WorldWideScience

Sample records for 23s rrna methyltransferase

  1. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M

    2008-01-01

    . coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  2. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Douthwaite, S

    1994-01-01

    The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  3. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Karminska, K. H.; Purta, E.; Hansen, L .H.

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... of a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension analysis...

  4. Structure of 23S rRNA hairpin 35 and its interaction with the tylosin-resistance methyltransferase RlmAII

    Science.gov (United States)

    Lebars, Isabelle; Yoshizawa, Satoko; Stenholm, Anne R.; Guittet, Eric; Douthwaite, Stephen; Fourmy, Dominique

    2003-01-01

    The bacterial rRNA methyltransferase RlmAII (formerly TlrB) contributes to resistance against tylosin-like 16-membered ring macrolide antibiotics. RlmAII was originally discovered in the tylosin-producer Streptomyces fradiae, and members of this subclass of methyltransferases have subsequently been found in other Gram-positive bacteria, including Streptococcus pneumoniae. In all cases, RlmAII methylates 23S rRNA at nucleotide G748, which is situated in a stem–loop (hairpin 35) at the macrolide binding site of the ribosome. The conformation of hairpin 35 recognized by RlmAII is shown here by NMR spectroscopy to resemble the anticodon loop of tRNA. The loop folds independently of the rest of the 23S rRNA, and is stabilized by a non-canonical G–A pair and a U-turn motif, rendering G748 accessible. Binding of S.pneumoniae RlmAII induces changes in NMR signals at specific nucleotides that are involved in the methyltransferase–RNA interaction. The conformation of hairpin 35 that interacts with RlmAII is radically different from the structure this hairpin adopts within the 50S subunit. This indicates that the hairpin undergoes major structural rearrangement upon interaction with ribosomal proteins during 50S assembly. PMID:12514124

  5. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    by introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents...... of this region to the chemical reagents. The data indicate that a less-exposed conformation at A2058 leads to reduction in methylation by ErmE. Nucleotide G2057 and its interaction with C2611 maintain the conformation at A2058, and are thus important in forming the structural motif that is recognized by the Erm...

  6. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification...

  7. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...

  8. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    DEFF Research Database (Denmark)

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    Erm methyltransferases modify bacterial 23S ribosomal RNA at adenosine 2058 (A2058, Escherichia coli numbering) conferring resistance to macrolide, lincosamide, and streptogramin B (MLS) antibiotics. The motif that is recognized by Erm methyltransferases is contained within helix 73 of 23S rRNA a...

  9. Structure of the bifunctional methyltransferase YcbY (RlmKL) that adds the m7G2069 and m2G2445 modifications in Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Wang, Kai-Tuo; Desmolaize, Benoit; Nan, Jie;

    2012-01-01

    to be fusions from two separate proteins found in Gram-positives. The crystal structures described here show that both the N- and C-terminal halves of E. coli YcbY have a methyltransferase active site and their folding patterns respectively resemble the Streptococcus mutans proteins Smu472 and Smu776. Mass...

  10. YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407

    DEFF Research Database (Denmark)

    Andersen, Niels Møller; Douthwaite, Stephen

    2006-01-01

    The rRNAs in Escherichia coli contain methylations at 24 nucleotides, which collectively are important for ribosome function. Three of these methylations are m5C modifications located at nucleotides C967 and C1407 in 16S rRNA and at nucleotide C1962 in 23S rRNA. Bacterial rRNA modifications gener...... methyltransferase gene rsmF, and that the nomenclature system be extended to include the rRNA methyltransferases that still await identification....

  11. A single methyltransferase YefA (RlmCD) catalyses both m5U747 and m5U1939 modifications in Bacillus subtilis 23S rRNA

    DEFF Research Database (Denmark)

    Desmolaize, Benoit; Fabret, Céline; Brégeon, Damien;

    2011-01-01

    . However, as previously shown, the m(5)U54 modification in B. subtilis tRNAs is catalysed in a fundamentally different manner by the folate-dependent enzyme TrmFO, which is unrelated to the E. coli TrmA. Here, we show that methylation of U747 and U1939 in B. subtilis rRNA is catalysed by a single enzyme...

  12. Mutations in conserved helix 69 of 23S rRNA of Thermus thermophilus that affect capreomycin resistance but not posttranscriptional modifications

    DEFF Research Database (Denmark)

    Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen

    2008-01-01

    of previously reported capreomycin resistance base substitutions. Capreomycin resistance in other bacteria has been shown to result from inactivation of the TlyA methyltransferase which 2'-O methylates C1920 of 23S rRNA. Inactivation of the tlyA gene in T. thermophilus does not affect its sensitivity...

  13. Diversity of 23S rRNA genes within individual prokaryotic genomes.

    Directory of Open Access Journals (Sweden)

    Anna Pei

    Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

  14. Recognition determinants for proteins and antibiotics within 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, Stephen Roger; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of molecu......Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  15. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... and chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...... "eukaryal" (1005G.1138C or 1006U.1137A) pair and one "bacterial" C.G pair largely restores the structure and function of the rRNA. Bacterial ribosomes containing both these eukaryal pairs also participate in protein synthesis, although at much reduced efficiency, and the structure of their pseudoknot region...

  16. Functional interactions within 23S rRNA involving the peptidyltransferase center

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... that also confer antibiotic resistance. Both the domain II deletion and the 2057A mutation relieve the hypersensitive effect of the 2032A mutation, producing an erythromycin-resistant phenotype; in addition, the combination of the 2032A and 2057A mutations confers a higher level of chloramphenicol...... and chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  17. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    DEFF Research Database (Denmark)

    Dam, M; Douthwaite, S; Tenson, T

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  18. Mutations in 23S rRNA Confer Resistance against Azithromycin in Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Marvig, Rasmus Lykke; Søndergaard, Mette S. R.; Pedersen, Søren Damkiær

    2012-01-01

    The emergence of antibiotic-resistant Pseudomonas aeruginosa is an important concern in the treatment of long-term airway infections in cystic fibrosis patients. In this study, we report the occurrence of azithromycin resistance among clinical P. aeruginosa DK2 isolates. We demonstrate that resis...... that resistance is associated with specific mutations (A2058G, A2059G, and C2611T in Escherichia coli numbering) in domain V of 23S rRNA and that introduction of A2058G and C2611T into strain PAO1 results in azithromycin resistance....

  19. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    Science.gov (United States)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  20. Interaction of tRNA with domain II of 23S rRNA.

    Science.gov (United States)

    Hill, W E; Tassanakajohn, A; Tapprich, W E

    1990-08-27

    The interaction of tRNA with domain II of 23S rRNA in E. coli ribosomes has been probed using short, complementary DNA oligodeoxyribonucleotides. Specifically, cDNA oligomers to the region 801-811 of the 23S rRNA were used to ascertain the interaction of this region with tRNA. It was found that when tRNA was bound to the P site, considerable competition occurred between tRNA and the cDNA oligomers which base paired with the nucleotides 807-811. However, A-site bound tRNA neither displaced, nor was displaced, by cDNA oligomers to this region. Additionally, the binding of tRNA lacking the CACCA nucleotides on the 3' terminus was unaffected by the presence a cDNA oligomer complementary to nucleotides 803-811, indicating that the cDNA-tRNA competition was dependent on the 3' terminal nucleotides of tRNA.

  1. Clinical and Microbiological Aspects of Linezolid Resistance Mediated by the cfr Gene Encoding a 23S rRNA Methyltransferase▿

    Science.gov (United States)

    Arias, Cesar A.; Vallejo, Martha; Reyes, Jinnethe; Panesso, Diana; Moreno, Jaime; Castañeda, Elizabeth; Villegas, Maria V.; Murray, Barbara E.; Quinn, John P.

    2008-01-01

    The cfr (chloramphenicol-florfenicol resistance) gene encodes a 23S rRNA methyltransferase that confers resistance to linezolid. Detection of linezolid resistance was evaluated in the first cfr-carrying human hospital isolate of linezolid and methicillin-resistant Staphylococcus aureus (designated MRSA CM-05) by dilution and diffusion methods (including Etest). The presence of cfr was investigated in isolates of staphylococci colonizing the patient's household contacts and clinical isolates recovered from patients in the same unit where MRSA CM-05 was isolated. Additionally, 68 chloramphenicol-resistant Colombian MRSA isolates recovered from hospitals between 2001 and 2004 were screened for the presence of the cfr gene. In addition to erm(B), the erm(A) gene was also detected in CM-05. The isolate belonged to sequence type 5 and carried staphylococcal chromosomal cassette mec type I. We were unable to detect the cfr gene in any of the human staphylococci screened (either clinical or colonizing isolates). Agar and broth dilution methods detected linezolid resistance in CM-05. However, the Etest and disk diffusion methods failed to detect resistance after 24 h of incubation. Oxazolidinone resistance mediated by the cfr gene is rare, and acquisition by a human isolate appears to be a recent event in Colombia. The detection of cfr-mediated linezolid resistance might be compromised by the use of the disk diffusion or Etest method. PMID:18174304

  2. Pentamidine inhibits Coxiella burnetii growth and 23S rRNA intron splicing in vitro.

    Science.gov (United States)

    Minnick, Michael F; Hicks, Linda D; Battisti, James M; Raghavan, Rahul

    2010-10-01

    Coxiella burnetii is the bacterial agent of Q fever in humans. Acute Q fever generally manifests as a flu-like illness and is typically self-resolving. In contrast, chronic Q fever usually presents with endocarditis and is often life-threatening without appropriate antimicrobial therapy. Unfortunately, available options for the successful treatment of chronic Q fever are both limited and protracted (>18 months). Pentamidine, an RNA splice inhibitor used to treat fungal and protozoal infections, was shown to reduce intracellular growth of Coxiella by ca. 73% at a concentration of 1 microM (ca. 0.6 microg/mL) compared with untreated controls, with no detectable toxic effects on host cells. Bacterial targets of pentamidine include Cbu.L1917 and Cbu.L1951, two group I introns that disrupt the 23S rRNA gene of Coxiella, as demonstrated by the drug's ability to inhibit intron RNA splicing in vitro. Since both introns are highly conserved amongst all eight genotypes of the pathogen, pentamidine is predicted to be efficacious against numerous strains of C. burnetii. To our knowledge, this is the first report describing antibacterial activity for this antifungal/antiprotozoal agent.

  3. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid-coded Escheri...

  4. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid-coded Escheri...

  5. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A

    1995-01-01

    assigned to the donor substrate binding site and a possible base-pairing interaction between the 3'-terminal sequence of the peptidyl-tRNA and the sequence psi/U-G-G2582, that is conserved in all the non-mitochondrial 23 S-like rRNA sequences, is proposed. Three sites that have been implicated in aminoacyl-tRNA...

  6. 23S rRNA gene mutations contributing to macrolide resistance in Campylobacter jejuni and Campylobacter coli

    Science.gov (United States)

    Operon specific 23S rRNA mutations affecting minimum inhibitory concentrations (MICs) of macrolides (erythromycin [ERY], azithromycin [AZM], tylosin [TYL]) and a lincosamide (clindamycin [CLI]) were examined in a collection of Campylobacter jejuni and C. coli isolates. The three copies of the Campy...

  7. A DEAD box protein is required for formation of a hidden break in Arabidopsis chloroplast 23S rRNA.

    Science.gov (United States)

    Nishimura, Kenji; Ashida, Hiroki; Ogawa, Taro; Yokota, Akiho

    2010-09-01

    In plant chloroplasts, the ribosomal RNA (rRNA) of the large subunit of the ribosome undergoes post-maturation fragmentation processing. This processing consists of site-specific cleavage that generates gapped, discontinuous rRNA molecules. However, the molecular mechanism underlying introduction of the gap structure (the 'hidden break') is poorly understood. Here, we found that the DEAD box protein RH39 plays a key role in introduction of the hidden break into the 23S rRNA in Arabidopsis chloroplasts. Genetic screening for an Arabidopsis plant with a drastically reduced level of ribulose-1,5-bisphosphate carboxylase/oxygenase identified an RH39 mutant. The levels of other chloroplast-encoded photosynthetic proteins were also severely reduced. The reductions were not due to a failure of transcription, but rather inefficiency in translation. RNA gel blotting revealed incomplete fragmentation of 23S rRNA in chloroplasts during maturation. In vitro analysis with recombinant RH39 suggested that the protein binds to the adjacent sequence upstream of the hidden break site to exert its function. We propose a molecular mechanism for the RH39-mediated fragmentation processing of 23S rRNA in chloroplasts.

  8. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    Science.gov (United States)

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  9. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...

  10. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...

  11. Crystal structure of the Escherichia coli 23S rRNA:m5C methyltransferase RlmI (YccW) reveals evolutionary links between RNA modification enzymes

    DEFF Research Database (Denmark)

    Sunita, S; Tkaczuk, Karolina L; Purta, Elzbieta

    2008-01-01

    Methylation is the most common RNA modification in the three domains of life. Transfer of the methyl group from S-adenosyl-l-methionine (AdoMet) to specific atoms of RNA nucleotides is catalyzed by methyltransferase (MTase) enzymes. The rRNA MTase RlmI (rRNA large subunit methyltransferase gene I...... that the evolutionary paths of RNA and DNA 5-methyluridine and 5-methylcytosine MTases have been closely intertwined....

  12. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex.......The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...

  13. Sequence Analysis and Comparison of 16S rRNA, 23S rRNA and 16S/23S Intergenic Spacer Region of Greening Bacterium Associated with Yellowing Disease (Huanglongbing) of Kinnow Mandarin.

    Science.gov (United States)

    Gupta, K N; Baranwal, V K; Haq, Q M R

    2012-03-01

    High incidence (up to 40%) of symptoms of yellowing and yellow mottling was observed in 5-8 years old orchards of kinnow mandarin {Citrus reticulate Balanco ('King' × 'Willow mandarin')} in the Punjab state of India during a survey in January 2007. These symptoms are often confused with nutrient deficiency and other stress related disorders. However, a greening bacterium has been attributed to cause the disease. The disease was graft transmissible and sequencing of 16S rRNA, 16S/23S intergenic spacer region and 23S rRNA of the greening bacterium associated with yellowing disease in kinnow mandarin confirmed it to be Candidatus Liberibacter asiaticus ('Ca L. asiaticus') showing maximum identity of 95.9% with 'Ca L. asiaticus' from USA and Brazil in 16S rRNA. The study indicates definite association of 'Ca L. asiaticus' with yellowing/chlorotic mottling symptoms of greening disease of kinnow mandarin in Punjab state of India.

  14. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    Science.gov (United States)

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  15. Sites of interaction of the CCA end of peptidyl-tRNA with 23S rRNA.

    Science.gov (United States)

    Moazed, D; Noller, H F

    1991-05-01

    Oligonucleotide fragments derived from the 3' CCA terminus of acylated tRNA, such as CACCA-(AcPhe), UACCA-(AcLeu), and CAACCA-(fMet), bind specifically to ribosomes in the presence of sparsomycin and methanol [Monro, R. E., Celma, M. L. & Vazquez, D. (1969) Nature (London) 222, 356-358]. All three oligonucleotides protect a characteristic set of bases in 23S rRNA from chemical probes: G2252, G2253, A2439, A2451, U2506, and U2585. A2602 shows enhanced reactivity. These account for most of the same bases that are protected when peptidyl-tRNA analogues such as AcPhe-tRNA are bound to the ribosomal P site, and correspond precisely to those bases whose protection is abolished by removal of the 3'-CA end of tRNA. We conclude that most of the observed interactions between tRNA and 23S rRNA in the 50S ribosomal P site involve the conserved CCA terminus of tRNA. Sparsomycin may inhibit protein synthesis by stabilizing interaction between the peptidyl-CCA and the 23S P site, preventing formation of the intermediate A/P hybrid state.

  16. Chloroplast RNA-Binding Protein RBD1 Promotes Chilling Tolerance through 23S rRNA Processing in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    2016-05-01

    Full Text Available Plants have varying abilities to tolerate chilling (low but not freezing temperatures, and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance.

  17. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    Energy Technology Data Exchange (ETDEWEB)

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  18. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    Science.gov (United States)

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence.

  19. New mutation points in 23S rRNA gene associated with Helicobacter Pylori resistance to clarithromycin in northeast China

    Institute of Scientific and Technical Information of China (English)

    Qing Hao; Yan Li; Zhi-Jie Zhang; Yong Liu; Hong Gao

    2004-01-01

    AIM: To investigate the resistance rate of Helicobacter pylori (Hpylori) to clarithromycin, metronidazole, amoxicillin and tetracycline to guide clinical practice, and to study the mechanism of H pyloriresistant to clarithromycin.METHODS: Thirty H pyloristrains were isolated from the mucosa of peptic ulcer, gastric tumor and chronic gastritis patients, then the minimal inhibitory concentration (MIC) to clarithromycin, metronidazole, amoxicillin and tetracycline was evaluated by E-test method. The sequence analysis of PCR fragments was conducted in 23S rRNA gene of H pylori resistant to clarithromycin to get the resistance mechanism of the bacteria.RESULTS: Among 30 H pyloristrains, 7 cases were resistant to clarithromycin, 12 to metronidazole, 2 to tetracycline and no strain was found to be resistant to amoxicillin. The resistance rates were 23.3%, 40%, 6.7% and 0%,respectively. Three new mutation points were found to be related to the clarithromycin resistance in H pyloriisolates,which were G2224A, C2245T and T2289C.CONCLUSION: In northeast China, H pylorishows high resistance to metronidazole, while sensitive to amoxicillin.The mechanism of resistance to clarithromycin may be related to the mutation of G2224A, C2245T and T2289C in the 23S rRNA gene.

  20. Sequence variation of the 16S to 23S rRNA spacer region in Salmonella enterica.

    Science.gov (United States)

    Christensen, H; Møller, P L; Vogensen, F K; Olsen, J E

    2000-01-01

    The possibility for identification of Salmonella enterica serotypes by sequence analysis of the 16S to 23S rRNA internal transcribed spacer was investigated by direct sequencing of polymerase chain reaction-amplified DNA from all operons simultaneously in a collection of 25 strains of 18 different serotypes of S. enterica, and by sequencing individual cloned operons from a single strain. It was only possible to determine the first 117 bases upstream from the 23S rRNA gene by direct sequencing because of variation between the rrn operons. Comparison of sequences from this region allowed separation of only 15 out of the 18 serotypes investigated and was not specific even at the subspecies level of S. enterica. To determine the differences between internal transcribed spacers in more detail, the individual rrn operons of strain JEO 197, serotype IV 43:z4,z23:-, were cloned and sequenced. The strain contained four short internal transcribed spacer fragments of 382-384 bases in length, which were 98.4-99.7% similar to each other and three long fragments of 505 bases with 98.0-99.8% similarity. The study demonstrated a higher degree of interbacterial variation than intrabacterial variation between operons for serotypes of S. enterica.

  1. Molecular characterization of the full-length 23S and 5S ribosomal RNA (rRNA) genes of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, Akihiro; Saito, Satoru; Sekizuka, Tsuyoshi; Murayama, Ohoshi; Takamiya, Shinzaburo; Moore, John E; Millar, B Cherie; Matsuda, Motoo

    2007-08-01

    An approximately 4.2 kbp region encoding 23S and 5S rRNA genes was identified when recombinant plasmid DNAs from two genomic DNA libraries and an inverse PCR product of Taylorella asinigenitalis UK-1 isolate were analyzed. Full-length genes of 23S rRNA (3,225 bp) and 5S rRNA (117 bp) of T. asinigenitalis are described. The present sequence analysis identified a non-coding hypothetically intrinsic transcription terminator region downstream of the 5S rRNA gene. The sequence, however, downstream of the 5S rRNA gene did not show any distal tRNA genes. Surprisingly, an intervening sequence (IVS) of 270 bp in length, including two specific tandem repeat units of 80 bp and one partial unit of 48 bp with unknown functions was identified in the first quarter of the 23S rRNA gene sequence. A second IVS of 70 bp in length was also identified in the central region of the 23S rRNA gene. In addition, by using PCR and sequencing procedures, two T. asinigenitalis isolates, UK-1 and UK-2, carried multiple IVSs in the first quarter and central regions. Moreover, the 23S rRNA fragmentation occurred in the UK-1 isolate. A phylogenetic analysis was first carried out based on the 23S rRNA sequence data from T. asinigenitalis UK-1 and 13 other beta-Proteobacteria. This is the first report of IVSs in the 23S rRNA gene from the beta-Proteobacteria.

  2. Resistance to the macrolide antibiotic tylosin is conferred by single methylations at 23S rRNA nucleotides G748 and A2058 acting in synergy

    Science.gov (United States)

    Liu, Mingfu; Douthwaite, Stephen

    2002-01-01

    The macrolide antibiotic tylosin has been used extensively in veterinary medicine and exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin-synthesizing strains of the Gram-positive bacterium Streptomyces fradiae protect themselves from their own product by differential expression of four resistance determinants, tlrA, tlrB, tlrC, and tlrD. The tlrB and tlrD genes encode methyltransferases that add single methyl groups at 23S rRNA nucleotides G748 and A2058, respectively. Here we show that methylation by neither TlrB nor TlrD is sufficient on its own to give tylosin resistance, and resistance is conferred by the G748 and A2058 methylations acting together in synergy. This synergistic mechanism of resistance is specific for the macrolides tylosin and mycinamycin that possess sugars extending from the 5- and 14-positions of the macrolactone ring and is not observed for macrolides, such as carbomycin, spiramycin, and erythromycin, that have different constellations of sugars. The manner in which the G748 and A2058 methylations coincide with the glycosylation patterns of tylosin and mycinamycin reflects unambiguously how these macrolides fit into their binding site within the bacterial 50S ribosomal subunit. PMID:12417742

  3. Mutations in 23S rRNA at the Peptidyl Transferase Center and Their Relationship to Linezolid Binding and Cross-Resistance

    DEFF Research Database (Denmark)

    Long, Katherine; Munck, Christian

    2010-01-01

    The oxazolidinone antibiotic linezolid targets the peptidyl transferase center (PTC) on the bacterial ribosome. Thirteen single and four double 23S rRNA mutations were introduced into a Mycobacterium smegmatis strain with a single rRNA operon. Converting bacterial base identity by single mutations...

  4. Rapid differentiation of Francisella species and subspecies by fluorescent in situ hybridization targeting the 23S rRNA

    Directory of Open Access Journals (Sweden)

    Trebesius Karlheinz

    2010-03-01

    Full Text Available Abstract Background Francisella (F. tularensis is the causative agent of tularemia. Due to its low infectious dose, ease of dissemination and high case fatality rate, F. tularensis was the subject in diverse biological weapons programs and is among the top six agents with high potential if misused in bioterrorism. Microbiological diagnosis is cumbersome and time-consuming. Methods for the direct detection of the pathogen (immunofluorescence, PCR have been developed but are restricted to reference laboratories. Results The complete 23S rRNA genes of representative strains of F. philomiragia and all subspecies of F. tularensis were sequenced. Single nucleotide polymorphisms on species and subspecies level were confirmed by partial amplification and sequencing of 24 additional strains. Fluorescent In Situ Hybridization (FISH assays were established using species- and subspecies-specific probes. Different FISH protocols allowed the positive identification of all 4 F. philomiragia strains, and more than 40 F. tularensis strains tested. By combination of different probes, it was possible to differentiate the F. tularensis subspecies holarctica, tularensis, mediasiatica and novicida. No cross reactivity with strains of 71 clinically relevant bacterial species was observed. FISH was also successfully applied to detect different F. tularensis strains in infected cells or tissue samples. In blood culture systems spiked with F. tularensis, bacterial cells of different subspecies could be separated within single samples. Conclusion We could show that FISH targeting the 23S rRNA gene is a rapid and versatile method for the identification and differentiation of F. tularensis isolates from both laboratory cultures and clinical samples.

  5. 116S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    Directory of Open Access Journals (Sweden)

    Sima eTokajian

    2016-02-01

    Full Text Available Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 to 849 bp, while their G+C content was 42.2 mol% to 57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes, ITSAla(TGC, ITSAla (TGC+Ile (GAT, ITSIle (GAT+Ala (TGC and ITS Ile (GAT+Pseudo. All of the identified tRNAAla (TGC molecules consisted of 73 bases, and all of the tRNAIle (GAT molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2.

  6. Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates

    Science.gov (United States)

    Bar-Yaacov, Dan; Frumkin, Idan; Yashiro, Yuka; Schlesinger, Orr; Bieri, Philipp; Greber, Basil; Ban, Nenad; Zarivach, Raz; Alfonta, Lital; Pilpel, Yitzhak; Suzuki, Tsutomu; Mishmar, Dan

    2016-01-01

    The mitochondrial ribosome, which translates all mitochondrial DNA (mtDNA)-encoded proteins, should be tightly regulated pre- and post-transcriptionally. Recently, we found RNA-DNA differences (RDDs) at human mitochondrial 16S (large) rRNA position 947 that were indicative of post-transcriptional modification. Here, we show that these 16S rRNA RDDs result from a 1-methyladenosine (m1A) modification introduced by TRMT61B, thus being the first vertebrate methyltransferase that modifies both tRNA and rRNAs. m1A947 is conserved in humans and all vertebrates having adenine at the corresponding mtDNA position (90% of vertebrates). However, this mtDNA base is a thymine in 10% of the vertebrates and a guanine in the 23S rRNA of 95% of bacteria, suggesting alternative evolutionary solutions. m1A, uridine, or guanine may stabilize the local structure of mitochondrial and bacterial ribosomes. Experimental assessment of genome-edited Escherichia coli showed that unmodified adenine caused impaired protein synthesis and growth. Our findings revealed a conserved mechanism of rRNA modification that has been selected instead of DNA mutations to enable proper mitochondrial ribosome function. PMID:27631568

  7. Intragenomic heterogeneity of the 16S rRNA-23S rRNA internal transcribed spacer among Pseudomonas syringae and Pseudomonas fluorescens strains.

    Science.gov (United States)

    Milyutina, Irina A; Bobrova, Vera K; Matveeva, Eugenia V; Schaad, Norman W; Troitsky, Alexey V

    2004-10-01

    The 16S-23S rRNA internal transcribed spacer regions (ITS1) from 14 strains of Pseudomonas syringae and P. fluorescens were sequenced. ITS1 exhibited significant sequence variability among different operons within a single genome. From 1 to 4 types of ITS1 were found in individual genomes of the P. syringae and P. fluorescens strains. A total of eight ITS1 types were identified among strains studied. The ITS1 nucleotide sequences consisted of conserved blocks including, among others, a stem-forming region of box B, tRNAIle and tRNAAla genes and several variable blocks. The differences in the variable regions were mostly due to insertions and/or deletions of nucleotide blocks. The intragenomic heterogeneity of ITS1 was brought about by different combinations of variable blocks, which possibly have resulted from recombination and horizontal transfer.

  8. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    Science.gov (United States)

    Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

  9. Analysis of the 16S-23S rRNA gene internal transcribed spacer region in Klebsiella species.

    Science.gov (United States)

    Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-11-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types-ITS(none) (without tRNA genes), ITS(glu) [with a tRNA(Glu (UUC)) gene], and ITS(ile+ala) [with tRNA(Ile (GAU)) and tRNA(Ala (UGC)) genes]-were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITS(glu) and ITS(ile+ala). The presence of ITS(none) in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITS(none), from 0.967 to 1.000 for ITS(glu), and from 0.968 to 1.000 for ITS(ile+ala). Interspecies sequence identities range from 0.775 to 0.989 for ITS(none), from 0.798 to 0.997 for ITS(glu), and from 0.712 to 0.985 for ITS(ile+ala). Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes.

  10. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  11. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H.

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  12. Differentiation of non-pylori Helicobacter species based on PCR-restriction fragment length polymorphism of the 23S rRNA gene.

    Science.gov (United States)

    Yadegar, Abbas; Alebouyeh, Masoud; Lawson, Andy J; Mirzaei, Tabassom; Nazemalhosseini Mojarad, Ehsan; Zali, Mohammad Reza

    2014-06-01

    Phenotypic identification of non-pylori Helicobacter species has always been problematic and time-consuming in comparison with many other bacteria. We developed a rapid two-step identification assay based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 23S rRNA gene for differentiating between non-pylori Helicobacter species. A new genus-specific primer pair based on all available complete and partial 23S rRNA sequences of Helicobacter species was designed. In silico restriction analysis of variable regions of the 23S rRNA gene suggested SmaI and HindIII endonucleases would provide a good level of differentiation. Analysis of the obtained 23S rRNA RFLP patterns divided all Helicobacter study strains into three species groups (groups A-C) and 12 unique restriction patterns. Wolinella succinogenes also gave a unique pattern. Our proposed PCR-RFLP method was found to be as a valuable tool for routine identification of non-pylori Helicobacter species from human or animal samples.

  13. The sequence of Methanospirillum hungatei 23S rRNA confirms the specific relationship between the extreme halophiles and the Methanomicrobiales

    Science.gov (United States)

    Burggraf, S.; Ching, A.; Stetter, K. O.; Woese, C. R.

    1991-01-01

    We have determined the sequence of the 23S rRNA from the methanogenic archaeon Methanospirillum hungatei. This is the first such sequence from a member of the Methanomicrobiales. Moreover, it brings additional evidence to bear on the possible specific relationship between this particular group of methanogens and the extreme halophiles. Such evidence is critical in that several new (and relatively untested) methods of phylogenetic inference have lead to the controversial conclusion that the extreme halophiles are either not related to the archaea, or are only peripherally so. Analysis of the Methanospirillum hungatei 23S rRNA sequence shows the Methanomicrobiales are indeed a sister group of the extreme halophiles, further strengthening the conclusions reached from analysis of 16S rRNA sequences.

  14. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    Science.gov (United States)

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis.

  15. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    in the latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop...... the functionally important peptidyl transferase loop of 23S rRNA at positions m2A2503/psi2504 and G2061/A2062. The modification yields are influenced strongly, and differentially, by P-site-bound tRNA and strongly by some of the peptidyl transferase antibiotics tested, with chloramphenicol producing a shift...... that was excised from the mature rRNA using RNAse H. In contrast, no antibiotic-induced effects were observed on in vitro T7 transcripts of full-length 23S rRNA, domain V, or on a fragment extending from positions approximately 2496-2566, which indicates that one or more posttranscriptional modifications within...

  16. The study of mutation in 23S rRNA resistance gene of Helicobacter pylori to clarithromycin in patients with gastrointestinal disorders in Isfahan - Iran.

    Science.gov (United States)

    Khademi, Farzad; Faghri, Jamshid; Moghim, Sharareh; Esfahani, Bahram Nasr; Fazeli, Hossein; Poursina, Farkhondeh; Adibi, Peyman; Madhi, Masoumeh; Safaei, Hajieh Ghasemian

    2014-01-01

    Helicobacter pylori antimicrobial resistance is an important factor responsible for treatment failure. The purpose of this study was evaluating the prevalence of point mutations in clarithromycin-resistant clinical isolates of H. pylori in Isfahan city of Iran. Thirty isolates of H. pylori from 130 biopsy specimens were isolated by culture and confirmed by biochemical and PCR tests. The MIC of clarithromycin antibiotic for 30 clinical isolates of H. pylori was determined by E-test method. The point mutations in the 288 bp of 23S rRNA gene of H. pylori were investigated in four clarithromycin-resistant clinical isolates by PCR followed by sequencing. Among 30 isolates of H. pylori, 4 cases were resistant to clarithromycin. One point mutation was found at position T2243C in the 23S rRNA gene in all resistance isolates. In our study, H. pylori resistance to clarithromycin associated with point mutation at position 2243 (T2243C).

  17. Methylation of 23S rRNA caused by tlrA (ermSF), a tylosin resistance determinant from Streptomyces fradiae.

    Science.gov (United States)

    Zalacain, M; Cundliffe, E

    1989-01-01

    Ribosomes from Streptomyces griseofuscus expressing tlrA, a resistance gene isolated from the tylosin producer Streptomyces fradiae, are resistant to macrolide and lincosamide antibiotics in vitro. The tlrA product was found to be a methylase that introduces two methyl groups into a single base within 23S rRNA, generating N6,N6-dimethyladenine at position 2058. This activity is therefore similar to the ermE resistance mechanism in Saccharopolyspora erythraea (formerly Streptomyces erythraeus). Images PMID:2753855

  18. Rapid assay of A2058T-mutated 23S rRNA allelic profiles associated with high-level macrolide resistance in Moraxella catarrhalis.

    Science.gov (United States)

    Saito, Ryoichi; Kasai, Ayako; Ogihara, Shinji; Yamada, Kageto; Tao, Kazuyuki

    2015-09-01

    We report on a restriction fragment-length polymorphism (HpyCH4III) assay for profile analysis of 23S rRNA gene A2058T-mutated alleles associated with high-level macrolide resistance in Moraxella catarrhalis. Our assay results were supported by DNA sequencing analysis, allowed for simultaneous testing of many strains, and produced results from pure-cultured colonies within 4 h.

  19. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    Science.gov (United States)

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  20. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  1. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S rRNA, a...

  2. Pseudouridylation of helix 69 of 23S rRNA is necessary for an effective translation termination

    DEFF Research Database (Denmark)

    Ejby, Morten; Sørensen, Michael A; Pedersen, Steen

    2007-01-01

    Escherichia coli strains with inactivated rluD genes were previously found to lack the conserved pseudouridines in helix 69 of 23S ribosomal RNA and to grow slowly. A suppressor mutant was isolated with a near normal growth rate that had changed the conserved Glu-172 codon to a Lys codon in prfB,...

  3. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Energy Technology Data Exchange (ETDEWEB)

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  4. Differentiation of acetic acid bacteria based on sequence analysis of 16S-23S rRNA gene internal transcribed spacer sequences.

    Science.gov (United States)

    González, Angel; Mas, Albert

    2011-06-30

    The 16S-23S gene internal transcribed spacer sequence of sixty-four strains belonging to different acetic acid bacteria genera were analyzed, and phylogenetic trees were generated for each genera. The topologies of the different trees were in accordance with the 16S rRNA gene trees, although the similarity percentages obtained between the species was shown to be much lower. These values suggest the usefulness of including the 16S-23S gene internal transcribed spacer region as a part of the polyphasic approach required for the further classification of acetic acid bacteria. Furthermore, the region could be a good target for primer and probe design. It has also been validated for use in the identification of unknown samples of this bacterial group from wine vinegar and fruit condiments.

  5. Identification of a novel G2073A mutation in 23S rRNA in amphenicol-selected mutants of Campylobacter jejuni.

    Directory of Open Access Journals (Sweden)

    Licai Ma

    Full Text Available OBJECTIVES: This study was conducted to examine the development and molecular mechanisms of amphenicol resistance in Campylobacter jejuni by using in vitro selection with chloramphenicol and florfenicol. The impact of the resistance development on growth rates was also determined using in vitro culture. METHODS: Chloramphenicol and florfenicol were used as selection agents to perform in vitro stepwise selection. Mutants resistant to the selective agents were obtained from the selection process. The mutant strains were compared with the parent strain for changes in MICs and growth rates. The 23S rRNA gene and the L4 and L22 ribosomal protein genes in the mutant strains and the parent strain were amplified and sequenced to identify potential resistance-associated mutations. RESULTS: C. jejuni strains that were highly resistant to chloramphenicol and florfenicol were obtained from in vitro selection. A novel G2073A mutation in all three copies of the 23S rRNA gene was identified in all the resistant mutants examined, which showed resistance to both chloramphenicol and florfenicol. In addition, all the mutants selected by chloramphenicol also exhibited the G74D modification in ribosomal protein L4, which was previously shown to confer a low-level erythromycin resistance in Campylobacter species. The mutants selected by florfenicol did not have the G74D mutation in L4. Notably, the amphenicol-resistant mutants also exhibited reduced susceptibility to erythromycin, suggesting that the selection resulted in cross resistance to macrolides. CONCLUSIONS: This study identifies a novel point mutation (G2073A in 23S rRNA in amphenicol-selected mutants of C. jejuni. Development of amphenicol resistance in Campylobacter likely incurs a fitness cost as the mutant strains showed slower growth rates in antibiotic-free media.

  6. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    Institute of Scientific and Technical Information of China (English)

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平

    2002-01-01

    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  7. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    Science.gov (United States)

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  8. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.

    Science.gov (United States)

    Bae, Hee-Sung; Hou, Aixin

    2013-02-01

    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods.

  9. The study of mutation in 23S rRNA resistance gene of Helicobacter pylori to clarithromycin in patients with gastrointestinal disorders in Isfahan — Iran

    Science.gov (United States)

    Khademi, Farzad; Faghri, Jamshid; Moghim, Sharareh; Esfahani, Bahram Nasr; Fazeli, Hossein; Poursina, Farkhondeh; Adibi, Peyman; Madhi, Masoumeh; Safaei, Hajieh Ghasemian

    2014-01-01

    Background: Helicobacter pylori antimicrobial resistance is an important factor responsible for treatment failure. The purpose of this study was evaluating the prevalence of point mutations in clarithromycin-resistant clinical isolates of H. pylori in Isfahan city of Iran. Materials and Methods: Thirty isolates of H. pylori from 130 biopsy specimens were isolated by culture and confirmed by biochemical and PCR tests. The MIC of clarithromycin antibiotic for 30 clinical isolates of H. pylori was determined by E-test method. The point mutations in the 288 bp of 23S rRNA gene of H. pylori were investigated in four clarithromycin-resistant clinical isolates by PCR followed by sequencing. Results: Among 30 isolates of H. pylori, 4 cases were resistant to clarithromycin. One point mutation was found at position T2243C in the 23S rRNA gene in all resistance isolates. Conclusions: In our study, H. pylori resistance to clarithromycin associated with point mutation at position 2243 (T2243C). PMID:24800187

  10. The study of mutation in 23S rRNA resistance gene of Helicobacter pylori to clarithromycin in patients with gastrointestinal disorders in Isfahan - Iran

    Directory of Open Access Journals (Sweden)

    Farzad Khademi

    2014-01-01

    Full Text Available Background: Helicobacter pylori antimicrobial resistance is an important factor responsible for treatment failure. The purpose of this study was evaluating the prevalence of point mutations in clarithromycin-resistant clinical isolates of H. pylori in Isfahan city of Iran. Materials and Methods: Thirty isolates of H. pylori from 130 biopsy specimens were isolated by culture and confirmed by biochemical and PCR tests. The MIC of clarithromycin antibiotic for 30 clinical isolates of H. pylori was determined by E-test method. The point mutations in the 288 bp of 23S rRNA gene of H. Pylori were investigated in four clarithromycin-resistant clinical isolates by PCR followed by sequencing. Results: Among 30 isolates of H. pylori, 4 cases were resistant to clarithromycin. One point mutation was found at position T2243C in the 23S rRNA gene in all resistance isolates. Conclusions: In our study, H. pylori resistance to clarithromycin associated with point mutation at position 2243 (T2243C.

  11. Dual detection of Legionella pneumophila and Legionella species by real-time PCR targeting the 23S-5S rRNA gene spacer region.

    Science.gov (United States)

    Yang, G; Benson, R; Pelish, T; Brown, E; Winchell, J M; Fields, B

    2010-03-01

    Although the majority of cases of Legionnaires' disease (LD) are caused by Legionella pneumophila, an increasing number of other Legionella species have been reported to cause human disease. There are no clinical presentations unique to LD and hence accurate laboratory tests are required for early diagnosis. Therefore, we designed a real-time PCR assay that targets the 23S-5S rRNA intergenic spacer region (23S-5S PCR) and allows for detection of all Legionella species and discrimination of L. pneumophila from other Legionella species. In total, 271 isolates representing 50 Legionella species were tested and the assay was validated using 39 culture-positive and 110 culture-negative patient specimens collected between 1989 and 2006. PCR-positive results were obtained with all 39 culture-positive samples (100% sensitivity). Specimens that tested positive according to 23S-5S PCR, but were culture-negative, were further analysed by DNA sequencing of the amplicon or the macrophage infectivity potentiator (mip) gene. In addition to L. pneumophila, Legionella longbeachae, Legionella cincinnatiensis and Legionella micdadei were identified in the specimens. The assay showed a 7-log dynamic range displaying a sensitivity of 7.5 CFU/mL or three genome equivalents per reaction. Sixty-one specimens containing viruses or bacteria other than Legionellae were negative according to 23S-5S PCR, demonstrating its specificity. Use of this assay should contribute to the earlier detection of respiratory disease caused by Legionella species, as well as to increased rates of detection.

  12. Establishment and analysis of specific DNA patterns in 16S-23S rRNA gene spacer regions for differentiating different bacteria

    Institute of Scientific and Technical Information of China (English)

    尚世强; 付君芬; 董关萍; 洪文澜; 杜立中; 俞锡林

    2003-01-01

    Objective To establish the specific 16S-23S rRNA gene spacer regions in different bacteria using polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP), DNA cloning and sequences analysis. Methods A pair of primers were selected from highly conserved sequences adjacent to the 16S-23S rRNA spacer region. Bacterial DNA from sixty-one strains of standard bacteria and corresponding clinical isolates representative of 20 genera and 26 species was amplified by PCR, and further analyzed by RFLP, DNA cloning and sequences analysis. Furthermore, all specimens were examined by bacterial culturing and PCR-RFLP analysis. The evaluation of these assays in practical clinic practice was also discussed.Results Restriction enzyme analysis revealed one, two or three bands or more observed among the 26 different standard strains. The sensitivity of PCR reached 2.5 colony-forming unit (CFU), and there was no cross reaction with human genomic DNA, fungus or virus. Fourteen species could be distinguished immediately by PCR, while another 10 species were further identified by Hinf Ⅰ or Alu Ⅰ digestion. The only difference between K.pneumoniae and E.durans was located at the site of the 779th nucleotide according to the sequence analysis and only XmaⅢ digestion could distinguish one from another. Of 42 specimens from septicemic neonates, 15 were identified as positive by blood culture at a rate of 35.7%. However, 27 specimens identified as positive by PCR, with a rate of 64.2%, a method significantly more effective than blood culture (P<0.01). Of 6 cerebrospinal fluid (CSF) specimens, one tested positive for S.epidermidis was also positive by PCR, two culture negative were positive by PCR and diagnosed as S.epidermidis according to the DNA pattern. One positive for C.neoformans was negative by PCR. The other two specimens were negative by both PCR and culture.Conclusions The method of detecting bacterial 16S-23S rRNA spacer regions using PCR

  13. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    DEFF Research Database (Denmark)

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  14. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA.

    Science.gov (United States)

    Sunita, S; Zhenxing, H; Swaathi, J; Cygler, Miroslaw; Matte, Allan; Sivaraman, J

    2006-06-16

    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine (Psi) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E.coli RluF at 2.6A resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. The structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of Psi-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.

  15. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Sunita,S.; Zhenxing, H.; Swaathi, J.; Cygler, M.; Matte, A.; Sivaraman, J.

    2006-01-01

    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine ({psi}) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E. coli RluF at 2.6 Angstroms resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. The structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of {psi}-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.

  16. SrmB, a DEAD-box helicase involved in Escherichia coli ribosome assembly, is specifically targeted to 23S rRNA in vivo.

    Science.gov (United States)

    Trubetskoy, Dmitrii; Proux, Florence; Allemand, Frédéric; Dreyfus, Marc; Iost, Isabelle

    2009-10-01

    DEAD-box proteins play specific roles in remodeling RNA or ribonucleoprotein complexes. Yet, in vitro, they generally behave as nonspecific RNA-dependent ATPases, raising the question of what determines their specificity in vivo. SrmB, one of the five Escherichia coli DEAD-box proteins, participates in the assembly of the large ribosomal subunit. Moreover, when overexpressed, it compensates for a mutation in L24, the ribosomal protein (r-protein) thought to initiate assembly. Here, using the tandem affinity purification (TAP) procedure, we show that SrmB forms a complex with r-proteins L4, L24 and a region near the 5'-end of 23S rRNA that binds these proteins. In vitro reconstitution experiments show that the stability of this complex reflects cooperative interactions of SrmB with L4, L24 and rRNA. These observations are consistent with an early role of SrmB in assembly and explain the genetic link between SrmB and L24. Besides its catalytic core, SrmB possesses a nonconserved C-terminal extension that, we show, is not essential for SrmB function and specificity. In this regard, SrmB differs from DbpA, another DEAD-box protein involved in ribosome assembly.

  17. Development of a multiplex PCR assay based on the 16S-23S rRNA internal transcribed spacer for the detection and identification of rodent Pasteurellaceae.

    Science.gov (United States)

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Bleich, André; Gougoula, Christina; Sager, Martin

    2013-11-01

    The rodents Pasteurellaceae have to be excluded from the specified pathogen free experimental animal facilities. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals just a few molecular based methods are available for their detection and identification. The aim of the present investigation was to develop a multiplex PCR assay allowing detection of all rodent Pasteurellaceae and identification of [Pasteurella] pneumotropica biotype Jawetz, [P.] pneumotropica biotype Heyl and [Actinobacillus] muris, as the most prevalent members of the group. For this, a Pasteurellaceae common forward primer located on the 16S rRNA gene was used in conjunction with four different reverse primers specific for [P.] pneumotropica biotype Jawetz, [P.] pneumotropica biotype Heyl, [A.] muris and a common reverse primer for all rodent Pasteurellaceae, all targeting the 16S-23S rRNA internal transcribed spacer sequences. The performance characteristics of the assay were tested against 125 Pasteurellaceae isolates belonging to eleven different species and including 34 strains of [P.] pneumotropica biotype Jawetz, 44 strains of [P.] pneumotropica biotype Heyl and 37 strains of [A.] muris. Additionally, eight other mouse associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA gene sequencing. This multiplex PCR represents the first molecular tool able to detect and differentiate in a single assay among the Pasteurellaceae found in laboratory mouse and may become a reliable alternative to the present diagnostic methods. © 2013.

  18. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  19. Genotyping of Salmonella spp.by 16S-23S rRNA assay%沙门菌PCR-dHPLC基因分型方法建立

    Institute of Scientific and Technical Information of China (English)

    张东方; 袁飞; 王娉; 杨海荣; 胡玥; 赵勇胜; 陈颖; 葛毅强

    2012-01-01

    Objective To develop a polymerase chain reaction-denaturing high performance liquid chromatography (PCR-dHPLC) genotyping method for genotyping of Salmonella spp. Methods Specific primers of 16S-23S rRNA in-tergenic spacer sequence (ITS) region were used to subtype Salmonella spp. The PCR amplification products of experimental strains were separated by dHPLC. The results of genotyping achieved through the differences between dHPLC peaks and were comparaed to the results obtained by serological typing and biochemical typing. Results Totally 89 Salmonella spp. strains were successfully genotyped into 12 dHPLC types(D type). All the Salmonella spp. strains had one same chromatographic peak,while other food-born pathogens showed no similar peak. DNA sequence analysis showed that the sequence was 600bp. The results indicate that the chromatographic peak is specific to Salmonella spp. Comparing the dHPLC genotyping results with those of serological typing and biochemical typing, we found dHPLC genotyping results were significantly differ from the serological typing results, while were consistent with that of the biochemical typing. Conclusion DHPLC is a novel, rapid, highly accurate, and cost-effective genotyping method for genotyping of Salmonella spp.%目的 建立沙门菌聚合酶链反应-变性高效液相色谱(PCR-dHPLC)基因分型方法.方法 采用16S ~23S rRNA内转录间隔(ITS)作为沙门菌分型目的基因,确定特异性扩增引物,进行PCR扩增,扩增产物经dHPLC分离,根据dHPLC图谱峰型差异进行分型,并与血清学和生化分型结果比较.结果 89株沙门菌共分为12个dHPLC型(D型);所有沙门菌均有1个相同色谱峰,克隆测序结果表明,其片断大小为600 bp,其他8种食源性致病菌对照株无此色谱峰,应为沙门菌16S~23S rRNA基因序列的特征性条带,分型结果与血清学差异较大,与生化分型结果有一定一致性.结论 所建立的沙门菌PCR-dHPLC基因分型方法具快速

  20. The Cfr rRNA methyltransferase confers resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics

    DEFF Research Database (Denmark)

    Long, K. S.; Poehlsgaard, Jacob; Kehrenberg, C.

    2006-01-01

    A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin...... drug classes: Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics. Each of these five drug classes contains important antimicrobial agents that are currently used in human and/or veterinary medicine. We find that binding of the PhLOPSA drugs, which bind...

  1. Identification of Carnobacterium Species by Restriction Fragment Length Polymorphism of the 16S-23S rRNA Gene Intergenic Spacer Region and Species-Specific PCR

    OpenAIRE

    Rachman, Cinta; Kabadjova, Petia; Valcheva, Rosica; Prévost, Hervé; Dousset, Xavier

    2004-01-01

    The genus Carnobacterium is currently divided into the following eight species: Carnobacterium piscicola, C. divergens, C. gallinarum, C. mobile, C. funditum, C. alterfunditum, C. inhibens, and C. viridans. An identification tool for the rapid differentiation of these eight Carnobacterium species was developed, based on the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR). PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of this 16S-23S rDNA ISR was performed in ord...

  2. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    DEFF Research Database (Denmark)

    Mann, P. A.; Xiong, L.; Mankin, A. S.

    2001-01-01

    exhibited a dramatic reduction in evernimicin binding, shown by both cell-free translation assays and direct-binding assays. The resistance determinant was cloned from strain 9631355; sequence alignments suggested it was a methyltransferase and therefore it was designated emtA for evernimicin...... methyltransferase. Evernimicin resistance was transmissible and emtA was localized to a plasmid-borne insertion element. Purified EmtA methylated 50S subunits from an evernimicin-sensitive strain 30-fold more efficiently than those from a resistant strain. Reverse transcription identified a pause site...

  3. Recognition elements in rRNA for the tylosin resistance methyltransferase RlmA(II)

    DEFF Research Database (Denmark)

    Lebars, Isabelle; Husson, Clotilde; Yoshizawa, Satoko

    2007-01-01

    antibiotics. We have previously solved the solution structure of hairpin 35 in the conformation that is recognized by the RlmA(II) methyltransferase from Streptococcus pneumoniae. It was shown that while essential recognition elements are located in hairpin 35, the interactions between RlmA(II) and hairpin 35...

  4. Development of an endpoint genotyping assay to detect the Mycoplasma pneumoniae 23S rRNA gene and distinguish the existence of macrolide resistance-associated mutations at position 2063.

    Science.gov (United States)

    Suzuki, Yu; Seto, Junji; Shimotai, Yoshitaka; Ikeda, Tatsuya; Yahagi, Kazue; Mizuta, Katsumi; Matsuzaki, Yoko; Hongo, Seiji

    2016-12-01

    The prevalence of macrolide-resistant Mycoplasma pneumoniae harboring a mutation in the 23S rRNA gene is increasing, and rapid detection assays are needed for clinical management. We developed an endpoint genotyping assay to detect the M. pneumoniae 23S rRNA gene and determine the existence of macrolide resistance-associated mutations at position 2063 (A2063G, A2063T and A2063C mutations). This A2063B genotyping assay detected more than 50 copies/reaction of the M. pneumoniae gene in every nucleotide mutation at position 2063. Of 42 clinical specimens, 3 were positive without mutation, 6 were positive with the A2063G mutation, and 33 were negative. The results were confirmed using nested PCR with the sequencing of the M. pneumoniae 23S rRNA gene, and a high sensitivity (90%), specificity (100%), and coincidence ratio (kappa coefficient=0.93) were obtained. Therefore, the A2063B genotyping assay is useful for the rapid discrimination of macrolide resistance mutations at position 2063.

  5. Identification of the RsmG methyltransferase target as 16S rRNA nucleotide G527 and characterization of Bacillus subtilis rsmG mutants

    DEFF Research Database (Denmark)

    Nishimura, Kenji; Johansen, Shanna K; Inaoka, Takashi;

    2007-01-01

    The methyltransferase RsmG methylates the N7 position of nucleotide G535 in 16S rRNA of Bacillus subtilis (corresponding to G527 in Escherichia coli). Disruption of rsmG resulted in low-level resistance to streptomycin. A growth competition assay revealed that there are no differences in fitness...

  6. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    DEFF Research Database (Denmark)

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N......-Ac-Phe-tRNA were derivatized at the 2 position with an azido group and the tRNAs were cross-linked to the ribosome on irradiation with ultraviolet light at 365 nm. The cross-links were localized on the rRNA within extended versions of three previously characterized 23S rRNA fragments F1', F2', and F4......' at nucleotides C2601/A2602, U2584/U2585 (F1'), U2506 (F2'), and A2062/C2063 (F4'). Each of these nucleotides lies within the peptidyl transferase loop region of the 23S rRNA. Cross-links were also formed with ribosomal proteins L27 (strong) and L33 (weak), as shown earlier. The antibiotics sparsomycin...

  7. Interaction of the tylosin-resistance methyltransferase RlmA II at its rRNA target differs from the orthologue RlmA I

    DEFF Research Database (Denmark)

    Douthwaite, Stephen; Jakobsen, Lene; Yoshizawa, Satoko

    2008-01-01

    RlmA(II) methylates the N1-position of nucleotide G748 in hairpin 35 of 23 S rRNA. The resultant methyl group extends into the peptide channel of the 50 S ribosomal subunit and confers resistance to tylosin and other mycinosylated macrolide antibiotics. Methylation at G748 occurs in several groups...... of Gram-positive bacteria, including the tylosin-producer Streptomyces fradiae and the pathogen Streptococcus pneumoniae. Recombinant S. pneumoniae RlmA(II) was purified and shown to retain its activity and specificity in vitro when tested on unmethylated 23 S rRNA substrates. RlmA(II) makes multiple...

  8. Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...... within the peptidyl transferase loop region of 23S-like rRNA by using a combination of a primer extension approach, RNase H fragment analysis, and crosslinking with radioactive [(125)I]phenol-alanine-sparsomycin. Crosslinking of several sparsomycin derivatives, modified near the sulfoxy group, implicated...

  9. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O 139 outbreak based on the inter-genomic heterogeneity of the 16S-23S rRNA intergenic spacer regions.

    Science.gov (United States)

    Ghatak, Atreyi; Majumdar, Anasuya; Ghosh, Ranajit K

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O 139 outbreak. ISR classes 'a' and 'g' were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O 139 serogroup and post-O 139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  10. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A

    1999-01-01

    Streptogramin antibiotics contain two active A and B components that inhibit peptide elongation synergistically. Mutants resistant to the A component (virginiamycin M1 and pristinamycin IIA) were selected for the archaeon Halobacterium halobium. The mutations mapped to the universally conserved...... and within the bacterial cells. It is inferred that position 2058 and the sites of mutation, A2059 and A2503, are involved in the synergistic inhibition by the two antibiotics. A structural model is presented which links A2059 and A2503 and provides a structural rationale for the rRNA footprints....

  11. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    DEFF Research Database (Denmark)

    Xiong, L; Kloss, P; Douthwaite, S

    2000-01-01

    Oxazolidinone antibiotics inhibit bacterial protein synthesis by interacting with the large ribosomal subunit. The structure and exact location of the oxazolidinone binding site remain obscure, as does the manner in which these drugs inhibit translation. To investigate the drug-ribosome interaction...... in the wild-type rRNA operon produced an oxazolidinone resistance phenotype, establishing that the G2032A substitution was the determinant of resistance. Engineered U and C substitutions at G2032, as well as a G2447-to-U mutation, also conferred resistance to oxazolidinone. All the characterized resistance...

  12. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides.

    Science.gov (United States)

    Almutairi, Mashal M; Park, Sung Ryeol; Rose, Simon; Hansen, Douglas A; Vázquez-Laslop, Nora; Douthwaite, Stephen; Sherman, David H; Mankin, Alexander S

    2015-10-20

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces venezuelae strain ATCC 15439. The producer avoids the inhibitory effects of its own antibiotics by expressing two paralogous rRNA methylase genes pikR1 and pikR2 with seemingly redundant functions. We show here that the PikR1 and PikR2 enzymes mono- and dimethylate, respectively, the N6 amino group in 23S rRNA nucleotide A2058. PikR1 monomethylase is constitutively expressed; it confers low resistance at low fitness cost and is required for ketolide-induced activation of pikR2 to attain high-level resistance. The regulatory mechanism controlling pikR2 expression has been evolutionary optimized for preferential activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism.

  13. Use of PCR primers and probes based on the 23S rRNA and internal transcription spacer (ITS) gene sequence for the detection and enumerization of Lactobacillus acidophilus and Lactobacillus plantarum in feed supplements.

    Science.gov (United States)

    Tsai, Cheng-Chih; Lai, Chieh-Hsien; Yu, Bi; Tsen, Hau-Yang

    2010-06-01

    Novel polymerase chain reaction (PCR) primers designed from the 16S-23S internal transcription spacer (ITS) rRNA and 23S rRNA genes, respectively, were used for the specific detection of Lactobacillus acidophilus and Lactobacillus plantarum. Molecular weights of the PCR products were 221 and 599 bp, respectively. Strains of L. acidophilus and L. plantarum obtained from the culture center, dairy products, infant stool and other samples, could be identified with these PCR primers. DNAs from other lactic acid bacteria (LAB) species including strains of Lactobacillus pentosus which was closely related to L. plantarum, and bacteria species other than LAB, would not generate the false positive results. When this PCR primer set was used for the detection of L. acidophilus and L. plantarum in feed supplement or feed starter samples, reliable results were obtained. Furthermore, when these L. acidophilus or L. plantarum specific primers were used as DNA probes for the colony hybridization of L. acidophilus and L. plantarum, the viable cells of these LAB species in culture and feed supplements or starter products could be identified and enumerized. The method described here thus offers a rapid and economic way to inspect and assure the quality of the feed supplements or fermentation starters.

  14. Immunological evaluation of an rsmD-like rRNA methyltransferase from Wolbachia endosymbiont of Brugia malayi.

    Science.gov (United States)

    Rana, Ajay Kumar; Kushwaha, Susheela; Singh, Prashant Kumar; Misra-Bhattacharya, Shailja

    2016-02-01

    Wolbachia is a wonderful anti-filarial target with many of its enzymes and surface proteins (WSPs) representing potential drug targets and vaccine candidates. Here we report on the immunologic response of a drug target, rsmD-like rRNA methyltransferase from Wolbachia endosymbiont of Brugia malayi. The recombinant protein generated both humoral and cell-mediated response in BALB/c mice but compromised its immunity. The humoral response was transient and endured barely for six months in mice with or without B. Malayi challenge. In splenocytes of mice, the key humoral immunity mediating cytokine IL4 was lowered (IL4↓) while IFNγ, the major cytokine mediating cellular immunity was decreased along with upregulation of IL10 cytokine (IFNγ↓, IL10↑). The finding here indicates that the enzyme has low immunogenicity and triggers lowering of cytokine level in BALB/c mice. Interestingly the overall immune profile can be summed up with equivalent response generated by WSP or whole Wolbachia.

  15. RmtC and RmtF 16S rRNA Methyltransferase in NDM-1–Producing Pseudomonas aeruginosa

    OpenAIRE

    Rahman, Mohibur; Prasad, Kashi Nath; Pathak, Ashutosh; Pati, Binod Kumar; Singh, Avinash; Ovejero, Cristina M.; Ahmad, Saheem; Gonzalez-Zorn, Bruno

    2015-01-01

    We investigated 16S rRNA methyltransferases in 38 bla NDM-1–positive Pseudomonas aeruginosa isolates and found RmtC in 3 isolates, 1 of which also harbored RmtF. The isolates were clonally unrelated; rmtC and rmtF genes were located on a chromosome with the bla NDM-1 gene. Strategies are needed to limit the spread of such isolates.

  16. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Karminska, K. H.; Purta, E.; Hansen, L .H.

    2010-01-01

    of a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension analysis....... The investigation has identified essential amino acids and Cfr variants with altered reaction mechanisms and represents a first step towards understanding the structural basis of Cfr activity....

  17. Structural Rearrangements in the Active Site of the Thermus thermophilus 16S rRNA Methyltransferase KsgA in a Binary Complex with 5'-Methylthioadenosine

    Energy Technology Data Exchange (ETDEWEB)

    Demirci, H.; Belardinelli, R; Seri, E; Gregory, S; Gualerzi, C; Dahlberg, A; Jogl, G

    2009-01-01

    Posttranscriptional modification of ribosomal RNA (rRNA) occurs in all kingdoms of life. The S-adenosyl-l-methionine-dependent methyltransferase KsgA introduces the most highly conserved rRNA modification, the dimethylation of A1518 and A1519 of 16S rRNA. Loss of this dimethylation confers resistance to the antibiotic kasugamycin. Here, we report biochemical studies and high-resolution crystal structures of KsgA from Thermus thermophilus. Methylation of 30S ribosomal subunits by T. thermophilus KsgA is more efficient at low concentrations of magnesium ions, suggesting that partially unfolded RNA is the preferred substrate. The overall structure is similar to that of other methyltransferases but contains an additional ?-helix in a novel N-terminal extension. Comparison of the apoenzyme with complex structures with 5?-methylthioadenosine or adenosine bound in the cofactor-binding site reveals novel features when compared with related enzymes. Several mobile loop regions that restrict access to the cofactor-binding site are observed. In addition, the orientation of residues in the substrate-binding site indicates that conformational changes are required for binding two adjacent residues of the substrate rRNA.

  18. Multicentre surveillance of prevalence of the 23S rRNA A2058G and A2059G point mutations and molecular subtypes of Treponema pallidum in Taiwan, 2009-2013.

    Science.gov (United States)

    Wu, B-R; Yang, C-J; Tsai, M-S; Lee, K-Y; Lee, N-Y; Huang, W-C; Wu, H; Lee, C-H; Chen, T-C; Ko, W-C; Lin, H-H; Lu, P-L; Chen, Y-H; Liu, W-C; Yang, S-P; Wu, P-Y; Su, Y-C; Hung, C-C; Chang, S-Y

    2014-08-01

    Resistance mutations A2058G and A2059G, within the 23S rRNA gene of Treponema pallidum, have been reported to cause treatment failures in patients receiving azithromycin for syphilis. Genotyping of T. pallidum strains sequentially isolated from patients with recurrent syphilis is rarely performed. From September 2009 to August 2013, we collected 658 clinical specimens from 375 patients who presented with syphilis for genotyping to examine the number of 60-bp repeats in the acidic repeat protein (arp) gene, T. pallidum repeat (tpr) polymorphism, and tp0548 gene, and to detect A2058G and A2059G point mutations by restriction fragment length polymorphism. Treponemal DNA was identified in 45.2% (n = 298) of the specimens that were collected from 216 (57.6%) patients; 268 (40.7%) specimens tested positive for the 23S rRNA gene, and were examined for macrolide resistance. Two isolates (0.7%) harboured the A2058G mutation, and no A2059G mutation was identified. A total of 14 strains of T. pallidum were identified, with 14f/f (57.5%) and 14b/c (10.0%) being the two predominant strains. Forty patients who presented with recurrent episodes of syphilis had T. pallidum DNA identified from the initial and subsequent episodes, with five cases showing strain discrepancies. One patient had two strains identified from different clinical specimens collected in the same episode. Our findings show that 14f/f is the most common T. pallidum strain in Taiwan, where the prevalence of T. pallidum strains that show A2058G or A2059G mutation remains low. Different genotypes of T. pallidum can be identified in patients with recurrent episodes of syphilis.

  19. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.

    Science.gov (United States)

    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu

    2015-02-01

    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis.

  20. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O139 outbreak based on the intergenomic heterogeneity of the 16S-23S rRNA intergenic spacer regions

    Indian Academy of Sciences (India)

    Atreyi Ghatak; Anasuya Majumdar; Ranajit K Ghosh

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O139 outbreak. ISR classes ‘a’ and ‘g’ were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O139 serogroup and post-O139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  1. Distinction between the Cfr Methyltransferase Conferring Antibiotic Resistance and the Housekeeping RlmN Methyltransferase

    DEFF Research Database (Denmark)

    Atkinson, Gemma C; Hansen, Lykke H; Tenson, Tanel

    2013-01-01

    The cfr gene encodes the Cfr methyltransferase that primarily methylates C-8 in A2503 of 23S rRNA in the peptidyl transferase region of bacterial ribosomes. The methylation provides resistance to six classes of antibiotics of clinical and veterinary importance. The rlmN gene encodes the Rlm......N methyltransferase that methylates C-2 in A2503 in 23S rRNA and A37 in tRNA, but RlmN does not significantly influence antibiotic resistance. The enzymes are homologous and use the same mechanism involving radical S-adenosyl methionine to methylate RNA via an intermediate involving a methylated cysteine....... The differentiation between the two classes is supported by previous and new experimental evidence from antibiotic resistance, primer extensions, and mass spectrometry. Finally, evolutionary aspects of the distribution of Cfr- and RlmN-like enzymes are discussed....

  2. Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine

    Energy Technology Data Exchange (ETDEWEB)

    Demirci, H.; Gregory, S; Dahlberg, A; Jogl, G

    2008-01-01

    Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N{sup 2}-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate.

  3. Persistent spread of the rmtB 16S rRNA methyltransferase gene among Escherichia coli isolates from diseased food-producing animals in China.

    Science.gov (United States)

    Xia, Jing; Sun, Jian; Cheng, Ke; Li, Liang; Fang, Liang-Xing; Zou, Meng-Ting; Liao, Xiao-Ping; Liu, Ya-Hong

    2016-05-30

    A total of 963 non-duplicate Escherichia coli strains isolated from food-producing animals between 2002 and 2012 were screened for the presence of the 16S rRNA methyltransferase genes. Among the positive isolates, resistance determinants to extended spectrum β-lactamases, plasmid-mediated quinolone resistance genes as well as floR and fosA/A3/C2 were detected using PCR analysis. These isolates were further subjected to antimicrobial susceptibility testing, molecular typing, PCR-based plasmid replicon typing and plasmid analysis. Of the 963 E. coli isolates, 173 (18.0%), 3 (0.3%) and 2 (0.2%) were rmtB-, armA- and rmtE-positive strains, respectively. All the 16S rRNA methyltransferase gene-positive isolates were multidrug resistant and over 90% of them carried one or more type of resistance gene. IncF (especially IncFII) and non-typeable plasmids played the main role in the dissemination of rmtB, followed by the IncN plasmids. Plasmids that harbored rmtB ranged in size from 20kb to 340kb EcoRI-RFLP testing of the 109 rmtB-positive plasmids from different years and different origins suggested that horizontal (among diverse animals) and vertical transfer of IncF, non-typeable and IncN-type plasmids were responsible for the spread of rmtB gene. In summary, our findings highlight that rmtB was the most prevalent 16S rRNA methyltransferase gene, which present persistent spread in food-producing animals in China and a diverse group of plasmids was responsible for rmtB dissemination.

  4. 16S rRNA、16S-23S rRNA基因测序分析检测主要血流感染病原菌比较%Comparison of the role of 16S rRNA and 16S-23S rRNA gene sequence-based identification of bacteria in bloodsteam infection

    Institute of Scientific and Technical Information of China (English)

    金中淦; 葛平; 徐蓉; 陈蓉; 宣瑛; 刘学杰; 王庆忠

    2012-01-01

    目的 比较细菌16S rRNA、16S-23S rRNA基因测序分析在血流感染病原菌检测中的作用.方法 提取临床上血流感染常见的金黄色葡萄菌、表皮葡萄球菌、大肠埃希菌、粪肠球菌、肺炎链球菌、铜绿假单胞菌、阴沟肠杆菌、鲍曼不动杆菌、洛菲不动杆菌、肺炎克雷伯杆菌、化脓性链球菌、奇异变形杆菌、潘尼变形杆菌、屎肠球菌、粘质沙雷菌、宋内志贺菌、产气肠杆菌、小肠结肠炎耶尔森菌、腐生葡萄球菌基因组DNA,运用16S rRNA、16S-23S rRNA基因进行PCR扩增.扩增产物经测序后在美国国家生物技术中心( NCBI)上进行比对分析,确定菌种.结果 在所分析的19种临床血流感染常见细菌中,16S rRNA基因测序分析可将除粘质沙雷菌外的细菌鉴定到种的水平,但无法完全区分近缘种属;16S-23SrRNA成功鉴定17种细菌,除大肠埃希菌、宋内志贺菌外所有细菌均成功鉴定到单一种的水平.结论 16S-23S rRNA基因可作为血流感染细菌检测较好的分子靶标.

  5. Structure-Activity Relationships of Diverse Oxazolidinones for Linezolid-Resistant Staphylococcus aureus Strains Possessing the cfr Methyltransferase Gene or Ribosomal Mutations▿

    OpenAIRE

    Locke, Jeffrey B.; Finn, John; Hilgers, Mark; Morales, Gracia; Rahawi, Shahad; Kedar, G. C.; Picazo, Juan José; Im, Weonbin; Shaw, Karen Joy; Stein, Jeffrey L.

    2010-01-01

    Staphylococcal resistance to linezolid (LZD) is mediated through ribosomal mutations (23S rRNA or ribosomal proteins L3 and L4) or through methylation of 23S rRNA by the horizontally transferred Cfr methyltransferase. To investigate the structural basis for oxazolidinone activity against LZD-resistant (LZDr) strains, we compared structurally diverse, clinically relevant oxazolidinones, including LZD, radezolid (RX-1741), TR-700 (torezolid), and a set of TR-700 analogs (including novel CD-ring...

  6. Coproduction of 16S rRNA Methyltransferase RmtD or RmtG with KPC-2 and CTX-M Group Extended-Spectrum β-Lactamases in Klebsiella pneumoniae

    OpenAIRE

    Bueno, Maria Fernanda C.; Francisco, Gabriela R.; O'Hara, Jessica A.; de Oliveira Garcia, Doroti; Doi, Yohei

    2013-01-01

    Eight Klebsiella pneumoniae clinical strains with high-level aminoglycoside resistance were collected from eight hospitals in São Paulo State, Brazil, in 2010 and 2011. Three of them produced an RmtD group 16S rRNA methyltransferase, RmtD1 or RmtD2. Five strains were found to produce a novel 16S rRNA methyltransferase, designated RmtG, which shared 57 to 58% amino acid identity with RmtD1 and RmtD2. Seven strains coproduced KPC-2 with or without various CTX-M group extended-spectrum β-lactama...

  7. Detection of the A2058G and A2059G 23S rRNA gene point mutations associated with azithromycin resistance in Treponema pallidum by use of a TaqMan real-time multiplex PCR assay.

    Science.gov (United States)

    Chen, Cheng-Yen; Chi, Kai-Hua; Pillay, Allan; Nachamkin, Eli; Su, John R; Ballard, Ronald C

    2013-03-01

    Macrolide treatment failure in syphilis patients is associated with a single point mutation (either A2058G or A2059G) in both copies of the 23S rRNA gene in Treponema pallidum strains. The conventional method for the detection of both point mutations uses nested PCR combined with restriction enzyme digestions, which is laborious and time-consuming. We initially developed a TaqMan-based real-time duplex PCR assay for detection of the A2058G mutation, and upon discovery of the A2059G mutation, we modified the assay into a triplex format to simultaneously detect both mutations. The point mutations detected by the real-time triplex PCR were confirmed by pyrosequencing. A total of 129 specimens PCR positive for T. pallidum that were obtained from an azithromycin resistance surveillance study conducted in the United States were analyzed. Sixty-six (51.2%) of the 129 samples with the A2058G mutation were identified by both real-time PCR assays. Of the remaining 63 samples that were identified as having a macrolide-susceptible genotype by the duplex PCR assay, 17 (27%) were found to contain the A2059G mutation by the triplex PCR. The proportions of macrolide-susceptible versus -resistant genotypes harboring either the A2058G or the A2059G mutation among the T. pallidum strains were 35.6, 51.2, and 13.2%, respectively. None of the T. pallidum strains examined had both point mutations. The TaqMan-based real-time triplex PCR assay offers an alternative to conventional nested PCR and restriction fragment length polymorphism analyses for the rapid detection of both point mutations associated with macrolide resistance in T. pallidum.

  8. Crystal structure of the RluD pseudouridine synthase catalytic module, an enzyme that modifies 23S rRNA and is essential for normal cell growth of Escherichia coli.

    Science.gov (United States)

    Sivaraman, J; Iannuzzi, Pietro; Cygler, Miroslaw; Matte, Allan

    2004-01-01

    Pseudouridine (5-beta-D-ribofuranosyluracil, Psi) is the most commonly found modified base in RNA. Conversion of uridine to Psi is performed enzymatically in both prokaryotes and eukaryotes by pseudouridine synthases (EC 4.2.1.70). The Escherichia coli Psi-synthase RluD modifies uridine to Psi at positions 1911, 1915 and 1917 within 23S rRNA. RluD also possesses a second function related to proper assembly of the 50S ribosomal subunit that is independent of Psi-synthesis. Here, we report the crystal structure of the catalytic module of RluD (residues 68-326; DeltaRluD) refined at 1.8A to a final R-factor of 21.8% (R(free)=24.3%). DeltaRluD is a monomeric enzyme having an overall mixed alpha/beta fold. The DeltaRluD molecule consists of two subdomains, a catalytic subdomain and C-terminal subdomain with the RNA-binding cleft formed by loops extending from the catalytic sub-domain. The catalytic sub-domain of DeltaRluD has a similar fold as in TruA, TruB and RsuA, with the location of the RNA-binding cleft, active-site and conserved, catalytic Asp residue superposing in all four structures. Superposition of the crystal structure of TruB bound to a T-stem loop with RluD reveals that similar RNA-protein interactions for the flipped-out uridine base would exist in both structures, implying that base-flipping is necessary for catalysis. This observation also implies that the specificity determinants for site-specific RNA-binding and recognition likely reside in parts of RluD beyond the active site.

  9. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  10. The rRNA methyltransferase Bud23 shows functional interaction with components of the SSU processome and RNase MRP.

    Science.gov (United States)

    Sardana, Richa; White, Joshua P; Johnson, Arlen W

    2013-06-01

    Bud23 is responsible for the conserved methylation of G1575 of 18S rRNA, in the P-site of the small subunit of the ribosome. bud23Δ mutants have severely reduced small subunit levels and show a general failure in cleavage at site A2 during rRNA processing. Site A2 is the primary cleavage site for separating the precursors of 18S and 25S rRNAs. Here, we have taken a genetic approach to identify the functional environment of BUD23. We found mutations in UTP2 and UTP14, encoding components of the SSU processome, as spontaneous suppressors of a bud23Δ mutant. The suppressors improved growth and subunit balance and restored cleavage at site A2. In a directed screen of 50 ribosomal trans-acting factors, we identified strong positive and negative genetic interactions with components of the SSU processome and strong negative interactions with components of RNase MRP. RNase MRP is responsible for cleavage at site A3 in pre-rRNA, an alternative cleavage site for separating the precursor rRNAs. The strong negative genetic interaction between RNase MRP mutants and bud23Δ is likely due to the combined defects in cleavage at A2 and A3. Our results suggest that Bud23 plays a role at the time of A2 cleavage, earlier than previously thought. The genetic interaction with the SSU processome suggests that Bud23 could be involved in triggering disassembly of the SSU processome, or of particular subcomplexes of the processome.

  11. Analysis of the genotypes among different strains of common Mycobacteria based on 16S rRNA gene and 16S-23S rRNA gene internal transcribed spacer sequences%常见分枝杆菌种内不同株之间16S rRNA基因和16S-23SrRNA ITS序列分析结果的比较

    Institute of Scientific and Technical Information of China (English)

    黄至澄; 徐黔宁; 闫李侠; 陈保文; 王国治

    2011-01-01

    目的 针对常见分枝杆菌不同株对其基因序列进行分析,比较分析结果.方法 利用16S rRNA Gene和16S-23S rRNAITS(转录间隔区序列)分析法分别对97株共7种DSMZ/ATCC引进的常见分枝杆菌进行种内不同株之间基因差异性分析,对比两种分型结果的异同.结果 16S rRNA基因可将13株草分枝杆菌分为3个型别,18株偶发分枝杆菌分为6个型别,17株耻垢分枝杆菌分为4个型别,8株戈登分枝杆菌分为3个型别,9株龟分枝杆菌龟亚种分为3个型别,15株堪萨斯分枝杆菌分为2个型别,17株产鼻疽分枝杆菌分为1个型别;而16S-23S rRNA ITS可依次将上述分枝杆菌分为3个、15个、7个、3个、4个、3个、5个型别.结论 16S rRNA G ene分析和16S-23S rRNA ITS分析均是分枝杆菌基因型分析的可靠方法,此外,16S-23SrRNA ITS的种内多态性高于16S rRNA Gene.

  12. 动物性食品源弓形菌23S rRNA基因PCR检测方法的建立%Establishment of PCR Method for Detecting Animal Food-Borne Arcobacter Based on the 23S rRNA Gene

    Institute of Scientific and Technical Information of China (English)

    毕水莲

    2014-01-01

    建立了一种快速、准确检测弓形菌(Arcobacter)的PCR方法.根据弓形菌23S rRNA基因序列设计引物,对弓形菌标准菌株、弓形菌食品分离株及非弓形菌属菌株进行PCR扩增.结果表明,弓形菌标准菌株和35株弓形菌食品分离株扩增后均可得到688 bp的目的条带,11株非弓形菌属菌株均未见任何扩增条带,对弓形菌的最低检测限为1.12× 103 CFU/mL.该方法操作简单、检测周期短、灵敏度高、特异性好,可用于食品中弓形菌的快速检测.

  13. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary

    2015-03-01

    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals.

  14. Intrinsic resistance to aminoglycosides in Enterococcus faecium is conferred by the 16S rRNA m5C1404-specific methyltransferase EfmM

    DEFF Research Database (Denmark)

    Galimand, Marc; Schmitt, Emmanuelle; Panvert, Michel

    2011-01-01

    methyltransferase, as well as by the previously characterized aac(6')-Ii that encodes a 6'-N-aminoglycoside acetyltransferase. Inactivation of efmM in E. faecium increases susceptibility to the aminoglycosides kanamycin and tobramycin, and, conversely, expression of a recombinant version of efmM in Escherichia coli...

  15. Specificity shifts in the rRNA and tRNA nucleotide targets of archaeal and bacterial m5U methyltransferases

    DEFF Research Database (Denmark)

    Auxilien, Sylvie; Rasmussen, Anette; Rose, Simon;

    2011-01-01

    Methyltransferase enzymes that use S-adenosylmethionine as a cofactor to catalyze 5-methyl uridine (m(5)U) formation in tRNAs and rRNAs are widespread in Bacteria and Eukaryota, but are restricted to the Thermococcales and Nanoarchaeota groups amongst the Archaea. The RNA m(5)U methyltransferases...... appear to have arisen in Bacteria and were then dispersed by horizontal transfer of an rlmD-type gene to the Archaea and Eukaryota. The bacterium Escherichia coli has three gene paralogs and these encode the methyltransferases TrmA that targets m(5)U54 in tRNAs, RlmC (formerly RumB) that modifies m(5)U......, however, neither of the two P. abyssi enzymes displays RlmD-like activity in vitro. PAB0719 acts in a TrmA-like manner to catalyze m(5)U54 methylation in P. abyssi tRNAs, and here we show that PAB0760 possesses RlmC-like activity and specifically methylates the nucleotide equivalent to U747 in P. abyssi...

  16. Insights into the catalytic mechanism of 16S rRNA methyltransferase RsmE (m³U1498) from crystal and solution structures.

    Science.gov (United States)

    Zhang, Heng; Wan, Hua; Gao, Zeng-Qiang; Wei, Yong; Wang, Wen-Jia; Liu, Guang-Feng; Shtykova, Eleonora V; Xu, Jian-Hua; Dong, Yu-Hui

    2012-11-01

    RsmE is the founding member of a new RNA methyltransferase (MTase) family responsible for methylation of U1498 in 16S ribosomal RNA in Escherichia coli. It is well conserved across bacteria and plants and may play an important role in ribosomal intersubunit communication. The crystal structure in monomer showed that it consists of two distinct but structurally related domains: the PUA (pseudouridine synthases and archaeosine-specific transglycosylases)-like RNA recognition and binding domain and the conserved MTase domain with a deep trefoil knot. Analysis of small-angle X-ray scattering data revealed that RsmE forms a flexible dimeric conformation that may be essential for substrate binding. The S-adenosyl-l-methionine (AdoMet)-binding characteristic determined by isothermal titration calorimetry suggested that there is only one AdoMet molecule bound in the subunit of the homodimer. In vitro methylation assay of the mutants based on the RsmE-AdoMet-uridylic acid complex model showed key residues involved in substrate binding and catalysis. Comprehensive comparisons of RsmE with closely related MTases, combined with the biochemical experiments, indicated that the MTase domain of one subunit in dimeric RsmE is responsible for binding of one AdoMet molecule and catalytic process while the PUA-like domain in the other subunit is mainly responsible for recognition of one substrate molecule (the ribosomal RNA fragment and ribosomal protein complex). The methylation process is required by collaboration of both subunits, and dimerization is functionally critical for catalysis. In general, our study provides new information on the structure-function relationship of RsmE and thereby suggests a novel catalytic mechanism.

  17. Identification of 8-methyladenosine as the modification catalyzed by the radical SAM methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Giessing, Anders; Jensen, Søren Skov; Rasmussen, Anette

    2009-01-01

    The Cfr methyltransferase confers combined resistance to five different classes of antibiotics that bind to the peptidyl transferase center of bacterial ribosomes. The Cfr-mediated modification has previously been shown to occur on nucleotide A2503 of 23S rRNA and has a mass corresponding......,8-dimethyladenosine. The mutation of single conserved cysteine residues in the radical SAM motif CxxxCxxC of Cfr abolishes its activity, lending support to the notion that the Cfr modification reaction occurs via a radical-based mechanism. Antibiotic susceptibility data confirm that the antibiotic resistance...

  18. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA....... Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... to form translationally active ribosomes. The function of 23S rRNA is largely reestablished by introduction of an alternative G1262.C2017 or U1262.A2017 pair, although neither of these supports polysome formation quite as effectively as the wild-type pair. A 23S rRNA with a C1262.G2017 pair...

  19. Cooperative assembly of proteins in the ribosomal GTPase centre demonstrated by their interactions with mutant 23S rRNAs

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1995-01-01

    The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions) and nume......The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions...

  20. Identification of two Escherichia coli pseudouridine synthases that show multisite specificity for 23S RNA.

    Science.gov (United States)

    Huang, L; Ku, J; Pookanjanatavip, M; Gu, X; Wang, D; Greene, P J; Santi, D V

    1998-11-10

    Several putative Escherichia coli pseudouridine (Psi) synthases have been identified by iterative searching of genomic databases for ORFs homologous to known Psi synthases [Gustafsson et al. (1996) Nucleic Acids Res. 24, 3756-3762]. Of these, yceC and yfiI were proposed to encode Psi synthases which modify 23S rRNA. In the present work, yceC and yfiI were cloned and overexpressed in E. coli, and the encoded enzymes, YceC and YfiI, were purified to homogeneity. Both proteins converted Urd residues of rRNA to Psi, thus confirming their identities as Psi synthases. However, in in vitro experiments both enzymes extensively modified Urd residues of both 23S rRNA and 16S rRNA. Gene-disruption of yceCresulted in the absence of Psi modification at positions U955, 2504, and 2580 of 23S RNA, thus identifying these sites as in vivo targets for YceC. Likewise, yfiI disruption resulted in the absence of Psi modification at positions U1911, 1917, and possibly 1915 of 23S RNA. Disruption of yceC did not affect the growth under the conditions tested, whereas yfiI-disrupted cells showed a dramatic decrease in growth rate. Since YceC and YfiI hypermodify RNA in vitro, factors in addition to ribonucleotide sequence must contribute to the in vivo specificity of these enzymes.

  1. Biochemical and Computational Analysis of the Substrate Specificities of Cfr and RlmN Methyltransferases

    DEFF Research Database (Denmark)

    Ntokou, Eleni; Hansen, Lykke Haastrup; Kongsted, Jacob;

    2015-01-01

    homology and may be evolutionarily linked to a common ancestor. To explore their individual specificity and similarity we performed two sets of experiments. We created a homology model of Cfr and explored the C2/C8 specificity using docking and binding energy calculations on the Cfr homology model and an X......Cfr and RlmN methyltransferases both modify adenine 2503 in 23S rRNA (Escherichia coli numbering). RlmN methylates position C2 of adenine while Cfr methylates position C8, and to a lesser extent C2, conferring antibiotic resistance to peptidyl transferase inhibitors. Cfr and RlmN show high sequence......-ray structure of RlmN. We used a trinucleotide as target sequence and assessed its positioning at the active site for methylation. The calculations are in accordance with different poses of the trinucleotide in the two enzymes indicating major evolutionary changes to shift the C2/C8 specificities. To explore...

  2. Minimal Substrate Features for Erm Methyltransferases Defined by Using a Combinatorial Oligonucleotide Library

    DEFF Research Database (Denmark)

    Hansen, Lykke H; Lobedanz, Sune; Douthwaite, Stephen

    2011-01-01

    , the main role played by the bottom strand appears to be in maintaining the conformation of the top strand. The addition of multiple LNA residues to the top strand impeded methylation; this indicates that the RNA substrate requires a certain amount of flexibility for accommodation into the active site...... of Erm. The combinatorial approach for identifying small but functional RNA substrates is a step towards making RNA-Erm complexes suitable for cocrystal determination, and for designing molecules that might block the substrate-recognition site of the enzyme.......Erm methyltransferases are prevalent in pathogenic bacteria and confer resistance to macrolide, lincosamide, and streptogramin B antibiotics by specifically methylating the 23S ribosomal RNA at nucleotide A2058. We have identified motifs within the rRNA substrate that are required for methylation...

  3. Amplification and direct sequence analysis of the 23S rRNA gene from thermophilic bacteria

    DEFF Research Database (Denmark)

    Ibrahim, Ashraf; Hofman-Bang, H. Jacob Peider; Ahring, Birgitte Kiær

    2001-01-01

    We present a simplified and fast method to obtain high-quality sequences directly from PCRs without the traditional gel purification. We also report on an improved method to obtain sequence-quality PCR products from microorganisms that are difficult to lyse with no need for DNA extraction. The te....... The technique uses exonuclease I and shrimp alkaline phosphatase to degrade residual dNTPs and primers. Our technique is shown to work on both Gram-positive and Gram-negative bacteria...

  4. Phylogenetic analysis of 23S rRNA gene sequences of some ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-08-31

    Aug 31, 2016 ... genetic distance among the studied isolates was very narrow (ranged from ... with concentrations 10, 20 and 30% of polyethylene glycol plus control. ... among bacteria since their evolution are slow and their ... improve the yield of legumes in stressed environments ... New Al Menia City, Menia Governorate.

  5. Structure-activity relationships of diverse oxazolidinones for linezolid-resistant Staphylococcus aureus strains possessing the cfr methyltransferase gene or ribosomal mutations.

    Science.gov (United States)

    Locke, Jeffrey B; Finn, John; Hilgers, Mark; Morales, Gracia; Rahawi, Shahad; G C, Kedar; Picazo, Juan José; Im, Weonbin; Shaw, Karen Joy; Stein, Jeffrey L

    2010-12-01

    Staphylococcal resistance to linezolid (LZD) is mediated through ribosomal mutations (23S rRNA or ribosomal proteins L3 and L4) or through methylation of 23S rRNA by the horizontally transferred Cfr methyltransferase. To investigate the structural basis for oxazolidinone activity against LZD-resistant (LZD(r)) strains, we compared structurally diverse, clinically relevant oxazolidinones, including LZD, radezolid (RX-1741), TR-700 (torezolid), and a set of TR-700 analogs (including novel CD-rings and various A-ring C-5 substituents), against a panel of laboratory-derived and clinical LZD(r) Staphylococcus aureus strains possessing a variety of resistance mechanisms. Potency against all strains was correlated with optimization of C- and D-rings, which interact with more highly conserved regions of the peptidyl transferase center binding site. Activity against cfr strains was retained with either hydroxymethyl or 1,2,3-triazole C-5 groups but was reduced by 2- to 8-fold in compounds with acetamide substituents. LZD, which possesses a C-5 acetamide group and lacks a D-ring substituent, demonstrated the lowest potency against all strains tested, particularly against cfr strains. These data reveal key features contributing to oxazolidinone activity and highlight structural tradeoffs between potency against susceptible strains and potency against strains with various resistance mechanisms.

  6. Structure-Activity Relationships of Diverse Oxazolidinones for Linezolid-Resistant Staphylococcus aureus Strains Possessing the cfr Methyltransferase Gene or Ribosomal Mutations▿

    Science.gov (United States)

    Locke, Jeffrey B.; Finn, John; Hilgers, Mark; Morales, Gracia; Rahawi, Shahad; G. C., Kedar; Picazo, Juan José; Im, Weonbin; Shaw, Karen Joy; Stein, Jeffrey L.

    2010-01-01

    Staphylococcal resistance to linezolid (LZD) is mediated through ribosomal mutations (23S rRNA or ribosomal proteins L3 and L4) or through methylation of 23S rRNA by the horizontally transferred Cfr methyltransferase. To investigate the structural basis for oxazolidinone activity against LZD-resistant (LZDr) strains, we compared structurally diverse, clinically relevant oxazolidinones, including LZD, radezolid (RX-1741), TR-700 (torezolid), and a set of TR-700 analogs (including novel CD-rings and various A-ring C-5 substituents), against a panel of laboratory-derived and clinical LZDr Staphylococcus aureus strains possessing a variety of resistance mechanisms. Potency against all strains was correlated with optimization of C- and D-rings, which interact with more highly conserved regions of the peptidyl transferase center binding site. Activity against cfr strains was retained with either hydroxymethyl or 1,2,3-triazole C-5 groups but was reduced by 2- to 8-fold in compounds with acetamide substituents. LZD, which possesses a C-5 acetamide group and lacks a D-ring substituent, demonstrated the lowest potency against all strains tested, particularly against cfr strains. These data reveal key features contributing to oxazolidinone activity and highlight structural tradeoffs between potency against susceptible strains and potency against strains with various resistance mechanisms. PMID:20837751

  7. Structural and functional analysis of Escherichia coli ribosomes containing small deletions around position 1760 in the 23S ribosomal RNA.

    Science.gov (United States)

    Zweib, C; Dahlberg, A E

    1984-09-25

    Three different small deletions were produced at a single Pvu 2 restriction site in E. coli 23S rDNA of plasmid pKK 3535 using exonuclease Bal 31. The deletions were located around position 1760 in 23S rRNA and were characterized by DNA sequencing as well as by direct fingerprinting and S1-mapping of the rRNA. Two of the mutant plasmids, Pvu 2-32 and Pvu 2-33, greatly reduced the growth rate of transformed cells while the third mutant, Pvu 2-14 grew as fast as cells containing the wild-type plasmid pKK 3535. All three mutant 23S rRNAs were incorporated into 50S-like particles and were even found in 70S ribosomes and polysomes in vivo. The conformation of mutant 23S rRNA in 50S subunits was probed with a double-strand specific RNase from cobra venom. These analyses revealed changes in the accessibility of cleavage sites near the deletions around position 1760 and in the area around position 800 in all three mutant rRNAs. We suggest, that an altered conformation of the rRNAs at the site of the deletion is responsible for the slow growth of cells containing mutant plasmids Pvu 2-32 and Pvu 2-33.

  8. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on peptide bond...

  9. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C;

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  10. Assignment of Isodoublet of 23S1 Meson Nonet

    Institute of Scientific and Technical Information of China (English)

    FENG Xue-Chao; JIANG Feng-Chun

    2007-01-01

    Inserting the masses of some states, which have been established in the experiments or the theory of lattice QCD, we investigate the mass of the isodoublet of the 23S1 meson nonet. The agreement results, 1567 ± 22.6 MeV and 1576.8 MeV, are given by two different approaches. We suggest that the assignment of 23S1 meson nonet should be re-examined in future experiments.

  11. The Cj0588 protein is a Campylobacter jejuni RNA methyltransferase.

    Science.gov (United States)

    Sałamaszyńska-Guz, Agnieszka; Taciak, Bartłomiej; Kwiatek, Agnieszka; Klimuszko, Danuta

    2014-06-06

    TlyA proteins belong to 2'-O-methyltransferases. Methylation is a common posttranscriptional RNA modification. The Campylobacter jejuni Cj0588 protein belongs to the TlyA(I) protein family and is a rRNA methyltransferase. Methylation of ribosomal RNA catalyzed by Cj0588 appears to have an impact on the biology of the cell. Presence of the cj0588 gene in bacteria appears to be important for ribosome stability and virulence properties. Absence of the Cj0588 protein causes accumulation of the 50S ribosomal subunits, reduction in the amount of functional 70S ribosomes and confers increase resistance to capreomycin.

  12. Macrolides and lincomycin susceptibility of Mycoplasma hyorhinis and variable mutation of domain II and V in 23S ribosomal RNA.

    Science.gov (United States)

    Kobayashi, Hideki; Nakajima, Hiromi; Shimizu, Yuka; Eguchi, Masashi; Hata, Eiji; Yamamoto, Koshi

    2005-08-01

    A total of 151 strains of Mycoplasma hyorhinis isolated from porcine lung lesions (weaned pigs, n=71, and finishers, n=80) were investigated for their in vitro susceptibility to 10 antimicrobial agents. Thirty-one strains (28 from weaned pigs and 3 from finishers) showed resistance to 16-membered macrolide antibiotics and lincomycin. The prevalence of the 16-membered macrolide-resistant M. hyorhinis strain in weaned pigs from Japanese herds has approximately quadrupled in the past 10 years. Several of the 31 strains were examined for mutations in the 23S ribosomal RNA (rRNA). All field strains tested showed a transition of A to G at position 2059 of 23S rRNA-rendered Escherichia coli. On the other hand, individual tylosin- and lincomycin-resistant mutants of M. hyorhinis were selected in vitro from the susceptible type strain BTS7 by 3 to 9 serial passages in subinhibitory concentrations of each antibiotic. The 23S rRNA sequences of both tylosin and lincomycin-resistant mutants were compared with that of the radical BTS7 strain. The BTS7 mutant strain selected by tylosin showed the same transition as the field-isolated strains of A2059G. However, the transition selected in lincomycin showed mutations in domains II and V of 23S rRNA, G2597U, C2611U in domain V, and the addition of an adenine at the pentameric adenine loop in domain II. The strain selected by lincomycin showed an additional point mutation of A2062G selected by tylosin.

  13. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    conserved nucleotides. With a view to investigate the function of this RNA region further, four of these conserved nucleotides, including one indirectly implicated in chloramphenicol binding, were selected for mutation in Escherichia coli 23S rRNA using oligonucleotide primers. Mutant RNAs were expressed......The peptidyl transfer site has been localized at the centre of domain V of 23S-like ribosomal RNA (rRNA) primarily on the basis of a chloramphenicol binding site. The implicated region constitutes an unstructured circle in the current secondary structural model which contains several universally...... in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...

  14. VapC20 of Mycobacterium tuberculosis Cleaves the Sarcin Ricin Loop of 23S rRNA

    DEFF Research Database (Denmark)

    Winther, Kristoffer Skovbo; Brodersen, Ditlev E.; Brown, Alistair K;

    2013-01-01

    The highly persistent and often lethal human pathogen, Mycobacterium tuberculosis contains at least 88 toxin–antitoxin genes. More than half of these encode VapC PIN domain endoribonucleases that inhibit cell growth by unknown mechanisms. Here we show that VapC20 of M. tuberculosis inhibits...... exhibited by M. tuberculosis. VapC20 cleavage is inhibited by mutations in the SRL that flank the cleavage site but not by changes elsewhere in the loop. Disruption of the SRL stem abolishes cleavage; however, further mutations that restore the SRL stem structure restore cleavage, revealing...

  15. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    DEFF Research Database (Denmark)

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller

    2011-01-01

    rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...

  16. Analysis of 16S-23S rRNA internal transcribed spacer regions in Pasteurellaceae isolated from laboratory rodents.

    Science.gov (United States)

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Christensen, Henrik; Sager, Martin

    2012-09-01

    The internal transcribed spacer (ITS) regions of members of Pasteurellaceae isolated from rodents, including the [Pasteurella] pneumotropica biotypes Jawetz and Heyl, [Actinobacillus] muris, "Hemophilus influenzaemurium" and Bisgaard taxon 17 were studied and their feasibility to discriminate these species was analyzed. The reference strains of all species analyzed showed unique species-specific ITS patterns which were further present in 49 clinical isolates of [P.] pneumotropica biotypes Jawetz and Heyl and [A.] muris allowing their identification by comparison to the reference strains pattern. Sequence analysis of the amplified fragments revealed in all species, with exception of "H. influenzaemurium", a larger ITS(ile+ala) which contained the genes for tRNA(Ile(GAU)) and tRNA(Ala(UGC)) and a smaller ITS(glu) with the tRNA(Glu(UUC)) gene. "H. influenzaemurium" revealed two each of the larger and respectively the smaller ITS fragments. Both the length and the sequence of each ITS type were highly conserved within the [P.] pneumotropica biotypes Jawetz and Heyl and [A.] muris strains tested. On the contrary, ITS sequences revealed significant interspecies variations with identity levels ranging from 61.2 to 89.5% for ITS(ile+ala) and 56.5 to 86.8% for ITS(glu). Sequences regions with significant interspecies variation but highly conserved within the species were identified and might be used to design probes for the identification of rodent Pasteurellaceae to the species level. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei.

  18. Helix 69 of Escherichia coli 23S ribosomal RNA as a peptide nucleic acid target.

    Science.gov (United States)

    Kulik, Marta; Markowska-Zagrajek, Agnieszka; Wojciechowska, Monika; Grzela, Renata; Wituła, Tomasz; Trylska, Joanna

    2017-07-01

    A fragment of 23S ribosomal RNA (nucleotides 1906-1924 in E. coli), termed Helix 69, forms a hairpin that is essential for ribosome function. Helix 69 forms a conformationally flexible inter-subunit connection with helix 44 of 16S ribosomal RNA, and the nucleotide A1913 of Helix 69 influences decoding accuracy. Nucleotides U1911 and U1917 are post-transcriptionally modified with pseudouridines (Ψ) and U1915 with 3-methyl-Ψ. We investigated Helix 69 as a target for a complementary synthetic oligonucleotide - peptide nucleic acid (PNA). We determined thermodynamic properties of Helix 69 and its complexes with PNA and tested the performance of PNA targeted at Helix 69 in inhibiting translation in cell-free extracts and growth of E. coli cells. First, we examined the interactions of a PNA oligomer complementary to the G1907-A1919 fragment of Helix 69 with the sequences corresponding to human and bacterial species (with or without pseudouridine modifications). PNA invades the Helix 69 hairpin creating stable complexes and PNA binding to the pseudouridylated bacterial sequence is stronger than to Helix 69 without any modifications. Second, we confirmed the binding of PNA to 23S rRNA and 70S ribosomes. Third, we verified the efficiency of translation inhibition of these PNA oligomers in the cell-free translation/transcription E. coli system, which were in a similar range as tetracycline. Next, we confirmed that PNA conjugated to the (KFF)3K transporter peptide inhibited E. coli growth in micromolar concentrations. Overall, targeting Helix 69 with PNA or other sequence-specific oligomers could be a promising way to inhibit bacterial translation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  19. Histone methyltransferases in cancer

    DEFF Research Database (Denmark)

    Albert, Mareike; Helin, Kristian

    2009-01-01

    Cancer is perceived as a heterogeneous group of diseases that is characterized by aberrant patterns of gene expression. In the last decade, an increasing amount of data has pointed to a key role for epigenetic alterations in human cancer. In this review, we focus on a subclass of epigenetic...... regulators, namely histone methyltransferases (HMTs). Several HMTs have been linked to different types of cancer; however, in most cases we only have limited knowledge regarding the molecular mechanisms by which the HMTs contribute to disease development. We summarize the current knowledge regarding some...

  20. The Expression of Antibiotic Resistance Methyltransferase Correlates with mRNA Stability Independently of Ribosome Stalling.

    Science.gov (United States)

    Dzyubak, Ekaterina; Yap, M N

    2016-12-01

    Members of the Erm methyltransferase family modify 23S rRNA of the bacterial ribosome and render cross-resistance to macrolides and multiple distantly related antibiotics. Previous studies have shown that the expression of erm is activated when a macrolide-bound ribosome stalls the translation of the leader peptide preceding the cotranscribed erm Ribosome stalling is thought to destabilize the inhibitory stem-loop mRNA structure and exposes the erm Shine-Dalgarno (SD) sequence for translational initiation. Paradoxically, mutations that abolish ribosome stalling are routinely found in hyper-resistant clinical isolates; however, the significance of the stalling-dead leader sequence is largely unknown. Here, we show that nonsense mutations in the Staphylococcus aureus ErmB leader peptide (ErmBL) lead to high basal and induced expression of downstream ErmB in the absence or presence of macrolide concomitantly with elevated ribosome methylation and resistance. The overexpression of ErmB is associated with the reduced turnover of the ermBL-ermB transcript, and the macrolide appears to mitigate mRNA cleavage at a site immediately downstream of the ermBL SD sequence. The stabilizing effect of antibiotics on mRNA is not limited to ermBL-ermB; cationic antibiotics representing a ribosome-stalling inducer and a noninducer increase the half-life of specific transcripts. These data unveil a new layer of ermB regulation and imply that ErmBL translation or ribosome stalling serves as a "tuner" to suppress aberrant production of ErmB because methylated ribosome may impose a fitness cost on the bacterium as a result of misregulated translation.

  1. Mutations at three sites in the Escherichia coli 23S ribosomal RNA binding region for protein L11 cause UGA-specific suppression and conditional lethality.

    Science.gov (United States)

    Murgola, E J; Xu, W; Arkov, A L

    1995-01-01

    A single nucleotide change, G to A, at nucleotide position 1093 of E. coli 23S ribosomal RNA was found to cause UGA-specific suppression (D.K. Jemiolo, F.T. Pagel and E.J. Murgola, Proc. Natl. Acad. Sci. USA, in press). To obtain new kinds of UGA-specific suppressors in 23S rRNA, we used segment-directed mutagenic PCR, and targeted first the 1405 nucleotide SnaBI/I-CeuI segment, which includes position 1093, of the rrnB operon cloned into a multicopy plasmid. The mutagenized fragments were subcloned into the plasmid vector and used to transform to ampicillin resistance (Ampr) a recipient strain containing a UGA mutation in trpA. The Ampr transformants were then screened for suppression of UGA. After purification, Trp+ transformants were tested for association of the suppressor phenotype first with the plasmid and then specifically with the SnaBI/I-CeuI fragment. In one screening, four different kinds of mutational change were found, all at three sites within a highly conserved hexanucleotide loop in domain II of 23S rRNA. This region is part of the site for binding of the large subunit protein L11, which has been shown to be involved in peptide chain termination in a specific way. All of the mutants (G1093A, G1093 delta, A1095 delta, and U1097 delta) suppress UGA mutations, but not UAA or UAG mutations, and all four types exhibit high-temperature conditional lethality when highly expressed. Several mechanisms can be suggested for the UGA-specific suppression exhibited by these mutants, including altered interaction with protein L11, Second-site mutations that overcome the conditional lethality of G1093A indicate that intramolecular interactions within 23S rRNA may play a role in peptide chain termination at the UGA stop codon.

  2. Sequence length variation of internal genic space of 16S rDNA-23S rDNA in biohydrogen-bacterium%产氢菌的16S -23S rDNA间隔区的长度变异性分析

    Institute of Scientific and Technical Information of China (English)

    李永峰; 郑国香; 张文启; 李建政; 胡立杰

    2005-01-01

    生物制氢细菌Rennanqilyf3的16S rRNA gene (rDNA)-23S rDNA间隔区碱基序列被测定.利用PCR扩增间隔区DNA,间隔区碱基序列存在长度多态现象.用这一长度多态现象进行产氢发酵细菌的辨认和识别.产氢发酵细菌Rennanqilyf3的16S rRNA gene (rDNA)-23S rDNA间隔区的PCR产品从1 270 到398 bp,共有5个序列.碱基数目分别为1 270、398、638、437 和 436 bp.%A method based on PCR amplification of the 16S rRNA gene (rDNA)-23S rDNA intergenic regions was developed for the identification of species for fermentative biohydrogen-producing bacterium. The sizes of the PCR products varied from 1 270 to 398 bp. Strain of Rennanqilyf3 were characterized as having products of 1 270,398,638, 437 and 436bp.

  3. Genetics Home Reference: guanidinoacetate methyltransferase deficiency

    Science.gov (United States)

    ... Facebook Share on Twitter Your Guide to Understanding Genetic Conditions Search MENU Toggle navigation Home Page Search ... Conditions Genes Chromosomes & mtDNA Resources Help Me Understand Genetics Home Health Conditions guanidinoacetate methyltransferase deficiency guanidinoacetate methyltransferase ...

  4. Bypassing rRNA methylation by RsmA/Dim1during ribosome maturation in the hyperthermophilic archaeon Nanoarchaeum equitans

    DEFF Research Database (Denmark)

    Seistrup, Kenneth H; Rose, Simon; Birkedal, Ulf

    2017-01-01

    In all free-living organisms a late-stage checkpoint in the biogenesis of the small ribosomal subunit involves rRNA modification by an RsmA/Dim1 methyltransferase. The hyperthermophilic archaeon Nanoarchaeum equitans, whose existence is confined to the surface of a second archaeon, Ignicoccus hos...

  5. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function...

  6. Fitness cost and interference of Arm/Rmt aminoglycoside resistance with the RsmF housekeeping methyltransferases.

    Science.gov (United States)

    Gutierrez, Belen; Escudero, Jose A; San Millan, Alvaro; Hidalgo, Laura; Carrilero, Laura; Ovejero, Cristina M; Santos-Lopez, Alfonso; Thomas-Lopez, Daniel; Gonzalez-Zorn, Bruno

    2012-05-01

    Arm/Rmt methyltransferases have emerged recently in pathogenic bacteria as enzymes that confer high-level resistance to 4,6-disubstituted aminoglycosides through methylation of the G1405 residue in the 16S rRNA (like ArmA and RmtA to -E). In prokaryotes, nucleotide methylations are the most common type of rRNA modification, and they are introduced posttranscriptionally by a variety of site-specific housekeeping enzymes to optimize ribosomal function. Here we show that while the aminoglycoside resistance methyltransferase RmtC methylates G1405, it impedes methylation of the housekeeping methyltransferase RsmF at position C1407, a nucleotide that, like G1405, forms part of the aminoglycoside binding pocket of the 16S rRNA. To understand the origin and consequences of this phenomenon, we constructed a series of in-frame knockout and knock-in mutants of Escherichia coli, corresponding to the genotypes rsmF(+), ΔrsmF, rsmF(+) rmtC(+), and ΔrsmF rmtC(+). When analyzed for the antimicrobial resistance pattern, the ΔrsmF bacteria had a decreased susceptibility to aminoglycosides, including 4,6- and 4,5-deoxystreptamine aminoglycosides, showing that the housekeeping methylation at C1407 is involved in intrinsic aminoglycoside susceptibility in E. coli. Competition experiments between the isogenic E. coli strains showed that, contrary to expectation, acquisition of rmtC does not entail a fitness cost for the bacterium. Finally, matrix-assisted laser desorption ionization (MALDI) mass spectrometry allowed us to determine that RmtC methylates the G1405 residue not only in presence but also in the absence of aminoglycoside antibiotics. Thus, the coupling between housekeeping and acquired methyltransferases subverts the methylation architecture of the 16S rRNA but elicits Arm/Rmt methyltransferases to be selected and retained, posing an important threat to the usefulness of aminoglycosides worldwide.

  7. The use of 16S and 16S-23S rDNA to easily detect and differentiate common Gram-negative orchard epiphytes.

    Science.gov (United States)

    Jeng, R S; Svircev, A M; Myers, A L; Beliaeva, L; Hunter, D M; Hubbes, M

    2001-02-01

    The identification of Gram-negative pathogenic and non-pathogenic bacteria commonly isolated from an orchard phylloplane may result in a time consuming and tedious process for the plant pathologist. The paper provides a simple "one-step" protocol that uses the polymerase chain reaction (PCR) to amplify intergenic spacer regions between 16S and 23S genes and a portion of 16S gene in the prokaryotic rRNA genetic loci. Amplified 16S rDNA, and restriction fragment length polymorphisms (RFLP) following EcoRI digestion produced band patterns that readily distinguished between the plant pathogen Erwinia amylovora (causal agent of fire blight in pear and apple) and the orchard epiphyte Pantoea agglomerans (formerly E. herbicola). The amplified DNA patterns of 16S-23S spacer regions may be used to differentiate E. amylovora at the intraspecies level. Isolates of E. amylovora obtained from raspberries exhibited two major fragments while those obtained from apples showed three distinct amplified DNA bands. In addition, the size of the 16S-23S spacer region differs between Pseudomonas syringae and Pseudomonas fluorescens. The RFLP pattern generated by HaeIII digestion may be used to provide a rapid and accurate identification of these two common orchard epiphytes.

  8. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    OpenAIRE

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A.

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 speci...

  9. Heterogeneity within the gram-positive anaerobic cocci demonstrated by analysis of 16S-23S intergenic ribosomal RNA polymorphisms.

    Science.gov (United States)

    Hill, K E; Davies, C E; Wilson, M J; Stephens, P; Lewis, M A O; Hall, V; Brazier, J; Thomas, D W

    2002-11-01

    Peptostreptococci are gram-positive, strictly anaerobic bacteria which, although regarded as members of the commensal human microflora, are also frequently isolated from sites of clinical infection. The study of this diverse group of opportunist pathogens has been hindered by an inadequate taxonomy and the lack of a valid identification scheme. Recent re-classification of the Peptostreptococcus family into five distinct genus groups has helped to clarify the situation. However, this has been on the basis of 16S rRNA sequence determinations, which are both time-consuming and expensive. The aim of the present study was to evaluate the use of PCR-amplified ribosomal DNA spacer polymorphisms for the rapid differentiation of the currently recognised taxa within the group of anaerobic gram-positive cocci. A collection comprising 19 reference strains with representatives of each of the 15 species, two close relatives and two of the well-characterised groups, together with 38 test strains was studied. All strains were identified to species group level by phenotypic means. Amplification of the 16S-23S intergenic spacer region (ISR) with universal primers produced distinct banding patterns for all the 19 reference strains and the patterns could be differentiated easily visually. However, of the 38 test strains, less than half could be speciated from ISR analysis alone. Only five groups produced correlating banding patterns for all members tested (Peptoniphilus lacrimalis, P. ivorii, Anaerococcus octavius, Peptostreptococcus anaerobius and Micromonas micros). For other species, either the type strain differed significantly from other species members (e.g., A. hydrogenalis) or there appeared to be considerable intra-species variation (e.g., A. vaginalis). Partial 16S rRNA gene sequences for the 'trisimilis' and 'betaGAL' groups showed that both are most closely related to the Anaerococcus group. This work highlights the heterogeneous nature of a number of Peptostreptococcus

  10. Proteome identification of proteins interacting with histone methyltransferase SET8

    Institute of Scientific and Technical Information of China (English)

    Yi Qin; Huafang Ouyang; Jing Liu; Youhua Xie

    2013-01-01

    SET8 (also known as PR-Set7/9,SETD8,KMT5A),a member of the SET domain containing methyltransferase family,which specifically catalyzes mono-methylation of K20 on histone H4 (H4K20me1),has been implicated in multiple biological processes,such as gene transcriptional regulation,cell cycle control,genomic integrity maintenance and development.In this study,we used GST-SET8 fusion protein as bait to search for SET8 interaction partners to elucidate physiological functions of SET8.In combination with mass spectrometry,we identified 40 proteins that potentially interact with SET8.DDX21,a nucleolar protein,was further confirmed to associate with SET8.Furthermore,we discovered a novel function of SET8 in the regulation of rRNA transcription.

  11. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    DEFF Research Database (Denmark)

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim;

    1999-01-01

    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems...... growth. The amounts of 23S rRNA and pre-16S rRNA measured for E. coli growing in intestinal mucus corresponded to that expected for bacteria with the observed growth rate. In contrast, the slow-growing E. coli cells present in intestinal contents turned out to have an approximately ninefold higher...

  12. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    Science.gov (United States)

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  13. Enzymology of Mammalian DNA Methyltransferases.

    Science.gov (United States)

    Jurkowska, Renata Z; Jeltsch, Albert

    2016-01-01

    DNA methylation is currently one of the hottest topics in basic and biomedical research. Despite tremendous progress in understanding the structures and biochemical properties of the mammalian DNA nucleotide methyltransferases (DNMTs), principles of their regulation in cells have only begun to be uncovered. In mammals, DNA methylation is introduced by the DNMT1, DNMT3A, and DNMT3B enzymes, which are all large multi-domain proteins. These enzymes contain a catalytic C-terminal domain with a characteristic cytosine-C5 methyltransferase fold and an N-terminal part with different domains that interacts with other proteins and chromatin and is involved in targeting and regulation of the DNMTs. The subnuclear localization of the DNMT enzymes plays an important role in their biological function: DNMT1 is localized to replicating DNA via interaction with PCNA and UHRF1. DNMT3 enzymes bind to heterochromatin via protein multimerization and are targeted to chromatin by their ADD and PWWP domains. Recently, a novel regulatory mechanism has been discovered in DNMTs, as latest structural and functional data demonstrated that the catalytic activities of all three enzymes are under tight allosteric control of their N-terminal domains having autoinhibitory functions. This mechanism provides numerous possibilities for the precise regulation of the methyltransferases via controlling the binding and release of autoinhibitory domains by protein factors, noncoding RNAs, or by posttranslational modifications of the DNMTs. In this chapter, we summarize key enzymatic properties of DNMTs, including their specificity and processivity, and afterward we focus on the regulation of their activity and targeting via allosteric processes, protein interactors, and posttranslational modifications.

  14. rRNA gene restriction patterns of Haemophilus influenzae biogroup aegyptius strains associated with Brazilian purpuric fever.

    Science.gov (United States)

    Irino, K; Grimont, F; Casin, I; Grimont, P A

    1988-08-01

    The rRNA gene restriction patterns of 92 isolates of Haemophilus influenzae biogroup aegyptius, associated with conjunctivitis or Brazilian purpuric fever in the State of São Paulo, Brazil, were studied with 16 + 23S rRNA from Escherichia coli as a probe. All strains were classified into 15 patterns. Isolates from Brazilian purpuric fever cases were seen only in patterns 3 (most frequently) and 4 (rarely), whereas isolates from conjunctivitis were found in all 15 patterns. The study demonstrated that rRNA from E. coli can serve as a probe for molecular epidemiology.

  15. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    to A752 via alkyl-aryl groups linked to a carbamate at the drug 11/12 position (in the ketolide antibiotics HMR 3647 and HMR 3004). The data indicate that simultaneous drug interactions with domains II and V strengthen binding and that the domain II contact is of particular importance to achieve...

  16. involvement of methyltransferases enzymes during the energy ...

    African Journals Online (AJOL)

    Mgina

    semesiae sp. nov. to evaluate whether the enzyme systems involved were constitutive or inductive. ... methyl transfer reaction in DMS conversion proceeds in a manner similar to methyltransferases ..... influence the rate of methanogenesis.

  17. Length polymorphisms for intergenic spacer regions of 16S-23S rDNA in members of the new hydrogen-producing bacteria

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A method based on PCR amplification of the 16S rRNA gene (rDNA) -23S rDNA intergenic spacer regions (ISR) was developed for the identification of species within the novel group hydrogen-producing anaerobes. The sizes of the PCR products varied from 1264 to 398 bp. Strain of isolate Rennanqilyf 3 was characterized as having products of 1262, 398, 638, 437 and 436 bp. The isolate Rennanqilyf 1 had product of 1264 bp. The isolate Rennanqilyf 13 had products of 1261, 579 and 485 bp. Of the 3 species of the novel group hydrogenproducing anaerobes examined, no one was indistinguishable. Two environmental isolates were identified as hydrogen-producing bacteria, which were new species in present taxon. Rennanqilyf 3 could not be associated With any Clostridium sp. Studied. Rennanqilyf 1 could be classified into Clostridium genus. The combination between 16S rDNA equencing and length polymorphisms of IRS in 16S-23S rDNA is a better method for determining species of the hydrogen-producing bacteria.

  18. Improved identification of rapidly growing mycobacteria by a 16S-23S internal transcribed spacer region PCR and capillary gel electrophoresis.

    Directory of Open Access Journals (Sweden)

    Timothy J Gray

    Full Text Available The identification of rapidly growing mycobacteria (RGM remains problematic because of evolving taxonomy, limitations of current phenotypic methods and absence of a universal gene target for reliable speciation. This study evaluated a novel method of identification of RGM by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS followed by resolution of amplified fragments by capillary gel electrophoresis (CGE. Nineteen American Type Culture Collection (ATCC Mycobacterium strains and 178 clinical isolates of RGM (12 species were studied. All RGM ATCC strains generated unique electropherograms with no overlap with slowly growing mycobacteria species, including M. tuberculosis. A total of 47 electropherograms for the 178 clinical isolates were observed allowing the speciation of 175/178 (98.3% isolates, including the differentiation of the closely related species, M. massiliense (M. abscessus subspecies bolletii and M. abscessus (M. abscessus sensu stricto. ITS fragment size ranged from 332 to 534 bp and 33.7% of clinical isolates generated electropherograms with two distinct peaks, while the remainder where characterized with a single peak. Unique peaks (fragment lengths were identified for 11/12 (92% RGM species with only M. moriokaense having an indistinguishable electropherogram from a rarely encountered CGE subtype of M. fortuitum. We conclude that amplification of the 16S-23S ITS gene region followed by resolution of fragments by CGE is a simple, rapid, accurate and reproducible method for species identification and characterization of the RGM.

  19. Specific features of 5S rRNA structure - its interactions with macromolecules and possible functions.

    Science.gov (United States)

    Smirnov, A V; Entelis, N S; Krasheninnikov, I A; Martin, R; Tarassov, I A

    2008-12-01

    Small non-coding RNAs are today a topic of great interest for molecular biologists because they can be regarded as relicts of a hypothetical "RNA world" which, apparently, preceded the modern stage of organic evolution on Earth. The small molecule of 5S rRNA (approximately 120 nucleotides) is a component of large ribosomal subunits of all living beings (5S rRNAs are not found only in mitoribosomes of fungi and metazoans). This molecule interacts with various protein factors and 23S (28S) rRNA. This review contains the accumulated data to date concerning 5S rRNA structure, interactions with other biological macromolecules, intracellular traffic, and functions in the cell.

  20. Caffeine synthase and related methyltransferases in plants.

    Science.gov (United States)

    Misako, Kato; Kouichi, Mizuno

    2004-05-01

    Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in high concentrations in tea and coffee and it is also found in a number of beverages such as coca cola. It is necessary to elucidate the caffeine biosynthetic pathway and to clone the genes related to the production of caffeine not only to determine the metabolism of the purine alkaloid but also to control the content of caffeine in tea and coffee. The available data support the operation of a xanthosine-->7-methylxanthosine-->7-methylxanthine-->theobromine-->caffeine pathway as the major route to caffeine. Since the caffeine biosynthetic pathway contains three S-adenosyl-L-methionine (SAM) dependent methylation steps, N-methyltransferases play important roles. This review focuses on the enzymes and genes involved in the methylation of purine ring. Caffeine synthase, the SAM-dependent methyltransferase involved in the last two steps of caffeine biosynthesis, was originally purified from young tea leaves (Camellia sinensis). The isolated cDNA, termed TCS1, consists of 1,483 base pairs and encodes a protein of 369 amino acids. Subsequently, the homologous genes that encode caffeine biosynthetic enzymes from coffee (Coffea arabica) were isolated. The recombinant proteins are classified into the three types on the basis of their substrate specificity i.e. 7-methylxanthosine synthase, theobromine synthase and caffeine synthase. The predicted amino acid sequences of caffeine biosynthetic enzymes derived from C. arabica exhibit more than 80% homology with those of the clones and but show only 40% homology with TCS1 derived from C. sinensis. In addition, they share 40% homology with the amino acid sequences of salicylic carboxyl methyltransferase, benzoic acid carboxyl methyltransferase and jasmonic acid carboxyl methyltransferase which belong to a family of motif B' methyltransferases which are novel plant methyltransferases with motif B' instead of motif B as the conserved region.

  1. Overexpression of the mitochondrial methyltransferase TFB1M in the mouse does not impact mitoribosomal methylation status or hearing

    DEFF Research Database (Denmark)

    Lee, Seungmin; Rose, Simon; Metodiev, Metodi D;

    2015-01-01

    Mitochondrial dysfunction is a well-established cause of sensorineural deafness, but the pathophysiological events are poorly understood. Non-syndromic deafness and predisposition to aminoglycoside-induced deafness can be caused by specific mutations in the 12S rRNA gene of mtDNA and are thus...... by 'hypermethylation' of two conserved adenosines of 12S rRNA in the mitoribosome is of key pathophysiological importance in sensorineural deafness. In support for this concept, it was reported that overexpression of the essential mitochondrial methyltransferase TFB1M in the mouse was sufficient to induce...... mitoribosomal hypermethylation and deafness. At variance with this model, we show here that 12S rRNA is near fully methylated in vivo in the mouse and thus cannot be further methylated to any significant extent. Furthermore, bacterial artificial chromosome transgenic mice overexpressing TFB1M have no increase...

  2. Higher-order structure of rRNA

    Science.gov (United States)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  3. Changes in the conformation of 5S rRNA cause alterations in principal functions of the ribosomal nanomachine.

    Science.gov (United States)

    Kouvela, Ekaterini C; Gerbanas, George V; Xaplanteri, Maria A; Petropoulos, Alexandros D; Dinos, George P; Kalpaxis, Dimitrios L

    2007-01-01

    5S rRNA is an integral component of the large ribosomal subunit in virtually all living organisms. Polyamine binding to 5S rRNA was investigated by cross-linking of N1-azidobenzamidino (ABA)-spermine to naked 5S rRNA or 50S ribosomal subunits and whole ribosomes from Escherichia coli cells. ABA-spermine cross-linking sites were kinetically measured and their positions in 5S rRNA were localized by primer extension analysis. Helices III and V, and loops A, C, D and E in naked 5S rRNA were found to be preferred polyamine binding sites. When 50S ribosomal subunits or poly(U)-programmed 70S ribosomes bearing tRNA(Phe) at the E-site and AcPhe-tRNA at the P-site were targeted, the susceptibility of 5S rRNA to ABA-spermine was greatly reduced. Regardless of 5S rRNA assembly status, binding of spermine induced significant changes in the 5S rRNA conformation; loop A adopted an apparent 'loosening' of its structure, while loops C, D, E and helices III and V achieved a more compact folding. Poly(U)-programmed 70S ribosomes possessing 5S rRNA cross-linked with spermine were more efficient than control ribosomes in tRNA binding, peptidyl transferase activity and translocation. Our results support the notion that 5S rRNA serves as a signal transducer between regions of 23S rRNA responsible for principal ribosomal functions.

  4. Analysis of the 16S-23S rDNA intergenic spacers (IGSs) of marine vibrios for species-specific signature DNA sequences.

    Science.gov (United States)

    Lee, Simon K Y; Wang, H Z; Law, Sheran H W; Wu, Rudolf S S; Kong, Richard Y C

    2002-05-01

    Vibrios are widespread in the marine environment and a few pathogenic species are known to be commonly associated with outbreaks of diarrheal diseases in humans due to the consumption of raw or improperly cooked seafood. However, there are also many Vibrio species which are potentially pathogenic to vertebrate and invertebrate aquatic animals, and of which little is known. In an attempt to develop rapid PCR detection methods for these latter class of vibrios, we have examined the 16S-23S intergenic spacers (IGSs) of 10 lesser-known Vibrio species and successfully developed species-specific primers for eight of them--Vibrio costicola, V. diazotrophicus, V. fluvialis, V. nigripulchritudo, V. proteolyticus, V. salmonicida, V. splendidus and V. tubiashii. The IGS amplicons were amplified using primers complementary to conserved regions of the 16S and 23S rRNA genes, and cloned into plasmid vectors and sequenced. Analysis of the IGS sequences showed that 37 ribosomal RNA (rrn) operons representing seven different IGS types have been cloned from the 10 vibrios. The three IGS types--IGS(0), IGS(IA) and IGS(Glu)--were the most prevalent forms detected. Multiple alignment of representative sequences of these three IGS types from different Vibrio species revealed several domains of high sequence variability, which were used to design species-specific primers for PCR. The specificity of the primers were evaluated using total DNA prepared from different Vibrio species and bacterial genera. The results showed that the PCR method can be used to reliably detect eight of the 10 Vibrio species in marine waters in this study.

  5. A second function for pseudouridine synthases: A point mutant of RluD unable to form pseudouridines 1911, 1915, and 1917 in Escherichia coli 23S ribosomal RNA restores normal growth to an RluD-minus strain.

    Science.gov (United States)

    Gutgsell, N S; Del Campo, M; Raychaudhuri, S; Ofengand, J

    2001-07-01

    This laboratory previously showed that truncation of the gene for RluD, the Escherichia coli pseudouridine synthase responsible for synthesis of 23S rRNA pseudouridines 1911, 1915, and 1917, blocks pseudouridine formation and inhibits growth. We now show that RluD mutants at the essential aspartate 139 allow these two functions of RluD to be separated. In vitro, RluD with aspartate 139 replaced by threonine or asparagine is completely inactive. In vivo, the growth defect could be completely restored by transformation of an RluD-inactive strain with plasmids carrying genes for RluD with aspartate 139 replaced by threonine or asparagine. Pseudouridine sequencing of the 23S rRNA from these transformed strains demonstrated the lack of these pseudouridines. Pseudoreversion, which has previously been shown to restore growth without pseudouridine formation by mutation at a distant position on the chromosome, was not responsible because transformation with empty vector under identical conditions did not alter the growth rate.

  6. Chicken rRNA Gene Cluster Structure.

    Directory of Open Access Journals (Sweden)

    Alexander G Dyomin

    Full Text Available Ribosomal RNA (rRNA genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5'ETS (1836 bp, 18S rRNA gene (1823 bp, ITS1 (2530 bp, 5.8S rRNA gene (157 bp, ITS2 (733 bp, 28S rRNA gene (4441 bp and 3'ETS (343 bp. The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region. The results have confirmed the chicken rRNA gene cluster validity.

  7. RISSC: a novel database for ribosomal 16S-23S RNA genes spacer regions.

    Science.gov (United States)

    García-Martínez, J; Bescós, I; Rodríguez-Sala, J J; Rodríguez-Valera, F

    2001-01-01

    A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S-23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documentation tool for studies on evolution, identification, typing and strain characterization, among others.

  8. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    Science.gov (United States)

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  9. rRNA operons and genome size of 'Candidatus Liberibacter americanus', a bacterium associated with citrus huanglongbing in Brazil.

    Science.gov (United States)

    Wulff, N A; Eveillard, S; Foissac, X; Ayres, A J; Bové, J-M

    2009-08-01

    Huanglongbing is one of the most severe diseases of citrus worldwide and is associated with 'Candidatus (Ca.) Liberibacter africanus' in Africa, 'Ca. Liberibacter asiaticus' in Asia and the Americas (Brazil, USA and Cuba) and 'Ca. Liberibacter americanus' (Lam) in Brazil. In the absence of axenic cultures, genetic information on liberibacters is scarce. The sequences of the entire 23S rRNA and 5S rRNA genes from Lam have now been obtained, using a consensus primer designed on known tRNAMet sequences of rhizobia. The size of the Lam genome was determined by PFGE, using Lam-infected periwinkle plants for bacterial enrichment, and was found to be close to 1.31 Mbp. In order to determine the number of ribosomal operons on the Lam genome, probes designed to detect the 16S rRNA gene and the 3' end of the 23S rRNA gene were developed and used for Southern hybridization with I-CeuI-treated genomic DNA. Our results suggest that there are three ribosomal operons in a circular genome. Lam is the first liberibacter species for which such data are available.

  10. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  11. Inter- and intraspecific genomic variability of the 16S-23S intergenic spacer regions (ISR) in representatives of Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans.

    Science.gov (United States)

    Ni, Yong-Qing; Yang, Yuan; Bao, Jing-Ting; He, Kai-Yu; Li, Hong-Yu

    2007-05-01

    The complete sequences of 32 intergenic spacer regions (ISR) from Acidithiobacillus strains, including 29 field strains isolated from coal, copper, molybdenum mine wastes or sediment of different geoclimatic regions in China, reference strain ATCC19859 and the type strains of the two species were determined. These data, together with other sequences available in the GenBank database, were used to carry out the first detailed assessment of the inter- and intraspecific genomic variability of the ISR sequences and to infer phylogenetic relationships within the genus. The total length of the 16S-23S rRNA intergenic spacer regions of the Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans strains ranged from 451 to 490 bp, and from 434 to 456 bp, respectively. The degree of intrageneric ISR sequence similarity was higher than the degree of intergeneric similarity, and the overall similarity values of the ISRs varied from 60.49% to 84.71% between representatives of different species of the genus Acidithiobacillus. Sequences from the spacer of the A. thiooxidans and A. ferrooxidans strains ranged from 86.71% to 99.56% and 92.36% to 100% similarity, respectively. All Acidithiobacillus strains were separated into three phylogenetic major clusters and seven phylogenetic groups. ISR may be a potential target for the development of in situ hybridization probe aimed at accurately detecting acidithiobacilli in the various acidic environments.

  12. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  13. COBALAMIN- AND COBAMIDE-DEPENDENT METHYLTRANSFERASES

    Science.gov (United States)

    Matthews, Rowena G.; Koutmos, Markos; Datta, Supratim

    2008-01-01

    Methyltransferases that employ cobalamin cofactors, or their analogues the cobamides, as intermediates in catalysis of methyl transfer play vital roles in energy generation in anaerobic unicellular organisms. In a broader range of organisms they are involved in the conversion of homocysteine to methionine. Although the individual methyl transfer reactions catalyzed are simple SN2 displacements, the required change in coordination at the cobalt of the cobalamin or cobamide cofactors and the lability of the reduced Co+1 intermediates introduces the necessity for complex conformational changes during the catalytic cycle. Recent spectroscopic and structural studies on several of these methyltransferases have helped to reveal the strategies by which these conformational changes are facilitated and controlled. PMID:19059104

  14. Catechol-O-methyltransferase and Parkinson's disease.

    OpenAIRE

    Tai CH; Wu RM

    2002-01-01

    Parkinson's disease (PD) is one of the main causes of neurological disability in the elderly. Levodopa is the gold standard for treating this disease, but chronic levodopa therapy is complicated by motor fluctuation and dyskinesia. The catechol-O-methyltransferase (COMT) inhibitors represent a new class of antiparkinsonian drugs. When coadministered with levodopa/decarboxylase inhibitor, 2 COMT inhibitors, tolcapone and entacapone have been shown to improve the clinical benefit of levodopa. C...

  15. The weak measurement process and the weak value of spin for metastable helium 23S1

    Science.gov (United States)

    Monachello, Vincenzo; Barker, Peter; Flack, Robert; Hiley, Basil

    2016-05-01

    An experiment is being designed and constructed in order to measure the weak value of spin for an atomic system. The principle of the ``weak measurement'' process was first proposed by Aharonov, Albert and Vaidman, and describes a scenario in which a system is weakly coupled to a pointer between well-defined pre- and post-selected states. This experiment will utilise a pulsed supersonic beam of spin-1 metastable Helium (He*) atoms in the 23S1 state. The spin of the pre-selected He* atoms will be weakly coupled to its centre-of-mass. During its flight, the atomic beam will be prepared in a desired quantum state and travel through two inhomogeneous magnets (weak and strong) which both comprise the ``weak measurement'' process. The deviation of the post-selected ms = + 1 state as measured using a micro-channel plate, phosphor screen and CCD camera setup will allow for the determination of the weak value of spin. This poster will report on the methods used and the experimental realisation.

  16. DNA methyltransferases as targets for cancer therapy.

    Science.gov (United States)

    Ghoshal, Kalpana; Bai, Shoumei

    2007-06-01

    Methylation of DNA at 5-position of cytosine, catalyzed by DNA methyltransferases, is the predominant epigenetic modification in mammals. Aberrations in methylation play a causal role in a variety of diseases, including cancer. Recent studies have established that like mutation, methylation-mediated gene silencing often leads to tumorigenesis. Paradoxically, genome-wide DNA hypomethylation may also play a causal role in carcinogenesis by inducing chromosomal instability and spurious gene expression. Since methylation does not alter DNA base sequence, much attention has been focused recently on developing small molecule inhibitors of DNA methyltransferases that can potentially be used as anticancer agents. Vidaza (5-azacytidine), marketed by Pharmion (Boulder, CO, USA), was the first DNA methyltransferase inhibitor approved by the U.S. Food and Drug Administration (FDA) for chemotherapy against myelodysplastic syndrome (MDS), a heterogeneous bone marrow disorder. Recently MGI Pharma Inc. (Bloomington, MN, USA) got FDA approval to market Dacogen (5-aza-2'-deoxycytidine, or decitabine) for treating MDS patients. These drugs were used earlier against certain anemias to induce expression of fetal globin genes. Interest in clinical trials of these drugs as anticancer agents has been renewed only recently because of reversal of methylation-mediated silencing of critical genes in cancer. Clinical trials have shown that both drugs have therapeutic potential against leukemia such as MDS, acute myeloid leukemia, chronic myelogenous leukemia and chronic myelomonocytic leukemia. In contrast, their effectiveness with solid tumors appears to be less promising, which challenges researchers to develop inhibitors with more efficacy and less toxicity. The major hindrance of their usage as anticancer agents is their instability in vivo as well as the toxicity secondary to their excessive incorporation into DNA, which causes cell cycle arrest. Gene expression profiling in cancer cells

  17. The aminoglycoside resistance methyltransferases from the ArmA/Rmt family operate late in the 30S ribosomal biogenesis pathway.

    Science.gov (United States)

    Zarubica, Tamara; Baker, Matthew R; Wright, H Tonie; Rife, Jason P

    2011-02-01

    Bacterial resistance to 4,6-type aminoglycoside antibiotics, which target the ribosome, has been traced to the ArmA/RmtA family of rRNA methyltransferases. These plasmid-encoded enzymes transfer a methyl group from S-adenosyl-L-methionine to N7 of the buried G1405 in the aminoglycoside binding site of 16S rRNA of the 30S ribosomal subunit. ArmA methylates mature 30S subunits but not 16S rRNA, 50S, or 70S ribosomal subunits or isolated Helix 44 of the 30S subunit. To more fully characterize this family of enzymes, we have investigated the substrate requirements of ArmA and to a lesser extent its ortholog RmtA. We determined the Mg+² dependence of ArmA activity toward the 30S ribosomal subunits and found that the enzyme recognizes both low Mg+² (translationally inactive) and high Mg+² (translationally active) forms of this substrate. We tested the effects of LiCl pretreatment of the 30S subunits, initiation factor 3 (IF3), and gentamicin/kasugamycin resistance methyltransferase (KsgA) on ArmA activity and determined whether in vivo derived pre-30S ribosomal subunits are ArmA methylation substrates. ArmA failed to methylate the 30S subunits generated from LiCl washes above 0.75 M, despite the apparent retention of ribosomal proteins and a fully mature 16S rRNA. From our experiments, we conclude that ArmA is most active toward the 30S ribosomal subunits that are at or very near full maturity, but that it can also recognize more than one form of the 30S subunit.

  18. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    OpenAIRE

    Triman, K L; Peister, A; Goel, R A

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  19. Improving cancer immunotherapy with DNA methyltransferase inhibitors.

    Science.gov (United States)

    Saleh, Mohammad H; Wang, Lei; Goldberg, Michael S

    2016-07-01

    Immunotherapy confers durable clinical benefit to melanoma, lung, and kidney cancer patients. Challengingly, most other solid tumors, including ovarian carcinoma, are not particularly responsive to immunotherapy, so combination with a complementary therapy may be beneficial. Recent findings suggest that epigenetic modifying drugs can prime antitumor immunity by increasing expression of tumor-associated antigens, chemokines, and activating ligands by cancer cells as well as cytokines by immune cells. This review, drawing from both preclinical and clinical data, describes some of the mechanisms of action that enable DNA methyltransferase inhibitors to facilitate the establishment of antitumor immunity.

  20. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  1. A plasmid-coded and site-directed mutation in Escherichia coli 23S RNA that confers resistance to erythromycin

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1987-01-01

    Primer-directed mutagenesis was employed to introduce an A2058----G transition in plasmid-encoded Escherichia coli 23S RNA at a site that has been implicated, indirectly, in erythromycin binding. The mutation raises the growth tolerance of cells from 30 to 300 micrograms/ml of erythromycin, and c...

  2. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    Science.gov (United States)

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  3. Novel non-specific DNA adenine methyltransferases

    Science.gov (United States)

    Drozdz, Marek; Piekarowicz, Andrzej; Bujnicki, Janusz M.; Radlinska, Monika

    2012-01-01

    The mom gene of bacteriophage Mu encodes an enzyme that converts adenine to N6-(1-acetamido)-adenine in the phage DNA and thereby protects the viral genome from cleavage by a wide variety of restriction endonucleases. Mu-like prophage sequences present in Haemophilus influenzae Rd (FluMu), Neisseria meningitidis type A strain Z2491 (Pnme1) and H. influenzae biotype aegyptius ATCC 11116 do not possess a Mom-encoding gene. Instead, at the position occupied by mom in Mu they carry an unrelated gene that encodes a protein with homology to DNA adenine N6-methyltransferases (hin1523, nma1821, hia5, respectively). Products of the hin1523, hia5 and nma1821 genes modify adenine residues to N6-methyladenine, both in vitro and in vivo. All of these enzymes catalyzed extensive DNA methylation; most notably the Hia5 protein caused the methylation of 61% of the adenines in λ DNA. Kinetic analysis of oligonucleotide methylation suggests that all adenine residues in DNA, with the possible exception of poly(A)-tracts, constitute substrates for the Hia5 and Hin1523 enzymes. Their potential ‘sequence specificity’ could be summarized as AB or BA (where B = C, G or T). Plasmid DNA isolated from Escherichia coli cells overexpressing these novel DNA methyltransferases was resistant to cleavage by many restriction enzymes sensitive to adenine methylation. PMID:22102579

  4. USE OF 16S-23S INTERGENIC TRANSCRIBED SPACER IN IDENTIFICATION AND COMMUNITY ANALYSIS OF BACTERIA%基因间隔序列(ITS)在细菌分类鉴定和种群分析中的应用

    Institute of Scientific and Technical Information of China (English)

    郑雪松; 杨虹; 李道棠; 韩文卿

    2003-01-01

    Use of 16S -23S intergenic transcribed spacer (ITS) variability, as a relatively new method, is becoming an important supplement to the molecular methods based on 16S rRNA for which has a fairly constant size and is not divergent enough to give good separation in close relationships. This paper summarizes the structures and characteristics of ITS regions that are extremely variable in copy number, length and sequence per genome. The ITS region can be amplified easily taking advantage of conserved nucleotide stretches at the 5′of the 16S and 3′of the 23S gene, and the amplicon can contain different amounts of the 16S rDNA by choosing primers at different conserved areas within this gene. These primers are listed and discussed for perfecting the methodology of ITS. Furthermore, some recent progresses on the taxonomy, identification and community analysis of bacteria by means of ITS in epidemiology, ecology and artificial environment are reviewed, as well, the virtues and limitations of that method are discussed. Fig 2, Tab 1, Ref 51

  5. A nonpyrrolysine member of the widely distributed trimethylamine methyltransferase family is a glycine betaine methyltransferase.

    Science.gov (United States)

    Ticak, Tomislav; Kountz, Duncan J; Girosky, Kimberly E; Krzycki, Joseph A; Ferguson, Donald J

    2014-10-28

    COG5598 comprises a large number of proteins related to MttB, the trimethylamine:corrinoid methyltransferase. MttB has a genetically encoded pyrrolysine residue proposed essential for catalysis. MttB is the only known trimethylamine methyltransferase, yet the great majority of members of COG5598 lack pyrrolysine, leaving the activity of these proteins an open question. Here, we describe the function of one of the nonpyrrolysine members of this large protein family. Three nonpyrrolysine MttB homologs are encoded in Desulfitobacterium hafniense, a Gram-positive strict anaerobe present in both the environment and human intestine. D. hafniense was found capable of growth on glycine betaine with electron acceptors such as nitrate or fumarate, producing dimethylglycine and CO2 as products. Examination of the genome revealed genes for tetrahydrofolate-linked oxidation of a methyl group originating from a methylated corrinoid protein, but no obvious means to carry out corrinoid methylation with glycine betaine. DSY3156, encoding one of the nonpyrrolysine MttB homologs, was up-regulated during growth on glycine betaine. The recombinant DSY3156 protein converts glycine betaine and cob(I)alamin to dimethylglycine and methylcobalamin. To our knowledge, DSY3156 is the first glycine betaine:corrinoid methyltransferase described, and a designation of MtgB is proposed. In addition, DSY3157, an adjacently encoded protein, was shown to be a methylcobalamin:tetrahydrofolate methyltransferase and is designated MtgA. Homologs of MtgB are widely distributed, especially in marine bacterioplankton and nitrogen-fixing plant symbionts. They are also found in multiple members of the human microbiome, and may play a beneficial role in trimethylamine homeostasis, which in recent years has been directly tied to human cardiovascular health.

  6. Structures of NS5 Methyltransferase from Zika Virus

    Directory of Open Access Journals (Sweden)

    Javier Coloma

    2016-09-01

    Full Text Available The Zika virus (ZIKV poses a major public health emergency. To aid in the development of antivirals, we present two high-resolution crystal structures of the ZIKV NS5 methyltransferase: one bound to S-adenosylmethionine (SAM and the other bound to SAM and 7-methyl guanosine diphosphate (7-MeGpp. We identify features of ZIKV NS5 methyltransferase that lend to structure-based antiviral drug discovery. Specifically, SAM analogs with functionalities on the Cβ atom of the methionine portion of the molecules that occupy the RNA binding tunnel may provide better specificity relative to human RNA methyltransferases.

  7. Evolutionary relationships among Chlamydophila abortus variant strains inferred by rRNA secondary structure-based phylogeny.

    Science.gov (United States)

    Siarkou, Victoria I; Stamatakis, Alexandros; Kappas, Ilias; Hadweh, Paul; Laroucau, Karine

    2011-01-01

    The evolutionary relationships among known Chlamydophila abortus variant strains including the LLG and POS, previously identified as being highly distinct, were investigated based on rRNA secondary structure information. PCR-amplified overlapping fragments of the 16S, 16S-23S intergenic spacer (IS), and 23S domain I rRNAs were subjected to cloning and sequencing. Secondary structure analysis revealed the presence of transitional single nucleotide variations (SNVs), two of which occurred in loops, while seven in stem regions that did not result in compensatory substitutions. Notably, only two SNVs, in 16S and 23S, occurred within evolutionary variable regions. Maximum likelihood and Bayesian phylogeny reconstructions revealed that C. abortus strains could be regarded as representing two distinct lineages, one including the "classical" C. abortus strains and the other the "LLG/POS variant", with the type strain B577(T) possibly representing an intermediate of the two lineages. The two C. abortus lineages shared three unique (apomorphic) characters in the 23S domain I and 16S-23S IS, but interestingly lacked synapomorphies in the 16S rRNA. The two lineages could be distinguished on the basis of eight positions; four of these comprised residues that appeared to be signature or unique for the "classical" lineage, while three were unique for the "LLG/POS variant". The U277 (E. coli numbering) signature character, corresponding to a highly conserved residue of the 16S molecule, and the unique G681 residue, conserved in a functionally strategic region also of 16S, are the most pronounced attributes (autapomorphies) of the "classical" and the "LLG/POS variant" lineages, respectively. Both lineages were found to be descendants of a common ancestor with the Prk/Daruma C. psittaci variant. Compared with the "classical", the "LLG/POS variant" lineage has retained more ancestral features. The current rRNA secondary structure-based analysis and phylogenetic inference reveal new

  8. Evolutionary relationships among Chlamydophila abortus variant strains inferred by rRNA secondary structure-based phylogeny.

    Directory of Open Access Journals (Sweden)

    Victoria I Siarkou

    Full Text Available The evolutionary relationships among known Chlamydophila abortus variant strains including the LLG and POS, previously identified as being highly distinct, were investigated based on rRNA secondary structure information. PCR-amplified overlapping fragments of the 16S, 16S-23S intergenic spacer (IS, and 23S domain I rRNAs were subjected to cloning and sequencing. Secondary structure analysis revealed the presence of transitional single nucleotide variations (SNVs, two of which occurred in loops, while seven in stem regions that did not result in compensatory substitutions. Notably, only two SNVs, in 16S and 23S, occurred within evolutionary variable regions. Maximum likelihood and Bayesian phylogeny reconstructions revealed that C. abortus strains could be regarded as representing two distinct lineages, one including the "classical" C. abortus strains and the other the "LLG/POS variant", with the type strain B577(T possibly representing an intermediate of the two lineages. The two C. abortus lineages shared three unique (apomorphic characters in the 23S domain I and 16S-23S IS, but interestingly lacked synapomorphies in the 16S rRNA. The two lineages could be distinguished on the basis of eight positions; four of these comprised residues that appeared to be signature or unique for the "classical" lineage, while three were unique for the "LLG/POS variant". The U277 (E. coli numbering signature character, corresponding to a highly conserved residue of the 16S molecule, and the unique G681 residue, conserved in a functionally strategic region also of 16S, are the most pronounced attributes (autapomorphies of the "classical" and the "LLG/POS variant" lineages, respectively. Both lineages were found to be descendants of a common ancestor with the Prk/Daruma C. psittaci variant. Compared with the "classical", the "LLG/POS variant" lineage has retained more ancestral features. The current rRNA secondary structure-based analysis and phylogenetic

  9. Phylogenetic diversity based on rrs, atpD, recA genes and 16S-23S intergenic sequence analyses of rhizobial strains isolated from Vicia faba and Pisum sativum in Peru.

    Science.gov (United States)

    Santillana, Nery; Ramírez-Bahena, Martha Helena; García-Fraile, Paula; Velázquez, Encarna; Zúñiga, Doris

    2008-03-01

    In this study 17 isolates from effective nodules of Vicia faba and Pisum sativum var. macrocarpum growing in different soils from Peru were isolated and characterized. The isolates, presenting 11 different RAPD profiles, were distributed in three groups on the basis of their 16S-RFLP patterns. The 16S rRNA gene sequences of strains from 16S-RFLP groups I, II and III were closely related (identities higher than 99.5%) to Rhizobium leguminosarum bv. trifolii DSM 30141 (=ATCC 14480), R. leguminosarum bv. viciae DSM 30132(T) and Rhizobium etli CFN42(T) (=USDA 9032(T)), respectively. The analysis of the 16S-23S intergenic spacer (ITS) and two housekeeping genes, atpD and recA, confirmed the identification of strains from group I, however those from groups II and III were phylogenetically divergent to strains DSM 30132(T) and CFN42(T). These results support the fact that the 16S rRNA gene is not adequate for identification at species level within genus Rhizobium and suggest the existence of putative new species within the phylogenetic group of R. leguminosarum. They also confirm the need of a taxonomic revision of R. leguminosarum since the reference strains of the three biovars included in this study are phylogenetically divergent according to their ITS, atpD and recA gene sequences.

  10. Differentiation of Closely Related Carnobacterium Food Isolates Based on 16S-23S Ribosomal DNA Intergenic Spacer Region Polymorphism

    OpenAIRE

    Kabadjova, Petia; Dousset, Xavier; Le Cam, Virginie; Prevost, Hervé

    2002-01-01

    A novel strategy for identification of Carnobacterium food isolates based on restriction fragment length polymorphism (RFLP) of PCR-amplified 16S-23S ribosomal intergenic spacer regions (ISRs) was developed. PCR amplification from all Carnobacterium strains studied always yielded three ISR amplicons, which were designated the small ISR (S-ISR), the medium ISR (M-ISR), and the large ISR (L-ISR). The lengths of these ISRs varied from one species to another. Carnobacterium divergens NCDO 2763T a...

  11. Interactions within the mammalian DNA methyltransferase family

    Directory of Open Access Journals (Sweden)

    Ehrenhofer-Murray Ann E

    2003-05-01

    Full Text Available Abstract Background In mammals, epigenetic information is established and maintained via the postreplicative methylation of cytosine residues by the DNA methyltransferases Dnmt1, Dnmt3a and Dnmt3b. Dnmt1 is required for maintenance methylation whereas Dnmt3a and Dnmt3b are responsible for de novo methylation. Contrary to Dnmt3a or Dnmt3b, the isolated C-terminal region of Dnmt1 is catalytically inactive, despite the presence of the sequence motifs typical of active DNA methyltransferases. Deletion analysis has revealed that a large part of the N-terminal domain is required for enzymatic activity. Results The role played by the N-terminal domain in this regulation has been investigated using the yeast two-hybrid system. We show here the presence of an intra-molecular interaction in Dnmt1 but not in Dnmt3a or Dnmt3b. This interaction was confirmed by immunoprecipitation and was localized by deletion mapping. Furthermore, a systematic analysis of interactions among the Dnmt family members has revealed that DNMT3L interacts with the C-terminal domain of Dnmt3a and Dnmt3b. Conclusions The lack of methylating ability of the isolated C-terminal domain of Dnmt1 could be explained in part by a physical interaction between N- and C-terminal domains that apparently is required for activation of the catalytic domain. Our deletion analysis suggests that the tertiary structure of Dnmt1 is important in this process rather than a particular sequence motif. Furthermore, the interaction between DNMT3L and the C-terminal domains of Dnmt3a and Dnmt3b suggests a mechanism whereby the enzymatically inactive DNMT3L brings about the methylation of its substrate by recruiting an active methylase.

  12. The Cfr rRNA methyltransferase confers resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics

    DEFF Research Database (Denmark)

    Long, K. S.; Poehlsgaard, Jacob; Kehrenberg, C.

    2006-01-01

    drug classes: Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics. Each of these five drug classes contains important antimicrobial agents that are currently used in human and/or veterinary medicine. We find that binding of the PhLOPSA drugs, which bind...... classes of antimicrobials. In addition, the findings described in this study represent the first report of a gene conferring transferable resistance to pleuromutilins and oxazolidinones....

  13. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides

    DEFF Research Database (Denmark)

    Almutairi, Mashal M; Park, Sung Ryeol; Rose, Simon

    2015-01-01

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces v...... together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism....

  14. nucleoside DNA methyltransferase 1 inhibitors for treating epi ...

    African Journals Online (AJOL)

    Keywords: Epi-mutation, DNA methyltransferase, Non-nucleoside, DNMT1 inhibitor, Docking .... associated genes [18] and the effect could not be ... compound that may inhibit DNA methylation non- ... potential of which is over estimated [16];.

  15. Monolignol 4-O-methyltransferases and uses thereof

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Chang-Jun; Bhuiya, Mohammad-Wadud; Zhang, Kewei

    2014-11-18

    Modified (iso)eugenol 4-O-methyltransferase enzymes having novel capacity for methylation of monolignols and reduction of lignin polymerization in plant cell wall are disclosed. Sequences encoding the modified enzymes are disclosed.

  16. Hypomethylation and hypermethylation of the tandem repetitive 5S rRNA genes in Arabidopsis.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Jasencakova, Zuzana; Douet, Julien; Schubert, Ingo; Tourmente, Sylvette

    2008-04-01

    5S ribosomal DNA (5S rDNA) is organized in tandem repeats on chromosomes 3, 4 and 5 in Arabidopsis thaliana. One part of the 5S rDNA is located within the heterochromatic chromocenters, and the other fraction forms loops with euchromatic features that emanate from the chromocenters. We investigated whether the A. thaliana heterochromatin, and particularly the 5S rDNA, is modified when changing the culture conditions (cultivation in growth chamber versus greenhouse). Nuclei from challenged tissues displayed larger total, as well as 5S rDNA, heterochromatic fractions, and the DNA methyltransferase mutants met1 and cmt3 had different impacts in Arabidopsis. The enlarged fraction of heterochromatic 5S rDNA was observed, together with the reversal of the silencing of some 5S rRNA genes known as minor genes. We observed hypermethylation at CATG sites, and a concomitant DNA hypomethylation at CG/CXG sites in 5S rDNA. Our results show that the asymmetrical hypermethylation is correlated with the ageing of the plants, whereas hypomethylation results from the growth chamber/culture conditions. In spite of severely reduced DNA methylation, the met1 mutant revealed no increase in minor 5S rRNA transcripts in these conditions. The increasing proportion of cytosines in asymmetrical contexts during transition from the euchromatic to the heterochromatic state in the 5S rDNA array suggests that 5S rDNA units are differently affected by the (hypo and hyper)methylation patterns along the 5S rDNA locus. This might explain the different behaviour of 5S rDNA subpopulations inside a 5S array in terms of chromatin compaction and expression, i.e. some 5S rRNA genes would become derepressed, whereas others would join the heterochromatic fraction.

  17. Functional characterization of a rice de novo DNA methyltransferase, OsDRM2, expressed in Escherichia coli and yeast

    Energy Technology Data Exchange (ETDEWEB)

    Pang, Jinsong, E-mail: pangjs542@nenu.edu.cn [Key Laboratory of Molecular Epigenetics of the Ministry of Education, Northeast Normal University, Changchun, Jilin 130024 (China); Dong, Mingyue; Li, Ning; Zhao, Yanli [Key Laboratory of Molecular Epigenetics of the Ministry of Education, Northeast Normal University, Changchun, Jilin 130024 (China); Liu, Bao, E-mail: baoliu@nenu.edu.cn [Key Laboratory of Molecular Epigenetics of the Ministry of Education, Northeast Normal University, Changchun, Jilin 130024 (China)

    2013-03-01

    Highlights: ► A rice de novo DNA methyltransferase OsDRM2 was cloned. ► In vitro methylation activity of OsDRM2 was characterized with Escherichia coli. ► Assays of OsDRM2 in vivo methylation were done with Saccharomyces cerevisiae. ► OsDRM2 methylation activity is not preferential to any type of cytosine context. ► The activity of OsDRM2 is independent of RdDM pathway. - Abstract: DNA methylation of cytosine nucleotides is an important epigenetic modification that occurs in most eukaryotic organisms and is established and maintained by various DNA methyltransferases together with their co-factors. There are two major categories of DNA methyltransferases: de novo and maintenance. Here, we report the isolation and functional characterization of a de novo methyltransferase, named OsDRM2, from rice (Oryza sativa L.). The full-length coding region of OsDRM2 was cloned and transformed into Escherichia coli and Saccharomyces cerevisiae. Both of these organisms expressed the OsDRM2 protein, which exhibited stochastic de novo methylation activity in vitro at CG, CHG, and CHH di- and tri-nucleotide patterns. Two lines of evidence demonstrated the de novo activity of OsDRM2: (1) a 5′-CCGG-3′ containing DNA fragment that had been pre-treated with OsDRM2 protein expressed in E. coli was protected from digestion by the CG-methylation-sensitive isoschizomer HpaII; (2) methylation-sensitive amplified polymorphism (MSAP) analysis of S. cerevisiae genomic DNA from transformants that had been introduced with OsDRM2 revealed CG and CHG methylation levels of 3.92–9.12%, and 2.88–6.93%, respectively, whereas the mock control S. cerevisiae DNA did not exhibit cytosine methylation. These results were further supported by bisulfite sequencing of the 18S rRNA and EAF5 genes of the transformed S. cerevisiae, which exhibited different DNA methylation patterns, which were observed in the genomic DNA. Our findings establish that OsDRM2 is an active de novo DNA

  18. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  19. Eukaryotic 5S rRNA biogenesis.

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2011-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. Copyright © 2011 John Wiley & Sons, Ltd.

  20. 16S and 23S plastid rDNA phylogenies of Prototheca species and their auxanographic phenotypes1

    Science.gov (United States)

    Ewing, Aren; Brubaker, Shane; Somanchi, Aravind; Yu, Esther; Rudenko, George; Reyes, Nina; Espina, Karen; Grossman, Arthur; Franklin, Scott

    2014-01-01

    Because algae have become more accepted as sources of human nutrition, phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied. This can help establish algal evolutionary relationships. Here, we compare Auxenochlorella protothecoides and 23 strains of Prototheca based on their complete 16S and partial 23S plastid rDNA sequences along with nutrient utilization (auxanographic) profiles. These data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships. PMID:25937672

  1. Purification and properties of thioether methyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Mozier, N.M.

    1988-01-01

    A method to assay activity was developed which measures acceptance of methyl groups from (methyl-{sup 3}H)-S-adenosylmethionine by dimethyl selenide. The product, ({sup 3}H)trimethylselenonium ion, is separated by HPLC and quantitated by scintillation counting. Thioether methyltransferase from mouse liver and lung resides primarily in the cytosol. In terms of specific activity the enzyme is most active in the lung and liver. Purification from lung cytosol requires a three-step process of DEAE and gel filtration column chromatographies followed by chromatofocusing. SDS-Polyacrylamide gel electrophoresis shows a single homogeneous band with a molecular mass of 28,000 daltons. Vmax and Km values for dimethyl selenide as a substrate are 15. 7 pmol/min and 0.44 {mu}M, respectively. Our studies have also shown that this purified enzyme is capable of methylating a wide range of compounds. To further test the enzyme's role in detoxification, in vivo studies were performed by injecting mice with substrate and (methyl-{sup 3}H)methionine and analyzing tissue extracts and urine for (methyl-{sup 3}H)sulfonium.

  2. Systematic Comparisons of Orthologous Selenocysteine Methyltransferase and Homocysteine Methyltransferase Genes from Seven Monocots Species

    Directory of Open Access Journals (Sweden)

    De-yong ZHAO

    2015-06-01

    Full Text Available Identifying and manipulating genes underlying selenium metabolism could be helpful for increasing selenium content in crop grain, which is an important way to overcome diseases resulted from selenium deficiency. A reciprocal smallest distance algorithm (RSD approach was applied using two experimentally confirmed Homocysteine S-Methyltransferases genes (HMT1 and HMT2 and a putative Selenocysteine Methyltransferase (SMT from dicots plant Arabidopsis thaliana, to explore their orthologs in seven sequenced diploid monocot species: Oryza sativa, Zea mays, Sorghum bicolor, Brachypodium distachyon, Hordeum vulgare, Aegilops tauschii (the D-genome donor of common wheat and Triticum urartu (the A-genome donor of common wheat. HMT1 was apparently diverged from HMT2 and most of SMT orthologs were the same with that of HMT2 in this study, leading to the hypothesis that SMT and HMT originate from one common ancestor gene. Identifying orthologs provide candidates for further experimental confirmation; also it could be helpful in designing primers to clone SMT or HMT orthologs in other crops.

  3. Deletion of gene encoding methyltransferase (gidB) confers high-level antimicrobial resistance in Salmonella.

    Science.gov (United States)

    Mikheil, Dareen M; Shippy, Daniel C; Eakley, Nicholas M; Okwumabua, Ogi E; Fadl, Amin A

    2012-04-01

    The glucose-inhibited division gene (gid)B, which resides in the gid operon, was thought to have a role in the modulation of genes similar to that of gidA. Recent studies have indicated that GidB is a methyltransferase enzyme that is involved in the methylation of the 16S ribosomal RNA (rRNA) in Escherichia coli. In this study, we investigated the role of GidB in susceptibility to antibiotics and the overall biology of Salmonella. A gidB isogenic mutant of Salmonella was constructed and subsequently characterized under different conditions. Our data indicated that growth and invasion characteristics of the gidB mutant were similar to those of the wild type (WT). The gidB mutant was outgrown by the WT in a competitive growth assay, indicating a compromised overall bacterial fitness. Under the stress of nalidixic acid, the gidB mutant's motility was significantly reduced. Similarly, the mutant showed a filamentous morphology and smaller colony size compared with the rod-shaped and large colonies of the WT in the presence of nalidixic acid. Most importantly, deletion of gidB conferred high-level resistance to the aminoglycoside antibiotics streptomycin and neomycin. A primer extension assay determined the methylation site for the WT to be at G527 of the 16S rRNA. A lack of methylation in the mutant indicated that GidB is required for this methylation. Taken together, these data indicate that the GidB enzyme has a significant role in the alteration of antibiotic susceptibility and the modulation of growth and morphology under stress conditions in Salmonella.

  4. Increased 5S rRNA oxidation in Alzheimer's disease.

    Science.gov (United States)

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  5. Differentiation of Acidithiobacillus ferrooxidans and A. thiooxidans strains based on 16S-23S rDNA spacer polymorphism analysis.

    Science.gov (United States)

    Bergamo, Rogério F; Novo, Maria Teresa M; Veríssimo, Ricardo V; Paulino, Luciana C; Stoppe, Nancy C; Sato, Maria Inês Z; Manfio, Gilson P; Prado, Paulo Inácio; Garcia, Oswaldo; Ottoboni, Laura M M

    2004-09-01

    Restriction fragment length polymorphism (RFLP) and sequence analyses of the PCR-amplified 16S-23S rDNA intergenic spacer (ITS) were used for differentiating Acidithiobacillus thiooxidans strains from other related acidithiobacilli, including A. ferrooxidans and A. caldus. RFLP fingerprints obtained with AluI, DdeI, HaeIII, HinfI and MspI enabled the differentiation of all Acidithiobacillus reference strains into species groups. The A. thiooxidans strains investigated (metal mine isolates) yielded identical RFLP patterns to the A. thiooxidans type strain (ATCC 19377(T)), except for strain DAMS, which had a distinct pattern for all enzymes tested. Fourteen A. ferrooxidans mine strains were assigned to 3 RFLP groups, the majority of which were grouped with A. ferrooxidans ATCC 23270(T). The spacer region of one representative strain from each of the RFLP groups obtained was subjected to sequence analysis, in addition to eleven additional A. thiooxidans strains isolated from sediment and water samples, and A. caldus DSM 8584(T). The tRNA(IIe) and tRNA(Ala) genes, present in all strains analyzed, showed high sequence similarity. Phylogenetic analysis of the ITS sequences differentiated all three Acidithiobacillus species. Inter- and infraspecific genetic variations detected were mainly due to the size and sequence polymorphism of the ITS3 region. Mantel tests showed no significant correlation between ITS sequence similarity and the geographical origin of strains. The results showed that the 16S-23S rDNA spacer region is a useful target for the development of molecular-based methods aimed at the detection, rapid differentiation and identification of acidithiobacilli.

  6. Evaluation of Borrelia real time PCR DNA targeting OspA, FlaB and 5S-23S IGS and Borrelia 16S rRNA RT-qPCR.

    Science.gov (United States)

    de Leeuw, Bertie H C G M; Maraha, Boulos; Hollemans, Leonie; Sprong, Hein; Brandenburg, Afke H; Westenend, Pieter J; Kusters, Johannes G

    2014-12-01

    Borrelia burgdorferi non-sensu lato (s.l.) strains occurred in the Netherlands. A multiplex OspA, FlaB, IGS real time PCR was compared to 16S rRNA/rDNA RT-qPCR with lower average Cycle threshold (Ct) and LOD on strain dilutions. Multiplexing increased sensitivity on CSF samples (n=74), distinguishing B. burgdorferi s.l. from non-s.l. strains. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences

    National Research Council Canada - National Science Library

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-01-01

    ...) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough...

  8. Evaluation of a fluorescence-labelled oligonucleotide tide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears

    DEFF Research Database (Denmark)

    Nordentoft, Steen; Christensen, H.; Wegener, Henrik Caspar

    1997-01-01

    -embedded tissue from experimentally infected mice or from animals with a history of clinical salmonellosis. In these tissue sections the probe hybridized specifically to Salmonella serovars, allowing for the detection of single bacterial cells. The development of a fluorescence-labelled specific oligonucleotide...

  9. Unusual features of the sequences of copies of the 16S-23S rRNA internal transcribed spacer regions of Acinetobacter bereziniae, Acinetobacter guillouiae and Acinetobacter baylyi arise from horizontal gene transfer events.

    Science.gov (United States)

    Maslunka, Christopher; Gürtler, Volker; Seviour, Robert

    2015-02-01

    The highly variable nature of the internal transcribed spacer region (ITS) has been claimed to represent an ideal target for designing species-specific probes/primers capable of differentiating between closely related Acinetobacter species. However, several Acinetobacter species contain multiple ITS copies of variable lengths, and these include Acinetobacter bereziniae, Acinetobacter guillouiae and Acinetobacter baylyi. This study shows these length variations result from inter-genomic insertion/deletion events (indels) involving horizontal transfer of ITS fragments of other Acinetobacter species and possibly unrelated bacteria, as shown previously by us. In some instances, indel incorporation results in the loss of probe target sites in the recipient cell ITS. In other cases, some indel sequences contain target sites for probes designed from a single ITS sequence to target other Acinetobacter species. Hence, these can generate false positives. The largest of the indels that remove probe sites is 683 bp (labelled bay/i1-0), and it derives from the horizontal transfer of a complete ITS between A. bereziniae BCRC15423(T) and A. baylyi strain ADP1. As a consequence, ITS sequencing or fingerprinting cannot be used to distinguish between the 683 bp ITS in these two strains.

  10. Yorkie Promotes Transcription by Recruiting a Histone Methyltransferase Complex

    Directory of Open Access Journals (Sweden)

    Hyangyee Oh

    2014-07-01

    Full Text Available Hippo signaling limits organ growth by inhibiting the transcriptional coactivator Yorkie. Despite the key role of Yorkie in both normal and oncogenic growth, the mechanism by which it activates transcription has not been defined. We report that Yorkie binding to chromatin correlates with histone H3K4 methylation and is sufficient to locally increase it. We show that Yorkie can recruit a histone methyltransferase complex through binding between WW domains of Yorkie and PPxY sequence motifs of NcoA6, a subunit of the Trithorax-related (Trr methyltransferase complex. Cell culture and in vivo assays establish that this recruitment of NcoA6 contributes to Yorkie’s ability to activate transcription. Mammalian NcoA6, a subunit of Trr-homologous methyltransferase complexes, can similarly interact with Yorkie’s mammalian homolog YAP. Our results implicate direct recruitment of a histone methyltransferase complex as central to transcriptional activation by Yorkie, linking the control of cell proliferation by Hippo signaling to chromatin modification.

  11. Diversity in mechanism and function of tRNA methyltransferases

    Science.gov (United States)

    Swinehart, William E; Jackman, Jane E

    2015-01-01

    tRNA molecules undergo extensive post-transcriptional processing to generate the mature functional tRNA species that are essential for translation in all organisms. These processing steps include the introduction of numerous specific chemical modifications to nucleotide bases and sugars; among these modifications, methylation reactions are by far the most abundant. The tRNA methyltransferases comprise a diverse enzyme superfamily, including members of multiple structural classes that appear to have arisen independently during evolution. Even among closely related family members, examples of unusual substrate specificity and chemistry have been observed. Here we review recent advances in tRNA methyltransferase mechanism and function with a particular emphasis on discoveries of alternative substrate specificities and chemistry associated with some methyltransferases. Although the molecular function for a specific tRNA methylation may not always be clear, mutations in tRNA methyltransferases have been increasingly associated with human disease. The impact of tRNA methylation on human biology is also discussed. PMID:25626150

  12. Chromosomal replication incompatibility in Dam methyltransferase deficient Escherichia coli cells

    DEFF Research Database (Denmark)

    Freiesleben, Ulrik Von

    1996-01-01

    Dam methyltransferase deficient Escherichia coli cells containing minichromosomes were constructed. Free plasmid DNA could not be detected in these cells and the minichromosomes were found to be integrated in multiple copies in the origin of replication (oriC) region of the host chromosome...

  13. IDENTIFYING CRITICAL CYSTEINE RESIDUES IN ARSENIC (+3 OXIDATION STATE) METHYLTRANSFERASE

    Science.gov (United States)

    Arsenic (+3 oxidation state) methyltransferase (AS3MT) catalyzes methylation of inorganic arsenic to mono, di, and trimethylated arsenicals. Orthologous AS3MT genes in genomes ranging from simple echinoderm to human predict a protein with five conserved cysteine (C) residues. In ...

  14. Yorkie promotes transcription by recruiting a histone methyltransferase complex.

    Science.gov (United States)

    Oh, Hyangyee; Slattery, Matthew; Ma, Lijia; White, Kevin P; Mann, Richard S; Irvine, Kenneth D

    2014-07-24

    Hippo signaling limits organ growth by inhibiting the transcriptional coactivator Yorkie. Despite the key role of Yorkie in both normal and oncogenic growth, the mechanism by which it activates transcription has not been defined. We report that Yorkie binding to chromatin correlates with histone H3K4 methylation and is sufficient to locally increase it. We show that Yorkie can recruit a histone methyltransferase complex through binding between WW domains of Yorkie and PPxY sequence motifs of NcoA6, a subunit of the Trithorax-related (Trr) methyltransferase complex. Cell culture and in vivo assays establish that this recruitment of NcoA6 contributes to Yorkie's ability to activate transcription. Mammalian NcoA6, a subunit of Trr-homologous methyltransferase complexes, can similarly interact with Yorkie's mammalian homolog YAP. Our results implicate direct recruitment of a histone methyltransferase complex as central to transcriptional activation by Yorkie, linking the control of cell proliferation by Hippo signaling to chromatin modification. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Convergent Mechanistic Features between the Structurally Diverse N- and O-Methyltransferases: Glycine N-Methyltransferase and Catechol O-Methyltransferase.

    Science.gov (United States)

    Zhang, Jianyu; Klinman, Judith P

    2016-07-27

    Although an enormous and still growing number of biologically diverse methyltransferases have been reported and identified, a comprehensive understanding of the enzymatic methyl transfer mechanism is still lacking. Glycine N-methyltransferase (GNMT), a member of the family that acts on small metabolites as the substrate, catalyzes methyl transfer from S-adenosyl-l-methionine (AdoMet) to glycine to form S-adenosyl-l-homocysteine and sarcosine. We report primary carbon ((12)C/(14)C) and secondary ((1)H3/(3)H3) kinetic isotope effects at the transferred methyl group, together with (1)H3/(3)H3 binding isotope effects for wild-type GNMT and a series of Tyr21 mutants. The data implicate a compaction effect in the methyl transfer step that is conferred by the protein structure. Furthermore, a remarkable similarity of properties is observed between GNMT and catechol O-methyltransferase, despite significant differences between these enzymes with regard to their active site structures and catalyzed reactions. We attribute these results to a catalytically relevant reduction in the methyl donor-acceptor distance that is dependent on a tyrosine side chain positioned behind the methyl-bearing sulfur of AdoMet.

  16. Structure and Function of Flavivirus NS5 Methyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Zhou,Y.; Ray, D.; Zhao, Y.; Dong, H.; Ren, S.; Li, Z.; Guo, Y.; Bernard, K.; Shi, P.; Li, H.

    2007-01-01

    The plus-strand RNA genome of flavivirus contains a 5' terminal cap 1 structure (m{sup 7}GpppAmG). The flaviviruses encode one methyltransferase, located at the N-terminal portion of the NS5 protein, to catalyze both guanine N-7 and ribose 2'-OH methylations during viral cap formation. Representative flavivirus methyltransferases from dengue, yellow fever, and West Nile virus (WNV) sequentially generate GpppA {yields} m{sup 7}GpppA {yields} m{sup 7}GpppAm. The 2'-O methylation can be uncoupled from the N-7 methylation, since m{sup 7}GpppA-RNA can be readily methylated to m{sup 7}GpppAm-RNA. Despite exhibiting two distinct methylation activities, the crystal structure of WNV methyltransferase at 2.8 {angstrom} resolution showed a single binding site for S-adenosyl-L-methionine (SAM), the methyl donor. Therefore, substrate GpppA-RNA should be repositioned to accept the N-7 and 2'-O methyl groups from SAM during the sequential reactions. Electrostatic analysis of the WNV methyltransferase structure showed that, adjacent to the SAM-binding pocket, is a highly positively charged surface that could serve as an RNA binding site during cap methylations. Biochemical and mutagenesis analyses show that the N-7 and 2'-O cap methylations require distinct buffer conditions and different side chains within the K{sub 61}-D{sub 146}-K{sub 182}-E{sub 218} motif, suggesting that the two reactions use different mechanisms. In the context of complete virus, defects in both methylations are lethal to WNV; however, viruses defective solely in 2'-O methylation are attenuated and can protect mice from later wild-type WNV challenge. The results demonstrate that the N-7 methylation activity is essential for the WNV life cycle and, thus, methyltransferase represents a novel target for flavivirus therapy.

  17. 23(S),25(R)-1,25-dihydroxyvitamin D3-26,23-lactone stimulates murine bone formation in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Shima, M.; Tanaka, H.; Norman, A.W.; Yamaoka, K.; Yoshikawa, H.; Takaoka, K.; Ishizuka, S.; Seino, Y. (Osaka Univ. School of Medicine (Japan))

    1990-02-01

    23(S),25(R)-1,25-Dihydroxyvitamin D3-26,23-lactone (1,25-lactone) has been shown to have unique actions different from those of 1,25-dihydroxyvitamin D3 (1,25-(OH)2D3). In contrast to 1,25-(OH)2D3, 1,25-lactone causes a significant reduction in the serum Ca2+ level, stimulates collagen production in an osteoblastic cell line, and inhibits bone resorption induced by 1,25-(OH)2D3. A possible effect of 1,25-lactone on bone formation was examined in experiments on ectopic bone formation using a bone-inducing factor derived from Dunn osteosarcomas. 1,25-Lactone, a metabolite of 1,25-(OH)2D3, increased (3H)proline uptake at the stage of chondrogenesis and {sup 85}Sr uptake during bone formation. Significantly enlarged bone was also induced by this compound 3 weeks after implantation. These results suggest that the 1,25-lactone may be able to stimulate bone formation under in vivo conditions.

  18. lncRNA-Induced Nucleosome Repositioning Reinforces Transcriptional Repression of rRNA Genes upon Hypotonic Stress

    Directory of Open Access Journals (Sweden)

    Zhongliang Zhao

    2016-03-01

    Full Text Available The activity of rRNA genes (rDNA is regulated by pathways that target the transcription machinery or alter the epigenetic state of rDNA. Previous work has established that downregulation of rRNA synthesis in quiescent cells is accompanied by upregulation of PAPAS, a long noncoding RNA (lncRNA that recruits the histone methyltransferase Suv4-20h2 to rDNA, thus triggering trimethylation of H4K20 (H4K20me3 and chromatin compaction. Here, we show that upregulation of PAPAS in response to hypoosmotic stress does not increase H4K20me3 because of Nedd4-dependent ubiquitinylation and proteasomal degradation of Suv4-20h2. Loss of Suv4-20h2 enables PAPAS to interact with CHD4, a subunit of the chromatin remodeling complex NuRD, which shifts the promoter-bound nucleosome into the transcriptional “off” position. Thus, PAPAS exerts a “stress-tailored” dual function in rDNA silencing, facilitating either Suv4-20h2-dependent chromatin compaction or NuRD-dependent changes in nucleosome positioning.

  19. The structure of the RNA m5C methyltransferase YebU from Escherichia coli reveals a C-terminal RNA-recruiting PUA domain.

    Science.gov (United States)

    Hallberg, B Martin; Ericsson, Ulrika B; Johnson, Kenneth A; Andersen, Niels Møller; Douthwaite, Stephen; Nordlund, Pär; Beuscher, Albert E; Erlandsen, Heidi

    2006-07-21

    Nucleotide methylations are the most common type of rRNA modification in bacteria, and are introduced post-transcriptionally by a wide variety of site-specific enzymes. Three 5-methylcytidine (m(5)C) bases are found in the rRNAs of Escherichia coli and one of these, at nucleotide 1407 in 16 S rRNA, is the modification product of the methyltransferase (MTase) YebU (also called RsmF). YebU requires S-adenosyl-l-methionine (SAM) and methylates C1407 within assembled 30 S subunits, but not in naked 16 S rRNA or within tight-couple 70 S ribosomes. Here, we describe the three-dimensional structure of YebU determined by X-ray crystallography, and we present a molecular model for how YebU specifically recognizes, binds and methylates its ribosomal substrate. The YebU protein has an N-terminal SAM-binding catalytic domain with structural similarity to the equivalent domains in several other m(5)C RNA MTases including RsmB and PH1374. The C-terminal one-third of YebU contains a domain similar to that in pseudouridine synthases and archaeosine-specific transglycosylases (PUA-domain), which was not predicted by sequence alignments. Furthermore, YebU is predicted to contain extended regions of positive electrostatic potential that differ from other RNA-MTase structures, suggesting that YebU interacts with its RNA target in a different manner. Docking of YebU onto the 30 S subunit indicates that the PUA and MTase domains make several contacts with 16 S rRNA as well as with the ribosomal protein S12. The ribosomal protein interactions would explain why the assembled 30 S subunit, and not naked 16 S rRNA, is the preferred substrate for YebU.

  20. Sequence determination of rRNA genes of pathogenic Vibrio species and whole-cell identification of Vibrio vulnificus with rRNA-targeted oligonucleotide probes.

    Science.gov (United States)

    Aznar, R; Ludwig, W; Amann, R I; Schleifer, K H

    1994-04-01

    A comparative analysis of seven new 16S rRNA gene sequences of pathogenic Vibrio species with previously published vibrio sequences confirmed that Vibrio vulnificus represents a group that is not closely related to the core organisms of the genus Vibrio. In addition, we found that V. vulnificus, Listonella (Vibrio) anguillarum and Vibrio diazotrophicus branch off separately from the core group. A comparison of the 16S rRNA gene sequences of V. vulnificus strains belonging to biotypes 1 and 2 revealed that the sequences of all but four biotype 1 strains were identical to each other but slightly different (17 bases) from the sequences of the rest of the V. vulnificus strains investigated. In addition, the sequences of variable regions of the 23S rRNA genes of Vibrio fluvialis, Vibrio furnissii, Vibrio harveyi, Vibrio cholerae, and V. vulnificus C7184 and TW1 were determined, aligned, and compared with all available bacterial 23S rRNA sequences in order to search for specific target sites. As a result, four oligonucleotide probes specific for V. vulnificus were synthesized, and the specificities of these probes were evaluated by dot blot hybridization to membrane-bound RNAs from 21 V. vulnificus strains, 13 strains belonging to other Vibrio species, 61 strains belonging to species that are members of the alpha, beta, and gamma subclasses of the Proteobacteria, and 3 eucaryotic microorganisms. Two probes hybridized with all of the V. vulnificus strains tested, and the other two probes distinguished V. vulnificus biotype 1 strains from all other organisms. In situ identification of V. vulnificus by using tetramethylrhodamine- or fluorescein-labelled oligonucleotides is now possible.

  1. Phylogenetic study of Geitlerinema and Microcystis (Cyanobacteria) using PC-IGS and 16S-23S ITS as markers: investigation of horizontal gene transfer.

    Science.gov (United States)

    Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo

    2014-08-01

    Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria.

  2. Corynebacterium glutamicum RNase E/G-type endoribonuclease encoded by NCgl2281 is involved in the 5' maturation of 5S rRNA.

    Science.gov (United States)

    Maeda, Tomoya; Wachi, Masaaki

    2012-02-01

    Corynebacterium glutamicum has one RNase E/G ortholog and one RNase J ortholog but no RNase Y. We previously reported that the C. glutamicum NCgl2281 gene encoding the RNase E/G ortholog complemented the rng::cat mutation in Escherichia coli but not the rne-1 mutation. In this study, we constructed an NCgl2281 knockout mutant and found that the mutant cells accumulated 5S rRNA precursor molecules. The processing of 16S and 23S rRNA, tRNA, and tmRNA was normal. Primer extension analysis revealed that the RNase E/G ortholog cleaved at the -1 site of the 5' end of 5S rRNA. However, 3' maturation was essentially unaffected. These findings showed that C. glutamicum NCgl2281 endoribonuclease is involved in the 5' maturation of 5S rRNA. This is the first report showing the physiological function of the RNase E/G ortholog in bacteria having one RNase E/G and one RNase J but no RNase Y.

  3. Cobalamin-dependent and cobamide-dependent methyltransferases.

    Science.gov (United States)

    Matthews, Rowena G; Koutmos, Markos; Datta, Supratim

    2008-12-01

    Methyltransferases that employ cobalamin cofactors, or their analogs the cobamides, as intermediates in catalysis of methyl transfer play vital roles in energy generation in anaerobic unicellular organisms. In a broader range of organisms they are involved in the conversion of homocysteine to methionine. Although the individual methyl transfer reactions catalyzed are simple S(N)2 displacements, the required change in coordination at the cobalt of the cobalamin or cobamide cofactors and the lability of the reduced Co(+1) intermediates introduces the necessity for complex conformational changes during the catalytic cycle. Recent spectroscopic and structural studies on several of these methyltransferases have helped to reveal the strategies by which these conformational changes are facilitated and controlled.

  4. Protein Methyltransferases: A Distinct, Diverse, and Dynamic Family of Enzymes.

    Science.gov (United States)

    Boriack-Sjodin, P Ann; Swinger, Kerren K

    2016-03-22

    Methyltransferase proteins make up a superfamily of enzymes that add one or more methyl groups to substrates that include protein, DNA, RNA, and small molecules. The subset of proteins that act upon arginine and lysine side chains are characterized as epigenetic targets because of their activity on histone molecules and their ability to affect transcriptional regulation. However, it is now clear that these enzymes target other protein substrates, as well, greatly expanding their potential impact on normal and disease biology. Protein methyltransferases are well-characterized structurally. In addition to revealing the overall architecture of the subfamilies of enzymes, structures of complexes with substrates and ligands have permitted detailed analysis of biochemical mechanism, substrate recognition, and design of potent and selective inhibitors. This review focuses on how knowledge gained from structural studies has impacted the understanding of this large class of epigenetic enzymes.

  5. Plant isoflavone and isoflavanone O-methyltransferase genes

    Science.gov (United States)

    Broeckling, Bettina E.; Liu, Chang-Jun; Dixon, Richard A.

    2014-08-19

    The invention provides enzymes that encode O-methyltransferases (OMTs) from Medicago truncatula that allow modification to plant (iso)flavonoid biosynthetic pathways. In certain aspects of the invention, the genes encoding these enzymes are provided. The invention therefore allows the modification of plants for isoflavonoid content. Transgenic plants comprising such enzymes are also provided, as well as methods for improving disease resistance in plants. Methods for producing food and nutraceuticals, and the resulting compositions, are also provided.

  6. Hepatitis viruses exploitation of host DNA methyltransferases functions.

    Science.gov (United States)

    Pazienza, Valerio; Panebianco, Concetta; Andriulli, Angelo

    2016-08-01

    Hepatitis B virus (HBV), hepatitis C virus (HCV) and Delta (HDV) infections are a global health burden. With different routes of infection and biology, HBV, HCV and HDV are capable to induce liver cirrhosis and cancer by impinging on epigenetic mechanisms altering host cell's pathways. In the present manuscript, we reviewed the published studies taking into account the relationship between the hepatitis viruses and the DNA methyltransferases proteins.

  7. Quick identification of acetic acid bacteria based on nucleotide sequences of the 16S-23S rDNA internal transcribed spacer region and of the PQQ-dependent alcohol dehydrogenase gene.

    Science.gov (United States)

    Trcek, Janja

    2005-10-01

    Acetic acid bacteria (AAB) are well known for oxidizing different ethanol-containing substrates into various types of vinegar. They are also used for production of some biotechnologically important products, such as sorbose and gluconic acids. However, their presence is not always appreciated since certain species also spoil wine, juice, beer and fruits. To be able to follow AAB in all these processes, the species involved must be identified accurately and quickly. Because of inaccuracy and very time-consuming phenotypic analysis of AAB, the application of molecular methods is necessary. Since the pairwise comparison among the 16S rRNA gene sequences of AAB shows very high similarity (up to 99.9%) other DNA-targets should be used. Our previous studies showed that the restriction analysis of 16S-23S rDNA internal transcribed spacer region is a suitable approach for quick affiliation of an acetic acid bacterium to a distinct group of restriction types and also for quick identification of a potentially novel species of acetic acid bacterium (Trcek & Teuber 2002; Trcek 2002). However, with the exception of two conserved genes, encoding tRNAIle and tRNAAla, the sequences of 16S-23S rDNA are highly divergent among AAB species. For this reason we analyzed in this study a gene encoding PQQ-dependent ADH as a possible DNA-target. First we confirmed the expression of subunit I of PQQ-dependent ADH (AdhA) also in Asaia, the only genus of AAB which exhibits little or no ADH-activity. Further we analyzed the partial sequences of adhA among some representative species of the genera Acetobacter, Gluconobacter and Gluconacetobacter. The conserved and variable regions in these sequences made possible the construction of A. acetispecific oligonucleotide the specificity of which was confirmed in PCR-reaction using 45 well-defined strains of AAB as DNA-templates. The primer was also successfully used in direct identification of A. aceti from home made cider vinegar as well as for

  8. Transfer RNA Methyltransferases from Thermoplasma acidophilum, a Thermoacidophilic Archaeon

    Directory of Open Access Journals (Sweden)

    Takuya Kawamura

    2014-12-01

    Full Text Available We investigated tRNA methyltransferase activities in crude cell extracts from the thermoacidophilic archaeon Thermoplasma acidophilum. We analyzed the modified nucleosides in native initiator and elongator tRNAMet, predicted the candidate genes for the tRNA methyltransferases on the basis of the tRNAMet and tRNALeu sequences, and characterized Trm5, Trm1 and Trm56 by purifying recombinant proteins. We found that the Ta0997, Ta0931, and Ta0836 genes of T. acidophilum encode Trm1, Trm56 and Trm5, respectively. Initiator tRNAMet from T. acidophilum strain HO-62 contained G+, m1I, and m22G, which were not reported previously in this tRNA, and the m2G26 and m22G26 were formed by Trm1. In the case of elongator tRNAMet, our analysis showed that the previously unidentified G modification at position 26 was a mixture of m2G and m22G, and that they were also generated by Trm1. Furthermore, purified Trm1 and Trm56 could methylate the precursor of elongator tRNAMet, which has an intron at the canonical position. However, the speed of methyl-transfer by Trm56 to the precursor RNA was considerably slower than that to the mature transcript, which suggests that Trm56 acts mainly on the transcript after the intron has been removed. Moreover, cellular arrangements of the tRNA methyltransferases in T. acidophilum are discussed.

  9. Structural characterization of the mitomycin 7-O-methyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Shanteri; Chang, Aram; Goff, Randal D.; Bingman, Craig A.; Grüschow, Sabine; Sherman, David H.; Phillips, Jr., George N.; Thorson, Jon S. (Michigan); (UW)

    2014-10-02

    Mitomycins are quinone-containing antibiotics, widely used as antitumor drugs in chemotherapy. Mitomycin-7-O-methyltransferase (MmcR), a key tailoring enzyme involved in the biosynthesis of mitomycin in Streptomyces lavendulae, catalyzes the 7-O-methylation of both C9{beta}- and C9{alpha}-configured 7-hydroxymitomycins. We have determined the crystal structures of the MmcR-S-adenosylhomocysteine (SAH) binary complex and MmcR-SAH-mitomycin A (MMA) ternary complex at resolutions of 1.9 and 2.3 {angstrom}, respectively. The study revealed MmcR to adopt a common S-adenosyl-L-methionine-dependent O-methyltransferase fold and the presence of a structurally conserved active site general acid-base pair is consistent with a proton-assisted methyltransfer common to most methyltransferases. Given the importance of C7 alkylation to modulate mitomycin redox potential, this study may also present a template toward the future engineering of catalysts to generate uniquely bioactive mitomycins.

  10. Specific detection of Serpulina hyodysenteriae and potentially pathogenic weakly beta-haemolytic porcine intestinal spirochetes by polymerase chain reaction targeting 23S rDNA

    DEFF Research Database (Denmark)

    Leser, Thomas; Møller, Kristian; Jensen, Tim Kåre;

    1997-01-01

    A 2470-bp section of the 23S ribosomal DNA from Serpulina hyodysenteriae and five biochemical ly different groups of weakly beta-haemolytic porcine intestinal Serpulina strains was sequenced. The similarity between the sequenced strains was high (96.85% to 99.84%). A phylogenetic tree was estimat...

  11. Higher-order structure in the 3'-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

    DEFF Research Database (Denmark)

    Garrett, R A; Christensen, A; Douthwaite, S

    1984-01-01

    An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large ...

  12. Formation of Tertiary Interactions during rRNA GTPase Center Folding.

    Science.gov (United States)

    Rau, Michael J; Welty, Robb; Tom Stump, W; Hall, Kathleen B

    2015-08-28

    The 60-nt GTPase center (GAC) of 23S rRNA has a phylogenetically conserved secondary structure with two hairpin loops and a 3-way junction. It folds into an intricate tertiary structure upon addition of Mg(2+) ions, which is stabilized by the L11 protein in cocrystal structures. Here, we monitor the kinetics of its tertiary folding and Mg(2+)-dependent intermediate states by observing selected nucleobases that contribute specific interactions to the GAC tertiary structure in the cocrystals. The fluorescent nucleobase 2-aminopurine replaced three individual adenines, two of which make long-range stacking interactions and one that also forms hydrogen bonds. Each site reveals a unique response to Mg(2+) addition and temperature, reflecting its environmental change from secondary to tertiary structure. Stopped-flow fluorescence experiments revealed that kinetics of tertiary structure formation upon addition of MgCl2 are also site specific, with local conformational changes occurring from 5 ms to 4s and with global folding from 1 to 5s. Site-specific substitution with (15)N-nucleobases allowed observation of stable hydrogen bond formation by NMR experiments. Equilibrium titration experiments indicate that a stable folding intermediate is present at stoichiometric concentrations of Mg(2+) and suggest that there are two initial sites of Mg(2+) ion association.

  13. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species wer...

  14. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    Science.gov (United States)

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J.; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I–V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC. PMID:27749897

  15. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria.

    Science.gov (United States)

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I-V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC.

  16. Association of myasthenia gravis with polymorphisms in the gene of histamine N-methyltransferase

    DEFF Research Database (Denmark)

    Kellermayer, Blanka; Polgar, Noemi; Pal, Jozsef

    2013-01-01

    Histamine N-methyltransferase (HNMT) is the main metabolizing enzyme of histamine. Histamine modulates immune responses and plays a role in the pathogenesis of autoimmune disorders.......Histamine N-methyltransferase (HNMT) is the main metabolizing enzyme of histamine. Histamine modulates immune responses and plays a role in the pathogenesis of autoimmune disorders....

  17. Protein arginine N-methyltransferase 1 promotes the proliferation and metastasis of hepatocellular carcinoma cells.

    Science.gov (United States)

    Gou, Qing; He, ShuJiao; Zhou, ZeJian

    2017-02-01

    Hepatocellular carcinoma is the most common subtype of liver cancer. Protein arginine N-methyltransferase 1 was shown to be upregulated in various cancers. However, the role of protein arginine N-methyltransferase 1 in hepatocellular carcinoma progression remains incompletely understood. We investigated the clinical and functional significance of protein arginine N-methyltransferase 1 in a series of clinical hepatocellular carcinoma samples and a panel of hepatocellular carcinoma cell lines. We performed suppression analysis of protein arginine N-methyltransferase 1 using small interfering RNA to determine the biological roles of protein arginine N-methyltransferase 1 in hepatocellular carcinoma. In addition, the expression of epithelial-mesenchymal transition indicators was verified by western blotting in hepatocellular carcinoma cell lines after small interfering RNA treatment. Protein arginine N-methyltransferase 1 expression was found to be significantly upregulated in hepatocellular carcinoma cell lines and clinical tissues. Moreover, downregulation of protein arginine N-methyltransferase 1 in hepatocellular carcinoma cells by small interfering RNA could inhibit cell proliferation, migration, and invasion in vitro. These results indicate that protein arginine N-methyltransferase 1 may contribute to hepatocellular carcinoma progression and serves as a promising target for the treatment of hepatocellular carcinoma patients.

  18. Coordinate regulation of DNA methyltransferase expression during oogenesis

    Directory of Open Access Journals (Sweden)

    Bestor Timothy H

    2007-04-01

    Full Text Available Abstract Background Normal mammalian development requires the action of DNA methyltransferases (DNMTs for the establishment and maintenance of DNA methylation within repeat elements and imprinted genes. Here we report the expression dynamics of Dnmt3a and Dnmt3b, as well as a regulator of DNA methylation, Dnmt3L, in isolated female germ cells. Results Our results indicate that these enzymes are coordinately regulated and that their expression peaks during the stage of postnatal oocyte development when maternal methylation imprints are established. We find that Dnmt3a, Dnmt3b, Dnmt3L and Dnmt1o transcript accumulation is related to oocyte diameter. Furthermore, DNMT3L deficient 15 dpp oocytes have aberrantly methylated Snrpn, Peg3 and Igf2r DMRs, but normal IAP and LINE-1 methylation levels, thereby highlighting a male germ cell specific role for DNMT3L in the establishment of DNA methylation at repeat elements. Finally, real-time RT-PCR analysis indicates that the depletion of either DNMT3L or DNMT1o in growing oocytes results in the increased expression of the de novo methyltransferase Dnmt3b, suggesting a potential compensation mechanism by this enzyme for the loss of one of the other DNA methyltransferases. Conclusion Together these results provide a better understanding of the developmental regulation of Dnmt3a, Dnmt3b and Dnmt3L at the time of de novo methylation during oogenesis and demonstrate that the involvement of DNMT3L in retrotransposon silencing is restricted to the male germ line. This in turn suggests the existence of other factors in the oocyte that direct DNA methylation to transposons.

  19. A SABATH Methyltransferase from the moss Physcomitrella patens catalyzes

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Nan [ORNL; Ferrer, Jean-Luc [Universite Joseph Fourier, France; Moon, Hong S [Department of Plant Sciences, University of Tennessee; Kapteyn, Jeremy [Institute of Biological Chemistry, Washington State University; Zhuang, Xiaofeng [Department of Plant Sciences, University of Tennessee; Hasebe, Mitsuyasu [Laboratory of Evolutionary Biology, National Institute for Biology, 38 Nishigounaka; Stewart, Neal C. [Department of Plant Sciences, University of Tennessee; Gang, David R. [Institute of Biological Chemistry, Washington State University; Chen, Feng [University of Tennessee, Knoxville (UTK)

    2012-01-01

    Known SABATH methyltransferases, all of which were identified from seed plants, catalyze methylation of either the carboxyl group of a variety of low molecular weight metabolites or the nitrogen moiety of precursors of caffeine. In this study, the SABATH family from the bryophyte Physcomitrella patens was identified and characterized. Four SABATH-like sequences (PpSABATH1, PpSABATH2, PpSABATH3, and PpSABATH4) were identified from the P. patens genome. Only PpSABATH1 and PpSABATH2 showed expression in the leafy gametophyte of P. patens. Full-length cDNAs of PpSABATH1 and PpSABATH2 were cloned and expressed in soluble form in Escherichia coli. Recombinant PpSABATH1 and PpSABATH2 were tested for methyltransferase activity with a total of 75 compounds. While showing no activity with carboxylic acids or nitrogen-containing compounds, PpSABATH1 displayed methyltransferase activity with a number of thiols. PpSABATH2 did not show activity with any of the compounds tested. Among the thiols analyzed, PpSABATH1 showed the highest level of activity with thiobenzoic acid with an apparent Km value of 95.5 lM, which is comparable to those of known SABATHs. Using thiobenzoic acid as substrate, GC MS analysis indicated that the methylation catalyzed by PpSABATH1 is on the sulfur atom. The mechanism for S-methylation of thiols catalyzed by PpSABATH1 was partially revealed by homology-based structural modeling. The expression of PpSABATH1 was induced by the treatment of thiobenzoic acid. Further transgenic studies showed that tobacco plants overexpressing PpSABATH1 exhibited enhanced tolerance to thiobenzoic acid, suggesting that PpSABATH1 have a role in the detoxification of xenobiotic thiols.

  20. Identification of a novel DNA methyltransferase 2 from the brine shrimp, Artemia franciscana.

    Science.gov (United States)

    Feng, Chen-Zhuo; Zhu, Xiao-Jing; Dai, Zhong-Min; Liu, Feng-Qi; Xiang, Jian-Hai; Yang, Wei-Jun

    2007-06-01

    DNA methyltransferase 2 (Dnmt2) is a dual-specificity DNA methyltransferase, which contains a weak DNA methyltransferase and novel tRNA methyltransferase activity. However, its biological function is still enigmatic. To elucidate the expression profiles of Dnmt2 in Artemia franciscana, we isolated the gene encoding a Dnmt2 from A. franciscana and named it as AfDnmt2. The cDNA of AfDnmt2 contained a 1140-bp open reading frame that encoded a putative Dnmt2 protein of 379 amino acids exhibiting 32% approximately 39% identities with other known Dnmt2 homologs. This is the first report of a DNA methyltransferase gene in Crustacean. By using semi-quantitative RT-PCR, AfDnmt2 was found to be expressed through all developmental stages and its expression increased during resumption of diapause cysts development. Southern blot analysis indicated the presence of multiple copies of AfDnmt2 genes in A. franciscana.

  1. Expression of exogenous DNA methyltransferases: application in molecular and cell biology.

    Science.gov (United States)

    Dyachenko, O V; Tarlachkov, S V; Marinitch, D V; Shevchuk, T V; Buryanov, Y I

    2014-02-01

    DNA methyltransferases might be used as powerful tools for studies in molecular and cell biology due to their ability to recognize and modify nitrogen bases in specific sequences of the genome. Methylation of the eukaryotic genome using exogenous DNA methyltransferases appears to be a promising approach for studies on chromatin structure. Currently, the development of new methods for targeted methylation of specific genetic loci using DNA methyltransferases fused with DNA-binding proteins is especially interesting. In the present review, expression of exogenous DNA methyltransferase for purposes of in vivo analysis of the functional chromatin structure along with investigation of the functional role of DNA methylation in cell processes are discussed, as well as future prospects for application of DNA methyltransferases in epigenetic therapy and in plant selection.

  2. Phase Transition and EOS of Marmatite (Zn0.76Fe0.23S) up to 623 K and 17 Gpa

    Institute of Scientific and Technical Information of China (English)

    JIANG Xi; ZHOU Wen-Ge; XIE Hong-Sen; LIU Yong-Gang; FAN Da-Wei; LIU Jing; LI Yan-Chun; LUO Chong-Ju; MA Mai-Ning

    2007-01-01

    @@ In situ energy dispersive x-ray diffraction for natural marmatite (Zn0.76Fe0.23S) is performed up to 17.7 GPa and 623K. It is fitted by the Birch-Murnaghan equation of state (EOS) that K0 and α0 for marmatite are 85(3)GPa and 0. 79(16)× 10-4 K-1, respectively.

  3. An allosteric inhibitor of protein arginine methyltransferase 3.

    Science.gov (United States)

    Siarheyeva, Alena; Senisterra, Guillermo; Allali-Hassani, Abdellah; Dong, Aiping; Dobrovetsky, Elena; Wasney, Gregory A; Chau, Irene; Marcellus, Richard; Hajian, Taraneh; Liu, Feng; Korboukh, Ilia; Smil, David; Bolshan, Yuri; Min, Jinrong; Wu, Hong; Zeng, Hong; Loppnau, Peter; Poda, Gennadiy; Griffin, Carly; Aman, Ahmed; Brown, Peter J; Jin, Jian; Al-Awar, Rima; Arrowsmith, Cheryl H; Schapira, Matthieu; Vedadi, Masoud

    2012-08-01

    PRMT3, a protein arginine methyltransferase, has been shown to influence ribosomal biosynthesis by catalyzing the dimethylation of the 40S ribosomal protein S2. Although PRMT3 has been reported to be a cytosolic protein, it has been shown to methylate histone H4 peptide (H4 1-24) in vitro. Here, we report the identification of a PRMT3 inhibitor (1-(benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-cyclohexenylethyl)urea; compound 1) with IC50 value of 2.5 μM by screening a library of 16,000 compounds using H4 (1-24) peptide as a substrate. The crystal structure of PRMT3 in complex with compound 1 as well as kinetic analysis reveals an allosteric mechanism of inhibition. Mutating PRMT3 residues within the allosteric site or using compound 1 analogs that disrupt interactions with allosteric site residues both abrogated binding and inhibitory activity. These data demonstrate an allosteric mechanism for inhibition of protein arginine methyltransferases, an emerging class of therapeutic targets.

  4. Putrescine N-methyltransferase--the start for alkaloids.

    Science.gov (United States)

    Biastoff, Stefan; Brandt, Wolfgang; Dräger, Birgit

    2009-01-01

    Putrescine N-methyltransferase (PMT) catalyses S-adenosylmethionine (SAM) dependent methylation of the diamine putrescine. The product N-methylputrescine is the first specific metabolite on the route to nicotine, tropane, and nortropane alkaloids. PMT cDNA sequences were cloned from tobacco species and other Solanaceae, also from nortropane-forming Convolvulaceae and enzyme proteins were synthesised in Escherichia coli. PMT activity was measured by HPLC separation of polyamine derivatives and by an enzyme-coupled colorimetric assay using S-adenosylhomocysteine. PMT cDNA sequences resemble those of plant spermidine synthases (putrescine aminopropyltransferases) and display little similarity to other plant methyltransferases. PMT is likely to have evolved from the ubiquitous enzyme spermidine synthase. PMT and spermidine synthase proteins share the same overall protein structure; they bind the same substrate putrescine and similar co-substrates, SAM and decarboxylated S-adenosylmethionine. The active sites of both proteins, however, were shaped differentially in the course of evolution. Phylogenetic analysis of both enzyme groups from plants revealed a deep bifurcation and confirmed an early descent of PMT from spermidine synthase in the course of angiosperm development.

  5. Hypnotizability and Catechol-O-Methyltransferase (COMT polymorphysms in Italians

    Directory of Open Access Journals (Sweden)

    Silvano ePresciuttini

    2014-01-01

    Full Text Available Higher brain dopamine content depending on lower activity of Catechol-O-Methyltransferase (COMT in subjects with high hypnotisability scores (highs has been considered responsible for their attentional characteristics. However, the results of the previous genetic studies on association between hypnotisability and the Catechol-O-Methyltransferase (COMT single nucleotide polymorphism (SNP rs4680 (Val158Met were inconsistent. Here, we used a selective genotyping approach to re-evaluate the association between hypnotisability and COMT in the context of a two-SNP haplotype analysis, considering not only the Val158Met polymorphism, but also the closely located rs4818 SNP. An Italian sample of 53 highs, 49 low hypnotizable subjects (lows and 57 controls, were genotyped for a segment of 805 bp of the COMT gene, including Val158Met and the closely located rs4818 SNP. Our selective genotyping approach had 97.1% power to detect the previously reported strongest association at the significance level of 5%. We found no evidence of association at the SNP, haplotype and diplotype levels. Thus, our results challenge the dopamine-based theory of hypnosis and indirectly support recent neuropsychological and neurophysiological findings reporting the lack of any association between hypnotisability and focused attention abilities.

  6. Structural biology of human H3K9 methyltransferases.

    Directory of Open Access Journals (Sweden)

    Hong Wu

    Full Text Available UNLABELLED: SET domain methyltransferases deposit methyl marks on specific histone tail lysine residues and play a major role in epigenetic regulation of gene transcription. We solved the structures of the catalytic domains of GLP, G9a, Suv39H2 and PRDM2, four of the eight known human H3K9 methyltransferases in their apo conformation or in complex with the methyl donating cofactor, and peptide substrates. We analyzed the structural determinants for methylation state specificity, and designed a G9a mutant able to tri-methylate H3K9. We show that the I-SET domain acts as a rigid docking platform, while induced-fit of the Post-SET domain is necessary to achieve a catalytically competent conformation. We also propose a model where long-range electrostatics bring enzyme and histone substrate together, while the presence of an arginine upstream of the target lysine is critical for binding and specificity. ENHANCED VERSION: This article can also be viewed as an enhanced version in which the text of the article is integrated with interactive 3D representations and animated transitions. Please note that a web plugin is required to access this enhanced functionality. Instructions for the installation and use of the web plugin are available in Text S1.

  7. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Science.gov (United States)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  8. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    Science.gov (United States)

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A

    2013-11-18

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  9. Detection of two Bartonella tamiae-like sequences in Amblyomma americanum (Acari: Ixodidae) using 16S-23S intergenic spacer region-specific primers.

    Science.gov (United States)

    Billeter, Sarah A; Miller, Melissa K; Breitschwerdt, Edward B; Levy, Michael G

    2008-01-01

    Four hundred and sixty-six questing Amblyomma americanum (L.) (Acari: Ixodidae) from Carolina County, VA, and 98 questing A. americanum from Chatham County, NC, were screened by polymerase chain reaction (PCR) for the Bartonella 16S-23S intergenic spacer region. Two amplicons, approximately 270-280 bp, were detected in two ticks from Virginia. Based upon PCR and sequencing, an adult male and adult female tick harbored DNA sequences closely related to Bartonella tamiae (DQ395180). Bartonella DNA was not detected in A. americanum from North Carolina. Potential transmission of Bartonella spp. by A. americanum should be the focus of future experimental studies.

  10. RNA methyltransferase NSUN2 promotes stress-induced HUVEC senescence.

    Science.gov (United States)

    Cai, Xiaoyu; Hu, Yuanyuan; Tang, Hao; Hu, Han; Pang, Lijun; Xing, Junyue; Liu, Zhenyun; Luo, Yuhong; Jiang, Bin; Liu, Te; Gorospe, Myriam; Chen, Chuan; Wang, Wengong

    2016-04-12

    The tRNA methyltransferase NSUN2 delays replicative senescence by regulating the translation of CDK1 and CDKN1B mRNAs. However, whether NSUN2 influences premature cellular senescence remains untested. Here we show that NSUN2 methylates SHC mRNA in vitro and in cells, thereby enhancing the translation of the three SHC proteins, p66SHC, p52SHC, and p46SHC. Our results further show that the elevation of SHC expression by NSUN2-mediated mRNA methylation increased the levels of ROS, activated p38MAPK, thereby accelerating oxidative stress- and high-glucose-induced senescence of human vascular endothelial cells (HUVEC). Our findings highlight the critical impact of NSUN2-mediated mRNA methylation in promoting premature senescence.

  11. Cell and molecular biology of DNA methyltransferase 1.

    Science.gov (United States)

    Mohan, K Naga; Chaillet, J Richard

    2013-01-01

    The DNA cytosine methyltransferase 1 (DNMT1) is a ubiquitous nuclear enzyme that catalyzes the well-established reaction of placing methyl groups on the unmethylated cytosines in methyl-CpG:CpG base pairs in the hemimethylated DNA formed by methylated parent and unmethylated daughter strands. This activity regenerates fully methylated methyl-CpG:methyl-CpG pairs. Despite the straightforward nature of its catalytic activity, detailed biochemical, genetic, and developmental studies revealed intricate details of the central regulatory role of DNMT1 in governing the epigenetic makeup of the nuclear genome. DNMT1 mediates demethylation and also participates in seemingly wide cellular functions unrelated to maintenance DNA methylation. This review brings together mechanistic details of maintenance methylation by DNMT1, its regulation at transcriptional and posttranscriptional levels, and the seemingly unexpected functions of DNMT1 in the context of DNA methylation which is central to epigenetic changes that occur during development and the process of cell differentiation.

  12. Development of fluorescent methods for DNA methyltransferase assay

    Science.gov (United States)

    Li, Yueying; Zou, Xiaoran; Ma, Fei; Tang, Bo; Zhang, Chun-yang

    2017-03-01

    DNA methylation modified by DNA methyltransferase (MTase) plays an important role in regulating gene transcription, cell growth and proliferation. The aberrant DNA MTase activity may lead to a variety of human diseases including cancers. Therefore, accurate and sensitive detection of DNA MTase activity is crucial to biomedical research, clinical diagnostics and therapy. However, conventional DNA MTase assays often suffer from labor-intensive operations and time-consuming procedures. Alternatively, fluorescent methods have significant advantages of simplicity and high sensitivity, and have been widely applied for DNA MTase assay. In this review, we summarize the recent advances in the development of fluorescent methods for DNA MTase assay. These emerging methods include amplification-free and the amplification-assisted assays. Moreover, we discuss the challenges and future directions of this area.

  13. Characterization of phosphoethanolamine-N-methyltransferases in green algae.

    Science.gov (United States)

    Hirashima, Takashi; Toyoshima, Masakazu; Moriyama, Takashi; Nakamura, Yuki; Sato, Naoki

    2017-06-17

    Phosphatidylcholine (PtdCho) is a common and abundant phospholipid in most eukaryotic organisms. Although it has been known that the model green alga Chlamydomonas reinhardtii lacks PtdCho, we recently detected PtdCho in four Chlamydomonas species. Homology search of draft genomic sequences of the four PtdCho-containing algae suggested existence of phosphoethanolamine-N-methyltransferase (PEAMT) in C. applanata and C. asymmetrica, which is the key enzyme in PtdCho biosynthesis in land plants. Here we analyzed the putative genes encoding PEAMT in C. applanata and C. asymmetrica, named CapPEAMT and CasPEAMT, respectively. In vitro assays with recombinant CapPEAMT and CasPEAMT indicated that they have the methylation activity for phosphoethanolamine, but not the methylation activity for phosphomonomethylethanolamine, in contrast with land plant PEAMTs, that possess the three successive methylation activities. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Clinical utility of thiopurine S-methyltransferase genotyping.

    Science.gov (United States)

    Corominas, Hèctor; Baiget, Montserrat

    2004-01-01

    Thiopurine S-methyltransferase (TPMT) is a cytosolic enzyme that plays a major role in the metabolism of thiopurine drugs such as mercaptopurine and azathioprine. The interindividual differences in response to thiopurine administration is in part due to the presence of genetic polymorphisms in the gene that regulates TPMT activity. TPMT genotype correlates well with the in vivo enzyme activity within erythrocytes. Patients with genetically determined decreased TPMT activity develop severe myelosuppression when treated with standard doses of thiopurine drugs because an excess of thioguanine nucleotides accumulates in hematopoietic tissues. TPMT genotyping provides clinicians with a reliable method for identifying TPMT-deficient patients who can benefit from low doses of thiopurine drugs in order to reduce the risk of developing adverse effects. Moreover, the administration of higher doses of the drug could improve therapeutic response in patients in whom the TPMT genotyping demonstrates the absence of mutated alleles.

  15. Cloning, Sequencing and Analysis of the 16S-23S rDNA Intergenic Spacers (IGSs) of Two Strains of Vibrio vulnificus%2株创伤弧菌的16S-23S rDNA间区的克隆、测序及分析

    Institute of Scientific and Technical Information of China (English)

    邓先余; 陈晓艳; 王智学; 欧普; 何建国

    2006-01-01

    根据细菌的16S rDNA 3'端和23S rDNA 5'端的高度保守区设计引物,PCR扩增了2株创伤弧菌(Vibrio vulnificus)的16S-23S rDNA间区(Intergenic spacer,IGS),克隆到pGEM-T载体上,测序.用BLAST和DNAstar软件对16S-23SrDNA间区序列及其内的tRNA基因进行比较分析.结果表明,2株创伤弧菌共测出9条16S-23S rDNA间区序列,其中ZSU006测出5条,间区类型分别为:IGSGLAV、IGSGLV、IGSIA、IGSA和IGSG.其中IGSGLAV最大,包含tRNAGlu、tRNALys、tRNAAla和tRNAVal基因;IGSGLV包含tRNAGlu、tRNALys和tRNAVal基因;IGSIn,则包含tRNAIle和tRNAAla基因;IGSG仅包含tRNAGlu基因;而IGSA仅包含tRNAAla基因.菌株CG021测出的16S-23S rDNAIGS序列有4条,除缺少IGSA外,其余的IGS类型均与ZSU006的相同.与GenBank内的创伤弧菌ATCC27562的IGS序列比较,发现创伤弧菌所有类型的IGS的tRNA基因两端的非编码区具有较高的种内同源性.16S-23S rDNA间区结构的差异为建立一种新的创伤弧菌检测方法奠定了基础.%According to the conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs, PCR primers were designed, and the 16S-23S rDNA intergenic spacers (IGSs) of two strains of Vibrio vulnificus were amplified by PCR and cloned into pGEM-T vector. Different clones were selected to be sequenced and the sequences were analyzed with BLAST and the software DNAstar. Analyses of the IGS sequences suggested that the strain ZSU006 contains five types of polymorphic16S-23S rDNA intergenic spacers, namely, IGSGLAV, IGSGLv, IGSIA, IGSG and IGSA; while the strain CG021 has the same types of IGSs except lacking IGSA. Among these five IGS types, IGSGLAV is the biggest type, including the gene cluster of tRNAGlu - tRNALys - tRNAAla - tRNAVal; IGSGLV includes that of tRNAGlu-tRNALys-tRNAVal; IGSAG, tRNAAla-tRNAGlu; IGSIA, tRNAIle -tRNAAla; IGSG, tRNAGlu and IGSA, tRNAAla. Intraspecies multiple alignment of all the IGS sequences of these two strains with those of V

  16. Molecular analysis of the 16S-23S rDNA internal spacer region (ISR) and truncated tRNA(Ala) gene segments in Campylobacter lari.

    Science.gov (United States)

    Hayashi, K; Tazumi, A; Nakanishi, S; Nakajima, T; Matsubara, K; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

    2012-06-01

    Following PCR amplification and sequencing, nucleotide sequence alignment analyses demonstrated the presence of two kinds of 16S-23S rDNA internal spacer regions (ISRs), namely, long length ISRs of 837-844 base pair (bp) [n = six for urease-negative (UN) Campylobacter lari isolates, UN C. lari JCM2530(T), RM2100, 176, 293, 299 and 448] and short length ISRs of 679-725 bp [n = six for UN C. lari: n = 14 for urease-positive thermophilic Campylobacter (UPTC) isolates]. The analyses also indicated that the short length ISRs mainly lacked the 156 bp sequence from the nucleotide positions 122-277 bp in long length ISRs for UN C. lari JCM2530(T). The 156 bp sequences shared 94.9-96.8 % sequence similarity among six isolates. Surprisingly, atypical tRNA(Ala) gene segment (5' end 35 bp), which was extremely truncated, occurred within the 156 bp sequences in the long length ISRs, as an unexpected tRNA(Ala) pseudogene. An order of the intercistronic tRNA genes within the short nucleotide spacer of 5'-16S rDNA-tRNA(Ala)-tRNA(Ile)-23S rDNA-3' occurred in all the C. lari isolates examined.

  17. Betaine-homocysteine methyltransferase (BHMT) : genomic sequencing and relevance to hyperhomocysteinemia and vascular disease in humans

    NARCIS (Netherlands)

    Heil, S.G.; Lievers, K.J.A.; Boers, G.H.; Verhoef, P.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.

    2000-01-01

    Elevated homocysteine levels have been associated with arteriosclerosis and thrombosis. Hyperhomocysteinemia is caused by altered functioning of enzymes of its metabolism due to either inherited or acquired factors. Betaine-homocysteine methyltransferase (BHMT) serves, next to methionine synthase, a

  18. Successful treatment of a guanidinoacetate methyltransferase deficient patient : Findings with relevance to treatment strategy and pathophysiology

    NARCIS (Netherlands)

    Verbruggen, Krijn T.; Sijens, Paul E.; Schulze, Andreas; Lunsing, Roelineke J.; Jakobs, Cornelis; Salomons, Gajja S.; van Spronsen, Francian J.

    2007-01-01

    Biochemical and developmental results of treatment of a guanidinoacetate methyltransferase (GAMT) deficient patient with a mild clinical presentation and remarkable developmental improvement after treatment are presented. Treatment with creatine (Cr) supplementation resulted in partial normalization

  19. An audit of thiopurine methyltransferase genotyping and phenotyping before intended azathioprine treatment for dermatological conditions

    DEFF Research Database (Denmark)

    Vestergaard, T; Bygum, A

    2009-01-01

    Summary Background. Determining thiopurine methyltransferase (TPMT) genotype and phenotype before azathioprine treatment predicts which patients are most likely to develop myelosuppression. Aim. To evaluate the course of azathioprine treatment in people with TPMT heterozygosity and whether this d...

  20. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    Science.gov (United States)

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Crystal structure of dengue virus methyltransferase without S-adenosyl-L-methionine.

    Science.gov (United States)

    Noble, Christian G; Li, Shi-Hua; Dong, Hongping; Chew, Sock Hui; Shi, Pei-Yong

    2014-11-01

    Flavivirus methyltransferase is a genetically-validated antiviral target. Crystal structures of almost all available flavivirus methyltransferases contain S-adenosyl-L-methionine (SAM), the methyl donor molecule that co-purifies with the enzymes. This raises a possibility that SAM is an integral structural component required for the folding of dengue virus (DENV) methyltransferase. Here we exclude this possibility by solving the crystal structure of DENV methyltransferase without SAM. The SAM ligand was removed from the enzyme through a urea-mediated denaturation-and-renaturation protocol. The crystal structure of the SAM-depleted enzyme exhibits a vacant SAM-binding pocket, with a conformation identical to that of the SAM-enzyme co-crystal structure. Functionally, equivalent enzymatic activities (N-7 methylation, 2'-O methylation, and GMP-enzyme complex formation) were detected for the SAM-depleted and SAM-containing recombinant proteins. These results clearly indicate that the SAM molecule is not an essential component for the correct folding of DENV methyltransferase. Furthermore, the results imply a potential antiviral approach to search for inhibitors that can bind to the SAM-binding pocket and compete against SAM binding. To demonstrate this potential, we have soaked crystals of DENV methyltransferase without a bound SAM with the natural product Sinefungin and show that preformed crystals are capable of binding ligands in this pocket.

  2. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation.

  3. A cfr-Like Gene from Clostridium difficile Confers Multiple Antibiotic Resistance by the Same Mechanism as the cfr Gene

    DEFF Research Database (Denmark)

    Hansen, Lykke H; Vester, Birte

    2015-01-01

    The Cfr RNA methyltransferase causes multiple resistances to peptidyl transferase inhibitors by methylation of A2503 23S rRNA. Many cfr-like gene sequences in the databases code for unknown functions. This study confirms that a Cfr-like protein from a Peptoclostridium difficile (formerly Clostrid......The Cfr RNA methyltransferase causes multiple resistances to peptidyl transferase inhibitors by methylation of A2503 23S rRNA. Many cfr-like gene sequences in the databases code for unknown functions. This study confirms that a Cfr-like protein from a Peptoclostridium difficile (formerly...... Clostridium difficile) strain does function as a Cfr protein. The enzyme is expressed in Escherichia coli and shows elevated MICs for five classes of antibiotics. A primer extension stop indicates a modification at A2503 in 23S rRNA....

  4. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  5. Identification of clinically relevant nonhemolytic Streptococci on the basis of sequence analysis of 16S-23S intergenic spacer region and partial gdh gene

    DEFF Research Database (Denmark)

    Nielsen, Xiaohui Chen; Justesen, Ulrik Stenz; Dargis, Rimtas;

    2009-01-01

    Nonhemolytic streptococci (NHS) cause serious infections, such as endocarditis and septicemia. Many conventional phenotypic methods are insufficient for the identification of bacteria in this group to the species level. Genetic analysis has revealed that single-gene analysis is insufficient...... for the identification of all species in this group of bacteria. The aim of the present study was to establish a method based on sequence analysis of the 16S-23S intergenic spacer (ITS) region and the partial gdh gene to identify clinical relevant NHS to the species level. Sequence analysis of the ITS region....... A phylogenetic algorithm based on the analysis of partial gdh gene sequences revealed three distinct clusters. We suggest that sequence analysis of the combination of the ITS region and the partial gdh gene can be used in the reference laboratory for the species-level identification of NHS....

  6. Parity nonconservation effect with laser-induced 2^3S_1 - 2^1S_0 transition in heavy heliumlike ions

    CERN Document Server

    Shabaev, V M; Kozhuharov, C; Plunien, G; Stöhlker, Th

    2010-01-01

    The parity nonconservation (PNC) effect on the laser-induced 2^3S_1 - 2^1S_0 transition in heavy heliumlike ions is considered. A simple analytical formula for the PNC correction to the cross section is derived for the case, when the opposite-parity 2^1S_0 and 2^3P_0 states are almost degenerate and, therefore, the PNC effect is strongly enhanced. Numerical results are presented for heliumlike gadolinium and thorium, which seem most promising candidates for such kind of experiments. In both Gd and Th cases the photon energy required will be anticipated with a high-energy laser built at GSI. Alternatively, it can be gained with ultraviolet lasers utilizing relativistic Doppler tuning at FAIR facilities in Darmstadt.

  7. An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Yih-Horng Shiao

    Full Text Available BACKGROUND: Ribosomal RNA (rRNA is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. METHODOLOGY/PRINCIPAL FINDINGS: Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1 and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014. During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014. Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. CONCLUSIONS/SIGNIFICANCE: The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

  8. Euchromatin histone methyltransferase 1 regulates cortical neuronal network development

    Science.gov (United States)

    Bart Martens, Marijn; Frega, Monica; Classen, Jessica; Epping, Lisa; Bijvank, Elske; Benevento, Marco; van Bokhoven, Hans; Tiesinga, Paul; Schubert, Dirk; Nadif Kasri, Nael

    2016-01-01

    Heterozygous mutations or deletions in the human Euchromatin histone methyltransferase 1 (EHMT1) gene cause Kleefstra syndrome, a neurodevelopmental disorder that is characterized by autistic-like features and severe intellectual disability (ID). Neurodevelopmental disorders including ID and autism may be related to deficits in activity-dependent wiring of brain circuits during development. Although Kleefstra syndrome has been associated with dendritic and synaptic defects in mice and Drosophila, little is known about the role of EHMT1 in the development of cortical neuronal networks. Here we used micro-electrode arrays and whole-cell patch-clamp recordings to investigate the impact of EHMT1 deficiency at the network and single cell level. We show that EHMT1 deficiency impaired neural network activity during the transition from uncorrelated background action potential firing to synchronized network bursting. Spontaneous bursting and excitatory synaptic currents were transiently reduced, whereas miniature excitatory postsynaptic currents were not affected. Finally, we show that loss of function of EHMT1 ultimately resulted in less regular network bursting patterns later in development. These data suggest that the developmental impairments observed in EHMT1-deficient networks may result in a temporal misalignment between activity-dependent developmental processes thereby contributing to the pathophysiology of Kleefstra syndrome. PMID:27767173

  9. The Role of Protein Arginine Methyltransferases in Inflammatory Responses

    Directory of Open Access Journals (Sweden)

    Ji Hye Kim

    2016-01-01

    Full Text Available Protein arginine methyltransferases (PRMTs mediate the methylation of a number of protein substrates of arginine residues and serve critical functions in many cellular responses, including cancer development, progression, and aggressiveness, T-lymphocyte activation, and hepatic gluconeogenesis. There are nine members of the PRMT family, which are divided into 4 types (types I–IV. Although most PRMTs do not require posttranslational modification (PTM to be activated, fine-tuning modifications, such as interactions between cofactor proteins, subcellular compartmentalization, and regulation of RNA, via micro-RNAs, seem to be required. Inflammation is an essential defense reaction of the body to eliminate harmful stimuli, including damaged cells, irritants, or pathogens. However, chronic inflammation can eventually cause several types of diseases, including some cancers, atherosclerosis, rheumatoid arthritis, and periodontitis. Therefore, inflammation responses should be well modulated. In this review, we briefly discuss the role of PRMTs in the control of inflammation. More specifically, we review the roles of four PRMTs (CARM1, PRMT1, PRMT5, and PRMT6 in modulating inflammation responses, particularly in terms of modulating the transcriptional factors or cofactors related to inflammation. Based on the regulatory roles known so far, we propose that PRMTs should be considered one of the target molecule groups that modulate inflammatory responses.

  10. Methyltransferase and demethylase profiling studies during brown adipocyte differentiation.

    Science.gov (United States)

    Son, Min Jeong; Kim, Won Kon; Oh, Kyoung-Jin; Park, Anna; Lee, Da Som; Han, Baek Soo; Lee, Sang Chul; Bae, Kwang-Hee

    2016-07-01

    Although brown adipose tissue is important with regard to energy balance, the molecular mechanism of brown adipocyte differentiation has not been extensively studied. Specifically, regulation factors at the level of protein modification are largely unknown. In this study, we examine the changes in the expression level of enzymes which are involved in protein lysine methylation during brown adipocyte differentiation. Several enzymes, in this case SUV420H2, PRDM9, MLL3 and JHDM1D, were found to be up-regulated. On the other hand, Set7/9 was significantly down-regulated. In the case of SUV420H2, the expression level increased sharply during brown adipocyte differentiation, whereas the expression of SUV420H2 was marginally enhanced during the white adipocyte differentiation. The knock-down of SUV420H2 caused the suppression of brown adipocyte differentiation, as compared to a scrambled control. These results suggest that SUV420H2, a methyltransferase, is involved in brown adipocyte differentiation, and that the methylation of protein lysine is important in brown adipocyte differentiation. [BMB Reports 2016; 49(7): 388-393].

  11. Isoprenyl carboxyl methyltransferase inhibitors: a brief review including recent patents.

    Science.gov (United States)

    Yang, Woo Seok; Yeo, Seung-Gu; Yang, Sungjae; Kim, Kyung-Hee; Yoo, Byong Chul; Cho, Jae Youl

    2017-06-19

    Among the enzymes involved in the post-translational modification of Ras, isoprenyl carboxyl methyltransferase (ICMT) has been explored by a number of researchers as a significant enzyme controlling the activation of Ras. Indeed, inhibition of ICMT exhibited promising anti-cancer activity against various cancer cell lines. This paper reviews patents and research articles published between 2009 and 2016 that reported inhibitors of ICMT as potential chemotherapeutic agents targeting Ras-induced growth factor signaling. Since ICMT inhibitors can modulate Ras signaling pathway, it might be possible to develop a new class of anti-cancer drugs targeting Ras-related cancers. Researchers have discovered indole-based small-molecular ICMT inhibitors through high-throughput screening. Researchers at Duke University identified a prototypical inhibitor, cysmethynil. At Singapore University, Ramanujulu and his colleagues patented more potent compounds by optimizing cysmethynil. In addition, Rodriguez and Stevenson at Universidad Complutense De Madrid and Cancer Therapeutics CRC PTY Ltd., respectively, have developed inhibitors based on formulas other than the indole base. However, further optimization of chemicals targeted to functional groups is needed to improve the characteristics of ICMT inhibitors related to their application as drugs, such as solubility, effectiveness, and safety, to facilitate clinical use.

  12. DNA Electrochemistry Shows DNMT1 Methyltransferase Hyperactivity in Colorectal Tumors.

    Science.gov (United States)

    Furst, Ariel L; Barton, Jacqueline K

    2015-07-23

    DNMT1, the most abundant human methyltransferase, is responsible for translating the correct methylation pattern during DNA replication, and aberrant methylation by DNMT1 has been linked to tumorigenesis. We have developed a sensitive signal-on electrochemical assay for the measurement of DNMT1 activity in crude tissue lysates. We have further analyzed ten tumor sets and have found a direct correlation between DNMT1 hyperactivity and tumorous tissue. In the majority of samples analyzed, the tumorous tissue has significantly higher DNMT1 activity than the healthy adjacent tissue. No such correlation is observed in measurements of DNMT1 expression by qPCR, DNMT1 protein abundance by western blotting, or DNMT1 activity using a radiometric DNA labeling assay. DNMT1 hyperactivity can result from both protein overexpression and enzyme hyperactivity. DNMT1 activity measured electrochemically provides a direct measure of activity in cell lysates and, as a result, provides a sensitive and early indication of cancerous transformation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Hypnotizability and Catechol-O-Methyltransferase (COMT) polymorphysms in Italians

    Science.gov (United States)

    Presciuttini, Silvano; Gialluisi, Alessandro; Barbuti, Serena; Curcio, Michele; Scatena, Fabrizio; Carli, Giancarlo; Santarcangelo, Enrica L.

    2014-01-01

    Higher brain dopamine content depending on lower activity of Catechol-O-Methyltransferase (COMT) in subjects with high hypnotizability scores (highs) has been considered responsible for their attentional characteristics. However, the results of the previous genetic studies on association between hypnotizability and the COMT single nucleotide polymorphism (SNP) rs4680 (Val158Met) were inconsistent. Here, we used a selective genotyping approach to re-evaluate the association between hypnotizability and COMT in the context of a two-SNP haplotype analysis, considering not only the Val158Met polymorphism, but also the closely located rs4818 SNP. An Italian sample of 53 highs, 49 low hypnotizable subjects (lows), and 57 controls, were genotyped for a segment of 805 bp of the COMT gene, including Val158Met and the closely located rs4818 SNP. Our selective genotyping approach had 97.1% power to detect the previously reported strongest association at the significance level of 5%. We found no evidence of association at the SNP, haplotype, and diplotype levels. Thus, our results challenge the dopamine-based theory of hypnosis and indirectly support recent neuropsychological and neurophysiological findings reporting the lack of any association between hypnotizability and focused attention abilities. PMID:24431998

  14. Theoretical insights into catalytic mechanism of protein arginine methyltransferase 1.

    Directory of Open Access Journals (Sweden)

    Ruihan Zhang

    Full Text Available Protein arginine methyltransferase 1 (PRMT1, the major arginine asymmetric dimethylation enzyme in mammals, is emerging as a potential drug target for cancer and cardiovascular disease. Understanding the catalytic mechanism of PRMT1 will facilitate inhibitor design. However, detailed mechanisms of the methyl transfer process and substrate deprotonation of PRMT1 remain unclear. In this study, we present a theoretical study on PRMT1 catalyzed arginine dimethylation by employing molecular dynamics (MD simulation and quantum mechanics/molecular mechanics (QM/MM calculation. Ternary complex models, composed of PRMT1, peptide substrate, and S-adenosyl-methionine (AdoMet as cofactor, were constructed and verified by 30-ns MD simulation. The snapshots selected from the MD trajectory were applied for the QM/MM calculation. The typical SN2-favored transition states of the first and second methyl transfers were identified from the potential energy profile. Deprotonation of substrate arginine occurs immediately after methyl transfer, and the carboxylate group of E144 acts as proton acceptor. Furthermore, natural bond orbital analysis and electrostatic potential calculation showed that E144 facilitates the charge redistribution during the reaction and reduces the energy barrier. In this study, we propose the detailed mechanism of PRMT1-catalyzed asymmetric dimethylation, which increases insight on the small-molecule effectors design, and enables further investigations into the physiological function of this family.

  15. Analysis of Free Energy Signals Arising from Nucleotide Hybridization Between rRNA and mRNA Sequences during Translation in Eubacteria

    Directory of Open Access Journals (Sweden)

    Stomp Anne-Marie

    2006-01-01

    Full Text Available A decoding algorithm is tested that mechanistically models the progressive alignments that arise as the mRNA moves past the rRNA tail during translation elongation. Each of these alignments provides an opportunity for hybridization between the single-stranded, -terminal nucleotides of the 16S rRNA and the spatially accessible window of mRNA sequence, from which a free energy value can be calculated. Using this algorithm we show that a periodic, energetic pattern of frequency 1/3 is revealed. This periodic signal exists in the majority of coding regions of eubacterial genes, but not in the non-coding regions encoding the 16S and 23S rRNAs. Signal analysis reveals that the population of coding regions of each bacterial species has a mean phase that is correlated in a statistically significant way with species ( content. These results suggest that the periodic signal could function as a synchronization signal for the maintenance of reading frame and that codon usage provides a mechanism for manipulation of signal phase.

  16. Analysis of Free Energy Signals Arising from Nucleotide Hybridization Between rRNA and mRNA Sequences during Translation in Eubacteria

    Directory of Open Access Journals (Sweden)

    Mladen A. Vouk

    2006-11-01

    Full Text Available A decoding algorithm is tested that mechanistically models the progressive alignments that arise as the mRNA moves past the rRNA tail during translation elongation. Each of these alignments provides an opportunity for hybridization between the single-stranded, 3′-terminal nucleotides of the 16S rRNA and the spatially accessible window of mRNA sequence, from which a free energy value can be calculated. Using this algorithm we show that a periodic, energetic pattern of frequency 1/3 is revealed. This periodic signal exists in the majority of coding regions of eubacterial genes, but not in the non-coding regions encoding the 16S and 23S rRNAs. Signal analysis reveals that the population of coding regions of each bacterial species has a mean phase that is correlated in a statistically significant way with species (G + C content. These results suggest that the periodic signal could function as a synchronization signal for the maintenance of reading frame and that codon usage provides a mechanism for manipulation of signal phase.

  17. Catechol-O-methyltransferase gene polymorphism and vulvar pain in women with vulvodynia.

    Science.gov (United States)

    Patanwala, Insiyyah Y; Lamvu, Georgine; Ledger, William J; Witzeman, Kathryn; Marvel, Richard; Rapkin, Andrea; Bongiovanni, Ann Marie; Feranec, Jessica; Witkin, Steven S

    2017-04-01

    The underlying causes of vulvar pain in women with vulvodynia remain poorly understood. Catechol-O-methyltransferase, an enzyme that metabolizes catecholamines, is a neuromodulator that is involved with perception and sensitivity to pain. The catechol-O-methyltransferase gene is polymorphic, and a single nucleotide polymorphism is associated with low activity and heightened pain sensitivity. The variant allele that encodes this polymorphism commonly is called the "L allele" because of its low enzyme activity as opposed to the normal H (high activity) allele. The methionine-containing catechol-O-methyltransferase protein coded by the L allele results in elevated catecholamine levels, reduced inactivation of the dopaminergic and adrenergic systems, and increased sensitivity to pain. This polymorphism not only may decrease the pain threshold in response to acute pain but also may facilitate the development of chronic pain. Therefore, the objective of our study was to assess whether a variation in the catechol-O-methyltransferase genotype is involved in increased pain sensitivity in women with vulvodynia. We conducted a prospective cohort study. Buccal swabs were collected from 167 white women with vulvodynia and 107 control subjects; the DNA was tested for a single nucleotide polymorphism at position 158 (rs4680) in the catechol-O-methyltransferase gene. Women with vulvodynia had a marginally increased, yet not significant, prevalence of the catechol-O-methyltransferase genotype that is associated with high activity of the coded protein: 32.9% in the women with vulvodynia, as opposed to 21.5% in the control subjects (odds ratio, 1.80; 95% confidence interval, 1.02-3.15). Subgrouping the cases based on pain frequency revealed that the elevated occurrence of this catechol-O-methyltransferase genotype was present in 40.6% of the subset of women who experienced pain only with sexual intercourse vs only 21.5% of control subjects (odds ratio, 2.50; 95% confidence interval

  18. Properties of human O/sup 6/-methylguanine-DNA methyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharyya, D.; Boulden, A.M.; Foote, R.S.; Mitra, S.

    1987-05-01

    The premutagenic base, O/sup 6/-methylguanine, is repaired in the DNA of both bacterial and mammalian cells by stoichiometric transfer of the methyl group to a protein cysteine residue. The human O/sup 6/-methylguanine-DNA methyltransferase has been extensively purified from placenta and partially characterized with respect to reaction kinetics, pH and temperature dependencies, and the effects of salt, metal ions, and DNA concentration. The methyl-transfer reaction has apparent second-order kinetics and an energy of activation, calculated from temperature-dependence studies, of approximately 18 kcal. The reaction rate is optimal at a pH of about 8.5. Chromatofocusing experiments indicate a pI of 6.2 for the methyltransferase. Like the E. coli and rodent methyltransferases, the human protein has no cofactor requirements. The reaction is significantly inhibited by physiological concentrations of NaCl. Both single- and double-stranded DNA also inhibit the reaction, presumably by nonspecific binding of the protein. Changes in the human methyltransferase due to its reaction with O/sup 6/-methylguanine were examined by chromatofocusing and binding to DNA-cellulose. The results were compared with those obtained in parallel experiments using purified methyltransferase from E. coli.

  19. Weaver Syndrome‐Associated EZH2 Protein Variants Show Impaired Histone Methyltransferase Function In Vitro

    Science.gov (United States)

    Yap, Damian B.; Lewis, M.E. Suzanne; Chijiwa, Chieko; Ramos‐Arroyo, Maria A.; Tkachenko, Natália; Milano, Valentina; Fradin, Mélanie; McKinnon, Margaret L.; Townsend, Katelin N.; Xu, Jieqing; Van Allen, M.I.; Ross, Colin J.D.; Dobyns, William B.; Weaver, David D.; Gibson, William T.

    2016-01-01

    ABSTRACT Weaver syndrome (WS) is a rare congenital disorder characterized by generalized overgrowth, macrocephaly, specific facial features, accelerated bone age, intellectual disability, and susceptibility to cancers. De novo mutations in the enhancer of zeste homolog 2 (EZH2) have been shown to cause WS. EZH2 is a histone methyltransferase that acts as the catalytic agent of the polycomb‐repressive complex 2 (PRC2) to maintain gene repression via methylation of lysine 27 on histone H3 (H3K27). Functional studies investigating histone methyltransferase activity of mutant EZH2 from various cancers have been reported, whereas WS‐associated mutations remain poorly characterized. To investigate the role of EZH2 in WS, we performed functional studies using artificially assembled PRC2 complexes containing mutagenized human EZH2 that reflected the codon changes predicted from patients with WS. We found that WS‐associated amino acid alterations reduce the histone methyltransferase function of EZH2 in this in vitro assay. Our results support the hypothesis that WS is caused by constitutional mutations in EZH2 that alter the histone methyltransferase function of PRC2. However, histone methyltransferase activities of different EZH2 variants do not appear to correlate directly with the phenotypic variability between WS patients and individuals with a common c.553G>C (p.Asp185His) polymorphism in EZH2. PMID:26694085

  20. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... to the presence of filamentous microorganisms was monitored weekly over 4 months. Microthrix was identified as a causative filament and suitable control measures were introduced. The level of Microthrix was reduced after 1-2 months but a number of other filamentous species were still present, with most of them...

  1. Changes in Bacillus Spore Small Molecules, rRNA, Germination, and Outgrowth after Extended Sublethal Exposure to Various Temperatures: Evidence that Protein Synthesis Is Not Essential for Spore Germination.

    Science.gov (United States)

    Korza, George; Setlow, Barbara; Rao, Lei; Li, Qiao; Setlow, Peter

    2016-12-15

    rRNAs of dormant spores of Bacillus subtilis were >95% degraded during extended incubation at 50°C, as reported previously (E. Segev, Y. Smith, and S. Ben-Yehuda, Cell 148:139-114, 2012, doi:http://dx.doi.org/10.1016/j.cell.2011.11.059), and this was also true of spores of Bacillus megaterium Incubation of spores of these two species for ∼20 h at 75 to 80°C also resulted in the degradation of all or the great majority of the 23S and 16S rRNAs, although this rRNA degradation was slower than nonenzymatic hydrolysis of purified rRNAs at these temperatures. This rRNA degradation at high temperature generated almost exclusively oligonucleotides with minimal levels of mononucleotides. RNase Y, suggested to be involved in rRNA hydrolysis during B. subtilis spore incubation at 50°C, did not play a role in B. subtilis spore rRNA breakdown at 80°C. Twenty hours of incubation of Bacillus spores at 70°C also decreased the already minimal levels of ATP in dormant spores 10- to 30-fold, to ≤0.01% of the total free adenine nucleotide levels. Spores depleted of rRNA were viable and germinated relatively normally, often even faster than starting spores. Their return to vegetative growth was also similar to that of untreated spores for B. megaterium spores and slower for heat-treated B. subtilis spores; accumulation of rRNA took place only after completion of spore germination. These findings thus strongly suggest that protein synthesis is not essential for Bacillus spore germination.IMPORTANCE A recent report (L. Sinai, A. Rosenberg, Y. Smith, E. Segev, and S. Ben-Yehuda, Mol Cell 57:3486-3495, 2015, doi:http://dx.doi.org/10.1016/j.molcel.2014.12.019) suggested that protein synthesis is essential for early steps in the germination of dormant spores of Bacillus subtilis If true, this would be a paradigm shift in our understanding of spore germination. We now show that essentially all of the rRNA can be eliminated from spores of Bacillus megaterium or B. subtilis, and these

  2. Mechanistic studies on transcriptional coactivator protein arginine methyltransferase 1.

    Science.gov (United States)

    Rust, Heather L; Zurita-Lopez, Cecilia I; Clarke, Steven; Thompson, Paul R

    2011-04-26

    Protein arginine methyltransferases (PRMTs) catalyze the transfer of methyl groups from S-adenosylmethionine (SAM) to the guanidinium group of arginine residues in a number of important cell signaling proteins. PRMT1 is the founding member of this family, and its activity appears to be dysregulated in heart disease and cancer. To begin to characterize the catalytic mechanism of this isozyme, we assessed the effects of mutating a number of highly conserved active site residues (i.e., Y39, R54, E100, E144, E153, M155, and H293), which are believed to play key roles in SAM recognition, substrate binding, and catalysis. The results of these studies, as well as pH-rate studies, and the determination of solvent isotope effects (SIEs) indicate that M155 plays a critical role in both SAM binding and the processivity of the reaction but is not responsible for the regiospecific formation of asymmetrically dimethylated arginine (ADMA). Additionally, mutagenesis studies on H293, combined with pH studies and the lack of a normal SIE, do not support a role for this residue as a general base. Furthermore, the lack of a normal SIE with either the wild type or catalytically impaired mutants suggests that general acid/base catalysis is not important for promoting methyl transfer. This result, combined with the fact that the E144A/E153A double mutant retains considerably more activity then the single mutants alone, suggests that the PRMT1-catalyzed reaction is primarily driven by bringing the substrate guanidinium into the proximity of the S-methyl group of SAM and that the prior deprotonation of the substrate guanidinium is not required for methyl transfer.

  3. O-Methyltransferases involved in biphenyl and dibenzofuran biosynthesis.

    Science.gov (United States)

    Khalil, Mohammed N A; Brandt, Wolfgang; Beuerle, Till; Reckwell, Dennis; Groeneveld, Josephine; Hänsch, Robert; Gaid, Mariam M; Liu, Benye; Beerhues, Ludger

    2015-07-01

    Biphenyls and dibenzofurans are the phytoalexins of the Malinae involving apple and pear. Biosynthesis of the defence compounds includes two O-methylation reactions. cDNAs encoding the O-methyltransferase (OMT) enzymes were isolated from rowan (Sorbus aucuparia) cell cultures after treatment with an elicitor preparation from the scab-causing fungus, Venturia inaequalis. The preferred substrate for SaOMT1 was 3,5-dihydroxybiphenyl, supplied by the first pathway-specific enzyme, biphenyl synthase (BIS). 3,5-Dihydroxybiphenyl underwent a single methylation reaction in the presence of S-adenosyl-l-methionine (SAM). The second enzyme, SaOMT2, exhibited its highest affinity for noraucuparin, however the turnover rate was greater with 5-hydroxyferulic acid. Both substrates were only methylated at the meta-positioned hydroxyl group. The substrate specificities of the OMTs and the regiospecificities of their reactions were rationalized by homology modeling and substrate docking. Interaction of the substrates with SAM also took place at a position other than the sulfur group. Expression of SaOMT1, SaOMT2 and SaBIS3 was transiently induced in rowan cell cultures by the addition of the fungal elicitor. While the immediate SaOMT1 products were not detectable in elicitor-treated cell cultures, noraucuparin and noreriobofuran accumulated transiently, followed by increasing levels of the SaOMT2 products aucuparin and eriobofuran. SaOMT1, SaOMT2 and SaBIS3 were N- and C-terminally fused with the super cyan fluorescent protein and a modified yellow fluorescent protein, respectively. All the fluorescent reporter fusions were localized to the cytoplasm of Nicotiana benthamiana leaf epidermis cells. A revised biosynthetic pathway of biphenyls and dibenzofurans in the Malinae is presented.

  4. The rRNA evolution and procaryotic phylogeny

    Science.gov (United States)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  5. The rRNA evolution and procaryotic phylogeny

    Science.gov (United States)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  6. Discovery of a Potent Class I Protein Arginine Methyltransferase Fragment Inhibitor.

    Science.gov (United States)

    Ferreira de Freitas, Renato; Eram, Mohammad S; Szewczyk, Magdalena M; Steuber, Holger; Smil, David; Wu, Hong; Li, Fengling; Senisterra, Guillermo; Dong, Aiping; Brown, Peter J; Hitchcock, Marion; Moosmayer, Dieter; Stegmann, Christian M; Egner, Ursula; Arrowsmith, Cheryl; Barsyte-Lovejoy, Dalia; Vedadi, Masoud; Schapira, Matthieu

    2016-02-11

    Protein methyltransferases (PMTs) are a promising target class in oncology and other disease areas. They are composed of SET domain methyltransferases and structurally unrelated Rossman-fold enzymes that include protein arginine methyltransferases (PRMTs). In the absence of a well-defined medicinal chemistry tool-kit focused on PMTs, most current inhibitors were identified by screening large and diverse libraries of leadlike molecules. So far, no successful fragment-based approach was reported against this target class. Here, by deconstructing potent PRMT inhibitors, we find that chemical moieties occupying the substrate arginine-binding site can act as efficient fragment inhibitors. Screening a fragment library against PRMT6 produced numerous hits, including a 300 nM inhibitor (ligand efficiency of 0.56) that decreased global histone 3 arginine 2 methylation in cells, and can serve as a warhead for the development of PRMT chemical probes.

  7. Virtual screening and biological characterization of novel histone arginine methyltransferase PRMT1 inhibitors.

    Science.gov (United States)

    Heinke, Ralf; Spannhoff, Astrid; Meier, Rene; Trojer, Patrick; Bauer, Ingo; Jung, Manfred; Sippl, Wolfgang

    2009-01-01

    Lysine and arginine methyltransferases participate in the posttranslational modification of histones and regulate key cellular functions. Protein arginine methyltransferase 1 (PRMT1) has been identified as an essential component of mixed lineage leukemia (MLL) oncogenic complexes, revealing its potential as a novel therapeutic target in human cancer. The first potent arginine methyltransferase inhibitors were recently discovered by random- and target-based screening approaches. Herein we report virtual and biological screening for novel inhibitors of PRMT1. Structure-based virtual screening (VS) of the Chembridge database composed of 328 000 molecules was performed with a combination of ligand- and target-based in silico approaches. Nine inhibitors were identified from the top-scored docking solutions; these were experimentally tested using human PRMT1 and an antibody-based assay with a time-resolved fluorescence readout. Among several aromatic amines, an aliphatic amine and an amide were also found to be active in the micromolar range.

  8. Restrição do 16S-23S DNAr intergênico para avaliação da diversidade de Azospirillum amazonense isolado de Brachiaria spp. Restriction of 16S-23S intergenic rDNA for diversity evaluation of Azospirillum amazonense isolated from different Brachiaria spp.

    Directory of Open Access Journals (Sweden)

    Fábio Bueno dos Reis Junior

    2006-03-01

    Full Text Available O objetivo deste trabalho foi avaliar a diversidade intra-específica de isolados de Azospirillum amazonense e estabelecer a possível influência de diferentes espécies de Brachiaria ssp. e diferentes condições edafoclimáticas. A caracterização da diversidade desses isolados foi conduzida, utilizando-se a análise de restrição da região intergênica 16S-23S DNAr. As estirpes estudadas separaram-se em dois grupos, definidos a 56% de similaridade. As espécies de Brachiaria ssp. influenciaram a diversidade de estirpes. A maioria dos isolados oriundos de B. decumbens e B. brizantha está inserida no primeiro grupo, enquanto os oriundos de B. humidicola concentram-se no segundo grupo.The aim of this work was to study the intra-specific diversity of Azospirillum amazonense isolates and to establish possible influences of different Brachiaria spp. and edaphoclimatic conditions. The characterization of the diversity among the isolates of A. amazonense studied was conducted using restriction analysis of the 16S-23S rDNA intergenic spacer region. The evaluated strains were separated in two groups, defined at 56% of similarity. Brachiaria spp. showed effects on strain diversity. Most part of the isolates from B. decumbens and B. brizantha are inserted in the first group, while B. humidicola isolates concentrate in the second group.

  9. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua (NCI)

    2012-03-26

    Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whether Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.

  10. Radiometric assay for phenylethanolamine N-methyltransferase and catechol O-methyltransferase in a single tissue sample: application to rat hypothalamic nuclei, pineal gland, and heart

    Energy Technology Data Exchange (ETDEWEB)

    Culman, J.; Torda, T.; Weise, V.K.

    1987-08-01

    A simple and highly sensitive method for simultaneous assay of phenylethanolamine N-methyltransferase (PNMT) and catechol O-methyltransferase (COMT) is described. These enzymes are determined in a single tissue homogenate using S-(methyl-/sup 3/H) adenosyl-L-methionine as methyl donor and sequentially incubating with the substrates phenylethanolamine and epinephrine. The radioactive products of the enzymatic reactions, N-methylphenylethanolamine and metanephrine, are extracted and then separated by thin-layer chromatography. The identity of the reaction products has been established chromatographically and the conditions for both enzymatic reactions in the assay procedure have been defined. Measurement of PNMT activity in the rat pineal gland or in minute fragments of other tissues (e.g., brain nuclei) has not been possible using previously described methods. Activities of PNMT and COMT in the rat pineal gland, various hypothalamic nuclei, and the auricular and ventricular myocardia are herein reported.

  11. Structural and evolutionary bioinformatics of the SPOUT superfamily of methyltransferases

    Directory of Open Access Journals (Sweden)

    Purta Elzbieta

    2007-03-01

    Full Text Available Abstract Background SPOUT methyltransferases (MTases are a large class of S-adenosyl-L-methionine-dependent enzymes that exhibit an unusual alpha/beta fold with a very deep topological knot. In 2001, when no crystal structures were available for any of these proteins, Anantharaman, Koonin, and Aravind identified homology between SpoU and TrmD MTases and defined the SPOUT superfamily. Since then, multiple crystal structures of knotted MTases have been solved and numerous new homologous sequences appeared in the databases. However, no comprehensive comparative analysis of these proteins has been carried out to classify them based on structural and evolutionary criteria and to guide functional predictions. Results We carried out extensive searches of databases of protein structures and sequences to collect all members of previously identified SPOUT MTases, and to identify previously unknown homologs. Based on sequence clustering, characterization of domain architecture, structure predictions and sequence/structure comparisons, we re-defined families within the SPOUT superfamily and predicted putative active sites and biochemical functions for the so far uncharacterized members. We have also delineated the common core of SPOUT MTases and inferred a multiple sequence alignment for the conserved knot region, from which we calculated the phylogenetic tree of the superfamily. We have also studied phylogenetic distribution of different families, and used this information to infer the evolutionary history of the SPOUT superfamily. Conclusion We present the first phylogenetic tree of the SPOUT superfamily since it was defined, together with a new scheme for its classification, and discussion about conservation of sequence and structure in different families, and their functional implications. We identified four protein families as new members of the SPOUT superfamily. Three of these families are functionally uncharacterized (COG1772, COG1901, and COG4080

  12. Phylogenetic analysis based on 28S rRNA of Babesia spp. in ruminants in China.

    Science.gov (United States)

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

    2013-04-01

    Molecular phylogenetic analyses are mainly based on the small ribosomal RNA subunit (18S rRNA), internal transcribed spacer regions, and other molecular markers. We compared the phylogenetic relationships of Babesia spp. using large subunit ribosomal RNA, i.e., 28S rRNA, and the united 28S + 18S rRNA sequence fragments from 11 isolates of Babesia spp. collected in China. Due to sequence length and variability, the 28S rRNA gene contained more information than the 18S rRNA gene and could be used to elucidate the phlyogenetic relationships of B. motasi, B. major, and B. bovis. Thus, 28S rRNA is another candidate marker that can be used for the phylogenetic analysis of Babesia spp. However, the united fragment (28S + 18S) analysis provided better supported phylogenetic relationships than single genes for Babesia spp. in China.

  13. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals.

    Science.gov (United States)

    Kakumanu, Madhavi L; Ponnusamy, Loganathan; Sutton, Haley T; Meshnick, Steven R; Nicholson, William L; Apperson, Charles S

    2016-04-01

    A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to otherRickettsia-specific PCR targets (ompA,gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11Rickettsiaspp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from "CandidatusRickettsia amblyommii." Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adultDermacentor variabilisticks. The nested 23S-5S IGS assay detectedRickettsiaDNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species ofRickettsia The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species ofRickettsiain the ticks. "CandidatusRickettsia amblyommii,"R. montanensis,R. felis, andR. belliiwere frequently identified species, along with some potentially novelRickettsiastrains that were closely related toR. belliiandR. conorii. Copyright © 2016 Kakumanu et al.

  14. Functional characterization of cinnamyl alcohol dehydrogenase and caffeic acid O-methyltransferase in Brachypodium distachyon.

    Science.gov (United States)

    Lignin is a significant recalcitrant in the conversion of plant biomass to bioethanol. Cinnamyl alcohol dehydrogenase (CAD) and caffeic acid O-methyltransferase (COMT) catalyze key steps in the pathway of lignin monomer biosynthesis. Brown midrib mutants in Zea mays and Sorghum bicolor with impaired...

  15. Structures of the m(6)A Methyltransferase Complex: Two Subunits with Distinct but Coordinated Roles.

    Science.gov (United States)

    Zhou, Katherine I; Pan, Tao

    2016-07-21

    In this issue of Molecular Cell, Wang et al. (2016a) report crystal structures of the core of the METTL3/METTL14 m(6)A methyltransferase complex and propose how the two subunits interact and cooperate to bind and methylate RNA.

  16. DNA methyltransferase DNMT3A associates with viral proteins and impacts HSV-1 infection.

    Science.gov (United States)

    Rowles, Daniell L; Tsai, Yuan-Chin; Greco, Todd M; Lin, Aaron E; Li, Minghao; Yeh, Justin; Cristea, Ileana M

    2015-06-01

    Viral infections can alter the cellular epigenetic landscape, through modulation of either DNA methylation profiles or chromatin remodeling enzymes and histone modifications. These changes can act to promote viral replication or host defense. Herpes simplex virus type 1 (HSV-1) is a prominent human pathogen, which relies on interactions with host factors for efficient replication and spread. Nevertheless, the knowledge regarding its modulation of epigenetic factors remains limited. Here, we used fluorescently-labeled viruses in conjunction with immunoaffinity purification and MS to study virus-virus and virus-host protein interactions during HSV-1 infection in primary human fibroblasts. We identified interactions among viral capsid and tegument proteins, detecting phosphorylation of the capsid protein VP26 at sites within its UL37-binding domain, and an acetylation within the major capsid protein VP5. Interestingly, we found a nuclear association between viral capsid proteins and the de novo DNA methyltransferase DNA (cytosine-5)-methyltransferase 3A (DNMT3A), which we confirmed by reciprocal isolations and microscopy. We show that drug-induced inhibition of DNA methyltransferase activity, as well as siRNA- and shRNA-mediated DNMT3A knockdowns trigger reductions in virus titers. Altogether, our results highlight a functional association of viral proteins with the mammalian DNA methyltransferase machinery, pointing to DNMT3A as a host factor required for effective HSV-1 infection.

  17. A fluorescence resonance energy transfer-based method for histone methyltransferases

    DEFF Research Database (Denmark)

    Devkota, Kanchan; Lohse, Brian; Nyby Jakobsen, Camilla;

    2015-01-01

    A simple dye–quencher fluorescence resonance energy transfer (FRET)-based assay for methyltransferases was developed and used to determine kinetic parameters and inhibitory activity at EHMT1 and EHMT2. Peptides mimicking the truncated histone H3 tail were functionalized in each end with a dye...

  18. The histone methyltransferase SET8 is required for S-phase progression

    DEFF Research Database (Denmark)

    Jørgensen, Stine; Elvers, Ingegerd; Trelle, Morten Beck;

    2008-01-01

    Chromatin structure and function is influenced by histone posttranslational modifications. SET8 (also known as PR-Set7 and SETD8) is a histone methyltransferase that monomethylates histonfe H4-K20. However, a function for SET8 in mammalian cell proliferation has not been determined. We show...

  19. Purification and characterization of dimethylamine:5-hydroxybenzimidazolyl-cobamide methyltransferase from Methanosarcina barkeri Fusaro.

    Science.gov (United States)

    Wassenaar, R W; Keltjens, J T; van der Drift, C; Vogels, G D

    1998-05-01

    Dimethylamine:5-hydroxybenzimidazolylcobamide methyltransferase (DMA-MT) was purified from cells of Methanosarcina barkeri Fusaro grown on trimethylamine. In the presence of methylcobalamine:coenzyme M methyltransferase isoenzyme II [MT2(II)] the enzyme quite specifically catalyzed the stoichiometric conversion of dimethylamine (apparent Km = 0.45 mM) and 2-mercaptoethane-sulfonate (coenzyme M) to monomethylamine and methyl-coenzyme M. Monomethylamine was a competitive inhibitor of the reaction (Ki = 4.5 mM). The apparent molecular mass of DMA-MT was 100 kDa and the enzyme was found to be a dimer, composed of identical 50-kDa subunits. A corrinoid content of 0.9 +/- 0.1 mol B12/mol holoenzyme was calculated from HPLC analysis. The as-isolated methyltransferase was inactive, but it could be reductively reactivated. Activation required the presence of methyltransferase-activating protein, ATP and dimethylamine. Incubation with these compounds resulted in the methylation of the corrinoid prosthetic group.

  20. The histone methyltransferase and putative oncoprotein MMSET is overexpressed in a large variety of human tumors

    DEFF Research Database (Denmark)

    Hudlebusch, Heidi Rye; Santoni-Rugiu, Eric; Simon, Ronald

    2011-01-01

    Multiple myeloma SET (Suppressor of variegation, Enhancer of zeste, and Trithorax) domain (MMSET) is a histone lysine methyltransferase deregulated in a subgroup of multiple myelomas with the t(4;14)(p16;q32) translocation and poor prognosis. With the aim of understanding, if MMSET can be involve...

  1. Local chromatin microenvironment determines DNMT activity : from DNA methyltransferase to DNA demethylase or DNA dehydroxymethylase

    NARCIS (Netherlands)

    van der Wijst, Monique G. P.; Venkiteswaran, Muralidhar; Chen, Hui; Xu, Guo-Liang; Plosch, Torsten; Rots, Marianne G.

    2015-01-01

    Insights on active DNA demethylation disproved the original assumption that DNA methylation is a stable epigenetic modification. Interestingly, mammalian DNA methyltransferases 3A and 3B (DNMT-3A and -3B) have also been reported to induce active DNA demethylation, in addition to their well-known fun

  2. DNA repair methyltransferase (Mgmt) knockout mice are sensitive to the lethal effects of chemotherapeutic alkylating agents.

    NARCIS (Netherlands)

    B.J. Glassner (Brian); G. Weeda (Geert); J.M. Allan (James); J.L.M. Broekhof (Jose'); N.H.E. Carls (Nick); I. Donker (Ingrid); B.P. Engelward (Bevin); R.J. Hampson (Richard); R. Hersmus (Remko); M.J. Hickman (Mark); R.B. Roth (Richard); H.B. Warren (Henry); M.M. Wu (Mavis); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1999-01-01

    textabstractWe have generated mice deficient in O6-methylguanine DNA methyltransferase activity encoded by the murine Mgmt gene using homologous recombination to delete the region encoding the Mgmt active site cysteine. Tissues from Mgmt null mice displayed very low O6-methylguanine DNA methyltransf

  3. Methyl transfer in glucosinolate biosynthesis mediated by indole glucosinolate O-Methyltransferase 5

    DEFF Research Database (Denmark)

    Pfalz, Marina; Mukhaimar, Maisara; Perreau, François

    2016-01-01

    with moderate similarity to previously characterized IGMTs, encodes the methyltransferase that is responsible for the conversion of 1OHI3M to 1MOI3M. Disruption of IGMT5 function increases resistance against the root-knot nematode Meloidogyne javanica and suggests a potential role for the 1-IG modification...

  4. rmtA, encoding a putative anginine methyltransferase, regulates secondary metabolism and development in Aspergillus flavus

    Science.gov (United States)

    Aspergillus flavus is found colonizing numerous oil seed crops such as corn, peanuts, sorghum, treenuts and cotton worldwide, contaminating them with aflatoxin and other harmful potent toxins. In the phylogenetically related model fungus Aspergillus nidulans, the methyltransferase, RmtA, has been de...

  5. Catechol-O-methyltransferase gene methylation and substance use in adolescents : the TRAILS study

    NARCIS (Netherlands)

    van der Knaap, L. J.; Schaefer, J. M.; Franken, I. H. A.; Verhulst, F. C.; van Oort, F. V. A.; Riese, H.

    2014-01-01

    Substance use often starts in adolescence and poses a major problem for society and individual health. The dopamine system plays a role in substance use, and catechol-O-methyltransferase (COMT) is an important enzyme that degrades dopamine. The Val(108/158)Met polymorphism modulates COMT activity an

  6. Loss of the histone methyltransferase EZH2 induces resistance to multiple drugs in acute myeloid leukemia

    DEFF Research Database (Denmark)

    Göllner, Stefanie; Oellerich, Thomas; Agrawal-Singh, Shuchi

    2017-01-01

    In acute myeloid leukemia (AML), therapy resistance frequently occurs, leading to high mortality among patients. However, the mechanisms that render leukemic cells drug resistant remain largely undefined. Here, we identified loss of the histone methyltransferase EZH2 and subsequent reduction of h...

  7. DNA methyltransferase and alcohol dehydrogenase: gene-nutrient interactions in relation to risk of colorectal polyps.

    NARCIS (Netherlands)

    Jung, A.Y.; Poole, E.M.; Bigler, J.; Whitton, J.; Potter, J.D.; Ulrich, C.M.

    2008-01-01

    Disturbances in DNA methylation are a characteristic of colorectal carcinogenesis. Folate-mediated one-carbon metabolism is essential for providing one-carbon groups for DNA methylation via DNA methyltransferases (DNMTs). Alcohol, a folate antagonist, could adversely affect one-carbon metabolism. In

  8. Structural mechanism of S-adenosyl methionine binding to catechol O-methyltransferase.

    Directory of Open Access Journals (Sweden)

    Douglas Tsao

    Full Text Available Methyltransferases possess a homologous domain that requires both a divalent metal cation and S-adenosyl-L-methionine (SAM to catalyze its reactions. The kinetics of several methyltransferases has been well characterized; however, the details regarding their structural mechanisms have remained unclear to date. Using catechol O-methyltransferase (COMT as a model, we perform discrete molecular dynamics and computational docking simulations to elucidate the initial stages of cofactor binding. We find that COMT binds SAM via an induced-fit mechanism, where SAM adopts a different docking pose in the absence of metal and substrate in comparison to the holoenzyme. Flexible modeling of the active site side-chains is essential for observing the lowest energy state in the apoenzyme; rigid docking tools are unable to recapitulate the pose unless the appropriate side-chain conformations are given a priori. From our docking results, we hypothesize that the metal reorients SAM in a conformation suitable for donating its methyl substituent to the recipient ligand. The proposed mechanism enables a general understanding of how divalent metal cations contribute to methyltransferase function.

  9. Association of Catechol-O-Methyltransferase (COMT) Polymorphism and Academic Achievement in a Chinese Cohort

    Science.gov (United States)

    Yeh, Ting-Kuang; Chang, Chun-Yen; Hu, Chung-Yi; Yeh, Ting-Chi; Lin, Ming-Yeh

    2009-01-01

    Catechol-O-methyltransferase (COMT) is a methylation enzyme that catalyzes the degradation pathway and inactivation of dopamine. It is accepted widely as being involved in the modulation of dopaminergic physiology and prefrontal cortex (PFC) function. The COMT Val158Met polymorphism is associated with variation in COMT activity. COMT 158Met allele…

  10. Catechol-O-methyltransferase: a method for autoradiographic visualization of isozymes in cellogel

    Energy Technology Data Exchange (ETDEWEB)

    Brahe, C.; Crosti, N.; Meera Khan, P.; Serra, A.

    1984-02-01

    An electrophoretic procedure for separating the molecular forms of catechol-O-methyltransferase in cellulose acetate gel is described; the zones of enzyme activity were revealed by autoradiography. The electrophoretic patterns of the enzyme in several tissues and cell lines derived from four different species are presented.

  11. Guanidinoacetate Methyltransferase (GAMT) Deficiency: Late Onset of Movement Disorder and Preserved Expressive Language

    Science.gov (United States)

    O'Rourke, Declan J.; Ryan, Stephanie; Salomons, Gajja; Jakobs, Cornelis; Monavari, Ahmad; King, Mary D.

    2009-01-01

    Guanidinoacetate methyltransferase (GAMT) deficiency is a disorder of creatine biosynthesis, characterized by early-onset learning disability and epilepsy in most affected children. Severe expressive language delay is a constant feature even in the mildest clinical phenotypes. We report the clinical, biochemical, imaging, and treatment data of two…

  12. Cations modulate the substrate specificity of bifunctional class I O-methyltransferase from Ammi majus.

    Science.gov (United States)

    Lukacin, Richard; Matern, Ulrich; Specker, Silvia; Vogt, Thomas

    2004-11-19

    Caffeoyl-coenzyme A O-methyltransferase cDNA was cloned from dark-grown Ammi majus L. (Apiaceae) cells treated with a crude fungal elicitor and the open reading frame was expressed in Escherichia coli. The translated polypeptide of 27.1-kDa shared significant identity to other members of this highly conserved class of proteins and was 98.8% identical to the corresponding O-methyltransferase from parsley. For biochemical characterization, the recombinant enzyme could be purified to apparent homogeneity by metal-affinity chromatography, although the recombinant enzyme did not contain any affinity tag. Based on sequence analysis and substrate specificity, the enzyme classifies as a cation-dependent O-methyltransferase with pronounced preference for caffeoyl coenzyme A, when assayed in the presence of Mg2+-ions. Surprisingly, however, the substrate specificity changed dramatically, when Mg2+ was replaced by Mn2+ or Co2+ in the assays. This effect could point to yet unknown functions and substrate specificities in situ and suggests promiscuous roles for the lignin specific cluster of plant O-methyltransferases.

  13. DNA methyltransferase and alcohol dehydrogenase: gene-nutrient interactions in relation to risk of colorectal polyps.

    NARCIS (Netherlands)

    Jung, A.Y.; Poole, E.M.; Bigler, J.; Whitton, J.; Potter, J.D.; Ulrich, C.M.

    2008-01-01

    Disturbances in DNA methylation are a characteristic of colorectal carcinogenesis. Folate-mediated one-carbon metabolism is essential for providing one-carbon groups for DNA methylation via DNA methyltransferases (DNMTs). Alcohol, a folate antagonist, could adversely affect one-carbon metabolism. In

  14. Guanidinoacetate methyltransferase (GAMT) deficiency : Outcomes in 48 individuals and recommendations for diagnosis, treatment and monitoring

    NARCIS (Netherlands)

    Stockler-Ipsiroglu, Sylvia; van Karnebeek, Clara; Longo, Nicola; Korenke, G. Christoph; Mercimek-Mahmutoglu, Saadet; Marquart, Iris; Barshop, Bruce; Grolik, Christiane; Schlune, Andrea; Angle, Brad; Araujo, Helena Caldeira; Coskun, Turgay; Diogo, Luisa; Geraghty, Michael; Haliloglu, Goknur; Konstantopoulou, Vassiliki; Leuzzi, Vincenzo; Levtova, Alina; MacKenzie, Jennifer; Maranda, Bruno; Mhanni, Aizeddin A.; Mitchell, Grant; Morris, Andrew; Newlove, Theresa; Renaud, Deborah; Scaglia, Fernando; Valayannopoulos, Vassili; van Spronsen, Francjan J.; Verbruggen, Krijn T.; Yuskiv, Nataliya; Nyhan, William; Schulze, Andreas

    We collected data on 48 patients from 38 families with guanidinoacetate methyltransferase (GAMT) deficiency. Global developmental delay/intellectual disability (DD/ID) with speech/language delay and behavioral problems as the most affected domains was present in 44 participants, with additional

  15. Suz12 is essential for mouse development and for EZH2 histone methyltransferase activity

    DEFF Research Database (Denmark)

    Pasini, Diego; Bracken, Adrian P; Jensen, Michael R

    2004-01-01

    SUZ12 is a recently identified Polycomb group (PcG) protein, which together with EZH2 and EED forms different Polycomb repressive complexes (PRC2/3). These complexes contain histone H3 lysine (K) 27/9 and histone H1 K26 methyltransferase activity specified by the EZH2 SET domain. Here we show tha...

  16. Guanidinoacetate methyltransferase (GAMT) deficiency : Outcomes in 48 individuals and recommendations for diagnosis, treatment and monitoring

    NARCIS (Netherlands)

    Stockler-Ipsiroglu, Sylvia; van Karnebeek, Clara; Longo, Nicola; Korenke, G. Christoph; Mercimek-Mahmutoglu, Saadet; Marquart, Iris; Barshop, Bruce; Grolik, Christiane; Schlune, Andrea; Angle, Brad; Araujo, Helena Caldeira; Coskun, Turgay; Diogo, Luisa; Geraghty, Michael; Haliloglu, Goknur; Konstantopoulou, Vassiliki; Leuzzi, Vincenzo; Levtova, Alina; MacKenzie, Jennifer; Maranda, Bruno; Mhanni, Aizeddin A.; Mitchell, Grant; Morris, Andrew; Newlove, Theresa; Renaud, Deborah; Scaglia, Fernando; Valayannopoulos, Vassili; van Spronsen, Francjan J.; Verbruggen, Krijn T.; Yuskiv, Nataliya; Nyhan, William; Schulze, Andreas

    2014-01-01

    We collected data on 48 patients from 38 families with guanidinoacetate methyltransferase (GAMT) deficiency. Global developmental delay/intellectual disability (DD/ID) with speech/language delay and behavioral problems as the most affected domains was present in 44 participants, with additional epil

  17. Clinical Pharmacogenetics Implementation Consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing

    DEFF Research Database (Denmark)

    Relling, M V; Gardner, E E; Sandborn, W J;

    2011-01-01

    Thiopurine methyltransferase (TPMT) activity exhibits monogenic co-dominant inheritance, with ethnic differences in the frequency of occurrence of variant alleles. With conventional thiopurine doses, homozygous TPMT-deficient patients (~1 in 178 to 1 in 3,736 individuals with two nonfunctional TP...

  18. CLONING, EXPRESSION, AND CHARACTERIZATION OF RAT S-ADENOSYL-L-METHIONINE: ARSENIC (III) METHYLTRANSFERASE (CYT19)

    Science.gov (United States)

    CLONING, EXPRESSION, AND CHARACTERIZATION OF RAT S-ADENOSYL-L-METHIONINE: ARSENIC(III) METHYLTRANSFERASE (cyt19)Stephen B. Waters1 , Felicia Walton1 , Miroslav Styblo1 , Karen Herbin-Davis2, and David J. Thomas2 1 School of Medicine, University of North Carolina at Chape...

  19. Genomic survey, gene expression analysis and structural modeling suggest diverse roles of DNA methyltransferases in legumes.

    Directory of Open Access Journals (Sweden)

    Rohini Garg

    Full Text Available DNA methylation plays a crucial role in development through inheritable gene silencing. Plants possess three types of DNA methyltransferases (MTases, namely Methyltransferase (MET, Chromomethylase (CMT and Domains Rearranged Methyltransferase (DRM, which maintain methylation at CG, CHG and CHH sites. DNA MTases have not been studied in legumes so far. Here, we report the identification and analysis of putative DNA MTases in five legumes, including chickpea, soybean, pigeonpea, Medicago and Lotus. MTases in legumes could be classified in known MET, CMT, DRM and DNA nucleotide methyltransferases (DNMT2 subfamilies based on their domain organization. First three MTases represent DNA MTases, whereas DNMT2 represents a transfer RNA (tRNA MTase. Structural comparison of all the MTases in plants with known MTases in mammalian and plant systems have been reported to assign structural features in context of biological functions of these proteins. The structure analysis clearly specified regions crucial for protein-protein interactions and regions important for nucleosome binding in various domains of CMT and MET proteins. In addition, structural model of DRM suggested that circular permutation of motifs does not have any effect on overall structure of DNA methyltransferase domain. These results provide valuable insights into role of various domains in molecular recognition and should facilitate mechanistic understanding of their function in mediating specific methylation patterns. Further, the comprehensive gene expression analyses of MTases in legumes provided evidence of their role in various developmental processes throughout the plant life cycle and response to various abiotic stresses. Overall, our study will be very helpful in establishing the specific functions of DNA MTases in legumes.

  20. Genomic survey, gene expression analysis and structural modeling suggest diverse roles of DNA methyltransferases in legumes.

    Science.gov (United States)

    Garg, Rohini; Kumari, Romika; Tiwari, Sneha; Goyal, Shweta

    2014-01-01

    DNA methylation plays a crucial role in development through inheritable gene silencing. Plants possess three types of DNA methyltransferases (MTases), namely Methyltransferase (MET), Chromomethylase (CMT) and Domains Rearranged Methyltransferase (DRM), which maintain methylation at CG, CHG and CHH sites. DNA MTases have not been studied in legumes so far. Here, we report the identification and analysis of putative DNA MTases in five legumes, including chickpea, soybean, pigeonpea, Medicago and Lotus. MTases in legumes could be classified in known MET, CMT, DRM and DNA nucleotide methyltransferases (DNMT2) subfamilies based on their domain organization. First three MTases represent DNA MTases, whereas DNMT2 represents a transfer RNA (tRNA) MTase. Structural comparison of all the MTases in plants with known MTases in mammalian and plant systems have been reported to assign structural features in context of biological functions of these proteins. The structure analysis clearly specified regions crucial for protein-protein interactions and regions important for nucleosome binding in various domains of CMT and MET proteins. In addition, structural model of DRM suggested that circular permutation of motifs does not have any effect on overall structure of DNA methyltransferase domain. These results provide valuable insights into role of various domains in molecular recognition and should facilitate mechanistic understanding of their function in mediating specific methylation patterns. Further, the comprehensive gene expression analyses of MTases in legumes provided evidence of their role in various developmental processes throughout the plant life cycle and response to various abiotic stresses. Overall, our study will be very helpful in establishing the specific functions of DNA MTases in legumes.

  1. Floral Benzenoid Carboxyl Methyltransferases: From in Vitro to in Planta Function

    Energy Technology Data Exchange (ETDEWEB)

    Effmert,U.; Saschenbrecker, S.; Ross, J.; Negre, F.; Fraser, C.; Noel, J.; Dudareva, N.; Piechulla, B.

    2005-01-01

    Benzenoid carboxyl methyltransferases synthesize methyl esters (e.g., methyl benzoate and methyl salicylate), which are constituents of aromas and scents of many plant species and play important roles in plant communication with the surrounding environment. Within the past five years, eleven such carboxyl methyltransferases were isolated and most of them were comprehensively investigated at the biochemical, molecular and structural level. Two types of enzymes can be distinguished according to their substrate preferences: the SAMT-type enzymes isolated from Clarkia breweri, Stephanotis floribunda, Antirrhinum majus, Hoya carnosa, and Petunia hybrida, which have a higher catalytic efficiency and preference for salicylic acid, while BAMT-type enzymes from A. majus, Arabidopsis thaliana, Arabidopsis lyrata, and Nicotiana suaveolens prefer benzoic acid. The elucidation of C. breweri SAMT's three-dimensional structure allowed a detailed modelling of the active sites of the carboxyl methyltransferases and revealed that the SAM binding pocket is highly conserved among these enzymes while the methyl acceptor binding site exhibits some variability, allowing a classification into SAMT-type and BAMT-type enzymes. The analysis of expression patterns coupled with biochemical characterization showed that these carboxyl methyltransferases are involved either in floral scent biosynthesis or in plant defense responses. While the latter can be induced by biotic or abiotic stress, the genes responsible for floral scent synthesis exhibit developmental and rhythmic expression pattern. The nature of the product and efficiency of its formation in plants depend on the availability of substrates, the catalytic efficiency of the enzyme toward benzoic acid and/or salicylic acid, and the transcriptional, translational, and post-translational regulation at the enzyme level. The biochemical properties of benzenoid carboxyl methyltransferases suggest that the genes involved in plant defenses

  2. Determination of Molecular Genotyping of Ureaplasma SPP in Women with Genital Infections by 16S–23S rDNA PCR-RFLP Method

    Directory of Open Access Journals (Sweden)

    R. Mirnejad

    2011-04-01

    Full Text Available Introduction & Objective: So far, despite the wide range of methods such as analytic methods used for differentiation of Mycoplasma, the diagnosis of Mycoplasma species is still difficult. Generally the low-level discriminatory power of serological methods because of the rapid changes in size and phase of the dominant antigens in the immune cell surface of Mycoplasmas greatly limits their applicability to the typing of Mycoplasmas. On the contrary,molecular methods do not suffer from these drawbacks and can be used for typing of Mycoplasmas. The aim of this investigation was molecular identification and genotyping of ureaplasma SPP in women with genital infections by 16S–23S rDNA PCR-RFLP.Materials & Methods: Genital swabs were taken from 210 patients who referred to gynecology clinic of Rasool hospital in Tehran, Iran during December 2007 until June 2008. The swabs suspended in PBS, were immediately transferred to laboratory .Following DNA extraction, PCR assay was performed using a genus specific primer pair. These primer sets amplified a 559 bp fragment for Ureaplasma Spp. Samples containing bands of the expected size for Ureaplasma strains were subjected to digestion with different restriction endonuclease enzymes (AluI, Taq I, CacI8, BbsI, EcoRI. Results: Of the 210 samples, Ureaplasma Spp was isolated from 93 patients (44.3% by PCR and 69 samples by culture. In the present study only Biovar 1 (Ureaplasma parvum was isolated from clinical specimens and the results were confirmed using a cutting enzyme TaqI (enzyme specific species of ureaplasma SPP. The results of this analysis using PCR-RFLP and sequencing showed that all had the same genotype and shared identical sequence with the genome sequence of serovar 3 Ureaplasma parvum.Conclusion: Ureaplasma parvum is generally isolated from the genital samples. In this study all isolates were identical and no difference was found among the enzyme patterns of the bacteria after PCR-RFLP .So

  3. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    Science.gov (United States)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  4. Protein Arginine Methyltransferase 5 as a Driver of Lymphomagenesis

    Science.gov (United States)

    Smith, Porsha Latrice

    Over the past decade, it has become clear that oncogenesis is a process driven by a wide variety of triggers including gene mutations, gene amplifications, inflammation, and immune deficiency. The growing pool of data collected from whole genome and epigenome studies of both solid and blood cancers has pointed toward dysregulation of chromatin remodelers as a unique class of cancer drivers. Next generation sequencing studies of lymphomas have identified a wide array of somatic mutations affecting enzymes that regulate epigenetic control of gene expression. Lymphoma is a type of cancer that originates in secondary lymphoid organs and manifests as an outgrowth of transformed lymphocytes, or white blood cells (WBCs) in the blood. The majority of lymphoma cases can be grouped into the Non-Hodgkins lymphoma (NHL) subset and mainly occurs in B-cells. B-cell NHL is a heterogeneous set of cancers that would benefit from new therapies to improve patient progression-free survival. Cancers such as NHL typically present with a combination of genetic and epigenetic aberrations that contribute to the malignancy program. The epigenetic modifier protein arginine methyltransferase 5 (PRMT5) is required for B-cell transformation following Epstein-Barr virus (EBV) infection, and is overexpressed in various subsets of B-cell NHL. Based on these data we hypothesized that PRMT5 is a major driver of B-cell lymphomagenesis. To explore the role of PRMT5 in the development and progression of B-cell NHL we created a small molecule inhibitors targeted to PRMT5. Using the NHL subset mantle cell lymphoma (MCL) as a model we tested the efficacy of the drug. We discovered that PRMT5 was overexpressed in MCL primary samples and cell lines as compared to normal resting B cells. Furthermore, use of the small molecule inhibitor decreased the proliferation and viability in these cells without affecting the normal B-cells. Additionally, use of inhibitors caused G2/M cell cycle and decreased the

  5. Development of a Broad-Range 23S rDNA Real-Time PCR Assay for the Detection and Quantification of Pathogenic Bacteria in Human Whole Blood and Plasma Specimens

    Directory of Open Access Journals (Sweden)

    Paolo Gaibani

    2013-01-01

    Full Text Available Molecular methods are important tools in the diagnosis of bloodstream bacterial infections, in particular in patients treated with antimicrobial therapy, due to their quick turn-around time. Here we describe a new broad-range real-time PCR targeting the 23S rDNA gene and capable to detect as low as 10 plasmid copies per reaction of targeted bacterial 23S rDNA gene. Two commercially available DNA extraction kits were evaluated to assess their efficiency for the extraction of plasma and whole blood samples spiked with different amount of either Staphylococcus aureus or Escherichia coli, in order to find the optimal extraction method to be used. Manual QIAmp extraction method with enzyme pre-treatment resulted the most sensitive for detection of bacterial load. Sensitivity of this novel assay ranged between 10 and 103 CFU per PCR reaction for E. coli and S. aureus in human whole blood samples depending on the extraction methods used. Analysis of plasma samples showed a 10- to 100-fold reduction of bacterial 23S rDNA in comparison to the corresponding whole blood specimens, thus indicating that whole blood is the preferential sample type to be used in this real-time PCR protocol. Our results thus show that the 23S rDNA gene represents an optimal target for bacteria quantification in human whole blood.

  6. The rluC gene of Escherichia coli codes for a pseudouridine synthase that is solely responsible for synthesis of pseudouridine at positions 955, 2504, and 2580 in 23 S ribosomal RNA.

    Science.gov (United States)

    Conrad, J; Sun, D; Englund, N; Ofengand, J

    1998-07-17

    Escherichia coli ribosomal RNA contains 10 pseudouridines, one in the 16 S RNA and nine in the 23 S RNA. Previously, the gene for the synthase responsible for the 16 S RNA pseudouridine was identified and cloned, as was a gene for a synthase that makes a single pseudouridine in 23 S RNA. The yceC open reading frame of E. coli is one of a set of genes homologous to these previously identified ribosomal RNA pseudouridine synthases. In this work, the gene was cloned, overexpressed, and shown to code for a pseudouridine synthase able to react with in vitro transcripts of 23 S ribosomal RNA. Deletion of the gene and analysis of the 23 S RNA from the deletion strain for the presence of pseudouridine at its nine known sites revealed that this synthase is solely responsible in vivo for the synthesis of three of the nine pseudouridine residues, at positions 955, 2504, and 2580. Therefore, this gene has been renamed rluC. Despite the absence of one-third of the normal complement of pseudouridines, there was no change in the exponential growth rate in either LB or M-9 medium at temperatures ranging from 24 to 42 degrees C. From this work and our previous studies, we have now identified three synthases that account for 50% of the pseudouridines in the E. coli ribosome.

  7. Characteristic archaebacterial 16S rRNA oligonucleotides

    Science.gov (United States)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  8. Defects in 18 S or 28 S rRNA processing activate the p53 pathway.

    Science.gov (United States)

    Hölzel, Michael; Orban, Mathias; Hochstatter, Julia; Rohrmoser, Michaela; Harasim, Thomas; Malamoussi, Anastassia; Kremmer, Elisabeth; Längst, Gernot; Eick, Dirk

    2010-02-26

    The p53 tumor suppressor pathway is activated by defective ribosome synthesis. Ribosomal proteins are released from the nucleolus and block human double minute-2 (Hdm2) that targets p53 for degradation. However, it remained elusive how abrogation of individual rRNA processing pathways contributes to p53 stabilization. Here, we show that selective inhibition of 18 S rRNA processing provokes accumulation of p53 as efficiently as abrogated 28 S rRNA maturation. We describe hUTP18 as a novel mammalian rRNA processing factor that is specifically involved in 18 S rRNA production. hUTP18 was essential for the cleavage of the 5'-external transcribed spacer leader sequence from the primary polymerase I transcript, but was dispensable for rRNA transcription. Because maturation of the 28 S rRNA was unaffected in hUTP18-depleted cells, our results suggest that the integrity of both the 18 S and 28 S rRNA synthesis pathways can be monitored independently by the p53 pathway. Interestingly, accumulation of p53 after hUTP18 knock down required the ribosomal protein L11. Therefore, cells survey the maturation of the small and large ribosomal subunits by separate molecular routes, which may merge in an L11-dependent signaling pathway for p53 stabilization.

  9. Fragmentary 5S rRNA gene in the human mitochondrial genome

    Energy Technology Data Exchange (ETDEWEB)

    Nierlich, D.P.

    1982-02-01

    The human mitochondrial genoma contains a 23-nucleodtide sequence that is homologous to a part of the 5S rRNA's of bacteria. This homology, the structure of the likely transcript, and the location of the sequence relative to the mitochondrial rRNA genes suggest that the sequence represents a fragmentary 5S rRNA gene.

  10. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kiparisov, Sergey; Petrov, Alexey; Meskauskas, Arturas; Sergiev, Petr V; Dontsova, Olga A; Dinman, Jonathan D

    2005-10-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semi-dominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression.

  11. rRNA maturation as a "quality" control step in ribosomal subunit assembly in Dictyostelium discoideum.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S; Bulfone, S

    1997-10-31

    In Dictyostelium discoideum, newly assembled ribosomal subunits enter polyribosomes while they still contain immature rRNA. rRNA maturation requires the engagement of the subunits in protein synthesis and leads to stabilization of their structure. Maturation of pre-17 S rRNA occurs only after the newly formed 40 S ribosomal particle has entered an 80 S ribosome and participated at least in the formation of one peptide bond or in one translocation event; maturation of pre-26 S rRNA requires the presence on the 80 S particle of a peptidyl-tRNA containing at least 6 amino acids. Newly assembled particles that cannot fulfill these requirements for structural reasons are disassembled into free immature rRNA and ribosomal proteins.

  12. A conformational switch in the active site of BT_2972, a methyltransferase from an antibiotic resistant pathogen B. thetaiotaomicron.

    Directory of Open Access Journals (Sweden)

    Veerendra Kumar

    Full Text Available Methylation is one of the most common biochemical reactions involved in cellular and metabolic functions and is catalysed by the action of methyltransferases. Bacteroides thetaiotaomicron is an antibiotic-resistant bacterium that confers resistance through methylation, and as yet, there is no report on the structure of methyltransferases from this bacterium. Here, we report the crystal structure of an AdoMet-dependent methyltransferase, BT_2972 and its complex with AdoMet and AdoHcy for B. thetaiotaomicron VPI-5482 strain along with isothermal titration calorimetric assessment of the binding affinities. Comparison of the apo and complexed BT_2972 structures reveals a significant conformational change between open and closed forms of the active site that presumably regulates the association with cofactors and may aid interaction with substrate. Together, our analysis suggests that BT_2972 is a small molecule methyltransferase and might catalyze two O-methylation reaction steps involved in the ubiquinone biosynthesis pathway.

  13. Resurrection of an ancestral 5S rRNA

    Directory of Open Access Journals (Sweden)

    Fox George E

    2011-07-01

    to resurrect additional meaningful 5S rRNA ancestors as well as ancestral sequences of many different types of RNA.

  14. Resurrection of an ancestral 5S rRNA.

    Science.gov (United States)

    Lu, Qing; Fox, George E

    2011-07-22

    In addition to providing phylogenetic relationships, tree making procedures such as parsimony and maximum likelihood can make specific predictions of actual historical sequences. Resurrection of such sequences can be used to understand early events in evolution. In the case of RNA, the nature of parsimony is such that when applied to multiple RNA sequences it typically predicts ancestral sequences that satisfy the base pairing constraints associated with secondary structure. The case for such sequences being actual ancestors is greatly improved, if they can be shown to be biologically functional. A unique common ancestral sequence of 28 Vibrio 5S ribosomal RNA sequences predicted by parsimony was resurrected and found to be functional in the context of the E. coli cellular environment. The functionality of various point variants and intermediates that were constructed as part of the resurrection were examined in detail. When separately introduced the changes at single stranded positions and individual double variants at base-paired positions were also viable. An additional double variant was examined at a different base-paired position and it was also valid. The results show that at least in the case of the 5S rRNAs considered here, ancestors predicted by parsimony are likely to be realistic when the prediction is not overly influenced by single outliers. It is especially noteworthy that the phenotype of the predicted ancestors could be anticipated as a cumulative consequence of the phenotypes of the individual variants that comprised them. Thus, point mutation data is potentially useful in evaluating the reasonableness of ancestral sequences predicted by parsimony or other methods. The results also suggest that in the absence of significant tertiary structure constraints double variants that preserve pairing in stem regions will typically be accepted. Overall, the results suggest that it will be feasible to resurrect additional meaningful 5S rRNA ancestors as well

  15. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Directory of Open Access Journals (Sweden)

    Markus Buchhaupt

    Full Text Available Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  16. Dicistronic tRNA-5S rRNA genes in Yarrowia lipolytica: an alternative TFIIIA-independent way for expression of 5S rRNA genes.

    Science.gov (United States)

    Acker, Joël; Ozanne, Christophe; Kachouri-Lafond, Rym; Gaillardin, Claude; Neuvéglise, Cécile; Marck, Christian

    2008-10-01

    In eukaryotes, genes transcribed by RNA polymerase III (Pol III) carry their own internal promoters and as such, are transcribed as individual units. Indeed, a very few cases of dicistronic Pol III genes are yet known. In contrast to other hemiascomycetes, 5S rRNA genes of Yarrowia lipolytica are not embedded into the tandemly repeated rDNA units, but appear scattered throughout the genome. We report here an unprecedented genomic organization: 48 over the 108 copies of the 5S rRNA genes are located 3' of tRNA genes. We show that these peculiar tRNA-5S rRNA dicistronic genes are expressed in vitro and in vivo as Pol III transcriptional fusions without the need of the 5S rRNA gene-specific factor TFIIIA, the deletion of which displays a viable phenotype. We also report the existence of a novel putative non-coding Pol III RNA of unknown function about 70 nucleotide-long (RUF70), the 13 genes of which are devoid of internal Pol III promoters and located 3' of the 13 copies of the tDNA-Trp (CCA). All genes embedded in the various dicistronic genes, fused 5S rRNA genes, RUF70 genes and their leader tRNA genes appear to be efficiently transcribed and their products correctly processed in vivo.

  17. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Science.gov (United States)

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  18. 18S rRNA degradation is not accompanied by altered rRNA transport at early times following irradiation of HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Fuchs, P.; Krolak, J.M.; McClain, D.; Minton, K.W.

    1990-01-01

    In recent investigations on the effects of radiation on rRNA processing in HeLa S3 cells, the authors pulse-labeled the cells with uridine immediately prior to irradiation. The 45 S rRNA precursor, which undergoes nuclear processing to form one each of its major daughter species, 28S and 18S rRNA, was separated from the daughter species by gel electrophoresis and the radiolabel in each species determined at various times after irradiation. By pulse-labeling the cells prior to irradiation, superimposed effects caused by radiation-induced alterations of rRNA transcription and Refs. therein were minimized, permitting selective analysis of the processing of that fraction of 45S precursor that had been synthesized (radiolabeled) predominantly prior to irradiation. They now report more detailed studies on 45S rRNA processing within the first 2 h following irradiation in which they have found a maximum 28 S:18 S ratio of 2:1 that is observed about 1 h following irradiation of 5 or 10 Gy.

  19. Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry

    DEFF Research Database (Denmark)

    Vranken, Charlotte; Deen, Jochem; Dirix, Lieve

    2014-01-01

    We demonstrate an approach to optical DNA mapping, which enables near single-molecule characterization of whole bacteriophage genomes. Our approach uses a DNA methyltransferase enzyme to target labelling to specific sites and copper-catalysed azide-alkyne cycloaddition to couple a fluorophore...... to the DNA. We achieve a labelling efficiency of ∼70% with an average labelling density approaching one site every 500 bp. Such labelling density bridges the gap between the output of a typical DNA sequencing experiment and the long-range information derived from traditional optical DNA mapping. We lay...... the foundations for a wider-scale adoption of DNA mapping by screening 11 methyltransferases for their ability to direct sequence-specific DNA transalkylation; the first step of the DNA labelling process and by optimizing reaction conditions for fluorophore coupling via a click reaction. Three of 11 enzymes...

  20. Crystallization and preliminary X-ray diffraction studies of a catechol-O-methyltransferase/inhibitor complex

    Energy Technology Data Exchange (ETDEWEB)

    Rodrigues, M. L. [Instituto de Tecnologia Química e Biológica (ITQB), Universidade Nova de Lisboa, Av. República, Apt. 127, 2781-901 Oeiras (Portugal); Bonifácio, M. J.; Soares-da-Silva, P. [Department of Research and Development, BIAL, 4785 S. Mamede do Coronado (Portugal); Carrondo, M. A.; Archer, M., E-mail: archer@itqb.unl.pt [Instituto de Tecnologia Química e Biológica (ITQB), Universidade Nova de Lisboa, Av. República, Apt. 127, 2781-901 Oeiras (Portugal)

    2005-01-01

    Catechol-O-methyltransferase has been co-crystallized with a novel inhibitor, which has potential therapeutic application in the Parkinson’s disease therapy. Inhibitors of the enzyme catechol-O-methyltransferase (COMT) are used as co-adjuvants in the therapy of Parkinson’s disease. A recombinant form of the soluble cytosolic COMT from rat has been co-crystallized with a new potent inhibitor, BIA 8-176 [(3,4-dihydroxy-2-nitrophenyl)phenylmethanone], by the vapour-diffusion method using PEG 6K as precipitant. Crystals diffract to 1.6 Å resolution on a synchrotron-radiation source and belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 52.77, b = 79.63, c = 61.54 Å, β = 91.14°.

  1. Discovery of sphingosine 1-O-methyltransferase in rat kidney and liver homogenates

    Institute of Scientific and Technical Information of China (English)

    Santosh J SACKET; Dong-soon IM

    2008-01-01

    Aim:To characterize sphingosine methyltransferase in rat tissues.Methods:By using S-adenosyl-L-(methyl-3H) methionine,enzymatic activity was measured in the rat liver and kidney homogenates.Results:The optimum pH and reaction time for the enzyme assay were pH 7.8 and 1 h.ZnCl2 inhibited the activity,but not MgCl2,CaCl2,CoCl2,or NiCl2.In the kidney homogenate,enzymatic activity was detectable in the cytosol and all membrane fractions from the plasma membrane and other organelles; however,in the liver homogenate,enzymatic activity was detectable in all membrane fractions,but not in the cytosol.We also tested the enzymatic activity with structurally-modified sphingosine derivatives.Conclusion:We found sphingosine l-O-methyltransferase activity in the rat liver and kidney homogenates.

  2. Catecholamine-o-methyltransferase polymorphisms are associated with postoperative pain intensity.

    LENUS (Irish Health Repository)

    Lee, Peter J

    2011-02-01

    single nucleotide polymorphisms (SNPs) in the genes for catecholamine-O-methyltransferase (COMT), μ-opioid receptor and GTP cyclohydrolase (GCH1) have been linked to acute and chronic pain states. COMT polymorphisms are associated with experimental pain sensitivity and a chronic pain state. No such association has been identified perioperatively. We carried out a prospective observational clinical trial to examine associations between these parameters and the development of postoperative pain in patients undergoing third molar (M3) extraction.

  3. Survival and tumorigenesis in O6-methylguanine DNA methyltransferase-deficient mice following cyclophosphamide exposure

    OpenAIRE

    Nagasubramanian, Ramamoorthy; Hansen, Ryan J.; Delaney, Shannon M.; Cherian, Mathew M.; Samson, Leona D.; Kogan, Scott C.; Dolan, M Eileen

    2008-01-01

    O6-methylguanine DNA methyltransferase (MGMT) deficiency is associated with an increased susceptibility to alkylating agent toxicity. To understand the contribution of MGMT in protecting against cyclophosphamide (CP)-induced toxicity, mutagenesis and tumorigenesis, we compared the biological effects of this agent in transgenic Mgmt knockout and wild-type mice. In addition, neurofibromin (Nf1)+/− background was used to increase the likelihood of CP-induced tumorigenesis. Cohorts of Mgmt-profic...

  4. Arsenic (+ 3 Oxidation State) Methyltransferase and the Methylation of Arsenicals in the Invertebrate Chordate Ciona intestinalis

    OpenAIRE

    Thomas, David J; Nava, Gerardo M.; Cai, Shi-Ying; Boyer, James L.; Hernández-Zavala, Araceli; Gaskins, H. Rex

    2009-01-01

    Biotransformation of inorganic arsenic (iAs) involves methylation catalyzed by arsenic (+ 3 oxidation state) methyltransferase (As3mt) yielding mono-, di-, and trimethylated arsenicals. To investigate the evolution of molecular mechanisms that mediate arsenic biotransformation, a comparative genomic approach focusing on the invertebrate chordate Ciona intestinalis was used. Bioinformatic analyses identified an As3mt gene in the C. intestinalis genome. Constitutive As3mt RNA expression was obs...

  5. Thiopurine S-methyltransferase polymorphisms and thiopurine toxicity in treatment of inflammatory bowel disease

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    AIM: To evaluate the relationship between thiopu- rine S-methyltransferase (TPMT) polymorphisms and thiopurine-induced adverse drug reactions (ADRs) in inflammatory bowel disease (IBD). METHODS: Eligible articles that compared the frequency of TPMT polymorphisms among thiopurine-tolerant and-intolerant adult IBD patients were included. Statistical analysis was performed with Review Manager 5.0. Sub-analysis/sensitivity analysis was also performed. RESULTS: Nine studies that investigated a total of 1309 part...

  6. De Novo DNA Methyltransferase DNMT3b Interacts with NEDD8-modified Proteins*

    OpenAIRE

    Shamay, Meir; Greenway, Melanie; Liao, Gangling; AMBINDER, RICHARD F; Hayward, S. Diane

    2010-01-01

    DNA methylation and histone modifications play an important role in transcription regulation. In cancer cells, many promoters become aberrantly methylated through the activity of the de novo DNA methyltransferases DNMT3a and DNMT3b and acquire repressive chromatin marks. NEDD8 is a ubiquitin-like protein modifier that is conjugated to target proteins, such as cullins, to regulate their activity, and cullin 4A (CUL4A) in its NEDD8-modified form is essential for repressive chromatin formation. ...

  7. Histone H3K9 methyltransferase G9a represses PPARγ expression and adipogenesis

    OpenAIRE

    Wang, Lifeng; Xu, Shiliyang; Lee, Ji-Eun; Baldridge, Anne; Grullon, Sean; Peng, Weiqun; Ge, Kai

    2012-01-01

    PPARγ promotes adipogenesis while Wnt proteins inhibit adipogenesis. However, the mechanisms that control expression of these positive and negative master regulators of adipogenesis remain incompletely understood. By genome-wide histone methylation profiling in preadipocytes, we find that among gene loci encoding adipogenesis regulators, histone methyltransferase (HMT) G9a-mediated repressive epigenetic mark H3K9me2 is selectively enriched on the entire PPARγ locus. H3K9me2 and G9a levels dec...

  8. A novel methyltransferase from the intracellular pathogen Plasmodiophora brassicae methylates salicylic acid.

    Science.gov (United States)

    Ludwig-Müller, Jutta; Jülke, Sabine; Geiß, Kathleen; Richter, Franziska; Mithöfer, Axel; Šola, Ivana; Rusak, Gordana; Keenan, Sandi; Bulman, Simon

    2015-05-01

    The obligate biotrophic pathogen Plasmodiophora brassicae causes clubroot disease in Arabidopsis thaliana, which is characterized by large root galls. Salicylic acid (SA) production is a defence response in plants, and its methyl ester is involved in systemic signalling. Plasmodiophora brassicae seems to suppress plant defence reactions, but information on how this is achieved is scarce. Here, we profile the changes in SA metabolism during Arabidopsis clubroot disease. The accumulation of SA and the emission of methylated SA (methyl salicylate, MeSA) were observed in P. brassicae-infected Arabidopsis 28 days after inoculation. There is evidence that MeSA is transported from infected roots to the upper plant. Analysis of the mutant Atbsmt1, deficient in the methylation of SA, indicated that the Arabidopsis SA methyltransferase was not responsible for alterations in clubroot symptoms. We found that P. brassicae possesses a methyltransferase (PbBSMT) with homology to plant methyltransferases. The PbBSMT gene is maximally transcribed when SA production is highest. By heterologous expression and enzymatic analyses, we showed that PbBSMT can methylate SA, benzoic and anthranilic acids.

  9. Transcriptome profiling of Set5 and Set1 methyltransferases: Tools for visualization of gene expression

    Directory of Open Access Journals (Sweden)

    Glòria Mas Martín

    2014-12-01

    Full Text Available Cells regulate transcription by coordinating the activities of multiple histone modifying complexes. We recently identified the yeast histone H4 methyltransferase Set5 and discovered functional overlap with the histone H3 methyltransferase Set1 in gene expression. Specifically, using next-generation RNA sequencing (RNA-Seq, we found that Set5 and Set1 function synergistically to regulate specific transcriptional programs at subtelomeres and transposable elements. Here we provide a comprehensive description of the methodology and analysis tools corresponding to the data deposited in NCBI's Gene Expression Omnibus (GEO under the accession number GSE52086. This data complements the experimental methods described in Mas Martín G et al. (2014 and provides the means to explore the cooperative functions of histone H3 and H4 methyltransferases in the regulation of transcription. Furthermore, a fully annotated R code is included to enable researchers to use the following computational tools: comparison of significant differential expression (SDE profiles; gene ontology enrichment of SDE; and enrichment of SDE relative to chromosomal features, such as centromeres, telomeres, and transposable elements. Overall, we present a bioinformatics platform that can be generally implemented for similar analyses with different datasets and in different organisms.

  10. Kinetic analysis of Yersinia pestis DNA adenine methyltransferase activity using a hemimethylated molecular break light oligonucleotide.

    Directory of Open Access Journals (Sweden)

    Robert J Wood

    Full Text Available BACKGROUND: DNA adenine methylation plays an important role in several critical bacterial processes including mismatch repair, the timing of DNA replication and the transcriptional control of gene expression. The dependence of bacterial virulence on DNA adenine methyltransferase (Dam has led to the proposal that selective Dam inhibitors might function as broad spectrum antibiotics. METHODOLOGY/PRINCIPAL FINDINGS: Herein we report the expression and purification of Yersinia pestis Dam and the development of a continuous fluorescence based assay for DNA adenine methyltransferase activity that is suitable for determining the kinetic parameters of the enzyme and for high throughput screening against potential Dam inhibitors. The assay utilised a hemimethylated break light oligonucleotide substrate containing a GATC methylation site. When this substrate was fully methylated by Dam, it became a substrate for the restriction enzyme DpnI, resulting in separation of fluorophore (fluorescein and quencher (dabcyl and therefore an increase in fluorescence. The assays were monitored in real time using a fluorescence microplate reader in 96 well format and were used for the kinetic characterisation of Yersinia pestis Dam, its substrates and the known Dam inhibitor, S-adenosylhomocysteine. The assay has been validated for high throughput screening, giving a Z-factor of 0.71+/-0.07 indicating that it is a sensitive assay for the identification of inhibitors. CONCLUSIONS/SIGNIFICANCE: The assay is therefore suitable for high throughput screening for inhibitors of DNA adenine methyltransferases and the kinetic characterisation of the inhibition.

  11. The Eukaryotic DNMT2 Genes Encode a New Class of Cytosine-5 DNA Methyltransferases

    Institute of Scientific and Technical Information of China (English)

    Lin-YaTang; M.NarsaReddy; VanyaRasheva; Tai-LinLee; Meng-JauLin; Ming-ShiuHung; C.-K.JamesShen

    2005-01-01

    DNMT2 is a subgroup of the eukaryotic cytosine-5 DNA methyltransferase gene family. Unlike the other family members, proteins encoded by DNMT2 genes were not known before to possess DNA methyltransferase activities. Most recently, we have showm that thegenome of Drosophila S2 cells stably expressing an exogenous Drosophila dDNMT2 cDNA became anoma-lously methylated at the 5'-positions of cytosines(Reddy, M. N., Tang, L. Y., Lee, T. L., and Shen, C.-K. J.(2003) Oncogene, in press). We present evidence here that the genomes of transgenic flies overexpressing the dDnmt2 protein also became hypermethylated at specific regions. Furthermore, transient transfection studies in combination with sodium bisulfite sequencing demonstrated that dDnmt2 as well as its mousc ortholog, mDnmt2, are capable of methylating a cotrans-fected plasmid DNA. These data provide solid evidence that the fly and mouse DNMT2 gene products are genuine cytosine-5 DNA methyltransferases.

  12. Histone tails regulate DNA methylation by allosterically activating de novo methyltransferase

    Institute of Scientific and Technical Information of China (English)

    Bin-Zhong Li; Guo-Liang Xu; Zheng Huang; Qing-Yan Cui; Xue-Hui Song; Lin Du; Albert Jeltsch; Ping Chen; Guohong Li; En Li

    2011-01-01

    Cytosine methylation of genomic DNA controls gene expression and maintains genome stability. How a specific DNA sequence is targeted for methylation by a methyltransferase is largely unknown. Here, we show that histone H3 tails lacking lysine 4 (K4) methylation function as an allosteric activator for methyltransferase Dnmt3a by binding to its plant homeodomain (PHD). In vitro, histone H3 peptides stimulated the methylation activity of Dnmt3a up to 8-fold, in a manner reversely correlated with the level of K4 methylation. The biological significance of allosteric regulation was manifested by molecular modeling and identification of key residues in both the PHD and the catalytic domain of Dnmt3a whose mutations impaired the stimulation of methylation activity by H3 peptides but not the binding of H3 peptides. Significantly, these mutant Dnmt3a proteins were almost inactive in DNA methylation when expressed in mouse embryonic stem cells while their recruitment to genomic targets was unaltered. We therefore propose a two-step mechanism for de novo DNA methylation - first recruitment of the methyltransferase probably assisted by a chromatin- or DNA-binding factor, and then allosteric activation depending on the interaction between Dnmt3a and the histone tails - the latter might serve as a checkpoint for the methylation activity.

  13. Highly Iterated Palindromic Sequences (HIPs and Their Relationship to DNA Methyltransferases

    Directory of Open Access Journals (Sweden)

    Jeff Elhai

    2015-03-01

    Full Text Available The sequence GCGATCGC (Highly Iterated Palindrome, HIP1 is commonly found in high frequency in cyanobacterial genomes. An important clue to its function may be the presence of two orphan DNA methyltransferases that recognize internal sequences GATC and CGATCG. An examination of genomes from 97 cyanobacteria, both free-living and obligate symbionts, showed that there are exceptional cases in which HIP1 is at a low frequency or nearly absent. In some of these cases, it appears to have been replaced by a different GC-rich palindromic sequence, alternate HIPs. When HIP1 is at a high frequency, GATC- and CGATCG-specific methyltransferases are generally present in the genome. When an alternate HIP is at high frequency, a methyltransferase specific for that sequence is present. The pattern of 1-nt deviations from HIP1 sequences is biased towards the first and last nucleotides, i.e., those distinguish CGATCG from HIP1. Taken together, the results point to a role of DNA methylation in the creation or functioning of HIP sites. A model is presented that postulates the existence of a GmeC-dependent mismatch repair system whose activity creates and maintains HIP sequences.

  14. Cooperativity between DNA Methyltransferases in the Maintenance Methylation of Repetitive Elements

    Science.gov (United States)

    Liang, Gangning; Chan, Matilda F.; Tomigahara, Yoshitaka; Tsai, Yvonne C.; Gonzales, Felicidad A.; Li, En; Laird, Peter W.; Jones, Peter A.

    2002-01-01

    We used mouse embryonic stem (ES) cells with systematic gene knockouts for DNA methyltransferases to delineate the roles of DNA methyltransferase 1 (Dnmt1) and Dnmt3a and -3b in maintaining methylation patterns in the mouse genome. Dnmt1 alone was able to maintain methylation of most CpG-poor regions analyzed. In contrast, both Dnmt1 and Dnmt3a and/or Dnmt3b were required for methylation of a select class of sequences which included abundant murine LINE-1 promoters. We used a novel hemimethylation assay to show that even in wild-type cells these sequences contain high levels of hemimethylated DNA, suggestive of poor maintenance methylation. We showed that Dnmt3a and/or -3b could restore methylation of these sequences to pretreatment levels following transient exposure of cells to 5-aza-CdR, whereas Dnmt1 by itself could not. We conclude that ongoing de novo methylation by Dnmt3a and/or Dnmt3b compensates for inefficient maintenance methylation by Dnmt1 of these endogenous repetitive sequences. Our results reveal a previously unrecognized degree of cooperativity among mammalian DNA methyltransferases in ES cells. PMID:11756544

  15. Genomic profiling of DNA methyltransferases reveals a role for DNMT3B in genic methylation.

    Science.gov (United States)

    Baubec, Tuncay; Colombo, Daniele F; Wirbelauer, Christiane; Schmidt, Juliane; Burger, Lukas; Krebs, Arnaud R; Akalin, Altuna; Schübeler, Dirk

    2015-04-09

    DNA methylation is an epigenetic modification associated with transcriptional repression of promoters and is essential for mammalian development. Establishment of DNA methylation is mediated by the de novo DNA methyltransferases DNMT3A and DNMT3B, whereas DNMT1 ensures maintenance of methylation through replication. Absence of these enzymes is lethal, and somatic mutations in these genes have been associated with several human diseases. How genomic DNA methylation patterns are regulated remains poorly understood, as the mechanisms that guide recruitment and activity of DNMTs in vivo are largely unknown. To gain insights into this matter we determined genomic binding and site-specific activity of the mammalian de novo DNA methyltransferases DNMT3A and DNMT3B. We show that both enzymes localize to methylated, CpG-dense regions in mouse stem cells, yet are excluded from active promoters and enhancers. By specifically measuring sites of de novo methylation, we observe that enzymatic activity reflects binding. De novo methylation increases with CpG density, yet is excluded from nucleosomes. Notably, we observed selective binding of DNMT3B to the bodies of transcribed genes, which leads to their preferential methylation. This targeting to transcribed sequences requires SETD2-mediated methylation of lysine 36 on histone H3 and a functional PWWP domain of DNMT3B. Together these findings reveal how sequence and chromatin cues guide de novo methyltransferase activity to ensure methylome integrity.

  16. miR-29 Represses the Activities of DNA Methyltransferases and DNA Demethylases

    Directory of Open Access Journals (Sweden)

    Izuho Hatada

    2013-07-01

    Full Text Available Members of the microRNA-29 (miR-29 family directly target the DNA methyltransferases, DNMT3A and DNMT3B. Disturbances in the expression levels of miR-29 have been linked to tumorigenesis and tumor aggressiveness. Members of the miR-29 family are currently thought to repress DNA methylation and suppress tumorigenesis by protecting against de novo methylation. Here, we report that members of the miR-29 family repress the activities of DNA methyltransferases and DNA demethylases, which have opposing roles in control of DNA methylation status. Members of the miR-29 family directly inhibited DNA methyltransferases and two major factors involved in DNA demethylation, namely tet methylcytosine dioxygenase 1 (TET1 and thymine DNA glycosylase (TDG. Overexpression of miR-29 upregulated the global DNA methylation level in some cancer cells and downregulated DNA methylation in other cancer cells, suggesting that miR-29 suppresses tumorigenesis by protecting against changes in the existing DNA methylation status rather than by preventing de novo methylation of DNA.

  17. Chromatin Targeting of de Novo DNA Methyltransferases by the PWWP Domain

    Institute of Scientific and Technical Information of China (English)

    Ying-ZiGe; Min-TiePu; HumairaGowher; Hai-PingWu; Jian-PingDing; AlbertJeltsch; Guo-LiangXu

    2005-01-01

    DNA methylation patterns of mammalian genomes are generated in gametogenesis and early embryonic development. Two de novo DNA methyltransferases, Dnmt3a and Dnmt3b, are responsible for the process. Both en-zymes contain a long N-terminal regulatory region linked to a conserved C-terminal domain responsible forthe catalytic activity. Although a PWWP domain in the N-terminal region has been shown to bind DNA in vitro, it is unclear how the DNA methyltransferases access their substrate in chromatin in vivo. We show here that the two proteins are associated with chromatin including mitotic chromosomes in mammalian cells, and the PWWP domain is essential for the chromatin targeting of the enzymes. The functional significance of PWWPmediated chromatin targeting is suggested by the fact that a missense mutation in this domain of human DNMT3B causes immunodeficiency, centromeric heterochromatin instability, facial anomalies (ICF) syndrome, which is characterized by loss of methylation insatellite DNA, pericentromeric instability, and immunodeficiency. We demonstrate that the mutant protein completely loses its chromatin targeting capacity. Our data establish the PWWP domain as a novel chromatin/chromosome-targeting module and suggest that the PWWP-mediated chromatin association is essential for the function of the de novo methyltransferases during development.

  18. Regulation of expression and activity of DNA (cytosine-5) methyltransferases in mammalian cells.

    Science.gov (United States)

    Kinney, Shannon R Morey; Pradhan, Sriharsa

    2011-01-01

    Three active DNA (cytosine-5) methyltransferases (DNMTs) have been identified in mammalian cells, Dnmt1, Dnmt3a, and Dnmt3b. DNMT1 is primarily a maintenance methyltransferase, as it prefers to methylate hemimethylated DNA during DNA replication and in vitro. DNMT3A and DNMT3B are de novo methyltransferases and show similar activity on unmethylated and hemimethylated DNA. DNMT3L, which lacks the catalytic domain, binds to DNMT3A and DNMT3B variants and facilitates their chromatin targeting, presumably for de novo methylation. There are several mechanisms by which mammalian cells regulate DNMT levels, including varied transcriptional activation of the respective genes and posttranslational modifications of the enzymes that can affect catalytic activity, targeting, and enzyme degradation. In addition, binding of miRNAs or RNA-binding proteins can also alter the expression of DNMTs. These regulatory processes can be disrupted in disease or by environmental factors, resulting in altered DNMT expression and aberrant DNA methylation patterns.

  19. An essential role for DNA methyltransferase DNMT3B in cancer cell survival.

    Science.gov (United States)

    Beaulieu, Normand; Morin, Steves; Chute, Ian C; Robert, Marie-France; Nguyen, Hannah; MacLeod, A Robert

    2002-08-02

    Abnormal methylation and associated silencing of tumor suppressor genes is a common feature of many types of cancers. The observation of persistent methylation in human cancer cells lacking the maintenance methyltransferase DNMT1 suggests the involvement of other DNA methyltransferases in gene silencing in cancer. To test this hypothesis, we have evaluated methylation and gene expression in cancer cells specifically depleted of DNMT3A or DNMT3B, de novo methyltransferases that are expressed in adult tissues. Here we have shown that depletion of DNMT3B, but not DNMT3A, induced apoptosis of human cancer cells but not normal cells. DNMT3B depletion reactivated methylation-silenced gene expression but did not induce global or juxtacentromeric satellite demethylation as did specific depletion of DNMT1. Furthermore, the effect of DNMT3B depletion was rescued by exogenous expression of either of the splice variants DNMT3B2 or DNMT3B3 but not DNMT1. These results indicate that DNMT3B has significant site selectivity that is distinct from DNMT1, regulates aberrant gene silencing, and is essential for cancer cell survival.

  20. Methylated nucleosides in tRNA and tRNA methyltransferases

    Directory of Open Access Journals (Sweden)

    Hiroyuki eHori

    2014-05-01

    Full Text Available To date, more than 90 modified nucleosides have been found in tRNA and the biosynthetic pathways of the majority of tRNA modifications include a methylation step(s. Recent studies of the biosynthetic pathways have demonstrated that the availability of methyl group donors for the methylation in tRNA is important for correct and efficient protein synthesis. In this review, I focus on the methylated nucleosides and tRNA methyltransferases. The primary functions of tRNA methylations are linked to the different steps of protein synthesis, such as the stabilization of tRNA structure, reinforcement of the codon–anticodon interaction, regulation of wobble base pairing, and prevention of frameshift errors. However, beyond these basic functions, recent studies have demonstrated that tRNA methylations are also involved in the RNA quality control system and regulation of tRNA localization in the cell. In a thermophilic eubacterium, tRNA modifications and the modification enzymes form a network that responses to temperature changes. Furthermore, several modifications are involved in genetic diseases, infections, and the immune response. Moreover, structural, biochemical, and bioinformatics studies of tRNA methyltransferases have been clarifying the details of tRNA methyltransferases and have enabled these enzymes to be classified. In the final section, the evolution of modification enzymes is discussed.

  1. S-Adenosyl-L-methionine: macrocin O-methyltransferase activities in a series of Streptomyces fradiae mutants that produce different levels of the macrolide antibiotic tylosin.

    OpenAIRE

    Seno, E T; Baltz, R H

    1982-01-01

    A series of mutants of Streptomyces fradiae selected for increased production of the macrolide antibiotic tylosin was analyzed for levels of expression of macrocin O-methyltransferase, the enzyme which catalyzes the final step in the biosynthesis of tylosin. Increased tylosin production was accompanied by increased macrocin O-methyltransferase in some of the mutants. Increased expression of macrocin O-methyltransferase was due to more rapid early biosynthesis of the enzyme, to reduced decay o...

  2. S-Adenosyl-L-methionine: macrocin O-methyltransferase activities in a series of Streptomyces fradiae mutants that produce different levels of the macrolide antibiotic tylosin.

    OpenAIRE

    Seno, E T; Baltz, R H

    1982-01-01

    A series of mutants of Streptomyces fradiae selected for increased production of the macrolide antibiotic tylosin was analyzed for levels of expression of macrocin O-methyltransferase, the enzyme which catalyzes the final step in the biosynthesis of tylosin. Increased tylosin production was accompanied by increased macrocin O-methyltransferase in some of the mutants. Increased expression of macrocin O-methyltransferase was due to more rapid early biosynthesis of the enzyme, to reduced decay o...

  3. Epigenetic Programming of the rRNA Promoter by MBD3

    OpenAIRE

    2008-01-01

    Within the human genome there are hundreds of copies of the rRNA gene, but only a fraction of these genes are active. Silencing through epigenetics has been extensively studied; however, it is essential to understand how active rRNA genes are maintained. Here, we propose a role for the methyl-CpG binding domain protein MBD3 in epigenetically maintaining active rRNA promoters. We show that MBD3 is localized to the nucleolus, colocalizes with upstream binding factor, and binds to unmethylated r...

  4. Evolutionary dynamics of rRNA gene clusters in cichlid fish

    Directory of Open Access Journals (Sweden)

    Nakajima Rafael T

    2012-10-01

    Full Text Available Abstract Background Among multigene families, ribosomal RNA (rRNA genes are the most frequently studied and have been explored as cytogenetic markers to study the evolutionary history of karyotypes among animals and plants. In this report, we applied cytogenetic and genomic methods to investigate the organization of rRNA genes among cichlid fishes. Cichlids are a group of fishes that are of increasing scientific interest due to their rapid and convergent adaptive radiation, which has led to extensive ecological diversity. Results The present paper reports the cytogenetic mapping of the 5S rRNA genes from 18 South American, 22 African and one Asian species and the 18S rRNA genes from 3 African species. The data obtained were comparatively analyzed with previously published information related to the mapping of rRNA genes in cichlids. The number of 5S rRNA clusters per diploid genome ranged from 2 to 15, with the most common pattern being the presence of 2 chromosomes bearing a 5S rDNA cluster. Regarding 18S rDNA mapping, the number of sites ranged from 2 to 6, with the most common pattern being the presence of 2 sites per diploid genome. Furthermore, searching the Oreochromis niloticus genome database led to the identification of a total of 59 copies of 5S rRNA and 38 copies of 18S rRNA genes that were distributed in several genomic scaffolds. The rRNA genes were frequently flanked by transposable elements (TEs and spread throughout the genome, complementing the FISH analysis that detect only clustered copies of rRNA genes. Conclusions The organization of rRNA gene clusters seems to reflect their intense and particular evolutionary pathway and not the evolutionary history of the associated taxa. The possible role of TEs as one source of rRNA gene movement, that could generates the spreading of ribosomal clusters/copies, is discussed. The present paper reinforces the notion that the integration of cytogenetic data and genomic analysis provides a

  5. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    OpenAIRE

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

  6. Evolutionary dynamics of rRNA gene clusters in cichlid fish

    Science.gov (United States)

    2012-01-01

    Background Among multigene families, ribosomal RNA (rRNA) genes are the most frequently studied and have been explored as cytogenetic markers to study the evolutionary history of karyotypes among animals and plants. In this report, we applied cytogenetic and genomic methods to investigate the organization of rRNA genes among cichlid fishes. Cichlids are a group of fishes that are of increasing scientific interest due to their rapid and convergent adaptive radiation, which has led to extensive ecological diversity. Results The present paper reports the cytogenetic mapping of the 5S rRNA genes from 18 South American, 22 African and one Asian species and the 18S rRNA genes from 3 African species. The data obtained were comparatively analyzed with previously published information related to the mapping of rRNA genes in cichlids. The number of 5S rRNA clusters per diploid genome ranged from 2 to 15, with the most common pattern being the presence of 2 chromosomes bearing a 5S rDNA cluster. Regarding 18S rDNA mapping, the number of sites ranged from 2 to 6, with the most common pattern being the presence of 2 sites per diploid genome. Furthermore, searching the Oreochromis niloticus genome database led to the identification of a total of 59 copies of 5S rRNA and 38 copies of 18S rRNA genes that were distributed in several genomic scaffolds. The rRNA genes were frequently flanked by transposable elements (TEs) and spread throughout the genome, complementing the FISH analysis that detect only clustered copies of rRNA genes. Conclusions The organization of rRNA gene clusters seems to reflect their intense and particular evolutionary pathway and not the evolutionary history of the associated taxa. The possible role of TEs as one source of rRNA gene movement, that could generates the spreading of ribosomal clusters/copies, is discussed. The present paper reinforces the notion that the integration of cytogenetic data and genomic analysis provides a more complete picture for

  7. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C.; Dennis, P. P.

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  8. Identification and chromosomal distribution of 5S rRNA genes in Neurospora crassa.

    OpenAIRE

    Metzenberg, R L; Stevens, J N; Selker, E U; Morzycka-Wroblewska, E

    1985-01-01

    The 5S rRNA genes of Neurospora crassa, unlike those of most organisms, are not tandemly arranged, and they are found imbedded in a variety of unique sequences. The 5S rRNA regions of most of the genes are of one type, alpha; however, several other "isotypes" (beta, gamma, delta, zeta, and eta) are also found. We asked whether Neurospora 5S rRNA genes are dispersed on a chromosomal scale and whether genes of different isotypes are spatially segregated. We identified, by DNA sequencing, 5S rRN...

  9. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  10. Magnetic and electrical properties of Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Bodnar, I. V., E-mail: chemzav@bsuir.by [Belarusian State University of Information and Radio Electronics (Belarus); Trukhanov, S. V. [National Academy of Sciences of Belarus, Scientific and Practical Materials Research Center (Belarus); Barugu, T. H. [Belarusian State University of Information and Radio Electronics (Belarus)

    2015-10-15

    The magnetic and electrical properties of the Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystal are studied in the temperature range 4–300 K and in magnetic fields of 0–14 T. It is established that the sample under study is paramagnetic. In the ground state, short-range-order correlations typical of a spin glass with a freezing temperature of 10 K are detected. The magnetic ordering temperature is 15 K. The sample is a semiconductor with a resistivity of 3.5 kΩ cm at room temperature. For the Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystal, a mechanism for the formation of magnetic and electrical states is suggested.

  11. Characterization of the binding sites of protein L11 and the L10.(L12)4 pentameric complex in the GTPase domain of 23 S ribosomal RNA from Escherichia coli

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S R; Liljas, A

    1990-01-01

    Ribonuclease and chemical probes were used to investigate the binding sites of ribosomal protein L11 and the pentameric complex L10.(L12)4 on Escherichia coli 23 S RNA. Protein complexes were formed with an RNA fragment constituting most of domains I and II or with 23 S RNA and they were...... investigated by an end-labelling method and a reverse transcriptase procedure, respectively. The results demonstrate that the two protein moieties bind at adjacent sites within a small RNA region. The L11 binding region overlaps with those of the modified peptide antibiotics thiostrepton and micrococcin...... data, were used in a computer graphics approach to build a partial RNA tertiary structural model. The model provides insight into the topography of the L11 binding site. It also provides a structural rationale for the mutually co-operative binding of protein L11 with the antibiotics thiostrepton...

  12. Comparative 16S rRNA signatures and multilocus sequence analysis for the genus Salinicola and description of Salinicola acroporae sp. nov., isolated from coral Acropora digitifera.

    Science.gov (United States)

    Lepcha, Rinchen T; Poddar, Abhijit; Schumann, Peter; Das, Subrata K

    2015-07-01

    A novel Gram-negative, aerobic, motile marine bacterium, strain S4-41(T), was isolated from mucus of the coral Acropora digitifera from the Andaman Sea. Heterotrophic growth was observed in 0-25 % NaCl, at 15-45 °C and pH 4.5-9. In phylogenetic trees, strain S4-41(T) was grouped within the genus Salinicola but formed a separate branch distant from a cluster composed of Salinicola salarius M27(T) and Salinicola socius SMB35(T). DNA-DNA relatedness between strain S4-41(T) and these reference strains were well below 70 %. Q-9 was the sole respiratory quinone. The DNA G+C content was determined to be 63.6 mol%. Based on a polyphasic analysis, strain S4-41(T) is concluded to represent a novel species in the genus Salinicola for which the name Salinicola acroporae sp. nov. is proposed. The type strain is S4-41(T) (=JCM 30412(T) = LMG 28587(T)). Comparative 16S rRNA analysis of the genera Salinicola, Kushneria, Chromohalobacter and Cobetia revealed the presence of genus specific sequence signatures. Multilocus sequence analysis based on concatenated sequences of rRNAs (16S and 23S) and four protein coding housekeeping genes (atpA, gyrB, secA, rpoD) was found to be unnecessary for phylogenetic studies of the genus Salinicola.

  13. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    Science.gov (United States)

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  14. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    Science.gov (United States)

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  15. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  16. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    Science.gov (United States)

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  17. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    Science.gov (United States)

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  18. Detection of Babesia microti parasites by highly sensitive 18S rRNA reverse transcription PCR.

    Science.gov (United States)

    Hanron, Amelia E; Billman, Zachary P; Seilie, Annette M; Chang, Ming; Murphy, Sean C

    2017-03-01

    Babesia are increasingly appreciated as a cause of transfusion-transmitted infection. Sensitive methods are needed to screen blood products. We report herein that B. microti 18S rRNA is over 1,000-fold more abundant than its coding genes, making reverse transcription PCR (RT-PCR) much more sensitive than PCR. Babesia 18S rRNA may be useful for screening the blood supply.

  19. Low abundant spacer 5S rRNA transcripts are frequently polyadenylated in Nicotiana.

    Science.gov (United States)

    Fulnecek, Jaroslav; Kovarik, Ales

    2007-11-01

    In plants, 5S rRNA genes (5S rDNA) encoding 120-nt structural RNA molecules of ribosomes are organized in tandem arrays comprising thousands of units. Failure to correctly terminate transcription would generate longer inaccurately processed transcripts interfering with ribosome biogenesis. Hence multiple termination signals occur immediately after the 5S rRNA coding sequence. To obtain information about the efficiency of termination of 5S rDNA transcription in plants we analyzed 5S rRNA pools in three Nicotiana species, N. sylvestris, N. tomentosiformis and N. tabacum. In addition to highly abundant 120-nt 5S rRNA transcripts, we also detected RNA species composed of a genic region and variable lengths of intergenic sequences. These genic-intergenic RNA molecules occur at a frequency severalfold lower than the mature 120-nt transcripts, and are posttranscriptionally modified by polyadenylation at their 3' end in contrast to 120-nt transcripts. An absence of 5S small RNAs (smRNA) argue against a dominant role for the smRNA biosynthesis pathway in the degradation of aberrant 5S rRNA in Nicotiana. This work is the first description of polyadenylated 5S rRNA species in higher eukaryotes originating from a read-through transcription into the intergenic spacer. We propose that polyadenylation may function in a "quality control" pathway ensuring that only correctly processed molecules enter the ribosome biogenesis.

  20. rRNA Pseudogenes in Filamentous Ascomycetes as Revealed by Genome Data

    Directory of Open Access Journals (Sweden)

    Yi Li

    2017-08-01

    Full Text Available The nuclear ribosomal DNA (rDNA is considered as a paradigm of concerted evolution. Components of the rDNA tandem repeats (45S are widely used in phylogenetic studies of different organisms and the internal transcribed spacer (ITS region was recently selected as a fungal DNA bar code. However, rRNA pseudogenes, as one kind of escape from concerted evolution, were reported in a wide range of organisms, especially in plants and animals. Moreover, large numbers of 5S rRNA pseudogenes were identified in several filamentous ascomycetes. To study whether rDNA evolves in a strict concerted manner and test whether rRNA pseudogenes exist in more species of ascomycetes, intragenomic rDNA polymorphisms were analyzed using whole genome sequences. Divergent rDNA paralogs were found to coexist within a single genome in seven filamentous ascomycetes examined. A great number of paralogs were identified as pseudogenes according to the mutation and secondary structure analyses. Phylogenetic analyses of the three rRNA coding regions of the 45S rDNA repeats, i.e., 18S, 5.8S, and 28S, revealed an interspecies clustering pattern of those different rDNA paralogs. The identified rRNA pseudogenic sequences were validated using specific primers designed. Mutation analyses revealed that the repeat-induced point (RIP mutation was probably responsible for the formation of those rRNA pseudogenes.

  1. Fine-tuning the stimulation of MLL1 methyltransferase activity by a histone H3-based peptide mimetic

    Energy Technology Data Exchange (ETDEWEB)

    Avdic, Vanja; Zhang, Pamela; Lanouette, Sylvain; Voronova, Anastassia; Skerjanc, Ilona; Couture, Jean-Francois (Ottawa)

    2011-08-24

    The SET1 family of methyltransferases carries out the bulk of histone H3 Lys-4 methylation in vivo. One of the common features of this family is the regulation of their methyltransferase activity by a tripartite complex composed of WDR5, RbBP5, and Ash2L. To selectively probe the role of the SET1 family of methyltransferases, we have developed a library of histone H3 peptide mimetics and report herein the characterization of an N{alpha} acetylated form of histone H3 peptide (N{alpha}H3). Binding and inhibition studies reveal that the addition of an acetyl moiety to the N terminus of histone H3 significantly enhances its binding to WDR5 and prevents the stimulation of MLL1 methyltransferase activity by the WDR5-RbBP5-Ash2L complex. The crystal structure of N{alpha}H3 in complex with WDR5 reveals that a high-affinity hydrophobic pocket accommodates the binding of the acetyl moiety. These results provide the structural basis to control WDR5-RbBP5-Ash2L-MLL1 activity and a tool to manipulate stem cell differentiation programs.-Avdic, V., Zhang, P., Lanouette, S., Voronova, A., Skerjanc, I., Couture, J.-F. Fine-tuning the stimulation of MLL1 methyltransferase activity by a histone H3-based peptide mimetic.

  2. The catechol-O-methyltransferase inhibitory potential of Z-vallesiachotamine by in silicoand in vitro approaches

    Directory of Open Access Journals (Sweden)

    Carolina dos Santos Passos

    2015-08-01

    Full Text Available AbstractZ-Vallesiachotamine is a monoterpene indole alkaloid that has a β-N-acrylate group in its structure. This class of compounds has already been described in different Psychotriaspecies. Our research group observed that E/Z-vallesiachotamine exhibits a multifunctional feature, being able to inhibit targets related to neurodegeneration, such as monoamine oxidase A, sirtuins 1 and 2, and butyrylcholinesterase enzymes. Aiming at better characterizing the multifunctional profile of this compound, its effect on cathecol-O-methyltransferase activity was investigated. The cathecol-O-methyltransferase activity was evaluated in vitro by a fluorescence-based method, using S-(5′-adenosyl-l-methionine as methyl donor and aesculetin as substrate. The assay optimization was performed varying the concentrations of methyl donor (S-(5′-adenosyl-l-methionine and enzyme. It was observed that the highest concentrations of both factors (2.25 U of the enzyme and 100 µM of S-(5′-adenosyl-l-methionine afforded the more reproducible results. The in vitro assay demonstrated that Z-vallesiachotamine was able to inhibit the cathecol-O-methyltransferase activity with an IC50 close to 200 µM. Molecular docking studies indicated that Z-vallesiachotamine can bind the catechol pocket of catechol-O-methyltransferase enzyme. The present work demonstrated for the first time the inhibitory properties of Z-vallesiachotamine on cathecol-O-methyltransferase enzyme, affording additional evidence regarding its multifunctional effects in targets related to neurodegenerative diseases.

  3. Selenium-based S-adenosylmethionine analog reveals the mammalian seven-beta-strand methyltransferase METTL10 to be an EF1A1 lysine methyltransferase.

    Directory of Open Access Journals (Sweden)

    Tadahiro Shimazu

    Full Text Available Lysine methylation has been extensively studied in histones, where it has been shown to provide specific epigenetic marks for the regulation of gene expression; however, the molecular mechanism and physiological function of lysine methylation in proteins other than histones remains to be fully addressed. To better understand the substrate diversity of lysine methylation, S-adenosylmethionine (SAM derivatives with alkyne-moieties have been synthesized. A selenium-based SAM analog, propargylic Se-adenosyl-l-selenomethionine (ProSeAM, has a wide spectrum of reactivity against various lysine methyltransferases (KMTs with sufficient stability to support enzymatic reactions in vitro. By using ProSeAM as a chemical probe for lysine methylation, we identified substrates for two seven-beta-strand KMTs, METTL21A and METTL10, on a proteomic scale in mammalian cells. METTL21A has been characterized as a heat shock protein (HSP-70 methyltransferase. Mammalian METTL10 remains functionally uncharacterized, although its ortholog in yeast, See1, has been shown to methylate the translation elongation factor eEF1A. By using ProSeAM-mediated alkylation followed by purification and quantitative MS analysis, we confirmed that METTL21A labels HSP70 family proteins. Furthermore, we demonstrated that METTL10 also methylates the eukaryotic elongation factor EF1A1 in mammalian cells. Subsequent biochemical characterization revealed that METTL10 specifically trimethylates EF1A1 at lysine 318 and that siRNA-mediated knockdown of METTL10 decreases EF1A1 methylation levels in vivo. Thus, our study emphasizes the utility of the synthetic cofactor ProSeAM as a chemical probe for the identification of non-histone substrates of KMTs.

  4. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    Directory of Open Access Journals (Sweden)

    Marissa B Hirst

    Full Text Available Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of

  5. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Science.gov (United States)

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  6. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Directory of Open Access Journals (Sweden)

    Huijing Hao

    Full Text Available API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  7. NRMT is an alpha-N-methyltransferase that methylates RCC1 and retinoblastoma protein.

    Science.gov (United States)

    Tooley, Christine E Schaner; Petkowski, Janusz J; Muratore-Schroeder, Tara L; Balsbaugh, Jeremy L; Shabanowitz, Jeffrey; Sabat, Michal; Minor, Wladek; Hunt, Donald F; Macara, Ian G

    2010-08-26

    The post-translational methylation of alpha-amino groups was first discovered over 30 years ago on the bacterial ribosomal proteins L16 and L33 (refs 1, 2), but almost nothing is known about the function or enzymology of this modification. Several other bacterial and eukaryotic proteins have since been shown to be alpha-N-methylated. However, the Ran guanine nucleotide-exchange factor, RCC1, is the only protein for which any biological function of alpha-N-methylation has been identified. Methylation-defective mutants of RCC1 have reduced affinity for DNA and cause mitotic defects, but further characterization of this modification has been hindered by ignorance of the responsible methyltransferase. All fungal and animal N-terminally methylated proteins contain a unique N-terminal motif, Met-(Ala/Pro/Ser)-Pro-Lys, indicating that they may be targets of the same, unknown enzyme. The initiating Met is cleaved, and the exposed alpha-amino group is mono-, di- or trimethylated. Here we report the discovery of the first alpha-N-methyltransferase, which we named N-terminal RCC1 methyltransferase (NRMT). Substrate docking and mutational analysis of RCC1 defined the NRMT recognition sequence and enabled the identification of numerous new methylation targets, including SET (also known as TAF-I or PHAPII) and the retinoblastoma protein, RB. Knockdown of NRMT recapitulates the multi-spindle phenotype seen with methylation-defective RCC1 mutants, demonstrating the importance of alpha-N-methylation for normal bipolar spindle formation and chromosome segregation.

  8. DMSP: tetrahydrofolate methyltransferase from the marine sulfate-reducing bacterium strain WN

    Science.gov (United States)

    Jansen, M.; Hansen, T. A.

    2000-08-01

    Dimethylsulfoniopropionate (DMSP), an important compatible solute of many marine algae, can be metabolised by bacteria via cleavage to dimethylsulfide and acrylate or via an initial demethylation. This is the first report on the purification of an enzyme that specifically catalyses the demethylation of DMSP. The enzyme was isolated from the sulfate-reducing bacterium strain WN, which grows on DMSP and demethylates it to methylthiopropionate. DMSP:tetrahydrofolate (THF) methyltransferase from strain WN was purified 76-fold [to a specific activity of 40.5 μmol min-1 (mg protein)-1]. SDS polyacrylamide gel electrophoresis showed two bands of approximately 10 and 35 kDa; in particular the 35 kDa polypeptide became significantly enriched during the purification. Storage of the purified fraction at -20°C under nitrogen resulted in a 99% loss of activity in two days. The activity could be partially restored by addition of 200 μM cyanocobalamin, hydroxocobalamin or coenzyme B12. ATP did not have any positive effect on activity. Reduction of the assay mixture by titanium(III)nitrilotriacetic acid slightly stimulated the activity. Gel filtration chromatography revealed a native molecular mass between 45 and 60 kDa for the DMSP:THF methyltransferase. The enzyme was most active at 35°C and pH 7.8. Glycine betaine, which can be considered an N-containing structural analogue of DMSP, did not serve as a methyl donor for DMSP:THF methyltransferase. Various sulfur-containing DMSP-analogues were tested but only methylethylsulfoniopropionate served as methyl donor. None of these compounds inhibited methyl transfer from DMSP to THF. Strain WN did not grow on any of the sulfur-containing DMSP-analogues.

  9. Identification of inhibitors of Plasmodium falciparum phosphoethanolamine methyltransferase using an enzyme-coupled transmethylation assay

    Directory of Open Access Journals (Sweden)

    Voelker Dennis R

    2010-01-01

    Full Text Available Abstract Background The phosphoethanolamine methyltransferase, PfPMT, of the human malaria parasite Plasmodium falciparum, a member of a newly identified family of phosphoethanolamine methyltransferases (PMT found solely in some protozoa, nematodes, frogs, and plants, is involved in the synthesis of the major membrane phospholipid, phosphatidylcholine. PMT enzymes catalyze a three-step S-adenosylmethionine-dependent methylation of the nitrogen atom of phosphoethanolamine to form phosphocholine. In P. falciparum, this activity is a limiting step in the pathway of synthesis of phosphatidylcholine from serine and plays an important role in the development, replication and survival of the parasite within human red blood cells. Results We have employed an enzyme-coupled methylation assay to screen for potential inhibitors of PfPMT. In addition to hexadecyltrimethylammonium, previously known to inhibit PfPMT, two compounds dodecyltrimethylammonium and amodiaquine were also found to inhibit PfPMT activity in vitro. Interestingly, PfPMT activity was not inhibited by the amodiaquine analog, chloroquine, or other aminoquinolines, amino alcohols, or histamine methyltransferase inhibitors. Using yeast as a surrogate system we found that unlike wild-type cells, yeast mutants that rely on PfPMT for survival were sensitive to amodiaquine, and their phosphatidylcholine biosynthesis was inhibited by this compound. Furthermore NMR titration studies to characterize the interaction between amoidaquine and PfPMT demonstrated a specific and concentration dependent binding of the compound to the enzyme. Conclusion The identification of amodiaquine as an inhibitor of PfPMT in vitro and in yeast, and the biophysical evidence for the specific interaction of the compound with the enzyme will set the stage for the development of analogs of this drug that specifically inhibit this enzyme and possibly other PMTs.

  10. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ji Eun; Cho, Eun Ju; Kim, Ji Hong; Chung, Byung Yeoup; Kim, Jin Hong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  11. 2'-O methylation of internal adenosine by flavivirus NS5 methyltransferase.

    Directory of Open Access Journals (Sweden)

    Hongping Dong

    Full Text Available RNA modification plays an important role in modulating host-pathogen interaction. Flavivirus NS5 protein encodes N-7 and 2'-O methyltransferase activities that are required for the formation of 5' type I cap (m(7GpppAm of viral RNA genome. Here we reported, for the first time, that flavivirus NS5 has a novel internal RNA methylation activity. Recombinant NS5 proteins of West Nile virus and Dengue virus (serotype 4; DENV-4 specifically methylates polyA, but not polyG, polyC, or polyU, indicating that the methylation occurs at adenosine residue. RNAs with internal adenosines substituted with 2'-O-methyladenosines are not active substrates for internal methylation, whereas RNAs with adenosines substituted with N⁶-methyladenosines can be efficiently methylated, suggesting that the internal methylation occurs at the 2'-OH position of adenosine. Mass spectroscopic analysis further demonstrated that the internal methylation product is 2'-O-methyladenosine. Importantly, genomic RNA purified from DENV virion contains 2'-O-methyladenosine. The 2'-O methylation of internal adenosine does not require specific RNA sequence since recombinant methyltransferase of DENV-4 can efficiently methylate RNAs spanning different regions of viral genome, host ribosomal RNAs, and polyA. Structure-based mutagenesis results indicate that K61-D146-K181-E217 tetrad of DENV-4 methyltransferase forms the active site of internal methylation activity; in addition, distinct residues within the methyl donor (S-adenosyl-L-methionine pocket, GTP pocket, and RNA-binding site are critical for the internal methylation activity. Functional analysis using flavivirus replicon and genome-length RNAs showed that internal methylation attenuated viral RNA translation and replication. Polymerase assay revealed that internal 2'-O-methyladenosine reduces the efficiency of RNA elongation. Collectively, our results demonstrate that flavivirus NS5 performs 2'-O methylation of internal adenosine of

  12. Furanocoumarin biosynthesis in Ammi majus L. Cloning of bergaptol O-methyltransferase.

    Science.gov (United States)

    Hehmann, Marc; Lukacin, Richard; Ekiert, Halina; Matern, Ulrich

    2004-03-01

    Plants belonging to the Apiaceae or Rutaceae accumulate methoxylated psoralens, such as bergapten or xanthotoxin, as the final products of their furanocoumarin biosynthesis, and the rate of accumulation depends on environmental and other cues. Distinct O-methyltransferase activities had been reported to methylate bergaptol to bergapten and xanthotoxol to xanthotoxin, from induced cell cultures of Ruta graveolens, Petroselinum crispum and Ammi majus. Bergaptol 5-O-methyltransferase (BMT) cDNA was cloned from dark-grown Ammi majus L. cells treated with a crude fungal elicitor. The translated polypeptide of 38.7 kDa, composed of 354 amino acids, revealed considerable sequence similarity to heterologous caffeic acid 3-O-methyltransferases (COMTs). For homologous comparison, COMT was cloned from A. majus plants and shown to share 64% identity and about 79% similarity with the BMT sequence at the polypeptide level. Functional expression of both enzymes in Escherichia coli revealed that the BMT activity in the bacterial extracts was labile and rapidly lost on purification, whereas the COMT activity remained stable. Furthermore, the recombinant AmBMT, which was most active in potassium phosphate buffer of pH 8 at 42 degrees C, showed narrow substrate specificity for bergaptol (Km SAM 6.5 micro m; Km Bergaptol 2.8 micro m) when assayed with a variety of substrates, including xanthotoxol, while the AmCOMT accepted 5-hydroxyferulic acid, esculetin and other substrates. Dark-grown A. majus cells expressed significant BMT activity which nevertheless increased sevenfold within 8 h upon the addition of elicitor and reached a transient maximum at 8-11 h, whereas the COMT activity was rather low and did not respond to the elicitation. Complementary Northern blotting revealed that the BMT transcript abundance increased to a maximum at 7 h, while only a weak constitutive signal was observed for the COMT transcript. The AmBMT sequence thus represents a novel database accession

  13. Arabidopsis DNA methyltransferase AtDNMT2 associates with histone deacetylase AtHD2s activity

    Energy Technology Data Exchange (ETDEWEB)

    Song, Yuan [Key Laboratory of Arid and Grassland Agroecology, Ministry of Education, School of Life Science, Lanzhou University, Lanzhou 730000 (China); Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, 1391 Sandford Street, London, ON, Canada N5V4T3 (Canada); Wu, Keqiang [Institute of Plant Biology, National Taiwan University, Taipei 106, Taiwan (China); Dhaubhadel, Sangeeta [Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, 1391 Sandford Street, London, ON, Canada N5V4T3 (Canada); An, Lizhe, E-mail: lizhean@lzu.edu.cn [Key Laboratory of Arid and Grassland Agroecology, Ministry of Education, School of Life Science, Lanzhou University, Lanzhou 730000 (China); Tian, Lining, E-mail: tianl@agr.gc.ca [Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, 1391 Sandford Street, London, ON, Canada N5V4T3 (Canada)

    2010-05-28

    DNA methyltransferase2 (DNMT2) is always deemed to be enigmatic, because it contains highly conserved DNA methyltransferase motifs but lacks the DNA methylation catalytic capability. Here we show that Arabidopsis DNA methyltransferase2 (AtDNMT2) is localized in nucleus and associates with histone deacetylation. Bimolecular fluorescence complementation and pull-down assays show AtDNMT2 interacts with type-2 histone deacetylases (AtHD2s), a unique type of histone deacetylase family in plants. Through analyzing the expression of AtDNMT2: ss-glucuronidase (GUS) fusion protein, we demonstrate that AtDNMT2 has the ability to repress gene expression at transcription level. Meanwhile, the expression of AtDNMT2 gene is altered in athd2c mutant plants. We propose that AtDNMT2 possibly involves in the activity of histone deacetylation and plant epigenetic regulatory network.

  14. Histone methyltransferase G9a contributes to H3K27 methylation in vivo

    Institute of Scientific and Technical Information of China (English)

    Hui Wu; Bing Zhu; Xiuzhen Chen; Jun Xiong; Yingfeng Li; Hong Li; Xiaojun Ding; Sheng Liu; She Chen; Shaorong Gao

    2011-01-01

    @@ Dear Editor, Histone modifications play a vital role in the conformation and function of their associated chromatin templates[1].Histone H3K27 methylation mediated by the PRC2 complex is critical for transcriptional regulation,Polycomb silencing,Drosophila segmentation,mammalian X inactivation and cancer[1].Interestingly,H3K27me1(H3 mono-methylated at residue K27)levels in vivo remain unaffected after PRC2 disruption[2,3],which is an indication for the existence of other contributing histone methyltransferase(s)to H3K27me1.

  15. Queen pheromones modulate DNA methyltransferase activity in bee and ant workers.

    Science.gov (United States)

    Holman, Luke; Trontti, Kalevi; Helanterä, Heikki

    2016-01-01

    DNA methylation is emerging as an important regulator of polyphenism in the social insects. Research has concentrated on differences in methylation between queens and workers, though we hypothesized that methylation is involved in mediating other flexible phenotypes, including pheromone-dependent changes in worker behaviour and physiology. Here, we find that exposure to queen pheromone affects the expression of two DNA methyltransferase genes in Apis mellifera honeybees and in two species of Lasius ants, but not in Bombus terrestris bumblebees. These results suggest that queen pheromones influence the worker methylome, pointing to a novel proximate mechanism for these key social signals. © 2016 The Author(s).

  16. DNA Methyltransferase Gene dDnmt2 and Longevity of Drosophila

    Institute of Scientific and Technical Information of China (English)

    Meng-JauLin; Lin-YaTang; M.NarsaReddy; C.K.JamesShen

    2005-01-01

    The DNA methylation program of the fruit fly Drosophila melanogaster is carried out by the single DNA methyltransferase gene dDnmt2, the function of which is unknown before. We present evidence that intactness of the gene is required for maintenance of the normal life span of the fruit flies. In contrast, overexpression of dDnmt2 could extend Drosophila life span. The study links the Drosophila DNA methylation program with the small heatshock proteins and longevity/aging and has interesting implication on the eukaryotic DNA methyl-ation programs in general.

  17. Protein lysine methyltransferase G9a acts on non-histone targets

    Science.gov (United States)

    Rathert, Philipp; Dhayalan, Arunkumar; Murakami, Marie; Zhang, Xing; Tamas, Raluca; Jurkowska, Renata; Komatsu, Yasuhiko; Shinkai, Yoichi; Cheng, Xiaodong; Jeltsch, Albert

    2009-01-01

    By methylation of peptide arrays, we determined the specificity profile of the protein methyltransferase G9a. We show that it mostly recognizes an Arg-Lys sequence and that its activity is inhibited by methylation of the arginine residue. Using the specificity profile, we identified new non-histone protein targets of G9a, including CDYL1, WIZ, ACINUS and G9a (automethylation), as well as peptides derived from CSB. We demonstrate potential downstream signaling pathways for methylation of non-histone proteins. PMID:18438403

  18. Aryl Pyrazoles as Potent Inhibitors of Arginine Methyltransferases: Identification of the First PRMT6 Tool Compound.

    Science.gov (United States)

    Mitchell, Lorna H; Drew, Allison E; Ribich, Scott A; Rioux, Nathalie; Swinger, Kerren K; Jacques, Suzanne L; Lingaraj, Trupti; Boriack-Sjodin, P Ann; Waters, Nigel J; Wigle, Tim J; Moradei, Oscar; Jin, Lei; Riera, Tom; Porter-Scott, Margaret; Moyer, Mikel P; Smith, Jesse J; Chesworth, Richard; Copeland, Robert A

    2015-06-11

    A novel aryl pyrazole series of arginine methyltransferase inhibitors has been identified. Synthesis of analogues within this series yielded the first potent, selective, small molecule PRMT6 inhibitor tool compound, EPZ020411. PRMT6 overexpression has been reported in several cancer types suggesting that inhibition of PRMT6 activity may have therapeutic utility. Identification of EPZ020411 provides the field with the first small molecule tool compound for target validation studies. EPZ020411 shows good bioavailability following subcutaneous dosing in rats making it a suitable tool for in vivo studies.

  19. Crystal structure of phosphoethanolamine methyltransferase from Plasmodium falciparum in complex with amodiaquine

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Soon Goo; Alpert, Tara D.; Jez, Joseph M. (WU)

    2012-07-17

    Phosphoethanolamine N-methyltransferase (PMT) is essential for phospholipid biogenesis in the malarial parasite Plasmodium falciparum. PfPMT catalyzes the triple methylation of phosphoethanolamine to produce phosphocholine, which is then used for phosphatidylcholine synthesis. Here we describe the 2.0 {angstrom} resolution X-ray crystal structure of PfPMT in complex with amodiaquine. To better characterize inhibition of PfPMT by amodiaquine, we determined the IC{sub 50} values of a series of aminoquinolines using a direct radiochemical assay. Both structural and functional analyses provide a possible approach for the development of new small molecule inhibitors of PfPMT.

  20. Synthesis and Evaluation of Heterocyclic Catechol Mimics as Inhibitors of Catechol-O-methyltransferase (COMT)

    Science.gov (United States)

    2015-01-01

    3-Hydroxy-4-pyridinones and 5-hydroxy-4-pyrimidinones were identified as inhibitors of catechol-O-methyltransferase (COMT) in a high-throughput screen. These heterocyclic catechol mimics exhibit potent inhibition of the enzyme and an improved toxicity profile versus the marketed nitrocatechol inhibitors tolcapone and entacapone. Optimization of the series was aided by X-ray cocrystal structures of the novel inhibitors in complex with COMT and cofactors SAM and Mg2+. The crystal structures suggest a mechanism of inhibition for these heterocyclic inhibitors distinct from previously disclosed COMT inhibitors. PMID:25815153

  1. Synthesis and optimization of N-heterocyclic pyridinones as catechol-O-methyltransferase (COMT) inhibitors.

    Science.gov (United States)

    Zhao, Zhijian; Harrison, Scott T; Schubert, Jeffrey W; Sanders, John M; Polsky-Fisher, Stacey; Zhang, Nanyan Rena; McLoughlin, Debra; Gibson, Christopher R; Robinson, Ronald G; Sachs, Nancy A; Kandebo, Monika; Yao, Lihang; Smith, Sean M; Hutson, Pete H; Wolkenberg, Scott E; Barrow, James C

    2016-06-15

    A series of N-heterocyclic pyridinone catechol-O-methyltransferase (COMT) inhibitors were synthesized. Physicochemical properties, including ligand lipophilic efficiency (LLE) and clogP, were used to guide compound design and attempt to improve inhibitor pharmacokinetics. Incorporation of heterocyclic central rings provided improvements in physicochemical parameters but did not significantly reduce in vitro or in vivo clearance. Nevertheless, compound 11 was identified as a potent inhibitor with sufficient in vivo exposure to significantly affect the dopamine metabolites homovanillic acid (HVA) and dihydroxyphenylacetic acid (DOPAC), and indicate central COMT inhibition.

  2. The 'de novo' DNA methyltransferase Dnmt3b compensates the Dnmt1-deficient intestinal epithelium.

    Science.gov (United States)

    Elliott, Ellen N; Sheaffer, Karyn L; Kaestner, Klaus H

    2016-01-25

    Dnmt1 is critical for immediate postnatal intestinal development, but is not required for the survival of the adult intestinal epithelium, the only rapidly dividing somatic tissue for which this has been shown. Acute Dnmt1 deletion elicits dramatic hypomethylation and genomic instability. Recovery of DNA methylation state and intestinal health is dependent on the de novo methyltransferase Dnmt3b. Ablation of both Dnmt1 and Dnmt3b in the intestinal epithelium is lethal, while deletion of either Dnmt1 or Dnmt3b has no effect on survival. These results demonstrate that Dnmt1 and Dnmt3b cooperate to maintain DNA methylation and genomic integrity in the intestinal epithelium.

  3. Discovery and development of DNA methyltransferase inhibitors using in silico approaches.

    Science.gov (United States)

    Medina-Franco, José L; Méndez-Lucio, Oscar; Dueñas-González, Alfonso; Yoo, Jakyung

    2015-05-01

    Multiple strategies have evolved during the past few years to advance epigenetic compounds targeting DNA methyltransferases (DNMTs). Significant progress has been made in HTS, lead optimization and determination of 3D structures of DNMTs. In light of the emerging concept of epi-informatics, computational approaches are employed to accelerate the development of DNMT inhibitors helping to screen chemical databases, mine the DNMT-relevant chemical space, uncover SAR and design focused libraries. Computational methods also synergize with natural-product-based drug discovery and drug repurposing. Herein, we survey the latest developments of in silico approaches to advance epigenetic drug and probe discovery targeting DNMTs.

  4. Mutations of mitochondrial 12S rRNA in gastric carcinoma and their significance

    Institute of Scientific and Technical Information of China (English)

    Cheng-Bo Han; Jia-Ming Ma; Yan Xin; Xiao-Yun Mao; Yu-Jie Zhao; Dong-Ying Wu; Su-Min Zhang; Yu-Kui Zhang

    2005-01-01

    AIM: To detect the variations of mitochondrial 12S rRNA in patients with gastric carcinoma, and to study their significance and the relationship between these variations and the genesis of gastric carcinoma.METHODS: PCR amplified mitochondrial 12S rRNA of 44 samples including 22 from gastric carcinoma tissues and 22 from adjacent normal tissues, was detected by direct DNA sequencing. Then laser capture microdissection technique (LCM) was used to separate the cancerous cells and dysplasia cells with specific mutations. Denaturing high performance liquid chromatography (DHPLC) plus allele-specific PCR (ASPCR), nest-PCR and polyacrylamide gel electrophoresis (PAGE)were used to further evaluate this mutant property and quantitative difference of mutant type between cancerous and dysplasia cells. Finally, RNAdraw biosoft was used to analyze the RNA secondary structure of mutant-type 12S rRNA.RESULTS: Compared with Mitomap database, some new variations were found, among which np652 G insertion and np716 T-G transversion were found only in cancerous tissues.There was a statistic difference in the frequency of 12S rRNA variation between intestinal type (12/17, 70.59%) and diffusive type (5/17, 29.41%) of gastric carcinoma (P<0.05).DHPLC analysis showed that 12S rRNA np652 G insertion and np716 T-G transversion were heteroplasmic mutations.The frequency of 12S rRNA variation in cancerous cells was higher than that in dysplasia cells (P<0.01). 12S rRNA np652 G insertion showed obviously negative effects on the stability of 12S rRNA secondary structure, while others such as T-G transversion did not.CONCLUSION: The mutations of mitochondrial 12S rRNA may be associated with the occurrence of intestinal-type gastric carcinoma. Most variations exist both in gastric carcinomas and in normal tissues, and they might not be the characteristics of tumors. However, np652 G insertion and np716 T-G transversion may possess some molecular significance in gastric carcinogenesis. During

  5. Rapid in vivo exploration of a 5S rRNA neutral network.

    Science.gov (United States)

    Zhang, Zhengdong D; Nayar, Madhavi; Ammons, David; Rampersad, Joanne; Fox, George E

    2009-02-01

    A partial knockout compensation method to screen 5S ribosomal RNA sequence variants in vivo is described. The system utilizes an Escherichia coli strain in which five of eight genomic 5S rRNA genes were deleted in conjunction with a plasmid which is compensatory when carrying a functionally active 5S rRNA. The partial knockout strain is transformed with a population of potentially compensatory plasmids each carrying a randomly generated 5S rRNA gene variant. a The ability to compensate the slow growth rate of the knockout strain is used in conjunction with sequencing to rapidly identify variant 5S rRNAs that are functional as well as those that likely are not. The assay is validated by showing that the growth rate of 15 variants separately expressed in the partial knockout strain can be accurately correlated with in vivo assessments of the potential validity of the same variants. A region of 5S rRNA was mutagenized with this approach and nine novel variants were recovered and characterized. Unlike a complete knockout system, the method allows recovery of both deleterious and functional variants.. The method can be used to study variants of any 5S rRNA in the E. coli context including those of E. coli.

  6. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA.

    Science.gov (United States)

    Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W Brad

    2009-05-01

    Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element.

  8. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  9. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    Science.gov (United States)

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  10. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    Directory of Open Access Journals (Sweden)

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  11. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  12. Caracterização da região espaçadora 16-23S rDNA para diferenciação de estirpes de rizóbios utilizadas na produção de inoculantes comerciais no Brasil Characterization of the spacer region 16-23S rDNA for differentiation of strains of rhizobia used in the production of commercial inoculants in Brazil

    Directory of Open Access Journals (Sweden)

    Andréia Mara Rotta Oliveira

    2012-08-01

    Full Text Available A identificação de estirpes de rizóbio tem sido feita pela especificidade por hospedeiros e ensaios microbiológicos tradicionais. Por constituírem um grupo filogeneticamente heterogêneo, diferentes técnicas moleculares têm sido empregadas para auxiliar na caracterização genética e na identificação de estirpes eficientes e competitivas para a produção de inoculantes. Este trabalho teve por objetivos caracterizar a região espaçadora 16S-23S rDNA das estirpes de rizóbios utilizadas nos inoculantes comercializados no Brasil para espécies leguminosas, utilizando a técnica da PCR em combinação com a de RFLP, e avaliar a possibilidade do uso desse marcador molecular como método auxiliar para identificação das estipes. A amplificação da região espaçadora 16-23 S rDNA das estirpes de rizóbios gerou fragmentos com tamanhos que variaram entre 700pb e 1350pb. Os produtos resultantes da amplificação foram submetidos à digestão com as endonucleases. Mps I, Dde I e Hae III. Os resultados obtidos neste estudo indicam a possibilidade do uso da técnica de PCR-RFLP da região espaçadora 16S-23S rDNA como marcador molecular para a diferenciar as estirpes de rizóbios, em complemento às técnicas microbiológicas tradicionais. Contudo, este marcador não é suficientemente discriminatório para ser usado na identificação das estirpes recomendadas para a produção de inoculantes comerciais.The identification of strains of rhizobia has been made by host specificity and regular microbiological tests. By forming a phylogenetically heterogeneous group, different molecular techniques have been employed to assist in the genetic characterization and identification of efficient and competitive strains for production of inoculants. This study aimed to characterize the spacer region 16S-23S rDNA of the strains of rhizobia used in commercial inoculants in Brazil for legume species, using PCR combined with RFLP, and assess the possibility

  13. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  14. Regulation of DNA replication and chromosomal polyploidy by the MLL-WDR5-RBBP5 methyltransferases

    Science.gov (United States)

    Lu, Fei; Wu, Xiaojun; Yin, Feng; Chia-Fang Lee, Christina; Yu, Min; Mihaylov, Ivailo S.; Yu, Jiekai; Sun, Hong

    2016-01-01

    ABSTRACT DNA replication licensing occurs on chromatin, but how the chromatin template is regulated for replication remains mostly unclear. Here, we have analyzed the requirement of histone methyltransferases for a specific type of replication: the DNA re-replication induced by the downregulation of either Geminin, an inhibitor of replication licensing protein CDT1, or the CRL4CDT2 ubiquitin E3 ligase. We found that siRNA-mediated reduction of essential components of the MLL-WDR5-RBBP5 methyltransferase complexes including WDR5 or RBBP5, which transfer methyl groups to histone H3 at K4 (H3K4), suppressed DNA re-replication and chromosomal polyploidy. Reduction of WDR5/RBBP5 also prevented the activation of H2AX checkpoint caused by re-replication, but not by ultraviolet or X-ray irradiation; and the components of MLL complexes co-localized with the origin recognition complex (ORC) and MCM2-7 replicative helicase complexes at replication origins to control the levels of methylated H3K4. Downregulation of WDR5 or RBBP5 reduced the methylated H3K4 and suppressed the recruitment of MCM2-7 complexes onto replication origins. Our studies indicate that the MLL complexes and H3K4 methylation are required for DNA replication but not for DNA damage repair. PMID:27744293

  15. Comparative analysis of DNA methyltransferase gene family in fungi: a focus on Basidiomycota

    Directory of Open Access Journals (Sweden)

    Ruirui Huang

    2016-10-01

    Full Text Available DNA methylation plays a crucial role in the regulation of gene expression in eukaryotes. Mushrooms belonging to the phylum Basidiomycota are highly valued for both nutritional and pharmaceutical uses. A growing number of studies have demonstrated the significance of DNA methylation in the development of plants and animals. However, our understanding of DNA methylation in mushrooms is limited. In this study, we identified and conducted comprehensive analyses on DNA methyltransferases (DNMtases in representative species from Basidiomycota and Ascomycota, and obtained new insights into their classification and characterization in fungi. Our results revealed that DNMtases in basidiomycetes can be divided into two classes, the Dnmt1 class and the newly defined Rad8 class. We also demonstrated that the fusion event between the characteristic domains of the DNMtases family and Snf2 family in the Rad8 class is fungi-specific, possibly indicating a functional novelty of Rad8 DNMtases in fungi. Additionally, expression profiles of DNMtases in the edible mushroom Pleurotus ostreatus revealed diverse expression patterns in various organs and developmental stages. For example, DNMtase genes displayed higher expression levels in dikaryons than in monokaryons. Consistent with the expression profiles, we found that dikaryons are more susceptible to the DNA methyltransferase inhibitor 5-azacytidine. Taken together, our findings pinpoint an important role of DNA methylation during the growth of mushrooms and provide a foundation for understanding of DNMtases in basidiomycetes.

  16. Comparative Analysis of DNA Methyltransferase Gene Family in Fungi: A Focus on Basidiomycota

    Science.gov (United States)

    Huang, Ruirui; Ding, Qiangqiang; Xiang, Yanan; Gu, Tingting; Li, Yi

    2016-01-01

    DNA methylation plays a crucial role in the regulation of gene expression in eukaryotes. Mushrooms belonging to the phylum Basidiomycota are highly valued for both nutritional and pharmaceutical uses. A growing number of studies have demonstrated the significance of DNA methylation in the development of plants and animals. However, our understanding of DNA methylation in mushrooms is limited. In this study, we identified and conducted comprehensive analyses on DNA methyltransferases (DNMtases) in representative species from Basidiomycota and Ascomycota, and obtained new insights into their classification and characterization in fungi. Our results revealed that DNMtases in basidiomycetes can be divided into two classes, the Dnmt1 class and the newly defined Rad8 class. We also demonstrated that the fusion event between the characteristic domains of the DNMtases family and Snf2 family in the Rad8 class is fungi-specific, possibly indicating a functional novelty of Rad8 DNMtases in fungi. Additionally, expression profiles of DNMtases in the edible mushroom Pleurotus ostreatus revealed diverse expression patterns in various organs and developmental stages. For example, DNMtase genes displayed higher expression levels in dikaryons than in monokaryons. Consistent with the expression profiles, we found that dikaryons are more susceptible to the DNA methyltransferase inhibitor 5-azacytidine. Taken together, our findings pinpoint an important role of DNA methylation during the growth of mushrooms and provide a foundation for understanding of DNMtases in basidiomycetes. PMID:27818666

  17. X-ray crystal structure of N-6 adenine deoxyribose nucleic acid methyltransferase from Streptococcus pneumoniae

    Science.gov (United States)

    Tran, Phidung Hong

    X-ray diffraction by using resonant anomalous scattering has become a popular tool for solving crystal structures in the last ten years with the expanded availability of tunable synchrotron radiation for protein crystallography. Mercury atoms were used for phasing. The crystal structure of N-6 deoxyribose nucleic acid methyltransferase from Streptoccocus pneumoniae (DpnM) was solved by using the Multiple Anomalous Diffraction technique. The crystal structure reveals the formation of mercaptide between the mercury ion and the thiol group on the cysteine amino acid in a hydrophobic environment. The crystal structure contains the bound ligand, S- adenosyl-l-methionine on the surface of the concave opening. The direction of the β-strands on the beta sheets are identical to other solved methyltransferases. The highly conserved motifs, DPPY and the FxGxG, are found to be important in ligand binding and possibly in methyl group transfer. The structure has a concave cleft with an opening on the order of 30 Å that can accommodate a DNA duplex. By molecular modelling coupled to sequence alignment, two other highly conserved residues Arg21 and Gly19 are found to be important in catalysis.

  18. Identification and characterization of new molecular partners for the protein arginine methyltransferase 6 (PRMT6.

    Directory of Open Access Journals (Sweden)

    Alessandra Lo Sardo

    Full Text Available PRMT6 is a protein arginine methyltransferase that has been implicated in transcriptional regulation, DNA repair, and human immunodeficiency virus pathogenesis. Only few substrates of this enzyme are known and therefore its cellular role is not well understood. To identify in an unbiased manner substrates and potential regulators of PRMT6 we have used a yeast two-hybrid approach. We identified 36 new putative partners for PRMT6 and we validated the interaction in vivo for 7 of them. In addition, using invitro methylation assay we identified 4 new substrates for PRMT6, extending the involvement of this enzyme to other cellular processes beyond its well-established role in gene expression regulation. Holistic approaches create molecular connections that allow to test functional hypotheses. The assembly of PRMT6 protein network allowed us to formulate functional hypotheses which led to the discovery of new molecular partners for the architectural transcription factor HMGA1a, a known substrate for PRMT6, and to provide evidences for a modulatory role of HMGA1a on the methyltransferase activity of PRMT6.

  19. Molecular basis of RNA guanine-7 methyltransferase (RNMT) activation by RAM.

    Science.gov (United States)

    Varshney, Dhaval; Petit, Alain-Pierre; Bueren-Calabuig, Juan A; Jansen, Chimed; Fletcher, Dan A; Peggie, Mark; Weidlich, Simone; Scullion, Paul; Pisliakov, Andrei V; Cowling, Victoria H

    2016-12-01

    Maturation and translation of mRNA in eukaryotes requires the addition of the 7-methylguanosine cap. In vertebrates, the cap methyltransferase, RNA guanine-7 methyltransferase (RNMT), has an activating subunit, RNMT-Activating Miniprotein (RAM). Here we report the first crystal structure of the human RNMT in complex with the activation domain of RAM. A relatively unstructured and negatively charged RAM binds to a positively charged surface groove on RNMT, distal to the active site. This results in stabilisation of a RNMT lobe structure which co-evolved with RAM and is required for RAM binding. Structure-guided mutagenesis and molecular dynamics simulations reveal that RAM stabilises the structure and positioning of the RNMT lobe and the adjacent α-helix hinge, resulting in optimal positioning of helix A which contacts substrates in the active site. Using biophysical and biochemical approaches, we observe that RAM increases the recruitment of the methyl donor, AdoMet (S-adenosyl methionine), to RNMT. Thus we report the mechanism by which RAM allosterically activates RNMT, allowing it to function as a molecular rheostat for mRNA cap methylation. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. A Remodeled Protein Arginine Methyltransferase 1 (PRMT1) Generates Symmetric Dimethylarginine*

    Science.gov (United States)

    Gui, Shanying; Gathiaka, Symon; Li, Jun; Qu, Jun; Acevedo, Orlando; Hevel, Joan M.

    2014-01-01

    Protein arginine methylation is emerging as a significant post-translational modification involved in various cell processes and human diseases. As the major arginine methylation enzyme, protein arginine methyltransferase 1 (PRMT1) strictly generates monomethylarginine and asymmetric dimethylarginine (ADMA), but not symmetric dimethylarginine (SDMA). The two types of dimethylarginines can lead to distinct biological outputs, as highlighted in the PRMT-dependent epigenetic control of transcription. However, it remains unclear how PRMT1 product specificity is regulated. We discovered that a single amino acid mutation (Met-48 to Phe) in the PRMT1 active site enables PRMT1 to generate both ADMA and SDMA. Due to the limited amount of SDMA formed, we carried out quantum mechanical calculations to determine the free energies of activation of ADMA and SDMA synthesis. Our results indicate that the higher energy barrier of SDMA formation (ΔΔG‡ = 3.2 kcal/mol as compared with ADMA) may explain the small amount of SDMA generated by M48F-PRMT1. Our study reveals unique energetic challenges for SDMA-forming methyltransferases and highlights the exquisite control of product formation by active site residues in the PRMTs. PMID:24478314

  1. Biochemical characterization of maintenance DNA methyltransferase DNMT-1 from silkworm, Bombyx mori.

    Science.gov (United States)

    Mitsudome, Takumi; Mon, Hiroaki; Xu, Jian; Li, Zhiqing; Lee, Jae Man; Patil, Anandrao Ashok; Masuda, Atsushi; Iiyama, Kazuhiro; Morokuma, Daisuke; Kusakabe, Takahiro

    2015-03-01

    DNA methylation is an important epigenetic mechanism involved in gene expression of vertebrates and invertebrates. In general, DNA methylation profile is established by de novo DNA methyltransferases (DNMT-3A, -3B) and maintainance DNA methyltransferase (DNMT-1). DNMT-1 has a strong substrate preference for hemimethylated DNA over the unmethylated one. Because the silkworm genome lacks an apparent homologue of de novo DNMT, it is still unclear that how silkworm chromosome establishes and maintains its DNA methylation profile. As the first step to unravel this enigma, we purified recombinant BmDNMT-1 using baculovirus expression system and characterized its DNA-binding and DNA methylation activity. We found that the BmDNMT-1 preferentially methylates hemimethylated DNA despite binding to both unmethylated and hemimethylated DNA. Interestingly, BmDNMT-1 formed a complex with DNA in the presence or absence of methyl group donor, S-Adenosylmethionine (AdoMet) and the AdoMet-dependent complex formation was facilitated by Zn(2+) and Mn(2+). Our results provide clear evidence that BmDNMT-1 retained the function as maintenance DNMT but its sensitivity to metal ions is different from mammalian DNMT-1.

  2. The Histone Methyltransferase Activity of MLL1 Is Dispensable for Hematopoiesis and Leukemogenesis

    Directory of Open Access Journals (Sweden)

    Bibhu P. Mishra

    2014-05-01

    Full Text Available Despite correlations between histone methyltransferase (HMT activity and gene regulation, direct evidence that HMT activity is responsible for gene activation is sparse. We address the role of the HMT activity for MLL1, a histone H3 lysine 4 (H3K4 methyltransferase critical for maintaining hematopoietic stem cells (HSCs. Here, we show that the SET domain, and thus HMT activity of MLL1, is dispensable for maintaining HSCs and supporting leukemogenesis driven by the MLL-AF9 fusion oncoprotein. Upon Mll1 deletion, histone H4 lysine 16 (H4K16 acetylation is selectively depleted at MLL1 target genes in conjunction with reduced transcription. Surprisingly, inhibition of SIRT1 is sufficient to prevent the loss of H4K16 acetylation and the reduction in MLL1 target gene expression. Thus, recruited MOF activity, and not the intrinsic HMT activity of MLL1, is central for the maintenance of HSC target genes. In addition, this work reveals a role for SIRT1 in opposing MLL1 function.

  3. Molecular characterization of O-methyltransferases involved in isoquinoline alkaloid biosynthesis in Coptis japonica

    Science.gov (United States)

    MORISHIGE, Takashi; TAMAKOSHI, Masanori; TAKEMURA, Tomoya; SATO, Fumihiko

    2010-01-01

    O-Methyltransferases, which catalyze the production of small molecules in plants, play a crucial role in determining biosynthetic pathways in secondary metabolism because of their strict substrate specificity. Using three O-methyltransferase (OMT) cDNAs that are involved in berberine biosynthesis, we investigated the structure that was essential for this substrate specificity and the possibility of creating a chimeric enzyme with novel substrate specificity. Since each OMT has a relatively well-conserved C-terminal putative S-adenosyl-L-methionine-binding domain, we first exchanged the N-terminal halves of different OMTs. Among the 6 combinations that we tested for creating chimeric OMTs, 5 constructs produced detectable amounts of recombinant proteins, and only one of these with an N-terminal half of 6-OMT and a C-terminal half of 4′-OMT (64′-OMT) showed methylation activity with isoquinoline alkaloids as a substrate. Further enzymological analysis of 64′-OMT reaction product indicated that 64′-OMT retained the regio-specificity of 6-OMT. Further examination of the N-terminal region of 64′-OMT showed that about 90 amino acid residues in the N-terminal half were critical for reaction specificity. The creation of OMTs with novel reactivity is discussed. PMID:20689233

  4. Comparative Analysis of DNA Methyltransferase Gene Family in Fungi: A Focus on Basidiomycota.

    Science.gov (United States)

    Huang, Ruirui; Ding, Qiangqiang; Xiang, Yanan; Gu, Tingting; Li, Yi

    2016-01-01

    DNA methylation plays a crucial role in the regulation of gene expression in eukaryotes. Mushrooms belonging to the phylum Basidiomycota are highly valued for both nutritional and pharmaceutical uses. A growing number of studies have demonstrated the significance of DNA methylation in the development of plants and animals. However, our understanding of DNA methylation in mushrooms is limited. In this study, we identified and conducted comprehensive analyses on DNA methyltransferases (DNMtases) in representative species from Basidiomycota and Ascomycota, and obtained new insights into their classification and characterization in fungi. Our results revealed that DNMtases in basidiomycetes can be divided into two classes, the Dnmt1 class and the newly defined Rad8 class. We also demonstrated that the fusion event between the characteristic domains of the DNMtases family and Snf2 family in the Rad8 class is fungi-specific, possibly indicating a functional novelty of Rad8 DNMtases in fungi. Additionally, expression profiles of DNMtases in the edible mushroom Pleurotus ostreatus revealed diverse expression patterns in various organs and developmental stages. For example, DNMtase genes displayed higher expression levels in dikaryons than in monokaryons. Consistent with the expression profiles, we found that dikaryons are more susceptible to the DNA methyltransferase inhibitor 5-azacytidine. Taken together, our findings pinpoint an important role of DNA methylation during the growth of mushrooms and provide a foundation for understanding of DNMtases in basidiomycetes.

  5. Histone methyltransferase 1 regulates the encystation process in the parasite Giardia lamblia.

    Science.gov (United States)

    Salusso, Agostina; Zlocowski, Natacha; Mayol, Gonzalo F; Zamponi, Nahuel; Rópolo, Andrea S

    2017-08-01

    In eukaryotes, histone lysine methylation is associated with either active or repressed chromatin states, depending on the status of methylation. Even when the amino-terminus of Giardia lamblia histones diverges from other organisms, these regions contain lysine residues that are potential targets for methylation. When we examined the role of the histone methyltransferase 1 (HMT1) in the regulation of the encystation process by giardial histone methyltransferase 1 (GlHMT1) overexpression or downregulation, we observed an increase or a decrease in cyst production, respectively, compared to wild-type trophozoites. A time-lapse analysis of encystation showed that overexpression of GlHMT1 induced an earlier and faster process than in wild-type cells together with an upregulation of mRNA expression of cyst wall proteins. Subcellular localization studies indicated that GlHMT1-hemaglutinin was mainly associated with the nuclear and perinuclear region in both growing and encysting parasites, in agreement with bioinformatics analyses showing that GlHMT-1 possesses nuclear localization signals in addition to the classical SU(var)3-9, Enhancer-of-Zeste, Trithorax (SET), and post-SET domains. Altogether, these findings suggest that the function of HMT1 is critical for the success and timing of the encystation process, and reinforce the idea that epigenetic marks are critical for cyst formation in G. lamblia. © 2017 Federation of European Biochemical Societies.

  6. Overexpression of INCREASED CAMBIAL ACTIVITY, a putative methyltransferase, increases cambial activity and plant growth

    Institute of Scientific and Technical Information of China (English)

    Hyunsook Kim; Mikiko Kojima; Daeseok Choi; Soyoung Park; Minami Matsui; Hitoshi Sakakibara; Ildoo Hwang

    2016-01-01

    Cambial activity is a prerequisite for secondary growth in plants; however, regulatory factors control ing the activity of the secondary meristem in radial growth remain elusive. Here, we identified INCREASED CAMBIAL ACTIVITY (ICA), a gene encoding a putative pectin methyltransferase, which could function as a modulator for the meristematic activity of fascicular and interfascicular cambium in Arabidopsis. An overexpressing transgenic line, 35S::ICA, showed accelerated stem elongation and radial thickening, resulting in increased accumulation of biomass, and increased levels of cytokinins (CKs) and gibberel ins (GAs). Expression of genes encoding pectin methylesterases involved in pectin modification together with pectin methyltransferases was highly induced in 35S::ICA, which might contribute to an increase of methanol emission as a byproduct in 35S::ICA. Methanol treatment induced the expression of GA-or CK-responsive genes and stimulated plant growth. Overal , we propose that ectopic expression of ICA increases cambial activity by regulating CK and GA homeostasis, and methanol emission, eventual y leading to stem elongation and radial growth in the inflorescence stem.

  7. Discovery of Potent and Selective Inhibitors for G9a-Like Protein (GLP) Lysine Methyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Xiong, Yan; Li, Fengling; Babault, Nicolas; Dong, Aiping; Zeng, Hong; Wu, Hong; Chen, Xin; Arrowsmith, Cheryl H.; Brown, Peter J.; Liu, Jing; Vedadi, Masoud; Jin, Jian

    2017-02-14

    G9a-like protein (GLP) and G9a are highly homologous protein lysine methyltransferases (PKMTs) sharing approximately 80% sequence identity in their catalytic domains. GLP and G9a form a heterodimer complex and catalyze mono- and dimethylation of histone H3 lysine 9 and nonhistone substrates. Although they are closely related, GLP and G9a possess distinct physiological and pathophysiological functions. Thus, GLP or G9a selective small-molecule inhibitors are useful tools to dissect their distinct biological functions. We previously reported potent and selective G9a/GLP dual inhibitors including UNC0638 and UNC0642. Here we report the discovery of potent and selective GLP inhibitors including 4 (MS0124) and 18 (MS012), which are >30-fold and 140-fold selective for GLP over G9a and other methyltransferases, respectively. The cocrystal structures of GLP and G9a in the complex with either 4 or 18 displayed virtually identical binding modes and interactions, highlighting the challenges in structure-based design of selective inhibitors for either enzyme.

  8. Human catechol-O-methyltransferase: Cloning and expression of the membrane-associated form

    Energy Technology Data Exchange (ETDEWEB)

    Bertocci, B.; Miggiano, V.; Da Prada, M.; Dembic, Z.; Lahm, H.W.; Malherbe, P. (F. Hoffmann-La Roche Ltd., Basel (Switzerland))

    1991-02-15

    A cDNA clone for human catechol-O-methyltransferase was isolated from a human hepatoma cell line (Hep G2) cDNA library by hybridization screening with a porcine cDNA probe. The cDNA clone was sequenced and found to have an insert of 1226 nucleotides. The deduced primary structure of hCOMT is composed of 271 amino acid residues with the predicted molecular mass of 30 kDa. At its N terminus it has a hydrophobic segment of 21 amino acid residues that may be responsible for insertion of hCOMT into the endoplasmic reticulum membrane. The primary structure of hCOMT exhibits high homology to the porcine partial cDNA sequence (93%). The deduced amino acid sequence contains two tryptic peptide sequences (T-22, T-33) found in porcine liver catechol-O-methyltransferase (CEMT). The coding region of hCOMT cDNA was placed under the control of the cytomegalovirus promoter to transfect human kidney 293 cells. The recombinant hCOMT was shown by immunoblot analysis to be mainly associated with the membrane fraction. RNA blot analysis revealed one COMT mRNA transcript of 1.4 kilobases in Hep G2 poly(A){sup +} RNA.

  9. Antiproliferative effects of DNA methyltransferase 3B depletion are not associated with DNA demethylation.

    Directory of Open Access Journals (Sweden)

    Sabine Hagemann

    Full Text Available Silencing of genes by hypermethylation contributes to cancer progression and has been shown to occur with increased frequency at specific genomic loci. However, the precise mechanisms underlying the establishment and maintenance of aberrant methylation marks are still elusive. The de novo DNA methyltransferase 3B (DNMT3B has been suggested to play an important role in the generation of cancer-specific methylation patterns. Previous studies have shown that a reduction of DNMT3B protein levels induces antiproliferative effects in cancer cells that were attributed to the demethylation and reactivation of tumor suppressor genes. However, methylation changes have not been analyzed in detail yet. Using RNA interference we reduced DNMT3B protein levels in colon cancer cell lines. Our results confirm that depletion of DNMT3B specifically reduced the proliferation rate of DNMT3B-overexpressing colon cancer cell lines. However, genome-scale DNA methylation profiling failed to reveal methylation changes at putative DNMT3B target genes, even in the complete absence of DNMT3B. These results show that DNMT3B is dispensable for the maintenance of aberrant DNA methylation patterns in human colon cancer cells and they have important implications for the development of targeted DNA methyltransferase inhibitors as epigenetic cancer drugs.

  10. An association between overexpression of DNA methyltransferase 3B4 and clear cell renal cell carcinoma.

    Science.gov (United States)

    Liu, You; Sun, Liantao; Fong, Peter; Yang, Jie; Zhang, Zhuxia; Yin, Shuihui; Jiang, Shuyuan; Liu, Xiaolei; Ju, Hongge; Huang, Lihua; Bai, Jing; Gong, Kerui; Yan, Shaochun; Zhang, Chunyang; Shao, Guo

    2017-02-01

    It is well known that abnormal DNA methylations occur frequently in kidney cancer. However, it remains unclear exactly which types of DNA methyltransferases (DNMT) contribute to the pathologies of kidney cancers. In order to determine the functions of DNA methyltransferase in kidney tumorigenesis on the molecular level, we examined the mRNA expression levels of DNMT1, DNMT3A, DNMT3B, and DNMT3B variants in renal cell carcinoma tissue. Both mRNA and protein levels of DNMT3B4, a splice variant of DNMT3B, were increased in renal cell carcinoma tissue compared with adjacent control tissues. Additionally, Alu elements and long interspersed nuclear elements (LINE-1) were hypomethylated in renal cell carcinoma tissue. Meanwhile, methylation of the promoter for RASSF1A, a tumor suppressor gene, was moderately increased in renal cell carcinoma tissue, while RASSF1A expression was decreased. Thus, our data suggest that the overexpression of DNMT3B4 may play an important role in human kidney tumorigenesis through chromosomal instability and methylation of RASSF1A.

  11. Phosphoethanolamine methyltransferases in phosphocholine biosynthesis: functions and potential for antiparasite therapy.

    Science.gov (United States)

    Bobenchik, April M; Augagneur, Yoann; Hao, Bing; Hoch, Jeffrey C; Ben Mamoun, Choukri

    2011-07-01

    S-adenosyl-L-methionine (SAM)-dependent methyltransferases represent a diverse group of enzymes that catalyze the transfer of a methyl group from a methyl donor SAM to nitrogen, oxygen, sulfur or carbon atoms of a large number of biologically active large and small molecules. These modifications play a major role in the regulation of various biological functions such as gene expression, signaling, nuclear division and metabolism. The three-step SAM-dependent methylation of phosphoethanolamine to form phosphocholine catalyzed by phosphoethanolamine N-methyltransferases (PMTs) has emerged as an important biochemical step in the synthesis of the major phospholipid, phosphatidylcholine, in some eukaryotes. PMTs have been identified in nematodes, plants, African clawed frogs, zebrafish, the Florida lancelet, Proteobacteria and human malaria parasites. Data accumulated thus far suggest an important role for these enzymes in growth and development. This review summarizes published studies on the biochemical and genetic characterization of these enzymes, and discusses their evolution and their suitability as targets for the development of therapies against parasitic infections, as well as in bioengineering for the development of nutritional and stress-resistant plants. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  12. The Ca2+-induced methyltransferase xPRMT1b controls neural fate in amphibian embryo.

    Science.gov (United States)

    Batut, Julie; Vandel, Laurence; Leclerc, Catherine; Daguzan, Christiane; Moreau, Marc; Néant, Isabelle

    2005-10-18

    We have previously shown that an increase in intracellular Ca2+ is both necessary and sufficient to commit ectoderm to a neural fate in Xenopus embryos. However, the relationship between this Ca2+ increase and the expression of early neural genes has yet to be defined. Using a subtractive cDNA library between untreated and caffeine-treated animal caps, i.e., control ectoderm and ectoderm induced toward a neural fate by a release of Ca2+, we have isolated the arginine N-methyltransferase, xPRMT1b, a Ca2+-induced target gene, which plays a pivotal role in this process. First, we show in embryo and in animal cap that xPRMT1b expression is Ca2+-regulated. Second, overexpression of xPRMT1b induces the expression of early neural genes such as Zic3. Finally, in the whole embryo, antisense approach with morpholino oligonucleotide against xPRMT1b impairs neural development and in animal caps blocks the expression of neural markers induced by a release of internal Ca2+. Our results implicate an instructive role of an enzyme, an arginine methyltransferase protein, in the embryonic choice of determination between epidermal and neural fate. The results presented provide insights by which a Ca2+ increase induces neural fate.

  13. Cloning and expression analysis of an o-methyltransferase (OMT) gene from Chinese shrimp, Fenneropenaeus chinensis.

    Science.gov (United States)

    Li, Dian-Xiang; Du, Xin-Jun; Zhao, Xiao-Fan; Wang, Jin-Xing

    2006-09-01

    O-methyltransferase (OMT) is ubiquitously present in diverse organisms and plays an important regulatory role in plant and animal growth, development, reproduction and defence and has also been implicated in human emotion and disease. A putative o-methyltransferase (OMT) gene has been cloned from the haemocytes of bacteria-infected Chinese shrimp (Fenneropenaeus chinensis) by suppression subtractive hybridisation (SSH) coupled with the SMART cDNA method. The isolated 944 bp full-length cDNA contains a single 666bp open reading frame (ORF) encoding a putative OMT protein of 221 amino acids. The predicted protein has a molecular weight of 24,572.06 Da and a pI of 5.27 as well as ten phosphorylation sites. Northern blot and in situ hybridisation analyses demonstrated that the OMT transcripts were constitutively expressed in tissue of shrimp challenged by bacterial infection and in unchallenged shrimp tissue. Constitutive OMT transcript was found in areas such as haemocytes, heart, hepatopancreas, stomach, gill, intestine and ovary. However, the OMT transcripts were upregulated in hepatopancreas and stomach in challenged shrimp.

  14. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    Science.gov (United States)

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  15. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  16. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    Directory of Open Access Journals (Sweden)

    Shu Wu

    Full Text Available Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9 within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%; and could aid in species-level analyses, but with some limitations; 2 nearly-whole-length sequences and some partial regions (around V2, V4, and V9 of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%; 3 compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%; and 4 V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  17. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    Science.gov (United States)

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  18. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    Science.gov (United States)

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  19. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Science.gov (United States)

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  20. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose

    OpenAIRE

    Rozier, Claude; Mache, Régis

    1984-01-01

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20° C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloropl...

  1. Phylogeny of protostome worms derived from 18S rRNA sequences.

    Science.gov (United States)

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  2. Conversion of nicotinic acid to trigonelline is catalyzed by N-methyltransferase belonged to motif B′ methyltransferase family in Coffea arabica

    Energy Technology Data Exchange (ETDEWEB)

    Mizuno, Kouichi, E-mail: koumno@akita-pu.ac.jp [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Matsuzaki, Masahiro [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Kanazawa, Shiho [Graduate School of Humanities and Sciences, Ochanomizu University, Otsuka, Bunkyo-ku, Tokyo 112-8610 (Japan); Tokiwano, Tetsuo; Yoshizawa, Yuko [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Kato, Misako [Graduate School of Humanities and Sciences, Ochanomizu University, Otsuka, Bunkyo-ku, Tokyo 112-8610 (Japan)

    2014-10-03

    Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl-{sup 14}C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or

  3. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  4. Azathioprine-associated acute myeloid leukemia in a patient with Crohn's disease and thiopurine S-methyltransferase deficiency

    DEFF Research Database (Denmark)

    Yenson, P.R.; Forrest, D.; Schmiegelow, K.

    2008-01-01

    Immunosuppressive thiopurines like azathioprine, 6-mercaptopurine, and thioguanine are commonly used in inflammatory and neoplastic disorders. A subset of these patients are genetically slow metabolizers due to point-mutations in enzyme thiopurine S-methyltransferase (TPMT), and are at a higher r...

  5. Thirteen new patients with guanidinoacetate methyltransferase deficiency and functional characterization of nineteen novel missense variants in the GAMT gene

    DEFF Research Database (Denmark)

    Mercimek-Mahmutoglu, Saadet; Ndika, Joseph; Kanhai, Warsha

    2014-01-01

    Guanidinoacetate methyltransferase deficiency (GAMT-D) is an autosomal recessively inherited disorder of creatine biosynthesis. Creatine deficiency on cranial proton magnetic resonance spectroscopy, and elevated guanidinoacetate levels in body fluids are the biomarkers of GAMT-D. In 74 patients 5...

  6. The effect of Ecstasy on memory is moderated by a functional polymorphism in the cathechol-O-methyltransferase (COMT) gene

    NARCIS (Netherlands)

    T. Schilt; M.W.J. Koeter; M.M.L. de Win; J.R. Zinkstok; T.A. van Amelsvoort; B. Schmand; W. van den Brink

    2009-01-01

    There is ample evidence for decreased verbal memory in heavy Ecstasy users. However, findings on the presence of a dose-response relation are inconsistent, possibly due to individual differences in genetic vulnerability. Catechol-O-methyltransferase (COMT) is involved in the catabolism of Ecstasy. T

  7. Polymorphisms in O-methyltransferase genes are associated with stover cell wall digestibility in European maize (Zea mays L.)

    DEFF Research Database (Denmark)

    Brenner, Everton A; Zein, Imad; Chen, Yongsheng

    2010-01-01

    Background OMT (O-methyltransferase) genes are involved in lignin biosynthesis, which relates to stover cell wall digestibility. Reduced lignin content is an important determinant of both forage quality and ethanol conversion efficiency of maize stover. Results Variation in genomic sequences coding...

  8. Vagus nerve contributes to the development of steatohepatitis and obesity in phosphatidylethanolamine N-methyltransferase deficient mice

    NARCIS (Netherlands)

    Gao, Xia; van der Veen, Jelske N.; Zhu, Linfu; Chaba, Todd; Ordonez, Marta; Lingrell, Susanne; Koonen, Debby P. Y.; Dyck, Jason R. B.; Gomez-Munoz, Antonio; Vance, Dennis E.; Jacobs, Rene L.

    2015-01-01

    BACKGROUND & AIMS: Phosphatidylethanolamine N-methyltransferase (PEMT), a liver enriched enzyme, is responsible for approximately one third of hepatic phosphatidylcholine biosynthesis. When fed a high-fat diet (HFD), Pemt(-/-) mice are protected from HF-induced obesity; however, they develop steatoh

  9. Characterization of cytosine methylated regions and 5-cytosine DNA methyltransferase (Ehmeth) in the protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Fisher, Ohad; Siman-Tov, Rama; Ankri, Serge

    2004-01-01

    The DNA methylation status of the protozoan parasite Entamoeba histolytica was heretofore unknown. In the present study, we developed a new technique, based on the affinity of methylated DNA to 5-methylcytosine antibodies, to identify methylated DNA in this parasite. Ribosomal DNA and ribosomal DNA circles were isolated by this method and we confirmed the validity of our approach by sodium bisulfite sequencing. We also report the identification and the characterization of a gene, Ehmeth, encoding a DNA methyltransferase strongly homologous to the human DNA methyltransferase 2 (Dnmt2). Immunofluorescence microscopy using an antibody raised against a recombinant Ehmeth showed that Ehmeth is concentrated in the nuclei of trophozoites. The recombinant Ehmeth has a weak but significant methyltransferase activity when E.histolytica genomic DNA is used as substrate. 5-Azacytidine (5-AzaC), an inhibitor of DNA methyltransferase, was used to study in vivo the role of DNA methylation in E.histolytica. Genomic DNA of trophozoites grown with 5-AzaC (23 microM) was undermethylated and the ability of 5-AzaC-treated trophozoites to kill mammalian cells or to cause liver abscess in hamsters was strongly impaired.

  10. A Novel 3-Methylhistidine Modification of Yeast Ribosomal Protein Rpl3 Is Dependent upon the YIL110W Methyltransferase*

    Science.gov (United States)

    Webb, Kristofor J.; Zurita-Lopez, Cecilia I.; Al-Hadid, Qais; Laganowsky, Arthur; Young, Brian D.; Lipson, Rebecca S.; Souda, Puneet; Faull, Kym F.; Whitelegge, Julian P.; Clarke, Steven G.

    2010-01-01

    We have shown that Rpl3, a protein of the large ribosomal subunit from baker's yeast (Saccharomyces cerevisiae), is stoichiometrically monomethylated at position 243, producing a 3-methylhistidine residue. This conclusion is supported by top-down and bottom-up mass spectrometry of Rpl3, as well as by biochemical analysis of Rpl3 radiolabeled in vivo with S-adenosyl-l-[methyl-3H]methionine. The results show that a +14-Da modification occurs within the GTKKLPRKTHRGLRKVAC sequence of Rpl3. Using high-resolution cation-exchange chromatography and thin layer chromatography, we demonstrate that neither lysine nor arginine residues are methylated and that a 3-methylhistidine residue is present. Analysis of 37 deletion strains of known and putative methyltransferases revealed that only the deletion of the YIL110W gene, encoding a seven β-strand methyltransferase, results in the loss of the +14-Da modification of Rpl3. We suggest that YIL110W encodes a protein histidine methyltransferase responsible for the modification of Rpl3 and potentially other yeast proteins, and now designate it Hpm1 (Histidine protein methyltransferase 1). Deletion of the YIL110W/HPM1 gene results in numerous phenotypes including some that may result from abnormal interactions between Rpl3 and the 25 S ribosomal RNA. This is the first report of a methylated histidine residue in yeast cells, and the first example of a gene required for protein histidine methylation in nature. PMID:20864530

  11. Current understanding of the interplay between catechol-O-methyltransferase genetic variants, sleep, brain development and cognitive performance in schizophrenia

    NARCIS (Netherlands)

    Tucci, Valter; Lassi, Glenda; Kas, Martien J

    2012-01-01

    Abnormal sleep is an endophenotype of schizophrenia. Here we provide an overview of the genetic mechanisms that link specific sleep physiological processes to schizophrenia-related cognitive defects. In particular, we will review the possible relationships between catechol-O-methyltransferase (COMT)

  12. An integrated epigenetic and genetic analysis of DNA methyltransferase genes (DNMTs) in tumor resistant and susceptible chicken lines

    Science.gov (United States)

    Both epigenetic alterations and genetic variations play essential roles in tumorigenesis. The epigenetic modification of DNA methylation is catalyzed and maintained by the DNA methyltransferases (DNMT3a, DNMT3b and DNMT1). DNA mutations and DNA methylation profiles of DNMTs themselves and their rela...

  13. Molecular cloning, characterization and expression of the caffeic acid O-methyltransferase (COMT) ortholog from kenaf (Hibiscus cannabinus)

    Science.gov (United States)

    We cloned the full-length of the gene putatively encoding caffeic acid O-methyltransferase (COMT) from kenaf (Hibiscus cannabinus L.) using degenerate primers and the RACE (rapid amplification of cDNA ends) method. Kenaf is an herbaceous and rapidly growing dicotyledonous plant with great potential ...

  14. Crystal Structure and Catalytic Mechanism of CouO, a Versatile C-Methyltransferase from Streptomyces rishiriensis

    Science.gov (United States)

    Pavkov-Keller, Tea; Steiner, Kerstin; Faber, Mario; Tengg, Martin; Schwab, Helmut; Gruber-Khadjawi, Mandana

    2017-01-01

    Friedel–Crafts alkylation of aromatic systems is a classic reaction in organic chemistry, for which regiospecific mono-alkylation, however, is generally difficult to achieve. In nature, methyltransferases catalyze the addition of methyl groups to a wide range of biomolecules thereby modulating the physico-chemical properties of these compounds. Specifically, S-adenosyl-L-methionine dependent C-methyltransferases possess a high potential to serve as biocatalysts in environmentally benign organic syntheses. Here, we report on the high resolution crystal structure of CouO, a C-methyltransferase from Streptomyces rishiriensis involved in the biosynthesis of the antibiotic coumermycin A1. Through molecular docking calculations, site-directed mutagenesis and the comparison with homologous enzymes we identified His120 and Arg121 as key functional residues for the enzymatic activity of this group of C-methyltransferases. The elucidation of the atomic structure and the insight into the catalytic mechanism provide the basis for the (semi)-rational engineering of the enzyme in order to increase the substrate scope as well as to facilitate the acceptance of SAM-analogues as alternative cofactors. PMID:28152088

  15. MicroRNA-29a Alleviates Bile Duct Ligation Exacerbation of Hepatic Fibrosis in Mice through Epigenetic Control of Methyltransferases

    Directory of Open Access Journals (Sweden)

    Ya-Ling Yang

    2017-01-01

    Full Text Available MicroRNA-29 (miR-29 is found to modulate hepatic stellate cells’ (HSCs activation and, thereby, reduces liver fibrosis pathogenesis. Histone methyltransferase regulation of epigenetic reactions reportedly participates in hepatic fibrosis. This study is undertaken to investigate the miR-29a regulation of the methyltransferase signaling and epigenetic program in hepatic fibrosis progression. miR-29a transgenic mice (miR-29aTg mice and wild-type littermates were subjected to bile duct-ligation (BDL to develop cholestatic liver fibrosis. Primary HSCs were transfected with a miR-29a mimic and antisense inhibitor. Profibrogenic gene expression, histone methyltransferases and global genetic methylation were probed with real-time quantitative RT-PCR, immunohistochemical stain, Western blot and ELISA. Hepatic tissue in miR-29aTg mice displayed weak fibrotic matrix as evidenced by Sirius Red staining concomitant with low fibrotic matrix collagen 1α1 expression within affected tissues compared to the wild-type mice. miR-29a overexpression reduced the BDL exaggeration of methyltransferases, DNMT1, DNMT3b and SET domain containing 1A (SET1A expression. It also elevated phosphatase and tensin homolog deleted on chromosome 10 (PTEN signaling within liver tissue. In vitro, miR-29a mimic transfection lowered collagen 1α1, DNMT1, DNMT3b and SET1A expression in HSCs. Gain of miR-29a signaling resulted in DNA hypomethylation and high PTEN expression. This study shines a new light on miR-29a inhibition of methyltransferase, a protective effect to maintain the DNA hypomethylation state that decreases fibrogenic activities in HSC. These robust analyses also highlight the miR-29a regulation of epigenetic actions to ameliorate excessive fibrosis during cholestatic liver fibrosis development.

  16. MicroRNA-29a Alleviates Bile Duct Ligation Exacerbation of Hepatic Fibrosis in Mice through Epigenetic Control of Methyltransferases

    Science.gov (United States)

    Yang, Ya-Ling; Wang, Feng-Sheng; Li, Sung-Chou; Tiao, Mao-Meng; Huang, Ying-Hsien

    2017-01-01

    MicroRNA-29 (miR-29) is found to modulate hepatic stellate cells’ (HSCs) activation and, thereby, reduces liver fibrosis pathogenesis. Histone methyltransferase regulation of epigenetic reactions reportedly participates in hepatic fibrosis. This study is undertaken to investigate the miR-29a regulation of the methyltransferase signaling and epigenetic program in hepatic fibrosis progression. miR-29a transgenic mice (miR-29aTg mice) and wild-type littermates were subjected to bile duct-ligation (BDL) to develop cholestatic liver fibrosis. Primary HSCs were transfected with a miR-29a mimic and antisense inhibitor. Profibrogenic gene expression, histone methyltransferases and global genetic methylation were probed with real-time quantitative RT-PCR, immunohistochemical stain, Western blot and ELISA. Hepatic tissue in miR-29aTg mice displayed weak fibrotic matrix as evidenced by Sirius Red staining concomitant with low fibrotic matrix collagen 1α1 expression within affected tissues compared to the wild-type mice. miR-29a overexpression reduced the BDL exaggeration of methyltransferases, DNMT1, DNMT3b and SET domain containing 1A (SET1A) expression. It also elevated phosphatase and tensin homolog deleted on chromosome 10 (PTEN) signaling within liver tissue. In vitro, miR-29a mimic transfection lowered collagen 1α1, DNMT1, DNMT3b and SET1A expression in HSCs. Gain of miR-29a signaling resulted in DNA hypomethylation and high PTEN expression. This study shines a new light on miR-29a inhibition of methyltransferase, a protective effect to maintain the DNA hypomethylation state that decreases fibrogenic activities in HSC. These robust analyses also highlight the miR-29a regulation of epigenetic actions to ameliorate excessive fibrosis during cholestatic liver fibrosis development. PMID:28106784

  17. Identification of an S-adenosylmethionine (SAM) dependent arsenic methyltransferase in Danio rerio

    Energy Technology Data Exchange (ETDEWEB)

    Hamdi, Mohamad [Department of Biological Sciences, Oakland University, Rochester, MI 48309 (United States); Yoshinaga, Masafumi; Packianathan, Charles; Qin, Jie [Department of Cellular Biology and Pharmacology, Herbert Wertheim College of Medicine, Florida International University, FL33199 (United States); Hallauer, Janell; McDermott, Joseph R. [Department of Biological Sciences, Oakland University, Rochester, MI 48309 (United States); Yang, Hung-Chi [Department of Medical Biotechnology and Laboratory Sciences, Chang-Gung University, Tao-Yuan, Kwei-San 333, Taiwan (China); Tsai, Kan-Jen [School of Medical Laboratory and Biotechnology, Chung Shan Medical University, Taichung, Taiwan (China); Liu, Zijuan, E-mail: liu2345@oakland.edu [Department of Biological Sciences, Oakland University, Rochester, MI 48309 (United States)

    2012-07-15

    Arsenic methylation is an important cellular metabolic process that modulates arsenic toxicity and carcinogenicity. Biomethylation of arsenic produces a series of mono-, di- and tri-methylated arsenic metabolites that can be detected in tissues and excretions. Here we report that zebrafish exposed to arsenite (As{sup III}) produces organic arsenicals, including MMA{sup III}, MMA{sup V} and DMA{sup V} with characteristic tissue ratios, demonstrating that an arsenic methylation pathway exists in zebrafish. In mammals, cellular inorganic arsenic is methylated by a SAM-dependent arsenic methyltransferase, AS3MT. A zebrafish arsenic methyltransferase homolog, As3mt, was identified by sequence alignment. Western blotting analysis showed that As3mt was universally expressed in zebrafish tissues. Prominent expression in liver and intestine correlated with methylated arsenic metabolites detected in those tissues. As3mt was expressed in and purified from Escherichia coli for in vitro functional studies. Our results demonstrated that As3mt methylated As{sup III} to DMA{sup V} as an end product and produced MMA{sup III} and MMA{sup V} as intermediates. The activity of As3mt was inhibited by elevated concentrations of the substrate As{sup III} as well as the metalloid selenite, which is a well-known antagonistic micronutrient of arsenic toxicity. The activity As3mt was abolished by substitution of either Cys160 or Cys210, which corresponds to conserved cysteine residues in AS3MT homologs, suggesting that they are involved in catalysis. Expression in zebrafish of an enzyme that has a similar function to human and rodent orthologs in catalyzing intracellular arsenic biomethylation validates the applicability of zebrafish as a valuable vertebrate model for understanding arsenic-associated diseases in humans. -- Highlights: ► Zebrafish methylated As{sup III} to MMA{sup III}, MMA{sup V} and DMA{sup V}. ► A zebrafish arsenic methyltransferase (As3mt) was purified in E. coli.

  18. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    Science.gov (United States)

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  19. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    NARCIS (Netherlands)

    Ziesemer, K.A.; Mann, A.E.; Sankaranarayanan, K.; Schroeder, H.; Ozga, A.T.; Brandt, B.W.; Zaura, E.; Waters-Rist, A.; Hoogland, M.; Salazar-García, D.C.; Aldenderfer, M.; Speller, C.; Hendy, J.; Weston, D.A.; MacDonald, S.J.; Thomas, G.H.; Collins, M.J.; Lewis, C.M.; Hofman, C.; Warinner, C.

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gen

  20. Rapid identification of rumen protozoa by restriction analysis of amplified 18S rRNA gene

    NARCIS (Netherlands)

    Regensbogenova, M.; Kisidayova, S.; Michalowski, T.; Javorsky, P.; Moon-van der Staay, S.Y.; Hackstein, J.H.P.; McEwan, N.R.; Jouany, J.P.; Newbold, J.C.; Pristas, P.

    2004-01-01

    A rapid method has been developed for molecular identification of rumen ciliates without the need for cultivation. Total DNA was isolated from single protozoal cells by the Chelex method and nearly complete protozoal 18S rRNA genes were amplified and subjected to restriction fragment length polymorp

  1. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    Science.gov (United States)

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  2. NOF1 encodes an Arabidopsis protein involved in the control of rRNA expression.

    Directory of Open Access Journals (Sweden)

    Erwana Harscoët

    Full Text Available The control of ribosomal RNA biogenesis is essential for the regulation of protein synthesis in eukaryotic cells. Here, we report the characterization of NOF1 that encodes a putative nucleolar protein involved in the control of rRNA expression in Arabidopsis. The gene has been isolated by T-DNA tagging and its function verified by the characterization of a second allele and genetic complementation of the mutants. The nof1 mutants are affected in female gametogenesis and embryo development. This result is consistent with the detection of NOF1 mRNA in all tissues throughout plant life's cycle, and preferentially in differentiating cells. Interestingly, the closely related proteins from zebra fish and yeast are also necessary for cell division and differentiation. We showed that the nof1-1 mutant displays higher rRNA expression and hypomethylation of rRNA promoter. Taken together, the results presented here demonstrated that NOF1 is an Arabidopsis gene involved in the control of rRNA expression, and suggested that it encodes a putative nucleolar protein, the function of which may be conserved in eukaryotes.

  3. Direct regulation of rRNA transcription by fibroblast growth factor 2.

    Science.gov (United States)

    Sheng, Zhi; Liang, Yanping; Lin, Chih-Yin; Comai, Lucio; Chirico, William J

    2005-11-01

    Fibroblast growth factor 2 (FGF-2), which is highly expressed in developing tissues and malignant cells, regulates cell growth, differentiation, and migration. Five isoforms (18 to approximately 34 kDa) of FGF-2 are derived from alternative initiation codons of a single mRNA. The 18-kDa FGF-2 isoform is released from cells by a nonclassical secretory pathway and regulates gene expression by binding to cell surface receptors. This isoform also localizes to the nucleolus, raising the possibility that it may directly regulate ribosome biogenesis, a rate-limiting process in cell growth. Although several growth factors have been shown to accumulate in the nucleolus, their function and mechanism of action remain unclear. Here we show that 18-kDa FGF-2 interacts with upstream binding factor (UBF), an architectural transcription factor essential for rRNA transcription. The maximal activation of rRNA transcription in vitro by 18-kDa FGF-2 requires UBF. The 18-kDa FGF-2 localizes to rRNA genes and is necessary for the full activation of pre-rRNA synthesis in vivo. Our results demonstrate that 18-kDa FGF-2 directly regulates rRNA transcription.

  4. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten;

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  5. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...

  6. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  7. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    Science.gov (United States)

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  8. Growth increase of Arabidopsis by forced expression of rice 45S rRNA gene.

    Science.gov (United States)

    Makabe, So; Motohashi, Reiko; Nakamura, Ikuo

    2017-02-01

    Forced expression of rice 45S rRNA gene conferred ca. 2-fold increase of above-ground growth in transgenic Arabidopsis . This growth increase was probably brought by cell proliferation, not by cell enlargement. Recent increase in carbon dioxide emissions is causing global climate change. The use of plant biomass as alternative energy source is one way to reduce these emissions. Therefore, reinforcement of plant biomass production is an urgent key issue to overcome both depletion of fossil energies and emission of carbon dioxide. Here, we created transgenic Arabidopsis with a 2-fold increase in above-ground growth by forced expression of the rice 45S rRNA gene using the maize ubiquitin promoter. Although the size of guard cells and ploidy of leaf-cells were similar between transgenic and control plants, numbers of stomata and pavement cells were much increased in the transgenic leaf. This data suggested that cell number, not cell expansion, was responsible for the growth increase, which might be brought by the forced expression of exogenous and full-length 45S rRNA gene. The expression level of rice 45S rRNA transcripts was very low, possibly triggering unknown machinery to enhance cell proliferation. Although microarray analysis showed enhanced expression of ethylene-responsive transcription factors, these factors might respond to ethylene induced by abiotic/biotic stresses or genomic incompatibility, which might be involved in the expression of species-specific internal transcribed spacer (ITS) sequences within rice 45S rRNA transcripts. Further analysis of the mechanism underlying the growth increase will contribute to understanding the regulation of the cell proliferation and the mechanism of hybrid vigor.

  9. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Directory of Open Access Journals (Sweden)

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  10. Evidence for autophagy-dependent pathways of rRNA turnover in Arabidopsis.

    Science.gov (United States)

    Floyd, Brice E; Morriss, Stephanie C; MacIntosh, Gustavo C; Bassham, Diane C

    2015-01-01

    Ribosomes account for a majority of the cell's RNA and much of its protein and represent a significant investment of cellular resources. The turnover and degradation of ribosomes has been proposed to play a role in homeostasis and during stress conditions. Mechanisms for the turnover of rRNA and ribosomal proteins have not been fully elucidated. We show here that the RNS2 ribonuclease and autophagy participate in RNA turnover in Arabidopsis thaliana under normal growth conditions. An increase in autophagosome formation was seen in an rns2-2 mutant, and this increase was dependent on the core autophagy genes ATG9 and ATG5. Autophagosomes and autophagic bodies in rns2-2 mutants contain RNA and ribosomes, suggesting that autophagy is activated as an attempt to compensate for loss of rRNA degradation. Total RNA accumulates in rns2-2, atg9-4, atg5-1, rns2-2 atg9-4, and rns2-2 atg5-1 mutants, suggesting a parallel role for autophagy and RNS2 in RNA turnover. rRNA accumulates in the vacuole in rns2-2 mutants. Vacuolar accumulation of rRNA was blocked by disrupting autophagy via an rns2-2 atg5-1 double mutant but not by an rns2-2 atg9-4 double mutant, indicating that ATG5 and ATG9 function differently in this process. Our results suggest that autophagy and RNS2 are both involved in homeostatic degradation of rRNA in the vacuole.

  11. Phylogenetic diversity of rhizobia associated with horsegram [Macrotyloma uniflorum (Lam.) Verdc.] grown in South India based on glnII, recA and 16S-23S intergenic sequence analyses.

    Science.gov (United States)

    Appunu, Chinnaswamy; Ganesan, Govindan; Kalita, Michał; Kaushik, Raghavan; Saranya, Balamurugan; Prabavathy, Vaiyapuri Ramalingam; Sudha, Nair

    2011-04-01

    Horsegram [Macrotyloma uniflorum (Lam.) Verdc.) is an important grain legume and fodder crop in India. Information on root nodule endosymbionts of this legume in India is limited. In the present study, 69 isolates from naturally occurring root nodules of horsegram collected from two agro-eco-climatic regions of South India was analyzed by generation rate, acid/alkali reaction on YMA medium, restriction fragment length polymorphism analysis of 16S-23S rDNA intergenic spacer region (IGS), and sequence analyses of IGS and housekeeping genes glnII and recA. Based on the rDNA IGS RFLP by means of three restriction enzymes rhizobia were grouped in five clusters (I-V). By sequence analysis of 16S-23S rDNA IGS identified genotypes of horsegram rhizobia were distributed into five divergent lineages of Bradyrhizobium genus which comprised (I) the IGS type IV rhizobia and valid species B. yuanmingense, (II) the strains of IGS type I and Bradyrhizobium sp. ORS 3257 isolated from Vigna sp., (III) the strains of the IGS type II and Bradyrhizobium sp. CIRADAc12 from Acacia sp., (IV) the IGS type V strains and Bradyrhizobium sp. genospecies IV, and (V) comprising genetically distinct IGS type III strains which probably represent an uncharacterized new genomic species. Nearly, 87% of indigenous horsegram isolates (IGS types I, II, III, and V) could not be related to any other species within the genus Bradyrhizobium. Phylogeny based on housekeeping glnII and recA genes confirmed those results found by the analysis of the IGS sequence. All the isolated rhizobia nodulated Macrotyloma sp. and Vigna spp., and only some of them formed nodules on Arachis hypogeae. The isolates within each IGS type varied in their ability to fix nitrogen. Selection for high symbiotic effective strains could reward horsegram production in poor soils of South India where this legume is largely cultivated.

  12. Human DNA (cytosine-5)-methyltransferases: a functional and structural perspective for epigenetic cancer therapy.

    Science.gov (United States)

    Rondelet, Grégoire; Wouters, Johan

    2017-08-01

    Epigenetic modifications modulate chromatin states to regulate gene expression. Among them, DNA methylation and histone modifications play a crucial role in the establishment of the epigenome. In cancer, these epigenetic events may act in concert to repress tumor suppressor genes or promote oncogenic pathways. In the context of cancer initiation and progression, recruitment of DNA (cytosine-5)-methyltransferases to specific genomic regions is mainly mediated by histone epigenetic marks, transcription factors and co-regulators as part of a dynamic process. Herein, we will review these mechanisms and present state-of-the-art of DNA methylation, treatment and development of epigenetic cancer therapies targeting this epigenetic modification. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  13. The Role of Nuclear Receptor-Binding SET Domain Family Histone Lysine Methyltransferases in Cancer.

    Science.gov (United States)

    Bennett, Richard L; Swaroop, Alok; Troche, Catalina; Licht, Jonathan D

    2017-06-01

    The nuclear receptor-binding SET Domain (NSD) family of histone H3 lysine 36 methyltransferases is comprised of NSD1, NSD2 (MMSET/WHSC1), and NSD3 (WHSC1L1). These enzymes recognize and catalyze methylation of histone lysine marks to regulate chromatin integrity and gene expression. The growing number of reports demonstrating that alterations or translocations of these genes fundamentally affect cell growth and differentiation leading to developmental defects illustrates the importance of this family. In addition, overexpression, gain of function somatic mutations, and translocations of NSDs are associated with human cancer and can trigger cellular transformation in model systems. Here we review the functions of NSD family members and the accumulating evidence that these proteins play key roles in tumorigenesis. Because epigenetic therapy is an important emerging anticancer strategy, understanding the function of NSD family members may lead to the development of novel therapies. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.

  14. Protective immunization against visceral leishmaniasis using Leishmania sterol 24-c-methyltransferase formulated in adjuvant.

    Science.gov (United States)

    Goto, Yasuyuki; Bogatzki, Lisa Y; Bertholet, Sylvie; Coler, Rhea N; Reed, Steven G

    2007-10-16

    We present here the identification and characterization of Leishmania sterol 24-c-methyltransferase (SMT), as well as data on protection of mice immunized with this Ag formulated in MPL-SE. Serological evaluation revealed that SMT is recognized by VL patients. C57BL/6 mice immunized with this vaccine candidate plus MPL-SE showed Ag-specific Th1 immune responses characterized by robust production of IFN-gamma upon specific Ag re-exposure in vitro. Upon challenge with L. infantum, mice immunized with SMT plus MPL-SE showed significant lower parasite burdens in both spleens and livers compared with non-immunized mice or mice injected with adjuvant alone. The results indicate that SMT/MPL-SE can be an effective vaccine candidate for use against VL.

  15. Miniaturization of High-Throughput Epigenetic Methyltransferase Assays with Acoustic Liquid Handling.

    Science.gov (United States)

    Edwards, Bonnie; Lesnick, John; Wang, Jing; Tang, Nga; Peters, Carl

    2016-02-01

    Epigenetics continues to emerge as an important target class for drug discovery and cancer research. As programs scale to evaluate many new targets related to epigenetic expression, new tools and techniques are required to enable efficient and reproducible high-throughput epigenetic screening. Assay miniaturization increases screening throughput and reduces operating costs. Echo liquid handlers can transfer compounds, samples, reagents, and beads in submicroliter volumes to high-density assay formats using only acoustic energy-no contact or tips required. This eliminates tip costs and reduces the risk of reagent carryover. In this study, we demonstrate the miniaturization of a methyltransferase assay using Echo liquid handlers and two different assay technologies: AlphaLISA from PerkinElmer and EPIgeneous HTRF from Cisbio.

  16. DNA methyltransferase 1 and DNA methylation patterning contribute to germinal center B-cell differentiation

    DEFF Research Database (Denmark)

    Shaknovich, Rita; Cerchietti, Leandro; Tsikitas, Lucas;

    2011-01-01

    The phenotype of germinal center (GC) B cells includes the unique ability to tolerate rapid proliferation and the mutagenic actions of activation induced cytosine deaminase (AICDA). Given the importance of epigenetic patterning in determining cellular phenotypes, we examined DNA methylation and t......, the GC B cells of Dnmt1 hypomorphic animals showed evidence of increased DNA damage, suggesting dual roles for DNMT1 in DNA methylation and double strand DNA break repair.......The phenotype of germinal center (GC) B cells includes the unique ability to tolerate rapid proliferation and the mutagenic actions of activation induced cytosine deaminase (AICDA). Given the importance of epigenetic patterning in determining cellular phenotypes, we examined DNA methylation...... and the role of DNA methyltransferases in the formation of GCs. DNA methylation profiling revealed a marked shift in DNA methylation patterning in GC B cells versus resting/naive B cells. This shift included significant differential methylation of 235 genes, with concordant inverse changes in gene expression...

  17. DNA methyltransferases are required to induce heterochromatic re-replication in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Hume Stroud

    2012-07-01

    Full Text Available The relationship between epigenetic marks on chromatin and the regulation of DNA replication is poorly understood. Mutations of the H3K27 methyltransferase genes, Arabidopsis trithorax-related protein5 (ATXR5 and ATXR6, result in re-replication (repeated origin firing within the same cell cycle. Here we show that mutations that reduce DNA methylation act to suppress the re-replication phenotype of atxr5 atxr6 mutants. This suggests that DNA methylation, a mark enriched at the same heterochromatic regions that re-replicate in atxr5/6 mutants, is required for aberrant re-replication. In contrast, RNA sequencing analyses suggest that ATXR5/6 and DNA methylation cooperatively transcriptionally silence transposable elements (TEs. Hence our results suggest a complex relationship between ATXR5/6 and DNA methylation in the regulation of DNA replication and transcription of TEs.

  18. Rationalization of Activity Cliffs of a Sulfonamide Inhibitor of DNA Methyltransferases with Induced-Fit Docking

    Directory of Open Access Journals (Sweden)

    José L. Medina-Franco

    2014-02-01

    Full Text Available Inhibitors of human DNA methyltransferases (DNMT are of increasing interest to develop novel epi-drugs for the treatment of cancer and other diseases. As the number of compounds with reported DNMT inhibition is increasing, molecular docking is shedding light to elucidate their mechanism of action and further interpret structure–activity relationships. Herein, we present a structure-based rationalization of the activity of SW155246, a distinct sulfonamide compound recently reported as an inhibitor of human DNMT1 obtained from high-throughput screening. We used flexible and induce-fit docking to develop a binding model of SW155246 with a crystallographic structure of human DNMT1. Results were in excellent agreement with experimental information providing a three-dimensional structural interpretation of ‘activity cliffs’, e.g., analogues of SW155246 with a high structural similarity to the sulfonamide compound, but with no activity in the enzymatic assay.

  19. Brain Histamine N-Methyltransferase As a Possible Target of Treatment for Methamphetamine Overdose

    Science.gov (United States)

    Kitanaka, Junichi; Kitanaka, Nobue; Hall, F. Scott; Uhl, George R.; Takemura, Motohiko

    2016-01-01

    Stereotypical behaviors induced by methamphetamine (METH) overdose are one of the overt symptoms of METH abuse, which can be easily assessed in animal models. Currently, there is no successful treatment for METH overdose. There is increasing evidence that elevated levels of brain histamine can attenuate METH-induced behavioral abnormalities, which might therefore constitute a novel therapeutic treatment for METH abuse and METH overdose. In mammals, histamine N-methyltransferase (HMT) is the sole enzyme responsible for degrading histamine in the brain. Metoprine, one of the most potent HMT inhibitors, can cross the blood–brain barrier and increase brain histamine levels by inhibiting HMT. Consequently, this compound can be a candidate for a prototype of drugs for the treatment of METH overdose. PMID:26966348

  20. Catechol-O-Methyltransferase gene val158met polymorphism and depressive symptoms during early childhood

    Science.gov (United States)

    Sheikh, Haroon I.; Kryski, Katie R.; Smith, Heather J.; Dougherty, Lea R.; Klein, Daniel N.; Bufferd, Sara J.; Singh, Shiva M.; Hayden, Elizabeth P.

    2017-01-01

    Catechol-O-Methyltransferase (COMT) is a critical regulator of catecholamine levels in the brain. A functional polymorphism of the COMT gene, val158met, has been linked to internalizing symptoms (i.e., depression and anxiety) in adolescents and adults. We extended this research by investigating whether the val158met polymorphism was associated with childhood symptoms of depression and anxiety in two independent samples of young children (Ns = 476 and 409). In both samples, preschool-aged children were genotyped for the COMT val158met polymorphism. Symptoms of psychopathology were assessed via parent interviews and primary caregiver reports. In both samples, children homozygous for the val allele had higher levels of depressive symptoms compared to children with at least one copy of the met allele. Our findings extend previous research in older participants by showing links between the COMT val158met polymorphism and internalizing symptoms in early childhood. PMID:23475824

  1. Histone methyltransferases and demethylases:regulators in balancing osteogenic and adipogenic differentiation of mesenchymal stem cells

    Institute of Scientific and Technical Information of China (English)

    Peng Deng; Qian-Ming Chen; Christine Hong; Cun-Yu Wang

    2015-01-01

    Mesenchymal stem cells (MSCs) are characterized by their self-renewing capacity and differentiation potential into multiple tissues. Thus, management of the differentiation capacities of MSCs is important for MSC-based regenerative medicine, such as craniofacial bone regeneration, and in new treatments for metabolic bone diseases, such as osteoporosis. In recent years, histone modification has been a growing topic in the field of MSC lineage specification, in which the Su(var)3–9, enhancer-of-zeste, trithorax (SET) domain-containing family and the Jumonji C (JmjC) domain-containing family represent the major histone lysine methyltransferases (KMTs) and histone lysine demethylases (KDMs), respectively. In this review, we summarize the current understanding of the epigenetic mechanisms by which SET domain-containing KMTs and JmjC domain-containing KDMs balance the osteogenic and adipogenic differentiation of MSCs.

  2. Role of the EZH2 histone methyltransferase as a therapeutic target in cancer.

    Science.gov (United States)

    Italiano, Antoine

    2016-09-01

    Besides being a genetic disease, cancer is also an epigenetic disease. The histone methyltransferase EZH2 is the catalytic subunit of PRC2, a highly conserved protein complex that regulates gene expression by methylating lysine 27 on histone H3. Given its role in tumorigenesis and its prognostic value in several tumor types, this protein appears a relevant therapeutic target. This review focuses on the preclinical and preliminary clinical results of studies investigating EZH2 inhibitors in human malignancies. These emerging data suggest that EZH2 inhibitors represent a very promising class of drugs, which will probably have a major impact on improving outcome and reducing toxicity for patients with indolent and aggressive B-cell lymphomas and other specific solid tumors.

  3. Strategy to target the substrate binding site of SET domain protein methyltransferases.

    Science.gov (United States)

    Nguyen, Kong T; Li, Fengling; Poda, Gennadiy; Smil, David; Vedadi, Masoud; Schapira, Matthieu

    2013-03-25

    Protein methyltransferases (PMTs) are a novel gene family of therapeutic relevance involved in chromatin-mediated signaling and other biological mechanisms. Most PMTs are organized around the structurally conserved SET domain that catalyzes the methylation of a substrate lysine. A few potent chemical inhibitors compete with the protein substrate, and all are anchored in the channel recruiting the methyl-accepting lysine. We propose a novel strategy to design focused chemical libraries targeting the substrate binding site, where a limited number of warheads each occupying the lysine-channel of multiple enzymes would be decorated by different substituents. A variety of sequence and structure-based approaches used to analyze the diversity of the lysine channel of SET domain PMTs support the relevance of this strategy. We show that chemical fragments derived from published inhibitors are valid warheads that can be used in the design of novel focused libraries targeting other PMTs.

  4. The catechol-O-methyltransferase gene (COMT) and cognitive function from childhood through adolescence.

    Science.gov (United States)

    Gaysina, Darya; Xu, Man K; Barnett, Jennifer H; Croudace, Tim J; Wong, Andrew; Richards, Marcus; Jones, Peter B

    2013-02-01

    Genetic variation in the catechol-O-methyltransferase gene (COMT) can influence cognitive function, and this effect may depend on developmental stage. Using a large representative British birth cohort, we investigated the effect of COMT on cognitive function (verbal and non-verbal) at ages 8 and 15 years taking into account the possible modifying effect of pubertal stage. Five functional COMT polymorphisms, rs6269, rs4818, rs4680, rs737865 and rs165599 were analysed. Associations between COMT polymorphisms and cognition were tested using regression and latent variable structural equation modelling (SEM). Before correction for multiple testing, COMT rs737865 showed association with reading comprehension, verbal ability and global cognition at age 15 years in pubescent boys only. Although there was some evidence for age- and sex-specific effects of the COMT rs737865 none remained significant after correction for multiple testing. Further studies are necessary in order to make firmer conclusions.

  5. Human nicotinamide N-methyltransferase gene: Molecular cloning, structural characterization and chromosomal localization

    Energy Technology Data Exchange (ETDEWEB)

    Aksoy, S.; Weinshilboum, R.M. [Mayo Medical School/Mayo Clinic/Mayo Foundation, Rochester, MN (United States); Brandriff, B.F. [Lawrence Livermore National Lab., CA (United States); Ward, A.; Little, P.F.R. [Imperial College of Science, Technology and Medicine, London (United Kingdom)

    1995-10-10

    Genomic DNA clones for nicotinamide N-methyltransferase (NNMT), an enzyme that catalyzes drug and xenobiotic metabolism, were isolated from a human chromosome 11-specific DNA library. Study of one of those clones, when combined with PCR-based experiments performed with human genomic DNA, made it possible to determine the structure of the human NNMT gene. The gene was approximately 16.5 kb in length and consisted of 3 exons and 2 introns. Transcription initiation for the NNMT gene occurred 105-109 nucleotides 5{prime}-upstream from the cDNA translation initiation codon on the basis of the results of both primer extension and 5{prime}-rapid amplification of cDNA ends. NNMT mapped to chromosome band 11q23.1 by fluorescence in situ hybridization.

  6. Ash2 acts as an ecdysone receptor coactivator by stabilizing the histone methyltransferase Trr.

    Science.gov (United States)

    Carbonell, Albert; Mazo, Alexander; Serras, Florenci; Corominas, Montserrat

    2013-02-01

    The molting hormone ecdysone triggers chromatin changes via histone modifications that are important for gene regulation. On hormone activation, the ecdysone receptor (EcR) binds to the SET domain-containing histone H3 methyltransferase trithorax-related protein (Trr). Methylation of histone H3 at lysine 4 (H3K4me), which is associated with transcriptional activation, requires several cofactors, including Ash2. We find that ash2 mutants have severe defects in pupariation and metamorphosis due to a lack of activation of ecdysone-responsive genes. This transcriptional defect is caused by the absence of the H3K4me3 marks set by Trr in these genes. We present evidence that Ash2 interacts with Trr and is required for its stabilization. Thus we propose that Ash2 functions together with Trr as an ecdysone receptor coactivator.

  7. Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode.

    Science.gov (United States)

    Lin, Jingyu; Mazarei, Mitra; Zhao, Nan; Zhu, Junwei J; Zhuang, Xiaofeng; Liu, Wusheng; Pantalone, Vincent R; Arelli, Prakash R; Stewart, Charles N; Chen, Feng

    2013-12-01

    Salicylic acid plays a critical role in activating plant defence responses after pathogen attack. Salicylic acid methyltransferase (SAMT) modulates the level of salicylic acid by converting salicylic acid to methyl salicylate. Here, we report that a SAMT gene from soybean (GmSAMT1) plays a role in soybean defence against soybean cyst nematode (Heterodera glycines Ichinohe, SCN). GmSAMT1 was identified as a candidate SCN defence-related gene in our previous analysis of soybean defence against SCN using GeneChip microarray experiments. The current study started with the isolation of the full-length cDNAs of GmSAMT1 from a SCN-resistant soybean line and from a SCN-susceptible soybean line. The two cDNAs encode proteins of identical sequences. The GmSAMT1 cDNA was expressed in Escherichia coli. Using in vitro enzyme assays, E. coli-expressed GmSAMT1 was confirmed to function as salicylic acid methyltransferase. The apparent Km value of GmSAMT1 for salicylic acid was approximately 46 μM. To determine the role of GmSAMT1 in soybean defence against SCN, transgenic hairy roots overexpressing GmSAMT1 were produced and tested for SCN resistance. Overexpression of GmSAMT1 in SCN-susceptible backgrounds significantly reduced the development of SCN, indicating that overexpression of GmSAMT1 in the transgenic hairy root system could confer resistance to SCN. Overexpression of GmSAMT1 in transgenic hairy roots was also found to affect the expression of selected genes involved in salicylic acid biosynthesis and salicylic acid signal transduction.

  8. Protein arginine methyltransferase 5 (PRMT5) is a novel coactivator of constitutive androstane receptor (CAR)

    Energy Technology Data Exchange (ETDEWEB)

    Kanno, Yuichiro, E-mail: ykanno@phar.toho-u.ac.jp; Inajima, Jun; Kato, Sayaka; Matsumoto, Maika; Tokumoto, Chikako; Kure, Yuki; Inouye, Yoshio

    2015-03-27

    The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that protein arginine methyltransferase 5 (PRMT5) is a novel CAR-interacting protein. Furthermore, the PRMT-dependent induction of a CAR reporter gene, which was independent of methyltransferase activity, was enhanced in the presence of steroid receptor coactivator 1 (SRC1), peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α) or DEAD box DNA/RNA helicase DP97. Using tetracycline inducible-hCAR system in HepG2 cells, we showed that knockdown of PRMT5 with small interfering RNA suppressed tetracycline -induced mRNA expression of CYP2B6 but not of CYP2C9 or CYP3A4. PRMT5 enhanced phenobarbital-mediated transactivation of a phenobarbital-responsive enhancer module (PBREM)-driven reporter gene in co-operation with PGC-1α in rat primary hepatocytes. Based on these findings, we suggest PRMT5 to be a gene (or promoter)-selective coactivator of CAR by mediating the formation of complexes between hCAR and appropriate coactivators. - Highlights: • Nuclear receptor CAR interact with PRMT5. • PRMT5 enhances transcriptional activity of CAR. • PRMT5 synergistically enhances transactivity of CAR by the co-expression of SRC-1, DP97 or PGC1α. • PRMT5 is a gene-selective co-activator for hCAR.

  9. The PRMT5 arginine methyltransferase: many roles in development, cancer and beyond.

    Science.gov (United States)

    Stopa, Nicole; Krebs, Jocelyn E; Shechter, David

    2015-06-01

    Post-translational arginine methylation is responsible for regulation of many biological processes. The protein arginine methyltransferase 5 (PRMT5, also known as Hsl7, Jbp1, Skb1, Capsuleen, or Dart5) is the major enzyme responsible for mono- and symmetric dimethylation of arginine. An expanding literature demonstrates its critical biological function in a wide range of cellular processes. Histone and other protein methylation by PRMT5 regulate genome organization, transcription, stem cells, primordial germ cells, differentiation, the cell cycle, and spliceosome assembly. Metazoan PRMT5 is found in complex with the WD-repeat protein MEP50 (also known as Wdr77, androgen receptor coactivator p44, or Valois). PRMT5 also directly associates with a range of other protein factors, including pICln, Menin, CoPR5 and RioK1 that may alter its subcellular localization and protein substrate selection. Protein substrate and PRMT5-MEP50 post-translation modifications induce crosstalk to regulate PRMT5 activity. Crystal structures of C. elegans PRMT5 and human and frog PRMT5-MEP50 complexes provide substantial insight into the mechanisms of substrate recognition and procession to dimethylation. Enzymological studies of PRMT5 have uncovered compelling insights essential for future development of specific PRMT5 inhibitors. In addition, newly accumulating evidence implicates PRMT5 and MEP50 expression levels and their methyltransferase activity in cancer tumorigenesis, and, significantly, as markers of poor clinical outcome, marking them as potential oncogenes. Here, we review the substantial new literature on PRMT5 and its partners to highlight the significance of understanding this essential enzyme in health and disease.

  10. A disulfide-bond cascade mechanism for arsenic(III) S-adenosylmethionine methyltransferase

    Science.gov (United States)

    Marapakala, Kavitha; Packianathan, Charles; Ajees, A. Abdul; Dheeman, Dharmendra S.; Sankaran, Banumathi; Kandavelu, Palani; Rosen, Barry P.

    2015-01-01

    Methylation of the toxic metalloid arsenic is widespread in nature. Members of every kingdom have arsenic(III) S-adenosylmethionine (SAM) methyltransferase enzymes, which are termed ArsM in microbes and AS3MT in animals, including humans. Trivalent arsenic(III) is methylated up to three times to form methylarsenite [MAs(III)], dimethylarsenite [DMAs(III)] and the volatile trimethylarsine [TMAs(III)]. In microbes, arsenic methylation is a detoxification process. In humans, MAs(III) and DMAs(III) are more toxic and carcinogenic than either inorganic arsenate or arsenite. Here, new crystal structures are reported of ArsM from the thermophilic eukaryotic alga Cyanidioschyzon sp. 5508 (CmArsM) with the bound aromatic arsenicals phenylarsenite [PhAs(III)] at 1.80 Å resolution and reduced roxarsone [Rox(III)] at 2.25 Å resolution. These organoarsenicals are bound to two of four conserved cysteine residues: Cys174 and Cys224. The electron density extends the structure to include a newly identified conserved cysteine residue, Cys44, which is disulfide-bonded to the fourth conserved cysteine residue, Cys72. A second disulfide bond between Cys72 and Cys174 had been observed previously in a structure with bound SAM. The loop containing Cys44 and Cys72 shifts by nearly 6.5 Å in the arsenic(III)-bound structures compared with the SAM-bound structure, which suggests that this movement leads to formation of the Cys72–Cys174 disulfide bond. A model is proposed for the catalytic mechanism of arsenic(III) SAM methyltransferases in which a disulfide-bond cascade maintains the products in the trivalent state. PMID:25760600

  11. Inhibition of H3K9 methyltransferase G9a ameliorates methylglyoxal-induced peritoneal fibrosis

    Science.gov (United States)

    Maeda, Kazuya; Doi, Shigehiro; Nakashima, Ayumu; Nagai, Takuo; Irifuku, Taisuke; Ueno, Toshinori; Masaki, Takao

    2017-01-01

    Activity of H3K9 histone methyltransferase G9a is reportedly induced by transforming growth factor-β1 (TGF-β1) and plays an important role in the progression of cancer and fibrosis. In this study, we investigated whether inhibition of G9a-mediated H3K9 methylation attenuates peritoneal fibrosis in mice and human peritoneal mesothelial cells (HPMCs). Nonadherent cells of peritoneal dialysis (PD) patients were isolated from PD effluent to examine expression of G9a. Peritoneal fibrosis was induced by peritoneal injection of methylglyoxal (MGO) in male C57/B6 mice for 3 weeks. BIX01294, a G9a inhibitor, was administered by subcutaneous injection. Effects of BIX01294 on MGO-induced pathological and functional changes in mice were evaluated by immunohistochemistry and a peritoneal equilibration test. HPMCs were isolated from human omentum, and the inhibitory effect of BIX01294 on TGF-β1-induced fibrotic changes was investigated in the HPMCs by western blotting. G9a was upregulated in nonadherent cells of human PD effluent, the peritoneum of MGO-injected mice, and TGF-β1-stimulated HPMCs. BIX01294 significantly reduced the submesothelial zone thickness and cell density in MGO-injected mice. Immunohistochemical staining revealed that BIX01294 treatment decreased not only mono-methylation of H3K9 (H3K9me1), but also the number of mesenchymal cells, accumulation of collagen, and infiltration of monocytes. In addition to the pathological changes, BIX01294 reduced the level of TGF-β1 in peritoneal fluid and improved peritoneal functions. Furthermore, BIX01294 inhibited TGF-β1-induced fibrotic changes along with suppression of H3K9me1 in HPMCs. Therefore, inhibition of H3K9 methyltransferase G9a suppresses peritoneal fibrosis through a reduction of H3K9me1. PMID:28278257

  12. Human calmodulin methyltransferase: expression, activity on calmodulin, and Hsp90 dependence.

    Directory of Open Access Journals (Sweden)

    Sophia Magen

    Full Text Available Deletion of the first exon of calmodulin-lysine N-methyltransferase (CaM KMT, previously C2orf34 has been reported in two multigene deletion syndromes, but additional studies on the gene have not been reported. Here we show that in the cells from 2p21 deletion patients the loss of CaM KMT expression results in accumulation of hypomethylated calmodulin compared to normal controls, suggesting that CaM KMT is essential for calmodulin methylation and there are no compensatory mechanisms for CaM methylation in humans. We have further studied the expression of this gene at the transcript and protein levels. We have identified 2 additional transcripts in cells of the 2p21 deletion syndrome patients that start from alternative exons positioned outside the deletion region. One of them starts in the 2(nd known exon, the other in a novel exon. The transcript starting from the novel exon was also identified in a variety of tissues from normal individuals. These new transcripts are not expected to produce proteins. Immunofluorescent localization of tagged CaM KMT in HeLa cells indicates that it is present in both the cytoplasm and nucleus of cells whereas the short isoform is localized to the Golgi apparatus. Using Western blot analysis we show that the CaM KMT protein is broadly expressed in mouse tissues. Finally we demonstrate that the CaM KMT interacts with the middle portion of the Hsp90 molecular chaperon and is probably a client protein since it is degraded upon treatment of cells with the Hsp90 inhibitor geldanamycin. These findings suggest that the CaM KMT is the major, possibly the single, methyltransferase of calmodulin in human cells with a wide tissue distribution and is a novel Hsp90 client protein. Thus our data provides basic information for a gene potentially contributing to the patient phenotype of two contiguous gene deletion syndromes.

  13. Characterization of three O-methyltransferases involved in noscapine biosynthesis in opium poppy.

    Science.gov (United States)

    Dang, Thu-Thuy T; Facchini, Peter J

    2012-06-01

    Noscapine is a benzylisoquinoline alkaloid produced in opium poppy (Papaver somniferum) and other members of the Papaveraceae. It has been used as a cough suppressant and more recently was shown to possess anticancer activity. However, the biosynthesis of noscapine in opium poppy has not been established. A proposed pathway leading from (S)-reticuline to noscapine includes (S)-scoulerine, (S)-canadine, and (S)-N-methylcanadine as intermediates. Stem cDNA libraries and latex extracts of eight opium poppy cultivars displaying different alkaloid profiles were subjected to massively parallel pyrosequencing and liquid chromatography-tandem mass spectrometry, respectively. Comparative transcript and metabolite profiling revealed the occurrence of three cDNAs encoding O-methyltransferases designated as SOMT1, SOMT2, and SOMT3 that correlated with the accumulation of noscapine in the eight cultivars. SOMT transcripts were detected in all opium poppy organs but were most abundant in aerial organs, where noscapine primarily accumulates. SOMT2 and SOMT3 showed strict substrate specificity and regiospecificity as 9-O-methyltransferases targeting (S)-scoulerine. In contrast, SOMT1 was able to sequentially 9- and 2-O-methylate (S)-scoulerine, yielding (S)-tetrahydropalmatine. SOMT1 also sequentially 3'- and 7-O-methylated both (S)-norreticuline and (S)-reticuline with relatively high substrate affinity, yielding (S)-tetrahydropapaverine and (S)-laudanosine, respectively. The metabolic functions of SOMT1, SOMT2, and SOMT3 were investigated in planta using virus-induced gene silencing. Reduction of SOMT1 or SOMT2 transcript levels resulted in a significant decrease in noscapine accumulation. Reduced SOMT1 transcript levels also caused a decrease in papaverine accumulation, confirming the selective roles for these enzymes in the biosynthesis of both alkaloids in opium poppy.

  14. Structure and Reaction Mechanism of Phosphoethanolamine Methyltransferase from the Malaria Parasite Plasmodium falciparum

    Science.gov (United States)

    Lee, Soon Goo; Kim, Youngchang; Alpert, Tara D.; Nagata, Akina; Jez, Joseph M.

    2012-01-01

    In the malarial parasite Plasmodium falciparum, a multifunctional phosphoethanolamine methyltransferase (PfPMT) catalyzes the methylation of phosphoethanolamine (pEA) to phosphocholine for membrane biogenesis. This pathway is also found in plant and nematodes, but PMT from these organisms use multiple methyltransferase domains for the S-adenosylmethionine (AdoMet) reactions. Because PfPMT is essential for normal growth and survival of Plasmodium and is not found in humans, it is an antiparasitic target. Here we describe the 1.55 Å resolution crystal structure of PfPMT in complex with AdoMet by single-wavelength anomalous dispersion phasing. In addition, 1.19–1.52 Å resolution structures of PfPMT with pEA (substrate), phosphocholine (product), sinefungin (inhibitor), and both pEA and S-adenosylhomocysteine bound were determined. These structures suggest that domain rearrangements occur upon ligand binding and provide insight on active site architecture defining the AdoMet and phosphobase binding sites. Functional characterization of 27 site-directed mutants identifies critical active site residues and suggests that Tyr-19 and His-132 form a catalytic dyad. Kinetic analysis, isothermal titration calorimetry, and protein crystallography of the Y19F and H132A mutants suggest a reaction mechanism for the PMT. Not only are Tyr-19 and His-132 required for phosphobase methylation, but they also form a “catalytic” latch that locks ligands in the active site and orders the site for catalysis. This study provides the first insight on this antiparasitic target enzyme essential for survival of the malaria parasite; however, further studies of the multidomain PMT from plants and nematodes are needed to understand the evolutionary division of metabolic function in the phosphobase pathway of these organisms. PMID:22117061

  15. Metabolomic profiles of arsenic (+3 oxidation state) methyltransferase knockout mice: effect of sex and arsenic exposure.

    Science.gov (United States)

    Huang, Madelyn C; Douillet, Christelle; Su, Mingming; Zhou, Kejun; Wu, Tao; Chen, Wenlian; Galanko, Joseph A; Drobná, Zuzana; Saunders, R Jesse; Martin, Elizabeth; Fry, Rebecca C; Jia, Wei; Stýblo, Miroslav

    2017-01-01

    Arsenic (+3 oxidation state) methyltransferase (As3mt) is the key enzyme in the pathway for methylation of inorganic arsenic (iAs). Altered As3mt expression and AS3MT polymorphism have been linked to changes in iAs metabolism and in susceptibility to iAs toxicity in laboratory models and in humans. As3mt-knockout mice have been used to study the association between iAs metabolism and adverse effects of iAs exposure. However, little is known about systemic changes in metabolism of these mice and how these changes lead to their increased susceptibility to iAs toxicity. Here, we compared plasma and urinary metabolomes of male and female wild-type (WT) and As3mt-KO (KO) C57BL/6 mice and examined metabolomic shifts associated with iAs exposure in drinking water. Surprisingly, exposure to 1 ppm As elicited only small changes in the metabolite profiles of either WT or KO mice. In contrast, comparisons of KO mice with WT mice revealed significant differences in plasma and urinary metabolites associated with lipid (phosphatidylcholines, cytidine, acyl-carnitine), amino acid (hippuric acid, acetylglycine, urea), and carbohydrate (L-sorbose, galactonic acid, gluconic acid) metabolism. Notably, most of these differences were sex specific. Sex-specific differences were also found between WT and KO mice in plasma triglyceride and lipoprotein cholesterol levels. Some of the differentially changed metabolites (phosphatidylcholines, carnosine, and sarcosine) are substrates or products of reactions catalyzed by other methyltransferases. These results suggest that As3mt KO alters major metabolic pathways in a sex-specific manner, independent of iAs treatment, and that As3mt may be involved in other cellular processes beyond iAs methylation.

  16. Functional characterisation of three o-methyltransferases involved in the biosynthesis of phenolglycolipids in Mycobacterium tuberculosis.

    Directory of Open Access Journals (Sweden)

    Roxane Simeone

    Full Text Available Phenolic glycolipids are produced by a very limited number of slow-growing mycobacterial species, most of which are pathogen for humans. In Mycobacterium tuberculosis, the etiologic agent of tuberculosis, these molecules play a role in the pathogenicity by modulating the host immune response during infection. The major variant of phenolic glycolipids produced by M. tuberculosis, named PGL-tb, consists of a large lipid core terminated by a glycosylated aromatic nucleus. The carbohydrate part is composed of three sugar residues, two rhamnosyl units and a terminal fucosyl residue, which is per-O-methylated, and seems to be important for pathogenicity. While most of the genes responsible for the synthesis of the lipid core domain and the saccharide appendage of PGL-tb have been characterized, the enzymes involved in the O-methylation of the fucosyl residue of PGL-tb remain unknown. In this study we report the identification and characterization of the methyltransferases required for the O-methylation of the terminal fucosyl residue of PGL-tb. These enzymes are encoded by genes Rv2954c, Rv2955c and Rv2956. Mutants of M. tuberculosis harboring deletion within these genes were constructed. Purification and analysis of the phenolglycolipids produced by these strains, using a combination of mass spectrometry and NMR spectroscopy, revealed that Rv2954c, Rv2955c and Rv2956 encode the methyltransferases that respectively catalysed the O-methylation of the hydroxyl groups located at positions 3, 4 and 2 of the terminal fucosyl residue of PGL-tb. Our data also suggest that methylation at these positions is a sequential process, starting with position 2, followed by positions 4 and 3.

  17. Molecular and biochemical characterization of the jasmonic acid methyltransferase gene from black cottonwood (Populus trichocarpa)

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Nan [ORNL; Yao, Jianzhuang [University of Tennessee, Knoxville (UTK); Chaiprasongsuk, Minta [University of Tennessee, Knoxville (UTK); Li, Guanglin [University of Tennessee, Knoxville (UTK); Guan, Ju [University of Tennessee, Knoxville (UTK); Tschaplinski, Timothy J [ORNL; Guo, Hong [University of Tennessee, Knoxville (UTK); Chen, Feng [University of Tennessee, Knoxville (UTK)

    2013-01-01

    Methyl jasmonate is a metabolite known to be produced by many plants and has roles in diverse biological processes. It is biosynthesized by the action of S-adenosyl-L-methionine:jasmonic acid carboxyl methyltransferase (JMT), which belongs to the SABATH family of methyltransferases. Herein is reported the isolation and biochemical characterization of a JMT gene from black cottonwood (Populus trichocarpa). The genome of P. trichocarpa contains 28 SABATH genes (PtSABATH1 to PtSABATH28). Recombinant PtSABATH3 expressed in Escherichia coli showed the highest level of activity with jasmonic acid (JA) among carboxylic acids tested. It was therefore renamed PtJMT1. PtJMT1 also displayed activity with benzoic acid (BA), with which the activity was about 22% of that with JA. PtSABATH2 and PtSABATH4 were most similar to PtJMT1 among all PtSABATHs. However, neither of them had activity with JA. The apparent Km values of PtJMT1 using JA and BA as substrate were 175 lM and 341 lM, respectively. Mutation of Ser-153 and Asn-361, two residues in the active site of PtJMT1, to Tyr and Ser respectively, led to higher specific activity with BA than with JA. Homology-based structural modeling indicated that substrate alignment, in which Asn-361 is involved, plays a role in determining the substrate specificity of PtJMT1. In the leaves of young seedlings of black cottonwood, the expression of PtJMT1 was induced by plant defense signal molecules methyl jasmonate and salicylic acid and a fungal elicitor alamethicin, suggesting that PtJMT1 may have a role in plant defense against biotic stresses. Phylogenetic analysis suggests that PtJMT1 shares a common ancestor with the Arabidopsis JMT, and functional divergence of these two apparent JMT orthologs has occurred since the split of poplar and Arabidopsis lineages.

  18. Atomic structure of a folate/FAD-dependent tRNA T54 methyltransferase.

    Science.gov (United States)

    Nishimasu, Hiroshi; Ishitani, Ryuichiro; Yamashita, Koki; Iwashita, Chikako; Hirata, Akira; Hori, Hiroyuki; Nureki, Osamu

    2009-05-19

    tRNAs from all 3 phylogenetic domains have a 5-methyluridine at position 54 (T54) in the T-loop. The methyl group is transferred from S-adenosylmethionine by TrmA methyltransferase in most Gram-negative bacteria and some archaea and eukaryotes, whereas it is transferred from 5,10-methylenetetrahydrofolate (MTHF) by TrmFO, a folate/FAD-dependent methyltransferase, in most Gram-positive bacteria and some Gram-negative bacteria. However, the catalytic mechanism remains unclear, because the crystal structure of TrmFO has not been solved. Here, we report the crystal structures of Thermus thermophilus TrmFO in its free form, tetrahydrofolate (THF)-bound form, and glutathione-bound form at 2.1-, 1.6-, and 1.05-A resolutions, respectively. TrmFO consists of an FAD-binding domain and an insertion domain, which both share structural similarity with those of GidA, an enzyme involved in the 5-carboxymethylaminomethylation of U34 of some tRNAs. However, the overall structures of TrmFO and GidA are basically different because of their distinct domain orientations, which are consistent with their respective functional specificities. In the THF complex, the pteridin ring of THF is sandwiched between the flavin ring of FAD and the imidazole ring of a His residue. This structure provides a snapshot of the folate/FAD-dependent methyl transfer, suggesting that the transferring methylene group of MTHF is located close to the redox-active N5 atom of FAD. Furthermore, we established an in vitro system to measure the methylation activity. Our TrmFO-tRNA docking model, in combination with mutational analyses, suggests a catalytic mechanism, in which the methylene of MTHF is directly transferred onto U54, and then the exocyclic methylene of U54 is reduced by FADH(2).

  19. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  20. The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

    OpenAIRE

    Takaiwa, F.; Kusuda, M; SUGIURA, M.

    1982-01-01

    The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.