidney plays a key role in homeostasis of human body. It has heterogenic structure and is characterized by complicated vascular beds and numbers of sympathetic nerves endings. Nucleotides receptors are involved in the regulation of blood flow, a fundamental process for renal function. Plasma is filtrated in renal glomerulus and activity of nucleotides receptors located on cells of glomerular filter modifies the physi- cochemical properties of filter and affects the filtration process. Electrolytes, water and low molecular weight molecules are reabsorbed from tubular fluid or secreted into fluid in proximal and distal tubules. Glomerular filtration rate and activity of tubular processes are regulated via nucleotides receptors by glomerulotubularbalance and tubuloglomerular feedback. Nucleotides receptors are involved in systemic regulation of blood pressure and carbohydrate metabolism.

  20. Phylogeny of some mycoplasmas from ruminants based on 16S rRNA sequences and definition of a new cluster within the hominis group.

    Science.gov (United States)

    Pettersson, B; Uhlén, M; Johansson, K E

    1996-10-01

    Almost complete (> 96%) 16S rRNA sequences from nine ruminant mycoplasmas have been determined by solid-phase DNA sequencing. Polymorphisms were found in four of the 16S rRNA sequences, which indicated the existence of two different rRNA operons. Seven polymorphisms were found in Mycoplasma agalatiae, three were found in Mycoplasma bovis, one was found in Mycoplasma alkalescens, and one was found in Mycoplasma bovirhinis. The sequence data were used for construction of phylogenetic trees. All but one of the ruminant mycoplasmas sequenced in this work clustered in the hominis group. A close relationship was found between M. agalactiae and M. bovis, with a 99% nucleotide similarity between their 16S rRNA sequences. They were also found to be members of the Mycoplasma lipophilum cluster of the hominis group. Furthermore, the 16S rRNA comparisons showed that Mycoplasma alkalescens and Mycoplasma canadense are closely related (> 98.5%), and these species were found to cluster in the Mycoplasma hominis cluster of the hominis group. Interestingly, M. bovirhinis grouped in a new phylogenetic cluster of the hominis group. The new cluster, which was supported by bootstrap percentage values, signature nucleotide analysis, and higher-order structural elements, was named the Mycoplasma synoviae cluster. Mycoplasma bovoculi, Mycoplasma conjunctivae, and Mycoplasma ovipneumoniae clustered in the Mycoplasma neurolyticum cluster of the hominis group. Mycoplasma alvi clustered with Mycoplasma pirum in the M. pneumoniae cluster of the pneumoniae group.

  1. 23(S),25(R)-1,25-dihydroxyvitamin D3-26,23-lactone stimulates murine bone formation in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Shima, M.; Tanaka, H.; Norman, A.W.; Yamaoka, K.; Yoshikawa, H.; Takaoka, K.; Ishizuka, S.; Seino, Y. (Osaka Univ. School of Medicine (Japan))

    1990-02-01

    23(S),25(R)-1,25-Dihydroxyvitamin D3-26,23-lactone (1,25-lactone) has been shown to have unique actions different from those of 1,25-dihydroxyvitamin D3 (1,25-(OH)2D3). In contrast to 1,25-(OH)2D3, 1,25-lactone causes a significant reduction in the serum Ca2+ level, stimulates collagen production in an osteoblastic cell line, and inhibits bone resorption induced by 1,25-(OH)2D3. A possible effect of 1,25-lactone on bone formation was examined in experiments on ectopic bone formation using a bone-inducing factor derived from Dunn osteosarcomas. 1,25-Lactone, a metabolite of 1,25-(OH)2D3, increased (3H)proline uptake at the stage of chondrogenesis and {sup 85}Sr uptake during bone formation. Significantly enlarged bone was also induced by this compound 3 weeks after implantation. These results suggest that the 1,25-lactone may be able to stimulate bone formation under in vivo conditions.

  2. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    Science.gov (United States)

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  3. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

    Directory of Open Access Journals (Sweden)

    Jiazhen Chen

    Full Text Available Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported.The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains.Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72% had intragenomic nucleotide polymorphisms (SNPs in multiple locations, and 13 strains (9.4% had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89 and 100% (19/19 of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed.Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities

  4. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

    Science.gov (United States)

    Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

    2015-01-01

    Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the

  5. The final step in 5.8S rRNA processing is cytoplasmic in Saccharomyces cerevisiae.

    Science.gov (United States)

    Thomson, Emma; Tollervey, David

    2010-02-01

    The 18S rRNA component of yeast (Saccharomyces cerevisiae) 40S ribosomes undergoes cytoplasmic 3' cleavage following nuclear export, whereas exported pre-60S subunits were believed to contain only mature 5.8S and 25S rRNAs. However, in situ hybridization detected 3'-extended forms of 5.8S rRNA in the cytoplasm, which were lost when Crm1-dependent preribosome export was blocked by treatment with leptomycin B (LMB). LMB treatment rapidly blocked processing of 6S pre-rRNA to 5.8S rRNA, leading to TRAMP-dependent pre-rRNA degradation. The 6S pre-rRNA was coprecipitated with the 60S export adapter Nmd3 and cytoplasmic 60S synthesis factor Lsg1. The longer 5.8S+30 pre-rRNA (a form of 5.8S rRNA 3' extended by approximately 30 nucleotides) is processed to 6S by the nuclear exonuclease Rrp6, and nuclear pre-rRNA accumulated in the absence of Rrp6. In contrast, 6S to 5.8S processing requires the cytoplasmic exonuclease Ngl2, and cytoplasmic pre-rRNA accumulated in strains lacking Ngl2. We conclude that nuclear pre-60S particles containing the 6S pre-rRNA bind Nmd3 and Crm1 and are exported to the cytoplasm prior to final maturation by Ngl2.

  6. The Final Step in 5.8S rRNA Processing Is Cytoplasmic in Saccharomyces cerevisiae▿ †

    Science.gov (United States)

    Thomson, Emma; Tollervey, David

    2010-01-01

    The 18S rRNA component of yeast (Saccharomyces cerevisiae) 40S ribosomes undergoes cytoplasmic 3′ cleavage following nuclear export, whereas exported pre-60S subunits were believed to contain only mature 5.8S and 25S rRNAs. However, in situ hybridization detected 3′-extended forms of 5.8S rRNA in the cytoplasm, which were lost when Crm1-dependent preribosome export was blocked by treatment with leptomycin B (LMB). LMB treatment rapidly blocked processing of 6S pre-rRNA to 5.8S rRNA, leading to TRAMP-dependent pre-rRNA degradation. The 6S pre-rRNA was coprecipitated with the 60S export adapter Nmd3 and cytoplasmic 60S synthesis factor Lsg1. The longer 5.8S+30 pre-rRNA (a form of 5.8S rRNA 3′ extended by ∼30 nucleotides) is processed to 6S by the nuclear exonuclease Rrp6, and nuclear pre-rRNA accumulated in the absence of Rrp6. In contrast, 6S to 5.8S processing requires the cytoplasmic exonuclease Ngl2, and cytoplasmic pre-rRNA accumulated in strains lacking Ngl2. We conclude that nuclear pre-60S particles containing the 6S pre-rRNA bind Nmd3 and Crm1 and are exported to the cytoplasm prior to final maturation by Ngl2. PMID:20008552

  7. Analysis of the secondary structure of mitochondrial LSU rRNA of Peruvian land snails (Orthalicidae: Gastropoda

    Directory of Open Access Journals (Sweden)

    Jorge Ramirez Ramirez

    2011-05-01

    Full Text Available The alignment of ribosomal genes is difficult due to insertion and deletion events of nucleotides, making the alignment ambiguous. This can be overcome by using information from the secondary structure of ribosomal genes. The aim of this study was to evaluate the utility of the secondary structure in improving the alignment of the 16S rRNA gene in land snails of the family Orthalicidae. We assessed 10 Orthalicid species (five genera. Total DNA was isolated and the partial 16S rRNA gene was amplified and sequenced using internal primers. The sequences were aligned with ClustalX and manually corrected, in DCSE format, using the 16S rRNA secondary structure of Albinaria caerulea (Pulmonata: Clausiliidae. The sequences obtained ranged from 323 to 345 bp corresponding to parts of both domains IV and V of the 16S rRNA gene. The secondary structure was recovered by homology using RnaViz 2.0. Most stems are conserved, and in general the loops are more variable. The compensatory mutations in stems are related to maintenance of the structure. The absence of a bulge-stem-loop in domain V places the family Orthalicidae within the Heterobranchia.

  8. Sequence determination of rRNA genes of pathogenic Vibrio species and whole-cell identification of Vibrio vulnificus with rRNA-targeted oligonucleotide probes.

    Science.gov (United States)

    Aznar, R; Ludwig, W; Amann, R I; Schleifer, K H

    1994-04-01

    A comparative analysis of seven new 16S rRNA gene sequences of pathogenic Vibrio species with previously published vibrio sequences confirmed that Vibrio vulnificus represents a group that is not closely related to the core organisms of the genus Vibrio. In addition, we found that V. vulnificus, Listonella (Vibrio) anguillarum and Vibrio diazotrophicus branch off separately from the core group. A comparison of the 16S rRNA gene sequences of V. vulnificus strains belonging to biotypes 1 and 2 revealed that the sequences of all but four biotype 1 strains were identical to each other but slightly different (17 bases) from the sequences of the rest of the V. vulnificus strains investigated. In addition, the sequences of variable regions of the 23S rRNA genes of Vibrio fluvialis, Vibrio furnissii, Vibrio harveyi, Vibrio cholerae, and V. vulnificus C7184 and TW1 were determined, aligned, and compared with all available bacterial 23S rRNA sequences in order to search for specific target sites. As a result, four oligonucleotide probes specific for V. vulnificus were synthesized, and the specificities of these probes were evaluated by dot blot hybridization to membrane-bound RNAs from 21 V. vulnificus strains, 13 strains belonging to other Vibrio species, 61 strains belonging to species that are members of the alpha, beta, and gamma subclasses of the Proteobacteria, and 3 eucaryotic microorganisms. Two probes hybridized with all of the V. vulnificus strains tested, and the other two probes distinguished V. vulnificus biotype 1 strains from all other organisms. In situ identification of V. vulnificus by using tetramethylrhodamine- or fluorescein-labelled oligonucleotides is now possible.

  9. Phylogenetic study of Geitlerinema and Microcystis (Cyanobacteria) using PC-IGS and 16S-23S ITS as markers: investigation of horizontal gene transfer.

    Science.gov (United States)

    Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo

    2014-08-01

    Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria.

  10. Identification of new 18S rRNA strains of Babesia canis isolated from dogs with subclinical babesiosis.

    Science.gov (United States)

    Łyp, P; Adaszek, Ł; Furmaga, B; Winiarczyk, S

    2015-01-01

    In this study, we used PCR to detect and characterize B. canis from naturally infected dogs in Poland with subclinical babesiosis by amplifying and sequencing a portion of the 18S ribosomal RNA (rRNA) gene. Venous blood samples were collected from ten dogs with subclinical babesiosis. A 559-bp fragment of the B. canis 18S rRNA gene was amplified by PCR. Sequencing of the PCR products led to the identification of a new variant of Babesia canis, differing from the previously detected protozoa genotypes (18S rRNA-A and 18S rRNA-B) with nucleotide substitutions in positions 150 and 151 of the tested gene fragment. The results indicate the emergence within the Polish territory of a new, previously unencountered Babesia canis genotype responsible for the development of subclinical babesiosis.

  11. Corynebacterium glutamicum RNase E/G-type endoribonuclease encoded by NCgl2281 is involved in the 5' maturation of 5S rRNA.

    Science.gov (United States)

    Maeda, Tomoya; Wachi, Masaaki

    2012-02-01

    Corynebacterium glutamicum has one RNase E/G ortholog and one RNase J ortholog but no RNase Y. We previously reported that the C. glutamicum NCgl2281 gene encoding the RNase E/G ortholog complemented the rng::cat mutation in Escherichia coli but not the rne-1 mutation. In this study, we constructed an NCgl2281 knockout mutant and found that the mutant cells accumulated 5S rRNA precursor molecules. The processing of 16S and 23S rRNA, tRNA, and tmRNA was normal. Primer extension analysis revealed that the RNase E/G ortholog cleaved at the -1 site of the 5' end of 5S rRNA. However, 3' maturation was essentially unaffected. These findings showed that C. glutamicum NCgl2281 endoribonuclease is involved in the 5' maturation of 5S rRNA. This is the first report showing the physiological function of the RNase E/G ortholog in bacteria having one RNase E/G and one RNase J but no RNase Y.

  12. The Identification of Discriminating Patterns from 16S rRNA Gene to Generate Signature for Bacillus Genus.

    Science.gov (United States)

    More, Ravi P; Purohit, Hemant J

    2016-08-01

    The 16S ribosomal RNA (16S rRNA) gene has been widely used for the taxonomic classification of bacteria. A molecular signature is a set of nucleotide patterns, which constitute a regular expression that is specific to each particular taxon. Our main goal was to identify discriminating nucleotide patterns in 16S rRNA gene and then to generate signatures for taxonomic classification. To demonstrate our approach, we used the phylum Firmicutes as a model using representative taxa Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus (genus), according to their dominance at each hierarchical taxonomic level. We applied combined composite vector and multiple sequence alignment approaches to generate gene-specific signatures. Further, we mapped all the patterns into the different hypervariable regions of 16S rRNA gene and confirmed the most appropriate distinguishing region as V3-V4 for targeted taxa. We also examined the evolution in discriminating patterns of signatures across taxonomic levels. We assessed the comparative classification accuracy of signatures with other methods (i.e., RDP Classifier, KNN, and SINA). Results revealed that the signatures for taxa Bacilli, Bacillales, Bacillaceae, and Bacillus could correctly classify isolate sequences with sensitivity of 0.99, 0.97, 0.94, and 0.89, respectively, and specificity close to 0.99. We developed signature-based software DNA Barcode Identification (DNA BarID) for taxonomic classification that is available at website http://www.neeri.res.in/DNA_BarID.htm . This pattern-based study provides a deeper understanding of taxon-specific discriminating patterns in 16S rRNA gene with respect to taxonomic classification.

  13. Evolution of RNA editing sites in the mitochondrial small subunit rRNA of the Myxomycota.

    Science.gov (United States)

    Krishnan, Uma; Barsamian, Arpi; Miller, Dennis L

    2007-01-01

    Because of their unique and unprecedented character, it is often difficult to imagine how and why the different, diverse types of RNA editing have evolved. Information about the evolution of a particular RNA editing system can be obtained by comparing RNA editing characteristics in contemporary organisms whose phylogenetic relationships are known so that editing patterns in ancestral organisms can be inferred. This information can then be used to build models of the origins, constraints, variability, and mechanisms of RNA editing. As an example of the types of information that can be obtained from these analyses, we describe how we have used cDNA, covariation, and phylogenetic analyses to study the evolution of the variation in RNA editing site location in the core region of the small subunit rRNA gene in the mtDNA of seven myxomycetes, including Physarum polycephalum. We find that the unique type of insertional RNA editing present in mitochondria of P. polycephalum is also present in the mitochondrial small subunit (SSU) rRNA of the other six myxomycetes. As in Physarum, this editing predominantly consists of cytidine insertions, but also includes uridine insertions and certain dinucleotide insertions such that any of the four canonical ribonucleotides can be inserted. Although the characteristics of RNA editing in these organisms are the same as in Physarum, the location of the insertion sites varies among the seven organisms relative to the conserved primary sequence and secondary structure of the rRNA. Nucleotide insertions have been identified at 29 different sites within this core region of the rRNA, but no one organism has more than 10 of these insertion sites, suggesting that editing sites have been created and/or eliminated since the divergence of these organisms. To determine the order in which editing sites have been created or eliminated, the sequences of the mitochondrial SSU rRNA have been aligned and this alignment has been used to produce

  14. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  15. [Characterization of 5S rRNA gene sequence and secondary structure in gymnosperms].

    Science.gov (United States)

    Liu, Zhan-Lin; Zhang, Da-Ming; Wang, Xiao-Ru

    2003-01-01

    diploid hybrid between P. tabulaeformis and P. yunnanensis. Its 5S rDNA composition is consistent with its hybrid origin. 5S rRNA of all gymnosperms published so far could be folded into a general secondary structure. Variation in this secondary structure was detected among species. About 55% of the 120 bp nucleotide positions was variable, in which 68% was on stem regions. Nevertheless, the positions at the end of the stems and those adjacent to loops are conserved. Their stability directly determines the size of the loops. Some mutations such as compensatory base-pair substitutions, and G-U pairing could be regarded as mechanisms for maintaining a stable secondary structure. The loops of the secondary structure are also relatively conserved. It seems that stable helices are necessary for the function of the gene. The conserved nucleotides in the loops are probably involved in the interaction with proteins and/or RNAs or with other nucleotide in the formation of the tertiary structure. However, unlike other reports, Loop E was found quite mutable among pines. These variations together with those on stems might be caused by the presence of pseudogenes among our clones. A preliminary evaluation indicates that only seven of 50 unique sequences are potentially functional genes.

  16. Two genetic clusters in swine hemoplasmas revealed by analyses of the 16S rRNA and RNase P RNA genes.

    Science.gov (United States)

    Watanabe, Yusaku; Fujihara, Masatoshi; Obara, Hisato; Nagai, Kazuya; Harasawa, Ryô

    2011-12-01

    Only two hemoplasma species, Eperythrozoon parvum and Mycoplasma suis, have been recognized in pigs. Here we demonstrate the genetic variations among six hemoplasma strains detected from pigs, by analyzing the 16S rRNA and RNase P RNA (rnpB) genes, and propose a novel hemoplasma taxon that has not been described previously. Phylogenetic trees based on the nucleotide sequence of the 16S rRNA gene indicated that these six hemoplasmas were divided into two clusters representing M. suis and a novel taxon. We further examined the primary and secondary structures of the nucleotide sequences of the rnpB gene of the novel taxon, and found it distinct from that of M. suis. In conclusion, we unveiled a genetic cluster distinct from M. suis, suggesting a new swine hemoplasma species or E. parvum. Our findings also suggest that this novel cluster should be included in the genus Mycoplasma.

  17. PHYLOGENETIC STATUS OF BABYLONIA ZEYLANICA (FAMILY BABYLONIIDAE BASED ON 18S rRNA GENE FRAGMENT

    Directory of Open Access Journals (Sweden)

    Vaithilingam RAVITCHANDIRANE

    2013-12-01

    Full Text Available Neogastropoda, highly diversed group of predatory marine snails, often been confused by shell colour and design pattern for identification. Gastropod resources which became economically important in India during the last decade are the whelk. The species Babylonia zeylanica of the family Babyloniidae began to be fished and exported from the country to China, Singapore, Thailand and Europe. This paper reports the molecular study of the group published to date with eight families of neogastropod taxa. For this study the 18S rRNA gene of B. zeylanica and other published data were collected from the GenBank. Kimura-2-Parameter genetic distance, nucleotide composition and neighbour joining analyses were conducted in all the eight families. The result clearly shows that Babyloniidae is clustered closely with Columbellidae of super family of Buccinoidea. Further additional gene data and increased sampling is warranted to give new insights into the phylogenetic relationships of Neogastropoda.

  18. Fluorescence spectroscopic study of the interaction of adenine and nucleotide with trichosanthin.

    Science.gov (United States)

    Hao, Q; Zhang, Y; Yang, H; Liu, G; Huang, Z; Liu, B; Yao, Q; Li, Q

    1995-07-01

    Trichosanthin (TCS) is an N-glycosidase that can attack the 28s rRNA of the ribosome at a highly conserved adenine residue. The interactions of adenine and its derivative nucleotides with TCS are reported. The fluorescence of Trp 192 of TCS is sensitive to the proximity of adenine, and produces a marked red shift indicative of trytophan in a more hydrophilic environment. By contrast AMP and ATP quench the maximal emission at 328nm. The binding of the adenine and ATP with TCS result in lower tryptophan accessibility to the quencher acrylamide, but higher tryptophan accessibility to the quencher iodide, while AMP caused higher tryptophan accessibility to acrylamide, and lower tryptophan accessibility to iodide. Also, the binding of nucleotides induces tryptophan heterogeneity in the protein. These findings lead us to propose that binding of nucleotides and adenine base cause different microenvironmental changes of the tryptophan residue, and Trp 192 may be involved in the active site of TCS.

  19. Specific detection of Serpulina hyodysenteriae and potentially pathogenic weakly beta-haemolytic porcine intestinal spirochetes by polymerase chain reaction targeting 23S rDNA

    DEFF Research Database (Denmark)

    Leser, Thomas; Møller, Kristian; Jensen, Tim Kåre;

    1997-01-01

    A 2470-bp section of the 23S ribosomal DNA from Serpulina hyodysenteriae and five biochemical ly different groups of weakly beta-haemolytic porcine intestinal Serpulina strains was sequenced. The similarity between the sequenced strains was high (96.85% to 99.84%). A phylogenetic tree was estimat...

  20. Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3'-Terminal Fragment of 16S rRNA in E. coli.

    Science.gov (United States)

    Golovin, A V; Khayrullina, G A; Kraal, B; Kopylov, Capital A Cyrillic М

    2012-10-01

    For prokaryotes in vitro, 16S rRNA and 20 ribosomal proteins are capable of hierarchical self- assembly yielding a 30S ribosomal subunit. The self-assembly is initiated by interactions between 16S rRNA and three key ribosomal proteins: S4, S8, and S7. These proteins also have a regulatory function in the translation of their polycistronic operons recognizing a specific region of mRNA. Therefore, studying the RNA-protein interactions within binary complexes is obligatory for understanding ribosome biogenesis. The non-conventional RNA-protein contact within the binary complex of recombinant ribosomal protein S7 and its 16S rRNA binding site (236 nucleotides) was identified. UV-induced RNA-protein cross-links revealed that S7 cross-links to nucleotide U1321 of 16S rRNA. The careful consideration of the published RNA- protein cross-links for protein S7 within the 30S subunit and their correlation with the X-ray data for the 30S subunit have been performed. The RNA - protein cross-link within the binary complex identified in this study is not the same as the previously found cross-links for a subunit both in a solution, and in acrystal. The structure of the binary RNA-protein complex formed at the initial steps of self-assembly of the small subunit appears to be rearranged during the formation of the final structure of the subunit.

  1. Formation of Tertiary Interactions during rRNA GTPase Center Folding.

    Science.gov (United States)

    Rau, Michael J; Welty, Robb; Tom Stump, W; Hall, Kathleen B

    2015-08-28

    The 60-nt GTPase center (GAC) of 23S rRNA has a phylogenetically conserved secondary structure with two hairpin loops and a 3-way junction. It folds into an intricate tertiary structure upon addition of Mg(2+) ions, which is stabilized by the L11 protein in cocrystal structures. Here, we monitor the kinetics of its tertiary folding and Mg(2+)-dependent intermediate states by observing selected nucleobases that contribute specific interactions to the GAC tertiary structure in the cocrystals. The fluorescent nucleobase 2-aminopurine replaced three individual adenines, two of which make long-range stacking interactions and one that also forms hydrogen bonds. Each site reveals a unique response to Mg(2+) addition and temperature, reflecting its environmental change from secondary to tertiary structure. Stopped-flow fluorescence experiments revealed that kinetics of tertiary structure formation upon addition of MgCl2 are also site specific, with local conformational changes occurring from 5 ms to 4s and with global folding from 1 to 5s. Site-specific substitution with (15)N-nucleobases allowed observation of stable hydrogen bond formation by NMR experiments. Equilibrium titration experiments indicate that a stable folding intermediate is present at stoichiometric concentrations of Mg(2+) and suggest that there are two initial sites of Mg(2+) ion association.

  2. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  3. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

    Science.gov (United States)

    Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

    2017-01-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

  4. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species wer...

  5. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    Science.gov (United States)

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J.; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I–V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC. PMID:27749897

  6. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria.

    Science.gov (United States)

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I-V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC.

  7. hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0

    Science.gov (United States)

    Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej

    2015-01-01

    Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5′-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site. PMID:26237581

  8. Identiifcation of pathogenic microorganism by sequencing 16S rRNA gene%16S rRNA基因序列分析法鉴定病原细菌

    Institute of Scientific and Technical Information of China (English)

    朱飞舟; 陈利玉; 陈汉春

    2013-01-01

    目的:运用16S rRNA 基因序列分析法鉴定14种细菌,为该方法的临床应用奠定基础。方法:提取细菌DNA,采用通用引物PCR扩增16S rRNA 基因片段并测序。将测序结果用Blastn 在线软件在Nucleotide 数据库中进行序列同源性比对,根据序列同源性鉴定病原细菌。结果:12种细菌可以鉴定到“种”,2种细菌可以鉴定到“属”。结论:16S rRNA 基因序列分析是一种有效的病原细菌鉴定方法。%Objective: To identify 14 bacteria by sequencing the 16S rRNA gene and establish the basis for clinical application in the future. Methods: DNA samples of the 14 bacteria were extracted. The 16S rRNA genes were amplified by PCR and sequenced with common primers. The sequences of the 16S rRNA genes were aligned by online software Blastn in nucleotide database. The bacteria were identified according to the homology of their 16S rRNA genes. Results: Twelve bacteria were classified to species, the other 2 bacteria were classified to genus. Conclusion: 16S rRNA gene sequence analysis is useful in identifying pathogenic bacteria.

  9. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua; (NCI)

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  10. European Nucleotide Archive in 2016

    Science.gov (United States)

    Toribio, Ana Luisa; Alako, Blaise; Amid, Clara; Cerdeño-Tarrága, Ana; Clarke, Laura; Cleland, Iain; Fairley, Susan; Gibson, Richard; Goodgame, Neil; ten Hoopen, Petra; Jayathilaka, Suran; Kay, Simon; Leinonen, Rasko; Liu, Xin; Martínez-Villacorta, Josué; Pakseresht, Nima; Rajan, Jeena; Reddy, Kethi; Rosello, Marc; Silvester, Nicole; Smirnov, Dmitriy; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy

    2017-01-01

    The European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena) offers a rich platform for data sharing, publishing and archiving and a globally comprehensive data set for onward use by the scientific community. With a broad scope spanning raw sequencing reads, genome assemblies and functional annotation, the resource provides extensive data submission, search and download facilities across web and programmatic interfaces. Here, we outline ENA content and major access modalities, highlight major developments in 2016 and outline a number of examples of data reuse from ENA. PMID:27899630

  11. Phase Transition and EOS of Marmatite (Zn0.76Fe0.23S) up to 623 K and 17 Gpa

    Institute of Scientific and Technical Information of China (English)

    JIANG Xi; ZHOU Wen-Ge; XIE Hong-Sen; LIU Yong-Gang; FAN Da-Wei; LIU Jing; LI Yan-Chun; LUO Chong-Ju; MA Mai-Ning

    2007-01-01

    @@ In situ energy dispersive x-ray diffraction for natural marmatite (Zn0.76Fe0.23S) is performed up to 17.7 GPa and 623K. It is fitted by the Birch-Murnaghan equation of state (EOS) that K0 and α0 for marmatite are 85(3)GPa and 0. 79(16)× 10-4 K-1, respectively.

  12. Nucleotide composition of CO1 sequences in Chelicerata (Arthropoda): detecting new mitogenomic rearrangements.

    Science.gov (United States)

    Arabi, Juliette; Judson, Mark L I; Deharveng, Louis; Lourenço, Wilson R; Cruaud, Corinne; Hassanin, Alexandre

    2012-02-01

    Here we study the evolution of nucleotide composition in third codon-positions of CO1 sequences of Chelicerata, using a phylogenetic framework, based on 180 taxa and three markers (CO1, 18S, and 28S rRNA; 5,218 nt). The analyses of nucleotide composition were also extended to all CO1 sequences of Chelicerata found in GenBank (1,701 taxa). The results show that most species of Chelicerata have a positive strand bias in CO1, i.e., in favor of C nucleotides, including all Amblypygi, Palpigradi, Ricinulei, Solifugae, Uropygi, and Xiphosura. However, several taxa show a negative strand bias, i.e., in favor of G nucleotides: all Scorpiones, Opisthothelae spiders and several taxa within Acari, Opiliones, Pseudoscorpiones, and Pycnogonida. Several reversals of strand-specific bias can be attributed to either a rearrangement of the control region or an inversion of a fragment containing the CO1 gene. Key taxa for which sequencing of complete mitochondrial genomes will be necessary to determine the origin and nature of mtDNA rearrangements involved in the reversals are identified. Acari, Opiliones, Pseudoscorpiones, and Pycnogonida were found to show a strong variability in nucleotide composition. In addition, both mitochondrial and nuclear genomes have been affected by higher substitution rates in Acari and Pseudoscorpiones. The results therefore indicate that these two orders are more liable to fix mutations of all types, including base substitutions, indels, and genomic rearrangements.

  13. Nucleotide Metabolism and DNA Replication.

    Science.gov (United States)

    Warner, Digby F; Evans, Joanna C; Mizrahi, Valerie

    2014-10-01

    The development and application of a highly versatile suite of tools for mycobacterial genetics, coupled with widespread use of "omics" approaches to elucidate the structure, function, and regulation of mycobacterial proteins, has led to spectacular advances in our understanding of the metabolism and physiology of mycobacteria. In this article, we provide an update on nucleotide metabolism and DNA replication in mycobacteria, highlighting key findings from the past 10 to 15 years. In the first section, we focus on nucleotide metabolism, ranging from the biosynthesis, salvage, and interconversion of purine and pyrimidine ribonucleotides to the formation of deoxyribonucleotides. The second part of the article is devoted to DNA replication, with a focus on replication initiation and elongation, as well as DNA unwinding. We provide an overview of replication fidelity and mutation rates in mycobacteria and summarize evidence suggesting that DNA replication occurs during states of low metabolic activity, and conclude by suggesting directions for future research to address key outstanding questions. Although this article focuses primarily on observations from Mycobacterium tuberculosis, it is interspersed, where appropriate, with insights from, and comparisons with, other mycobacterial species as well as better characterized bacterial models such as Escherichia coli. Finally, a common theme underlying almost all studies of mycobacterial metabolism is the potential to identify and validate functions or pathways that can be exploited for tuberculosis drug discovery. In this context, we have specifically highlighted those processes in mycobacterial DNA replication that might satisfy this critical requirement.

  14. Diversity of 18S rRNA Gene of 19 Wild Herbage Germplasms%19种野生牧草种质资源18S rRNA 基因的多态性

    Institute of Scientific and Technical Information of China (English)

    武玉祥; 田兵; 王啸; 陈彬; 冉雪琴; 王嘉福

    2014-01-01

    为了开发牧草资源,对贵州部分野生草本植物种质资源的遗传多样性进行研究。根据模式植物拟南芥18S rRNA 基因序列设计特异性引物,对贵州大学农场试验田自然生长的19种野生草本植物的18S rRNA 基因序列进行扩增、测序、构建进化树。结果表明:将获得的1000 bp 左右的 DNA 片段测序进行同源比对,共找到2280个碱基变异位点,分布在8个区段。据各样本18S rRNA 基因的遗传距离构建进化树推测,菊科、苋科和藜科之间存在较近的遗传相似性,豆科中三叶草属与豌豆属之间有较近的遗传距离。%In order to explore forage resource,the genetic diversity of 18 S rRNA gene in 19 kinds of wild herb germplasms were investigated,which were collected from the farm of Guizhou Unversity.The results showed that about 1000 bp fragments of 18 S rRNA genes were amplificated using specific primers based on the gene of Arabidopsis thaliana.After sequencing and homologous comparison,a total of 2 280 nucleotides were found out to be polymorphim sites.Phylogenetic tree of each family were constructed by similarity of 18S rRNA gene.The molecular classification of 19 kinds of wild herbs was consistent with its category based on morphological characteristics.Furthermore,the molecular classification could be useful to distinguish those similar species in morphology, and the genetic data suggested a close genetic relationship in three families,Compositae,Amaranthaceae and Chenopodiaceae.Trifolium and Pisum might share a high genetic similarty with each other.

  15. Typification of virulent and low virulence Babesia bigemina clones by 18S rRNA and rap-1c.

    Science.gov (United States)

    Thompson, C; Baravalle, M E; Valentini, B; Mangold, A; Torioni de Echaide, S; Ruybal, P; Farber, M; Echaide, I

    2014-06-01

    The population structure of original Babesia bigemina isolates and reference strains with a defined phenotypic profile was assessed using 18S rRNA and rap-1c genes. Two reference strains, BbiS2P-c (virulent) and BbiS1A-c (low virulence), were biologically cloned in vitro. The virulence profile of the strains and clones was assessed in vivo. One fully virulent and one low-virulence clone were mixed in identical proportions to evaluate their growth efficiency in vitro. Each clone was differentiated by two microsatellites and the gene gp45. The 18S rRNA and rap-1c genes sequences from B. bigemina biological clones and their parental strains, multiplied exclusively in vivo or in vitro, were compared with strain JG-29. The virulence of clones derived from the BbiS2P-c strain was variable. Virulent clone Bbi9P1 grew more efficiently in vitro than did the low-virulence clone Bbi2A1. The haplotypes generated by the nucleotide polymorphism, localized in the V4 region of the 18S rRNA, allowed the identification of three genotypes. The rap-1c haplotypes allowed defining four genotypes. Parental and original strains were defined by multiple haplotypes identified in both genes. The rap-1c gene, analyzed by high-resolution melting (HRM), allowed discrimination between two genotypes according to their phenotype, and both were different from JG-29. B. bigemina biological clones made it possible to define the population structure of isolates and strains. The polymorphic regions of the 18S rRNA and rap-1c genes allowed the identification of different subpopulations within original B. bigemina isolates by the definition of several haplotypes and the differentiation of fully virulent from low virulence clones.

  16. Structural diversity of eukaryotic 18S rRNA and its impact on alignment and phylogenetic reconstruction.

    Science.gov (United States)

    Xie, Qiang; Lin, Jinzhong; Qin, Yan; Zhou, Jianfu; Bu, Wenjun

    2011-02-01

    Ribosomal RNAs are important because they catalyze the synthesis of peptides and proteins. Comparative studies of the secondary structure of 18S rRNA have revealed the basic locations of its many length-conserved and length-variable regions. In recent years, many more sequences of 18S rDNA with unusual lengths have been documented in GenBank. These data make it possible to recognize the diversity of the secondary and tertiary structures of 18S rRNAs and to identify the length-conserved parts of 18S rDNAs. The longest 18S rDNA sequences of almost every known eukaryotic phylum were included in this study. We illustrated the bioinformatics-based structure to show that, the regions that are more length-variable, regions that are less length-variable, the splicing sites for introns, and the sites of A-minor interactions are mostly distributed in different parts of the 18S rRNA. Additionally, this study revealed that some length-variable regions or insertion positions could be quite close to the functional part of the 18S rRNA of Foraminifera organisms. The tertiary structure as well as the secondary structure of 18S rRNA can be more diverse than what was previously supposed. Besides revealing how this interesting gene evolves, it can help to remove ambiguity from the alignment of eukaryotic 18S rDNAs and to improve the performance of 18S rDNA in phylogenetic reconstruction. Six nucleotides shared by Archaea and Eukaryota but rarely by Bacteria are also reported here for the first time, which might further support the supposed origin of eukaryote from archaeans.

  17. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    Science.gov (United States)

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product.

  18. Single nucleotide markers of D-loop for identification of Indian wild pig (Sus scrofa cristatus)

    OpenAIRE

    Gaurav Kumar Srivastava; Nidhi Rajput; Kajal Kumar Jadav; Avadh Bihari Shrivastav; Himanshu R. Joshi

    2015-01-01

    Aim: Partial fragment of D-loop region extending from 35 to 770 were compared with corresponding sequences of 16 wild pigs and 9 domestic pig breeds from different parts of the world for detection of single nucleotide polymorphism (SNP) markers in the region. The paper also reappraises SNP markers from two fragments of cytochrome b gene and a fragment 12S rRNA gene distinguishing the Indian wild pig from other pig species of the world. Materials and Methods: Deoxyribonucleic acid (DNA) was is...

  19. Interaction of ribosomal proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA.

    Science.gov (United States)

    Stern, S; Powers, T; Changchien, L M; Noller, H F

    1988-06-20

    We have examined the effects of assembly of ribosomal proteins S5, S6, S11, S12, S18 and S21 on the reactivities of residues in 16 S rRNA towards chemical probes. The results show that S6, S18 and S11 interact with the 690-720 and 790 loop regions of 16 S rRNA in a highly co-operative manner, that is consistent with the previously defined assembly map relationships among these proteins. The results also indicate that these proteins, one of which (S18) has previously been implicated as a component of the ribosomal P-site, interact with residues near some of the recently defined P-site (class II tRNA protection) nucleotides in 16 S rRNA. In addition, assembly of protein S12 has been found to result in the protection of residues in both the 530 stem/loop and the 900 stem regions; the latter group is closely juxtaposed to a segment of 16 S rRNA recently shown to be protected from chemical probes by streptomycin. Interestingly, both S5 and S12 appear to protect, to differing degrees, a well-defined set of residues in the 900 stem/loop and 5'-terminal regions. These observations are discussed in terms of the effects of S5 and S12 on streptomycin binding, and in terms of the class III tRNA protection found in the 900 stem of 16 S rRNA. Altogether these results show that many of the small subunit proteins, which have previously been shown to be functionally important, appear to be associated with functionally implicated segments of 16 S rRNA.

  20. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei.

  1. Detection of two Bartonella tamiae-like sequences in Amblyomma americanum (Acari: Ixodidae) using 16S-23S intergenic spacer region-specific primers.

    Science.gov (United States)

    Billeter, Sarah A; Miller, Melissa K; Breitschwerdt, Edward B; Levy, Michael G

    2008-01-01

    Four hundred and sixty-six questing Amblyomma americanum (L.) (Acari: Ixodidae) from Carolina County, VA, and 98 questing A. americanum from Chatham County, NC, were screened by polymerase chain reaction (PCR) for the Bartonella 16S-23S intergenic spacer region. Two amplicons, approximately 270-280 bp, were detected in two ticks from Virginia. Based upon PCR and sequencing, an adult male and adult female tick harbored DNA sequences closely related to Bartonella tamiae (DQ395180). Bartonella DNA was not detected in A. americanum from North Carolina. Potential transmission of Bartonella spp. by A. americanum should be the focus of future experimental studies.

  2. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  3. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-02-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  4. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Directory of Open Access Journals (Sweden)

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  5. Phylogeny and evolutionary genetics of Frankia strains based on 16S rRNA and nifD-K gene sequences.

    Science.gov (United States)

    Mishra, Arun Kumar; Singh, Pawan Kumar; Singh, Prashant; Singh, Anumeha; Singh, Satya Shila; Srivastava, Amrita; Srivastava, Alok Kumar; Sarma, Hridip Kumar

    2015-08-01

    16S rRNA and nifD-nifK sequences were used to study the molecular phylogeny and evolutionary genetics of Frankia strains isolated from Hippöphae salicifolia D. Don growing at different altitudes (ecologically classified as riverside and hillside isolates) of the Eastern Himalayan region of North Sikkim, India. Genetic information for the small subunit rRNA (16S rRNA) revealed that the riverside Frankia isolates markedly differed from the hillside isolates suggesting that the riverside isolates are genetically compact. Further, for enhanced resolutions, the partial sequence of nifD (3' end), nifK (5' end) and nifD-K IGS region have been investigated. The sequences obtained, failed to separate riverside isolates and hillside isolates, thus suggesting a possible role of genetic transfer events either from hillside to riverside or vice versa. The evolutionary genetic analyses using evogenomic extrapolations of gene sequence data obtained from 16S rRNA and nifD-K provided differing equations with the pace of evolution being more appropriately, intermediate. Values of recombination frequency (R), nucleotide diversity per site (Pi), and DNA divergence estimates supported the existence of an intermixed zone where spatial isolations occurred in sync with the temporal estimates. J. Basic Microbiol. 2015, 54, 1-9.

  6. Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

    Science.gov (United States)

    Röder, Christoph; König, Helmut; Fröhlich, Jürgen

    2007-09-01

    Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

  7. Complete nucleotide sequences of two adjacent early vaccinia virus genes located within the inverted terminal repetition.

    Science.gov (United States)

    Venkatesan, S; Gershowitz, A; Moss, B

    1982-11-01

    The proximal part of the 10,000-base pair (bp) inverted terminal repetition of vaccinia virus DNA encodes at least three early mRNAs. A 2,236-bp segment of the repetition was sequenced to characterize two of the genes. This task was facilitated by constructing a series of recombinants containing overlapping deletions; oligonucleotide linkers with synthetic restriction sites provided points for radioactive labeling before sequencing by the chemical degradation method of Maxam and Gilbert (Methods Enzymol. 65:499-560, 1980). The ends of the transcripts were mapped by hybridizing labeled DNA fragments to early viral RNA and resolving nuclease S1-protected fragments in sequencing gels, by sequencing cDNA clones, and from the lengths of the RNAs. The nucleotide sequences for at least 60 bp upstream of both transcriptional initiation sites are more than 80% adenine . thymine rich and contain long runs of adenines and thymines with some homology to procaryotic and eucaryotic consensus sequences. The gene transcribed in the rightward direction encodes an RNA of approximately 530 nucleotides with a single open reading frame of 420 nucleotides. Preceding the first AUG, there is a heptanucleotide that can hybridize to the 3' end of 18S rRNA with only one mismatch. The derived amino acid sequence of the protein indicated a molecular weight of 15,500. The gene transcribed in the leftward direction encodes an RNA 1,000 to 1,100 nucleotides long with an open reading frame of 996 nucleotides and a leader sequence of only 5 to 6 nucleotides. The derived amino acid sequence of this protein indicated a molecular weight of 38,500. The 3' ends of the two transcripts were located within 100 bp of each other. Although there are adenine . thymine-rich clusters near the putative transcriptional termination sites, specific AATAAA polyadenylic acid signal sequences are absent.

  8. Sublingual nucleotides and immune response to exercise

    Directory of Open Access Journals (Sweden)

    Ostojic Sergej M

    2012-07-01

    Full Text Available Abstract Evidence exists regarding the potential role of exogenous nucleotides as regulators of the immune function in physically active humans, yet the potential use of nucleotides has been hindered by their low bioavailability after oral administration. We conducted a double-blind, placebo-controlled, randomized trial to assess the effect of sublingual nucleotides (50 mg/day on salivary and serum immunity indicators as compared to placebo, both administered to healthy males aged 20 to 25 years for 14 days. Sublingual administration of nucleotides for 14 days increased serum immunoglobulin A, natural killer cells count and cytotoxic activity, and offset the post-exercise drop of salivary immunoglobulins and lactoferrin (P  0.05. It seems that sublingual administration of nucleotides for two weeks considerably affected immune function in healthy males.

  9. Phylogenetic relationships among Linguatula serrata isolates from Iran based on 18S rRNA and mitochondrial cox1 gene sequences.

    Science.gov (United States)

    Ghorashi, Seyed Ali; Tavassoli, Mousa; Peters, Andrew; Shamsi, Shokoofeh; Hajipour, Naser

    2016-01-01

    The phylogenetic relationships among seven Linguatula serrata (L. serrata) isolates collected from cattle, goats, sheep, dogs and camels in different geographical locations of Iran were investigated using partial 18S ribosomal RNA (rRNA) and partial mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequences. The nucleotide sequences were analysed in order to determine the phylogenetic relationships between the isolates. Higher sequence diversity and intraspecies variation was observed in the cox1 gene compared to 18S rRNA sequences. Phylogenetic analysis of the cox1 gene placed all L. serrata isolates in a sister clade to L. arctica. The Mantel regression analysis revealed no association between genetic variations and host species or geographical location, perhaps due to the small sample size. However, genetic variations between L. serrata isolates in Iran and those isolated in other parts of the world may exist and could reveal possible evolutionary relationships.

  10. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    Science.gov (United States)

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics

    Directory of Open Access Journals (Sweden)

    Zhou Jianjin

    2011-01-01

    Full Text Available Abstract Background Aminoglycoside ototoxicity is one of the common health problems. Mitochondrial 12S rRNA mutations are one of the important causes of aminoglycoside ototoxicity. However, the incidences of 12S rRNA mutations associated with aminoglycoside ototoxicity are less known. Methods A total of 440 Chinese pediatric hearing-impaired subjects were recruited from two otology clinics in the Ningbo and Wenzhou cities of Zhejiang Province, China. These subjects underwent clinical, genetic evaluation and molecular analysis of mitochondrial 12S rRNA. Resultant mtDNA variants were evaluated by structural and phylogenetic analysis. Results The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years, with the median age of 9 years. Ninety-eight subjects (58 males and 40 females had a history of exposure to aminoglycosides, accounting for 22.3% cases of hearing loss in this cohort. Molecular analysis of 12S rRNA gene identified 41 (39 known and 2 novel variants. The incidences of the known deafness-associated 1555A > G, 1494C > T and 1095T > C mutations were 7.5%, 0.45% and 0.91% in this entire hearing-impaired subjects, respectively, and 21.4%, 2% and 2% among 98 subjects with aminoglycoside ototoxicity, respectively. The structural and phylogenetic evaluations showed that a novel 747A > G variant and known 839A > G, 1027A > G, 1310C > T and 1413T > C variants conferred increased sensitivity to aminoglycosides or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants were polymorphisms. Of 44 subjects carrying one of definite or putative deafness-related 12S rRNA variants, only one subject carrying the 1413T > C variant harbored the 235DelC/299DelAT mutations in the GJB2 gene, while none of mutations in GJB2 gene was detected in other 43 subjects. Conclusions Mutations in mitochondrial 12S rRNA

  12. Species radiation by DNA replication that systematically exchanges nucleotides?

    Science.gov (United States)

    Seligmann, Hervé

    2014-12-21

    RNA and DNA syntheses share many properties. Therefore, the existence of 'swinger' RNAs, presumed 'orphan' transcripts matching genomic sequences only if transcription systematically exchanged nucleotides, suggests replication producing swinger DNA. Transcripts occur in many short-lived copies, the few cellular DNA molecules are long-lived. Hence pressures for functional swinger DNAs are greater than for swinger RNAs. Protein coding properties of swinger sequences differ from original sequences, suggesting rarity of corresponding swinger DNA. For genes producing structural RNAs, such as tRNAs and rRNAs, three exchanges (AT, CG and AT+CG) conserve self-hybridization properties. All nuclear eukaryote swinger DNA sequences detected in GenBank are for rRNA genes assuming AT+CG exchanges. In brachyuran crabs, 25 species had AT+CG swinger 18S rDNA, all matching the reverse-exchanged version of regular 18S rDNA of a related species. In this taxon, swinger replication of 18S rDNA apparently associated with, or even resulted in species radiation. AT+CG transformation doesn't invert sequence direction, differing from inverted repeats. Swinger repeats (detectable only assuming swinger transformations, AT+CG swinger repeats most frequent) within regular human rRNAs, independently confirm swinger polymerizations for most swinger types. Swinger replication might be an unsuspected molecular mechanism for ultrafast speciation.

  13. [Mg2+ ions affect the structure of the central domain of the 18S rRNA in the vicinity of the ribosomal protein S13 binding site].

    Science.gov (United States)

    Ivanov, A V; Malygin, A A; Karpova, G G

    2013-01-01

    It is known that Mg2+ ions at high concentrations stabilize the structure of the 16S rRNA in a conformation favorable for binding to the ribosomal proteins in the course of the eubacterial 30S ribosomal subunits assembly in vitro. Effect of Mg2+ on the formation of the 18S rRNA structure at the 40S subunit assembly remains poorly explored. In this paper, we show that the sequentional increase of the Mg2+ concentration from 0.5 mM to 20 mM leads to a significant decrease of the affinity of recombinant human ribosomal protein S13 (rpS13e) to a RNA transcript corresponding to the central domain fragment of the 18S rRNA (18SCD). The regions near the rpS13e binding site in 18SCD (including the nucleotides of helices H20 and H22), whose availabilities to hydroxyl radicals were dependent on the Mg2+ concentration, were determined. It was found that increase of the concentrations of Mg2+ results in the enhanced accessibilities of nucleotides G933-C937 and C1006-A1009 in helix H22 and reduces those of nucleotides A1023, A1024, and A1028-S1026 in the helix H20. Comparison of the results obtained with the crystallographic data on the structure of the central domain of 18S rRNA in the 40S ribosomal subunit led to conclusion that increase of Mg2+ concentrations results in the reorientation of helices H20 and H24 relatively helices H22 and H23 to form a structure, in which these helices are positioned the same way as in 40S subunits. Hence, saturation of the central domain of 18S rRNA with coordinated Mg2+ ions causes the same changes in its structure as rpS13e binding does, and leads to decreasing of this domain affinity to the protein.

  14. Nucleotide Salvage Deficiencies, DNA Damage and Neurodegeneration

    Directory of Open Access Journals (Sweden)

    Michael Fasullo

    2015-04-01

    Full Text Available Nucleotide balance is critically important not only in replicating cells but also in quiescent cells. This is especially true in the nervous system, where there is a high demand for adenosine triphosphate (ATP produced from mitochondria. Mitochondria are particularly prone to oxidative stress-associated DNA damage because nucleotide imbalance can lead to mitochondrial depletion due to low replication fidelity. Failure to maintain nucleotide balance due to genetic defects can result in infantile death; however there is great variability in clinical presentation for particular diseases. This review compares genetic diseases that result from defects in specific nucleotide salvage enzymes and a signaling kinase that activates nucleotide salvage after DNA damage exposure. These diseases include Lesch-Nyhan syndrome, mitochondrial depletion syndromes, and ataxia telangiectasia. Although treatment options are available to palliate symptoms of these diseases, there is no cure. The conclusions drawn from this review include the critical role of guanine nucleotides in preventing neurodegeneration, the limitations of animals as disease models, and the need to further understand nucleotide imbalances in treatment regimens. Such knowledge will hopefully guide future studies into clinical therapies for genetic diseases.

  15. Detection of Borrelia-specific 16S rRNA sequence in total RNA extracted from Ixodes ricinus ticks

    Directory of Open Access Journals (Sweden)

    Ž. Radulović

    2010-08-01

    Full Text Available A reverse transcriptase - polymerase chain reaction based assay for Borrelia species detection in ticks was developed. The method was based on amplification of 552 nucleotide bases long sequence of 16S rRNA, targeted by Borrelia specific primers. In the present study, total RNA extracted from Ixodes ricinus ticks was used as template. The results showed higher sensitivity for Borrelia detection as compared to standard dark-field microscopy. Method specificity was confirmed by cloning and sequencing of obtained 552 base pairs long amplicons. Phylogenetic analysis of obtained sequences showed that they belong to B. lusitaniae and B. afzelii genospecies. RT-PCR based method presented in this paper could be very useful as a screening test for detecting pathogen presence, especially when in investigations is required extraction of total RNA from ticks.

  16. Nucleotides and inorganic phosphates as potential antioxidants.

    Science.gov (United States)

    Richter, Yael; Fischer, Bilha

    2006-11-01

    Highly reactive OH radicals, formed in an iron-ion catalyzed Fenton reaction, are implicated in many pathological conditions. The quest for Fenton reaction inhibitors, either radical scavenger or metal-ion chelator antioxidants, spans the previous decades. Purine nucleotides were previously studied as natural modulators of the Fenton reaction; however, the modulatory role of purine nucleotides remained in dispute. Here, we have resolved this long-standing dispute and demonstrated a concentration-dependent biphasic modulation of the Fenton reaction by nucleotides. By electron spin resonance measurements with 0.1 mM Fe(II), we observed an increase of *OH production at low purine nucleotide concentrations (up to 0.15 mM), while at higher nucleotide concentrations, an exponential decay of *OH concentration was observed. We found that the phosphate moiety, not the nucleoside, determines the pro/antioxidant properties of a nucleotide, suggesting a chelation-based modulation. Furthermore, the biphasic modulation mode is probably due to diverse nucleotide-Fe(II) complexes formed in a concentration-dependent manner. At ATP concentrations much greater than Fe(II) concentrations, multiligand chelates are formed which inhibit the Fenton reaction owing to a full Fe(II) coordination sphere. In addition to natural nucleotides, we investigated a series of base- or phosphate-modified nucleotides, dinucleotides, and inorganic phosphates, as potential biocompatible antioxidants. Ap5A, inorganic thiophosphate and ATP-gamma-S proved highly potent antioxidants with IC50 values of 40, 30, and 10 microM, respectively. ATP-gamma-S proved 100 and 20 times more active than ATP and the potent antioxidant Trolox, respectively. In the presence of 30 microM ATP-gamma-S no *OH was detected after 5 min in the Fenton reaction mixture. The most potent antioxidants identified inhibit the Fenton reaction by forming full coordination sphere chelates.

  17. Phylogenetic positions of two marine ciliates, Metanophrys similis and Pseudocohnilembus hargisi (Protozoa, Ciliophora, Scuticociliatia), inferred from complete small subunit rRNA gene sequences

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The small subunit rRNA (SSrRNA) gene was sequenced for two marine scuticociliates Metanophrys similis and Pseudocohnilembus hargisi. The results show that this gene comprises 1763 and 1753 nucleotides in the two marine ciliates respectively.Metanophrys similis is phylogenetically closely related to the clade containing Mesanophrys carcini and Anophyroides haemophila, which branches basally to other species within the order Philasterida. Pseudocohnilembus hargisi groups with its congener, P. marinus, with strong bootstrap support. Paranophrys magna groups with the clade including Cohnilembus and Uronema, representing a sister clade to that containing the two Pseudocohnilembus species.

  18. Identification of clinically relevant nonhemolytic Streptococci on the basis of sequence analysis of 16S-23S intergenic spacer region and partial gdh gene

    DEFF Research Database (Denmark)

    Nielsen, Xiaohui Chen; Justesen, Ulrik Stenz; Dargis, Rimtas;

    2009-01-01

    Nonhemolytic streptococci (NHS) cause serious infections, such as endocarditis and septicemia. Many conventional phenotypic methods are insufficient for the identification of bacteria in this group to the species level. Genetic analysis has revealed that single-gene analysis is insufficient...... for the identification of all species in this group of bacteria. The aim of the present study was to establish a method based on sequence analysis of the 16S-23S intergenic spacer (ITS) region and the partial gdh gene to identify clinical relevant NHS to the species level. Sequence analysis of the ITS region....... A phylogenetic algorithm based on the analysis of partial gdh gene sequences revealed three distinct clusters. We suggest that sequence analysis of the combination of the ITS region and the partial gdh gene can be used in the reference laboratory for the species-level identification of NHS....

  19. Parity nonconservation effect with laser-induced 2^3S_1 - 2^1S_0 transition in heavy heliumlike ions

    CERN Document Server

    Shabaev, V M; Kozhuharov, C; Plunien, G; Stöhlker, Th

    2010-01-01

    The parity nonconservation (PNC) effect on the laser-induced 2^3S_1 - 2^1S_0 transition in heavy heliumlike ions is considered. A simple analytical formula for the PNC correction to the cross section is derived for the case, when the opposite-parity 2^1S_0 and 2^3P_0 states are almost degenerate and, therefore, the PNC effect is strongly enhanced. Numerical results are presented for heliumlike gadolinium and thorium, which seem most promising candidates for such kind of experiments. In both Gd and Th cases the photon energy required will be anticipated with a high-energy laser built at GSI. Alternatively, it can be gained with ultraviolet lasers utilizing relativistic Doppler tuning at FAIR facilities in Darmstadt.

  20. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  1. Effects of nucleotides and nucleosides on coagulation

    DEFF Research Database (Denmark)

    Bune, Laurids; Thaning, Pia; Johansson, Pär I;

    2010-01-01

    Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminated...... intravascular coagulation. We investigated whether nucleotide-induced cardiovascular collapse as provoked by systemic infusion of adenosine, ADP, ATP, UTP and nitric oxide affected the haemostatic system as assessed by whole blood thromboelastography (TEG) analysis. Ten pigs received a randomized infusion...

  2. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua (NCI)

    2012-03-26

    Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whether Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.

  3. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... to the presence of filamentous microorganisms was monitored weekly over 4 months. Microthrix was identified as a causative filament and suitable control measures were introduced. The level of Microthrix was reduced after 1-2 months but a number of other filamentous species were still present, with most of them...

  4. Molecular phylogenetics of the spider family Micropholcommatidae (Arachnida: Araneae) using nuclear rRNA genes (18S and 28S).

    Science.gov (United States)

    Rix, Michael G; Harvey, Mark S; Roberts, J Dale

    2008-03-01

    The spider family Micropholcommatidae is an enigmatic taxon of uncertain limits and uncertain affinities. Various phylogenetic hypotheses have been proposed for the family, but these hypotheses have never been tested with a robust phylogenetic analysis. The existence of similar Australasian and New World taxa, the possibility of morphological convergence associated with extreme 'smallness', and the apparent paucity of synapomorphic morphological characters, have all clouded generic relationships in this group. We used fragments from two nuclear ribosomal RNA genes (18S and 28S) to test the monophyly and phylogenetic position of the Micropholcommatidae. The analyses incorporated 50 ingroup spider species, including 23 micropholcommatid species and representatives from 14 other spider families. Ribosomal RNA secondary structures were inferred for the V3-V5 region of the 18S rRNA gene, and Domain II of the 28S rRNA gene of Hickmania troglodytes [Higgins, E.T., Petterd, W.F., 1883. Description of a new cave-inhabiting spider, together with notes on mammalian remains from a recently discovered cave in the Chudleigh district. Pap. Proc. R. Soc. Tasman. 1882, 191-192]. These secondary structures were used to guide multiple sequence alignments, and determine the position and nature of indels in different taxa. Secondary structure information was also incorporated into a structurally partitioned rRNA analysis in MrBayes Version 3.1.2, using a doublet model of nucleotide substitution. This structurally partitioned rRNA analysis provided a less resolved but more conservative and informative estimate of phylogeny than an otherwise identical, unpartitioned rDNA analysis. With the exception of the Chilean species Teutoniella cekalovici [Platnick, N.I., Forster, R.R., 1986. On Teutoniella, an American genus of the spider family Micropholcommatidae (Araneae, Palpimanoidea). Am. Mus. Novit. 2854, 1-9], the family Micropholcommatidae was found to be monophyletic with three

  5. An analysis of the V1 and V2 regions of Vibrio cholerae and Vibrio mimicus 16S rRNA.

    Science.gov (United States)

    Coelho, A; Momen, H; Vicente, A C; Salles, C A

    1994-02-01

    The V1 and V2 variable regions of the 16S rRNA gene of three strains of V. cholerae and one strain of V. mimicus were amplified by PCR. Fragments containing both regions were cloned into M13mp18 using Smal and sequenced by the dideoxy method. The 263-bp sequence from a strain isolated during the 1991 cholera outbreak in Brazil was deposited in Genbank under the accession number L05178. Except for an extra G in one of the strains, the three V. cholerae sequences were identical. The V. mimicus sequence was very similar, with only two substitutions. We compared these sequences with the Vibrio 16S rRNA sequences described by Dorsch et al. in 1992. It was noted that the V1 region, including helix 6 and its associated loop, comprised two different sizes and sequences in the various Vibrio species. While V. cholerae, V. mimicus, V. vulnificus, V. anguillarum and V. diazotrophicus had a 46-nucleotide V1, other species such as V. parahaemolyticus, V. proteolyticus, V. alginolyticus, V. campbellii and V. hollisae had longer 54- or 55-nucleotide regions, with a different consensus sequence. The phylogeny of Vibrio was analysed using the sequenced region and its equivalent in other species, by means of the "Phylip" software package. Species with a short helix 6 were grouped together, as were species with a long helix. Dorsh et al.'s analysis is discussed in relation to this "helix 6 split".

  6. The rRNA evolution and procaryotic phylogeny

    Science.gov (United States)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  7. The rRNA evolution and procaryotic phylogeny

    Science.gov (United States)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  8. Identification of Entamoeba polecki with Unique 18S rRNA Gene Sequences from Celebes Crested Macaques and Pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia.

    Science.gov (United States)

    Tuda, Josef; Feng, Meng; Imada, Mihoko; Kobayashi, Seiki; Cheng, Xunjia; Tachibana, Hiroshi

    2016-09-01

    Unique species of macaques are distributed across Sulawesi Island, Indonesia, and the details of Entamoeba infections in these macaques are unknown. A total of 77 stool samples from Celebes crested macaques (Macaca nigra) and 14 stool samples from pigs were collected in Tangkoko Nature Reserve, North Sulawesi, and the prevalence of Entamoeba infection was examined by PCR. Entamoeba polecki was detected in 97% of the macaques and all of the pigs, but no other Entamoeba species were found. The nucleotide sequence of the 18S rRNA gene in E. polecki from M. nigra was unique and showed highest similarity with E. polecki subtype (ST) 4. This is the first case of identification of E. polecki ST4 from wild nonhuman primates. The sequence of the 18S rRNA gene in E. polecki from pigs was also unique and showed highest similarity with E. polecki ST1. These results suggest that the diversity of the 18S rRNA gene in E. polecki is associated with differences in host species and geographic localization, and that there has been no transmission of E. polecki between macaques and pigs in the study area.

  9. Analysis of RAPD and mitochondrial 16S rRNA gene sequences from Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea

    Institute of Scientific and Technical Information of China (English)

    MENG Zining; ZHUANG Zhimeng; JIN Xianshi; TANG Qisheng; SU Yongquan

    2004-01-01

    Random amplified polymorphic DNA (RAPD) technique is applied to 12 individuals from each species of the hairtail fishes Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea. The percentage of polymorphic sites, degree of genetic polymorphism and genetic distance are compared and the phylogenetic tree is constructed by Neighbor-joining method. The partial mitochondrial 16S rRNA gene is amplified by polymerase chain reaction (PCR) and the PCR products are directly sequenced after being purified. These sequences, together with the homologous sequences of another Trichiuridae species Lepidopus caudatus obtained from GenBank, are used to analyze nucleotide difference and to construct a UPGMA phylogenetic tree by means of biological informatics. Analysis shows: (1) the RAPD technique is a highly sensitive method for investigating genetic diversity in T. lepturus, and E. muticus. T. lepturus exhibits a lower polymorphism and genetic diversity than E. muticus; (2) according to the analysis of the partial mitochondrial 16S rRNA gene sequences, a very low intraspecific variation and considerably high divergence among species were found, which reveals a dual nature of conservatism and variability in mitochondrial 16S rRNA gene; (3) five primers generate the species-specific RAPD sites and these sites can be served as the molecular markers for species identification and (4) it can be proved at DNA variation level that T. lepturus and E. muticus are of two species respectively pertaining to different genera, which supports the Nelson taxonomic conclusion.

  10. Identification of protein-coding sequences using the hybridization of 18S rRNA and mRNA during translation.

    Science.gov (United States)

    Xing, Chuanhua; Bitzer, Donald L; Alexander, Winser E; Vouk, Mladen A; Stomp, Anne-Marie

    2009-02-01

    We introduce a new approach in this article to distinguish protein-coding sequences from non-coding sequences utilizing a period-3, free energy signal that arises from the interactions of the 3'-terminal nucleotides of the 18S rRNA with mRNA. We extracted the special features of the amplitude and the phase of the period-3 signal in protein-coding regions, which is not found in non-coding regions, and used them to distinguish protein-coding sequences from non-coding sequences. We tested on all the experimental genes from Saccharomyces cerevisiae and Schizosaccharomyces pombe. The identification was consistent with the corresponding information from GenBank, and produced better performance compared to existing methods that use a period-3 signal. The primary tests on some fly, mouse and human genes suggests that our method is applicable to higher eukaryotic genes. The tests on pseudogenes indicated that most pseudogenes have no period-3 signal. Some exploration of the 3'-tail of 18S rRNA and pattern analysis of protein-coding sequences supported further our assumption that the 3'-tail of 18S rRNA has a role of synchronization throughout translation elongation process. This, in turn, can be utilized for the identification of protein-coding sequences.

  11. Assessment of rpoB and 16S rRNA genes as targets for PCR-based identification of Pasteurella pneumotropica.

    Science.gov (United States)

    Dole, Vandana S; Banu, Laila A; Fister, Richard D; Nicklas, Werner; Henderson, Kenneths S

    2010-12-01

    Diagnosis of Pasteurella pneumotropica in laboratory animals relies on isolation of the organism, biochemical characterization, and, more recently, DNA-based diagnostic methods. 16S rRNA and rpoB gene sequences were examined for development of a real-time PCR assay. Partial sequencing of rpoB (456 bp) and 16S rRNA (1368 bp) of Pasteurella pneumotropica isolates identified by microbiologic and biochemical assays indicated that either gene sequence can be used to distinguish P. pneumotropica from other members of the Pasteurellaceae family. However, alignment of rpoB sequences from the Pasteurella pneumotropica Heyl (15 sequences) and Jawetz (16 sequences) biotypes with other Pasteurellaceae sequences from GenBank indicated that although rpoB DNA sequencing could be used for diagnosis, development of diagnostic primers and probes would be difficult, because the sequence variability between Heyl and Jawetz biotypes is not clustered in any particular region of the rpoB sequence. In contrast, alignment of 16S rRNA sequences revealed a region with unique and stable nucleotide motifs sufficient to permit development of a specific fluorogenic real-time PCR assay to confirm P. pneumotropica isolated by culture and to differentiate Heyl and Jawetz biotypes.

  12. Design and synthesis of ATP-based nucleotide analogues and profiling of nucleotide-binding proteins

    NARCIS (Netherlands)

    Wolters, Justina. C.; Roelfes, Gerard; Poolman, Bert

    2011-01-01

    Two nucleotide-based probes were designed and synthesized in order to enrich samples for specific classes of proteins by affinity-based protein profiling. We focused on the profiling of adenine nucleotide-binding proteins. Two properties were considered in the design of the probes: the bait needs to

  13. Design and synthesis of ATP-based nucleotide analogues and profiling of nucleotide-binding proteins

    NARCIS (Netherlands)

    Wolters, Justina. C.; Roelfes, Gerard; Poolman, Bert

    Two nucleotide-based probes were designed and synthesized in order to enrich samples for specific classes of proteins by affinity-based protein profiling. We focused on the profiling of adenine nucleotide-binding proteins. Two properties were considered in the design of the probes: the bait needs to

  14. The International Nucleotide Sequence Database Collaboration

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Takagi, Toshihisa; Sequence Database Collaboration, International Nucleotide

    2016-01-01

    The International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org) comprises three global partners committed to capturing, preserving and providing comprehensive public-domain nucleotide sequence information. The INSDC establishes standards, formats and protocols for data and metadata to make it easier for individuals and organisations to submit their nucleotide data reliably to public archives. This work enables the continuous, global exchange of information about living things. Here we present an update of the INSDC in 2015, including data growth and diversification, new standards and requirements by publishers for authors to submit their data to the public archives. The INSDC serves as a model for data sharing in the life sciences. PMID:26657633

  15. Restrição do 16S-23S DNAr intergênico para avaliação da diversidade de Azospirillum amazonense isolado de Brachiaria spp. Restriction of 16S-23S intergenic rDNA for diversity evaluation of Azospirillum amazonense isolated from different Brachiaria spp.

    Directory of Open Access Journals (Sweden)

    Fábio Bueno dos Reis Junior

    2006-03-01

    Full Text Available O objetivo deste trabalho foi avaliar a diversidade intra-específica de isolados de Azospirillum amazonense e estabelecer a possível influência de diferentes espécies de Brachiaria ssp. e diferentes condições edafoclimáticas. A caracterização da diversidade desses isolados foi conduzida, utilizando-se a análise de restrição da região intergênica 16S-23S DNAr. As estirpes estudadas separaram-se em dois grupos, definidos a 56% de similaridade. As espécies de Brachiaria ssp. influenciaram a diversidade de estirpes. A maioria dos isolados oriundos de B. decumbens e B. brizantha está inserida no primeiro grupo, enquanto os oriundos de B. humidicola concentram-se no segundo grupo.The aim of this work was to study the intra-specific diversity of Azospirillum amazonense isolates and to establish possible influences of different Brachiaria spp. and edaphoclimatic conditions. The characterization of the diversity among the isolates of A. amazonense studied was conducted using restriction analysis of the 16S-23S rDNA intergenic spacer region. The evaluated strains were separated in two groups, defined at 56% of similarity. Brachiaria spp. showed effects on strain diversity. Most part of the isolates from B. decumbens and B. brizantha are inserted in the first group, while B. humidicola isolates concentrate in the second group.

  16. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene

    Directory of Open Access Journals (Sweden)

    Pasupuleti Sreenivasa Rao

    2013-08-01

    Full Text Available Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Sequences of various species related to genus Leptospira obtained from the NCBI database etc and aligned (CLUSTAL_X. Two Phylogenetic trees were constructed (MEGA-5 in which the first one is related to various serovars of L. interrogans and the other is related to various species of Leptospira. The Phylogenetic trees revealed the relationship and genetic diversity of various serovars of L. interrogans and the other Leptospira species, with their nearest phylogenetic relatives. In the first tree, two major clades were observed which were named as A and B, whereas in the second tree, three major clades were observed and named as A, B and C respectively. Aquifex pyrophilus strain has been used for out grouping in both the trees. The genetic distance between the species in the phylogenetic tree is presented by a bar which represents 0.5 nucleotide substitutions per alignment position in the 16S rRNA gene sequence among the various serovars of L. interrogans while 0.05 nucleotide substitutions in case of various species related to the genus Leptospira. Thus, the findings from the above study confirm that the genus Leptospira exhibits genetic diversity in the 16S rRNA gene. [Int J Res Med Sci 2013; 1(4.000: 369-377

  17. Effects of nucleotides and nucleosides on coagulation

    DEFF Research Database (Denmark)

    Bune, Laurids; Thaning, Pia; Johansson, Pär I;

    2010-01-01

    intravascular coagulation. We investigated whether nucleotide-induced cardiovascular collapse as provoked by systemic infusion of adenosine, ADP, ATP, UTP and nitric oxide affected the haemostatic system as assessed by whole blood thromboelastography (TEG) analysis. Ten pigs received a randomized infusion......Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminated.......7 ng/ml; P blood was evaluated by TEG. Circulating ADP induces hypocoagulation without signs of increased fibrinolysis as evaluated by TEG. The potential...

  18. 'Candidatus Phytoplasma pruni', a novel taxon associated with X-disease of stone fruits, Prunus spp.: multilocus characterization based on 16S rRNA, secY, and ribosomal protein genes.

    Science.gov (United States)

    Davis, Robert E; Zhao, Yan; Dally, Ellen L; Lee, Ing-Ming; Jomantiene, Rasa; Douglas, Sharon M

    2013-02-01

    X-disease is one of the most serious diseases known in peach (Prunus persica). Based on RFLP analysis of 16S rRNA gene sequences, peach X-disease phytoplasma strains from eastern and western United States and eastern Canada were classified in 16S rRNA gene RFLP group 16SrIII, subgroup A. Phylogenetic analyses of 16S rRNA gene sequences revealed that the X-disease phytoplasma strains formed a distinct subclade within the phytoplasma clade, supporting the hypothesis that they represented a lineage distinct from those of previously described 'Candidatus Phytoplasma' species. Nucleotide sequence alignments revealed that all studied X-disease phytoplasma strains shared less than 97.5 % 16S rRNA gene sequence similarity with previously described 'Candidatus Phytoplasma' species. Based on unique properties of the DNA, we propose recognition of X-disease phytoplasma strain PX11CT1(R) as representative of a novel taxon, 'Candidatus Phytoplasma pruni'. Results from nucleotide and phylogenetic analyses of secY and ribosomal protein (rp) gene sequences provided additional molecular markers of the 'Ca. Phytoplasma pruni' lineage. We propose that the term 'Ca. Phytoplasma pruni' be applied to phytoplasma strains whose 16S rRNA gene sequences contain the oligonucleotide sequences of unique regions that are designated in the formally published description of the taxon. Such strains include X-disease phytoplasma and--within the tolerance of a single base difference in one unique sequence--peach rosette, peach red suture, and little peach phytoplasmas. Although not employed for taxon delineation in this work, we further propose that secY, rp, and other genetic loci from the reference strain of a taxon, and where possible oligonucleotide sequences of unique regions of those genes that distinguish taxa within a given 16Sr group, be incorporated in emended descriptions and as part of future descriptions of 'Candidatus Phytoplasma' taxa.

  19. [Sublicons containing amino acids and nucleotides].

    Science.gov (United States)

    Kaĭmakov, E A

    1979-01-01

    Sublicons have been obtained. Sublicons are threadlike structures appearing during sublimation of frozen solutions of small concentrations, containing racemate mixture of amino acids and nucleotides. It is suggested that close location of chains and their zonal distribution by the section of helix spire forming sublicon wall, should provide the formation of stereohomogenous and complementary successions of biomonomers of different clases.

  20. Phylogenetic analysis based on 28S rRNA of Babesia spp. in ruminants in China.

    Science.gov (United States)

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

    2013-04-01

    Molecular phylogenetic analyses are mainly based on the small ribosomal RNA subunit (18S rRNA), internal transcribed spacer regions, and other molecular markers. We compared the phylogenetic relationships of Babesia spp. using large subunit ribosomal RNA, i.e., 28S rRNA, and the united 28S + 18S rRNA sequence fragments from 11 isolates of Babesia spp. collected in China. Due to sequence length and variability, the 28S rRNA gene contained more information than the 18S rRNA gene and could be used to elucidate the phlyogenetic relationships of B. motasi, B. major, and B. bovis. Thus, 28S rRNA is another candidate marker that can be used for the phylogenetic analysis of Babesia spp. However, the united fragment (28S + 18S) analysis provided better supported phylogenetic relationships than single genes for Babesia spp. in China.

  1. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals.

    Science.gov (United States)

    Kakumanu, Madhavi L; Ponnusamy, Loganathan; Sutton, Haley T; Meshnick, Steven R; Nicholson, William L; Apperson, Charles S

    2016-04-01

    A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to otherRickettsia-specific PCR targets (ompA,gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11Rickettsiaspp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from "CandidatusRickettsia amblyommii." Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adultDermacentor variabilisticks. The nested 23S-5S IGS assay detectedRickettsiaDNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species ofRickettsia The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species ofRickettsiain the ticks. "CandidatusRickettsia amblyommii,"R. montanensis,R. felis, andR. belliiwere frequently identified species, along with some potentially novelRickettsiastrains that were closely related toR. belliiandR. conorii. Copyright © 2016 Kakumanu et al.

  2. Phylogenetic analysis of Lactococcus lactis subspecies based on decoding the sequence of the pepT tripeptidase gene, the pepV dipeptidase gene and 16S rRNA.

    Science.gov (United States)

    Mori, Sumiko; Mori, Katsumi; Suzuki, Ichirou; Kasumi, Takafumi

    2004-08-01

    Tripeptidase (PepT) and dipeptidase (PepV), the enzymes located in the final stage of the intracellular proteolytic system, were demonstrated to be distributed widely in lactic acid bacteria, especially in lactococci. Both the tripeptidase genes (pepT) and dipeptidase genes (pepV) of 15 lactococcal strains consisting of the type and domestic strains were cloned and sequenced using normal and TAIL PCR methods. Amino acid sequences of these enzymes were highly conserved among strains. Evolutionary distance trees based on the sequence of 1239 nucleotides of pepT and 1416 nucleotide of pepV showed a similar cluster as that obtained from the 1499 fragment of the 16S rRNA. Based on this profile, the species Lactococcus lactis is reasonably divided into three subspecies groups, subsp. lactis, cremoris, and hordniae, as in the current classification. Figure of trees from pepT and pepV were essentially identical to each other and slightly more intricate than that from 16S rRNA. The K nuc values obtained from pepT and pepV genes were approximately ten times as high as that from 16S rRNA. Considering these results, phylogenetic analysis based on pepT and pepV genes may aid in a more precise index of classification of L. lactis subspecies. PepT and PepV seem to have evolved in similar directions in lactococci.

  3. First description of heterogeneity in 18S rRNA genes in the haploid genome of Cryptosporidium andersoni Kawatabi type.

    Science.gov (United States)

    Ikarashi, Makoto; Fukuda, Yasuhiro; Honma, Hajime; Kasai, Kenji; Kaneta, Yoshiyasu; Nakai, Yutaka

    2013-09-01

    The Apicomplexan Cryptosporidium andersoni, is a species of gastric Cryptosporidium, is frequently detected in older calves and adult cattle. Genotyping analyses based on 18S ribosomal RNA gene sequences have been performed on a novel C. andersoni genotype, namely the Kawatabi type, and the oocysts were classified into two distinct groups genotypically: Type A (the sequence in GenBank) and Type B (with a thymine nucleotide insertion not in Type A). This study analyzed 3775 cattle at a slaughterhouse and 310 cattle at a farm using microscopy and found 175 Cryptosporidium-positive animals: 171 from the slaughterhouse and four from the farm, and all infecting parasites were determined to be C. andersoni from 18S rRNA gene sequences determined from fecal DNA. In genotyping analyses with single isolated oocysts, about a half of analyzed ones were clearly classified into well known two genotypes (Type A and B). In addition to these two known genotypes, we have detected some oocysts showing mixed signals of Types A and B in the electropherogram from the automated sequencer (the Type C genotype). To determine the genotypic composition of sporozoites carried by the Type C oocysts, we analyzed their 18S rRNA gene sequences using a single sporozoite isolation procedure. Some sporozoites were classified as either Type A or Type B. However, more than half of the analyzed isolated sporozoites showed a mixed signal identical to that of Type C oocysts, and both the Type A and B signals were surely detectable from such sporozoites after a cloning procedure. In conclusion, C. andersoni carries two different genotypes heterogeneously in its haploid genome.

  4. Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

    Science.gov (United States)

    Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

    2015-04-01

    Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode.

  5. Determination of Molecular Genotyping of Ureaplasma SPP in Women with Genital Infections by 16S–23S rDNA PCR-RFLP Method

    Directory of Open Access Journals (Sweden)

    R. Mirnejad

    2011-04-01

    Full Text Available Introduction & Objective: So far, despite the wide range of methods such as analytic methods used for differentiation of Mycoplasma, the diagnosis of Mycoplasma species is still difficult. Generally the low-level discriminatory power of serological methods because of the rapid changes in size and phase of the dominant antigens in the immune cell surface of Mycoplasmas greatly limits their applicability to the typing of Mycoplasmas. On the contrary,molecular methods do not suffer from these drawbacks and can be used for typing of Mycoplasmas. The aim of this investigation was molecular identification and genotyping of ureaplasma SPP in women with genital infections by 16S–23S rDNA PCR-RFLP.Materials & Methods: Genital swabs were taken from 210 patients who referred to gynecology clinic of Rasool hospital in Tehran, Iran during December 2007 until June 2008. The swabs suspended in PBS, were immediately transferred to laboratory .Following DNA extraction, PCR assay was performed using a genus specific primer pair. These primer sets amplified a 559 bp fragment for Ureaplasma Spp. Samples containing bands of the expected size for Ureaplasma strains were subjected to digestion with different restriction endonuclease enzymes (AluI, Taq I, CacI8, BbsI, EcoRI. Results: Of the 210 samples, Ureaplasma Spp was isolated from 93 patients (44.3% by PCR and 69 samples by culture. In the present study only Biovar 1 (Ureaplasma parvum was isolated from clinical specimens and the results were confirmed using a cutting enzyme TaqI (enzyme specific species of ureaplasma SPP. The results of this analysis using PCR-RFLP and sequencing showed that all had the same genotype and shared identical sequence with the genome sequence of serovar 3 Ureaplasma parvum.Conclusion: Ureaplasma parvum is generally isolated from the genital samples. In this study all isolates were identical and no difference was found among the enzyme patterns of the bacteria after PCR-RFLP .So

  6. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    Science.gov (United States)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  7. Radiation and thermal stabilities of adenine nucleotides.

    Science.gov (United States)

    Demidov, V V; Potaman, V N; Solyanina, I P; Trofimov, V I

    1995-03-01

    We have investigated in detail radiation and thermal stabilities and transformations of adenosine mono- and triphosphates in liquid and frozen solid aqueous solutions within a wide range of absorbed radiation dose (up to 75 kGy) and temperature (up to 160 degrees C). Dephosphorylation is the main pathway of high temperature hydrolysis of adenine nucleotides. Basic thermodynamic and kinetic parameters of this process have been determined. Radiolysis of investigated compounds at room temperature results in scission of N-glycosidic bond with a radiation yield about of 1 mol/100 eV. Solution freezing significantly enhances radiation stability of nucleotides as well as other biomolecules. This circumstance is essential in the discussion of panspermia concepts.

  8. Nucleotide sequence of papaya mosaic virus RNA.

    Science.gov (United States)

    Sit, T L; Abouhaidar, M G; Holy, S

    1989-09-01

    The RNA genome of papaya mosaic virus is 6656 nucleotides long [excluding the poly(A) tail] with six open reading frames (ORFs) more than 200 nucleotides long. The four nearest the 5' end each overlap with adjacent ORFs and could code for proteins with Mr 176307, 26248, 11949 and 7224 (ORFs 1 to 4). The fifth ORF produces the capsid protein of Mr 23043 and the sixth ORF, located completely within ORF1, could code for a protein with Mr 14113. The translation products of ORFs 1 to 3 show strong similarity with those of other potexviruses but the ORF 4 protein has only limited similarity with the other potexvirus ORF 4 proteins of 7K to 11K.

  9. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  10. Development of a Broad-Range 23S rDNA Real-Time PCR Assay for the Detection and Quantification of Pathogenic Bacteria in Human Whole Blood and Plasma Specimens

    Directory of Open Access Journals (Sweden)

    Paolo Gaibani

    2013-01-01

    Full Text Available Molecular methods are important tools in the diagnosis of bloodstream bacterial infections, in particular in patients treated with antimicrobial therapy, due to their quick turn-around time. Here we describe a new broad-range real-time PCR targeting the 23S rDNA gene and capable to detect as low as 10 plasmid copies per reaction of targeted bacterial 23S rDNA gene. Two commercially available DNA extraction kits were evaluated to assess their efficiency for the extraction of plasma and whole blood samples spiked with different amount of either Staphylococcus aureus or Escherichia coli, in order to find the optimal extraction method to be used. Manual QIAmp extraction method with enzyme pre-treatment resulted the most sensitive for detection of bacterial load. Sensitivity of this novel assay ranged between 10 and 103 CFU per PCR reaction for E. coli and S. aureus in human whole blood samples depending on the extraction methods used. Analysis of plasma samples showed a 10- to 100-fold reduction of bacterial 23S rDNA in comparison to the corresponding whole blood specimens, thus indicating that whole blood is the preferential sample type to be used in this real-time PCR protocol. Our results thus show that the 23S rDNA gene represents an optimal target for bacteria quantification in human whole blood.

  11. The rluC gene of Escherichia coli codes for a pseudouridine synthase that is solely responsible for synthesis of pseudouridine at positions 955, 2504, and 2580 in 23 S ribosomal RNA.

    Science.gov (United States)

    Conrad, J; Sun, D; Englund, N; Ofengand, J

    1998-07-17

    Escherichia coli ribosomal RNA contains 10 pseudouridines, one in the 16 S RNA and nine in the 23 S RNA. Previously, the gene for the synthase responsible for the 16 S RNA pseudouridine was identified and cloned, as was a gene for a synthase that makes a single pseudouridine in 23 S RNA. The yceC open reading frame of E. coli is one of a set of genes homologous to these previously identified ribosomal RNA pseudouridine synthases. In this work, the gene was cloned, overexpressed, and shown to code for a pseudouridine synthase able to react with in vitro transcripts of 23 S ribosomal RNA. Deletion of the gene and analysis of the 23 S RNA from the deletion strain for the presence of pseudouridine at its nine known sites revealed that this synthase is solely responsible in vivo for the synthesis of three of the nine pseudouridine residues, at positions 955, 2504, and 2580. Therefore, this gene has been renamed rluC. Despite the absence of one-third of the normal complement of pseudouridines, there was no change in the exponential growth rate in either LB or M-9 medium at temperatures ranging from 24 to 42 degrees C. From this work and our previous studies, we have now identified three synthases that account for 50% of the pseudouridines in the E. coli ribosome.

  12. Visualization of cyclic nucleotide dynamics in neurons

    Directory of Open Access Journals (Sweden)

    Kirill eGorshkov

    2014-12-01

    Full Text Available The second messengers cAMP and cGMP transduce many neuromodulatory signals from hormones and neurotransmitters into specific functional outputs. Their production, degradation and signaling are spatiotemporally regulated to achieve high specificity in signal transduction. The development of genetically encodable fluorescent biosensors has provided researchers with useful tools to study these versatile second messengers and their downstream effectors with unparalleled spatial and temporal resolution in cultured cells and living animals. In this review, we introduce the general design of these fluorescent biosensors and describe several of them in more detail. Then we discuss a few examples of using cyclic nucleotide fluorescent biosensors to study regulation of neuronal function and finish with a discussion of advances in the field. Although there has been significant progress made in understanding how the specific signaling of cyclic nucleotide second messengers is achieved, the mechanistic details in complex cell types like neurons are only just beginning to surface. Current and future fluorescent protein reporters will be essential to elucidate the role of cyclic nucleotide signaling dynamics in the functions of individual neurons and their networks.

  13. Nucleotide-Dependent Bioautocatalytic Timer Reaction.

    Science.gov (United States)

    Chen, Ting-Ru; Hsu, Ching-Fong; Chen, Chih-Lin; Witek, Henryk A; Urban, Pawel L

    2016-09-16

    We describe a biochemical timer composed of three biocatalytic reactions involving three types of adenylate nucleotides: adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP). The timer is triggered by a small amount of ATP or ADP. An abrupt increase in the ATP concentration (following numerous amplification cycles) leads to a sudden increase of luminescence from the reaction mixture. The time point when the luminescence appears is found to be a function of the initial concentration of the triggering nucleotide (5.0 × 10(-8)-1.0 × 10(-6) M), even in the presence of a complex biological matrix. The mechanism of the observed dependence of the time of luminescence increase on the concentration has been confirmed with simple kinetic models. Due to the biocompatibility of the proposed trienzymatic reaction scheme (sensitivity to common nucleotides and occurrence in a neutral pH aqueous environment), the scheme can be used in bioengineered systems that require modulation of the response time (light emission) by concentration.

  14. Multiphasic interactions between nucleotides and target proteins

    CERN Document Server

    Nissen, Per

    2016-01-01

    The nucleotides guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) bind to target proteins to promote bacterial survival (Corrigan et al. 2016). Thus, the binding of the nucleotides to RsgA, a GTPase, inhibits the hydrolysis of GTP. The dose response, taken to be curvilinear with respect to the logarithm of the inhibitor concentration, is instead much better (P<0.001 when the 6 experiments are combined) represented as multiphasic, with high to exceedingly high absolute r values for the straight lines, and with transitions in the form of non-contiguities (jumps). Profiles for the binding of radiolabeled nucleotides to HprT and Gmk, GTP synthesis enzymes, were, similarly, taken to be curvilinear with respect to the logarithm of the protein concentration. However, the profiles are again much better represented as multiphasic than as curvilinear (the P values range from 0.047 to <0.001 for each of the 8 experiments for binding of ppGpp and pppGpp to HprT). The binding of GTP to HprT and ...

  15. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  16. Characteristic archaebacterial 16S rRNA oligonucleotides

    Science.gov (United States)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  17. Defects in 18 S or 28 S rRNA processing activate the p53 pathway.

    Science.gov (United States)

    Hölzel, Michael; Orban, Mathias; Hochstatter, Julia; Rohrmoser, Michaela; Harasim, Thomas; Malamoussi, Anastassia; Kremmer, Elisabeth; Längst, Gernot; Eick, Dirk

    2010-02-26

    The p53 tumor suppressor pathway is activated by defective ribosome synthesis. Ribosomal proteins are released from the nucleolus and block human double minute-2 (Hdm2) that targets p53 for degradation. However, it remained elusive how abrogation of individual rRNA processing pathways contributes to p53 stabilization. Here, we show that selective inhibition of 18 S rRNA processing provokes accumulation of p53 as efficiently as abrogated 28 S rRNA maturation. We describe hUTP18 as a novel mammalian rRNA processing factor that is specifically involved in 18 S rRNA production. hUTP18 was essential for the cleavage of the 5'-external transcribed spacer leader sequence from the primary polymerase I transcript, but was dispensable for rRNA transcription. Because maturation of the 28 S rRNA was unaffected in hUTP18-depleted cells, our results suggest that the integrity of both the 18 S and 28 S rRNA synthesis pathways can be monitored independently by the p53 pathway. Interestingly, accumulation of p53 after hUTP18 knock down required the ribosomal protein L11. Therefore, cells survey the maturation of the small and large ribosomal subunits by separate molecular routes, which may merge in an L11-dependent signaling pathway for p53 stabilization.

  18. Fragmentary 5S rRNA gene in the human mitochondrial genome

    Energy Technology Data Exchange (ETDEWEB)

    Nierlich, D.P.

    1982-02-01

    The human mitochondrial genoma contains a 23-nucleodtide sequence that is homologous to a part of the 5S rRNA's of bacteria. This homology, the structure of the likely transcript, and the location of the sequence relative to the mitochondrial rRNA genes suggest that the sequence represents a fragmentary 5S rRNA gene.

  19. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kiparisov, Sergey; Petrov, Alexey; Meskauskas, Arturas; Sergiev, Petr V; Dontsova, Olga A; Dinman, Jonathan D

    2005-10-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semi-dominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression.

  20. rRNA maturation as a "quality" control step in ribosomal subunit assembly in Dictyostelium discoideum.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S; Bulfone, S

    1997-10-31

    In Dictyostelium discoideum, newly assembled ribosomal subunits enter polyribosomes while they still contain immature rRNA. rRNA maturation requires the engagement of the subunits in protein synthesis and leads to stabilization of their structure. Maturation of pre-17 S rRNA occurs only after the newly formed 40 S ribosomal particle has entered an 80 S ribosome and participated at least in the formation of one peptide bond or in one translocation event; maturation of pre-26 S rRNA requires the presence on the 80 S particle of a peptidyl-tRNA containing at least 6 amino acids. Newly assembled particles that cannot fulfill these requirements for structural reasons are disassembled into free immature rRNA and ribosomal proteins.

  1. Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3’-Terminal Fragment of 16S rRNA in E. coli

    Science.gov (United States)

    Golovin, A.V.; Khayrullina, G.A.; Kraal, B.; Kopylov, А.М.

    2012-01-01

    For prokaryotes in vitro, 16S rRNA and 20 ribosomal proteins are capable of hierarchical self- assembly yielding a 30S ribosomal subunit. The self-assembly is initiated by interactions between 16S rRNA and three key ribosomal proteins: S4, S8, and S7. These proteins also have a regulatory function in the translation of their polycistronic operons recognizing a specific region of mRNA. Therefore, studying the RNA–protein interactions within binary complexes is obligatory for understanding ribosome biogenesis. The non-conventional RNA–protein contact within the binary complex of recombinant ribosomal protein S7 and its 16S rRNA binding site (236 nucleotides) was identified. UV–induced RNA–protein cross-links revealed that S7 cross-links to nucleotide U1321 of 16S rRNA. The careful consideration of the published RNA– protein cross-links for protein S7 within the 30S subunit and their correlation with the X-ray data for the 30S subunit have been performed. The RNA – protein cross–link within the binary complex identified in this study is not the same as the previously found cross-links for a subunit both in a solution, and in acrystal. The structure of the binary RNA–protein complex formed at the initial steps of self-assembly of the small subunit appears to be rearranged during the formation of the final structure of the subunit. PMID:23346381

  2. Resurrection of an ancestral 5S rRNA

    Directory of Open Access Journals (Sweden)

    Fox George E

    2011-07-01

    to resurrect additional meaningful 5S rRNA ancestors as well as ancestral sequences of many different types of RNA.

  3. Resurrection of an ancestral 5S rRNA.

    Science.gov (United States)

    Lu, Qing; Fox, George E

    2011-07-22

    In addition to providing phylogenetic relationships, tree making procedures such as parsimony and maximum likelihood can make specific predictions of actual historical sequences. Resurrection of such sequences can be used to understand early events in evolution. In the case of RNA, the nature of parsimony is such that when applied to multiple RNA sequences it typically predicts ancestral sequences that satisfy the base pairing constraints associated with secondary structure. The case for such sequences being actual ancestors is greatly improved, if they can be shown to be biologically functional. A unique common ancestral sequence of 28 Vibrio 5S ribosomal RNA sequences predicted by parsimony was resurrected and found to be functional in the context of the E. coli cellular environment. The functionality of various point variants and intermediates that were constructed as part of the resurrection were examined in detail. When separately introduced the changes at single stranded positions and individual double variants at base-paired positions were also viable. An additional double variant was examined at a different base-paired position and it was also valid. The results show that at least in the case of the 5S rRNAs considered here, ancestors predicted by parsimony are likely to be realistic when the prediction is not overly influenced by single outliers. It is especially noteworthy that the phenotype of the predicted ancestors could be anticipated as a cumulative consequence of the phenotypes of the individual variants that comprised them. Thus, point mutation data is potentially useful in evaluating the reasonableness of ancestral sequences predicted by parsimony or other methods. The results also suggest that in the absence of significant tertiary structure constraints double variants that preserve pairing in stem regions will typically be accepted. Overall, the results suggest that it will be feasible to resurrect additional meaningful 5S rRNA ancestors as well

  4. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Directory of Open Access Journals (Sweden)

    Markus Buchhaupt

    Full Text Available Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  5. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Science.gov (United States)

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  6. 18S rRNA degradation is not accompanied by altered rRNA transport at early times following irradiation of HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Fuchs, P.; Krolak, J.M.; McClain, D.; Minton, K.W.

    1990-01-01

    In recent investigations on the effects of radiation on rRNA processing in HeLa S3 cells, the authors pulse-labeled the cells with uridine immediately prior to irradiation. The 45 S rRNA precursor, which undergoes nuclear processing to form one each of its major daughter species, 28S and 18S rRNA, was separated from the daughter species by gel electrophoresis and the radiolabel in each species determined at various times after irradiation. By pulse-labeling the cells prior to irradiation, superimposed effects caused by radiation-induced alterations of rRNA transcription and Refs. therein were minimized, permitting selective analysis of the processing of that fraction of 45S precursor that had been synthesized (radiolabeled) predominantly prior to irradiation. They now report more detailed studies on 45S rRNA processing within the first 2 h following irradiation in which they have found a maximum 28 S:18 S ratio of 2:1 that is observed about 1 h following irradiation of 5 or 10 Gy.

  7. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.

    Science.gov (United States)

    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2010-11-01

    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  8. Visual analysis of the yeast 5S rRNA gene transcriptome: regulation and role of La protein.

    Science.gov (United States)

    French, Sarah L; Osheim, Yvonne N; Schneider, David A; Sikes, Martha L; Fernandez, Cesar F; Copela, Laura A; Misra, Vikram A; Nomura, Masayasu; Wolin, Sandra L; Beyer, Ann L

    2008-07-01

    5S rRNA genes from Saccharomyces cerevisiae were examined by Miller chromatin spreading, representing the first quantitative analysis of RNA polymerase III genes in situ by electron microscopy. These very short genes, approximately 132 nucleotides (nt), were engaged by one to three RNA polymerases. Analysis in different growth conditions and in strains with a fourfold range in gene copy number revealed regulation at two levels: number of active genes and polymerase loading per gene. Repressive growth conditions (presence of rapamycin or postexponential growth) led first to fewer active genes, followed by lower polymerase loading per active gene. The polymerase III elongation rate was estimated to be in the range of 60 to 75 nt/s, with a reinitiation interval of approximately 1.2 s. The yeast La protein, Lhp1, was associated with 5S genes. Its absence had no discernible effect on the amount or size of 5S RNA produced yet resulted in more polymerases per gene on average, consistent with a non-rate-limiting role for Lhp1 in a process such as polymerase release/recycling upon transcription termination.

  9. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Science.gov (United States)

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  10. Dbl family guanine nucleotide exchange factors.

    Science.gov (United States)

    Zheng, Y

    2001-12-01

    The Dbl family of guanine nucleotide exchange factors are multifunctional molecules that transduce diverse intracellular signals leading to the activation of Rho GTPases. The tandem Dbl-homology and pleckstrin-homology domains shared by all members of this family represent the structural module responsible for catalyzing the GDP-GTP exchange reaction of Rho proteins. Recent progress in genomic, genetic, structural and biochemical studies has implicated Dbl family members in diverse biological processes, including growth and development, skeletal muscle formation, neuronal axon guidance and tissue organization. The detailed pictures of their autoregulation, agonist-controlled activation and mechanism of interaction with Rho GTPase substrates, have begun to emerge.

  11. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER. © 2012 by the authors; licensee MDPI, Basel...

  12. In Vitro Selection Using Modified or Unnatural Nucleotides

    Science.gov (United States)

    Stovall, Gwendolyn M.; Bedenbaugh, Robert S.; Singh, Shruti; Meyer, Adam J.; Hatala, Paul J.; Ellington, Andrew D.; Hall, Bradley

    2014-01-01

    Incorporation of modified nucleotides into in vitro RNA or DNA selections offer many potential advantages, such as the increased stability of selected nucleic acids against nuclease degradation, improved affinities, expanded chemical functionality, and increased library diversity. This unit provides useful information and protocols for in vitro selection using modified nucleotides. It includes a discussion of when to use modified nucleotides; protocols for evaluating and optimizing transcription reactions, as well as confirming the incorporation of the modified nucleotides; protocols for evaluating modified nucleotide transcripts as template in reverse transcription reactions; protocols for the evaluation of the fidelity of modified nucleotides in the replication and the regeneration of the pool; and a protocol to compare modified nucleotide pools and selection conditions. PMID:25606981

  13. [Identification of single nucleotide polymorphisms in centenarians].

    Science.gov (United States)

    Gambini, Juan; Gimeno-Mallench, Lucía; Inglés, Marta; Olaso, Gloria; Abdelaziz, Kheira Mohamed; Avellana, Juan Antonio; Belenguer, Ángel; Cruz, Raquel; Mas-Bargues, Cristina; Borras, Consuelo; Viña, José

    2016-01-01

    Longevity is determined by genetic and external factors, such as nutritional, environmental, social, etc. Nevertheless, when living conditions are optimal, longevity is determined by genetic variations between individuals. In a same population, with relative genotypic homogeneity, subtle changes in the DNA sequence affecting a single nucleotide can be observed. These changes, called single nucleotide polymorphisms (SNP) are present in 1-5% of the population. A total of 92 subjects were recruited, including 28 centenarians and 64 controls, in order to find SNP that maybe implicated in the extreme longevity, as in the centenarians. Blood samples were collected to isolate and amplify the DNA in order to perform the analysis of SPN by Axiom™ Genotyping of Affymetrix technology. Statistical analyses were performed using the Plink program and libraries SNPassoc and skatMeta. Our results show 12 mutations with a p<.001, where 5 of these (DACH1, LOC91948, BTB16, NFIL3 y HDAC4) have regulatory functions of the expressions of others genes. Therefore, these results suggest that the genetic variation between centenarians and controls occurs in five genes that are involved in the regulation of gene expression to adapt to environmental changes better than controls. Copyright © 2015 SEGG. Published by Elsevier Espana. All rights reserved.

  14. Estimation of evolutionary distances between nucleotide sequences.

    Science.gov (United States)

    Zharkikh, A

    1994-09-01

    A formal mathematical analysis of the substitution process in nucleotide sequence evolution was done in terms of the Markov process. By using matrix algebra theory, the theoretical foundation of Barry and Hartigan's (Stat. Sci. 2:191-210, 1987) and Lanave et al.'s (J. Mol. Evol. 20:86-93, 1984) methods was provided. Extensive computer simulation was used to compare the accuracy and effectiveness of various methods for estimating the evolutionary distance between two nucleotide sequences. It was shown that the multiparameter methods of Lanave et al.'s (J. Mol. Evol. 20:86-93, 1984), Gojobori et al.'s (J. Mol. Evol. 18:414-422, 1982), and Barry and Hartigan's (Stat. Sci. 2:191-210, 1987) are preferable to others for the purpose of phylogenetic analysis when the sequences are long. However, when sequences are short and the evolutionary distance is large, Tajima and Nei's (Mol. Biol. Evol. 1:269-285, 1984) method is superior to others.

  15. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  16. Epigenetic Programming of the rRNA Promoter by MBD3

    OpenAIRE

    2008-01-01

    Within the human genome there are hundreds of copies of the rRNA gene, but only a fraction of these genes are active. Silencing through epigenetics has been extensively studied; however, it is essential to understand how active rRNA genes are maintained. Here, we propose a role for the methyl-CpG binding domain protein MBD3 in epigenetically maintaining active rRNA promoters. We show that MBD3 is localized to the nucleolus, colocalizes with upstream binding factor, and binds to unmethylated r...

  17. Evolutionary dynamics of rRNA gene clusters in cichlid fish

    Directory of Open Access Journals (Sweden)

    Nakajima Rafael T

    2012-10-01

    Full Text Available Abstract Background Among multigene families, ribosomal RNA (rRNA genes are the most frequently studied and have been explored as cytogenetic markers to study the evolutionary history of karyotypes among animals and plants. In this report, we applied cytogenetic and genomic methods to investigate the organization of rRNA genes among cichlid fishes. Cichlids are a group of fishes that are of increasing scientific interest due to their rapid and convergent adaptive radiation, which has led to extensive ecological diversity. Results The present paper reports the cytogenetic mapping of the 5S rRNA genes from 18 South American, 22 African and one Asian species and the 18S rRNA genes from 3 African species. The data obtained were comparatively analyzed with previously published information related to the mapping of rRNA genes in cichlids. The number of 5S rRNA clusters per diploid genome ranged from 2 to 15, with the most common pattern being the presence of 2 chromosomes bearing a 5S rDNA cluster. Regarding 18S rDNA mapping, the number of sites ranged from 2 to 6, with the most common pattern being the presence of 2 sites per diploid genome. Furthermore, searching the Oreochromis niloticus genome database led to the identification of a total of 59 copies of 5S rRNA and 38 copies of 18S rRNA genes that were distributed in several genomic scaffolds. The rRNA genes were frequently flanked by transposable elements (TEs and spread throughout the genome, complementing the FISH analysis that detect only clustered copies of rRNA genes. Conclusions The organization of rRNA gene clusters seems to reflect their intense and particular evolutionary pathway and not the evolutionary history of the associated taxa. The possible role of TEs as one source of rRNA gene movement, that could generates the spreading of ribosomal clusters/copies, is discussed. The present paper reinforces the notion that the integration of cytogenetic data and genomic analysis provides a

  18. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    OpenAIRE

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

  19. Evolutionary dynamics of rRNA gene clusters in cichlid fish

    Science.gov (United States)

    2012-01-01

    Background Among multigene families, ribosomal RNA (rRNA) genes are the most frequently studied and have been explored as cytogenetic markers to study the evolutionary history of karyotypes among animals and plants. In this report, we applied cytogenetic and genomic methods to investigate the organization of rRNA genes among cichlid fishes. Cichlids are a group of fishes that are of increasing scientific interest due to their rapid and convergent adaptive radiation, which has led to extensive ecological diversity. Results The present paper reports the cytogenetic mapping of the 5S rRNA genes from 18 South American, 22 African and one Asian species and the 18S rRNA genes from 3 African species. The data obtained were comparatively analyzed with previously published information related to the mapping of rRNA genes in cichlids. The number of 5S rRNA clusters per diploid genome ranged from 2 to 15, with the most common pattern being the presence of 2 chromosomes bearing a 5S rDNA cluster. Regarding 18S rDNA mapping, the number of sites ranged from 2 to 6, with the most common pattern being the presence of 2 sites per diploid genome. Furthermore, searching the Oreochromis niloticus genome database led to the identification of a total of 59 copies of 5S rRNA and 38 copies of 18S rRNA genes that were distributed in several genomic scaffolds. The rRNA genes were frequently flanked by transposable elements (TEs) and spread throughout the genome, complementing the FISH analysis that detect only clustered copies of rRNA genes. Conclusions The organization of rRNA gene clusters seems to reflect their intense and particular evolutionary pathway and not the evolutionary history of the associated taxa. The possible role of TEs as one source of rRNA gene movement, that could generates the spreading of ribosomal clusters/copies, is discussed. The present paper reinforces the notion that the integration of cytogenetic data and genomic analysis provides a more complete picture for

  20. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C.; Dennis, P. P.

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  1. Identification and chromosomal distribution of 5S rRNA genes in Neurospora crassa.

    OpenAIRE

    Metzenberg, R L; Stevens, J N; Selker, E U; Morzycka-Wroblewska, E

    1985-01-01

    The 5S rRNA genes of Neurospora crassa, unlike those of most organisms, are not tandemly arranged, and they are found imbedded in a variety of unique sequences. The 5S rRNA regions of most of the genes are of one type, alpha; however, several other "isotypes" (beta, gamma, delta, zeta, and eta) are also found. We asked whether Neurospora 5S rRNA genes are dispersed on a chromosomal scale and whether genes of different isotypes are spatially segregated. We identified, by DNA sequencing, 5S rRN...

  2. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  3. Magnetic and electrical properties of Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Bodnar, I. V., E-mail: chemzav@bsuir.by [Belarusian State University of Information and Radio Electronics (Belarus); Trukhanov, S. V. [National Academy of Sciences of Belarus, Scientific and Practical Materials Research Center (Belarus); Barugu, T. H. [Belarusian State University of Information and Radio Electronics (Belarus)

    2015-10-15

    The magnetic and electrical properties of the Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystal are studied in the temperature range 4–300 K and in magnetic fields of 0–14 T. It is established that the sample under study is paramagnetic. In the ground state, short-range-order correlations typical of a spin glass with a freezing temperature of 10 K are detected. The magnetic ordering temperature is 15 K. The sample is a semiconductor with a resistivity of 3.5 kΩ cm at room temperature. For the Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystal, a mechanism for the formation of magnetic and electrical states is suggested.

  4. Characterization of the binding sites of protein L11 and the L10.(L12)4 pentameric complex in the GTPase domain of 23 S ribosomal RNA from Escherichia coli

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S R; Liljas, A

    1990-01-01

    Ribonuclease and chemical probes were used to investigate the binding sites of ribosomal protein L11 and the pentameric complex L10.(L12)4 on Escherichia coli 23 S RNA. Protein complexes were formed with an RNA fragment constituting most of domains I and II or with 23 S RNA and they were...... investigated by an end-labelling method and a reverse transcriptase procedure, respectively. The results demonstrate that the two protein moieties bind at adjacent sites within a small RNA region. The L11 binding region overlaps with those of the modified peptide antibiotics thiostrepton and micrococcin...... data, were used in a computer graphics approach to build a partial RNA tertiary structural model. The model provides insight into the topography of the L11 binding site. It also provides a structural rationale for the mutually co-operative binding of protein L11 with the antibiotics thiostrepton...

  5. DNA authentication of Plantago Herb based on nucleotide sequences of 18S-28S rRNA internal transcribed spacer region.

    Science.gov (United States)

    Sahin, Fatma Pinar; Yamashita, Hiromi; Guo, Yahong; Terasaka, Kazuyoshi; Kondo, Toshiya; Yamamoto, Yutaka; Shimada, Hiroshi; Fujita, Masao; Kawasaki, Takeshi; Sakai, Eiji; Tanaka, Toshihiro; Goda, Yukihiro; Mizukami, Hajime

    2007-07-01

    Internal transcribed spacer (ITS) regions of nuclear ribosomal RNA gene were amplified from 23 plant- and herbarium specimens belonging to eight Plantago species (P. asiatica, P. depressa, P. major, P. erosa, P. hostifolia, P. camtschatica, P. virginica and P. lanceolata). Sequence comparison indicated that these Plantago species could be identified based on the sequence type of the ITS locus. Sequence analysis of the ITS regions amplified from the crude drug Plantago Herb obtained in the markets indicated that all the drugs from Japan were derived from P. asiatica whereas the samples obtained in China were originated from various Plantago species including P. asiatica, P. depressa, P. major and P. erosa.

  6. Comparative 16S rRNA signatures and multilocus sequence analysis for the genus Salinicola and description of Salinicola acroporae sp. nov., isolated from coral Acropora digitifera.

    Science.gov (United States)

    Lepcha, Rinchen T; Poddar, Abhijit; Schumann, Peter; Das, Subrata K

    2015-07-01

    A novel Gram-negative, aerobic, motile marine bacterium, strain S4-41(T), was isolated from mucus of the coral Acropora digitifera from the Andaman Sea. Heterotrophic growth was observed in 0-25 % NaCl, at 15-45 °C and pH 4.5-9. In phylogenetic trees, strain S4-41(T) was grouped within the genus Salinicola but formed a separate branch distant from a cluster composed of Salinicola salarius M27(T) and Salinicola socius SMB35(T). DNA-DNA relatedness between strain S4-41(T) and these reference strains were well below 70 %. Q-9 was the sole respiratory quinone. The DNA G+C content was determined to be 63.6 mol%. Based on a polyphasic analysis, strain S4-41(T) is concluded to represent a novel species in the genus Salinicola for which the name Salinicola acroporae sp. nov. is proposed. The type strain is S4-41(T) (=JCM 30412(T) = LMG 28587(T)). Comparative 16S rRNA analysis of the genera Salinicola, Kushneria, Chromohalobacter and Cobetia revealed the presence of genus specific sequence signatures. Multilocus sequence analysis based on concatenated sequences of rRNAs (16S and 23S) and four protein coding housekeeping genes (atpA, gyrB, secA, rpoD) was found to be unnecessary for phylogenetic studies of the genus Salinicola.

  7. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H;

    1996-01-01

    , the sensitivity of H-Ras to GRF was abolished when residues 130-139 were replaced by proline-aspartic acid-glutamine, whereas substitution of the entire loop 8 (residues 123-130 replaced by leucine-isoleucine-arginine) had no effect on the stimulation of guanine nucleotide release by GRF. Substrate activity...

  8. Mutations of PKA cyclic nucleotide-binding domains reveal novel aspects of cyclic nucleotide selectivity.

    Science.gov (United States)

    Lorenz, Robin; Moon, Eui-Whan; Kim, Jeong Joo; Schmidt, Sven H; Sankaran, Banumathi; Pavlidis, Ioannis V; Kim, Choel; Herberg, Friedrich W

    2017-07-06

    Cyclic AMP and cyclic GMP are ubiquitous second messengers that regulate the activity of effector proteins in all forms of life. The main effector proteins, the 3',5'-cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) and the 3',5'-cyclic guanosine monophosphate (cGMP)-dependent protein kinase (PKG), are preferentially activated by cAMP and cGMP, respectively. However, the molecular basis of this cyclic nucleotide selectivity is still not fully understood. Analysis of isolated cyclic nucleotide-binding (CNB) domains of PKA regulatory subunit type Iα (RIα) reveals that the C-terminal CNB-B has a higher cAMP affinity and selectivity than the N-terminal CNB-A. Here, we show that introducing cGMP-specific residues using site-directed mutagenesis reduces the selectivity of CNB-B, while the combination of two mutations (G316R/A336T) results in a cGMP-selective binding domain. Furthermore, introducing the corresponding mutations (T192R/A212T) into the PKA RIα CNB-A turns this domain into a highly cGMP-selective domain, underlining the importance of these contacts for achieving cGMP specificity. Binding data with the generic purine nucleotide 3',5'-cyclic inosine monophosphate (cIMP) reveal that introduced arginine residues interact with the position 6 oxygen of the nucleobase. Co-crystal structures of an isolated CNB-B G316R/A336T double mutant with either cAMP or cGMP reveal that the introduced threonine and arginine residues maintain their conserved contacts as seen in PKG I CNB-B. These results improve our understanding of cyclic nucleotide binding and the molecular basis of cyclic nucleotide specificity. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  9. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    Science.gov (United States)

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  10. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    Science.gov (United States)

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  11. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  12. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    Science.gov (United States)

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  13. Detection of Babesia microti parasites by highly sensitive 18S rRNA reverse transcription PCR.

    Science.gov (United States)

    Hanron, Amelia E; Billman, Zachary P; Seilie, Annette M; Chang, Ming; Murphy, Sean C

    2017-03-01

    Babesia are increasingly appreciated as a cause of transfusion-transmitted infection. Sensitive methods are needed to screen blood products. We report herein that B. microti 18S rRNA is over 1,000-fold more abundant than its coding genes, making reverse transcription PCR (RT-PCR) much more sensitive than PCR. Babesia 18S rRNA may be useful for screening the blood supply.

  14. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  15. A 22-nucleotide spliced leader sequence in the human parasitic nematode Brugia malayi is identical to the trans-spliced leader exon in Caenorhabditis elegans.

    OpenAIRE

    Takacs, A M; Denker, J A; Perrine, K G; Maroney, P A; Nilsen, T W

    1988-01-01

    The mRNAs encoding a 63-kDa antigen in the human parasitic nematode Brugia Malayi contain a spliced leader sequence of 22 nucleotides (nt) that is identical to the trans-spliced leader found on certain actin mRNAs in the distantly related nematode Caenorhabditis elegans. The 22-nt sequence does not appear to be encoded near the 63-kDa genes but is present in multiple copies in several locations within the parasite genome, including the 5S rRNA gene repeat. The 5S-linked copies of the 22-nt se...

  16. Low abundant spacer 5S rRNA transcripts are frequently polyadenylated in Nicotiana.

    Science.gov (United States)

    Fulnecek, Jaroslav; Kovarik, Ales

    2007-11-01

    In plants, 5S rRNA genes (5S rDNA) encoding 120-nt structural RNA molecules of ribosomes are organized in tandem arrays comprising thousands of units. Failure to correctly terminate transcription would generate longer inaccurately processed transcripts interfering with ribosome biogenesis. Hence multiple termination signals occur immediately after the 5S rRNA coding sequence. To obtain information about the efficiency of termination of 5S rDNA transcription in plants we analyzed 5S rRNA pools in three Nicotiana species, N. sylvestris, N. tomentosiformis and N. tabacum. In addition to highly abundant 120-nt 5S rRNA transcripts, we also detected RNA species composed of a genic region and variable lengths of intergenic sequences. These genic-intergenic RNA molecules occur at a frequency severalfold lower than the mature 120-nt transcripts, and are posttranscriptionally modified by polyadenylation at their 3' end in contrast to 120-nt transcripts. An absence of 5S small RNAs (smRNA) argue against a dominant role for the smRNA biosynthesis pathway in the degradation of aberrant 5S rRNA in Nicotiana. This work is the first description of polyadenylated 5S rRNA species in higher eukaryotes originating from a read-through transcription into the intergenic spacer. We propose that polyadenylation may function in a "quality control" pathway ensuring that only correctly processed molecules enter the ribosome biogenesis.

  17. rRNA Pseudogenes in Filamentous Ascomycetes as Revealed by Genome Data

    Directory of Open Access Journals (Sweden)

    Yi Li

    2017-08-01

    Full Text Available The nuclear ribosomal DNA (rDNA is considered as a paradigm of concerted evolution. Components of the rDNA tandem repeats (45S are widely used in phylogenetic studies of different organisms and the internal transcribed spacer (ITS region was recently selected as a fungal DNA bar code. However, rRNA pseudogenes, as one kind of escape from concerted evolution, were reported in a wide range of organisms, especially in plants and animals. Moreover, large numbers of 5S rRNA pseudogenes were identified in several filamentous ascomycetes. To study whether rDNA evolves in a strict concerted manner and test whether rRNA pseudogenes exist in more species of ascomycetes, intragenomic rDNA polymorphisms were analyzed using whole genome sequences. Divergent rDNA paralogs were found to coexist within a single genome in seven filamentous ascomycetes examined. A great number of paralogs were identified as pseudogenes according to the mutation and secondary structure analyses. Phylogenetic analyses of the three rRNA coding regions of the 45S rDNA repeats, i.e., 18S, 5.8S, and 28S, revealed an interspecies clustering pattern of those different rDNA paralogs. The identified rRNA pseudogenic sequences were validated using specific primers designed. Mutation analyses revealed that the repeat-induced point (RIP mutation was probably responsible for the formation of those rRNA pseudogenes.

  18. [Nucleotide receptors--structure and function, history and perspectives].

    Science.gov (United States)

    Barańska, Jolanta

    2014-01-01

    First nucleotide receptors were discovered by Geoffrey Burnstock in 70ties of the last century, as a purinoreceptors activated by ATP. It was further found that they may be activated both by purine and pyrimidine nucleotides and their name was changed to nucleotide receptors. They are divided into two fsamilies: P1, activated by adenosine and P2, activated by nucleotides which are further divided into P2X and P2Y subfamilies. P2X are ionotropic receptors activated by ATP, P2Y (as the P1) are metabotropic receptors coupled with protein G. P2Y receptors are activated by ATP, ADP, UTP, UDP and UDP-sugar derivatives. This review describes early history of extracellular nucleotide signaling studies and presents current knowledge of the particular nucleotide receptors subtypes. The article also describes the structure and functional roles of these receptors and speculates about future research and therapeutic directions in this field.

  19. Frequency and Correlation of Nearest Neighboring Nucleotides in Human Genome

    Science.gov (United States)

    Jin, Neng-zhi; Liu, Zi-xian; Qiu, Wen-yuan

    2009-02-01

    Zipf's approach in linguistics is utilized to analyze the statistical features of frequency and correlation of 16 nearest neighboring nucleotides (AA, AC, AG, ..., TT) in 12 human chromosomes (Y, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, and 12). It is found that these statistical features of nearest neighboring nucleotides in human genome: (i) the frequency distribution is a linear function, and (ii) the correlation distribution is an inverse function. The coefficients of the linear function and inverse function depend on the GC content. It proposes the correlation distribution of nearest neighboring nucleotides for the first time and extends the descriptor about nearest neighboring nucleotides.

  20. Fluoride ion promoted deprotection and transesterification in nucleotide triesters.

    Science.gov (United States)

    Ogilvie, K K; Beaucage, S L

    1979-10-10

    Tetrabutylammonium fluoride will remove phenyl, trichloroethyl and cyanoethyl groups from nucleotides. In addition to the desired nucleotide products other results including chain cleavage, phosphofluoridates and cyanoethylated thymidine units may be obtained depending on the conditions used. Fluoride ion has been used to successfully exchange phenyl and trichloroethyl groups for methyl, ethyl and butyl groups in nucleotide triesters. This represents a rapid high yield route to a variety of phosphate esters. The synthesis of a novel nucleotide analogue in which two chains are bridged through their phosphates is described.

  1. Correlated Evolution of Nucleotide Positions within Splice Sites in Mammals.

    Science.gov (United States)

    Denisov, Stepan; Bazykin, Georgii; Favorov, Alexander; Mironov, Andrey; Gelfand, Mikhail

    2015-01-01

    Splice sites (SSs)--short nucleotide sequences flanking introns--are under selection for spliceosome binding, and adhere to consensus sequences. However, non-consensus nucleotides, many of which probably reduce SS performance, are frequent. Little is known about the mechanisms maintaining such apparently suboptimal SSs. Here, we study the correlations between strengths of nucleotides occupying different positions of the same SS. Such correlations may arise due to epistatic interactions between positions (i.e., a situation when the fitness effect of a nucleotide in one position depends on the nucleotide in another position), their evolutionary history, or to other reasons. Within both the intronic and the exonic parts of donor SSs, nucleotides that increase (decrease) SS strength tend to co-occur with other nucleotides increasing (respectively, decreasing) it, consistent with positive epistasis. Between the intronic and exonic parts of donor SSs, the correlations of nucleotide strengths tend to be negative, consistent with negative epistasis. In the course of evolution, substitutions at a donor SS tend to decrease the strength of its exonic part, and either increase or do not change the strength of its intronic part. In acceptor SSs, the situation is more complicated; the correlations between adjacent positions appear to be driven mainly by avoidance of the AG dinucleotide which may cause aberrant splicing. In summary, both the content and the evolution of SSs is shaped by a complex network of interdependences between adjacent nucleotides that respond to a range of sometimes conflicting selective constraints.

  2. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  3. 福建华溪蟹线粒体DNA COI和16S rRNA基因序列的遗传多样性%Genetic diversity on mitochondrial DNA COI and 16S rRNA of Sinopotamon fukienense

    Institute of Scientific and Technical Information of China (English)

    石林波; 张小燕; 汪雁; 王云龙; 周宪民; 邹节新

    2013-01-01

    目的 探讨福建华溪蟹(Sinopotamonfukienense)的遗传多样性.方法 采用PCR结合DNA测序技术,测定S.fukienense的线粒体COI和16S rRNA基因序列的组成.经比对获得639 bp长度的COI基因序列和526 bp的16S rRNA基因序列,以对比分析S.fukienense的遗传多样性.结果 S.fukienense基于COI基因核苷酸多样性(Pi)为0.048 4,高于其基于16S rRNA基因核苷酸多样性(Pi)为0.021 6.同时,S.fukienense基于COI基因单倍型间的平均遗传距离(P)为0.048,大于其基于16S rRNA基因单倍型间的平均遗传距离(P)0.026.结论 COI序列在分析S.fukienense遗传异变时的作用更优于16S rRNA基因序列.%The aim of this study was to explore the genetic diversity of the freshwater crab S.fukienense based on the gene sequence CO I and 16S rRNA.The genes of CO I and 16S rRNA were amplified with PCR and subsequently sequenced.The base composition and sequence variation of them were analyed with Mega version 4.0 and DnaSP version 4.10.We obtained 639 bp nucleotide sequence of gene COI and 526 bp nucleotide sequence of gene 16S rRNA.The nucleotide diversity based on gene COI (Pi=0.048 4) was higher than that based on 16S rRNA (Pi=0.021 6).At the same time,the average genetic distance of haplotypes based on gene COI (P=0.048) was larger than that based on 16S rRNA (P=0.026).Results suggest that the COI sequence is better than the 16S rRNA sequence in the analysis of genetic mutation for S.fukienense.

  4. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    Directory of Open Access Journals (Sweden)

    Marissa B Hirst

    Full Text Available Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of

  5. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Science.gov (United States)

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  6. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Directory of Open Access Journals (Sweden)

    Huijing Hao

    Full Text Available API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  7. Nucleotide Excision Repair in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Hannes Lans

    2011-01-01

    Full Text Available Nucleotide excision repair (NER plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vitro and live cell experiments, particularly using model systems such as bacteria, yeast, and mammalian cell cultures. In recent years, the versatility of the nematode C. elegans to study DNA damage response (DDR mechanisms including NER has become increasingly clear. In particular, C. elegans seems to be a convenient tool to study NER during the UV response in vivo, to analyze this process in the context of a developing and multicellular organism, and to perform genetic screening. Here, we will discuss current knowledge gained from the use of C. elegans to study NER and the response to UV-induced DNA damage.

  8. Human molecular cytogenetics: From cells to nucleotides.

    Science.gov (United States)

    Riegel, Mariluce

    2014-03-01

    The field of cytogenetics has focused on studying the number, structure, function and origin of chromosomal abnormalities and the evolution of chromosomes. The development of fluorescent molecules that either directly or via an intermediate molecule bind to DNA has led to the development of fluorescent in situ hybridization (FISH), a technology linking cytogenetics to molecular genetics. This technique has a wide range of applications that increased the dimension of chromosome analysis. The field of cytogenetics is particularly important for medical diagnostics and research as well as for gene ordering and mapping. Furthermore, the increased application of molecular biology techniques, such as array-based technologies, has led to improved resolution, extending the recognized range of microdeletion/microduplication syndromes and genomic disorders. In adopting these newly expanded methods, cytogeneticists have used a range of technologies to study the association between visible chromosome rearrangements and defects at the single nucleotide level. Overall, molecular cytogenetic techniques offer a remarkable number of potential applications, ranging from physical mapping to clinical and evolutionary studies, making a powerful and informative complement to other molecular and genomic approaches. This manuscript does not present a detailed history of the development of molecular cytogenetics; however, references to historical reviews and experiments have been provided whenever possible. Herein, the basic principles of molecular cytogenetics, the technologies used to identify chromosomal rearrangements and copy number changes, and the applications for cytogenetics in biomedical diagnosis and research are presented and discussed.

  9. Human molecular cytogenetics: from cells to nucleotides

    Directory of Open Access Journals (Sweden)

    Mariluce Riegel

    2014-01-01

    Full Text Available The field of cytogenetics has focused on studying the number, structure, function and origin of chromosomal abnormalities and the evolution of chromosomes. The development of fluorescent molecules that either directly or via an intermediate molecule bind to DNA has led to the development of fluorescent in situ hybridization (FISH, a technology linking cytogenetics to molecular genetics. This technique has a wide range of applications that increased the dimension of chromosome analysis. The field of cytogenetics is particularly important for medical diagnostics and research as well as for gene ordering and mapping. Furthermore, the increased application of molecular biology techniques, such as array-based technologies, has led to improved resolution, extending the recognized range of microdeletion/microduplication syndromes and genomic disorders. In adopting these newly expanded methods, cytogeneticists have used a range of technologies to study the association between visible chromosome rearrangements and defects at the single nucleotide level. Overall, molecular cytogenetic techniques offer a remarkable number of potential applications, ranging from physical mapping to clinical and evolutionary studies, making a powerful and informative complement to other molecular and genomic approaches. This manuscript does not present a detailed history of the development of molecular cytogenetics; however, references to historical reviews and experiments have been provided whenever possible. Herein, the basic principles of molecular cytogenetics, the technologies used to identify chromosomal rearrangements and copy number changes, and the applications for cytogenetics in biomedical diagnosis and research are presented and discussed.

  10. Adenine nucleotides of the stria vascularis.

    Science.gov (United States)

    Thalmann, I; Marcus, N Y; Thalmann, R

    1979-01-01

    The levels of the adenine nucleotides ATP, ADP, and AMP in the stria vascularis were measured under normal conditions, and following various durations of ischemia. The concentrations of these compounds were used for the calculation of the adenylate energy charge, the energy status and the phosphorylation state of the stria. Following 10 min of ischemia the adenylate energy charge had decreased three fold, the energy status seven fold and the phosphorylation state 14 fold. To study the potential for recovery of strial function following various brief and prolonged ischemic intervals, a method for the perfusion of the ear via the anterior inferior cerebellar artery was developed. For various reasons it was found advantageous to use "artifical blood" as perfusate, relying upon fluorocarbons as oxygen carriers. The endolymphatic potential was used as electrical indicator of strial function. Recovery of the endolymphatic potential following brief periods of ischemia was paralleled by a corresponding increase of the ATP levels and a drastic decrease of the AMP levels of the stria vascularis. Preliminary results on the effects of substrate-free perfusion are presented.

  11. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information to be ...

  12. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  13. Prebiotic nucleotide synthesis demonstration of a geologically plausible pathway

    NARCIS (Netherlands)

    Schwartz, A.W.; Veen, van der M.; Bisseling, T.; Chittenden, G.J.

    1975-01-01

    Mineral phosphate (apatite) is activated for the synthesis of nucleotides when dilute solutions containing nucleoside and ammonium oxalate are evaporated in its presence. A natural, igneous fluorapatite was found to be even more effective in nucleotide synthesis than the more soluble hydroxylapatite

  14. Mutations of mitochondrial 12S rRNA in gastric carcinoma and their significance

    Institute of Scientific and Technical Information of China (English)

    Cheng-Bo Han; Jia-Ming Ma; Yan Xin; Xiao-Yun Mao; Yu-Jie Zhao; Dong-Ying Wu; Su-Min Zhang; Yu-Kui Zhang

    2005-01-01

    AIM: To detect the variations of mitochondrial 12S rRNA in patients with gastric carcinoma, and to study their significance and the relationship between these variations and the genesis of gastric carcinoma.METHODS: PCR amplified mitochondrial 12S rRNA of 44 samples including 22 from gastric carcinoma tissues and 22 from adjacent normal tissues, was detected by direct DNA sequencing. Then laser capture microdissection technique (LCM) was used to separate the cancerous cells and dysplasia cells with specific mutations. Denaturing high performance liquid chromatography (DHPLC) plus allele-specific PCR (ASPCR), nest-PCR and polyacrylamide gel electrophoresis (PAGE)were used to further evaluate this mutant property and quantitative difference of mutant type between cancerous and dysplasia cells. Finally, RNAdraw biosoft was used to analyze the RNA secondary structure of mutant-type 12S rRNA.RESULTS: Compared with Mitomap database, some new variations were found, among which np652 G insertion and np716 T-G transversion were found only in cancerous tissues.There was a statistic difference in the frequency of 12S rRNA variation between intestinal type (12/17, 70.59%) and diffusive type (5/17, 29.41%) of gastric carcinoma (P<0.05).DHPLC analysis showed that 12S rRNA np652 G insertion and np716 T-G transversion were heteroplasmic mutations.The frequency of 12S rRNA variation in cancerous cells was higher than that in dysplasia cells (P<0.01). 12S rRNA np652 G insertion showed obviously negative effects on the stability of 12S rRNA secondary structure, while others such as T-G transversion did not.CONCLUSION: The mutations of mitochondrial 12S rRNA may be associated with the occurrence of intestinal-type gastric carcinoma. Most variations exist both in gastric carcinomas and in normal tissues, and they might not be the characteristics of tumors. However, np652 G insertion and np716 T-G transversion may possess some molecular significance in gastric carcinogenesis. During

  15. Rapid in vivo exploration of a 5S rRNA neutral network.

    Science.gov (United States)

    Zhang, Zhengdong D; Nayar, Madhavi; Ammons, David; Rampersad, Joanne; Fox, George E

    2009-02-01

    A partial knockout compensation method to screen 5S ribosomal RNA sequence variants in vivo is described. The system utilizes an Escherichia coli strain in which five of eight genomic 5S rRNA genes were deleted in conjunction with a plasmid which is compensatory when carrying a functionally active 5S rRNA. The partial knockout strain is transformed with a population of potentially compensatory plasmids each carrying a randomly generated 5S rRNA gene variant. a The ability to compensate the slow growth rate of the knockout strain is used in conjunction with sequencing to rapidly identify variant 5S rRNAs that are functional as well as those that likely are not. The assay is validated by showing that the growth rate of 15 variants separately expressed in the partial knockout strain can be accurately correlated with in vivo assessments of the potential validity of the same variants. A region of 5S rRNA was mutagenized with this approach and nine novel variants were recovered and characterized. Unlike a complete knockout system, the method allows recovery of both deleterious and functional variants.. The method can be used to study variants of any 5S rRNA in the E. coli context including those of E. coli.

  16. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA.

    Science.gov (United States)

    Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W Brad

    2009-05-01

    Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element.

  18. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  19. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    Science.gov (United States)

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  20. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    Directory of Open Access Journals (Sweden)

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  1. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  2. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation.

    Directory of Open Access Journals (Sweden)

    A Murat Eren

    Full Text Available BACKGROUND: Bacterial vaginosis (BV is an enigmatic disease of unknown origin that affects a large percentage of women. The vaginal microbiota of women with BV is associated with serious sequelae, including abnormal pregnancies. The etiology of BV is not fully understood, however, it has been suggested that it is transmissible, and that G. vaginalis may be an etiological agent. Studies using enzymatic assays to define G. vaginalis biotypes, as well as more recent genomic comparisons of G. vaginalis isolates from symptomatic and asymptomatic women, suggest that particular G. vaginalis strains may play a key role in the pathogenesis of BV. METHODOLOGY/PRINCIPAL FINDINGS: To explore G. vaginalis diversity, distribution and sexual transmission, we developed a Shannon entropy-based method to analyze low-level sequence variation in 65,710 G. vaginalis 16S rRNA gene segments that were PCR-amplified from vaginal samples of 53 monogamous women and from urethral and penile skin samples of their male partners. We observed a high degree of low-level diversity among G. vaginalis sequences with a total of 46 unique sequence variants (oligotypes, and also found strong correlations of these oligotypes between sexual partners. Even though Gram stain-defined normal and some Gram stain-defined intermediate oligotype profiles clustered together in UniFrac analysis, no single G. vaginalis oligotype was found to be specific to BV or normal vaginal samples. CONCLUSIONS: This study describes a novel method for investigating G. vaginalis diversity at a low level of taxonomic discrimination. The findings support cultivation-based studies that indicate sexual partners harbor the same strains of G. vaginalis. This study also highlights the fact that a few, reproducible nucleotide variations within the 16S rRNA gene can reveal clinical or epidemiological associations that would be missed by genus-level or species-level categorization of 16S rRNA data.

  3. Caracterização da região espaçadora 16-23S rDNA para diferenciação de estirpes de rizóbios utilizadas na produção de inoculantes comerciais no Brasil Characterization of the spacer region 16-23S rDNA for differentiation of strains of rhizobia used in the production of commercial inoculants in Brazil

    Directory of Open Access Journals (Sweden)

    Andréia Mara Rotta Oliveira

    2012-08-01

    Full Text Available A identificação de estirpes de rizóbio tem sido feita pela especificidade por hospedeiros e ensaios microbiológicos tradicionais. Por constituírem um grupo filogeneticamente heterogêneo, diferentes técnicas moleculares têm sido empregadas para auxiliar na caracterização genética e na identificação de estirpes eficientes e competitivas para a produção de inoculantes. Este trabalho teve por objetivos caracterizar a região espaçadora 16S-23S rDNA das estirpes de rizóbios utilizadas nos inoculantes comercializados no Brasil para espécies leguminosas, utilizando a técnica da PCR em combinação com a de RFLP, e avaliar a possibilidade do uso desse marcador molecular como método auxiliar para identificação das estipes. A amplificação da região espaçadora 16-23 S rDNA das estirpes de rizóbios gerou fragmentos com tamanhos que variaram entre 700pb e 1350pb. Os produtos resultantes da amplificação foram submetidos à digestão com as endonucleases. Mps I, Dde I e Hae III. Os resultados obtidos neste estudo indicam a possibilidade do uso da técnica de PCR-RFLP da região espaçadora 16S-23S rDNA como marcador molecular para a diferenciar as estirpes de rizóbios, em complemento às técnicas microbiológicas tradicionais. Contudo, este marcador não é suficientemente discriminatório para ser usado na identificação das estirpes recomendadas para a produção de inoculantes comerciais.The identification of strains of rhizobia has been made by host specificity and regular microbiological tests. By forming a phylogenetically heterogeneous group, different molecular techniques have been employed to assist in the genetic characterization and identification of efficient and competitive strains for production of inoculants. This study aimed to characterize the spacer region 16S-23S rDNA of the strains of rhizobia used in commercial inoculants in Brazil for legume species, using PCR combined with RFLP, and assess the possibility

  4. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  5. Empirical Bayes analysis of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ickstadt Katja

    2008-03-01

    Full Text Available Abstract Background An important goal of whole-genome studies concerned with single nucleotide polymorphisms (SNPs is the identification of SNPs associated with a covariate of interest such as the case-control status or the type of cancer. Since these studies often comprise the genotypes of hundreds of thousands of SNPs, methods are required that can cope with the corresponding multiple testing problem. For the analysis of gene expression data, approaches such as the empirical Bayes analysis of microarrays have been developed particularly for the detection of genes associated with the response. However, the empirical Bayes analysis of microarrays has only been suggested for binary responses when considering expression values, i.e. continuous predictors. Results In this paper, we propose a modification of this empirical Bayes analysis that can be used to analyze high-dimensional categorical SNP data. This approach along with a generalized version of the original empirical Bayes method are available in the R package siggenes version 1.10.0 and later that can be downloaded from http://www.bioconductor.org. Conclusion As applications to two subsets of the HapMap data show, the empirical Bayes analysis of microarrays cannot only be used to analyze continuous gene expression data, but also be applied to categorical SNP data, where the response is not restricted to be binary. In association studies in which typically several ten to a few hundred SNPs are considered, our approach can furthermore be employed to test interactions of SNPs. Moreover, the posterior probabilities resulting from the empirical Bayes analysis of (prespecified interactions/genotypes can also be used to quantify the importance of these interactions.

  6. Nucleotide excision repair in differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail: l.mullenders@lumc.nl

    2007-01-03

    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  7. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    Science.gov (United States)

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  8. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  9. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    Directory of Open Access Journals (Sweden)

    Shu Wu

    Full Text Available Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9 within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%; and could aid in species-level analyses, but with some limitations; 2 nearly-whole-length sequences and some partial regions (around V2, V4, and V9 of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%; 3 compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%; and 4 V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  10. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    Science.gov (United States)

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  11. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    Directory of Open Access Journals (Sweden)

    Seung Hak Yang

    2015-09-01

    Full Text Available The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site.

  12. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Science.gov (United States)

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  13. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose

    OpenAIRE

    Rozier, Claude; Mache, Régis

    1984-01-01

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20° C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloropl...

  14. Phylogeny of protostome worms derived from 18S rRNA sequences.

    Science.gov (United States)

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  15. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  16. Identifying 2'-O-methylationation sites by integrating nucleotide chemical properties and nucleotide compositions.

    Science.gov (United States)

    Chen, Wei; Feng, Pengmian; Tang, Hua; Ding, Hui; Lin, Hao

    2016-06-01

    2'-O-methylationation is an important post-transcriptional modification and plays important roles in many biological processes. Although experimental technologies have been proposed to detect 2'-O-methylationation sites, they are cost-ineffective. As complements to experimental techniques, computational methods will facilitate the identification of 2'-O-methylationation sites. In the present study, we proposed a support vector machine-based method to identify 2'-O-methylationation sites. In this method, RNA sequences were formulated by nucleotide chemical properties and nucleotide compositions. In the jackknife cross-validation test, the proposed method obtained an accuracy of 95.58% for identifying 2'-O-methylationation sites in the human genome. Moreover, the model was also validated by identifying 2'-O-methylation sites in the Mus musculus and Saccharomyces cerevisiae genomes, and the obtained accuracies are also satisfactory. These results indicate that the proposed method will become a useful tool for the research on 2'-O-methylation.

  17. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  18. Frequency and Correlation of Nearest Neighboring Nucleotides in Human Genome

    Institute of Scientific and Technical Information of China (English)

    Neng-zhi Jin; Zi-xian Liu; Wen-yuan Qiu

    2009-01-01

    Zipf's approach in linguistics is utilized to analyze the statistical features of frequency and mosomes (Y, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, and 12). It is found that these statistical features of nearest neighboring nucleotides in human genome: (ⅰ) the frequency distribution is a linear function, and (ⅱ) the correlation distribution is an inverse function. The coeffi-cients of the linear function and inverse function depend on the GC content. It proposes the correlation distribution of nearest neighboring nucleotides for the first time and extends the descriptor about nearest neighboring nucleotides.

  19. Building phylogenetic trees by using gene Nucleotide Genomic Signals.

    Science.gov (United States)

    Cristea, Paul Dan

    2012-01-01

    Nucleotide genomic signal (NuGS) methodology allows a molecular level approach to determine distances between homologous genes or between conserved equivalent non-coding genome regions in various species or individuals of the same species. Therefore, distances between the genes of species or individuals can be computed and phylogenetic trees can be built. The paper illustrates the use of the nucleotide imbalance (N) and nucleotide pair imbalance (P) signals to determine the distances between the genes of several Hominidae. The results are in accordance with those of other genetic or phylogenetic approaches to establish distances between Hominidae species.

  20. Caracterização de rizóbios indicados para produção de inoculantes por meio de sequenciamento parcial do 16S rRNA Characterization of rhizobia indicated for inoculant production using 16S rRNA partial sequencing

    Directory of Open Access Journals (Sweden)

    Bethânia Figueiredo Barbosa de Toledo

    2009-04-01

    Full Text Available O objetivo deste trabalho foi confrontar as sequências parciais do gene 16S rRNA de estirpes padrão de rizóbios com as de estirpes recomendadas para a produção de inoculantes no Brasil, com vistas à verificação da confiabilidade do sequenciamento parcial desse gene para a identificação rápida de estirpes. Foram realizados sequenciamentos através de reação em cadeia da polimerase (PCR com iniciadores relativos à região codificadora do gene 16S rRNA entre as bactérias estudadas. Os resultados foram analisados pela consulta de similaridade de nucleotídeos aos do "Basic Local Alignment Search Tool" (Blastn e por meio da interpretação de árvores filogenéticas geradas usando ferramentas de bioinformática. A classificação taxonômica das estirpes Semia recomendadas para inoculação de leguminosas com base em propriedades morfológicas e especificidade hospedeira não foi confirmada em todas as estirpes. A maioria das estirpes estudadas, consultadas no Blastn, é consistente com a classificação proposta pela construção de árvores filogenéticas das sequências destas estirpes, com base na similaridade pelo sequenciamento parcial do gene considerado.The aim of this work was to compare the partial sequences of 16S rRNA gene of rhizobia strain patterns already classified with strains recommended for the production of inoculants in Brazil, in order to verify the reliability of partial sequencing of the gene for the purpose of rapid identification of strains. Polymerase Chain Reaction (PCR sequencing using primers on the coding region of the 16S rRNA gene among the bacteria studied was conducted. The results were analyzed by consulting the nucleotides' similarity based on Basic Local Alignment Search Tool (Blastn and by interpreting the phylogenetic trees generated by bioinformatic tools. The taxonomic classification of Semia strains recommended for legume inoculation based on morphological properties and host specificity was

  1. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  2. Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine

    Energy Technology Data Exchange (ETDEWEB)

    Demirci, H.; Gregory, S; Dahlberg, A; Jogl, G

    2008-01-01

    Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N{sup 2}-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate.

  3. Molecular analysis of 16S rRNA genes identifies potentially periodontal pathogenic bacteria and archaea in the plaque of partially erupted third molars.

    Science.gov (United States)

    Mansfield, J M; Campbell, J H; Bhandari, A R; Jesionowski, A M; Vickerman, M M

    2012-07-01

    Small subunit rRNA sequencing and phylogenetic analysis were used to identify cultivable and uncultivable microorganisms present in the dental plaque of symptomatic and asymptomatic partially erupted third molars to determine the prevalence of putative periodontal pathogens in pericoronal sites. Template DNA prepared from subgingival plaque collected from partially erupted symptomatic and asymptomatic mandibular third molars and healthy incisors was used in polymerase chain reaction with broad-range oligonucleotide primers to amplify 16S rRNA bacterial and archaeal genes. Amplicons were cloned, sequenced, and compared with known nucleotide sequences in online databases to identify the microorganisms present. Two thousand three hundred two clones from the plaque of 12 patients carried bacterial sequences from 63 genera belonging to 11 phyla, including members of the uncultivable TM7, SR1, and Chloroflexi, and difficult-to-cultivate Synergistetes and Spirochaetes. Dialister invisus, Filifactor alocis, Fusobacterium nucleatum, Porphyromonas endodontalis, Prevotella denticola, Tannerella forsythia, and Treponema denticola, which have been associated with periodontal disease, were found in significantly greater abundance in pericoronal compared with incisor sites. Dialister invisus and F nucleatum were found in greater abundance in sites exhibiting clinical symptoms. The archaeal species, Methanobrevibacter oralis, which has been associated with severe periodontitis, was found in 3 symptomatic patients. These findings have provided new insights into the complex microbiota of pericoronitis. Several bacterial and archaeal species implicated in periodontal disease were recovered in greater incidence and abundance from the plaque of partially erupted third molars compared with incisors, supporting the hypothesis that the pericoronal region may provide a favored niche for periodontal pathogens in otherwise healthy mouths. Copyright © 2012 American Association of Oral and

  4. An unusual 5S rRNA, from Sulfolobus acidocaldarius, and its implications for a general 5S rRNA structure.

    OpenAIRE

    Stahl, D A; Luehrsen, K R; Woese, C R; Pace, N R

    1981-01-01

    The nucleotide sequence of the 5S ribosomal RNA of the thermoacidophilic archaebacterium Sulfolobus acidocaldarius was determined. The high degree of evident secondary structure in the molecule has implications for the common higher order structure of other 5S rRNAs, both bacterial and eukaryotic.

  5. An unusual 5S rRNA, from Sulfolobus acidocaldarius, and its implications for a general 5S rRNA structure.

    OpenAIRE

    Stahl, D A; Luehrsen, K R; Woese, C R; Pace, N R

    1981-01-01

    The nucleotide sequence of the 5S ribosomal RNA of the thermoacidophilic archaebacterium Sulfolobus acidocaldarius was determined. The high degree of evident secondary structure in the molecule has implications for the common higher order structure of other 5S rRNAs, both bacterial and eukaryotic.

  6. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    Science.gov (United States)

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  7. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    NARCIS (Netherlands)

    Ziesemer, K.A.; Mann, A.E.; Sankaranarayanan, K.; Schroeder, H.; Ozga, A.T.; Brandt, B.W.; Zaura, E.; Waters-Rist, A.; Hoogland, M.; Salazar-García, D.C.; Aldenderfer, M.; Speller, C.; Hendy, J.; Weston, D.A.; MacDonald, S.J.; Thomas, G.H.; Collins, M.J.; Lewis, C.M.; Hofman, C.; Warinner, C.

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gen

  8. Rapid identification of rumen protozoa by restriction analysis of amplified 18S rRNA gene

    NARCIS (Netherlands)

    Regensbogenova, M.; Kisidayova, S.; Michalowski, T.; Javorsky, P.; Moon-van der Staay, S.Y.; Hackstein, J.H.P.; McEwan, N.R.; Jouany, J.P.; Newbold, J.C.; Pristas, P.

    2004-01-01

    A rapid method has been developed for molecular identification of rumen ciliates without the need for cultivation. Total DNA was isolated from single protozoal cells by the Chelex method and nearly complete protozoal 18S rRNA genes were amplified and subjected to restriction fragment length polymorp

  9. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    Science.gov (United States)

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  10. NOF1 encodes an Arabidopsis protein involved in the control of rRNA expression.

    Directory of Open Access Journals (Sweden)

    Erwana Harscoët

    Full Text Available The control of ribosomal RNA biogenesis is essential for the regulation of protein synthesis in eukaryotic cells. Here, we report the characterization of NOF1 that encodes a putative nucleolar protein involved in the control of rRNA expression in Arabidopsis. The gene has been isolated by T-DNA tagging and its function verified by the characterization of a second allele and genetic complementation of the mutants. The nof1 mutants are affected in female gametogenesis and embryo development. This result is consistent with the detection of NOF1 mRNA in all tissues throughout plant life's cycle, and preferentially in differentiating cells. Interestingly, the closely related proteins from zebra fish and yeast are also necessary for cell division and differentiation. We showed that the nof1-1 mutant displays higher rRNA expression and hypomethylation of rRNA promoter. Taken together, the results presented here demonstrated that NOF1 is an Arabidopsis gene involved in the control of rRNA expression, and suggested that it encodes a putative nucleolar protein, the function of which may be conserved in eukaryotes.

  11. Direct regulation of rRNA transcription by fibroblast growth factor 2.

    Science.gov (United States)

    Sheng, Zhi; Liang, Yanping; Lin, Chih-Yin; Comai, Lucio; Chirico, William J

    2005-11-01

    Fibroblast growth factor 2 (FGF-2), which is highly expressed in developing tissues and malignant cells, regulates cell growth, differentiation, and migration. Five isoforms (18 to approximately 34 kDa) of FGF-2 are derived from alternative initiation codons of a single mRNA. The 18-kDa FGF-2 isoform is released from cells by a nonclassical secretory pathway and regulates gene expression by binding to cell surface receptors. This isoform also localizes to the nucleolus, raising the possibility that it may directly regulate ribosome biogenesis, a rate-limiting process in cell growth. Although several growth factors have been shown to accumulate in the nucleolus, their function and mechanism of action remain unclear. Here we show that 18-kDa FGF-2 interacts with upstream binding factor (UBF), an architectural transcription factor essential for rRNA transcription. The maximal activation of rRNA transcription in vitro by 18-kDa FGF-2 requires UBF. The 18-kDa FGF-2 localizes to rRNA genes and is necessary for the full activation of pre-rRNA synthesis in vivo. Our results demonstrate that 18-kDa FGF-2 directly regulates rRNA transcription.

  12. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    Science.gov (United States)

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  13. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten;

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  14. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...

  15. Overview of the application of nucleotide in aquaculture

    Directory of Open Access Journals (Sweden)

    Hoang Do Huu

    2016-10-01

    Full Text Available Although long history application in infant formula, dietary nucleotide supplementation has been used only recently in the evaluation of growth performance, stress and pathogen resistance in aquaculture species. This paper addresses the present knowledge of the use of nucleotide supplemented in the diet for culture species. Research reveals that dietary nucleotide may have significant impact and is recommended to add to the feed of aquatic species to get better performance. However, more studies should also be conducted to have better understandings on dose requirement, duration of application, impact on different life stage and under different environmental stress and pathogens. Further study should also examine the effects of dietary nucleotide supplementation of intestinal microbiota and gut morphology, and immune response of aquaculture species.

  16. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  17. Overview of the application of nucleotide in aquaculture

    Institute of Scientific and Technical Information of China (English)

    Hoang Do Huu

    2016-01-01

    Although long history application in infant formula, dietary nucleotide supplementation has been used only recently in the evaluation of growth performance, stress and pathogen resistance in aquaculture species. This paper addresses the present knowledge of the use of nucleotide supplemented in the diet for culture species. Research reveals that dietary nucleotide may have significant impact and is recommended to add to the feed of aquatic species to get better performance. However, more studies should also be conducted to have better understandings on dose requirement, duration of application, impact on different life stage and under different environmental stress and pathogens. Further study should also examine the effects of dietary nucleotide supplementation of intestinal microbiota and gut morphology, and immune response of aquaculture species.

  18. Association study of nonsynonymous single nucleotide polymorphisms in schizophrenia

    DEFF Research Database (Denmark)

    Carrera, Noa; Arrojo, Manuel; Sanjuán, Julio

    2012-01-01

    Genome-wide association studies using several hundred thousand anonymous markers present limited statistical power. Alternatively, association studies restricted to common nonsynonymous single nucleotide polymorphisms (nsSNPs) have the advantage of strongly reducing the multiple testing problem, ...

  19. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  20. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    Science.gov (United States)

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  1. Bioinformatics and molecular dynamics simulation study of L1 stalk non-canonical rRNA elements: kink-turns, loops, and tetraloops.

    Science.gov (United States)

    Krepl, Miroslav; Réblová, Kamila; Koča, Jaroslav; Sponer, Jiří

    2013-05-09

    The L1 stalk is a prominent mobile element of the large ribosomal subunit. We explore the structure and dynamics of its non-canonical rRNA elements, which include two kink-turns, an internal loop, and a tetraloop. We use bioinformatics to identify the L1 stalk RNA conservation patterns and carry out over 11.5 μs of MD simulations for a set of systems ranging from isolated RNA building blocks up to complexes of L1 stalk rRNA with the L1 protein and tRNA fragment. We show that the L1 stalk tetraloop has an unusual GNNA or UNNG conservation pattern deviating from major GNRA and YNMG RNA tetraloop families. We suggest that this deviation is related to a highly conserved tertiary contact within the L1 stalk. The available X-ray structures contain only UCCG tetraloops which in addition differ in orientation (anti vs syn) of the guanine. Our analysis suggests that the anti orientation might be a mis-refinement, although even the anti interaction would be compatible with the sequence pattern and observed tertiary interaction. Alternatively, the anti conformation may be a real substate whose population could be pH-dependent, since the guanine syn orientation requires protonation of cytosine in the tertiary contact. In absence of structural data, we use molecular modeling to explore the GCCA tetraloop that is dominant in bacteria and suggest that the GCCA tetraloop is structurally similar to the YNMG tetraloop. Kink-turn Kt-77 is unusual due to its 11-nucleotide bulge. The simulations indicate that the long bulge is a stalk-specific eight-nucleotide insertion into consensual kink-turn only subtly modifying its structural dynamics. We discuss a possible evolutionary role of helix H78 and a mechanism of L1 stalk interaction with tRNA. We also assess the simulation methodology. The simulations provide a good description of the studied systems with the latest bsc0χOL3 force field showing improved performance. Still, even bsc0χOL3 is unable to fully stabilize an essential

  2. The effect of mitochondrial dysfunction on cytosolic nucleotide metabolism

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Lykke, Anne; Rasmussen, Lene Juel

    2010-01-01

    of cytosolic ribonucleotides and deoxyribonucleotides, which in turn can result in aberrant RNA and DNA synthesis. Mitochondrial dysfunction has been linked to genomic instability, and it is possible that the limiting effect of mitochondrial dysfunction on the levels of nucleotides and resulting aberrant RNA...... and DNA synthesis in part can be responsible for this link. This paper summarizes the parts of the metabolic pathways responsible for nucleotide metabolism that can be affected by mitochondrial dysfunction....

  3. Nucleotide binding switches the information flow in ras GTPases.

    Science.gov (United States)

    Raimondi, Francesco; Portella, Guillem; Orozco, Modesto; Fanelli, Francesca

    2011-03-01

    The Ras superfamily comprises many guanine nucleotide-binding proteins (G proteins) that are essential to intracellular signal transduction. The guanine nucleotide-dependent intrinsic flexibility patterns of five G proteins were investigated in atomic detail through Molecular Dynamics simulations of the GDP- and GTP-bound states (S(GDP) and S(GTP), respectively). For all the considered systems, the intrinsic flexibility of S(GDP) was higher than that of S(GTP), suggesting that Guanine Exchange Factor (GEF) recognition and nucleotide switch require higher amplitude motions than effector recognition or GTP hydrolysis. Functional mode, dynamic domain, and interaction energy correlation analyses highlighted significant differences in the dynamics of small G proteins and Gα proteins, especially in the inactive state. Indeed, S(GDP) of Gα(t), is characterized by a more extensive energy coupling between nucleotide binding site and distal regions involved in GEF recognition compared to small G proteins, which attenuates in the active state. Moreover, mechanically distinct domains implicated in nucleotide switch could be detected in the presence of GDP but not in the presence of GTP. Finally, in small G proteins, functional modes are more detectable in the inactive state than in the active one and involve changes in solvent exposure of two highly conserved amino acids in switches I and II involved in GEF recognition. The average solvent exposure of these amino acids correlates in turn with the rate of GDP release, suggesting for them either direct or indirect roles in the process of nucleotide switch. Collectively, nucleotide binding changes the information flow through the conserved Ras-like domain, where GDP enhances the flexibility of mechanically distinct portions involved in nucleotide switch, and favors long distance allosteric communication (in Gα proteins), compared to GTP.

  4. Nucleotide binding switches the information flow in ras GTPases.

    Directory of Open Access Journals (Sweden)

    Francesco Raimondi

    2011-03-01

    Full Text Available The Ras superfamily comprises many guanine nucleotide-binding proteins (G proteins that are essential to intracellular signal transduction. The guanine nucleotide-dependent intrinsic flexibility patterns of five G proteins were investigated in atomic detail through Molecular Dynamics simulations of the GDP- and GTP-bound states (S(GDP and S(GTP, respectively. For all the considered systems, the intrinsic flexibility of S(GDP was higher than that of S(GTP, suggesting that Guanine Exchange Factor (GEF recognition and nucleotide switch require higher amplitude motions than effector recognition or GTP hydrolysis. Functional mode, dynamic domain, and interaction energy correlation analyses highlighted significant differences in the dynamics of small G proteins and Gα proteins, especially in the inactive state. Indeed, S(GDP of Gα(t, is characterized by a more extensive energy coupling between nucleotide binding site and distal regions involved in GEF recognition compared to small G proteins, which attenuates in the active state. Moreover, mechanically distinct domains implicated in nucleotide switch could be detected in the presence of GDP but not in the presence of GTP. Finally, in small G proteins, functional modes are more detectable in the inactive state than in the active one and involve changes in solvent exposure of two highly conserved amino acids in switches I and II involved in GEF recognition. The average solvent exposure of these amino acids correlates in turn with the rate of GDP release, suggesting for them either direct or indirect roles in the process of nucleotide switch. Collectively, nucleotide binding changes the information flow through the conserved Ras-like domain, where GDP enhances the flexibility of mechanically distinct portions involved in nucleotide switch, and favors long distance allosteric communication (in Gα proteins, compared to GTP.

  5. Growth increase of Arabidopsis by forced expression of rice 45S rRNA gene.

    Science.gov (United States)

    Makabe, So; Motohashi, Reiko; Nakamura, Ikuo

    2017-02-01

    Forced expression of rice 45S rRNA gene conferred ca. 2-fold increase of above-ground growth in transgenic Arabidopsis . This growth increase was probably brought by cell proliferation, not by cell enlargement. Recent increase in carbon dioxide emissions is causing global climate change. The use of plant biomass as alternative energy source is one way to reduce these emissions. Therefore, reinforcement of plant biomass production is an urgent key issue to overcome both depletion of fossil energies and emission of carbon dioxide. Here, we created transgenic Arabidopsis with a 2-fold increase in above-ground growth by forced expression of the rice 45S rRNA gene using the maize ubiquitin promoter. Although the size of guard cells and ploidy of leaf-cells were similar between transgenic and control plants, numbers of stomata and pavement cells were much increased in the transgenic leaf. This data suggested that cell number, not cell expansion, was responsible for the growth increase, which might be brought by the forced expression of exogenous and full-length 45S rRNA gene. The expression level of rice 45S rRNA transcripts was very low, possibly triggering unknown machinery to enhance cell proliferation. Although microarray analysis showed enhanced expression of ethylene-responsive transcription factors, these factors might respond to ethylene induced by abiotic/biotic stresses or genomic incompatibility, which might be involved in the expression of species-specific internal transcribed spacer (ITS) sequences within rice 45S rRNA transcripts. Further analysis of the mechanism underlying the growth increase will contribute to understanding the regulation of the cell proliferation and the mechanism of hybrid vigor.

  6. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Directory of Open Access Journals (Sweden)

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  7. Evidence for autophagy-dependent pathways of rRNA turnover in Arabidopsis.

    Science.gov (United States)

    Floyd, Brice E; Morriss, Stephanie C; MacIntosh, Gustavo C; Bassham, Diane C

    2015-01-01

    Ribosomes account for a majority of the cell's RNA and much of its protein and represent a significant investment of cellular resources. The turnover and degradation of ribosomes has been proposed to play a role in homeostasis and during stress conditions. Mechanisms for the turnover of rRNA and ribosomal proteins have not been fully elucidated. We show here that the RNS2 ribonuclease and autophagy participate in RNA turnover in Arabidopsis thaliana under normal growth conditions. An increase in autophagosome formation was seen in an rns2-2 mutant, and this increase was dependent on the core autophagy genes ATG9 and ATG5. Autophagosomes and autophagic bodies in rns2-2 mutants contain RNA and ribosomes, suggesting that autophagy is activated as an attempt to compensate for loss of rRNA degradation. Total RNA accumulates in rns2-2, atg9-4, atg5-1, rns2-2 atg9-4, and rns2-2 atg5-1 mutants, suggesting a parallel role for autophagy and RNS2 in RNA turnover. rRNA accumulates in the vacuole in rns2-2 mutants. Vacuolar accumulation of rRNA was blocked by disrupting autophagy via an rns2-2 atg5-1 double mutant but not by an rns2-2 atg9-4 double mutant, indicating that ATG5 and ATG9 function differently in this process. Our results suggest that autophagy and RNS2 are both involved in homeostatic degradation of rRNA in the vacuole.

  8. Nucleotide-sugar transporters: structure, function and roles in vivo

    Directory of Open Access Journals (Sweden)

    Handford M.

    2006-01-01

    Full Text Available The glycosylation of glycoconjugates and the biosynthesis of polysaccharides depend on nucleotide-sugars which are the substrates for glycosyltransferases. A large proportion of these enzymes are located within the lumen of the Golgi apparatus as well as the endoplasmic reticulum, while many of the nucleotide-sugars are synthesized in the cytosol. Thus, nucleotide-sugars are translocated from the cytosol to the lumen of the Golgi apparatus and endoplasmic reticulum by multiple spanning domain proteins known as nucleotide-sugar transporters (NSTs. These proteins were first identified biochemically and some of them were cloned by complementation of mutants. Genome and expressed sequence tag sequencing allowed the identification of a number of sequences that may encode for NSTs in different organisms. The functional characterization of some of these genes has shown that some of them can be highly specific in their substrate specificity while others can utilize up to three different nucleotide-sugars containing the same nucleotide. Mutations in genes encoding for NSTs can lead to changes in development in Drosophila melanogaster or Caenorhabditis elegans, as well as alterations in the infectivity of Leishmania donovani. In humans, the mutation of a GDP-fucose transporter is responsible for an impaired immune response as well as retarded growth. These results suggest that, even though there appear to be a fair number of genes encoding for NSTs, they are not functionally redundant and seem to play specific roles in glycosylation.

  9. Mammalian mismatches in nucleotide metabolism: implications for xenotransplantation.

    Science.gov (United States)

    Khalpey, Zain; Yuen, Ada H Y; Lavitrano, Marialuisa; McGregor, Christopher G A; Kalsi, Kameljit K; Yacoub, Magdi H; Smolenski, Ryszard T

    2007-10-01

    Acute humoral rejection (AHR) limits the clinical application of animal organs for xenotransplantation. Mammalian disparities in nucleotide metabolism may contribute significantly to the microvascular component in AHR; these, however remain ill-defined. We evaluated the extent of species-specific differences in nucleotide metabolism. HPLC analysis was performed on venous blood samples (nucleotide metabolites) and heart biopsies (purine enzymes) from wild type mice, rats, pigs, baboons, and human donors.Ecto-5'-nucleotidase (E5'N) activities were 4-fold lower in pigs and baboon hearts compared to human and mice hearts while rat activity was highest. Similar differences between pigs and humans were also observed with kidneys and endothelial cells. More than 10-fold differences were observed with other purine enzymes. AMP deaminase (AMPD) activity was exceptionally high in mice but very low in pig and baboon hearts. Adenosine deaminase (ADA) activity was highest in baboons. Adenosine kinase (AK) activity was more consistent across different species. Pig blood had the highest levels of hypoxanthine, inosine and adenine. Human blood uric acid concentration was almost 100 times higher than in other species studied. We conclude that species-specific differences in nucleotide metabolism may affect compatibility of pig organs within a human metabolic environment. Furthermore, nucleotide metabolic mismatches may affect clinical relevance of animal organ transplant models. Supplementation of deficient precursors or application of inhibitors of nucleotide metabolism (e.g., allopurinol) or transgenic upregulation of E5'N may overcome some of these differences.

  10. Phylogenetic diversity of rhizobia associated with horsegram [Macrotyloma uniflorum (Lam.) Verdc.] grown in South India based on glnII, recA and 16S-23S intergenic sequence analyses.

    Science.gov (United States)

    Appunu, Chinnaswamy; Ganesan, Govindan; Kalita, Michał; Kaushik, Raghavan; Saranya, Balamurugan; Prabavathy, Vaiyapuri Ramalingam; Sudha, Nair

    2011-04-01

    Horsegram [Macrotyloma uniflorum (Lam.) Verdc.) is an important grain legume and fodder crop in India. Information on root nodule endosymbionts of this legume in India is limited. In the present study, 69 isolates from naturally occurring root nodules of horsegram collected from two agro-eco-climatic regions of South India was analyzed by generation rate, acid/alkali reaction on YMA medium, restriction fragment length polymorphism analysis of 16S-23S rDNA intergenic spacer region (IGS), and sequence analyses of IGS and housekeeping genes glnII and recA. Based on the rDNA IGS RFLP by means of three restriction enzymes rhizobia were grouped in five clusters (I-V). By sequence analysis of 16S-23S rDNA IGS identified genotypes of horsegram rhizobia were distributed into five divergent lineages of Bradyrhizobium genus which comprised (I) the IGS type IV rhizobia and valid species B. yuanmingense, (II) the strains of IGS type I and Bradyrhizobium sp. ORS 3257 isolated from Vigna sp., (III) the strains of the IGS type II and Bradyrhizobium sp. CIRADAc12 from Acacia sp., (IV) the IGS type V strains and Bradyrhizobium sp. genospecies IV, and (V) comprising genetically distinct IGS type III strains which probably represent an uncharacterized new genomic species. Nearly, 87% of indigenous horsegram isolates (IGS types I, II, III, and V) could not be related to any other species within the genus Bradyrhizobium. Phylogeny based on housekeeping glnII and recA genes confirmed those results found by the analysis of the IGS sequence. All the isolated rhizobia nodulated Macrotyloma sp. and Vigna spp., and only some of them formed nodules on Arachis hypogeae. The isolates within each IGS type varied in their ability to fix nitrogen. Selection for high symbiotic effective strains could reward horsegram production in poor soils of South India where this legume is largely cultivated.

  11. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  12. Activity profiles for marine sponge-associated bacteria obtained by 16S rRNA vs 16S rRNA gene comparisons.

    Science.gov (United States)

    Kamke, Janine; Taylor, Michael W; Schmitt, Susanne

    2010-04-01

    The phylogenetic diversity of microorganisms in marine sponges is becoming increasingly well described, yet relatively little is known about the activities of these symbionts. Given the seemingly favourable environment provided to microbes by their sponge hosts, as indicated by the extraordinarily high abundance of sponge symbionts, we hypothesized that the majority of sponge-associated bacteria are active in situ. To test this hypothesis we compared, for the first time in sponges, 16S rRNA gene- vs 16S rRNA-derived bacterial community profiles to gain insights into symbiont composition and activity, respectively. Clone libraries revealed a highly diverse bacterial community in Ancorina alata, and a much lower diversity in Polymastia sp., which were identified by electron microscopy as a high- and a low-microbial abundance sponge, respectively. Substantial overlap between DNA and RNA libraries was evident at both phylum and phylotype levels, indicating in situ activity for a large fraction of sponge-associated bacteria. This active fraction included uncultivated, sponge-specific lineages within, for example, Actinobacteria, Chloroflexi and Gemmatimonadetes. This study shows the potential of RNA vs DNA comparisons based on the 16S rRNA gene to provide insights into the activity of sponge-associated microorganisms.

  13. Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.

    Science.gov (United States)

    Ermert, Susanne; Marx, Andreas; Hacker, Stephan M

    2017-04-01

    Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.

  14. Evolution of Nucleotide Punctuation Marks: From Structural to Linear Signals.

    Science.gov (United States)

    El Houmami, Nawal; Seligmann, Hervé

    2017-01-01

    We present an evolutionary hypothesis assuming that signals marking nucleotide synthesis (DNA replication and RNA transcription) evolved from multi- to unidimensional structures, and were carried over from transcription to translation. This evolutionary scenario presumes that signals combining secondary and primary nucleotide structures are evolutionary transitions. Mitochondrial replication initiation fits this scenario. Some observations reported in the literature corroborate that several signals for nucleotide synthesis function in translation, and vice versa. (a) Polymerase-induced frameshift mutations occur preferentially at translational termination signals (nucleotide deletion is interpreted as termination of nucleotide polymerization, paralleling the role of stop codons in translation). (b) Stem-loop hairpin presence/absence modulates codon-amino acid assignments, showing that translational signals sometimes combine primary and secondary nucleotide structures (here codon and stem-loop). (c) Homopolymer nucleotide triplets (AAA, CCC, GGG, TTT) cause transcriptional and ribosomal frameshifts. Here we find in recently described human mitochondrial RNAs that systematically lack mono-, dinucleotides after each trinucleotide (delRNAs) that delRNA triplets include 2x more homopolymers than mitogenome regions not covered by delRNA. Further analyses of delRNAs show that the natural circular code X (a little-known group of 20 translational signals enabling ribosomal frame retrieval consisting of 20 codons {AAC, AAT, ACC, ATC, ATT, CAG, CTC, CTG, GAA, GAC, GAG, GAT, GCC, GGC, GGT, GTA, GTC, GTT, TAC, TTC} universally overrepresented in coding versus other frames of gene sequences), regulates frameshift in transcription and translation. This dual transcription and translation role confirms for X the hypothesis that translational signals were carried over from transcriptional signals.

  15. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    Science.gov (United States)

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.

    2015-01-01

    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  16. 基于16S和23S rDNA基因芯片检测和鉴定七种临床常见病原菌%Detection and identification of seven clinical common pathogenic bacteria by oligonucleotide microarray

    Institute of Scientific and Technical Information of China (English)

    邢建明; 张甦; 张红河; 沈翠芬; 毕丹; 李刚; 姚丽惠

    2008-01-01

    Objective Using 16S rDNA and 23S rDNA genes as the target sequences to develop a system based on oligonucleotide microarray and to detect the seven clinical pathogenic bacteria, commonly seen. Methods Double polymerase chain reaction(PCR) was applied to amplify the segments of 16S rDNA and 23S rDNA genes of the target bacteria. An oligonucleotide microarray was constructed to simultaneously detect EHEC O157:H7, Vibrio parahaemolyticus , Saimonella sp., Vibrio cholerae ,Listeria monocytogenes, Campylobacter jejuni and Shigella sp. Specificity, sensitivity and reproducibility of the microarray during detection were checked. And then microarray was used to detect the microbes in stool specimens of 81 patients with diarrhea and vomiting. Results The double PCR method could simultaneously amplify the target sequences of 16S rDNA and 23S rDNA genes of the seven pathogens. The sensitivity of the developed oligonueleotide microarray could reach 103 cfu/ml but no positive results were presented for non-targeted bacteria. The coefficients of differentiation in one lot or among different lots of the microarray slices were 3.89%-5.81%. The positive detection rate of the stool specimens by oligonucleotide microarray was 39.5 % (32/81), with a coincidence of 96.3 % (78/81) for the patients and another coincidence of 96.8% (31/32) for bacterial genus or species identification, when comparing to the results by routine bacteriological examinations. Conclusion The established assay in this study based on oligonucleotide microarray to detect the seven pathogenic bacteria has many advantages such as convenient,rapid, accurate, stable and high flux, which is suitable for clinical specimen examination and epidemiological field investigation.%目的 以细菌16S rDNA和23S rDNA基因为靶序列建立可检测临床七种常见病原菌寡核苷酸芯片系统.方法 采用双重PCR扩增标本中靶细菌16S和23S rDNA基因片段.构建能同时检测肠出血性大肠埃希菌O157:H7

  17. Insertions/deletions-associated nucleotide polymorphism in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Changjiang Guo

    2016-11-01

    Full Text Available Although high levels of within-species variation are commonly observed, a general mechanism for the origin of such variation is still lacking. Insertions and deletions (indels are a widespread feature of genomes and we hypothesize that there might be an association between indels and patterns of nucleotide polymorphism. Here, we investigate flanking sequences around 18 indels (>100bp among a large number of accessions of the plant, Arabidopsis thaliana. We found two distinct haplotypes, i.e. a nucleotide dimorphism, present around each of these indels and dimorphic haplotypes always corresponded to the indel-present/-absent patterns. In addition, the peaks of nucleotide diversity between the two divergent alleles were closely associated with these indels. Thus, there exists a close association between indels and dimorphisms. Further analysis suggests that indel-associated substitutions could be an important component of genetic variation shaping nucleotide polymorphism in Arabidopsis. Finally, we suggest a mechanism by which indels might generate these highly divergent haplotypes. This study provides evidence that nucleotide dimorphisms, which are frequently regarded as evidence of frequency-dependent selection, could be explained simply by structural variation in the genome.

  18. Moss Phylogeny Reconstruction Using Nucleotide Pangenome of Complete Mitogenome Sequences.

    Science.gov (United States)

    Goryunov, D V; Nagaev, B E; Nikolaev, M Yu; Alexeevski, A V; Troitsky, A V

    2015-11-01

    Stability of composition and sequence of genes was shown earlier in 13 mitochondrial genomes of mosses (Rensing, S. A., et al. (2008) Science, 319, 64-69). It is of interest to study the evolution of mitochondrial genomes not only at the gene level, but also on the level of nucleotide sequences. To do this, we have constructed a "nucleotide pangenome" for mitochondrial genomes of 24 moss species. The nucleotide pangenome is a set of aligned nucleotide sequences of orthologous genome fragments covering the totality of all genomes. The nucleotide pangenome was constructed using specially developed new software, NPG-explorer (NPGe). The stable part of the mitochondrial genome (232 stable blocks) is shown to be, on average, 45% of its length. In the joint alignment of stable blocks, 82% of positions are conserved. The phylogenetic tree constructed with the NPGe program is in good correlation with other phylogenetic reconstructions. With the NPGe program, 30 blocks have been identified with repeats no shorter than 50 bp. The maximal length of a block with repeats is 140 bp. Duplications in the mitochondrial genomes of mosses are rare. On average, the genome contains about 500 bp in large duplications. The total length of insertions and deletions was determined in each genome. The losses and gains of DNA regions are rather active in mitochondrial genomes of mosses, and such rearrangements presumably can be used as additional markers in the reconstruction of phylogeny.

  19. 罗氏沼虾18S rRNA基因生物素标记探针的制备及应用%Preparation and application of the biotin-labeled probe of 18S rRNA gene in Macrobrachium rosenbergii

    Institute of Scientific and Technical Information of China (English)

    高风英; 叶星; 白俊杰; 吴锐全; 劳海华; 简清; 罗建仁

    2005-01-01

    Probes are essential for study of gene expression and regulation. In this study, a method was established to prepare the biotin-labeled probe for 18S rRNA gene of freshwater prawn, Macrobrachium rosenbergii. And the labeled method was used to produce a lysozyme gene probe, then applied in analysis of lysozyme gene expression. Primers were designed according to the nucleotide sequences of 18S rRNA of Decalxxta in order to isolate the 18S rRNA gene sequences of M. rosenbergii. Total genomic DNA was isolated from hepatopancreas of the freshwater prawn. A specific DNA fragment with desired size was amplified by PCR using the total DNA as templates. The DNA fragment was inserted into pGEM-T Easy vector and sequenced. The result of BLAST and alignment analysis confirmed that the DNA fragment isolated was the 18S rRNA gene of M. rosenbergii, which was 418 nt in length.Biotin-labeled probe of the 18S rRNA was then produced by PCR using the recombinant plasmid as templates. The biotin-21-dTTP and the non-labeled dNTP were added to the PCR reaction system. Ratio of the biotin-21-dTTP and the non-labeled dTFP was 3 to 1.The yield of the labeled probe is 300 ng·μL-1. The detection limit of the probe is 60 pg. A biotin-labeled probe of lysozyme gene was prepared by the same label method, and the yield of the lysozyme gene probe is 500 ng·μL-1. These biotin-labeled probes were applied in Northern dot blotting analysis of tissue distribution of lysoyzme mRNA of M. rosenbergii. Signals were scanned and quantified by Analysis System of Biology Image. The signal intensity ratio of the lysozyme to 18S rRNA represents the relative expression level of lysozyme mRNA. The results showed that the lysozyme mRNA existed in all the tissues checked, including eye,muscle, gill, hepatopancreas, haemocytes and intestine. But lysoyzme mRNA levels varied among different tissues. The highest level was found in the intestine, and the second was in the hepatopancreas and the lowest was in the

  20. 16S rRNA beacons for bacterial monitoring during human space missions.

    Science.gov (United States)

    Larios-Sanz, Maia; Kourentzi, Katerina D; Warmflash, David; Jones, Jeffrey; Pierson, Duane L; Willson, Richard C; Fox, George E

    2007-04-01

    Microorganisms are unavoidable in space environments and their presence has, at times, been a source of problems. Concerns about disease during human space missions are particularly important considering the significant changes the immune system incurs during spaceflight and the history of microbial contamination aboard the Mir space station. Additionally, these contaminants may have adverse effects on instrumentation and life-support systems. A sensitive, highly specific system to detect, characterize, and monitor these microbial populations is essential. Herein we describe a monitoring approach that uses 16S rRNA targeted molecular beacons to successfully detect several specific bacterial groupings. This methodology will greatly simplify in-flight monitoring by minimizing sample handling and processing. We also address and provide solutions to target accessibility problems encountered in hybridizations that target 16S rRNA.

  1. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    Directory of Open Access Journals (Sweden)

    Jolanta Kwasniewska

    Full Text Available In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley by maleic hydrazide (MH cells was performed. Simultaneously fluorescence in situ hybridization (FISH with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment.

  2. A renaissance for the pioneering 16S rRNA gene

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  3. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    Science.gov (United States)

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  4. Improving oligonucleotide fingerprinting of rRNA genes by implementation of polony microarray technology

    Science.gov (United States)

    Ruegger, Paul M.; Bent, Elizabeth; Li, Wei; Jeske, Daniel R.; Cui, Xinping; Braun, Jonathan; Jiang, Tao; Borneman, James

    2012-01-01

    Improvements to oligonucleotide fingerprinting of rRNA genes (OFRG) were obtained by implementing polony microarray technology. OFRG is an array-based method for analyzing microbial community composition. Polonies are discrete clusters of DNA, produced by solid-phase PCR in hydrogels, and derived from individual, spatially isolated DNA molecules. The advantages of a polony-based OFRG method include higher throughput and reductions in the PCR-induced errors and compositional skew inherent in all other PCR-based community composition methods, including high throughput sequencing of rRNA genes. Given the similarities between polony microarrays and certain aspects of sequencing methods such as the Illumina platform, we suggest that if concepts presented in this study were implemented in high throughput sequencing protocols, a reduction of PCR-induced errors and compositional skew may be realized. PMID:22640891

  5. Chromosome mapping of H1 histone and 5S rRNA gene clusters in three species of Astyanax (Teleostei, Characiformes).

    Science.gov (United States)

    Hashimoto, D T; Ferguson-Smith, M A; Rens, W; Foresti, F; Porto-Foresti, F

    2011-01-01

    We report here on the physical mapping of the H1 histone genes (hisDNA) and the 5S ribosomal DNA (rDNA) in 3 Neotropical fish species of the genus Astyanax(A. altiparanae, A. bockmanni and A. fasciatus) and the comparative analysis of the chromosomes bearing these genes. Nucleotide analyses by sequencing of both genes were also performed. The distribution of the H1 histone genes was more conserved than that of the rRNA genes, since these were always located in the pericentromeric regions of 2 chromosome pairs. 5S rDNA was found on one of the pairs that presented an H1 histone cluster; this seems to be a conserved chromosomal feature of the genus Astyanax. In addition, individuals of A. bockmanni and A. fasciatus showed clusters of 5S rDNA on 1 pair of acrocentric chromosomes, not found in A. altiparanae. The results obtained by chromosome mapping as well as by sequencing of both genes showed that A.bockmanni is more closely related to A. fasciatus than to A. altiparanae. The results allow the characterization of cytogenetic markers for improved elucidation of the processes involved in karyotype differentiation of fish genomes. Copyright © 2011 S. Karger AG, Basel.

  6. Thinking beside the box: Should we care about the non-coding strand of the 16S rRNA gene?

    Science.gov (United States)

    Garcia-Mazcorro, Jose F; Barcenas-Walls, Jose R

    2016-08-01

    The 16S rRNA gene (16S rDNA) codes for RNA that plays a fundamental role during translation in the ribosome and is used extensively as a marker gene to establish relationships among bacteria. However, the complementary non-coding 16S rDNA (nc16S rDNA) has been ignored. An idea emerged in the course of analyzing bacterial 16S rDNA sequences in search for nucleotide composition and substitution patterns: Does the nc16S rDNA code? If so, what does it code for? More importantly: Does 16S rDNA evolution reflect its own evolution or the evolution of its counterpart nc16S rDNA? The objective of this minireview is to discuss these thoughts. nc strands often encode small RNAs (sRNAs), ancient components of gene regulation. nc16S rDNA sequences from different bacterial groups were used to search for possible matches in the Bacterial Small Regulatory RNA Database. Intriguingly, the sequence of one published sRNA obtained from Legionella pneumophila (GenBank: AE0173541) showed high non-random similarity with nc16S rDNA corresponding in part to the V5 region especially from Legionella and relatives. While the target(s) of this sRNA is unclear at the moment, its mere existence might open up a new chapter in the use of the 16S rDNA to study relationships among bacteria.

  7. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Directory of Open Access Journals (Sweden)

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  8. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    Science.gov (United States)

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general.

  9. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons.

    Science.gov (United States)

    Kiryk, Anna; Sowodniok, Katharina; Kreiner, Grzegorz; Rodriguez-Parkitna, Jan; Sönmez, Aynur; Górkiewicz, Tomasz; Bierhoff, Holger; Wawrzyniak, Marcin; Janusz, Artur K; Liss, Birgit; Konopka, Witold; Schütz, Günther; Kaczmarek, Leszek; Parlato, Rosanna

    2013-01-01

    Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer's disease (AD) and may play a role in dementia. Moreover, aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3, and dentate gyrus (DG). Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that 36 transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF) binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the DG a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving neuronal function.

  10. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    Energy Technology Data Exchange (ETDEWEB)

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  11. PCR-based bioprospecting for homing endonucleases in fungal mitochondrial rRNA genes.

    Science.gov (United States)

    Hafez, Mohamed; Guha, Tuhin Kumar; Shen, Chen; Sethuraman, Jyothi; Hausner, Georg

    2014-01-01

    Fungal mitochondrial genomes act as "reservoirs" for homing endonucleases. These enzymes with their DNA site-specific cleavage activities are attractive tools for genome editing and gene therapy applications. Bioprospecting and characterization of naturally occurring homing endonucleases offers an alternative to synthesizing artificial endonucleases. Here, we describe methods for PCR-based screening of fungal mitochondrial rRNA genes for homing endonuclease encoding sequences, and we also provide protocols for the purification and biochemical characterization of putative native homing endonucleases.

  12. Stimulation of the mouse rRNA gene promoter by a distal spacer promoter.

    OpenAIRE

    Paalman, M H; Henderson, S L; Sollner-Webb, B

    1995-01-01

    We show that the mouse ribosomal DNA (rDNA) spacer promoter acts in vivo to stimulate transcription from a downstream rRNA gene promoter. This augmentation of mammalian RNA polymerase I transcription is observed in transient-transfection experiments with three different rodent cell lines, under noncompetitive as well as competitive transcription conditions, over a wide range of template concentrations, whether or not the enhancer repeats alone stimulate or repress expression from the downstre...

  13. Novel variants of the 5S rRNA genes in Eruca sativa.

    Science.gov (United States)

    Singh, K; Bhatia, S; Lakshmikumaran, M

    1994-02-01

    The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

  14. Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias

    Directory of Open Access Journals (Sweden)

    Ovchinnikov Sergey

    2012-03-01

    Full Text Available Abstract Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic

  15. Environmental rRNA inventories miss over half of protistan diversity

    Directory of Open Access Journals (Sweden)

    Hong Sunhee

    2008-12-01

    Full Text Available Abstract Background The main tool to discover novel microbial eukaryotes is the rRNA approach. This approach has important biases, including PCR discrimination against certain rRNA gene species, which makes molecular inventories skewed relative to the source communities. The degree of this bias has not been quantified, and it remains unclear whether species missed from clone libraries could be recovered by increasing sequencing efforts, or whether they cannot be detected in principle. Here we attempt to discriminate between these possibilities by statistically analysing four protistan inventories obtained using different general eukaryotic PCR primers. Results We show that each PCR primer set-specific clone library is not a sample from the community diversity but rather from a fraction of this diversity. Therefore, even sequencing such clone libraries to saturation would only recover that fraction, which, according to the parametric models, varies between 17 ± 4% to 49 ± 10%, depending on the set of primers. The pooled data is thus qualitatively richer than individual libraries, even if normalized to the same sequencing effort. Conclusion The use of a single pair of primers leads to significant underestimation of the true community richness at all levels of taxonomic hierarchy. The majority of available protistan rRNA gene surveys likely sampled less than half of the target diversity, and might have completely missed the rest. The use of multiple PCR primers reduces this bias but does not necessarily eliminate it.

  16. 4-thiouridine inhibits rRNA synthesis and causes a nucleolar stress response.

    Science.gov (United States)

    Burger, Kaspar; Mühl, Bastian; Kellner, Markus; Rohrmoser, Michaela; Gruber-Eber, Anita; Windhager, Lukas; Friedel, Caroline C; Dölken, Lars; Eick, Dirk

    2013-10-01

    High concentrations (> 100 µM) of the ribonucleoside analog 4-thiouridine (4sU) is widely used in methods for RNA analysis like photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) and nascent messenger (m)RNA labeling (4sU-tagging). Here, we show that 4sU-tagging at low concentrations ≤ 10 µM can be used to measure production and processing of ribosomal (r)RNA. However, elevated concentrations of 4sU (> 50 µM), which are usually used for mRNA labeling experiments, inhibit production and processing of 47S rRNA. The inhibition of rRNA synthesis is accompanied by nucleoplasmic translocation of nucleolar nucleophosmin (NPM1), induction of the tumor suppressor p53, and inhibition of proliferation. We conclude that metabolic labeling of RNA by 4sU triggers a nucleolar stress response, which might influence the interpretation of results. Therefore, functional ribosome biogenesis, nucleolar integrity, and cell cycle should be addressed in 4sU labeling experiments.

  17. Proteins associated with rRNA in the Escherichia coli ribosome.

    Science.gov (United States)

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  18. Purine and pyrimidine composition in 5S rRNA and its mutational significance

    Directory of Open Access Journals (Sweden)

    Subacius Sandra Maria Rodrigues

    1998-01-01

    Full Text Available Variations observed in 5S rRNA base compositions are almost entirely due to fixation of point mutations. As a consequence, 5S rRNA size has remained relatively constant during evolution and, therefore, dependencies among the four bases can be predicted. In order to characterize the nature and to determine the degree of such dependencies, correlation analysis followed by principal component factorial analysis was conducted on a large sample of 5S rRNA sequences. The results show that the purine and pyrimidine contents tend to remain constant, so that A + G = Kpur and C + U = Kpyr. The composition of the four bases expressed now by Kpur/Kpyr relationships is also constant (Ks. These relationships imply that the behavior of the mutations in the variable sites of the molecule follows rules imposed by the chemical nature of the bases involved. Consequently, transition mutations would be more favored than substitutions in transversion sites and also than insertion-deletion (rare in 5S rRNAs, since transitions would not significantly alter the values of the Ks-index.

  19. Crystallization and X-ray diffraction data of Thermus flavus 5S rRNA helices

    Science.gov (United States)

    Vallazza, Marco; Senge, Andrea; Lippmann, Corinna; Perbandt, Markus; Betzel, Christian; Bald, Rolf; Erdmann, Volker A.

    2001-11-01

    5S rRNA is an essential component of the large ribosomal subunit in prokaryotes and eukaryotes. Its unknown function in the ribosome will eventually be revealed in part by structural studies. To promote crystallization and enhance resolution in X-ray diffraction the molecule was subdivided into five domains A-E. Several RNA oligonucleotides were chemically produced by solid-phase phosphoramidite synthesis in order to construct the domains of the 5S rRNA. An improved RNA-MPD-screen was applied in crystallization which covers a complete 2D matrix for the components used. Crystallization analysis resulted in preferred combinations of pH, polyamine, monovalent and divalent cations for short RNA molecules. Six types of crystals corresponding to the domains B, C and E of Thermus flavus 5S rRNA could be obtained which were suitable for X-ray diffraction. Four RNA helices consist of seven base pairs and two of eight base pairs. As special features, they contain two adenines in a bulge position or G : U wobble base pairs assumed to be involved in RNA-protein recognition. With an increase in crystal size an increase in resolution by X-ray analysis was observed. X-ray diffraction data were collected to 1.5 Å resolution using synchrotron radiation and cryogenic cooling techniques.

  20. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    Science.gov (United States)

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  1. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Directory of Open Access Journals (Sweden)

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  2. Inositol pyrophosphates regulate RNA polymerase I-mediated rRNA transcription in Saccharomyces cerevisiae.

    Science.gov (United States)

    Thota, Swarna Gowri; Unnikannan, C P; Thampatty, Sitalakshmi R; Manorama, R; Bhandari, Rashna

    2015-02-15

    Ribosome biogenesis is an essential cellular process regulated by the metabolic state of a cell. We examined whether inositol pyrophosphates, energy-rich derivatives of inositol that act as metabolic messengers, play a role in ribosome synthesis in the budding yeast, Saccharomyces cerevisiae. Yeast strains lacking the inositol hexakisphosphate (IP6) kinase Kcs1, which is required for the synthesis of inositol pyrophosphates, display increased sensitivity to translation inhibitors and decreased protein synthesis. These phenotypes are reversed on expression of enzymatically active Kcs1, but not on expression of the inactive form. The kcs1Δ yeast cells exhibit reduced levels of ribosome subunits, suggesting that they are defective in ribosome biogenesis. The rate of rRNA synthesis, the first step of ribosome biogenesis, is decreased in kcs1Δ yeast strains, suggesting that RNA polymerase I (Pol I) activity may be reduced in these cells. We determined that the Pol I subunits, A190, A43 and A34.5, can accept a β-phosphate moiety from inositol pyrophosphates to undergo serine pyrophosphorylation. Although there is impaired rRNA synthesis in kcs1Δ yeast cells, we did not find any defect in recruitment of Pol I on rDNA, but observed that the rate of transcription elongation was compromised. Taken together, our findings highlight inositol pyrophosphates as novel regulators of rRNA transcription.

  3. The Role of 16S rRNA Gene Sequencing in Confirmation of Suspected Neonatal Sepsis.

    Science.gov (United States)

    El Gawhary, Somaia; El-Anany, Mervat; Hassan, Reem; Ali, Doaa; El Gameel, El Qassem

    2016-02-01

    Different molecular assays for the detection of bacterial DNA in the peripheral blood represented a diagnostic tool for neonatal sepsis. We targeted to evaluate the role of 16S rRNA gene sequencing to screen for bacteremia to confirm suspected neonatal sepsis (NS) and compare with risk factors and septic screen testing. Sixty-two neonates with suspected NS were enrolled. White blood cells count, I/T ratio, C-reactive protein, blood culture and 16S rRNA sequencing were performed. Blood culture was positive in 26% of cases, and PCR was positive in 26% of cases. Evaluation of PCR for the diagnosis of NS showed sensitivity 62.5%, specificity 86.9%, PPV 62.5%, NPV 86.9% and accuracy of 79.7%. 16S rRNA PCR increased the sensitivity of detecting bacterial DNA in newborns with signs of sepsis from 26 to 35.4%, and its use can be limited to cases with the most significant risk factors and positive septic screen. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Improved identification of Gordonia, Rhodococcus and Tsukamurella species by 5'-end 16S rRNA gene sequencing.

    Science.gov (United States)

    Wang, Tao; Kong, Fanrong; Chen, Sharon; Xiao, Meng; Sorrell, Tania; Wang, Xiaoyan; Wang, Shuo; Sintchenko, Vitali

    2011-01-01

    The identification of fastidious aerobic Actinomycetes such as Gordonia, Rhodococcus, and Tsukamurella has remained a challenge leading to clinically significant misclassifications. This study is intended to examine the feasibility of partial 5'-end 16S rRNA gene sequencing for the identification of Gordonia, Rhodococcus, and Tsukamurella, and defined potential reference sequences for species from each of these genera. The 16S rRNA gene sequence based identification algorithm for species identification was used and enhanced by aligning test sequences with reference sequences from the List of Prokaryotic Names with Standing in Nomenclature. Conventional PCR based 16S rRNA gene sequencing and the alignment of the isolate 16S rRNA gene sequence with reference sequences accurately identified 100% of clinical strains of aerobic Actinomycetes. While partial 16S rRNA gene sequences of reference type strains matched with the 16S rRNA gene sequences of 19 isolates in our data set, another 13 strains demonstrated a degree of polymorphism with a 1-4 bp difference in the regions of difference. 5'-end 606 bp 16S rRNA gene sequencing, coupled with the assignment of well defined reference sequences to clinically relevant species of bacteria, can be a useful strategy for improving the identification of clinically relevant aerobic Actinomycetes.

  5. [Phylogenetic comparison between Spirulina and Arthrospira based on 16S rRNA and rpoC1 gene].

    Science.gov (United States)

    Wu, Yuemei; Wang, Suying; Dong, Shirui

    2016-02-04

    Based on 16S rRNA and rpoC1 gene sequences, the phylogenetic relationship between Spirulina and Arthrospira were studied and compared. We amplified, sequenced and analyzed 16S rRNA and rpoC1 of 84 strains. Then the phylogenetic trees were constructed and compared. The conserved sites percentage, average G+C content and sequence identity of rpoC1 were 49.7%, 47.7%, 76%-100% respectively, significantly lower than 79.4%, 55.6% and 91%-100% of 16S rRNA, and the heterogeneity degree was higher. The trees generated with two different genes showed similar topologies and thus inferred consistent phylogenetic relationships. Eighty-four experimental strains were divided into 3 groups belonging to 2 genera: F-35 1, F-904-2, F-1070 and TJBC14 were Spirulina and the rest were Arthrospira. Although morphospecies and geographical species could not be distinguished based on 16S rRNA and rpoC1 gene sequences, the bootstrap value of rpoC1 (100%) was higher than that of 16S rRNA (99%). Moreover, clustering effect of rpoC1 for Spirulina and Arthrospirai was better than 16S rRNA. Spirulina and Arthrospira were different genera, rpoC1 gene has more advantage to distinguish the strains in the same genus than that of 16S rRNA gene.

  6. Palladium-Catalyzed Modification of Unprotected Nucleosides, Nucleotides, and Oligonucleotides

    Directory of Open Access Journals (Sweden)

    Kevin H. Shaughnessy

    2015-05-01

    Full Text Available Synthetic modification of nucleoside structures provides access to molecules of interest as pharmaceuticals, biochemical probes, and models to study diseases. Covalent modification of the purine and pyrimidine bases is an important strategy for the synthesis of these adducts. Palladium-catalyzed cross-coupling is a powerful method to attach groups to the base heterocycles through the formation of new carbon-carbon and carbon-heteroatom bonds. In this review, approaches to palladium-catalyzed modification of unprotected nucleosides, nucleotides, and oligonucleotides are reviewed. Polar reaction media, such as water or polar aprotic solvents, allow reactions to be performed directly on the hydrophilic nucleosides and nucleotides without the need to use protecting groups. Homogeneous aqueous-phase coupling reactions catalyzed by palladium complexes of water-soluble ligands provide a general approach to the synthesis of modified nucleosides, nucleotides, and oligonucleotides.

  7. Compositions and methods for detecting single nucleotide polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  8. Dynamics of Charge Transfer in Ordered and Chaotic Nucleotide Sequences

    CERN Document Server

    Fialko, N S

    2013-01-01

    Charge transfer is considered in systems composed of a donor, an acceptor and bridge sites of (AT) nucleotide pairs. For a bridge consisting of 180 (AT) pairs, three cases are dealt with: a uniform case, when all the nucleotides in each strand are identical; an ordered case, when nucleotides in each DNA strand are arranged in an orderly fashion; a chaotic case, when (AT) and (TA) pairs are arranged randomly. It is shown that in all the cases a charge transfer from a donor to an acceptor can take place. All other factors being equal, the transfer is the most efficient in the uniform case, the ordered and chaotic cases are less and the least efficient, accordingly. The results obtained are in agreement with experimental data on long-range charge transfer in DNA.

  9. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    in cardioprotection against hypoxic stress has not been reported. OBJECTIVE: To investigate the role of purine and pyrimidine nucleotides and nucleosides in protective effects in cardiomyocytes subjected to hypoxia. METHODS AND RESULTS: Rat cultured cardiomyocytes were treated with various extracellular nucleotides...... and nucleosides, before or during hypoxic stress. The results revealed that GTP or CTP exhibit cardioprotective ability, as revealed by lactate dehydrogenase (LDH) release, by propidium iodide (PI) staining, by cell morphology, and by preserved mitochondrial activity. Pretreatment with various P2 antagonists...... (suramin, RB-2, or PPADS) did not abolish the cardioprotective effect of the nucleotides. Moreover, P2Y₂ -/- , P2Y₄ -/-, and P2Y₂ -/-/P2Y₄ -/- receptor knockouts mouse cardiomyocytes were significantly protected against hypoxic stress when treated with UTP. These results indicate that the protective effect...

  10. Effect of nucleotides on broiler performance and carcass yield

    Directory of Open Access Journals (Sweden)

    VC Pelícia

    2010-03-01

    Full Text Available This study aimed at evaluating the effect of nucleotides on the performance and carcass yield of broilers fed diets with no antibiotic growth promoters (AGP, anticoccidials, or animal feedstuffs. In the trial, 600 Ross 308 male broilers were distributed in a completely randomized experimental design into six treatments with four replicates of 25 birds each. Treatments consisted of a control diet (CD, CD + AGP, CD + 0.04%, CD + 0.05%, CD + 0.06%, and CD + 0.07% nucleotides. The experimental diets did not contain anticoccidials, and birds were vaccinated against coccidiosis at three days of age. No significant differences were detected among broilers submitted to the different treatments in none of the studied parameters. Under the conditions of this experiment, diets supplemented with nucleotides did not influence broiler performance or carcass yield at 42 days of age, and were not different from the feeds not containing any additive or with AGP.

  11. Fixed-gap tunnel junction for reading DNA nucleotides.

    Science.gov (United States)

    Pang, Pei; Ashcroft, Brian Alan; Song, Weisi; Zhang, Peiming; Biswas, Sovan; Qing, Quan; Yang, Jialing; Nemanich, Robert J; Bai, Jingwei; Smith, Joshua T; Reuter, Kathleen; Balagurusamy, Venkat S K; Astier, Yann; Stolovitzky, Gustavo; Lindsay, Stuart

    2014-12-23

    Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events.

  12. Nucleotide frequencies in human genome and fibonacci numbers.

    Science.gov (United States)

    Yamagishi, Michel E Beleza; Shimabukuro, Alex Itiro

    2008-04-01

    This work presents a mathematical model that establishes an interesting connection between nucleotide frequencies in human single-stranded DNA and the famous Fibonacci's numbers. The model relies on two assumptions. First, Chargaff's second parity rule should be valid, and second, the nucleotide frequencies should approach limit values when the number of bases is sufficiently large. Under these two hypotheses, it is possible to predict the human nucleotide frequencies with accuracy. This result may be used as evidence to the Fibonacci string model that was proposed to the sequence growth of DNA repetitive sequences. It is noteworthy that the predicted values are solutions of an optimization problem, which is commonplace in many of nature's phenomena.

  13. Characterization of nucleotide misincorporation patterns in the iceman's mitochondrial DNA.

    Directory of Open Access Journals (Sweden)

    Cristina Olivieri

    Full Text Available BACKGROUND: The degradation of DNA represents one of the main issues in the genetic analysis of archeological specimens. In the recent years, a particular kind of post-mortem DNA modification giving rise to nucleotide misincorporation ("miscoding lesions" has been the object of extensive investigations. METHODOLOGY/PRINCIPAL FINDINGS: To improve our knowledge regarding the nature and incidence of ancient DNA nucleotide misincorporations, we have utilized 6,859 (629,975 bp mitochondrial (mt DNA sequences obtained from the 5,350-5,100-years-old, freeze-desiccated human mummy popularly known as the Tyrolean Iceman or Otzi. To generate the sequences, we have applied a mixed PCR/pyrosequencing procedure allowing one to obtain a particularly high sequence coverage. As a control, we have produced further 8,982 (805,155 bp mtDNA sequences from a contemporary specimen using the same system and starting from the same template copy number of the ancient sample. From the analysis of the nucleotide misincorporation rate in ancient, modern, and putative contaminant sequences, we observed that the rate of misincorporation is significantly lower in modern and putative contaminant sequence datasets than in ancient sequences. In contrast, type 2 transitions represent the vast majority (85% of the observed nucleotide misincorporations in ancient sequences. CONCLUSIONS/SIGNIFICANCE: This study provides a further contribution to the knowledge of nucleotide misincorporation patterns in DNA sequences obtained from freeze-preserved archeological specimens. In the Iceman system, ancient sequences can be clearly distinguished from contaminants on the basis of nucleotide misincorporation rates. This observation confirms a previous identification of the ancient mummy sequences made on a purely phylogenetical basis. The present investigation provides further indication that the majority of ancient DNA damage is reflected by type 2 (cytosine

  14. MAC: identifying and correcting annotation for multi-nucleotide variations.

    Science.gov (United States)

    Wei, Lei; Liu, Lu T; Conroy, Jacob R; Hu, Qiang; Conroy, Jeffrey M; Morrison, Carl D; Johnson, Candace S; Wang, Jianmin; Liu, Song

    2015-08-01

    Next-Generation Sequencing (NGS) technologies have rapidly advanced our understanding of human variation in cancer. To accurately translate the raw sequencing data into practical knowledge, annotation tools, algorithms and pipelines must be developed that keep pace with the rapidly evolving technology. Currently, a challenge exists in accurately annotating multi-nucleotide variants (MNVs). These tandem substitutions, when affecting multiple nucleotides within a single protein codon of a gene, result in a translated amino acid involving all nucleotides in that codon. Most existing variant callers report a MNV as individual single-nucleotide variants (SNVs), often resulting in multiple triplet codon sequences and incorrect amino acid predictions. To correct potentially misannotated MNVs among reported SNVs, a primary challenge resides in haplotype phasing which is to determine whether the neighboring SNVs are co-located on the same chromosome. Here we describe MAC (Multi-Nucleotide Variant Annotation Corrector), an integrative pipeline developed to correct potentially mis-annotated MNVs. MAC was designed as an application that only requires a SNV file and the matching BAM file as data inputs. Using an example data set containing 3024 SNVs and the corresponding whole-genome sequencing BAM files, we show that MAC identified eight potentially mis-annotated SNVs, and accurately updated the amino acid predictions for seven of the variant calls. MAC can identify and correct amino acid predictions that result from MNVs affecting multiple nucleotides within a single protein codon, which cannot be handled by most existing SNV-based variant pipelines. The MAC software is freely available and represents a useful tool for the accurate translation of genomic sequence to protein function.

  15. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    Science.gov (United States)

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  16. Phylogenetic position of Linguatula arctica and Linguatula serrata (Pentastomida) as inferred from the nuclear 18S rRNA gene and the mitochondrial cytochrome c oxidase subunit I gene.

    Science.gov (United States)

    Gjerde, Bjørn

    2013-10-01

    Genomic DNA was isolated from a Linguatula serrata female expelled from a dog imported to Norway from Romania and from four Linguatula arctica females collected from semi-domesticated reindeer from northern Norway and subjected to PCR amplification of the complete nuclear 18S rRNA gene and a 1,045-bp portion of the mitochondrial cytochrome c oxidase subunit I gene (cox1). The two species differed at two of 1,830 nucleotide positions (99.9% identity) of the complete 18S rRNA gene sequences and at 102 of 1,045 nucleotide positions (90.2% identity) of the partial cox1 sequences. The four isolates of L. arctica showed no genetic variation in either gene. The new cox1 primers may facilitate the diagnosis of various developmental stages of L. arctica and L. serrata in their hosts. In separate phylogenetic analyses using the maximum likelihood method on sequence data from either gene, L. arctica and L. serrata clustered with members of the order Cephalobaenida rather than with members of the order Porocephalida, in which the genus Linguatula is currently placed based on morphological characters. The phylogenetic relationship of L. arctica, L. serrata and other pentastomids to other metazoan groups could not be clearly resolved, but the pentastomids did not seem to have a sister relationship to crustaceans of the subclass Branchiura as found in other studies. A more extensive taxon sampling, including molecular characterisation of more pentastomid taxa across different genera, seems to be necessary in order to estimate the true relationship of the Pentastomida to other metazoan groups.

  17. Fluorescence chemosensors with pyrene and their interaction with nucleotide phosphate

    Institute of Scientific and Technical Information of China (English)

    李华平; 汪鹏飞; 吴世康

    1999-01-01

    A group of fluorescence chemosensor with pyrene, compounds (Ⅰ), (Ⅱ) and (Ⅲ), were synthesized The fluorescence spectra and the lifetime of these compounds were carefully measured. The fluorescence quenching spec tra of pyrenyl butyric acid, compounds (Ⅰ), (Ⅱ) and (Ⅲ) by different nucleotide phosphates, AMP ADP, ATP dTTP, were also recorded and studied. The quenching and the stability constants were calculated by Stern-Volmer equa tion and eq. (2), respectively. The mechanism of interaction between fluorescence chemosensor and nucleotide phos phate was didscussed based on the comparison of the results obtained with the CPK model of free molecules of these com pounds in the ground state.

  18. Effect of nucleotides on broiler performance and carcass yield

    OpenAIRE

    VC Pelícia; JR Sartori; KC Zavarize; AC Pezzato; AC Stradiotti; PC Araujo; MAO Mituo; LA Madeira

    2010-01-01

    This study aimed at evaluating the effect of nucleotides on the performance and carcass yield of broilers fed diets with no antibiotic growth promoters (AGP), anticoccidials, or animal feedstuffs. In the trial, 600 Ross 308 male broilers were distributed in a completely randomized experimental design into six treatments with four replicates of 25 birds each. Treatments consisted of a control diet (CD), CD + AGP, CD + 0.04%, CD + 0.05%, CD + 0.06%, and CD + 0.07% nucleotides. The experimental ...

  19. Dynamics of tongue microbial communities with single-nucleotide resolution using oligotyping

    Directory of Open Access Journals (Sweden)

    Jessica L. Mark Welch

    2014-11-01

    Full Text Available The human mouth is an excellent system to study the dynamics of microbial communities and their interactions with their host. We employed oligotyping to analyze, with single-nucleotide resolution, oral microbial 16S ribosomal RNA (rRNA gene sequence data from a time course sampled from the tongue of two individuals, and we interpret our results in the context of oligotypes that we previously identified in the oral data from the Human Microbiome Project. Our previous work established that many of these oligotypes had dramatically different distributions between individuals and across oral habitats, suggesting that they represented functionally different organisms. Here we demonstrate the presence of a consistent tongue microbiome but with rapidly fluctuating proportions of the characteristic taxa. In some cases closely related oligotypes representing strains or variants within a single species displayed fluctuating relative abundances over time, while in other cases an initially dominant oligotype was replaced by another oligotype of the same species. We use this high temporal and taxonomic level of resolution to detect correlated changes in oligotype abundance that could indicate which taxa likely interact synergistically or occupy similar habitats, and which likely interact antagonistically or prefer distinct habitats. For example, we found a strong correlation in abundance over time between two oligotypes from different families of Gamma Proteobacteria, suggesting a close functional or ecological relationship between them. In summary, the tongue is colonized by a microbial community of moderate complexity whose proportional abundance fluctuates widely on time scales of days. The drivers and functional consequences of these community dynamics are not known, but we expect they will prove tractable to future, targeted studies employing taxonomically resolved analysis of high-throughput sequencing data sampled at appropriate temporal intervals and

  20. The Final Step in 5.8S rRNA Processing Is Cytoplasmic in Saccharomyces cerevisiae▿ †

    OpenAIRE

    Thomson, Emma; TOLLERVEY, DAVID

    2009-01-01

    The 18S rRNA component of yeast (Saccharomyces cerevisiae) 40S ribosomes undergoes cytoplasmic 3' cleavage following nuclear export, whereas exported pre-60S subunits were believed to contain only mature 5.8S and 25S rRNAs. However, in situ hybridization detected 3'-extended forms of 5.8S rRNA in the cytoplasm, which were lost when Crm1-dependent preribosome export was blocked by treatment with leptomycin B (LMB). LMB treatment rapidly blocked processing of 6S pre-rRNA to 5.8S rRNA, leading t...

  1. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Institute of Scientific and Technical Information of China (English)

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles

    2010-01-01

    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  2. Genetic Diversity of Bacillus thuringiensis from Different Geo-Ecological Regions of Ukraine by Analyzing the 16S rRNA and gyrB Genes and by AP-PCR and saAFLP.

    Science.gov (United States)

    Punina, N V; Zotov, V S; Parkhomenko, A L; Parkhomenko, T U; Topunov, A F

    2013-01-01

    The Bacillus cereus group consists of closely related species of bacteria and is of interest to researchers due to its importance in industry and medicine. However, it remains difficult to distinguish these bacteria at the intra- and inter-species level. Bacillus thuringiensis (Bt) is a member of the B. cereus group. In this work, we studied the inter-species structure of five entomopathogenic strains and 20 isolates of Bt, which were collected from different geo-ecological regions of Ukraine, using various methods: physiological and biochemical analyses, analysis of the nucleotide sequences of the 16S rRNA and gyrB genes, by AP-PCR (BOX and ERIC), and by saAFLP. The analysis of the 16S rRNA and gyrB genes revealed the existence of six subgroups within theB.cereus group: B anthracis, B. cereus I and II, Bt I and II, and Bt III, and confirmed that these isolates belong to the genus Bacillus. All strains were subdivided into 3 groups. Seventeen strains belong to the group Bt II of commercial, industrial strains. The AP-PCR (BOX and ERIC) and saAFLP results were in good agreement and with the results obtained for the 16S rRNA and gyrB genes. Based on the derived patterns, all strains were reliably combined into 5 groups. Interestingly, a specific pattern was revealed by the saAFLP analysis for the industrial strain Bt 0376 р.о., which is used to produce the entomopathogenic preparation "STAR-t".

  3. Open complex scrunching before nucleotide addition accounts for the unusual transcription start site of E. coli ribosomal RNA promoters.

    Science.gov (United States)

    Winkelman, Jared T; Chandrangsu, Pete; Ross, Wilma; Gourse, Richard L

    2016-03-29

    Most Escherichia coli promoters initiate transcription with a purine 7 or 8 nt downstream from the -10 hexamer, but some promoters, including the ribosomal RNA promoter rrnB P1, start 9 nt from the -10 element. We identified promoter and RNA polymerase determinants of this noncanonical rrnB P1 start site using biochemical and genetic approaches including mutational analysis of the promoter, Fe(2+) cleavage assays to monitor template strand positions near the active-site, and Bpa cross-linking to map the path of open complex DNA at amino acid and nucleotide resolution. We find that mutations in several promoter regions affect transcription start site (TSS) selection. In particular, we show that the absence of strong interactions between the discriminator region and σ region 1.2 and between the extended -10 element and σ region 3.0, identified previously as a determinant of proper regulation of rRNA promoters, is also required for the unusual TSS. We find that the DNA in the single-stranded transcription bubble of the rrnB P1 promoter complex expands and is "scrunched" into the active site channel of RNA polymerase, similar to the situation in initial transcribing complexes. However, in the rrnB P1 open complex, scrunching occurs before RNA synthesis begins. We find that the scrunched open complex exhibits reduced abortive product synthesis, suggesting that scrunching and unusual TSS selection contribute to the extraordinary transcriptional activity of rRNA promoters by increasing promoter escape, helping to offset the reduction in promoter activity that would result from the weak interactions with σ.

  4. Identification of Staphylococcus saprophyticus isolated from patients with urinary tract infection using a simple set of biochemical tests correlating with 16S-23S interspace region molecular weight patterns.

    Science.gov (United States)

    Ferreira, Adriano Martison; Bonesso, Mariana Fávero; Mondelli, Alessandro Lia; da Cunha, Maria de Lourdes Ribeiro de Souza

    2012-12-01

    The emergence of Staphylococcus spp. not only as human pathogens, but also as reservoirs of antibiotic resistance determinants, requires the development of methods for their rapid and reliable identification in medically important samples. The aim of this study was to compare three phenotypic methods for the identification of Staphylococcus spp. isolated from patients with urinary tract infection using the PCR of the 16S-23S interspace region generating molecular weight patterns (ITR-PCR) as reference. All 57 S. saprophyticus studied were correctly identified using only the novobiocin disk. A rate of agreement of 98.0% was obtained for the simplified battery of biochemical tests in relation to ITR-PCR, whereas the Vitek I system and novobiocin disk showed 81.2% and 89.1% agreement, respectively. No other novobiocin-resistant non-S. saprophyticus strain was identified. Thus, the novobiocin disk is a feasible alternative for the identification of S. saprophyticus in urine samples in laboratories with limited resources. ITR-PCR and the simplified battery of biochemical tests were more reliable than the commercial systems currently available. This study confirms that automated systems are still unable to correctly differentiate CoNS species and that simple, reliable and inexpensive methods can be used for routine identification.

  5. Role of a GAG hinge in the nucleotide-induced conformational change governing nucleotide specificity by T7 DNA polymerase.

    Science.gov (United States)

    Jin, Zhinan; Johnson, Kenneth A

    2011-01-14

    A nucleotide-induced change in DNA polymerase structure governs the kinetics of polymerization by high fidelity DNA polymerases. Mutation of a GAG hinge (G542A/G544A) in T7 DNA polymerase resulted in a 1000-fold slower rate of conformational change, which then limited the rate of correct nucleotide incorporation. Rates of misincorporation were comparable to that seen for wild-type enzyme so that the net effect of the mutation was a large decrease in fidelity. We demonstrate that a presumably modest change from glycine to alanine 20 Å from the active site can severely restrict the flexibility of the enzyme structure needed to recognize and incorporate correct substrates with high specificity. These results emphasize the importance of the substrate-induced conformational change in governing nucleotide selectivity by accelerating the incorporation of correct base pairs but not mismatches.

  6. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna

    1998-01-01

    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...

  7. Design and experimental application of a novel non-degenerate universal primer set that amplifies prokaryotic 16S rRNA genes with a low possibility to amplify eukaryotic rRNA genes.

    Science.gov (United States)

    Mori, Hiroshi; Maruyama, Fumito; Kato, Hiromi; Toyoda, Atsushi; Dozono, Ayumi; Ohtsubo, Yoshiyuki; Nagata, Yuji; Fujiyama, Asao; Tsuda, Masataka; Kurokawa, Ken

    2014-01-01

    The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities.

  8. Nucleotide excision repair: ERCC1 and TFIIH complexes

    NARCIS (Netherlands)

    A.J. van Vuuren (Hanneke)

    1995-01-01

    textabstractDNA is the carrier of genetic information in living organisms. The information stored in the nucleotide sequence of DNA is transmitted to the offspring by generating identical copies of the parental DNA molecules. Damage in DNA can cause loss of genetic information. Nevertheless, the DNA

  9. Single nucleotide polymorphisms associated with rat expressed sequences

    NARCIS (Netherlands)

    Guryev, Victor; Berezikov, Eugene; Malik, Rainer; Plasterk, Ronald H A; Cuppen, Edwin

    2004-01-01

    Single nucleotide polymorphisms (SNPs) are the most common source of genetic variation in populations and are thus most likely to account for the majority of phenotypic and behavioral differences between individuals or strains. Although the rat is extensively studied for the latter, data on naturall

  10. Nucleotide excision repair syndromes: molecular basis and clinical symptoms.

    NARCIS (Netherlands)

    D. Bootsma (Dirk); G. Weeda (Geert); W. Vermeulen (Wim); H. van Vuuren; C. Troelstra (Christine); J.H.J. Hoeijmakers (Jan); P.J. van der Spek (Peter)

    1995-01-01

    textabstractThe phenotypic consequences of a nucleotide excision repair (NER) defect in man are apparent from three distinct inborn diseases characterized by hypersensitivity of the skin to ultraviolet light and a remarkable clinical and genetic heterogeneity. These are the prototype repair

  11. Nucleotide Sequence of the Protective Antigen Gene of Bacillus Anthracis

    Science.gov (United States)

    1988-02-02

    Montie, S. Kadis, and S. I. Ajl (ed.), Microbial toxins, vol. 3. Academic Press, Inc., New York. 23. Little, S. F., and G. B. Knudaon. 1986...Takkinen, and L. Kaariainen. 1981. Nucleotide sequence of the promoter and NHa-terminal signal peptide region of the a- amylase gene from Bacillus

  12. Single nucleotide polymorphism in genome-wide association of ...

    African Journals Online (AJOL)

    Mohd Fareed

    2012-09-25

    Sep 25, 2012 ... The arrival of new technologies that type more than millions of the single nucleotide polymor- .... and quality control now permit affordable, reliable genotyping of up to 1 million ... disease. Such pooled studies, like all genetic association stud- .... to researchers interested in evolutionary biology, and hence.

  13. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry

    2006-01-01

    Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycli...

  14. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... 3Technical Center for Inspection and Quarantine, Beijing Entry-Exit Inspection ... differentiation related to geographical distribution in C. japonica ... gene sequences of C. japonica in China to assess nucleotide ... Map of China with locations from which Caligula japonica was sampled indicated a black dot.

  15. THE NUCLEOTIDE RECEPTORS ON MOUSE C2C12 MYOTUBES

    NARCIS (Netherlands)

    HENNING, RH; NELEMANS, A; VANDENAKKER, J; DENHERTOG, A

    1992-01-01

    1 The response of C2C12 mouse myotubes to stimulation with adenosine triphosphate (ATP) and other nucleotides was studied by measuring changes in membrane potential. 2 A transient hyperpolarization followed by a slowly declining depolarization of the cells was observed in the presence of ATP (10-mu-

  16. Increased nucleotide diversity with transient Y linkage in Drosophila americana.

    Directory of Open Access Journals (Sweden)

    Bryant F McAllister

    Full Text Available Recombination shapes nucleotide variation within genomes. Patterns are thought to arise from the local recombination landscape, influencing the degree to which neutral variation experiences hitchhiking with selected variation. This study examines DNA polymorphism along Chromosome 4 (element B of Drosophila americana to identify effects of hitchhiking arising as a consequence of Y-linked transmission. A centromeric fusion between the X and 4(th chromosomes segregates in natural populations of D. americana. Frequency of the X-4 fusion exhibits a strong positive correlation with latitude, which has explicit consequences for unfused 4(th chromosomes. Unfused Chromosome 4 exists as a non-recombining Y chromosome or as an autosome proportional to the frequency of the X-4 fusion. Furthermore, Y linkage along the unfused 4 is disrupted as a function of the rate of recombination with the centromere. Inter-population and intra-chromosomal patterns of nucleotide diversity were assayed using six regions distributed along unfused 4(th chromosomes derived from populations with different frequencies of the X-4 fusion. No difference in overall level of nucleotide diversity was detected among populations, yet variation along the chromosome exhibits a distinct pattern in relation to the X-4 fusion. Sequence diversity is inflated at loci experiencing the strongest Y linkage. These findings are inconsistent with the expected reduction in nucleotide diversity resulting from hitchhiking due to background selection or selective sweeps. In contrast, excessive polymorphism is accruing in association with transient Y linkage, and furthermore, hitchhiking with sexually antagonistic alleles is potentially responsible.

  17. Nucleotide excision repair of DNA: The very early history.

    Science.gov (United States)

    Friedberg, Errol C

    2011-07-15

    This article, taken largely from the book Correcting the Blueprint of Life: An Historical Account of the Discovery of DNA Repair Mechanisms, summarizes the very early history of the discovery of nucleotide excision repair. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  19. [Tabular excel editor for analysis of aligned nucleotide sequences].

    Science.gov (United States)

    Demkin, V V

    2010-01-01

    Excel platform was used for transition of results of multiple aligned nucleotide sequences obtained using the BLAST network service to the form appropriate for visual analysis and editing. Two macros operators for MS Excel 2007 were constructed. The array of aligned sequences transformed into Excel table and processed using macros operators is more appropriate for analysis than initial html data.

  20. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    Science.gov (United States)

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  1. THE NUCLEOTIDE RECEPTORS ON MOUSE C2C12 MYOTUBES

    NARCIS (Netherlands)

    HENNING, RH; NELEMANS, A; VANDENAKKER, J; DENHERTOG, A

    1 The response of C2C12 mouse myotubes to stimulation with adenosine triphosphate (ATP) and other nucleotides was studied by measuring changes in membrane potential. 2 A transient hyperpolarization followed by a slowly declining depolarization of the cells was observed in the presence of ATP

  2. Synthesis, bioanalysis and pharmacology of nucleoside and nucleotide analogs

    NARCIS (Netherlands)

    Jansen, R.S.

    2009-01-01

    Nucleoside analogs are an important class of drugs in anticancer and antiviral therapy. The compounds are, however, only active after intracellular conversion to their mono-, di- and triphosphate nucleotide form. In this thesis the development of sensitive liquid chromatography coupled to tandem mas

  3. DNA Nucleotides Detection via capacitance properties of Graphene

    Science.gov (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  4. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    Science.gov (United States)

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

    2016-01-01

    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  5. Mining for Single Nucleotide Polymorphisms in Pig genome sequence data

    NARCIS (Netherlands)

    Kerstens, H.H.D.; Kollers, S.; Kommandath, A.; Rosario, del M.; Dibbits, B.W.; Kinders, S.M.; Crooijmans, R.P.M.A.; Groenen, M.A.M.

    2009-01-01

    Background - Single nucleotide polymorphisms (SNPs) are ideal genetic markers due to their high abundance and the highly automated way in which SNPs are detected and SNP assays are performed. The number of SNPs identified in the pig thus far is still limited. Results - A total of 4.8 million whole g

  6. Transcription of the 5S rRNA heterochromatic genes is epigenetically controlled in Arabidopsis thaliana and Xenopus laevis.

    Science.gov (United States)

    Douet, J; Tourmente, S

    2007-07-01

    5S ribosomal DNA is a highly conserved tandemly repeated multigenic family. As suggested for a long time, we have shown that only a fraction of the 5S rRNA genes are expressed in Arabidopsis thaliana. In Xenopus laevis, there is a developmental control of the expression of the 5S rRNA genes with only one of the two 5S rDNA families expressed during oogenesis. For both Arabidopsis and Xenopus, the strongest transcription of 5S rRNA, respectively in the seed and during oogenesis is correlated with heterogeneity in the transcribed 5S rRNAs. Epigenetic mechanisms such as modification of the chromatin structure are involved in the transcriptional regulation of the 5S rRNA genes in both organisms. In Arabidopsis, two silencing pathways, methylation-dependent (RNAi) and methylation-independent (MOM pathway), are involved in the silencing of a 5S rDNA fraction.

  7. Identification of Swertia mussotii and its adulterant Swertia species by 5S rRNA gene spacer.

    Science.gov (United States)

    Yu, Man-Tang; Wong, Ka-Lok; Zong, Yu-Ying; Shaw, Pang-Chui; Che, Chun-Tao

    2008-03-01

    This research focused on analyzing the differences of 5S rRNA gene spacer sequences on Swertia mussotii and its commonly used adulterants, including S. franchetiana, S. wolfangiana and S. chirayita. DNA was extracted from the collected Swertia samples. 5S rRNA intergenic spacers were amplified by PCR, sequenced and analyzed. 5S rRNA gene spacer sequences were different between S. mussotii and its other three adulterants. Sequence divergence among species ranged from 30.6% to 65.0%. 5S rRNA spacers may be used as molecular authentication markers to differentiate S. mussotii and other commonly used Swertia adulterants. This result provides reliable and simple reference for the authentication of Swertia genus species.

  8. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    National Research Council Canada - National Science Library

    Nossa, Carlos W; Oberdorf, William E; Yang, Liying; Aas, Jørn A; Paster, Bruce J; Desantis, Todd Z; Brodie, Eoin L; Malamud, Daniel; Poles, Michael A; Pei, Zhiheng

    2010-01-01

    .... A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral, esophageal, and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species...

  9. Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic sediments

    DEFF Research Database (Denmark)

    Ravenschlag, K.; Sahm, K.; Knoblauch, C.;

    2000-01-01

    The community structure of sulfate-reducing bacteria (SRB) of a marine Arctic sediment (Smeerenburg-fjorden, Svalbard) a-as characterized by both fluorescence in situ hybridization (FISH) and rRNA slot blot hybridization by using group- and genus-specific 16S rRNA-targeted oligonucleotide probes...... that FISH and rRNA slot blot hybridization gave comparable results. Furthermore, a combination of the two methods allowed us to calculate specific cellular rRNA contents with respect to localization in the sediment profile. The rRNA contents of Desulfosarcina-Desulfococcus cells were highest in the first 5...... mm of the sediment (0.9 and 1.4 fg, respectively) and decreased steeply with depth, indicating that maximal metabolic activity occurred close to the surface, Based on SRB cell numbers, cellular sulfate reduction rates were calculated. The rates were highest in the surface layer (0.14 fmol cell(-1...

  10. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Directory of Open Access Journals (Sweden)

    Yen-Chun Liu

    Full Text Available BACKGROUND: The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis. CONCLUSIONS/SIGNIFICANCE: Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  11. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  12. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    Science.gov (United States)

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  13. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Directory of Open Access Journals (Sweden)

    Chenyu Zhang

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  14. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    Science.gov (United States)

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  15. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    Science.gov (United States)

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity.

  16. Hypomethylation and hypermethylation of the tandem repetitive 5S rRNA genes in Arabidopsis.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Jasencakova, Zuzana; Douet, Julien; Schubert, Ingo; Tourmente, Sylvette

    2008-04-01

    5S ribosomal DNA (5S rDNA) is organized in tandem repeats on chromosomes 3, 4 and 5 in Arabidopsis thaliana. One part of the 5S rDNA is located within the heterochromatic chromocenters, and the other fraction forms loops with euchromatic features that emanate from the chromocenters. We investigated whether the A. thaliana heterochromatin, and particularly the 5S rDNA, is modified when changing the culture conditions (cultivation in growth chamber versus greenhouse). Nuclei from challenged tissues displayed larger total, as well as 5S rDNA, heterochromatic fractions, and the DNA methyltransferase mutants met1 and cmt3 had different impacts in Arabidopsis. The enlarged fraction of heterochromatic 5S rDNA was observed, together with the reversal of the silencing of some 5S rRNA genes known as minor genes. We observed hypermethylation at CATG sites, and a concomitant DNA hypomethylation at CG/CXG sites in 5S rDNA. Our results show that the asymmetrical hypermethylation is correlated with the ageing of the plants, whereas hypomethylation results from the growth chamber/culture conditions. In spite of severely reduced DNA methylation, the met1 mutant revealed no increase in minor 5S rRNA transcripts in these conditions. The increasing proportion of cytosines in asymmetrical contexts during transition from the euchromatic to the heterochromatic state in the 5S rDNA array suggests that 5S rDNA units are differently affected by the (hypo and hyper)methylation patterns along the 5S rDNA locus. This might explain the different behaviour of 5S rDNA subpopulations inside a 5S array in terms of chromatin compaction and expression, i.e. some 5S rRNA genes would become derepressed, whereas others would join the heterochromatic fraction.

  17. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  18. Diversity and evolution of 5S rRNA gene family organization in Pythium.

    Science.gov (United States)

    Bedard, James E J; Schurko, Andrew M; de Cock, Arthur W A M; Klassen, Glen R

    2006-01-01

    The 5S rRNA gene family organization among 87 species and varieties of Pythium was investigated to assess evolutionary stability of the two patterns detected and to determine which pattern is likely the ancestral state in the genus. Species with filamentous sporangia (Groups A-C according to the ITS phylogenetic tree for Pythium) had 5S genes linked to the rDNA repeat that were predominantly coded for on the DNA strand opposite to the one with the other rRNA genes ('inverted' orientation). A small group of species with contiguous sporangia (Group D) is related to Groups A-C but had unlinked 5S genes. The main group of species with spherical zoosporangia (Groups E-J) generally had unlinked 5S genes in tandem arrays. The six species in Group K, although they also have spherical sporangia, had linked genes on the same strand as the other rRNA genes 'non-inverted' and most of them had pairs of tandem 5S genes. The evolutionary stability of 5S sequence organization was compared with the stability of morphological characters as interpreted from a phylogeny based on ITS sequence analysis. Features of 5S sequence organization were found to be just as consistent within groups as were the morphological characters. To determine the ancestral type of 5S family organization, a survey of Phytophthora strains was conducted to supply an outgroup reference. The most parsimonious interpretation of the data in this survey yielded the tentative conclusion that the linked condition of the 5S sequences was ancestral.

  19. Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA

    Directory of Open Access Journals (Sweden)

    A Azazy Ahmed

    2010-11-01

    Full Text Available Abstract Background Malaria is an endemic disease in Yemen and is responsible for 4.9 deaths per 100,000 population per year and 43,000 disability adjusted life years lost. Although malaria in Yemen is caused mainly by Plasmodium falciparum and Plasmodium vivax, there are no sequence data available on the two species. This study was conducted to investigate the distribution of the Plasmodium species based on the molecular detection and to study the molecular phylogeny of these parasites. Methods Blood samples from 511 febrile patients were collected and a partial region of the 18 s ribosomal RNA (18 s rRNA gene was amplified using nested PCR. From the 86 positive blood samples, 13 Plasmodium falciparum and 4 Plasmodium vivax were selected and underwent cloning and, subsequently, sequencing and the sequences were subjected to phylogenetic analysis using the neighbor-joining and maximum parsimony methods. Results Malaria was detected by PCR in 86 samples (16.8%. The majority of the single infections were caused by P. falciparum (80.3%, followed by P. vivax (5.8%. Mixed infection rates of P. falciparum + P. vivax and P. falciparum + P. malariae were 11.6% and 2.3%, respectively. All P. falciparum isolates were grouped with the strain 3D7, while P. vivax isolates were grouped with the strain Salvador1. Phylogenetic trees based on 18 s rRNA placed the P. falciparum isolates into three sub-clusters and P. vivax into one cluster. Sequence alignment analysis showed 5-14.8% SNP in the partial sequences of the 18 s rRNA of P. falciparum. Conclusions Although P. falciparum is predominant, P. vivax, P. malariae and mixed infections are more prevalent than has been revealed by microscopy. This overlooked distribution should be considered by malaria control strategy makers. The genetic polymorphisms warrant further investigation.

  20. Intrinsic and selected resistance to antibiotics binding the ribosome: analyses of Brucella 23S rrn, L4, L22, EF-Tu1, EF-Tu2, efflux and phylogenetic implications

    Directory of Open Access Journals (Sweden)

    Jensen Allen E

    2006-10-01

    Full Text Available Abstract Background Brucella spp. are highly similar, having identical 16S RNA. However, they have important phenotypic differences such as differential susceptibility to antibiotics binding the ribosome. Neither the differential susceptibility nor its basis has been rigorously studied. Differences found among other conserved ribosomal loci could further define the relationships among the classical Brucella spp. Results Minimum inhibitory concentration (MIC values of Brucella reference strains and three marine isolates to antibiotics binding the ribosome ranged from 0.032 to >256 μg/ml for the macrolides erythromycin, clarithromycin, and azithromycin and 2 to >256 μg/ml for the lincosamide, clindamycin. Though sequence polymorphisms were identified among ribosome associated loci 23S rrn, rplV, tuf-1 and tuf-2 but not rplD, they did not correlate with antibiotic resistance phenotypes. When spontaneous erythromycin resistant (eryR mutants were examined, mutation of the peptidyl transferase center (A2058G Ec correlated with increased resistance to both erythromycin and clindamycin. Brucella efflux was examined as an alternative antibiotic resistance mechanism by use of the inhibitor L-phenylalanine-L-arginine β-naphthylamide (PAβN. Erythromycin MIC values of reference and all eryR strains, except the B. suis eryR mutants, were lowered variably by PAβN. A phylogenetic tree based on concatenated ribosomal associated loci supported separate evolutionary paths for B. abortus, B. melitensis, and B. suis/B. canis, clustering marine Brucella and B. neotomae with B. melitensis. Though Brucella ovis was clustered with B. abortus, the bootstrap value was low. Conclusion Polymorphisms among ribosomal loci from the reference Brucella do not correlate with their highly differential susceptibility to erythromycin. Efflux plays an important role in Brucella sensitivity to erythromycin. Polymorphisms identified among ribosome associated loci construct a